National Library of Energy BETA

Sample records for low-flow sampling method

  1. ACL monitoring using a low-flow sampling technique: A case study

    SciTech Connect (OSTI)

    Hurley, D.F.; Whitehouse, J.M.


    A dedicated low-flow groundwater sample collection system was designed for implementation in a post-closure ACL monitoring program at the Yaworski Lagoon NPL site in Canterbury, Connecticut. The system includes dedicated bladder pumps with intake ports located in the screened interval of the monitoring wells. This sampling technique was implemented in the spring of 1993. The system was designed to simultaneously obtain samples directly from the screened interval of nested wells in three distinct water bearing zones. Sample collection is begun upon stabilization of field parameters. Other than line volume, no prior purging of the well is required. It was found that dedicated low-flow sampling from the screened interval provides a method of representative sample collection without the bias of suspended solids introduced by traditional techniques of pumping and bailing. Analytical data indicate that measured chemical constituents are representative of groundwater migrating through the screened interval. Upon implementation of the low-flow monitoring system, analytical results exhibited a decrease in concentrations of some organic compounds and metals. The system has also proven to be a cost effective alternative to pumping and bailing which generate large volumes of purge water requiring containment and disposal.

  2. Sampling system and method

    DOE Patents [OSTI]

    Decker, David L.; Lyles, Brad F.; Purcell, Richard G.; Hershey, Ronald Lee


    The present disclosure provides an apparatus and method for coupling conduit segments together. A first pump obtains a sample and transmits it through a first conduit to a reservoir accessible by a second pump. The second pump further conducts the sample from the reservoir through a second conduit.

  3. Sampling system and method

    DOE Patents [OSTI]

    Decker, David L; Lyles, Brad F; Purcell, Richard G; Hershey, Ronald Lee


    An apparatus and method for supporting a tubing bundle during installation or removal. The apparatus includes a clamp for securing the tubing bundle to an external wireline. The method includes deploying the tubing bundle and wireline together, The tubing bundle is periodically secured to the wireline using a clamp.

  4. Fluid sampling apparatus and method

    DOE Patents [OSTI]

    Yeamans, David R.


    Incorporation of a bellows in a sampling syringe eliminates ingress of contaminants, permits replication of amounts and compression of multiple sample injections, and enables remote sampling for off-site analysis.

  5. Fluid sampling apparatus and method

    DOE Patents [OSTI]

    Yeamans, D.R.


    Incorporation of a bellows in a sampling syringe eliminates ingress of contaminants, permits replication of amounts and compression of multiple sample injections, and enables remote sampling for off-site analysis. 3 figs.

  6. Duplex sampling apparatus and method

    DOE Patents [OSTI]

    Brown, Paul E.; Lloyd, Robert


    An improved apparatus is provided for sampling a gaseous mixture and for measuring mixture components. The apparatus includes two sampling containers connected in series serving as a duplex sampling apparatus. The apparatus is adapted to independently determine the amounts of condensable and noncondensable gases in admixture from a single sample. More specifically, a first container includes a first port capable of selectively connecting to and disconnecting from a sample source and a second port capable of selectively connecting to and disconnecting from a second container. A second container also includes a first port capable of selectively connecting to and disconnecting from the second port of the first container and a second port capable of either selectively connecting to and disconnecting from a differential pressure source. By cooling a mixture sample in the first container, the condensable vapors form a liquid, leaving noncondensable gases either as free gases or dissolved in the liquid. The condensed liquid is heated to drive out dissolved noncondensable gases, and all the noncondensable gases are transferred to the second container. Then the first and second containers are separated from one another in order to separately determine the amount of noncondensable gases and the amount of condensable gases in the sample.

  7. Apparatus and method for handheld sampling

    DOE Patents [OSTI]

    Staab, Torsten A.


    The present invention includes an apparatus, and corresponding method, for taking a sample. The apparatus is built around a frame designed to be held in at least one hand. A sample media is used to secure the sample. A sample media adapter for securing the sample media is operated by a trigger mechanism connectively attached within the frame to the sample media adapter.

  8. Soil sampling kit and a method of sampling therewith

    DOE Patents [OSTI]

    Thompson, Cyril V.


    A soil sampling device and a sample containment device for containing a soil sample is disclosed. In addition, a method for taking a soil sample using the soil sampling device and soil sample containment device to minimize the loss of any volatile organic compounds contained in the soil sample prior to analysis is disclosed. The soil sampling device comprises two close fitting, longitudinal tubular members of suitable length, the inner tube having the outward end closed. With the inner closed tube withdrawn a selected distance, the outer tube can be inserted into the ground or other similar soft material to withdraw a sample of material for examination. The inner closed end tube controls the volume of the sample taken and also serves to eject the sample. The soil sample containment device has a sealing member which is adapted to attach to an analytical apparatus which analyzes the volatile organic compounds contained in the sample. The soil sampling device in combination with the soil sample containment device allow an operator to obtain a soil sample containing volatile organic compounds and minimizing the loss of the volatile organic compounds prior to analysis of the soil sample for the volatile organic compounds.

  9. Soil sampling kit and a method of sampling therewith

    DOE Patents [OSTI]

    Thompson, C.V.


    A soil sampling device and a sample containment device for containing a soil sample is disclosed. In addition, a method for taking a soil sample using the soil sampling device and soil sample containment device to minimize the loss of any volatile organic compounds contained in the soil sample prior to analysis is disclosed. The soil sampling device comprises two close fitting, longitudinal tubular members of suitable length, the inner tube having the outward end closed. With the inner closed tube withdrawn a selected distance, the outer tube can be inserted into the ground or other similar soft material to withdraw a sample of material for examination. The inner closed end tube controls the volume of the sample taken and also serves to eject the sample. The soil sample containment device has a sealing member which is adapted to attach to an analytical apparatus which analyzes the volatile organic compounds contained in the sample. The soil sampling device in combination with the soil sample containment device allows an operator to obtain a soil sample containing volatile organic compounds and minimizing the loss of the volatile organic compounds prior to analysis of the soil sample for the volatile organic compounds. 11 figures.

  10. Method and apparatus for data sampling

    DOE Patents [OSTI]

    Odell, D.M.C.


    A method and apparatus for sampling radiation detector outputs and determining event data from the collected samples is described. The method uses high speed sampling of the detector output, the conversion of the samples to digital values, and the discrimination of the digital values so that digital values representing detected events are determined. The high speed sampling and digital conversion is performed by an A/D sampler that samples the detector output at a rate high enough to produce numerous digital samples for each detected event. The digital discrimination identifies those digital samples that are not representative of detected events. The sampling and discrimination also provides for temporary or permanent storage, either serially or in parallel, to a digital storage medium. 6 figures.

  11. Method and apparatus for data sampling

    DOE Patents [OSTI]

    Odell, Daniel M. C.


    A method and apparatus for sampling radiation detector outputs and determining event data from the collected samples. The method uses high speed sampling of the detector output, the conversion of the samples to digital values, and the discrimination of the digital values so that digital values representing detected events are determined. The high speed sampling and digital conversion is performed by an A/D sampler that samples the detector output at a rate high enough to produce numerous digital samples for each detected event. The digital discrimination identifies those digital samples that are not representative of detected events. The sampling and discrimination also provides for temporary or permanent storage, either serially or in parallel, to a digital storage medium.

  12. Systems and methods for sample analysis

    DOE Patents [OSTI]

    Cooks, Robert Graham; Li, Guangtao; Li, Xin; Ouyang, Zheng


    The invention generally relates to systems and methods for sample analysis. In certain embodiments, the invention provides a system for analyzing a sample that includes a probe including a material connected to a high voltage source, a device for generating a heated gas, and a mass analyzer.

  13. Systems and methods for sample analysis

    SciTech Connect (OSTI)

    Cooks, Robert Graham; Li, Guangtao; Li, Xin; Ouyang, Zheng


    The invention generally relates to systems and methods for sample analysis. In certain embodiments, the invention provides a system for analyzing a sample that includes a probe including a material connected to a high voltage source, a device for generating a heated gas, and a mass analyzer.

  14. Method and apparatus for sampling atmospheric mercury

    DOE Patents [OSTI]

    Trujillo, Patricio E.; Campbell, Evan E.; Eutsler, Bernard C.


    A method of simultaneously sampling particulate mercury, organic mercurial vapors, and metallic mercury vapor in the working and occupational environment and determining the amount of mercury derived from each such source in the sampled air. A known volume of air is passed through a sampling tube containing a filter for particulate mercury collection, a first adsorber for the selective adsorption of organic mercurial vapors, and a second adsorber for the adsorption of metallic mercury vapor. Carbon black molecular sieves are particularly useful as the selective adsorber for organic mercurial vapors. The amount of mercury adsorbed or collected in each section of the sampling tube is readily quantitatively determined by flameless atomic absorption spectrophotometry.

  15. Flow cytometric detection method for DNA samples

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz; Langlois, Richard G.; Venkateswaran, Kodumudi S.


    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.

  16. Flow cytometric detection method for DNA samples

    DOE Patents [OSTI]

    Nasarabadi,Shanavaz; Langlois, Richard G.; Venkateswaran, Kodumudi S.


    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.

  17. Well purge and sample apparatus and method

    DOE Patents [OSTI]

    Schalla, R.; Smith, R.M.; Hall, S.H.; Smart, J.E.; Gustafson, G.S.


    The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly with a packer, pump and exhaust, that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. The packer is positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion. 8 figs.

  18. Well purge and sample apparatus and method

    DOE Patents [OSTI]

    Schalla, Ronald; Smith, Ronald M.; Hall, Stephen H.; Smart, John E.; Gustafson, Gregg S.


    The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly with a packer, pump and exhaust, that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. The packer is positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion.

  19. System and method for extracting a sample from a surface

    SciTech Connect (OSTI)

    Van Berkel, Gary; Covey, Thomas


    A system and method is disclosed for extracting a sample from a sample surface. A sample is provided and a sample surface receives the sample which is deposited on the sample surface. A hydrophobic material is applied to the sample surface, and one or more devices are configured to dispense a liquid on the sample, the liquid dissolving the sample to form a dissolved sample material, and the one or more devices are configured to extract the dissolved sample material from the sample surface.

  20. Modified electrokinetic sample injection method in chromatography and electrophoresis analysis

    DOE Patents [OSTI]

    Davidson, J. Courtney; Balch, Joseph W.


    A sample injection method for horizontal configured multiple chromatography or electrophoresis units, each containing a number of separation/analysis channels, that enables efficient introduction of analyte samples. This method for loading when taken in conjunction with horizontal microchannels allows much reduced sample volumes and a means of sample stacking to greatly reduce the concentration of the sample. This reduction in the amount of sample can lead to great cost savings in sample preparation, particularly in massively parallel applications such as DNA sequencing. The essence of this method is in preparation of the input of the separation channel, the physical sample introduction, and subsequent removal of excess material. By this method, sample volumes of 100 nanoliter to 2 microliters have been used successfully, compared to the typical 5 microliters of sample required by the prior separation/analysis method.

  1. Microfluidic DNA sample preparation method and device

    DOE Patents [OSTI]

    Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.


    Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

  2. Methods for characterizing, classifying, and identifying unknowns in samples

    DOE Patents [OSTI]

    Grate, Jay W [West Richland, WA; Wise, Barry M [Manson, WA


    Disclosed is a method for taking the data generated from an array of responses from a multichannel instrument, and determining the characteristics of a chemical in the sample without the necessity of calibrating or training the instrument with known samples containing the same chemical. The characteristics determined by the method are then used to classify and identify the chemical in the sample. The method can also be used to quantify the concentration of the chemical in the sample.

  3. Methods for characterizing, classifying, and identifying unknowns in samples

    DOE Patents [OSTI]

    Grate, Jay W.; Wise, Barry M.


    Disclosed is a method for taking the data generated from an array of responses from a multichannel instrument, and determining the characteristics of a chemical in the sample without the necessity of calibrating or training the instrument with known samples containing the same chemical. The characteristics determined by the method are then used to classify and identify the chemical in the sample. The method can also be used to quantify the concentration of the chemical in the sample.

  4. Method for sampling sub-micron particles

    DOE Patents [OSTI]

    Gay, Don D.; McMillan, William G.


    Apparatus and method steps for collecting sub-micron sized particles include a collection chamber and cryogenic cooling. The cooling is accomplished by coil tubing carrying nitrogen in liquid form, with the liquid nitrogen changing to the gas phase before exiting from the collection chamber in the tubing. Standard filters are used to filter out particles of diameter greater than or equal to 0.3 microns; however the present invention is used to trap particles of less than 0.3 micron in diameter. A blower draws air to said collection chamber through a filter which filters particles with diameters greater than or equal to 0.3 micron. The air is then cryogenically cooled so that moisture and sub-micron sized particles in the air condense into ice on the coil. The coil is then heated so that the ice melts, and the liquid is then drawn off and passed through a Buchner funnel where the liquid is passed through a Nuclepore membrane. A vacuum draws the liquid through the Nuclepore membrane, with the Nuclepore membrane trapping sub-micron sized particles therein. The Nuclepore membrane is then covered on its top and bottom surfaces with sheets of Mylar.RTM. and the assembly is then crushed into a pellet. This effectively traps the sub-micron sized particles for later analysis.

  5. Soil Separator and Sampler and Method of Sampling - Energy Innovation

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Portal Soil Separator and Sampler and Method of Sampling Fluidized Bed system Idaho National Laboratory Contact INL About This Technology Technology Marketing Summary INL has developed a method for sampling soil to determine the presence of extremely fine particles such as asbestos. Description The apparatus uses a fluidized bed for receiving a soil sample, which is connected to a vacuum for drawing air through the bed and suspends particulate matter of the soil sample in the air, and draws

  6. Photoacoustic sample vessel and method of elevated pressure operation

    DOE Patents [OSTI]

    Autrey, Tom; Yonker, Clement R.


