skip to main content

Title: Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Authors:
; ; ; ;
Publication Date:
OSTI Identifier:
22416403
Resource Type:
Journal Article
Resource Relation:
Journal Name: Biochemical and Biophysical Research Communications; Journal Volume: 447; Journal Issue: 1; Other Information: Copyright (c) 2014 Elsevier Science B.V., Amsterdam, The Netherlands, All rights reserved.; Country of input: International Atomic Energy Agency (IAEA)
Country of Publication:
United States
Language:
English
Subject:
60 APPLIED LIFE SCIENCES; ABSORPTION SPECTROSCOPY; ANTIOXIDANTS; DETOXIFICATION; DRUGS; ENZYMES; INCUBATION; INFLAMMATION; INHIBITION; LIGANDS; MAGNETIC CIRCULAR DICHROISM; NEOPLASMS; NUCLEAR MAGNETIC RESONANCE; POTASSIUM IONS; PROMOTERS; PROTONS; TRANSCRIPTION FACTORS