Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Title: Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Abstract

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

Inventors:: Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

Issue Date:: 2017-10-31

Research Org.:: Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

Sponsoring Org.:: USDOE

OSTI Identifier:: 1406570

Patent Number(s):: 9,803,238

Application Number:: 14/090,040

Assignee:: National Technology & Engineering Solutions of Sandia, LLC

DOE Contract Number:: AC04-94AL85000

Resource Type:: Patent

Resource Relation:: Patent File Date: 2013 Nov 26

Country of Publication:: United States

Language:: English

Subject:: 59 BASIC BIOLOGICAL SCIENCES

Citation Formats


                    Koh, Chung-Yan, Light, Yooli Kim, Piccini, Matthew Ernest, and Singh, Anup K. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid.  United States: N. p., 2017. 
        Web.

Copy to clipboard


                    Koh, Chung-Yan, Light, Yooli Kim, Piccini, Matthew Ernest, & Singh, Anup K. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid.  United States.

Copy to clipboard


                    Koh, Chung-Yan, Light, Yooli Kim, Piccini, Matthew Ernest, and Singh, Anup K. Tue .  
        "Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid".  United States.  https://www.osti.gov/servlets/purl/1406570.

Copy to clipboard


                    
@article{osti_1406570,

  title        = {Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid},

  author       = {Koh, Chung-Yan and Light, Yooli Kim and Piccini, Matthew Ernest and Singh, Anup K.},

  abstractNote = {Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.},

  doi          = {},

  journal      = {},
number       = ,

  volume       = ,

  place        = {United States},

  year         = {2017},

  month        = {10}

}

Copy to clipboard

Patent:

View Patent

Save / Share:

Export Metadata

Save to My Library

Works referenced in this record:

Multistation, Single Channel Analytical Photometer and Method Of Use
patent, January 1971

Anderson, Norman G.
US Patent Document 3,555,284
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F3555284

Loading disk for photometric analyzer of rotary cuvette type
patent, July 1973

Maddox, Wayne L.; Coleman, Robert L.; Shults, II, Wilbur D.
US Patent Document 3,744,974
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F3744974

Separation of solid and liquid components of mixtures
patent, November 1978

Hunter, William M.
US Patent Document 4,125,375
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F4125375

Apparatus and method for measuring white blood cell and platelet concentrations in blood
patent, May 1979

Wardlaw, Stephen
US Patent Document 4,156,570
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F4156570

Heterogeneous binding assay
patent, April 1987

Baker, Terence; Abbott, Stephen; Simpson, John
US Patent Document 4,656,143
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F4656143

Method and apparatus for measuring blood constituent counts
patent, July 1987

Wardlaw, Stephen
US Patent Document 4,683,579
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F4683579

Method for separating the cellular components of blood samples
patent, July 1989

Smith, Ward
US Patent Document 4,844,818
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F4844818

Method of separation employing magnetic particles and second medium
patent, January 1994

Vorpahl, John
US Patent Document 5,279,936
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F5279936

Assay of blood or other biologic samples for target analytes
patent, June 1997

Levine, Robert A.; Wardlaw, Stephen C.; Rodriguez, Rodolfo R.
US Patent Document 5,635,362
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F5635362

Method and apparatus for fully automated nucleic acid amplification, nucleic acid assay and immunoassay
patent, June 1997

Cottingham, Hugh
US Patent Document 5,639,428
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F5639428

DNA purification and isolation using magnetic particles
patent, January 1998

Hawkins, Trevor
US Patent Document 5,705,628
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F5705628

Assay system and method for conducting assays
patent, March 1999

Andrevski, Zygmunt M.; Roach, William Ronald; Southgate, Peter David
US Patent Document 5,882,903
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F5882903

Centrifugal hematology disposable
patent, November 2000

Thomas, Bradley S.
US Patent Document 6,153,148
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F6153148

Devices and methods for using centripetal acceleration to drive fluid movement in a microfluidics system
patent, November 2001

Mian, Alec; Kieffer-Higgins, Stephen G.; Corey, George D.
US Patent Document 6,319,469
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F6319469

Diagnostic tests and kits for Clostridium difficile
patent, January 2003

Valkirs, Gunars E.
US Patent Document 6,503,722
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F6503722