    An improved photoacoustic vessel and method of photoacoustic analysis. The photoacoustic sample vessel comprises an acoustic detector, an acoustic couplant, and an acoustic coupler having a chamber for holding the acoustic couplant and a sample. The acoustic couplant is selected from the group consisting of liquid, solid, and combinations thereof. Passing electromagnetic energy through the sample generates an acoustic signal within the sample, whereby the acoustic signal propagates through the sample to and through the acoustic couplant to the acoustic detector.

  7. DOE methods for evaluating environmental and waste management samples.

    SciTech Connect (OSTI)

    Goheen, S C; McCulloch, M; Thomas, B L; Riley, R G; Sklarew, D S; Mong, G M; Fadeff, S K


    DOE Methods for Evaluating Environmental and Waste Management Samples (DOE Methods) provides applicable methods in use by. the US Department of Energy (DOE) laboratories for sampling and analyzing constituents of waste and environmental samples. The development of DOE Methods is supported by the Laboratory Management Division (LMD) of the DOE. This document contains chapters and methods that are proposed for use in evaluating components of DOE environmental and waste management samples. DOE Methods is a resource intended to support sampling and analytical activities that will aid in defining the type and breadth of contamination and thus determine the extent of environmental restoration or waste management actions needed, as defined by the DOE, the US Environmental Protection Agency (EPA), or others.

  8. Method and apparatus for imaging a sample on a device

    DOE Patents [OSTI]

    Trulson, Mark; Stern, David; Fiekowsky, Peter; Rava, Richard; Walton, Ian; Fodor, Stephen P. A.


    A method and apparatus for imaging a sample are provided. An electromagnetic radiation source generates excitation radiation which is sized by excitation optics to a line. The line is directed at a sample resting on a support and excites a plurality of regions on the sample. Collection optics collect response radiation reflected from the sample I and image the reflected radiation. A detector senses the reflected radiation and is positioned to permit discrimination between radiation reflected from a certain focal plane in the sample and certain other planes within the sample.

  9. Engineering Study of 500 ML Sample Bottle Transportation Methods

    SciTech Connect (OSTI)

    BOGER, R.M.


    This engineering study reviews and evaluates all available methods for transportation of 500-mL grab sample bottles, reviews and evaluates transportation requirements and schedules and analyzes and recommends the most cost-effective method for transporting 500-mL grab sample bottles.

  10. Method for using polarization gating to measure a scattering sample

    SciTech Connect (OSTI)

    Baba, Justin S.


    Described herein are systems, devices, and methods facilitating optical characterization of scattering samples. A polarized optical beam can be directed to pass through a sample to be tested. The optical beam exiting the sample can then be analyzed to determine its degree of polarization, from which other properties of the sample can be determined. In some cases, an apparatus can include a source of an optical beam, an input polarizer, a sample, an output polarizer, and a photodetector. In some cases, a signal from a photodetector can be processed through attenuation, variable offset, and variable gain.

  11. Method and sample spinning apparatus for measuring the NMR spectrum of an orientationally disordered sample

    DOE Patents [OSTI]

    Pines, Alexander; Samoson, Ago


    An improved NMR apparatus and method are described which substantially improve the resolution of NMR measurements made on powdered or amorphous or otherwise orientationally disordered samples. The apparatus spins the sample about an axis. The angle of the axis is mechanically varied such that the time average of two or more Legendre polynomials are zero.

  12. DOE methods for evaluating environmental and waste management samples

    SciTech Connect (OSTI)

    Goheen, S.C.; McCulloch, M.; Thomas, B.L.; Riley, R.G.; Sklarew, D.S.; Mong, G.M.; Fadeff, S.K.


    DOE Methods for Evaluating Environmental and Waste Management Samples (DOE Methods) is a resource intended to support sampling and analytical activities for the evaluation of environmental and waste management samples from U.S. Department of Energy (DOE) sites. DOE Methods is the result of extensive cooperation from all DOE analytical laboratories. All of these laboratories have contributed key information and provided technical reviews as well as significant moral support leading to the success of this document. DOE Methods is designed to encompass methods for collecting representative samples and for determining the radioisotope activity and organic and inorganic composition of a sample. These determinations will aid in defining the type and breadth of contamination and thus determine the extent of environmental restoration or waste management actions needed, as defined by the DOE, the U.S. Environmental Protection Agency, or others. The development of DOE Methods is supported by the Analytical Services Division of DOE. Unique methods or methods consolidated from similar procedures in the DOE Procedures Database are selected for potential inclusion in this document. Initial selection is based largely on DOE needs and procedure applicability and completeness. Methods appearing in this document are one of two types, {open_quotes}Draft{close_quotes} or {open_quotes}Verified{close_quotes}. {open_quotes}Draft{close_quotes} methods that have been reviewed internally and show potential for eventual verification are included in this document, but they have not been reviewed externally, and their precision and bias may not be known. {open_quotes}Verified{close_quotes} methods in DOE Methods have been reviewed by volunteers from various DOE sites and private corporations. These methods have delineated measures of precision and accuracy.

  13. System and method for measuring fluorescence of a sample

    DOE Patents [OSTI]

    Riot, Vincent J


    The present disclosure provides a system and a method for measuring fluorescence of a sample. The sample may be a polymerase-chain-reaction (PCR) array, a loop-mediated-isothermal amplification array, etc. LEDs are used to excite the sample, and a photodiode is used to collect the sample's fluorescence. An electronic offset signal is used to reduce the effects of background fluorescence and the noises from the measurement system. An integrator integrates the difference between the output of the photodiode and the electronic offset signal over a given period of time. The resulting integral is then converted into digital domain for further processing and storage.

  14. Method and apparatus for imaging a sample on a device

    DOE Patents [OSTI]

    Trulson, Mark; Stern, David; Fiekowsky, Peter; Rava, Richard; Walton, Ian; Fodor, Stephen P. A.


    The present invention provides methods and systems for detecting a labeled marker on a sample located on a support. The imaging system comprises a body for immobilizing the support, an excitation radiation source and excitation optics to generate and direct the excitation radiation at the sample. In response, labeled material on the sample emits radiation which has a wavelength that is different from the excitation wavelength, which radiation is collected by collection optics and imaged onto a detector which generates an image of the sample.

  15. Soil separator and sampler and method of sampling

    DOE Patents [OSTI]

    O'Brien, Barry H. [Idaho Falls, ID; Ritter, Paul D. [Idaho Falls, ID


    A soil sampler includes a fluidized bed for receiving a soil sample. The fluidized bed may be in communication with a vacuum for drawing air through the fluidized bed and suspending particulate matter of the soil sample in the air. In a method of sampling, the air may be drawn across a filter, separating the particulate matter. Optionally, a baffle or a cyclone may be included within the fluidized bed for disentrainment, or dedusting, so only the finest particulate matter, including asbestos, will be trapped on the filter. The filter may be removable, and may be tested to determine the content of asbestos and other hazardous particulate matter in the soil sample.

  16. Beryllium Wipe Sampling (differing methods - differing exposure potentials)

    SciTech Connect (OSTI)

    Kerr, Kent


    This research compared three wipe sampling techniques currently used to test for beryllium contamination on room and equipment surfaces in Department of Energy facilities. Efficiencies of removal of beryllium contamination from typical painted surfaces were tested by wipe sampling without a wetting agent, with water-moistened wipe materials, and by methanol-moistened wipes. Analysis indicated that methanol-moistened wipe sampling removed about twice as much beryllium/oil-film surface contamination as water-moistened wipes, which removed about twice as much residue as dry wipes. Criteria at 10 CFR 850.30 and .31 were established on unspecified wipe sampling method(s). The results of this study reveal a need to identify criteria-setting method and equivalency factors. As facilities change wipe sampling methods among the three compared in this study, these results may be useful for approximate correlations. Accurate decontamination decision-making depends on the selection of appropriate wetting agents for the types of residues and surfaces. Evidence for beryllium sensitization via skin exposure argues in favor of wipe sampling with wetting agents that provide enhanced removal efficiency such as methanol when surface contamination includes oil mist residue.

  17. Examination of Hydrate Formation Methods: Trying to Create Representative Samples

    SciTech Connect (OSTI)

    Kneafsey, T.J.; Rees, E.V.L.; Nakagawa, S.; Kwon, T.-H.


    Forming representative gas hydrate-bearing laboratory samples is important so that the properties of these materials may be measured, while controlling the composition and other variables. Natural samples are rare, and have often experienced pressure and temperature changes that may affect the property to be measured [Waite et al., 2008]. Forming methane hydrate samples in the laboratory has been done a number of ways, each having advantages and disadvantages. The ice-to-hydrate method [Stern et al., 1996], contacts melting ice with methane at the appropriate pressure to form hydrate. The hydrate can then be crushed and mixed with mineral grains under controlled conditions, and then compacted to create laboratory samples of methane hydrate in a mineral medium. The hydrate in these samples will be part of the load-bearing frame of the medium. In the excess gas method [Handa and Stupin, 1992], water is distributed throughout a mineral medium (e.g. packed moist sand, drained sand, moistened silica gel, other porous media) and the mixture is brought to hydrate-stable conditions (chilled and pressurized with gas), allowing hydrate to form. This method typically produces grain-cementing hydrate from pendular water in sand [Waite et al., 2004]. In the dissolved gas method [Tohidi et al., 2002], water with sufficient dissolved guest molecules is brought to hydrate-stable conditions where hydrate forms. In the laboratory, this is can be done by pre-dissolving the gas of interest in water and then introducing it to the sample under the appropriate conditions. With this method, it is easier to form hydrate from more soluble gases such as carbon dioxide. It is thought that this method more closely simulates the way most natural gas hydrate has formed. Laboratory implementation, however, is difficult, and sample formation is prohibitively time consuming [Minagawa et al., 2005; Spangenberg and Kulenkampff, 2005]. In another version of this technique, a specified quantity of gas

  18. Fluidics platform and method for sample preparation and analysis

    DOE Patents [OSTI]

    Benner, W. Henry; Dzenitis, John M.; Bennet, William J.; Baker, Brian R.


    Herein provided are fluidics platform and method for sample preparation and analysis. The fluidics platform is capable of analyzing DNA from blood samples using amplification assays such as polymerase-chain-reaction assays and loop-mediated-isothermal-amplification assays. The fluidics platform can also be used for other types of assays and analyzes. In some embodiments, a sample in a sealed tube can be inserted directly. The following isolation, detection, and analyzes can be performed without a user's intervention. The disclosed platform may also comprises a sample preparation system with a magnetic actuator, a heater, and an air-drying mechanism, and fluid manipulation processes for extraction, washing, elution, assay assembly, assay detection, and cleaning after reactions and between samples.

  19. Self-contained cryogenic gas sampling apparatus and method

    DOE Patents [OSTI]

    McManus, Gary J.; Motes, Billy G.; Bird, Susan K.; Kotter, Dale K.


    Apparatus for obtaining a whole gas sample, composed of: a sample vessel having an inlet for receiving a gas sample; a controllable valve mounted for controllably opening and closing the inlet; a valve control coupled to the valve for opening and closing the valve at selected times; a portable power source connected for supplying operating power to the valve control; and a cryogenic coolant in thermal communication with the vessel for cooling the interior of the vessel to cryogenic temperatures. A method of obtaining an air sample using the apparatus described above, by: placing the apparatus at a location at which the sample is to be obtained; operating the valve control to open the valve at a selected time and close the valve at a selected subsequent time; and between the selected times maintaining the vessel at a cryogenic temperature by heat exchange with the coolant.

  20. Self-contained cryogenic gas sampling apparatus and method

    DOE Patents [OSTI]

    McManus, G.J.; Motes, B.G.; Bird, S.K.; Kotter, D.K.


    Apparatus for obtaining a whole gas sample, is composed of: a sample vessel having an inlet for receiving a gas sample; a controllable valve mounted for controllably opening and closing the inlet; a valve control coupled to the valve for opening and closing the valve at selected times; a portable power source connected for supplying operating power to the valve control; and a cryogenic coolant in thermal communication with the vessel for cooling the interior of the vessel to cryogenic temperatures. A method is described for obtaining an air sample using the apparatus described above, by: placing the apparatus at a location at which the sample is to be obtained; operating the valve control to open the valve at a selected time and close the valve at a selected subsequent time; and between the selected times maintaining the vessel at a cryogenic temperature by heat exchange with the coolant. 3 figs.

  1. Method and apparatus for sampling low-yield wells

    DOE Patents [OSTI]

    Last, George V.; Lanigan, David C.


    An apparatus and method for collecting a sample from a low-yield well or perched aquifer includes a pump and a controller responsive to water level sensors for filling a sample reservoir. The controller activates the pump to fill the reservoir when the water level in the well reaches a high level as indicated by the sensor. The controller deactivates the pump when the water level reaches a lower level as indicated by the sensors. The pump continuously activates and deactivates the pump until the sample reservoir is filled with a desired volume, as indicated by a reservoir sensor. At the beginning of each activation cycle, the controller optionally can select to purge an initial quantity of water prior to filling the sample reservoir. The reservoir can be substantially devoid of air and the pump is a low volumetric flow rate pump. Both the pump and the reservoir can be located either inside or outside the well.

  2. A flexible importance sampling method for integrating subgrid processes


    Raut, E. K.; Larson, V. E.


    Numerical models of weather and climate need to compute grid-box-averaged rates of physical processes such as microphysics. These averages are computed by integrating subgrid variability over a grid box. For this reason, an important aspect of atmospheric modeling is spatial integration over subgrid scales. The needed integrals can be estimated by Monte Carlo integration. Monte Carlo integration is simple and general but requires many evaluations of the physical process rate. To reduce the number of function evaluations, this paper describes a new, flexible method of importance sampling. It divides the domain of integration into eight categories, such as the portion that containsmore » both precipitation and cloud, or the portion that contains precipitation but no cloud. It then allows the modeler to prescribe the density of sample points within each of the eight categories. The new method is incorporated into the Subgrid Importance Latin Hypercube Sampler (SILHS). The resulting method is tested on drizzling cumulus and stratocumulus cases. In the cumulus case, the sampling error can be considerably reduced by drawing more sample points from the region of rain evaporation.« less

  3. A flexible importance sampling method for integrating subgrid processes


    Raut, E. K.; Larson, V. E.


