Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction
Abstract
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
- Inventors:
- Issue Date:
- Research Org.:
- Univ. of Nevada, Las Vegas, NV (United States)
- Sponsoring Org.:
- USDOE
- OSTI Identifier:
- 1174842
- Patent Number(s):
- 6733999
- Application Number:
- 10/080,959
- Assignee:
- University Of Nevada
- Patent Classifications (CPCs):
-
C - CHEMISTRY C12 - BIOCHEMISTRY C12Q - MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS
- DOE Contract Number:
- FG03-98ER62574
- Resource Type:
- Patent
- Country of Publication:
- United States
- Language:
- English
- Subject:
- 59 BASIC BIOLOGICAL SCIENCES
Citation Formats
Cruz-Perez, Patricia, and Buttner, Mark P. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction. United States: N. p., 2004.
Web.
Cruz-Perez, Patricia, & Buttner, Mark P. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction. United States.
Cruz-Perez, Patricia, and Buttner, Mark P. Tue .
"Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction". United States. https://www.osti.gov/servlets/purl/1174842.
@article{osti_1174842,
title = {Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction},
author = {Cruz-Perez, Patricia and Buttner, Mark P.},
abstractNote = {A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.},
doi = {},
journal = {},
number = ,
volume = ,
place = {United States},
year = {Tue May 11 00:00:00 EDT 2004},
month = {Tue May 11 00:00:00 EDT 2004}
}
Works referenced in this record:
Real time quantitative PCR.
journal, October 1996
- Heid, C. A.; Stevens, J.; Livak, K. J.
- Genome Research, Vol. 6, Issue 10, p. 986-994
Detection of Varicella-Zoster Virus DNA in Air Samples from Hospital Rooms
journal, January 1994
- Sawyer, M. H.; Chamberlin, C. J.; Wu, Y. N.
- Journal of Infectious Diseases, Vol. 169, Issue 1
Use of solid-phase PCR for enhanced detection of airborne microorganisms.
journal, January 1994
- Alvarez, A. J.; Buttner, M. P.; Toranzos, G. A.
- Applied and Environmental Microbiology, Vol. 60, Issue 1
Comparison of the ABI 7700 System (TaqMan) and Competitive PCR for Quantification of IS6110 DNA in Sputum during Treatment of Tuberculosis
journal, January 1998
- Desjardin, L. e.; Chen, Y.; Perkins, M. D.
- Journal of Clinical Microbiology, Vol. 36, Issue 7
Specific detection of Stachybotrys chartarum in pure culture using quantitative polymerase chain reaction
journal, June 2001
- Cruz-Perez, P.; Buttner, M. P.; Stetzenbach, L. D.
- Molecular and Cellular Probes, Vol. 15, Issue 3
PCR for bioaerosol monitoring: sensitivity and environmental interference.
journal, January 1995
- Alvarez, A. J.; Buttner, M. P.; Stetzenbach, L. D.
- Applied and environmental microbiology, Vol. 61, Issue 10
Density and Molecular Epidemiology ofAspergillus in Air and Relationship to Outbreaks ofAspergillus Infection
journal, January 1999
- Leenders, Alexander C. A. P.; van Belkum, Alex; Behrendt, Myra
- Journal of Clinical Microbiology, Vol. 37, Issue 6
Evaluation ofStachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during, and after remediation
journal, March 2000
- Vesper, Stephen; Dearborn, Dorr G.; Yike, Iwona
- Journal of Urban Health, Vol. 77, Issue 1
Identification of putative sequence specific PCR primers for detection of the toxigenic fungal speciesStachybotrys chartarum
journal, December 1998
- Haugland, R. A.; Heckman, J. L.
- Molecular and Cellular Probes, Vol. 12, Issue 6
Quantification of Stachybotrys chartarum conidia in indoor dust using real time, fluorescent probe-based detection of PCR products
journal, February 2001
- Roe, Jennie D.; Haugland, Richard A.; Vesper, Stephen J.
- Journal of Exposure Science & Environmental Epidemiology, Vol. 11, Issue 1
Quantitative measurement of Stachybotrys chartarum conidia using real time detection of PCR products with the TaqManTMfluorogenic probe system
journal, October 1999
- Haugland, R. A.; Vesper, S. J.; Wymer, L. J.
- Molecular and Cellular Probes, Vol. 13, Issue 5