Monolithic microfluidic concentrators and mixers
patent, May 2005

Frechet, Jean M. J.; Svec, Frantisek; Yu, Cong
US Patent Document 6,887,384
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F6887384

Multi-parameter assays including analysis discs and methods relating thereto
patent, April 2006

Gordon, John Francis
US Patent Document 7,033,747
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F7033747

Optical bio-discs and fluidic circuits for analysis of cells and methods relating thereto
patent, January 2007

Valencia, Ramoncito; Chen, YihFar; Hurt, Susan
US Patent Document 7,157,049
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F7157049

Centripetally-motivated microfluidics system for performing in vitro hybridization and amplification of nucleic acids
patent, February 2008

Kellogg, Gregory; Carvalho, Bruce; Sheppard, Norman
US Patent Document 7,332,326
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F7332326

Centrifugal force based microfluidic device, microfluidic system including the same, and method of determining home position of the microfluidic device
patent, July 2010

Lee, Jeong-gun; Lee, Beom-seok; Park, Jong-myeon
US Patent Document 7,758,810
URL: http://patft.uspto.gov/netacgi/nph-Parser?Sect2=PTO1&Sect2=HITOFF&p=1&u=%2Fnetahtml%2FPTO%2Fsearch-bool.html&r=1&f=G&l=50&d=PALL&RefSrch=yes&Query=PN%2F7758810

Devices and Method For Using Centripetal Acceleration To Drive Fluid Movement In A Microfluidics System With On-Board Informatics
patent-application, December 2001

Mian, Alec; Kieffer-Higgins, Stephen G.; Corey, George D.
US Patent Document 08/761063; 20010055812
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220010055812%22.PGNR.&OS=DN/20010055812&RS=DN/20010055812

Class characterization of circulating cancer cells isolated from body fluids and methods of use
patent-application, July 2002

Wang, Zheng-Pin; TS'O, Paul O.P.
US Patent Document 09/501179; 20020098535
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220020098535%22.PGNR.&OS=DN/20020098535&RS=DN/20020098535

Reagents for labeling biomolecules having aldehyde or ketone Moieties
patent-application, September 2002

Haugland, Richard P.; Steinberg, Thomas H.; Patton, Wayne F.
US Patent Application 09/970215; 20020137068
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220020137068%22.PGNR.&OS=DN/20020137068&RS=DN/20020137068

Multi-parameter assays including analysis discs and methods relating thereto
patent-application, October 2002

Gordon, John Francis
US Patent Application 10/121281; 20020151043
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220020151043%22.PGNR.&OS=DN/20020151043&RS=DN/20020151043

Analytical methods and compositions
patent-application, November 2002

Rao, Galla Chandra; Terstapper, Leon Wmm
US Patent Application 10/017437; 20020164659
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220020164659%22.PGNR.&OS=DN/20020164659&RS=DN/20020164659

Method for separating cells
patent-application, July 2003

Woodside, Steven M.
US Patent Application 10/260560; 2003012471
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220030124719%22.PGNR.&OS=DN/20030124719&RS=DN/20030124719

Microfluidic particle-analysis systems
patent-application, April 2004

Chou, Hou-Pu; Daridon, Antoine; Farrell, Kevin
US Patent Application 10/405953; 20040072278
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220040072278%22.PGNR.&OS=DN/20040072278&RS=DN/20040072278

Protecting agent
patent-application, August 2005

Kange, Rickard; Inganas, Mats; Gustafsson, Magnus
US Patent Application 11/038712; 20050186685
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220050186685%22.PGNR.&OS=DN/20050186685&RS=DN/20050186685

Centrifuge with removable core for scalable centrifugation
patent-application, September 2005

Merino, Sandra Patricia; Dalessio, Steven J.; Rudy Otten, Robin Roy Louis
US Patent Application 11/129116; 20050215410
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220050215410%22.PGNR.&OS=DN/20050215410&RS=DN/20050215410

Microparticle-based methods and systems and applications thereof
patent-application, December 2005

Prober, James M.; Cui, Xiumin; Dam, Rudy J.
US Patent Document 11/189080; 20050282220
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220050282220%22.PGNR.&OS=DN/20050282220&RS=DN/20050282220