    Numerical models of weather and climate need to compute grid-box-averaged rates of physical processes such as microphysics. These averages are computed by integrating subgrid variability over a grid box. For this reason, an important aspect of atmospheric modeling is integration. The needed integrals can be estimated by Monte Carlo integration. Monte Carlo integration is simple and general but requires many evaluations of the physical process rate. To reduce the number of function evaluations, this paper describes a new, flexible method of importance sampling. It divides the domain of integration into eight categories, such as the portion that contains bothmoreprecipitation and cloud, or the portion that contains precipitation but no cloud. It then allows the modeler to prescribe the density of sample points within each of the eight categories. The new method is incorporated into the Subgrid Importance Latin Hypercube Sampler (SILHS). The resulting method is tested on drizzling cumulus and stratocumulus cases. In the cumulus case, the sampling error can be considerably reduced by drawing more sample points from the region of rain evaporation.less

  4. Performance evaluation of a gasoline vapor sampling method

    SciTech Connect (OSTI)

    Russo, P.J.; Florky, G.R.; Agopsowicz, D.E.


    A study has been conducted to evaluate the performance of the method used by Exxon to monitor worker exposures to gasoline vapors. The study specifically addresses the effects of temperature and humidity on breakthrough volume as an indicator of performance limits. Results indicate that a 600 mg charcoal tube will yield excellent results if sample flow rate is adjusted properly with regard to absolute humidity. In order to aid the field hygienist in applying the study results, charts that relate sampling parameters to environmental conditions are presented.


    SciTech Connect (OSTI)

    Maxwell, S.; Culligan, B.; Noyes, G.


    A new rapid method for the determination of actinides in soil and sediment samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used for samples up to 2 grams in emergency response situations. The actinides in soil method utilizes a rapid sodium hydroxide fusion method, a lanthanum fluoride soil matrix removal step, and a streamlined column separation process with stacked TEVA, TRU and DGA Resin cartridges. Lanthanum was separated rapidly and effectively from Am and Cm on DGA Resin. Vacuum box technology and rapid flow rates are used to reduce analytical time. Alpha sources are prepared using cerium fluoride microprecipitation for counting by alpha spectrometry. The method showed high chemical recoveries and effective removal of interferences. This new procedure was applied to emergency soil samples received in the NRIP Emergency Response exercise administered by the National Institute for Standards and Technology (NIST) in April, 2009. The actinides in soil results were reported within 4-5 hours with excellent quality.


    SciTech Connect (OSTI)

    Maxwell, S.; Noyes, G.; Culligan, B.


    A new rapid method for the determination of actinides and strontium in air filter samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used in emergency response situations. The actinides and strontium in air filter method utilizes a rapid acid digestion method and a streamlined column separation process with stacked TEVA, TRU and Sr Resin cartridges. Vacuum box technology and rapid flow rates are used to reduce analytical time. Alpha emitters are prepared using cerium fluoride microprecipitation for counting by alpha spectrometry. The purified {sup 90}Sr fractions are mounted directly on planchets and counted by gas flow proportional counting. The method showed high chemical recoveries and effective removal of interferences. This new procedure was applied to emergency air filter samples received in the NRIP Emergency Response exercise administered by the National Institute for Standards and Technology (NIST) in April, 2009. The actinide and {sup 90}Sr in air filter results were reported in {approx}4 hours with excellent quality.

  7. Hand held sample tube manipulator, system and method

    DOE Patents [OSTI]

    Kenny, Donald V. [Liberty Township, OH; Smith, Deborah L. [Liberty Township, OH; Severance, Richard A. [late of Columbus, OH


    A manipulator apparatus, system and method for measuring analytes present in sample tubes. The manipulator apparatus includes a housing having a central bore with an inlet end and outlet end; a plunger mechanism with at least a portion thereof slideably disposed for reciprocal movement within the central bore, the plunger mechanism having a tubular gas channel with an inlet end and an outlet end, the gas channel inlet end disposed in the same direction as said inlet end of the central bore, wherein the inlet end of said plunger mechanism is adapted for movement so as to expel a sample tube inserted in the bore at the outlet end of the housing, the inlet end of the plunger mechanism is adapted for connection to gas supply; a first seal is disposed in the housing for sealing between the central bore and the plunger mechanism; a second seal is disposed at the outlet end of the housing for sealing between the central bore and a sample tube; a holder mounted on the housing for holding the sample tube; and a biasing mechanism for returning the plunger mechanism to a starting position.

  8. A Novel Method for Sampling Alpha-Helical Protein Backbones

    DOE R&D Accomplishments [OSTI]

    Fain, Boris; Levitt, Michael


    We present a novel technique of sampling the configurations of helical proteins. Assuming knowledge of native secondary structure, we employ assembly rules gathered from a database of existing structures to enumerate the geometrically possible 3-D arrangements of the constituent helices. We produce a library of possible folds for 25 helical protein cores. In each case the method finds significant numbers of conformations close to the native structure. In addition we assign coordinates to all atoms for 4 of the 25 proteins. In the context of database driven exhaustive enumeration our method performs extremely well, yielding significant percentages of structures (0.02%--82%) within 6A of the native structure. The method's speed and efficiency make it a valuable contribution towards the goal of predicting protein structure.

  9. Well fluid isolation and sample apparatus and method

    DOE Patents [OSTI]

    Schalla, Ronald; Smith, Ronald M.; Hall, Stephen H.; Smart, John E.


    The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. A seal may be positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Purged well fluid is stored in a riser above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion.

  10. Drum plug piercing and sampling device and method

    DOE Patents [OSTI]

    Counts, Kevin T.


    An apparatus and method for piercing a drum plug of a drum in order to sample and/or vent gases that may accumulate in a space of the drum is provided. The drum is not damaged and can be reused since the pierced drum plug can be subsequently replaced. The apparatus includes a frame that is configured for engagement with the drum. A cylinder actuated by a fluid is mounted to the frame. A piercer is placed into communication with the cylinder so that actuation of the cylinder causes the piercer to move in a linear direction so that the piercer may puncture the drum plug of the drum.

  11. Method for testing earth samples for contamination by organic contaminants

    DOE Patents [OSTI]

    Schabron, John F.


    Provided is a method for testing earth samples for contamination by organic contaminants, and particularly for aromatic compounds such as those found in diesel fuel and other heavy fuel oils, kerosene, creosote, coal oil, tars and asphalts. A drying step is provided in which a drying agent is contacted with either the earth sample or a liquid extract phase to reduce to possibility of false indications of contamination that could occur when humic material is present in the earth sample. This is particularly a problem when using relatively safe, non-toxic and inexpensive polar solvents such as isopropyl alcohol since the humic material tends to be very soluble in those solvents when water is present. Also provided is an ultraviolet spectroscopic measuring technique for obtaining an indication as to whether a liquid extract phase contains aromatic organic contaminants. In one embodiment, the liquid extract phase is subjected to a narrow and discrete band of radiation including a desired wave length and the ability of the liquid extract phase to absorb that wavelength of ultraviolet radiation is measured to provide an indication of the presence of aromatic organic contaminants.

  12. Method for testing earth samples for contamination by organic contaminants

    DOE Patents [OSTI]

    Schabron, J.F.


    Provided is a method for testing earth samples for contamination by organic contaminants, and particularly for aromatic compounds such as those found in diesel fuel and other heavy fuel oils, kerosene, creosote, coal oil, tars and asphalts. A drying step is provided in which a drying agent is contacted with either the earth sample or a liquid extract phase to reduce to possibility of false indications of contamination that could occur when humic material is present in the earth sample. This is particularly a problem when using relatively safe, non-toxic and inexpensive polar solvents such as isopropyl alcohol since the humic material tends to be very soluble in those solvents when water is present. Also provided is an ultraviolet spectroscopic measuring technique for obtaining an indication as to whether a liquid extract phase contains aromatic organic contaminants. In one embodiment, the liquid extract phase is subjected to a narrow and discrete band of radiation including a desired wave length and the ability of the liquid extract phase to absorb that wavelength of ultraviolet radiation is measured to provide an indication of the presence of aromatic organic contaminants. 2 figs.

  13. A comparison of methods for representing sparsely sampled random quantities.

    SciTech Connect (OSTI)

    Romero, Vicente Jose; Swiler, Laura Painton; Urbina, Angel; Mullins, Joshua


    This report discusses the treatment of uncertainties stemming from relatively few samples of random quantities. The importance of this topic extends beyond experimental data uncertainty to situations involving uncertainty in model calibration, validation, and prediction. With very sparse data samples it is not practical to have a goal of accurately estimating the underlying probability density function (PDF). Rather, a pragmatic goal is that the uncertainty representation should be conservative so as to bound a specified percentile range of the actual PDF, say the range between 0.025 and .975 percentiles, with reasonable reliability. A second, opposing objective is that the representation not be overly conservative; that it minimally over-estimate the desired percentile range of the actual PDF. The presence of the two opposing objectives makes the sparse-data uncertainty representation problem interesting and difficult. In this report, five uncertainty representation techniques are characterized for their performance on twenty-one test problems (over thousands of trials for each problem) according to these two opposing objectives and other performance measures. Two of the methods, statistical Tolerance Intervals and a kernel density approach specifically developed for handling sparse data, exhibit significantly better overall performance than the others.


    SciTech Connect (OSTI)



    The Markov Chain Monte Carlo technique provides a means for drawing random samples from a target probability density function (pdf). MCMC allows one to assess the uncertainties in a Bayesian analysis described by a numerically calculated posterior distribution. This paper describes the Hamiltonian MCMC technique in which a momentum variable is introduced for each parameter of the target pdf. In analogy to a physical system, a Hamiltonian H is defined as a kinetic energy involving the momenta plus a potential energy {var_phi}, where {var_phi} is minus the logarithm of the target pdf. Hamiltonian dynamics allows one to move along trajectories of constant H, taking large jumps in the parameter space with relatively few evaluations of {var_phi} and its gradient. The Hamiltonian algorithm alternates between picking a new momentum vector and following such trajectories. The efficiency of the Hamiltonian method for multidimensional isotropic Gaussian pdfs is shown to remain constant at around 7% for up to several hundred dimensions. The Hamiltonian method handles correlations among the variables much better than the standard Metropolis algorithm. A new test, based on the gradient of {var_phi}, is proposed to measure the convergence of the MCMC sequence.

  15. Photoacoustic spectroscopy sample array vessels and photoacoustic spectroscopy methods for using the same

    DOE Patents [OSTI]

    Amonette, James E.; Autrey, S. Thomas; Foster-Mills, Nancy S.


    Methods and apparatus for simultaneous or sequential, rapid analysis of multiple samples by photoacoustic spectroscopy are disclosed. Particularly, a photoacoustic spectroscopy sample array vessel including a vessel body having multiple sample cells connected thereto is disclosed. At least one acoustic detector is acoustically positioned near the sample cells. Methods for analyzing the multiple samples in the sample array vessels using photoacoustic spectroscopy are provided.

  16. Photoacoustic spectroscopy sample array vessel and photoacoustic spectroscopy method for using the same

    DOE Patents [OSTI]

    Amonette, James E.; Autrey, S. Thomas; Foster-Mills, Nancy S.; Green, David


    Methods and apparatus for analysis of multiple samples by photoacoustic spectroscopy are disclosed. Particularly, a photoacoustic spectroscopy sample array vessel including a vessel body having multiple sample cells connected thereto is disclosed. At least one acoustic detector is acoustically coupled with the vessel body. Methods for analyzing the multiple samples in the sample array vessels using photoacoustic spectroscopy are provided.

  17. Analytical instrument with apparatus and method for sample concentrating

    DOE Patents [OSTI]

    Zaromb, S.


    A system for analysis of trace concentrations of contaminants in air includes a portable liquid chromatograph and a preconcentrator for the contaminants to be analyzed. The preconcentrator includes a sample bag having an inlet valve and an outlet valve for collecting an air sample. When the sample is collected the sample bag is connected in series with a sorbing apparatus in a recirculation loop. The sorbing apparatus has an inner gas-permeable container containing a sorbent material and an outer gas-impermeable container. The sample is circulated through the outer container and around the inner container for trapping and preconcentrating the contaminants in the sorbent material. The sorbent material may be a liquid having the same composition as the mobile phase of the chromatograph for direct injection thereinto. Alternatively, the sorbent material may be a porous, solid body, to which mobile phase liquid is added after preconcentration of the contaminants for dissolving the contaminants, the liquid solution then being withdrawn for injection into the chromatograph.

  18. Method for preconcentrating a sample for subsequent analysis

    DOE Patents [OSTI]

    Zaromb, Solomon (Hinsdale, IL)


    A system for analysis of trace concentration of contaminants in air includes a portable liquid chromatograph and a preconcentrator for the contaminants to be analyzed. The preconcentrator includes a sample bag having an inlet valve and an outlet valve for collecting an air sample. When the sample is collected the sample bag is connected in series with a sorbing apparatus in a recirculation loop. The sorbing apparatus has an inner gas-permeable container containing a sorbent material and an outer gas-impermeable container. The sample is circulated through the outer container and around the inner container for trapping and preconcentrating the contaminants in the sorbent material. The sorbent material may be a liquid having the same composition as the mobile phase of the chromatograph for direct injection thereinto. Alternatively, the sorbent material may be a porous, solid body, to which mobile phase liquid is added after preconcentration of the contaminants for dissolving the contaminants, the liquid solution then being withdrawn for injection into the chromatograph.

