Skip to main content
U.S. Department of Energy
Office of Scientific and Technical Information

Human NAD(P)H:quinone oxidoreductase (NQO sub 1 ) gene structure and induction by dioxin

Journal Article · · Biochemistry; (United States)
DOI:https://doi.org/10.1021/bi00108a007· OSTI ID:5687405
 [1]
  1. New York Univ. Medical Center, NY (United States) Fox Chase Cancer Center, Philadelphia, PA (United States)
The human NAD(P):quinone oxidoreductase (NQO{sub 1}) gene, 1850 base pairs (bp) of the 5{prime} flanking region, and 67 bp of the 3{prime} flanking region have been sequenced. The human NQO{sub 1} gene is approximately 20 kb in length and has six exons interrupted by five introns. The start site of transcription was determined by primer extension analysis. Nuclear run-on experiments performed using nuclei isolated from 2,3,7,8-tetrachlorodibenzo-p-doxin (TCDD) treated and untreated human hepatoblastoma (Hep-G2) cells demonstrated that TCDD treatment increases the rate of transcription of endogenous NQO{sub 1} gene by 3-fold. The sequence analysis of the 5{prime} flanking region of the NQO{sub 1} gene showed the presence of a TATA box in the {minus}37 to {minus}32 bp region, one CCAAT box at nucleotide {minus}649, an AP1 binding site at position {minus}462, an AP2 site at nucleotide position {minus}156, and one copy of the nucleotide sequence GCGTC. It is noteworthy that XRE in human NQO{sub 1} gene is located 5{prime} to the ARE compared to its 3{prime} location in the rat quinone reductase gene. Interestingly, the consensus sequence for binding to AP1 protein (TGACTCA) is contained within the ARE sequence (TCACAGTGACTCAGCAGAATC) of human NQO{sub 1} gene. By deletion mutagenesis and transfection studies, the author has identified a segment of DNA in the upstream region of the human NQO{sub 1} gene required for a high level of expression in hepatoma cells and its induction by TCDD.
OSTI ID:
5687405
Journal Information:
Biochemistry; (United States), Journal Name: Biochemistry; (United States) Vol. 30:44; ISSN 0006-2960; ISSN BICHA
Country of Publication:
United States
Language:
English