Method and Apparatus For Precise Transfer and Manipulation Of Fluids By Centrifugal and Or Capillary Forces
patent-application, January 2009

Pugia, Michael J.; Blankenstein, Gert; Peters, Ralf-Peter
US Patent Document 12/205965; 20090004059
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220090004059%22.PGNR.&OS=DN/20090004059&RS=DN/20090004059

Method For Isolating Nucleic Acids Comprising The Use Of Ethylene Glycol Multimers
patent-application, March 2009

Finne, Erling
US Patent Application 11/815967; 20090069554
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220090069554%22.PGNR.&OS=DN/20090069554&RS=DN/20090069554

Centrifugal Separation System
patent-application, August 2009

Andersson, Lars
US Patent Application 12/296982; 20090209402
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220090209402%22.PGNR.&OS=DN/20090209402&RS=DN/20090209402

Method for detecting analytes in a sample
patent-application, December 2009

Hinnah, Silke Christine; Lambru, Dagmar; Droge, Sonja
US Patent Application 11/629107; 20090325186
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220090325186%22.PGNR.&OS=DN/20090325186&RS=DN/20090325186

Density-based cell detection system
patent, March 2010

Kirakossian, Hrair
US Patent Application 12/380877; 20100068754
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220100068754%22.PGNR.&OS=DN/20100068754&RS=DN/20100068754

Separation Device
patent-application, May 2010

Froman, Gunnar; Haneskog, Lars; Johansson, Bjorn A.
US Patent Application12/597925; 20100120596
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220100120596%22.PGNR.&OS=DN/20100120596&RS=DN/20100120596

Compact disk based platform for separating and detecting immunomagnetic bead labeled cells
patent-application, June 2010

Wo, Andrew M.; Chen, Chen-Lin; Chen, Ken-Chao
US Patent Application12/382844; 20100151560
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220100151560%22.PGNR.&OS=DN/20100151560&RS=DN/20100151560

Centrifugation Apparatus For Containers Of Biological Material
patent-application, February 2011

Pedrazzini, Gianandrea
US Patent Application 12/867345; 20110045958
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220110045958%22.PGNR.&OS=DN/20110045958&RS=DN/20110045958

Systems and Methods for Handling Microfluidic Droplets
patent-application, October 2013

Link, Darren R.
US Patent Application 13/855318; 20130260447
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220130260447%22.PGNR.&OS=DN/20130260447&RS=DN/20130260447

Diagnostic Analyzers With Pretreatment Carousels and Related Methods
patent-application, September 2014

Ochranek, Brian L.; Arnquist, David C.
US Patent Application 14/142474; 20140273241
URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PG01&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.html&r=1&f=G&l=50&s1=%2220140273241%22.PGNR.&OS=DN/20140273241&RS=DN/20140273241

Polyethyleneimine functionalized iron oxide nanoparticles as agents for DNA delivery and transfection
journal, January 2007

McBain, S. C.; Yiu, H. H. P.; El Haj, A.
Journal of Materials Chemistry, Vol. 17, Issue 24, p. 2561-2565
DOI: 10.1039/B617402G

Infrared controlled waxes for liquid handling and storage on a CD-microfluidic platform
journal, January 2011

Abi-Samra, Kameel; Hanson, Ryan; Madou, Marc
Lab on a Chip, Vol. 11, Issue 4, p. 723-726
DOI: 10.1039/C0LC00160K

Micro freef-low IEF enhanced by active cooling and functionalized gels
journal, December 2006

Albrecht, Jacob W.; Jensen, Klavs F.
ELECTROPHORESIS, Vol. 27, Issue 24, p. 4960-4969
DOI: 10.1002/elps.200600436

Ricin A-Chain Activity on Stem−Loop and Unstructured DNA Substrates
journal, March 2005

Amukele, Tim K.; Roday, Setu; Schramm, Vern L.
Biochemistry, Vol. 44, Issue 11, p. 4416-4425
DOI: 10.1021/bi0474362

Parallel Nanoliter Microfluidic Analysis System
journal, June 2007

Andersson, Per; Jesson, Gerald; Kylberg, Gunnar
Analytical Chemistry, Vol. 79, Issue 11, p. 4022-4030
DOI: 10.1021/ac061692y