  19. Statistical Methods and Tools for Hanford Staged Feed Tank Sampling

    SciTech Connect (OSTI)

    Fountain, Matthew S.; Brigantic, Robert T.; Peterson, Reid A.


    This report summarizes work conducted by Pacific Northwest National Laboratory to technically evaluate the current approach to staged feed sampling of high-level waste (HLW) sludge to meet waste acceptance criteria (WAC) for transfer from tank farms to the Hanford Waste Treatment and Immobilization Plant (WTP). The current sampling and analysis approach is detailed in the document titled Initial Data Quality Objectives for WTP Feed Acceptance Criteria, 24590-WTP-RPT-MGT-11-014, Revision 0 (Arakali et al. 2011). The goal of this current work is to evaluate and provide recommendations to support a defensible, technical and statistical basis for the staged feed sampling approach that meets WAC data quality objectives (DQOs).

  20. [DOE method for evaluating environmental and waste management samples: Revision 1, Addendum 1

    SciTech Connect (OSTI)

    Goheen, S.C.


    The US Dapartment of Energy`s (DOE`s) environmental and waste management (EM) sampling and analysis activities require that large numbers of samples be analyzed for materials characterization, environmental surveillance, and site-remediation programs. The present document, DOE Methods for Evaluating Environmental and Waste Management Samples (DOE Methods), is a supplemental resource for analyzing many of these samples.

  1. High-throughput liquid-absorption preconcentrator sampling methods

    DOE Patents [OSTI]

    Zaromb, Solomon (95706 William Dr., Hinsdale, IL 60521)


    A system for detecting trace concentrations of an analyte in air includes a preconcentrator for the analyte and an analyte detector. The preconcentrator includes an elongated tubular container comprising a wettable material. The wettable material is continuously wetted with an analyte-sorbing liquid which flows from one part of the container to a lower end. Sampled air flows through the container in contact with the wetted material with a swirling motion which results in efficient transfer of analyte vapors or aerosol particles to the sorbing liquid and preconcentration of traces of analyte in the liquid. The preconcentrated traces of analyte may be either detected within the container or removed therefrom for injection into a separate detection means or for subsequent analysis.

  2. High-throughput liquid-absorption preconcentrator sampling methods

    DOE Patents [OSTI]

    Zaromb, S.


    A system for detecting trace concentrations of an analyte in air includes a preconcentrator for the analyte and an analyte detector. The preconcentrator includes an elongated tubular container comprising a wettable material. The wettable material is continuously wetted with an analyte-sorbing liquid which flows from one part of the container to a lower end. Sampled air flows through the container in contact with the wetted material with a swirling motion which results in efficient transfer of analyte vapors or aerosol particles to the sorbing liquid and preconcentration of traces of analyte in the liquid. The preconcentrated traces of analyte may be either detected within the container or removed therefrom for injection into a separate detection means or for subsequent analysis. 12 figs.

  3. Method and apparatus for processing a test sample to concentrate an analyte in the sample from a solvent in the sample

    DOE Patents [OSTI]

    Turner, T.D.; Beller, L.S.; Clark, M.L.; Klingler, K.M.


    A method of processing a test sample to concentrate an analyte in the sample from a solvent in the sample includes: (a) boiling the test sample containing the analyte and solvent in a boiling chamber to a temperature greater than or equal to the solvent boiling temperature and less than the analyte boiling temperature to form a rising sample vapor mixture; (b) passing the sample vapor mixture from the boiling chamber to an elongated primary separation tube, the separation tube having internal sidewalls and a longitudinal axis, the longitudinal axis being angled between vertical and horizontal and thus having an upper region and a lower region; (c) collecting the physically transported liquid analyte on the internal sidewalls of the separation tube; and (d) flowing the collected analyte along the angled internal sidewalls of the separation tube to and pass the separation tube lower region. The invention also includes passing a turbulence inducing wave through a vapor mixture to separate physically transported liquid second material from vaporized first material. Apparatus is also disclosed for effecting separations. Further disclosed is a fluidically powered liquid test sample withdrawal apparatus for withdrawing a liquid test sample from a test sample container and for cleaning the test sample container. 8 figs.

  4. Method and apparatus for processing a test sample to concentrate an analyte in the sample from a solvent in the sample

    DOE Patents [OSTI]

    Turner, Terry D.; Beller, Laurence S.; Clark, Michael L.; Klingler, Kerry M.


    A method of processing a test sample to concentrate an analyte in the sample from a solvent in the sample includes: a) boiling the test sample containing the analyte and solvent in a boiling chamber to a temperature greater than or equal to the solvent boiling temperature and less than the analyte boiling temperature to form a rising sample vapor mixture; b) passing the sample vapor mixture from the boiling chamber to an elongated primary separation tube, the separation tube having internal sidewalls and a longitudinal axis, the longitudinal axis being angled between vertical and horizontal and thus having an upper region and a lower region; c) collecting the physically transported liquid analyte on the internal sidewalls of the separation tube; and d) flowing the collected analyte along the angled internal sidewalls of the separation tube to and pass the separation tube lower region. The invention also includes passing a turbulence inducing wave through a vapor mixture to separate physically transported liquid second material from vaporized first material. Apparatus are also disclosed for effecting separations. Further disclosed is a fluidically powered liquid test sample withdrawal apparatus for withdrawing a liquid test sample from a test sample container and for cleaning the test sample container.

  5. Method for sequential injection of liquid samples for radioisotope separations

    DOE Patents [OSTI]

    Egorov, Oleg B.; Grate, Jay W.; Bray, Lane A.


    The present invention is a method of separating a short-lived daughter isotope from a longer lived parent isotope, with recovery of the parent isotope for further use. Using a system with a bi-directional pump and one or more valves, a solution of the parent isotope is processed to generate two separate solutions, one of which contains the daughter isotope, from which the parent has been removed with a high decontamination factor, and the other solution contains the recovered parent isotope. The process can be repeated on this solution of the parent isotope. The system with the fluid drive and one or more valves is controlled by a program on a microprocessor executing a series of steps to accomplish the operation. In one approach, the cow solution is passed through a separation medium that selectively retains the desired daughter isotope, while the parent isotope and the matrix pass through the medium. After washing this medium, the daughter is released from the separation medium using another solution. With the automated generator of the present invention, all solution handling steps necessary to perform a daughter/parent radionuclide separation, e.g. Bi-213 from Ac-225 "cow" solution, are performed in a consistent, enclosed, and remotely operated format. Operator exposure and spread of contamination are greatly minimized compared to the manual generator procedure described in U.S. patent application Ser. No. 08/789,973, now U.S. Pat. No. 5,749,042, herein incorporated by reference. Using 16 mCi of Ac-225 there was no detectable external contamination of the instrument components.

  6. Installation of a Low Flow Unit at the Abiquiu Hydroelectric Facility

    SciTech Connect (OSTI)

    Jack Q. Richardson


    Final Technical Report for the Recovery Act Project for the Installation of a Low Flow Unit at the Abiquiu Hydroelectric Facility. The Abiquiu hydroelectric facility existed with two each 6.9 MW vertical flow Francis turbine-generators. This project installed a new 3.1 MW horizontal flow low flow turbine-generator. The total plant flow range to capture energy and generate power increased from between 250 and 1,300 cfs to between 75 and 1,550 cfs. Fifty full time equivalent (FTE) construction jobs were created for this project - 50% (or 25 FTE) were credited to ARRA funding due to the ARRA 50% project cost match. The Abiquiu facility has increased capacity, increased efficiency and provides for an improved aquatic environment owing to installed dissolved oxygen capabilities during traditional low flow periods in the Rio Chama. A new powerhouse addition was constructed to house the new turbine-generator equipment.

  7. Methods for point-of-care detection of nucleic acid in a sample...

    Office of Scientific and Technical Information (OSTI)

    Provided herein are methods and apparatus for detecting a target nucleic acid in a sample ... Sponsoring Org: USDOE Country of Publication: United States Language: English Subject: 59 ...

  8. ASTM sampling methods and analytical validation for lead in paint, dust, soil, and air

    SciTech Connect (OSTI)

    Ashley, K.; Schlecht, P.C.; Song, R.; Feng, A.; DeWalt, G.; McKnight, M.E.


    ASTM Subcommittee E06.23 on Abatement/Mitigation of Lead Hazards has developed a number of standards that are concerned with the sampling of leas in environmental media, namely paint, dust, soil and airborne particulate. An ASTM practice for the collection of airborne particulate lead in the workplace has been published. New ASTM standards for the collection of dry paint film samples, surface soil samples, and surface dust wipe samples for subsequent lead analysis have also been promulgated. Other draft standards pertinent to lead sampling are under development. The ASTM standards concerned with lead sample collection are accompanied by separate sample preparation standard practices and a standard analysis method. Sample preparation and analytical methods have been evaluated by interlaboratory testing; such analyses may be used to assess the efficacy of sampling protocols.

  9. Rapid method for the determination of 226Ra in hydraulic fracturing wastewater samples


    Maxwell, Sherrod L.; Culligan, Brian K.; Warren, Richard A.; McAlister, Daniel R.


    A new method that rapidly preconcentrates and measures 226Ra from hydraulic fracturing wastewater samples was developed in the Savannah River Environmental Laboratory. The method improves the quality of 226Ra measurements using gamma spectrometry by providing up to 100x preconcentration of 226Ra from this difficult sample matrix, which contains very high levels of calcium, barium, strontium, magnesium and sodium. The high chemical yield, typically 80-90%, facilitates a low detection limit, important for lower level samples, and indicates method ruggedness. Ba-133 tracer is used to determine chemical yield and correct for geometry-related counting issues. The 226Ra sample preparation takes < 2 hours.

  10. Optical method and system for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.


    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  11. Optical method for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.


    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  12. Optical method for the characterization of laterally patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.


    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  13. Optical method and system for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.


    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  14. Optical method for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.


    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  15. Quantitative method of determining beryllium or a compound thereof in a sample

    DOE Patents [OSTI]

    McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.


    A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.

  16. Quantitative method of determining beryllium or a compound thereof in a sample

    DOE Patents [OSTI]

    McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.


    A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.

  17. Universal nucleic acids sample preparation method for cells, spores and their mixture

    DOE Patents [OSTI]

    Bavykin, Sergei


    The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.


    SciTech Connect (OSTI)

    Maxwell, S.


    A new rapid fusion method for the determination of plutonium in large rice samples has been developed at the Savannah River National Laboratory (Aiken, SC, USA) that can be used to determine very low levels of plutonium isotopes in rice. The recent accident at Fukushima Nuclear Power Plant in March, 2011 reinforces the need to have rapid, reliable radiochemical analyses for radionuclides in environmental and food samples. Public concern regarding foods, particularly foods such as rice in Japan, highlights the need for analytical techniques that will allow very large sample aliquots of rice to be used for analysis so that very low levels of plutonium isotopes may be detected. The new method to determine plutonium isotopes in large rice samples utilizes a furnace ashing step, a rapid sodium hydroxide fusion method, a lanthanum fluoride matrix removal step, and a column separation process with TEVA Resin� cartridges. The method can be applied to rice sample aliquots as large as 5 kg. Plutonium isotopes can be determined using alpha spectrometry or inductively-coupled plasma mass spectrometry (ICP-MS). The method showed high chemical recoveries and effective removal of interferences. The rapid fusion technique is a rugged sample digestion method that ensures that any refractory plutonium particles are effectively digested. The MDA for a 5 kg rice sample using alpha spectrometry is 7E-5 mBq g{sup -1}. The method can easily be adapted for use by ICP-MS to allow detection of plutonium isotopic ratios.

  19. Rapid method to determine actinides and 89/90Sr in limestone and marble samples


    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; Utsey, Robin C.; Sudowe, Ralf; McAlister, Daniel R.


    A new method for the determination of actinides and radiostrontium in limestone and marble samples has been developed that utilizes a rapid sodium hydroxide fusion to digest the sample. Following rapid pre-concentration steps to remove sample matrix interferences, the actinides and 89/90Sr are separated using extraction chromatographic resins and measured radiometrically. The advantages of sodium hydroxide fusion versus other fusion techniques will be discussed. Lastly, this approach has a sample preparation time for limestone and marble samples of <4 hours.


    SciTech Connect (OSTI)

    Polley, M.; Ankrom, J.; Wickland, T.; Warren, J.


    A fast, safe, and cost-effective method for obtaining headspace gas samples has been developed and implemented at Los Alamos National Laboratory (LANL). A sample port is installed directly into a drum lid using a pneumatic driver, allowing sampling with a side-port needle. Testing has shown that the sample port can be installed with no release of radioactive material. Use of this system at LANL has significantly reduced the time required for sampling, and eliminates the need for many safety precautions previously used. The system has significantly improved productivity and lowered radiation exposure and cost.

  1. Apparatus and method for maintaining multi-component sample gas constituents in vapor phase during sample extraction and cooling

    DOE Patents [OSTI]

    Felix, Larry Gordon; Farthing, William Earl; Irvin, James Hodges; Snyder, Todd Robert


    A dilution apparatus for diluting a gas sample. The apparatus includes a sample gas conduit having a sample gas inlet end and a diluted sample gas outlet end, and a sample gas flow restricting orifice disposed proximate the sample gas inlet end connected with the sample gas conduit and providing fluid communication between the exterior and the interior of the sample gas conduit. A diluted sample gas conduit is provided within the sample gas conduit having a mixing end with a mixing space inlet opening disposed proximate the sample gas inlet end, thereby forming an annular space between the sample gas conduit and the diluted sample gas conduit. The mixing end of the diluted sample gas conduit is disposed at a distance from the sample gas flow restricting orifice. A dilution gas source connected with the sample gas inlet end of the sample gas conduit is provided for introducing a dilution gas into the annular space, and a filter is provided for filtering the sample gas. The apparatus is particularly suited for diluting heated sample gases containing one or more condensable components.

