Internal twisting motion dependent conductance of an aperiodic DNA molecule
- Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from a base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.
- OSTI ID:
- 22606709
- Journal Information:
- AIP Conference Proceedings, Journal Name: AIP Conference Proceedings Journal Issue: 1 Vol. 1729; ISSN APCPCS; ISSN 0094-243X
- Country of Publication:
- United States
- Language:
- English
Similar Records
Probing radiation damage by alternated current conductivity as a method to characterize electron hopping conduction in DNA molecules
Direct calculation of Slater-Koster parameters: Fourfold-coordinated silicon/boron phases