Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
- OSTI ID:
- 22416403
- Journal Information:
- Biochemical and Biophysical Research Communications, Vol. 447, Issue 1; Other Information: Copyright (c) 2014 Elsevier Science B.V., Amsterdam, The Netherlands, All rights reserved.; Country of input: International Atomic Energy Agency (IAEA); ISSN 0006-291X
- Country of Publication:
- United States
- Language:
- English
Similar Records
Activation of the Nrf2/ARE pathway via S-alkylation of cysteine 151 in the chemopreventive agent-sensor Keap1 protein by falcarindiol, a conjugated diacetylene compound
Nrf2 activation prevents cadmium-induced acute liver injury