  2. Method and apparatus for measuring the NMR spectrum of an orientationally disordered sample

    DOE Patents [OSTI]

    Pines, Alexander; Samoson, Ago


    An improved NMR probe and method are described which substantially improve the resolution of NMR measurements made on powdered or amorphous or otherwise oreintationally disordered samples. The apparatus mechanically varies the orientation of the sample such that the time average of two or more sets of spherical harmonic functions is zero.

  3. Sample preparation method for glass welding by ultrashort laser pulses yields higher seam strength

    SciTech Connect (OSTI)

    Cvecek, K.; Miyamoto, I.; Strauss, J.; Wolf, M.; Frick, T.; Schmidt, M.


    Glass welding by ultrashort laser pulses allows joining without the need of an absorber or a preheating and postheating process. However, cracks generated during the welding process substantially impair the joining strength of the welding seams. In this paper a sample preparation method is described that prevents the formation of cracks. The measured joining strength of samples prepared by this method is substantially higher than previously reported values.

  4. Systems and methods for laser assisted sample transfer to solution for chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J.; Kertesz, Vilmos; Ovchinnikova, Olga S.


    Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.

  5. Systems and methods for laser assisted sample transfer to solution for chemical analysis

    DOE Patents [OSTI]

    Van Berkel, Gary J; Kertesz, Vilmos; Ovchinnikova, Olga S


    Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.

  6. Systems and methods for laser assisted sample transfer to solution for chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J.; Kertesz, Vilmos; Ovchinnikova, Olga S.


    Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.

  7. Method for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein

    DOE Patents [OSTI]

    Sinha, D.N.; Anthony, B.W.


    A method is described for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein. A direct correlation between the octane rating of gasoline and the frequency of corresponding acoustic resonances therein has been experimentally observed. Therefore, the octane rating of a gasoline sample can be directly determined through speed of sound measurements instead of by the cumbersome process of quantifying the knocking quality of the gasoline. Various receptacle geometries and construction materials may be employed. Moreover, it is anticipated that the measurements can be performed on flowing samples in pipes, thereby rendering the present method useful in refineries and distilleries. 3 figs.

  8. Method and apparatus for the preparation of liquid samples for determination of boron

    DOE Patents [OSTI]

    Siemer, D.D.

    A method and apparatus are described for the preparation of a liquid sample for the quantitative determination of boron by flame photometry. The sample is combined in a vessel with sulfuric acid, and an excess of methanol is added thereto. The methanol reacts with any boron present in the sample to form trimethyl borate which is volatilized by the heat of reaction between the excess methanol and sulfuric acid. The volatilized trimethyl borate is withdrawn from the vessel by either a partial vacuum or a positive pressure and is rapidly transferred to a standard flame photometer. The method is free of interference from typical boron concomitants.

  9. Method and apparatus for the preparation of liquid samples for determination of boron

    DOE Patents [OSTI]

    Siemer, Darryl D.


    A method and apparatus for the preparation of a liquid sample for the quantitative determination of boron by flame photometry. The sample is combined in a vessel with sulfuric acid, and an excess of methanol is added thereto. The methanol reacts with any boron present in the sample to form trimethyl borate which is volatilized by the heat of reaction between the excess methanol and sulfuric acid. The volatilized trimethyl borate is withdrawn from the vessel by either a partial vacuum or a positive pressure and is rapidly transferred to a standard flame photometer. The method is free of interference from typical boron concomitants.

  10. Method for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein

    DOE Patents [OSTI]

    Sinha, Dipen N.; Anthony, Brian W.


    A method for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein. A direct correlation between the octane rating of gasoline and the frequency of corresponding acoustic resonances therein has been experimentally observed. Therefore, the octane rating of a gasoline sample can be directly determined through speed of sound measurements instead of by the cumbersome process of quantifying the knocking quality of the gasoline. Various receptacle geometries and construction materials may be employed. Moreover, it is anticipated that the measurements can be performed on flowing samples in pipes, thereby rendering the present method useful in refineries and distilleries.

  11. Method for Operating a Sensor to Differentiate Between Analytes in a Sample

    DOE Patents [OSTI]

    Kunt, Tekin; Cavicchi, Richard E; Semancik, Stephen; McAvoy, Thomas J


    Disclosed is a method for operating a sensor to differentiate between first and second analytes in a sample. The method comprises the steps of determining a input profile for the sensor which will enhance the difference in the output profiles of the sensor as between the first analyte and the second analyte; determining a first analyte output profile as observed when the input profile is applied to the sensor; determining a second analyte output profile as observed when the temperature profile is applied to the sensor; introducing the sensor to the sample while applying the temperature profile to the sensor, thereby obtaining a sample output profile; and evaluating the sample output profile as against the first and second analyte output profiles to thereby determine which of the analytes is present in the sample.

  12. Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples


    Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.


    Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, withmore » total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 ºC in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.« less

  13. Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.


    Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, with total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 ºC in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.

  14. Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.


    Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, with total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 C in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.

  15. Field sampling and selecting on-site analytical methods for explosives in soil

    SciTech Connect (OSTI)

    Crockett, A.B.; Craig, H.D.; Jenkins, T.F.; Sisk, W.E.


    A large number of defense-related sites are contaminated with elevated levels of secondary explosives. Levels of contamination range from barely detectable to levels above 10% that need special handling because of the detonation potential. Characterization of explosives-contaminated sites is particularly difficult because of the very heterogeneous distribution of contamination in the environment and within samples. To improve site characterization, several options exist including collecting more samples, providing on-site analytical data to help direct the investigation, compositing samples, improving homogenization of the samples, and extracting larger samples. This publication is intended to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods for detecting and quantifying secondary explosive compounds in soils, and is not intended to include discussions of the safety issues associated with sites contaminated with explosive residues.

  16. Methods for point-of-care detection of nucleic acid in a sample

    DOE Patents [OSTI]

    Bearinger, Jane P.; Dugan, Lawrence C.


    Provided herein are methods and apparatus for detecting a target nucleic acid in a sample and related methods and apparatus for diagnosing a condition in an individual. The condition is associated with presence of nucleic acid produced by certain pathogens in the individual.


    SciTech Connect (OSTI)

    Maxwell, S.; Culligan, B.; Noyes, G.


    A new rapid method for the determination of {sup 237}Np and Pu isotopes in soil and sediment samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used for large soil samples. The new soil method utilizes an acid leaching method, iron/titanium hydroxide precipitation, a lanthanum fluoride soil matrix removal step, and a rapid column separation process with TEVA Resin. The large soil matrix is removed easily and rapidly using this two simple precipitations with high chemical recoveries and effective removal of interferences. Vacuum box technology and rapid flow rates are used to reduce analytical time.

  18. Method for producing a thin sample band in a microchannel device

    DOE Patents [OSTI]

    Griffiths, Stewart K.; Nilson, Robert H.


    The present invention improves the performance of microchannel systems for chemical and biological synthesis and analysis by providing a method and apparatus for producing a thin band of a species sample. Thin sample bands improve the resolution of microchannel separation processes, as well as many other processes requiring precise control of sample size and volume. The new method comprises a series of steps in which a species sample is manipulated by controlled transport through a junction formed at the intersection of four or more channels. A sample is first inserted into the end of one of these channels in the vicinity of the junction. Next, this sample is thinned by transport across the junction one or more times. During these thinning steps, flow enters the junction through one of the channels and exists through those remaining, providing a divergent flow field that progressively stretches and thins the band with each traverse of the junction. The thickness of the resulting sample band may be smaller than the channel width. Moreover, the thickness of the band may be varied and controlled by altering the method alone, without modification to the channel or junction geometries. The invention is applicable to both electroosmotic and electrophoretic transport, to combined electrokinetic transport, and to some special cases in which bulk fluid transport is driven by pressure gradients. It is further applicable to channels that are open, filled with a gel or filled with a porous or granular material.

  19. Rapid fusion method for the determination of Pu, Np, and Am in large soil samples


    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; McAlister, Daniel R.


    A new rapid sodium hydroxide fusion method for the preparation of 10-20 g soil samples has been developed by the Savannah River National Laboratory (SRNL). The method enables lower detection limits for plutonium, neptunium, and americium in environmental soil samples. The method also significantly reduces sample processing time and acid fume generation compared to traditional soil digestion techniques using hydrofluoric acid. Ten gram soil aliquots can be ashed and fused using the new method in 1-2 hours, completely dissolving samples, including refractory particles. Pu, Np and Am are separated using stacked 2mL cartridges of TEVA and DGA Resin and measuredmore » using alpha spectrometry. The method can be adapted for measurement by inductively-coupled plasma mass spectrometry (ICP-MS). Two 10 g soil aliquots of fused soil may be combined prior to chromatographic separations to further improve detection limits. Total sample preparation time, including chromatographic separations and alpha spectrometry source preparation, is less than 8 hours.« less

  20. Rapid fusion method for the determination of Pu, Np, and Am in large soil samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; McAlister, Daniel R.


    A new rapid sodium hydroxide fusion method for the preparation of 10-20 g soil samples has been developed by the Savannah River National Laboratory (SRNL). The method enables lower detection limits for plutonium, neptunium, and americium in environmental soil samples. The method also significantly reduces sample processing time and acid fume generation compared to traditional soil digestion techniques using hydrofluoric acid. Ten gram soil aliquots can be ashed and fused using the new method in 1-2 hours, completely dissolving samples, including refractory particles. Pu, Np and Am are separated using stacked 2mL cartridges of TEVA and DGA Resin and measured using alpha spectrometry. The method can be adapted for measurement by inductively-coupled plasma mass spectrometry (ICP-MS). Two 10 g soil aliquots of fused soil may be combined prior to chromatographic separations to further improve detection limits. Total sample preparation time, including chromatographic separations and alpha spectrometry source preparation, is less than 8 hours.

  1. Apparatus and methods for high resolution separation of sample components on microfabricated channel devices

    DOE Patents [OSTI]

    Mathies, Richard A.; Paegel, Brian; Simpson, Peter C.; Hutt, Lester


    Sample component separation apparatus and methods are described. An exemplary sample component separation apparatus includes a separation channel having a turn portion configured to reduce band-broadening caused by passage of a sample through the turn portion. To reduce band broadening caused by passage of a sample through a turn portion, the turn portion may be constructed and arranged to have a sample transport characteristic that is different from the corresponding sample transport characteristic of a substantially straight portion of the separation channel. For example, the turn portion may be configured with an effective channel width that is smaller than the effective channel widths of the substantially straight portion of the separation channel. The actual channel width of the turn portion may be smaller than the channel widths of the substantially straight portion; the effective channel width of the turn portion may be reduced by placing one or more sample transport barriers or constrictions in the turn portion of the channel. Alternatively, the sample velocity through the turn portion may be controlled so as to reduce band broadening. For example, sample transport barriers may be disposed in the turn portion so that sample components of a given band travel through the turn portion at substantially the same effective rate, whereby the band orientation remains substantially aligned along radial directions characteristic of the turn portion. Other a sample transport characteristics, such as electrical resistance or fluid flow resistance, of the turn portion may be adapted to reduce band broadening caused by passage of the sample through the turn portion.

  2. Method for the concentration and separation of actinides from biological and environmental samples

    DOE Patents [OSTI]

    Horwitz, E.P.; Dietz, M.L.


    A method and apparatus for the quantitative recover of actinide values from biological and environmental sample by passing appropriately prepared samples in a mineral acid solution through a separation column of a dialkyl(phenyl)-N,N-dialylcarbamoylmethylphosphine oxide dissolved in tri-n-butyl phosphate on an inert substrate which selectively extracts the actinide values. The actinide values can be eluted either as a group or individually and their presence quantitatively detected by alpha counting. 3 figs.

  3. Method for the concentration and separation of actinides from biological and environmental samples

    DOE Patents [OSTI]

    Horwitz, E. Philip; Dietz, Mark L.


    A method and apparatus for the quantitative recover of actinide values from biological and environmental sample by passing appropriately prepared samples in a mineral acid solution through a separation column of a dialkyl(phenyl)-N,N-dialylcarbamoylmethylphosphine oxide dissolved in tri-n-butyl phosphate on an inert substrate which selectively extracts the actinide values. The actinide values can be eluted either as a group or individually and their presence quantitatively detected by alpha counting.

  4. Assembly for collecting samples for purposes of identification or analysis and method of use

    DOE Patents [OSTI]

    Thompson, Cyril V. [Knoxville, TN; Smith, Rob R. [Knoxville, TN


    An assembly and an associated method for collecting a sample of material desired to be characterized with diagnostic equipment includes or utilizes an elongated member having a proximal end with which the assembly is manipulated by a user and a distal end. In addition, a collection tip which is capable of being placed into contact with the material to be characterized is supported upon the distal end. The collection tip includes a body of chemically-inert porous material for binding a sample of material when the tip is placed into contact with the material and thereby holds the sample of material for subsequent introduction to the diagnostic equipment.

  5. Method and apparatus for measuring the gas permeability of a solid sample

    DOE Patents [OSTI]

    Carstens, D.H.W.


    The disclosure is directed to an apparatus and method for measuring the permeability of a gas in a sample. The gas is allowed to reach a steady flow rate through the sample. A measurable amount of the gas is collected during a given time period and then delivered to a sensitive quadrupole. The quadrupole signal, adjusted for background, is proportional to the amount of gas collected during the time period. The quadrupole can be calibrated with a standard helium leak. The gas can be deuterium and the sample can be polyvinyl alcohol.

  6. Electrodeposition as an alternate method for preparation of environmental samples for iodide by AMS


    Adamic, M. L.; Lister, T. E.; Dufek, E. J.; Jenson, D. D.; Olson, J. E.; Vockenhuber, C.; Watrous, M. G.


