Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Yang, Yongil; Chaffin, Timothy A.; Shao, Yuanhua; Balasubramanian, Vimal K.; Markillie, Meng; Mitchell, Hugh; Rubio‐Wilhelmi, Maria M.; Ahkami, Amir H.; Blumwald, Eduardo; Neal Stewart, Jr, C.

doi:10.1111/pbi.14289

Title: Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Journal Article · 16 January 2024 · Plant Biotechnology Journal

DOI: https://doi.org/10.1111/pbi.14289 · OSTI ID:2281624

Yang, Yongil ^[1]; Chaffin, Timothy A. ^[1]; Shao, Yuanhua ^[2]; Balasubramanian, Vimal K. ^[3]; Markillie, Meng ^[3]; Mitchell, Hugh ^[3]; Rubio‐Wilhelmi, Maria M. ^[4]; Ahkami, Amir H. ^[3];

^[4];

^[2]

Center for Agricultural Synthetic Biology University of Tennessee Institute of Agriculture Knoxville Tennessee USA
Center for Agricultural Synthetic Biology University of Tennessee Institute of Agriculture Knoxville Tennessee USA, Department of Plant Sciences University of Tennessee Knoxville Tennessee USA
Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory Richland WA USA
Department of Plant Sciences University of California Davis California USA

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

View Journal Article

Cite

Export

Save

Research Organization:: Pacific Northwest National Laboratory (PNNL), Richland, WA (United States)

Sponsoring Organization:: USDOE; USDOE Office of Science (SC), Biological and Environmental Research (BER)

Grant/Contract Number:: AC05-76RL01830; SC0018347

OSTI ID:: 2281624

Report Number(s):: PNNL-SA-189970

Journal Information:: Plant Biotechnology Journal, Journal Name: Plant Biotechnology Journal Journal Issue: 6 Vol. 22; ISSN 1467-7644

Publisher:: Wiley-BlackwellCopyright Statement

Country of Publication:: United Kingdom

Language:: English

References (69)