How Hofmeister ion interactions affect protein stability
journal, October 1996

Baldwin, R. L.
Biophysical Journal, Vol. 71, Issue 4, p. 2056-2063
DOI: 10.1016/S0006-3495(96)79404-3

One-step purification of nucleic acid for gene expression analysis via Immiscible Filtration Assisted by Surface Tension (IFAST)
journal, January 2011

Berry, Scott M.; Alarid, Elaine T.; Beebe, David J.
Lab on a Chip, Vol. 11, Issue 10, p. 1747-1753
DOI: 10.1039/C1LC00004G

Cell-Free DNA—A Marker to Predict Ischemic Brain Damage in a Rat Stroke Experimental Model
journal, January 2011

Boyko, Matthew; Ohayon, Sharon; Goldsmith, Tomer
Journal of Neurosurgical Anesthesiology, Vol. 23, Issue 3, p. 222-228
DOI: 10.1097/ANA.0b013e31821b536a

Shiga toxin 1 acting on DNA in vitro is a heat-stable enzyme not requiring proteolytic activation
journal, April 2004

Brigotti, Maurizio; Carnicelli, Domenica; Vara, Antonio González
Biochimie, Vol. 86, Issue 4-5, p. 305-309
DOI: 10.1016/j.biochi.2004.03.009

A molecular approach to bioseparations: Protein–protein and protein–salt interactions
journal, February 2006

Curtis, R. A.; Lue, L.
Chemical Engineering Science, Vol. 61, Issue 3, p. 907-923
DOI: 10.1016/j.ces.2005.04.007

Measurement of Circulating Cell-Free DNA Levels by a New Simple Fluorescent Test in Patients With Primary Colorectal Cancer
journal, February 2011

Czeiger, David; Shaked, Gad; Eini, Hadar
American Journal of Clinical Pathology, Vol. 135, Issue 2, p. 264-270
DOI: 10.1309/AJCP4RK2IHVKTTZV

Depurination of A4256 in 28 S rRNA by the Ribosome-inactivating Proteins from Barley and Ricin Results in Different Ribosome Conformations
journal, May 1996

Holmberg, Lovisa; Nygård, Odd
Journal of Molecular Biology, Vol. 259, Issue 1, p. 81-94
DOI: 10.1006/jmbi.1996.0303

Leukocyte analysis and differentiation using high speed microfluidic single cell impedance cytometry
journal, January 2009

Holmes, David; Pettigrew, David; Reccius, Christian H.
Lab on a Chip, Vol. 9, Issue 20, p. 2881-2889
DOI: 10.1039/B910053A

Fully integrated lab-on-a-disc for simultaneous analysis of biochemistry and immunoassay from whole blood
journal, January 2011

Lee, Beom Seok; Lee, Yang Ui; Kim, Han-Sang
Lab on a Chip, Vol. 11, Issue 1, p. 70-78
DOI: 10.1039/C0LC00205D

A fully automated immunoassay from whole blood on a disc
journal, January 2009

Lee, Beom Seok; Lee, Jung-Nam; Park, Jong-Myeon
Lab on a Chip, Vol. 9, Issue 11, p. 1548-1555
DOI: 10.1039/B820321K

Bead-based microfluidic immunoassays: The next generation
journal, February 2007

Lim, C. T.; Zhang, Y.
Biosensors and Bioelectronics, Vol. 22, Issue 7, p. 1197-1204
DOI: 10.1016/j.bios.2006.06.005

Photopolymerized diffusion-defined polyacrylamide gradient gels for on-chip protein sizing
journal, January 2008

Lo, Catherine T.; Throckmorton, Daniel J.; Singh, Anup K.
Lab on a Chip, Vol. 8, Issue 8, p. 1273-1279
DOI: 10.1039/B804485F

Comparison of sample fixation and the use of LDS-751 or anti-CD45 for leukocyte identification in mouse whole blood for flow cytometry
journal, January 2007

Maes, Melissa L.; Davidson, Lisa B.; McDonagh, Paul F.
Journal of Immunological Methods, Vol. 319, Issue 1-2, p. 79-86
DOI: 10.1016/j.jim.2006.10.016

