Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

Cruz-Perez, Patricia; Buttner, Mark P.

Title: Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

Abstract

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Inventors:: Cruz-Perez, Patricia; Buttner, Mark P.

Issue Date:: 2004-05-11

Research Org.:: Univ. of Nevada, Las Vegas, NV (United States)

Sponsoring Org.:: USDOE

OSTI Identifier:: 1174842

Patent Number(s):: 6733999

Application Number:: 10/080,959

Assignee:: University Of Nevada

Patent Classifications (CPCs):: C - CHEMISTRY C12 - BIOCHEMISTRY C12Q - MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS

Show more

C - CHEMISTRY C12 - BIOCHEMISTRY C12Q - MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS
C12Q1/6851 - Quantitative amplification
C12Q1/6895 - for plants, fungi or algae

Show less

DOE Contract Number:: FG03-98ER62574

Resource Type:: Patent

Country of Publication:: United States

Language:: English

Subject:: 59 BASIC BIOLOGICAL SCIENCES

Citation Formats


                    Cruz-Perez, Patricia, and Buttner, Mark P. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction.  United States: N. p., 2004. 
        Web.

Copy to clipboard


                    Cruz-Perez, Patricia, & Buttner, Mark P. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction.  United States.

Copy to clipboard


                    Cruz-Perez, Patricia, and Buttner, Mark P. Tue .  
        "Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction".  United States.  https://www.osti.gov/servlets/purl/1174842.

Copy to clipboard


                    
@article{osti_1174842,

  title        = {Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction},

  author       = {Cruz-Perez, Patricia and Buttner, Mark P.},

  abstractNote = {A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.},

  doi          = {},

  journal      = {},
number       = ,

  volume       = ,

  place        = {United States},

  year         = {2004},

  month        = {5}

}

Copy to clipboard

Patent:

Save / Share:

Export Metadata

Save to My Library

Works referenced in this record:

Real time quantitative PCR.
journal, October 1996

Heid, C. A.; Stevens, J.; Livak, K. J.
Genome Research, Vol. 6, Issue 10, p. 986-994
https://doi.org/10.1101/gr.6.10.986

Detection of Varicella-Zoster Virus DNA in Air Samples from Hospital Rooms
journal, January 1994

Sawyer, M. H.; Chamberlin, C. J.; Wu, Y. N.
Journal of Infectious Diseases, Vol. 169, Issue 1
https://doi.org/10.1093/infdis/169.1.91

Use of solid-phase PCR for enhanced detection of airborne microorganisms.
journal, January 1994

Alvarez, A. J.; Buttner, M. P.; Toranzos, G. A.
Applied and Environmental Microbiology, Vol. 60, Issue 1
https://doi.org/10.1128/AEM.60.1.374-376.1994

Comparison of the ABI 7700 System (TaqMan) and Competitive PCR for Quantification of IS6110 DNA in Sputum during Treatment of Tuberculosis
journal, January 1998

Desjardin, L. e.; Chen, Y.; Perkins, M. D.
Journal of Clinical Microbiology, Vol. 36, Issue 7
https://doi.org/10.1128/JCM.36.7.1964-1968.1998

Specific detection of Stachybotrys chartarum in pure culture using quantitative polymerase chain reaction
journal, June 2001

Cruz-Perez, P.; Buttner, M. P.; Stetzenbach, L. D.
Molecular and Cellular Probes, Vol. 15, Issue 3
https://doi.org/10.1006/mcpr.2001.0347

PCR for bioaerosol monitoring: sensitivity and environmental interference.
journal, January 1995

Alvarez, A. J.; Buttner, M. P.; Stetzenbach, L. D.
Applied and environmental microbiology, Vol. 61, Issue 10
https://doi.org/10.1128/AEM.61.10.3639-3644.1995

Density and Molecular Epidemiology ofAspergillus in Air and Relationship to Outbreaks ofAspergillus Infection
journal, January 1999

Leenders, Alexander C. A. P.; van Belkum, Alex; Behrendt, Myra
Journal of Clinical Microbiology, Vol. 37, Issue 6
https://doi.org/10.1128/JCM.37.6.1752-1757.1999

Evaluation ofStachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during, and after remediation
journal, March 2000

Vesper, Stephen; Dearborn, Dorr G.; Yike, Iwona
Journal of Urban Health, Vol. 77, Issue 1
https://doi.org/10.1007/BF02350963

Identification of putative sequence specific PCR primers for detection of the toxigenic fungal speciesStachybotrys chartarum
journal, December 1998

