skip to main content
OSTI.GOV title logo U.S. Department of Energy
Office of Scientific and Technical Information

Title: Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

Patent ·
OSTI ID:1174842
;

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Research Organization:
Univ. of Nevada, Las Vegas, NV (United States)
Sponsoring Organization:
USDOE
DOE Contract Number:
FG03-98ER62574
Assignee:
University Of Nevada
Patent Number(s):
6,733,999
Application Number:
10/080,959
OSTI ID:
1174842
Country of Publication:
United States
Language:
English

References (11)

Real time quantitative PCR. journal October 1996
Detection of Varicella-Zoster Virus DNA in Air Samples from Hospital Rooms journal January 1994
Use of solid-phase PCR for enhanced detection of airborne microorganisms. journal January 1994
Comparison of the ABI 7700 System (TaqMan) and Competitive PCR for Quantification of IS6110 DNA in Sputum during Treatment of Tuberculosis journal January 1998
Specific detection of Stachybotrys chartarum in pure culture using quantitative polymerase chain reaction journal June 2001
PCR for bioaerosol monitoring: sensitivity and environmental interference. journal January 1995
Density and Molecular Epidemiology ofAspergillus in Air and Relationship to Outbreaks ofAspergillus Infection journal January 1999
Evaluation ofStachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during, and after remediation journal March 2000
Identification of putative sequence specific PCR primers for detection of the toxigenic fungal speciesStachybotrys chartarum journal December 1998
Quantification of Stachybotrys chartarum conidia in indoor dust using real time, fluorescent probe-based detection of PCR products journal February 2001
Quantitative measurement of Stachybotrys chartarum conidia using real time detection of PCR products with the TaqManTMfluorogenic probe system journal October 1999

Similar Records

Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties
Journal Article · Fri Dec 15 00:00:00 EST 2006 · Toxicology and Applied Pharmacology · OSTI ID:1174842
+1 more
Determination of gene dosage by a quantitative adaptation of the polymerase chain reaction (gd-PCR): Rapid detection of deletions and duplications of gene sequences
Journal Article · Sun May 15 00:00:00 EDT 1994 · Genomics; (United States) · OSTI ID:1174842
+3 more
DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins
Journal Article · Tue Aug 01 00:00:00 EDT 2006 · Toxicology and Applied Pharmacology · OSTI ID:1174842

Related Subjects

59 BASIC BIOLOGICAL SCIENCES