    This paper presents an evaluation of an alternate method for preparing environmental samples for 129I analysis by accelerator mass spectrometry (AMS) at Idaho National Laboratory. The optimal sample preparation method is characterized by ease of preparation, capability of processing very small quantities of iodide, and ease of loading into a cathode. Electrodeposition of iodide on a silver wire was evaluated using these criteria. This study indicates that the electrochemically-formed silver iodide deposits produce ion currents similar to those from precipitated silver iodide for the same sample mass. Furthermore, precipitated silver iodide samples are usually mixed with niobium or silver powdermore » prior to loading in a cathode. Using electrodeposition, the silver is already mixed with the sample and can simply be picked up with tweezers, placed in the sample die, and pressed into a cathode. The major advantage of this method is that the silver wire/electrodeposited silver iodide is much easier to load into a cathode.« less

  7. Analytical Chemistry Laboratory (ACL) procedure compendium. Volume 2, Sample preparation methods

    SciTech Connect (OSTI)

    Not Available


    This volume contains the interim change notice for sample preparation methods. Covered are: acid digestion for metals analysis, fusion of Hanford tank waste solids, water leach of sludges/soils/other solids, extraction procedure toxicity (simulate leach in landfill), sample preparation for gamma spectroscopy, acid digestion for radiochemical analysis, leach preparation of solids for free cyanide analysis, aqueous leach of solids for anion analysis, microwave digestion of glasses and slurries for ICP/MS, toxicity characteristic leaching extraction for inorganics, leach/dissolution of activated metal for radiochemical analysis, extraction of single-shell tank (SST) samples for semi-VOC analysis, preparation and cleanup of hydrocarbon- containing samples for VOC and semi-VOC analysis, receiving of waste tank samples in onsite transfer cask, receipt and inspection of SST samples, receipt and extrusion of core samples at 325A shielded facility, cleaning and shipping of waste tank samplers, homogenization of solutions/slurries/sludges, and test sample preparation for bioassay quality control program.

  8. Final LDRD report : development of sample preparation methods for ChIPMA-based imaging mass spectrometry of tissue samples.

    SciTech Connect (OSTI)

    Maharrey, Sean P.; Highley, Aaron M.; Behrens, Richard, Jr.; Wiese-Smith, Deneille


    The objective of this short-term LDRD project was to acquire the tools needed to use our chemical imaging precision mass analyzer (ChIPMA) instrument to analyze tissue samples. This effort was an outgrowth of discussions with oncologists on the need to find the cellular origin of signals in mass spectra of serum samples, which provide biomarkers for ovarian cancer. The ultimate goal would be to collect chemical images of biopsy samples allowing the chemical images of diseased and nondiseased sections of a sample to be compared. The equipment needed to prepare tissue samples have been acquired and built. This equipment includes an cyro-ultramicrotome for preparing thin sections of samples and a coating unit. The coating unit uses an electrospray system to deposit small droplets of a UV-photo absorbing compound on the surface of the tissue samples. Both units are operational. The tissue sample must be coated with the organic compound to enable matrix assisted laser desorption/ionization (MALDI) and matrix enhanced secondary ion mass spectrometry (ME-SIMS) measurements with the ChIPMA instrument Initial plans to test the sample preparation using human tissue samples required development of administrative procedures beyond the scope of this LDRD. Hence, it was decided to make two types of measurements: (1) Testing the spatial resolution of ME-SIMS by preparing a substrate coated with a mixture of an organic matrix and a bio standard and etching a defined pattern in the coating using a liquid metal ion beam, and (2) preparing and imaging C. elegans worms. Difficulties arose in sectioning the C. elegans for analysis and funds and time to overcome these difficulties were not available in this project. The facilities are now available for preparing biological samples for analysis with the ChIPMA instrument. Some further investment of time and resources in sample preparation should make this a useful tool for chemical imaging applications.

  9. Method of analyzing multiple sample simultaneously by detecting absorption and systems for use in such a method

    DOE Patents [OSTI]

    Yeung, Edward S.; Gong, Xiaoyi


    The present invention provides a method of analyzing multiple samples simultaneously by absorption detection. The method comprises: (i) providing a planar array of multiple containers, each of which contains a sample comprising at least one absorbing species, (ii) irradiating the planar array of multiple containers with a light source and (iii) detecting absorption of light with a detetion means that is in line with the light source at a distance of at leaat about 10 times a cross-sectional distance of a container in the planar array of multiple containers. The absorption of light by a sample indicates the presence of an absorbing species in it. The method can further comprise: (iv) measuring the amount of absorption of light detected in (iii) indicating the amount of the absorbing species in the sample. Also provided by the present invention is a system for use in the abov metho.The system comprises; (i) a light source comrnpising or consisting essentially of at leaat one wavelength of light, the absorption of which is to be detected, (ii) a planar array of multiple containers, and (iii) a detection means that is in line with the light source and is positioned in line with and parallel to the planar array of multiple contiainers at a distance of at least about 10 times a cross-sectional distance of a container.

  10. An efficient and cost-effective method for preparing transmission electron microscopy samples from powders


    Wen, Haiming; Lin, Yaojun; Seidman, David N.; Schoenung, Julie M.; van Rooyen, Isabella J.; Lavernia, Enrique J.


    The preparation of transmission electron microcopy (TEM) samples from powders with particle sizes larger than ~100 nm poses a challenge. The existing methods are complicated and expensive, or have a low probability of success. Herein, we report a modified methodology for preparation of TEM samples from powders, which is efficient, cost-effective, and easy to perform. This method involves mixing powders with an epoxy on a piece of weighing paper, curing the powder–epoxy mixture to form a bulk material, grinding the bulk to obtain a thin foil, punching TEM discs from the foil, dimpling the discs, and ion milling the dimpledmore » discs to electron transparency. Compared with the well established and robust grinding–dimpling–ion-milling method for TEM sample preparation for bulk materials, our modified approach for preparing TEM samples from powders only requires two additional simple steps. In this article, step-by-step procedures for our methodology are described in detail, and important strategies to ensure success are elucidated. Furthermore, our methodology has been applied successfully for preparing TEM samples with large thin areas and high quality for many different mechanically milled metallic powders.« less

  11. Device and method for automated separation of a sample of whole blood into aliquots

    DOE Patents [OSTI]

    Burtis, Carl A.; Johnson, Wayne F.


    A device and a method for automated processing and separation of an unmeasured sample of whole blood into multiple aliquots of plasma. Capillaries are radially oriented on a rotor, with the rotor defining a sample chamber, transfer channels, overflow chamber, overflow channel, vent channel, cell chambers, and processing chambers. A sample of whole blood is placed in the sample chamber, and when the rotor is rotated, the blood moves outward through the transfer channels to the processing chambers where the blood is centrifugally separated into a solid cellular component and a liquid plasma component. When the rotor speed is decreased, the plasma component backfills the capillaries resulting in uniform aliquots of plasma which may be used for subsequent analytical procedures.

  12. Rapid Column Extraction Method for Actinides and Sr-89/90 in Water Samples

    SciTech Connect (OSTI)



    The SRS Environmental Laboratory analyzes water samples for environmental monitoring, including river water and ground water samples. A new, faster actinide and strontium 89/90 separation method has been developed and implemented to improve productivity, reduce labor costs and add capacity to this laboratory. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and Sr-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), curium (Cm) and thorium (Th) using a single multi-stage column combined with alpha spectrometry. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized. The method can be used for routine analysis or as a rapid method for emergency preparedness. Thorium and curium are often analyzed separately due to the interference of the daughter of Th-229 tracer, actinium (Ac)-225, on curium isotopes when measured by alpha spectrometry. This new method also adds a separation step using DGA Resin{reg_sign}, (Diglycolamide Resin, Eichrom Technologies) to remove Ac-225 and allow the separation and analysis of thorium isotopes and curium isotopes at the same time.

  13. Electrical network method for the thermal or structural characterization of a conducting material sample or structure

    DOE Patents [OSTI]

    Ortiz, M.G.


    A method for modeling a conducting material sample or structure system, as an electrical network of resistances in which each resistance of the network is representative of a specific physical region of the system. The method encompasses measuring a resistance between two external leads and using this measurement in a series of equations describing the network to solve for the network resistances for a specified region and temperature. A calibration system is then developed using the calculated resistances at specified temperatures. This allows for the translation of the calculated resistances to a region temperature. The method can also be used to detect and quantify structural defects in the system.

  14. Electrical network method for the thermal or structural characterization of a conducting material sample or structure

    DOE Patents [OSTI]

    Ortiz, Marco G.


    A method for modeling a conducting material sample or structure system, as an electrical network of resistances in which each resistance of the network is representative of a specific physical region of the system. The method encompasses measuring a resistance between two external leads and using this measurement in a series of equations describing the network to solve for the network resistances for a specified region and temperature. A calibration system is then developed using the calculated resistances at specified temperatures. This allows for the translation of the calculated resistances to a region temperature. The method can also be used to detect and quantify structural defects in the system.

  15. Method of extruding and packaging a thin sample of reactive material, including forming the extrusion die

    DOE Patents [OSTI]

    Lewandowski, E.F.; Peterson, L.L.


    This invention teaches a method of cutting a narrow slot in an extrusion die with an electrical discharge machine by first drilling spaced holes at the ends of where the slot will be, whereby the oil can flow through the holes and slot to flush the material eroded away as the slot is being cut. The invention further teaches a method of extruding a very thin ribbon of solid highly reactive material such as lithium or sodium through the die in an inert atmosphere of nitrogen, argon, or the like as in a glovebox. The invention further teaches a method of stamping out sample discs from the ribbon and of packaging each disc by sandwiching it between two aluminum sheets and cold welding the sheets together along an annular seam beyond the outer periphery of the disc. This provides a sample of high purity reactive material that can have a long shelf life.

  16. Method of extruding and packaging a thin sample of reactive material including forming the extrusion die

    DOE Patents [OSTI]

    Lewandowski, Edward F.; Peterson, Leroy L.


    This invention teaches a method of cutting a narrow slot in an extrusion die with an electrical discharge machine by first drilling spaced holes at the ends of where the slot will be, whereby the oil can flow through the holes and slot to flush the material eroded away as the slot is being cut. The invention further teaches a method of extruding a very thin ribbon of solid highly reactive material such as lithium or sodium through the die in an inert atmosphere of nitrogen, argon or the like as in a glovebox. The invention further teaches a method of stamping out sample discs from the ribbon and of packaging each disc by sandwiching it between two aluminum sheets and cold welding the sheets together along an annular seam beyond the outer periphery of the disc. This provides a sample of high purity reactive material that can have a long shelf life.

  17. Rapid method to determine 89Sr/90Sr in large concrete samples


    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; Utsey, Robin C.; Sudowe, Ralf; McAlister, Daniel R.


    Here, a new rapid method has been developed that provides high quality low-level measurements of 89,90Sr in concrete samples with an MDA (Minimum Detectable Activity) of <1 mBq g-1. The new method is fast, meets new decommissioning regulatory limits and is robust even if refractory particles are present. The method utilizes a rapid fusion to ensure total dissolution of samples and rapid preconcentration and separation of 89,90Sr from 5-10 g concrete samples. When, the 89Sr/90Sr ratio is high, Sr can be isolated from up to 5g concrete samples, total 89/90Sr measured, and then 90Sr determined via 90Y separated after amore » period of ingrowth. Another approach allows the immediate determination of 90Sr in 10 g concrete aliquots without waiting for 90Y ingrowth, in instances where the shorter lived 89Sr is unlikely to be encountered.« less

  18. Simple method for highlighting the temperature distribution into a liquid sample heated by microwave power field

    SciTech Connect (OSTI)

    Surducan, V.; Surducan, E.; Dadarlat, D.


    Microwave induced heating is widely used in medical treatments, scientific and industrial applications. The temperature field inside a microwave heated sample is often inhomogenous, therefore multiple temperature sensors are required for an accurate result. Nowadays, non-contact (Infra Red thermography or microwave radiometry) or direct contact temperature measurement methods (expensive and sophisticated fiber optic temperature sensors transparent to microwave radiation) are mainly used. IR thermography gives only the surface temperature and can not be used for measuring temperature distributions in cross sections of a sample. In this paper we present a very simple experimental method for temperature distribution highlighting inside a cross section of a liquid sample, heated by a microwave radiation through a coaxial applicator. The method proposed is able to offer qualitative information about the heating distribution, using a temperature sensitive liquid crystal sheet. Inhomogeneities as smaller as 1°-2°C produced by the symmetry irregularities of the microwave applicator can be easily detected by visual inspection or by computer assisted color to temperature conversion. Therefore, the microwave applicator is tuned and verified with described method until the temperature inhomogeneities are solved.


    SciTech Connect (OSTI)

    Maxwell, S


    The analysis of actinides in environmental soil and sediment samples is very important for environmental monitoring. There is a need to measure actinide isotopes with very low detection limits. A new, rapid actinide separation method has been developed and implemented that allows the measurement of plutonium, americium and curium isotopes in very large soil samples (100-200 g) with high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and DGA-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), americium (Am), and curium (Cm) using a single multistage column combined with alpha spectrometry. The method combines an acid leach step and innovative matrix removal using cerium fluoride precipitation to remove the difficult soil matrix. This method is unique in that it provides high tracer recoveries and effective removal of interferences with small extraction chromatography columns instead of large ion exchange resin columns that generate large amounts of acid waste. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  20. Photothermal method for in situ microanalysis of the chemical composition of coal samples

    DOE Patents [OSTI]

    Amer, N.M.