Haugland, R. A.; Heckman, J. L.
Molecular and Cellular Probes, Vol. 12, Issue 6
https://doi.org/10.1006/mcpr.1998.0197

Quantification of Stachybotrys chartarum conidia in indoor dust using real time, fluorescent probe-based detection of PCR products
journal, February 2001

Roe, Jennie D.; Haugland, Richard A.; Vesper, Stephen J.
Journal of Exposure Science & Environmental Epidemiology, Vol. 11, Issue 1
https://doi.org/10.1038/sj.jea.7500147

Quantitative measurement of Stachybotrys chartarum conidia using real time detection of PCR products with the TaqManTMfluorogenic probe system
journal, October 1999

Haugland, R. A.; Vesper, S. J.; Wymer, L. J.
Molecular and Cellular Probes, Vol. 13, Issue 5
https://doi.org/10.1006/mcpr.1999.0258

Similar Records in DOE Patents and OSTI.GOV collections:

Nested methylation-specific polymerase chain reaction cancer detection method

Patent Belinsky, Steven A [Albuquerque, NM]; Palmisano, William A [Edgewood, NM]

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection ofmore » lung and other cancers. « less
Full Text Available
Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

Patent Nasarabadi, Shanavaz [Livermore, CA]

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » « less
Full Text Available
Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Patent Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; ...

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR. « less
Full Text Available
Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Patent Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; ...

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR. « less
Full Text Available
Gene-matched enrichment and polymerase chain reaction for rapid detection of microorganisms

Patent Ozanich, Richard M.; Hutchison, Janine R.; Victry, Kristin D.; ...

A method for amplifying and detecting microorganisms, such as species of Listeria, is described. The method utilizes gene-matched enrichment media and PCR-based detection. The enrichment media is spent media produced using a modified microorganism containing a plurality of mutations in a selected gene such that the modified microorganism does not contain the PCR signature. Thus, PCR detects only the amplified microorganism of interest, not the modified microorganism. Exemplary methods and kits for amplification and detection of Listeria species are described.
Full Text Available

Similar Records

Title: Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

Abstract

Citation Formats

Real time quantitative PCR. journal, October 1996

Detection of Varicella-Zoster Virus DNA in Air Samples from Hospital Rooms journal, January 1994

Use of solid-phase PCR for enhanced detection of airborne microorganisms. journal, January 1994

Comparison of the ABI 7700 System (TaqMan) and Competitive PCR for Quantification of IS6110 DNA in Sputum during Treatment of Tuberculosis journal, January 1998

Specific detection of Stachybotrys chartarum in pure culture using quantitative polymerase chain reaction journal, June 2001

PCR for bioaerosol monitoring: sensitivity and environmental interference. journal, January 1995

Density and Molecular Epidemiology ofAspergillus in Air and Relationship to Outbreaks ofAspergillus Infection journal, January 1999

Evaluation ofStachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during, and after remediation journal, March 2000

Identification of putative sequence specific PCR primers for detection of the toxigenic fungal speciesStachybotrys chartarum journal, December 1998

Quantification of Stachybotrys chartarum conidia in indoor dust using real time, fluorescent probe-based detection of PCR products journal, February 2001

Quantitative measurement of Stachybotrys chartarum conidia using real time detection of PCR products with the TaqManTMfluorogenic probe system journal, October 1999

Real time quantitative PCR.
journal, October 1996

Detection of Varicella-Zoster Virus DNA in Air Samples from Hospital Rooms
journal, January 1994

Use of solid-phase PCR for enhanced detection of airborne microorganisms.
journal, January 1994

Comparison of the ABI 7700 System (TaqMan) and Competitive PCR for Quantification of IS6110 DNA in Sputum during Treatment of Tuberculosis
journal, January 1998

Specific detection of Stachybotrys chartarum in pure culture using quantitative polymerase chain reaction
journal, June 2001

PCR for bioaerosol monitoring: sensitivity and environmental interference.
journal, January 1995

Density and Molecular Epidemiology ofAspergillus in Air and Relationship to Outbreaks ofAspergillus Infection
journal, January 1999

Evaluation ofStachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during, and after remediation
journal, March 2000

Identification of putative sequence specific PCR primers for detection of the toxigenic fungal speciesStachybotrys chartarum
journal, December 1998

Quantification of Stachybotrys chartarum conidia in indoor dust using real time, fluorescent probe-based detection of PCR products
journal, February 2001

Quantitative measurement of Stachybotrys chartarum conidia using real time detection of PCR products with the TaqManTMfluorogenic probe system
journal, October 1999