Skip to main content
U.S. Department of Energy
Office of Scientific and Technical Information

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

Journal Article · · Genomics; (United States)
; ; ; ;  [1]
  1. Centre National de la Recherche Scientifique, Gif-sur-Yvette (France)
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11, respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.
OSTI ID:
6886014
Journal Information:
Genomics; (United States), Journal Name: Genomics; (United States) Journal Issue: 3 Vol. 15:3; ISSN GNMCEP; ISSN 0888-7543
Country of Publication:
United States
Language:
English