    Successive minute regions along a scan path on a coal sample are individually analyzed, at a series of different depths if desired, to determine chemical composition including the locations, sizes and distributions of different maceral inclusions. A sequence of infrared light pulses of progressively changing wavelengths is directed into each minute region and a probe light beam is directed along the sample surface adjacent the region. Infrared wavelengths at which strong absorption occurs in the region are identified by detecting the resulting deflections of the probe beam caused by thermally induced index of refraction changes in the air or other medium adjacent the region. The detected peak absorption wavelengths are correlated with known characteristic peak absorption wavelengths of specific coal constituents to identify the composition of each such minute region of the sample. The method enables rapid, convenient and non-destructive analyses of coal specimens to facilitate mining, processing and utilization of coals. 2 figures.

  1. Survey of sampling-based methods for uncertainty and sensitivity analysis.

    SciTech Connect (OSTI)

    Johnson, Jay Dean; Helton, Jon Craig; Sallaberry, Cedric J. PhD.; Storlie, Curt B. (Colorado State University, Fort Collins, CO)


    Sampling-based methods for uncertainty and sensitivity analysis are reviewed. The following topics are considered: (1) Definition of probability distributions to characterize epistemic uncertainty in analysis inputs, (2) Generation of samples from uncertain analysis inputs, (3) Propagation of sampled inputs through an analysis, (4) Presentation of uncertainty analysis results, and (5) Determination of sensitivity analysis results. Special attention is given to the determination of sensitivity analysis results, with brief descriptions and illustrations given for the following procedures/techniques: examination of scatterplots, correlation analysis, regression analysis, partial correlation analysis, rank transformations, statistical tests for patterns based on gridding, entropy tests for patterns based on gridding, nonparametric regression analysis, squared rank differences/rank correlation coefficient test, two dimensional Kolmogorov-Smirnov test, tests for patterns based on distance measures, top down coefficient of concordance, and variance decomposition.

  2. System and method for laser assisted sample transfer to solution for chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J; Kertesz, Vilmos


    A system and method for laser desorption of an analyte from a specimen and capturing of the analyte in a suspended solvent to form a testing solution are described. The method can include providing a specimen supported by a desorption region of a specimen stage and desorbing an analyte from a target site of the specimen with a laser beam centered at a radiation wavelength (.lamda.). The desorption region is transparent to the radiation wavelength (.lamda.) and the sampling probe and a laser source emitting the laser beam are on opposite sides of a primary surface of the specimen stage. The system can also be arranged where the laser source and the sampling probe are on the same side of a primary surface of the specimen stage. The testing solution can then be analyzed using an analytical instrument or undergo further processing.

  3. Method for the thermal characterization, visualization, and integrity evaluation of conducting material samples or complex structures

    DOE Patents [OSTI]

    Ortiz, Marcos G.


    A method for modeling a conducting material sample or structure (herein called a system) as at least two regions which comprise an electrical network of resistances, for measuring electric resistance between at least two selected pairs of external leads attached to the surface of the system, wherein at least one external lead is attached to the surface of each of the regions, and, using basic circuit theory, for translating measured resistances into temperatures or thermophysical properties in corresponding regions of the system.

  4. Comparison of SW-846 method 3051 and SW-846 method 7471A for the preparation of solid waste samples for mercury determination

    SciTech Connect (OSTI)

    Giaquinto, J.M.; Essling, A.M.; Keller, J.M.


    This report describes experimental studies to evaluate the use of EPA SW-846 method 3051 for preparation and dissolution of solid samples for Hg analysis. The study showed that the method is effective in dissolution of four sample types without significant loss of Hg. Based on results of this study, method 3051 was used for analysis of high radioactive waste samples to obtain results for a number of RCRA regulated metals without the need to utilize a separate sample preparation method (EPA SW-846 method 7471A) specific only for Hg.

  5. Rapid Method for Ra-226 and Ra-228 in Water Samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod, L. III


    The measurement of radium isotopes in natural waters is important for oceanographic studies and for public health reasons. Ra-226 (1620 year half-life) is one of the most toxic of the long-lived alpha emitters present in the environment due to its long life and its tendency to concentrate in bones, which increases the internal radiation dose of individuals. The analysis of radium-226 and radium-228 in natural waters can be tedious and time-consuming. Different sample preparation methods are often required to prepare Ra-226 and Ra-228 for separate analyses. A rapid method has been developed at the Savannah River Environmental Laboratory that effectively separates both Ra-226 and Ra-228 (via Ac-228) for assay. This method uses MnO{sub 2} Resin from Eichrom Technologies (Darien, IL, USA) to preconcentrate Ra-226 and Ra-228 rapidly from water samples, along with Ba-133 tracer. DGA Resin{reg_sign} (Eichrom) and Ln-Resin{reg_sign} (Eichrom) are employed in tandem to prepare Ra-226 for assay by alpha spectrometry and to determine Ra-228 via the measurement of Ac-228 by gas proportional counting. After preconcentration, the manganese dioxide is dissolved from the resin and passed through stacked Ln-Resin-DGA Resin cartridges that remove uranium and thorium interferences and retain Ac-228 on DGA Resin. The eluate that passed through this column is evaporated, redissolved in a lower acidity and passed through Ln-Resin again to further remove interferences before performing a barium sulfate microprecipitation. The Ac-228 is stripped from the resin, collected using cerium fluoride microprecipitation and counted by gas proportional counting. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  6. Method for the thermal characterization, visualization, and integrity evaluation of conducting material samples or complex structures

    DOE Patents [OSTI]

    Ortiz, M.G.


    Disclosed is a method for modeling a conducting material sample or structure (herein called a system) as at least two regions which comprise an electrical network of resistances, for measuring electric resistance between at least two selected pairs of external leads attached to the surface of the system, wherein at least one external lead is attached to the surface of each of the regions, and, using basic circuit theory, for translating measured resistances into temperatures or thermophysical properties in corresponding regions of the system. 16 figs.

  7. Systems For Column-Based Separations, Methods Of Forming Packed Columns, And Methods Of Purifying Sample Components

    DOE Patents [OSTI]

    Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.


    The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

  8. Systems for column-based separations, methods of forming packed columns, and methods of purifying sample components

    DOE Patents [OSTI]

    Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.


    The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

  9. Systems For Column-Based Separations, Methods Of Forming Packed Columns, And Methods Of Purifying Sample Components.

    DOE Patents [OSTI]

    Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.


    The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

  10. Method and apparatus for automated processing and aliquoting of whole blood samples for analysis in a centrifugal fast analyzer

    DOE Patents [OSTI]

    Burtis, C.A.; Johnson, W.F.; Walker, W.A.


    A rotor and disc assembly for use in a centrifugal fast analyzer. The assembly is designed to process multiple samples of whole blood followed by aliquoting of the resultant serum into precisely measured samples for subsequent chemical analysis. The assembly requires minimal operator involvement with no mechanical pipetting. The system comprises: (1) a whole blood sample disc; (2) a serum sample disc; (3) a sample preparation rotor; and (4) an analytical rotor. The blood sample disc and serum sample disc are designed with a plurality of precision bore capillary tubes arranged in a spoked array. Samples of blood are loaded into the blood sample disc by capillary action and centrifugally discharged into cavities of the sample preparation rotor where separation of serum and solids is accomplished. The serum is loaded into the capillaries of the serum sample disc by capillary action and subsequently centrifugally expelled into cuvettes of the analyticaly rotor for conventional methods. 5 figs.

  11. Method and apparatus for automated processing and aliquoting of whole blood samples for analysis in a centrifugal fast analyzer

    DOE Patents [OSTI]

    Burtis, Carl A.; Johnson, Wayne F.; Walker, William A.


    A rotor and disc assembly for use in a centrifugal fast analyzer. The assembly is designed to process multiple samples of whole blood followed by aliquoting of the resultant serum into precisely measured samples for subsequent chemical analysis. The assembly requires minimal operator involvement with no mechanical pipetting. The system comprises (1) a whole blood sample disc, (2) a serum sample disc, (3) a sample preparation rotor, and (4) an analytical rotor. The blood sample disc and serum sample disc are designed with a plurality of precision bore capillary tubes arranged in a spoked array. Samples of blood are loaded into the blood sample disc in capillary tubes filled by capillary action and centrifugally discharged into cavities of the sample preparation rotor where separation of serum and solids is accomplished. The serum is loaded into the capillaries of the serum sample disc by capillary action and subsequently centrifugally expelled into cuvettes of the analytical rotor for analysis by conventional methods.

  12. Method and apparatus for maintaining multi-component sample gas constituents in vapor phase during sample extraction and cooling

    DOE Patents [OSTI]

    Farthing, William Earl [Pinson, AL; Felix, Larry Gordon [Pelham, AL; Snyder, Todd Robert [Birmingham, AL


    An apparatus and method for diluting and cooling that is extracted from high temperature and/or high pressure industrial processes. Through a feedback process, a specialized, CFD-modeled dilution cooler is employed along with real-time estimations of the point at which condensation will occur within the dilution cooler to define a level of dilution and diluted gas temperature that results in a gas that can be conveyed to standard gas analyzers that contains no condensed hydrocarbon compounds or condensed moisture.

  13. Method and apparatus maintaining multi-component sample gas constituents in vapor phase during sample extraction and cooling

    DOE Patents [OSTI]

    Farthing, William Earl; Felix, Larry Gordon; Snyder, Todd Robert


    An apparatus and method for diluting and cooling that is extracted from high temperature and/or high pressure industrial processes. Through a feedback process, a specialized, CFD-modeled dilution cooler is employed along with real-time estimations of the point at which condensation will occur within the dilution cooler to define a level of dilution and diluted gas temperature that results in a gas that can be conveyed to standard gas analyzers that contains no condensed hydrocarbon compounds or condensed moisture.

  14. Photothermal method for in situ microanalysis of the chemical composition of coal samples

    DOE Patents [OSTI]

    Amer, Nabil M.


    Successive minute regions (13) along a scan path on a coal sample (11) are individually analyzed, at a series of different depths if desired, to determine chemical composition including the locations, sizes and distributions of different maceral inclusions (12). A sequence of infrared light pulses (17) of progressively changing wavelengths is directed into each minute region (13) and a probe light beam (22) is directed along the sample surface (21) adjacent the region (13). Infrared wavelengths at which strong absorption occurs in the region (13) are identified by detecting the resulting deflections (.phi.) of the probe beam (22) caused by thermally induced index of refraction changes in the air or other medium (19) adjacent the region (13). The detected peak absorption wavelengths are correlated with known characteristic peak absorption wavelengths of specific coal constituents to identify the composition of each such minute region (13) of the sample (11). The method enables rapid, convenient and non-destructive analyses of coal specimens to facilitate mining, processing and utilization of coals.

  15. Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

    SciTech Connect (OSTI)

    Almond, P. M.; Kaplan, D. I.; Langton, C. A.; Stefanko, D. B.; Spencer, W. A.; Hatfield, A.; Arai, Y.


    The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

  16. Markov Chain Monte Carlo Sampling Methods for 1D Seismic and EM Data Inversion

    Energy Science and Technology Software Center (OSTI)


    This software provides several Markov chain Monte Carlo sampling methods for the Bayesian model developed for inverting 1D marine seismic and controlled source electromagnetic (CSEM) data. The current software can be used for individual inversion of seismic AVO and CSEM data and for joint inversion of both seismic and EM data sets. The structure of the software is very general and flexible, and it allows users to incorporate their own forward simulation codes and rockmore » physics model codes easily into this software. Although the softwae was developed using C and C++ computer languages, the user-supplied codes can be written in C, C++, or various versions of Fortran languages. The software provides clear interfaces for users to plug in their own codes. The output of this software is in the format that the R free software CODA can directly read to build MCMC objects.« less

  17. Sampling and analytical methods development at the HGP-a generator facility

    SciTech Connect (OSTI)

    Thomas, D.M.


    During shakedown operations for the HGP-A generator plant sampling and analytical problems were encountered during the process chemistry monitoring effort. Acid-preservation of brine for cation analysis required the use of nitrous oxideacetylene flame for accurate A-A analysis of calcium. Analysis of gases for carbonate and sulfide was by specific ion electrode and alkalinity titration, respectively. Sulfide caused substantial interferences with the alkalinity method and corrections for sulfide were required. Sulfide also interfered with chloride analyses in the steam phase requiring removal of the sulfide by boiling. Analysis of dissolved silica in the brine was complicated by the presence of colloidal silica which produced erratic analytical results. An accurate evaluation of the hydrogen sulfide abatement system was possible only when the hydrogen sulfide concentrations in the treated and untreated steam were compared with a second component in the steam phase that was unaffected by caustic injection.

  18. Flow through in situ reactors with suction lysimeter sampling capability and methods of using

    DOE Patents [OSTI]

    Radtke, Corey W. (Idaho Falls, ID) [Idaho Falls, ID; Blackwelder, D. Brad (Blackfoot, ID) [Blackfoot, ID; Hubbell, Joel M. (Idaho Falls, ID) [Idaho Falls, ID


    An in situ reactor for use in a geological strata includes a liner defining a centrally disposed passageway and a sampling conduit received within the passageway. The sampling conduit may be used to receive a geological speciment derived from geological strata therein and a lysimeter is disposed within the sampling conduit in communication with the geological specimen. Fluid may be added to the geological specimen through the passageway defined by the liner, between an inside surface of the liner and an outside surface of the sampling conduit. A distal portion of the sampling conduit may be in fluid communication with the passageway.

  19. Method for detection of long-lived radioisotopes in small biochemical samples

    DOE Patents [OSTI]

    Turteltaub, K.W.; Vogel, J.S.; Felton, J.S.; Gledhill, B.L.; Davis, J.C.


    Disclosed is a method for detection of long-lived radioisotopes in small biochemical samples, comprising: a. selecting a biological host in which radioisotopes are present in concentrations equal to or less than those in the ambient biosphere, b. preparing a long-lived radioisotope labeled reactive chemical specie, c. administering the chemical specie to the biologist host in doses sufficiently low to avoid significant overt damage to the biological system, d. allowing a period of time to elapse sufficient for dissemination and interaction of the chemical specie with the host throughout the biological system of the host, e. isolating a reacted fraction of the biological substance from the host in a manner sufficient to avoid contamination of the substance from extraneous sources, f. converting the fraction of biological substance by suitable means to a material which efficiently produces charged ions in at least one of several possible ion sources without introduction of significant isotopic fractionation, and, g. measuring the radioisotope concentration in the material by means of direct isotopic counting. 5 figs.

