skip to main content
DOE Patents title logo U.S. Department of Energy
Office of Scientific and Technical Information

Title: Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

Abstract

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Inventors:
;
Issue Date:
Research Org.:
Univ. of Nevada, Las Vegas, NV (United States)
Sponsoring Org.:
USDOE
OSTI Identifier:
1174842
Patent Number(s):
6733999
Application Number:
10/080,959
Assignee:
University Of Nevada
Patent Classifications (CPCs):
C - CHEMISTRY C12 - BIOCHEMISTRY C12Q - MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS
DOE Contract Number:  
FG03-98ER62574
Resource Type:
Patent
Country of Publication:
United States
Language:
English
Subject:
59 BASIC BIOLOGICAL SCIENCES

Citation Formats

Cruz-Perez, Patricia, and Buttner, Mark P. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction. United States: N. p., 2004. Web.
Cruz-Perez, Patricia, & Buttner, Mark P. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction. United States.
Cruz-Perez, Patricia, and Buttner, Mark P. Tue . "Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction". United States. https://www.osti.gov/servlets/purl/1174842.
@article{osti_1174842,
title = {Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction},
author = {Cruz-Perez, Patricia and Buttner, Mark P.},
abstractNote = {A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.},
doi = {},
journal = {},
number = ,
volume = ,
place = {United States},
year = {2004},
month = {5}
}

Patent:

Save / Share:

Works referenced in this record:

Real time quantitative PCR.
journal, October 1996


Detection of Varicella-Zoster Virus DNA in Air Samples from Hospital Rooms
journal, January 1994


Use of solid-phase PCR for enhanced detection of airborne microorganisms.
journal, January 1994


Specific detection of Stachybotrys chartarum in pure culture using quantitative polymerase chain reaction
journal, June 2001


PCR for bioaerosol monitoring: sensitivity and environmental interference.
journal, January 1995


Density and Molecular Epidemiology ofAspergillus in Air and Relationship to Outbreaks ofAspergillus Infection
journal, January 1999


Quantification of Stachybotrys chartarum conidia in indoor dust using real time, fluorescent probe-based detection of PCR products
journal, February 2001