Cell‐Type‐Specific Proteomics Analysis of a Small Number of Plant Cells by Integrating Laser Capture Microdissection with a Nanodroplet Sample Processing Platform Balasubramanian, Vimal K.; Purvine, Samuel O.; Liang, Yiran Current Protocols, Vol. 1, Issue 5 https://doi.org/10.1002/cpz1.153	journal	May 2021
Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method Livak, Kenneth J.; Schmittgen, Thomas D. Methods, Vol. 25, Issue 4 https://doi.org/10.1006/meth.2001.1262	journal	December 2001
Characterization of a rice gene family encoding root-specific proteins Xu, Yong; Buchholz, Wallace G.; DeRose, Richard T. Plant Molecular Biology, Vol. 27, Issue 2 https://doi.org/10.1007/BF00020180	journal	January 1995
A profilin gene promoter from switchgrass (Panicum virgatum L.) directs strong and specific transgene expression to vascular bundles in rice Xu, Wenzhi; Liu, Wusheng; Ye, Rongjian Plant Cell Reports, Vol. 37, Issue 4 https://doi.org/10.1007/s00299-018-2253-1	journal	January 2018
Synthetic promoters in planta Dey, Nrisingha; Sarkar, Shayan; Acharya, Sefali Planta, Vol. 242, Issue 5 https://doi.org/10.1007/s00425-015-2377-2	journal	August 2015
Genetically modified crops: current status and future prospects Kumar, Krishan; Gambhir, Geetika; Dass, Abhishek Planta, Vol. 251, Issue 4 https://doi.org/10.1007/s00425-020-03372-8	journal	March 2020
Seed-specific increased expression of 2S albumin promoter of sesame qualifies it as a useful genetic tool for fatty acid metabolic engineering and related transgenic intervention in sesame and other oil seed crops Bhunia, Rupam Kumar; Chakraborty, Anirban; Kaur, Ranjeet Plant Molecular Biology, Vol. 86, Issue 4-5 https://doi.org/10.1007/s11103-014-0233-6	journal	August 2014
A maize α-zein promoter drives an endosperm-specific expression of transgene in rice Joshi, J. Beslin; Geetha, S.; Singh, Birla Physiology and Molecular Biology of Plants, Vol. 21, Issue 1 https://doi.org/10.1007/s12298-014-0268-9	journal	October 2014
Construction of a novel synthetic root-specific promoter and its characterization in transgenic tobacco plants Mohan, Chakravarthi; Jayanarayanan, Ashwin Narayan; Narayanan, Subramonian 3 Biotech, Vol. 7, Issue 4 https://doi.org/10.1007/s13205-017-0872-9	journal	July 2017
Construction vascular-specific expression bi-directional promoters in plants Lv, Xiaomeng; Song, Xiaodan; Rao, Guodong Journal of Biotechnology, Vol. 141, Issue 3-4 https://doi.org/10.1016/j.jbiotec.2009.03.009	journal	May 2009
Multiple Levels of Regulation Determine Monoterpenoid Essential Oil Compositional Variation in the Mint Family Ahkami, Amirhossein; Johnson, Sean R.; Srividya, Narayanan Molecular Plant, Vol. 8, Issue 1 https://doi.org/10.1016/j.molp.2014.11.009	journal	January 2015
Draft Genome Sequence of Mentha longifolia and Development of Resources for Mint Cultivar Improvement Vining, Kelly J.; Johnson, Sean R.; Ahkami, Amirhossein Molecular Plant, Vol. 10, Issue 2 https://doi.org/10.1016/j.molp.2016.10.018	journal	February 2017
Cloning and characterization of a novel Athspr promoter specifically active in vascular tissue Zhang, Liang; Yang, Tao; Li, Xiaoying Plant Physiology and Biochemistry, Vol. 78 https://doi.org/10.1016/j.plaphy.2014.02.019	journal	May 2014
Plant synthetic biology innovations for biofuels and bioproducts Yang, Yongil; Chaffin, Timothy Alexander; Ahkami, Amir H. Trends in Biotechnology https://doi.org/10.1016/j.tibtech.2022.09.007	journal	October 2022
Plant Single-Cell Multiomics: Cracking the Molecular Profiles of Plant Cells Thibivilliers, Sandra; Libault, Marc Trends in Plant Science, Vol. 26, Issue 6 https://doi.org/10.1016/j.tplants.2021.03.001	journal	June 2021
Designing artificial synthetic promoters for accurate, smart, and versatile gene expression in plants Yasmeen, Erum; Wang, Jin; Riaz, Muhammad Plant Communications, Vol. 4, Issue 4 https://doi.org/10.1016/j.xplc.2023.100558	journal	July 2023
GB_SynP: A Modular dCas9-Regulated Synthetic Promoter Collection for Fine-Tuned Recombinant Gene Expression in Plants Moreno-Giménez, Elena; Selma, Sara; Calvache, Camilo ACS Synthetic Biology, Vol. 11, Issue 9 https://doi.org/10.1021/acssynbio.2c00238	journal	August 2022
