Identification of a p53-response element in the promoter of the proline oxidase gene
- Department of Pathology and Laboratory Medicine, College of Medicine, Texas A and M Health Science Center, College Station, TX 77843-1114 (United States)
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.
- OSTI ID:
- 21143640
- Journal Information:
- Biochemical and Biophysical Research Communications, Vol. 369, Issue 2; Other Information: DOI: 10.1016/j.bbrc.2008.01.171; PII: S0006-291X(08)00227-1; Copyright (c) 2008 Elsevier Science B.V., Amsterdam, The Netherlands, All rights reserved; Country of input: International Atomic Energy Agency (IAEA); ISSN 0006-291X
- Country of Publication:
- United States
- Language:
- English
Similar Records
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
1α,25-dihydroxyvitamin D3 stimulates human SOST gene expression and sclerostin secretion