Chromosomal mapping of the human histone gene H2AZ to 4q24 by fluorescence in situ hybridization
Journal Article
·
· Genomics; (United States)
- National Cancer Institute, Bethesday, MD (United States)
The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21. Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.
- OSTI ID:
- 6821695
- Journal Information:
- Genomics; (United States), Journal Name: Genomics; (United States) Vol. 20:2; ISSN GNMCEP; ISSN 0888-7543
- Country of Publication:
- United States
- Language:
- English
Similar Records
Characterization of frequent deletions causing steroid 21-hydroxylase deficiency
The gene for murine megakaryocyte growth and development factor (thrombopoietin, Thpo) is located on mouse chromosome 16
Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism
Journal Article
·
Wed Jun 01 00:00:00 EDT 1988
· Proceedings of the National Academy of Sciences of the United States of America; (USA)
·
OSTI ID:5563642
The gene for murine megakaryocyte growth and development factor (thrombopoietin, Thpo) is located on mouse chromosome 16
Journal Article
·
Mon Apr 10 00:00:00 EDT 1995
· Genomics
·
OSTI ID:209956
Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism
Journal Article
·
Fri Jan 31 23:00:00 EST 1986
· Proc. Natl. Acad. Sci. U.S.A.; (United States)
·
OSTI ID:6220243