A Golden Gate Modular Cloning Toolbox for Plants Engler, Carola; Youles, Mark; Gruetzner, Ramona ACS Synthetic Biology, Vol. 3, Issue 11 https://doi.org/10.1021/sb4001504	journal	February 2014
Direct measurement of DNA affinity landscapes on a high-throughput sequencing instrument Nutiu, Razvan; Friedman, Robin C.; Luo, Shujun Nature Biotechnology, Vol. 29, Issue 7 https://doi.org/10.1038/nbt.1882	journal	June 2011
An algorithm for finding protein–DNA binding sites with applications to chromatin- immunoprecipitation microarray experiments Liu, X. Shirley; Brutlag, Douglas L.; Liu, Jun S. Nature Biotechnology, Vol. 20, Issue 8 https://doi.org/10.1038/nbt717	journal	July 2002
Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences Jaeger, Geert De; Scheffer, Stanley; Jacobs, Anni Nature Biotechnology, Vol. 20, Issue 12 https://doi.org/10.1038/nbt755	journal	November 2002
Fast gapped-read alignment with Bowtie 2 Langmead, Ben; Salzberg, Steven L. Nature Methods, Vol. 9, Issue 4 https://doi.org/10.1038/nmeth.1923	journal	March 2012
Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants Sparkes, Imogen A.; Runions, John; Kearns, Anne Nature Protocols, Vol. 1, Issue 4 https://doi.org/10.1038/nprot.2006.286	journal	November 2006
Mapping genome-wide transcription-factor binding sites using DAP-seq Bartlett, Anna; O'Malley, Ronan C.; Huang, Shao-shan Carol Nature Protocols, Vol. 12, Issue 8 https://doi.org/10.1038/nprot.2017.055	journal	July 2017
Broad-spectrum resistance to bacterial blight in rice using genome editing Oliva, Ricardo; Ji, Chonghui; Atienza-Grande, Genelou Nature Biotechnology, Vol. 37, Issue 11 https://doi.org/10.1038/s41587-019-0267-z	journal	October 2019
Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice Wang, Rui; Zhu, Menglin; Ye, Rongjian Scientific Reports, Vol. 5, Issue 1 https://doi.org/10.1038/srep18256	journal	December 2015
Developing synthetic biology for industrial biotechnology applications Clarke, Lionel; Kitney, Richard Biochemical Society Transactions, Vol. 48, Issue 1 https://doi.org/10.1042/BST20190349	journal	February 2020
Quantitative nature of the Prolamin‐box, ACGT and AACA motifs in a rice glutelin gene promoter: minimal cis‐element requirements for endosperm‐specific gene expression Wu, Chuan‐Yin; Washida, Haruhiko; Onodera, Yasuyuki The Plant Journal, Vol. 23, Issue 3 https://doi.org/10.1046/j.1365-313x.2000.00797.x	journal	August 2000
The promoter from SlREO, a highly-expressed, root-specific Solanum lycopersicum gene, directs expression to cortex of mature roots Jones, Matthew O.; Manning, Kenneth; Andrews, John Functional Plant Biology, Vol. 35, Issue 12 https://doi.org/10.1071/FP08139	journal	January 2008
A review of ensemble methods forde novomotif discovery in ChIP-Seq data Lihu, Andrei; Holban, Stefan Briefings in Bioinformatics, Vol. 17, Issue 4 https://doi.org/10.1093/bib/bbw047	journal	June 2016
Analysing high-throughput sequencing data in Python with HTSeq 2.0 Putri, Givanna H.; Anders, Simon; Pyl, Paul Theodor Bioinformatics, Vol. 38, Issue 10 https://doi.org/10.1093/bioinformatics/btac166	journal	March 2022
W-AlignACE: an improved Gibbs sampling algorithm based on more accurate position weight matrices learned from sequence and gene expression/ChIP-chip data Chen, Xin; Guo, Lingqiong; Fan, Zhaocheng Bioinformatics, Vol. 24, Issue 9 https://doi.org/10.1093/bioinformatics/btn088	journal	March 2008
Plant synthetic biology: exploring the frontiers of sustainable agriculture and fundamental plant biology Yang, Jae-Seong; Reyna-Llorens, Ivan Journal of Experimental Botany, Vol. 74, Issue 13 https://doi.org/10.1093/jxb/erad220	journal	July 2023
Storage of competent cells for Agrobacterium transformation Hofgen, Rainer; Willmitzer, Lothar Nucleic Acids Research, Vol. 16, Issue 20 https://doi.org/10.1093/nar/16.20.9877	journal	January 1988
Plant cis-acting regulatory DNA elements (PLACE) database: 1999 Higo, K.; Ugawa, Y.; Iwamoto, M. Nucleic Acids Research, Vol. 27, Issue 1 https://doi.org/10.1093/nar/27.1.297	journal	January 1999
Rational design of minimal synthetic promoters for plants Cai, Yao-Min; Kallam, Kalyani; Tidd, Henry Nucleic Acids Research, Vol. 48, Issue 21 https://doi.org/10.1093/nar/gkaa682	journal	August 2020
Phytozome: a comparative platform for green plant genomics Goodstein, David M.; Shu, Shengqiang; Howson, Russell Nucleic Acids Research, Vol. 40, Issue D1 https://doi.org/10.1093/nar/gkr944	journal	November 2011