Functional integration of DNA purification and concentration into a real time micro-PCR chip
journal, January 2011

Min, Junhong; Kim, Joon-Ho; Lee, Youngsun
Lab on a Chip, Vol. 11, Issue 2, p. 259-265
DOI: 10.1039/C0LC00320D

Plasma DNA concentration as a predictor of mortality and sepsis in critically ill patients
journal, April 2006

Rhodes, Andrew; Wort, Stephen J.; Thomas, Helen
Critical Care, Vol. 10, Issue 2, Article No. R60
DOI: 10.1186/cc4894

A B Cell-Based Sensor for Rapid Identification of Pathogens
journal, July 2003

Rider, Todd H.; Petrovick, Martha S.; Nargi, Frances E.
Science, Vol. 301, Issue 5630, p. 213-215
DOI: 10.1126/science.1084920

Read-out concepts for multiplexed bead-based fluorescence immunoassays on centrifugal microfluidic platforms
journal, February 2006

Riegger, L.; Grumann, M.; Nann, T.
Sensors and Actuators A: Physical, Vol. 126, Issue 2, p. 455-462
DOI: 10.1016/j.sna.2005.11.006

Cell-Free Plasma DNA as a Predictor of Outcome in Severe Sepsis and Septic Shock
journal, April 2008

Saukkonen, K.; Lakkisto, P.; Pettila, V.
Clinical Chemistry, Vol. 54, Issue 6, p. 1000-1007
DOI: 10.1373/clinchem.2007.101030

Characterization of EBV-genome negative “null” and “T” cell lines derived from children with acute lymphoblastic leukemia and leukemic transformed non-Hodgkin lymphoma
journal, May 1977

Schneider, Ulrich; Schwenk, Hans-Ulrich; Bornkamm, Georg
International Journal of Cancer, Vol. 19, Issue 5, p. 621-626
DOI: 10.1002/ijc.2910190505

Bioinformatic processing to identify single nucleotide polymorphism that potentially affect Ape1 function
journal, June 2011

Yu, Eizadora T.; Hadi, Masood Z.
Mutation Research/Genetic Toxicology and Environmental Mutagenesis, Vol. 722, Issue 2, p. 140-146
DOI: 10.1016/j.mrgentox.2010.06.015

A new biodosimetric method: branched DNA-based quantitative detection of B1 DNA in mouse plasma
journal, August 2010

Zhang, L.; Zhang, M.; Yang, S.
The British Journal of Radiology, Vol. 83, Issue 992, p. 694-701
DOI: 10.1259/bjr/49886569

Circulating DNA: a new diagnostic gold mine?
journal, October 2002

Ziegler, Annemarie; Zangemeister-Wittke, Uwe; Stahel, Rolf A.
Cancer Treatment Reviews, Vol. 28, Issue 5, p. 255-271
DOI: 10.1016/S0305-7372(02)00077-4

Detection of Listeria monocytogenes and the toxin listeriolysin O in food
journal, February 2006

Churchill, Robin L. T.; Lee, Hung; Hall, J. Christopher
Journal of Microbiological Methods, Vol. 64, Issue 2, p. 141-170
DOI: 10.1016/j.mimet.2005.10.007

Similar Records in DOE Patents and OSTI.GOV collections:

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

Patent Nasarabadi, Shanavaz [Livermore, CA]

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore »« less
Full Text Available
Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

Patent Cruz-Perez, Patricia; Buttner, Mark P.

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Full Text Available
Method for nucleic acid isolation using supercritical fluids

Patent Nivens, David E [11912 Kingsgate Rd., Knoxville, TN 37911]; Applegate, Bruce M [3700 Sutherland Ave. #Q2, Knoxville, TN 37911]

A method for detecting the presence of a microorganism in an environmental sample involves contacting the sample with a supercritical fluid to isolate nucleic acid from the microorganism, then detecting the presence of a particular sequence within the isolated nucleic acid. The nucleic acid may optionally be subjected to further purification.
Full Text Available
Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation

Patent Castro, Alonso

A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected tomore »« less
Full Text Available
Nested methylation-specific polymerase chain reaction cancer detection method

Patent Belinsky, Steven A [Albuquerque, NM]; Palmisano, William A [Edgewood, NM]

