Skip to main content
OSTI.GOVU.S. Department of Energy Office of Scientific and Technical Information
U.S. Department of Energy
Office of Scientific and Technical Information
 

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

Patent ·
OSTI ID:1174842
;
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Research Organization:
University Of Nevada, Las Vegas, NV (United States)
Sponsoring Organization:
USDOE
DOE Contract Number:
FG03-98ER62574
Assignee:
University Of Nevada
Patent Number(s):
6,733,999
Application Number:
10/080,959
OSTI ID:
1174842
Country of Publication:
United States
Language:
English

References (11)

Quantitative measurement of Stachybotrys chartarum conidia using real time detection of PCR products with the TaqManTMfluorogenic probe system journal October 1999
Detection of Varicella-Zoster Virus DNA in Air Samples from Hospital Rooms journal January 1994
Specific detection of Stachybotrys chartarum in pure culture using quantitative polymerase chain reaction journal June 2001
Density and Molecular Epidemiology ofAspergillus in Air and Relationship to Outbreaks ofAspergillus Infection journal January 1999
Identification of putative sequence specific PCR primers for detection of the toxigenic fungal speciesStachybotrys chartarum journal December 1998
Evaluation ofStachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during, and after remediation journal March 2000
Use of solid-phase PCR for enhanced detection of airborne microorganisms. journal January 1994
PCR for bioaerosol monitoring: sensitivity and environmental interference. journal January 1995
Quantification of Stachybotrys chartarum conidia in indoor dust using real time, fluorescent probe-based detection of PCR products journal February 2001
Real time quantitative PCR. journal October 1996
Comparison of the ABI 7700 System (TaqMan) and Competitive PCR for Quantification of IS6110 DNA in Sputum during Treatment of Tuberculosis journal January 1998

Similar Records

Dual phase multiplex polymerase chain reaction
Patent · 2008 · OSTI ID:985411
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
Journal Article · 1989 · Anal. Biochem.; (United States) · OSTI ID:5822591
Polymerase chain reaction system
Patent · 2004 · OSTI ID:1174747

Related Subjects

59 BASIC BIOLOGICAL SCIENCES