The BioMart community portal: an innovative alternative to large, centralized data repositories Smedley, Damian; Haider, Syed; Durinck, Steffen Nucleic Acids Research, Vol. 43, Issue W1 https://doi.org/10.1093/nar/gkv350	journal	April 2015
The MEME Suite Bailey, Timothy L.; Johnson, James; Grant, Charles E. Nucleic Acids Research, Vol. 43, Issue W1 https://doi.org/10.1093/nar/gkv416	journal	May 2015
Combining ATAC-seq with nuclei sorting for discovery of cis-regulatory regions in plant genomes Lu, Zefu; Hofmeister, Brigitte T.; Vollmers, Christopher Nucleic Acids Research, Vol. 45, Issue 6 https://doi.org/10.1093/nar/gkw1179	journal	November 2016
Genetic Transformation of Populus trichocarpa Genotype Nisqually-1: A Functional Genomic Tool for Woody Plants Song, Jingyuan; Lu, Shanfa; Chen, Zenn-Zong Plant and Cell Physiology, Vol. 47, Issue 11, p. 1582-1589 https://doi.org/10.1093/pcp/pcl018	journal	November 2006
Cis-regulatory sequences in plants: Their importance, discovery, and future challenges Schmitz, Robert J.; Grotewold, Erich; Stam, Maike The Plant Cell, Vol. 34, Issue 2 https://doi.org/10.1093/plcell/koab281	journal	November 2021
Vessel-Specific Reintroduction of CINNAMOYL-COA REDUCTASE1 (CCR1) in Dwarfed ccr1 Mutants Restores Vessel and Xylary Fiber Integrity and Increases Biomass De Meester, Barbara; de Vries, Lisanne; Özparpucu, Merve Plant Physiology, Vol. 176, Issue 1 https://doi.org/10.1104/pp.17.01462	journal	November 2017
The 6xABRE Synthetic Promoter Enables the Spatiotemporal Analysis of ABA-Mediated Transcriptional Regulation Wu, Rui; Duan, Lina; Pruneda-Paz, José L. Plant Physiology, Vol. 177, Issue 4 https://doi.org/10.1104/pp.18.00401	journal	June 2018
A rice promoter containing both novel positive and negative cis-elements for regulation of green tissue-specific gene expression in transgenic plants Cai, Meng; Wei, Jun; Li, Xianghua Plant Biotechnology Journal, Vol. 5, Issue 5 https://doi.org/10.1111/j.1467-7652.2007.00271.x	journal	September 2007
Tissue-type-specific transcriptome analysis identifies developing xylem-specific promoters in poplar Ko, Jae-Heung; Kim, Hyun-Tae; Hwang, Ildoo Plant Biotechnology Journal, Vol. 10, Issue 5, p. 587-596 https://doi.org/10.1111/j.1467-7652.2012.00690.x	journal	March 2012
Computational discovery of soybean promoter cis -regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters Liu, Wusheng; Mazarei, Mitra; Peng, Yanhui Plant Biotechnology Journal, Vol. 12, Issue 8 https://doi.org/10.1111/pbi.12206	journal	June 2014
Wood forming tissue‐specific bicistronic expression of Pd GA 20ox1 and Ptr MYB 221 improves both the quality and quantity of woody biomass production in a hybrid poplar Cho, Jin‐Seong; Jeon, Hyung‐Woo; Kim, Min‐Ha Plant Biotechnology Journal, Vol. 17, Issue 6 https://doi.org/10.1111/pbi.13036	journal	December 2018
Comprehensive construction strategy of bidirectional green tissue‐specific synthetic promoters Bai, Jiuyuan; Wang, Xin; Wu, Hao Plant Biotechnology Journal, Vol. 18, Issue 3 https://doi.org/10.1111/pbi.13231	journal	August 2019
Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements Yang, Yongil; Lee, Jun Hyung; Poindexter, Magen R. Plant Biotechnology Journal, Vol. 19, Issue 7 https://doi.org/10.1111/pbi.13550	journal	February 2021
Engineered gamma radiation phytosensors for environmental monitoring Sears, Robert G.; Rigoulot, Stephen B.; Occhialini, Alessandro Plant Biotechnology Journal, Vol. 21, Issue 9 https://doi.org/10.1111/pbi.14072	journal	May 2023
Plant-made vaccines and therapeutics Fausther-Bovendo, Hugues; Kobinger, Gary Science, Vol. 373, Issue 6556 https://doi.org/10.1126/science.abf5375	journal	August 2021
cis-Regulatory Elements in Plant Development, Adaptation, and Evolution Marand, Alexandre P.; Eveland, Andrea L.; Kaufmann, Kerstin Annual Review of Plant Biology, Vol. 74, Issue 1 https://doi.org/10.1146/annurev-arplant-070122-030236	journal	May 2023
Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Love, Michael I.; Huber, Wolfgang; Anders, Simon Genome Biology, Vol. 15, Issue 12 https://doi.org/10.1186/s13059-014-0550-8	journal	December 2014