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection ofmore » lung and other cancers.« less
Full Text Available

Similar Records

Title: Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Abstract

Citation Formats

Multistation, Single Channel Analytical Photometer and Method Of Use patent, January 1971

Loading disk for photometric analyzer of rotary cuvette type patent, July 1973

Separation of solid and liquid components of mixtures patent, November 1978

Apparatus and method for measuring white blood cell and platelet concentrations in blood patent, May 1979

Heterogeneous binding assay patent, April 1987

Method and apparatus for measuring blood constituent counts patent, July 1987

Method for separating the cellular components of blood samples patent, July 1989

Method of separation employing magnetic particles and second medium patent, January 1994

Assay of blood or other biologic samples for target analytes patent, June 1997

Method and apparatus for fully automated nucleic acid amplification, nucleic acid assay and immunoassay patent, June 1997

DNA purification and isolation using magnetic particles patent, January 1998

Assay system and method for conducting assays patent, March 1999

Centrifugal hematology disposable patent, November 2000

Devices and methods for using centripetal acceleration to drive fluid movement in a microfluidics system patent, November 2001

Diagnostic tests and kits for Clostridium difficile patent, January 2003

Monolithic microfluidic concentrators and mixers patent, May 2005

Multi-parameter assays including analysis discs and methods relating thereto patent, April 2006

Optical bio-discs and fluidic circuits for analysis of cells and methods relating thereto patent, January 2007

Centripetally-motivated microfluidics system for performing in vitro hybridization and amplification of nucleic acids patent, February 2008

Centrifugal force based microfluidic device, microfluidic system including the same, and method of determining home position of the microfluidic device patent, July 2010

Devices and Method For Using Centripetal Acceleration To Drive Fluid Movement In A Microfluidics System With On-Board Informatics patent-application, December 2001

Class characterization of circulating cancer cells isolated from body fluids and methods of use patent-application, July 2002

Reagents for labeling biomolecules having aldehyde or ketone Moieties patent-application, September 2002

Multi-parameter assays including analysis discs and methods relating thereto patent-application, October 2002

Analytical methods and compositions patent-application, November 2002

Method for separating cells patent-application, July 2003

Microfluidic particle-analysis systems patent-application, April 2004

Protecting agent patent-application, August 2005

Centrifuge with removable core for scalable centrifugation patent-application, September 2005

Microparticle-based methods and systems and applications thereof patent-application, December 2005

Method and Apparatus For Precise Transfer and Manipulation Of Fluids By Centrifugal and Or Capillary Forces patent-application, January 2009

Method For Isolating Nucleic Acids Comprising The Use Of Ethylene Glycol Multimers patent-application, March 2009

Centrifugal Separation System patent-application, August 2009

Method for detecting analytes in a sample patent-application, December 2009

Density-based cell detection system patent, March 2010

Separation Device patent-application, May 2010

Compact disk based platform for separating and detecting immunomagnetic bead labeled cells patent-application, June 2010

Centrifugation Apparatus For Containers Of Biological Material patent-application, February 2011

Systems and Methods for Handling Microfluidic Droplets patent-application, October 2013

Diagnostic Analyzers With Pretreatment Carousels and Related Methods patent-application, September 2014

Polyethyleneimine functionalized iron oxide nanoparticles as agents for DNA delivery and transfection journal, January 2007

Infrared controlled waxes for liquid handling and storage on a CD-microfluidic platform journal, January 2011

Micro freef-low IEF enhanced by active cooling and functionalized gels journal, December 2006

Ricin A-Chain Activity on Stem−Loop and Unstructured DNA Substrates journal, March 2005

Parallel Nanoliter Microfluidic Analysis System journal, June 2007

How Hofmeister ion interactions affect protein stability journal, October 1996

One-step purification of nucleic acid for gene expression analysis via Immiscible Filtration Assisted by Surface Tension (IFAST) journal, January 2011

Cell-Free DNA—A Marker to Predict Ischemic Brain Damage in a Rat Stroke Experimental Model journal, January 2011

Shiga toxin 1 acting on DNA in vitro is a heat-stable enzyme not requiring proteolytic activation journal, April 2004

