Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer
Journal Article
·
· Medical Oncology (Online)
- Shanghai Jiaotong University, Department of Thoracic Surgery, Shanghai First People’s Hospital (China)
- Shanghai Jiaotong University, Department of Pulmonary, Shanghai Chest Hospital (China)
The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as 'TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT'.
- OSTI ID:
- 22938411
- Journal Information:
- Medical Oncology (Online), Vol. 36, Issue 6; Other Information: Copyright (c) 2019 Springer Science+Business Media, LLC, part of Springer Nature; http://www.springer-ny.com; Country of input: International Atomic Energy Agency (IAEA); ISSN 1559-131X
- Country of Publication:
- United States
- Language:
- English
Similar Records
Knockdown of ADAM17 inhibits cell proliferation and increases oxaliplatin sensitivity in HCT-8 colorectal cancer through EGFR-PI3K-AKT activation
CXCL5 knockdown expression inhibits human bladder cancer T24 cells proliferation and migration
Knockdown of LncRNA PVT1 inhibits tumorigenesis in non-small-cell lung cancer by regulating miR-497 expression
Journal Article
·
Sat Sep 15 00:00:00 EDT 2018
· Biochemical and Biophysical Research Communications
·
OSTI ID:22938411
+3 more
CXCL5 knockdown expression inhibits human bladder cancer T24 cells proliferation and migration
Journal Article
·
Fri Mar 28 00:00:00 EDT 2014
· Biochemical and Biophysical Research Communications
·
OSTI ID:22938411
Knockdown of LncRNA PVT1 inhibits tumorigenesis in non-small-cell lung cancer by regulating miR-497 expression
Journal Article
·
Mon Jan 15 00:00:00 EST 2018
· Experimental Cell Research
·
OSTI ID:22938411
+1 more