Switchgrass (Panicum virgatum L.) promoters for green tissue-specific expression of the MYB4 transcription factor for reduced-recalcitrance transgenic switchgrass Liu, Wusheng; Mazarei, Mitra; Ye, Rongjian Biotechnology for Biofuels, Vol. 11, Issue 1 https://doi.org/10.1186/s13068-018-1119-7	journal	April 2018
A gene-editing/complementation strategy for tissue-specific lignin reduction while preserving biomass yield Yu, Hasi; Liu, Chang; Dixon, Richard A. Biotechnology for Biofuels, Vol. 14, Issue 1 https://doi.org/10.1186/s13068-021-02026-5	journal	September 2021
Gene network analysis of poplar root transcriptome in response to drought stress identifies a PtaJAZ3PtaRAP2.6-centered hierarchical network Dash, Madhumita; Yordanov, Yordan S.; Georgieva, Tatyana PLOS ONE, Vol. 13, Issue 12 https://doi.org/10.1371/journal.pone.0208560	journal	December 2018
Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation Yang, Yongil; Shao, Yuanhua; Chaffin, Timothy BIO-PROTOCOL, Vol. 13, Issue 8 https://doi.org/10.21769/BioProtoc.4660	journal	January 2023
Strength, Stability, and cis-Motifs of In silico Identified Phloem-Specific Promoters in Brassica juncea (L.) Koramutla, Murali Krishna; Bhatt, Deepa; Negi, Manisha Frontiers in Plant Science, Vol. 7 https://doi.org/10.3389/fpls.2016.00457	journal	April 2016
Ectopic Expression of PtoMYB74 in Poplar and Arabidopsis Promotes Secondary Cell Wall Formation Li, Chaofeng; Ma, Xiaodong; Yu, Hong Frontiers in Plant Science, Vol. 9 https://doi.org/10.3389/fpls.2018.01262	journal	October 2018
A Fruitful Decade Using Synthetic Promoters in the Improvement of Transgenic Plants Ali, Sajid; Kim, Won-Chan Frontiers in Plant Science, Vol. 10 https://doi.org/10.3389/fpls.2019.01433	journal	November 2019
The Q-System as a Synthetic Transcriptional Regulator in Plants Persad, Ramona; Reuter, D. Nikki; Dice, Lezlee T. Frontiers in Plant Science, Vol. 11 https://doi.org/10.3389/fpls.2020.00245	journal	March 2020
Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba) Yang, Yongil; Shao, Yuanhua; Chaffin, Timothy A. Frontiers in Plant Science, Vol. 13 https://doi.org/10.3389/fpls.2022.1011939	journal	October 2022
Specific Bacterial Pathogen Phytosensing Is Enabled by a Synthetic Promoter-Transcription Factor System in Potato Persad-Russell, Ramona; Mazarei, Mitra; Schimel, Tayler Marie Frontiers in Plant Science, Vol. 13 https://doi.org/10.3389/fpls.2022.873480	journal	April 2022
Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max) Sultana, Mst Shamira; Mazarei, Mitra; Millwood, Reginald J. Frontiers in Plant Science, Vol. 13 https://doi.org/10.3389/fpls.2022.988048	journal	September 2022
Tinkering Cis Motifs Jigsaw Puzzle Led to Root-Specific Drought-Inducible Novel Synthetic Promoters Jameel, Aysha; Noman, Muhammad; Liu, Weican International Journal of Molecular Sciences, Vol. 21, Issue 4 https://doi.org/10.3390/ijms21041357	journal	February 2020
Plant-Based Drugs and Vaccines for COVID-19 Mahmood, Nasir; Nasir, Sarah Bushra; Hefferon, Kathleen Vaccines, Vol. 9, Issue 1 https://doi.org/10.3390/vaccines9010015	journal	December 2020
Fast track assembly of multigene constructs using Golden Gate cloning and the MoClo system Werner, Stefan; Engler, Carola; Weber, Ernst Bioengineered, Vol. 3, Issue 1 https://doi.org/10.4161/bbug.3.1.18223	journal	January 2012
Vision, challenges and opportunities for a Plant Cell Atlas Ahmed, Jahed; Alaba, Oluwafemi; Ameen, Gazala eLife, Vol. 10 https://doi.org/10.7554/eLife.66877	journal	September 2021

Similar Records

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba)

Journal Article · 2022 · Frontiers in Plant Science · OSTI ID:1893536

Yang, Yongil; Shao, Yuanhua; Chaffin, Timothy A.; +5 more

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Journal Article · 2021 · Plant Biotechnology Journal · OSTI ID:1765044

Yang, Yongil; Lee, Jun Hyung; Poindexter, Magen R.; +6 more

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach (Final Report)

Technical Report · 2024 · OSTI ID:2282027

Blumwald, Eduardo; Ahkami, Amir H.; Stewart Jr., Neil; +1 more

Related Subjects

59 BASIC BIOLOGICAL SCIENCES
Populus
green tissue specific promoter
synthetic biology
synthetic promoter
water-deficit stress

Title: Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Citation Formats

References (69)

Similar Records

Related Subjects