A molecular approach to bioseparations: Protein–protein and protein–salt interactions journal, February 2006

Measurement of Circulating Cell-Free DNA Levels by a New Simple Fluorescent Test in Patients With Primary Colorectal Cancer journal, February 2011

Depurination of A4256 in 28 S rRNA by the Ribosome-inactivating Proteins from Barley and Ricin Results in Different Ribosome Conformations journal, May 1996

Leukocyte analysis and differentiation using high speed microfluidic single cell impedance cytometry journal, January 2009

Fully integrated lab-on-a-disc for simultaneous analysis of biochemistry and immunoassay from whole blood journal, January 2011

A fully automated immunoassay from whole blood on a disc journal, January 2009

Bead-based microfluidic immunoassays: The next generation journal, February 2007

Photopolymerized diffusion-defined polyacrylamide gradient gels for on-chip protein sizing journal, January 2008

Comparison of sample fixation and the use of LDS-751 or anti-CD45 for leukocyte identification in mouse whole blood for flow cytometry journal, January 2007

Functional integration of DNA purification and concentration into a real time micro-PCR chip journal, January 2011

Plasma DNA concentration as a predictor of mortality and sepsis in critically ill patients journal, April 2006

A B Cell-Based Sensor for Rapid Identification of Pathogens journal, July 2003

Read-out concepts for multiplexed bead-based fluorescence immunoassays on centrifugal microfluidic platforms journal, February 2006

Cell-Free Plasma DNA as a Predictor of Outcome in Severe Sepsis and Septic Shock journal, April 2008

Characterization of EBV-genome negative “null” and “T” cell lines derived from children with acute lymphoblastic leukemia and leukemic transformed non-Hodgkin lymphoma journal, May 1977

Bioinformatic processing to identify single nucleotide polymorphism that potentially affect Ape1 function journal, June 2011

A new biodosimetric method: branched DNA-based quantitative detection of B1 DNA in mouse plasma journal, August 2010

Circulating DNA: a new diagnostic gold mine? journal, October 2002

Detection of Listeria monocytogenes and the toxin listeriolysin O in food journal, February 2006

Multistation, Single Channel Analytical Photometer and Method Of Use
patent, January 1971

Loading disk for photometric analyzer of rotary cuvette type
patent, July 1973

Separation of solid and liquid components of mixtures
patent, November 1978

Apparatus and method for measuring white blood cell and platelet concentrations in blood
patent, May 1979

Heterogeneous binding assay
patent, April 1987

Method and apparatus for measuring blood constituent counts
patent, July 1987

Method for separating the cellular components of blood samples
patent, July 1989

Method of separation employing magnetic particles and second medium
patent, January 1994

Assay of blood or other biologic samples for target analytes
patent, June 1997

Method and apparatus for fully automated nucleic acid amplification, nucleic acid assay and immunoassay
patent, June 1997

DNA purification and isolation using magnetic particles
patent, January 1998

Assay system and method for conducting assays
patent, March 1999

Centrifugal hematology disposable
patent, November 2000

Devices and methods for using centripetal acceleration to drive fluid movement in a microfluidics system
patent, November 2001

Diagnostic tests and kits for Clostridium difficile
patent, January 2003

Monolithic microfluidic concentrators and mixers
patent, May 2005

Multi-parameter assays including analysis discs and methods relating thereto
patent, April 2006

Optical bio-discs and fluidic circuits for analysis of cells and methods relating thereto
patent, January 2007

Centripetally-motivated microfluidics system for performing in vitro hybridization and amplification of nucleic acids
patent, February 2008

Centrifugal force based microfluidic device, microfluidic system including the same, and method of determining home position of the microfluidic device
patent, July 2010

Devices and Method For Using Centripetal Acceleration To Drive Fluid Movement In A Microfluidics System With On-Board Informatics
patent-application, December 2001

Class characterization of circulating cancer cells isolated from body fluids and methods of use
patent-application, July 2002

Reagents for labeling biomolecules having aldehyde or ketone Moieties
patent-application, September 2002

Multi-parameter assays including analysis discs and methods relating thereto
patent-application, October 2002

Analytical methods and compositions
patent-application, November 2002

Method for separating cells
patent-application, July 2003

Microfluidic particle-analysis systems
patent-application, April 2004

Protecting agent
patent-application, August 2005

Centrifuge with removable core for scalable centrifugation
patent-application, September 2005

Microparticle-based methods and systems and applications thereof
patent-application, December 2005

Method and Apparatus For Precise Transfer and Manipulation Of Fluids By Centrifugal and Or Capillary Forces
patent-application, January 2009

Method For Isolating Nucleic Acids Comprising The Use Of Ethylene Glycol Multimers
patent-application, March 2009

Centrifugal Separation System
patent-application, August 2009

Method for detecting analytes in a sample
patent-application, December 2009

Density-based cell detection system
patent, March 2010

Separation Device
patent-application, May 2010

Compact disk based platform for separating and detecting immunomagnetic bead labeled cells
patent-application, June 2010

Centrifugation Apparatus For Containers Of Biological Material
patent-application, February 2011

Systems and Methods for Handling Microfluidic Droplets
patent-application, October 2013

Diagnostic Analyzers With Pretreatment Carousels and Related Methods
patent-application, September 2014

Polyethyleneimine functionalized iron oxide nanoparticles as agents for DNA delivery and transfection
journal, January 2007

Infrared controlled waxes for liquid handling and storage on a CD-microfluidic platform
journal, January 2011

Micro freef-low IEF enhanced by active cooling and functionalized gels
journal, December 2006

Ricin A-Chain Activity on Stem−Loop and Unstructured DNA Substrates
journal, March 2005

Parallel Nanoliter Microfluidic Analysis System
journal, June 2007

How Hofmeister ion interactions affect protein stability
journal, October 1996

One-step purification of nucleic acid for gene expression analysis via Immiscible Filtration Assisted by Surface Tension (IFAST)
journal, January 2011

Cell-Free DNA—A Marker to Predict Ischemic Brain Damage in a Rat Stroke Experimental Model
journal, January 2011

Shiga toxin 1 acting on DNA in vitro is a heat-stable enzyme not requiring proteolytic activation
journal, April 2004

A molecular approach to bioseparations: Protein–protein and protein–salt interactions
journal, February 2006

Measurement of Circulating Cell-Free DNA Levels by a New Simple Fluorescent Test in Patients With Primary Colorectal Cancer
journal, February 2011

Depurination of A4256 in 28 S rRNA by the Ribosome-inactivating Proteins from Barley and Ricin Results in Different Ribosome Conformations
journal, May 1996

Leukocyte analysis and differentiation using high speed microfluidic single cell impedance cytometry
journal, January 2009

Fully integrated lab-on-a-disc for simultaneous analysis of biochemistry and immunoassay from whole blood
journal, January 2011

A fully automated immunoassay from whole blood on a disc
journal, January 2009

Bead-based microfluidic immunoassays: The next generation
journal, February 2007

Photopolymerized diffusion-defined polyacrylamide gradient gels for on-chip protein sizing
journal, January 2008

Comparison of sample fixation and the use of LDS-751 or anti-CD45 for leukocyte identification in mouse whole blood for flow cytometry
journal, January 2007

Functional integration of DNA purification and concentration into a real time micro-PCR chip
journal, January 2011

Plasma DNA concentration as a predictor of mortality and sepsis in critically ill patients
journal, April 2006

A B Cell-Based Sensor for Rapid Identification of Pathogens
journal, July 2003

Read-out concepts for multiplexed bead-based fluorescence immunoassays on centrifugal microfluidic platforms
journal, February 2006

Cell-Free Plasma DNA as a Predictor of Outcome in Severe Sepsis and Septic Shock
journal, April 2008

Characterization of EBV-genome negative “null” and “T” cell lines derived from children with acute lymphoblastic leukemia and leukemic transformed non-Hodgkin lymphoma
journal, May 1977

Bioinformatic processing to identify single nucleotide polymorphism that potentially affect Ape1 function
journal, June 2011

A new biodosimetric method: branched DNA-based quantitative detection of B1 DNA in mouse plasma
journal, August 2010

Circulating DNA: a new diagnostic gold mine?
journal, October 2002

Detection of Listeria monocytogenes and the toxin listeriolysin O in food
journal, February 2006