  20. Method for detection of long-lived radioisotopes in small biochemical samples

    DOE Patents [OSTI]

    Turteltaub, Kenneth W.; Vogel, John S.; Felton, James S.; Gledhill, Barton L.; Davis, Jay C.


    Disclosed is a method for detection of long-lived radioisotopes in small bio-chemical samples, comprising: a. selecting a biological host in which radioisotopes are present in concentrations equal to or less than those in the ambient biosphere, b. preparing a long-lived radioisotope labeled reactive chemical specie, c. administering said chemical specie to said biologist host in doses sufficiently low to avoid significant overt damage to the biological system thereof, d. allowing a period of time to elapse sufficient for dissemination and interaction of said chemical specie with said host throughout said biological system of said host, e. isolating a reacted fraction of the biological substance from said host in a manner sufficient to avoid contamination of said substance from extraneous sources, f. converting said fraction of biological substance by suitable means to a material which efficiently produces charged ions in at least one of several possible ion sources without introduction of significant isotopic fractionation, and, g. measuring the radioisotope concentration in said material by means of direct isotopic counting.

  1. The SAGES Legacy Unifying Globulars and Galaxies survey (SLUGGS): sample definition, methods, and initial results

    SciTech Connect (OSTI)

    Brodie, Jean P.; Romanowsky, Aaron J.; Jennings, Zachary G.; Pota, Vincenzo; Kader, Justin; Roediger, Joel C.; Villaume, Alexa; Arnold, Jacob A.; Woodley, Kristin A.; Strader, Jay; Forbes, Duncan A.; Pastorello, Nicola; Usher, Christopher; Blom, Christina; Kartha, Sreeja S.; Foster, Caroline; Spitler, Lee R.


    We introduce and provide the scientific motivation for a wide-field photometric and spectroscopic chemodynamical survey of nearby early-type galaxies (ETGs) and their globular cluster (GC) systems. The SAGES Legacy Unifying Globulars and GalaxieS (SLUGGS) survey is being carried out primarily with Subaru/Suprime-Cam and Keck/DEIMOS. The former provides deep gri imaging over a 900 arcmin{sup 2} field-of-view to characterize GC and host galaxy colors and spatial distributions, and to identify spectroscopic targets. The NIR Ca II triplet provides GC line-of-sight velocities and metallicities out to typically ?8 R {sub e}, and to ?15 R {sub e} in some cases. New techniques to extract integrated stellar kinematics and metallicities to large radii (?2-3 R {sub e}) are used in concert with GC data to create two-dimensional (2D) velocity and metallicity maps for comparison with simulations of galaxy formation. The advantages of SLUGGS compared with other, complementary, 2D-chemodynamical surveys are its superior velocity resolution, radial extent, and multiple halo tracers. We describe the sample of 25 nearby ETGs, the selection criteria for galaxies and GCs, the observing strategies, the data reduction techniques, and modeling methods. The survey observations are nearly complete and more than 30 papers have so far been published using SLUGGS data. Here we summarize some initial results, including signatures of two-phase galaxy assembly, evidence for GC metallicity bimodality, and a novel framework for the formation of extended star clusters and ultracompact dwarfs. An integrated overview of current chemodynamical constraints on GC systems points to separate, in situ formation modes at high redshifts for metal-poor and metal-rich GCs.

  2. Device for high spatial resolution chemical analysis of a sample and method of high spatial resolution chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J.


    A system and method for analyzing a chemical composition of a specimen are described. The system can include at least one pin; a sampling device configured to contact a liquid with a specimen on the at least one pin to form a testing solution; and a stepper mechanism configured to move the at least one pin and the sampling device relative to one another. The system can also include an analytical instrument for determining a chemical composition of the specimen from the testing solution. In particular, the systems and methods described herein enable chemical analysis of specimens, such as tissue, to be evaluated in a manner that the spatial-resolution is limited by the size of the pins used to obtain tissue samples, not the size of the sampling device used to solubilize the samples coupled to the pins.

  3. Method and system having ultrasonic sensor movable by translation device for ultrasonic profiling of weld samples

    DOE Patents [OSTI]

    Panyard, James; Potter, Timothy; Charron, William; Hopkins, Deborah; Reverdy, Frederic


    A system for ultrasonic profiling of a weld sample includes a carriage movable in opposite first and second directions. An ultrasonic sensor is coupled to the carriage to move over the sample as the carriage moves. An encoder determines the position of the carriage to determine the position of the sensor. A spring is connected at one end of the carriage. Upon the carriage being moved in the first direction toward the spring such that the carriage and the sensor are at a beginning position and the spring is compressed the spring decompresses to push the carriage back along the second direction to move the carriage and the sensor from the beginning position to an ending position. The encoder triggers the sensor to take the ultrasonic measurements of the sample when the sensor is at predetermined positions while the sensor moves over the sample between the beginning and positions.

  4. Chapter 11, Sample Design Cross-Cutting Protocols: The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    1: Sample Design Cross-Cutting Protocols M. Sami Khawaja, Josh Rushton, and Josh Keeling, The Cadmus Group, Inc. Subcontract Report NREL/SR-7A30-53827 April 2013 The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures 11 - 1 Chapter 11 - Table of Contents 1 Introduction ............................................................................................................................ 3 1.1 Chapter Organization

  5. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.


    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  6. Method and apparatus for reducing sample dispersion in turns and junctions of microchannel systems

    DOE Patents [OSTI]

    Griffiths, Stewart K.; Nilson, Robert H.


    The performance of microchannel devices is improved by providing turns, wyes, tees, and other junctions that produce little dispersions of a sample as it traverses the turn or junction. The reduced dispersion results from contraction and expansion regions that reduce the cross-sectional area over some portion of the turn or junction. By carefully designing the geometries of these regions, sample dispersion in turns and junctions is reduced to levels comparable to the effects of ordinary diffusion. A numerical algorithm was employed to evolve low-dispersion geometries by computing the electric or pressure field within candidate configurations, sample transport through the turn or junction, and the overall effective dispersion. These devices should greatly increase flexibility in the design of microchannel devices by permitting the use of turns and junctions that do not induce large sample dispersion. In particular, the ability to fold electrophoretic and electrochrornatographic separation columns will allow dramatic improvements in the miniaturization of these devices. The low-lispersion devices are particularly suited to electrochromatographic and electrophoretic separations, as well as pressure-driven chromatographic separation. They are further applicable to microfluidic systems employing either electroosrnotic or pressure-driven flows for sample transport, reaction, mixing, dilution or synthesis.

  7. Method And Apparatus For Reducing Sample Dispersion In Turns And Junctions Of Micro-Channel Systems

    DOE Patents [OSTI]

    Griffiths, Stewart K. , Nilson, Robert H.


    What is disclosed pertains to improvement in the performance of microchannel devices by providing turns, wyes, tees, and other junctions that produce little dispersion of a sample as it traverses the turn or junction. The reduced dispersion results from contraction and expansion regions that reduce the cross-sectional area over some portion of the turn or junction. By carefully designing the geometries of these regions, sample dispersion in turns and junctions is reduced to levels comparable to the effects of ordinary diffusion. The low dispersion features are particularly suited for microfluidic devices and systems using either electromotive force, pressure, or combinations thereof as the principle of fluid transport. Such microfluidic devices and systems are useful for separation of components, sample transport, reaction, mixing, dilution or synthesis, or combinations thereof.

  8. Tensiometer, drive probe for use with environmental testing equipment, and methods of inserting environmental testing equipment into a sample

    DOE Patents [OSTI]

    Hubbell, Joel M.; Sisson, James B.


    A method of inserting a tensiometer into a sample, comprises providing a drive probe configured to be engaged by direct push equipment; supporting a porous member from the drive probe; and driving the drive probe into the sample using a cone penetrometer. A tensiometer comprises a drive probe configured to be engaged by direct push equipment or a cone penetrometer; a porous member supported by the drive probe; and a pressure sensor in pressure sensing relation to the porous member.

  9. Method of retrieving a liquid sample, a suction lysimeter, a portable suction lysimeter, a lysimeter system, and a deep lysimeter

    DOE Patents [OSTI]

    Hubbell, Joel M.; Sisson, James B.


    A method of retrieving a liquid sample comprises providing a portable lysimeter including a semi-permeable membrane and a chamber in fluid communication with the semi-permeable membrane; making a hole at a site from which a liquid sample is desired; evacuating the chamber by applying a vacuum to the chamber; lowering the portable lysimeter into the hole; obtaining a sample in the chamber; and retrieving the lysimeter from the bore; wherein it is not necessary to backfill the bore. A portable lysimeter includes a semi-permeable member and a chamber in fluid communication with the semi-permeable membrane.

  10. Method of characterizing void volume headspace in vented transuranic waste sludge drums using limited sampling data

    SciTech Connect (OSTI)

    Liekhus, K.J.; Connolly, M.J.; Arnold, P.M.; O`Leary, G.A.


    The Department of Energy must demonstrate to the Environmental Protection Agency that a drum headspace sample is representative of the volatile organic compounds (VOCs) within the entire void space of the waste container in order to demonstrate compliance in the future when drums could be directly emplaced in the Waste Isolation Pilot Plant in New Mexico. A test program is underway at the Idaho National Engineering Laboratory to determine if the drum headspace VOC concentration is representative of the concentration in the entire drum void space and demonstrate that the VOC concentration in the void space of each layer of confinement can be estimated using a model incorporating diffusive and permeative transport principles and limited waste drum sampling data. A comparison of model predictions of VOC concentration in the innermost layer of confinement with actual measurement from transuranic waste sludge drums demonstrate that the model may be useful in characterizing VOC concentration throughout entire drum void volume.


    SciTech Connect (OSTI)

    Click, D.; Edwards, T.; Jones, M.; Wiedenman, B.


    For each sludge batch that is processed in the Defense Waste Processing Facility (DWPF), the Savannah River National Laboratory (SRNL) performs confirmation of the applicability of the digestion method to be used by the DWPF lab for elemental analysis of Sludge Receipt and Adjustment Tank (SRAT) receipt samples and SRAT product process control samples. DWPF SRAT samples are typically dissolved using a room temperature HF-HNO{sub 3} acid dissolution (i.e., DWPF Cold Chem Method, see DWPF Procedure SW4-15.201) and then analyzed by inductively coupled plasma - atomic emission spectroscopy (ICP-AES). This report contains the results and comparison of data generated from performing the Aqua Regia (AR), Sodium peroxide/Hydroxide Fusion (PF) and DWPF Cold Chem (CC) method digestions of Sludge Batch 7a (SB7a) SRAT Receipt and SB7a SRAT Product samples. The SB7a SRAT Receipt and SB7a SRAT Product samples were prepared in the SRNL Shielded Cells, and the SRAT Receipt material is representative of the sludge that constituates the SB7a Batch or qualification composition. This is the sludge in Tank 51 that is to be transferred into Tank 40, which will contain the heel of Sludge Batch 6 (SB6), to form the Sb7a Blend composition.


    SciTech Connect (OSTI)



    The following report is a summary of work conducted to evaluate the ability of existing correlative techniques and alternative methods to accurately estimate impeller speed and power requirements for mechanical mixers proposed for use in a mixing and sampling facility (MSF). The proposed facility would accept high level waste sludges from Hanford double-shell tanks and feed uniformly mixed high level waste to the Waste Treatment Plant. Numerous methods are evaluated and discussed, and resulting recommendations provided.

  13. Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples

    DOE Patents [OSTI]

    Caldwell, John T.; Kunz, Walter E.; Cates, Michael R.; Franks, Larry A.


    Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fissions are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for .sup.239 Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

  14. Laminated metal composite formed from low flow stress layers and high flow stress layers using flow constraining elements and making same

    DOE Patents [OSTI]

    Syn, C.K.; Lesuer, D.R.


    A laminated metal composite of low flow stress layers and high flow stress layers is described which is formed using flow constraining elements, preferably in the shape of rings, individually placed around each of the low flow stress layers while pressure is applied to the stack to bond the layers of the composite together, to thereby restrain the flow of the low flow stress layers from the stack during the bonding. The laminated metal composite of the invention is made by the steps of forming a stack of alternate layers of low flow stress layers and high flow stress layers with each layer of low flow stress material surrounded by an individual flow constraining element, such as a ring, and then applying pressure to the top and bottom surfaces of the resulting stack to bond the dissimilar layers together, for example, by compression rolling the stack. In a preferred embodiment, the individual flow constraining elements surrounding the layers of low flow stress material are formed of a material which may either be the same material as the material comprising the high flow stress layers, or have similar flow stress characteristics to the material comprising the high flow stress layers. Additional sacrificial layers may be added to the top and bottom of the stack to avoid damage to the stack during the bonding step; and these additional layers may then be removed after the bonding step. 5 figs.

  15. Laminated metal composite formed from low flow stress layers and high flow stress layers using flow constraining elements and making same

    DOE Patents [OSTI]

    Syn, Chol K.; Lesuer, Donald R.


    A laminated metal composite of low flow stress layers and high flow stress layers is described which is formed using flow constraining elements, preferably in the shape of rings, individually placed around each of the low flow stress layers while pressure is applied to the stack to bond the layers of the composite together, to thereby restrain the flow of the low flow stress layers from the stack during the bonding. The laminated metal composite of the invention is made by the steps of forming a stack of alternate layers of low flow stress layers and high flow stress layers with each layer of low flow stress material surrounded by an individual flow constraining element, such as a ring, and then applying pressure to the top and bottom surfaces of the resulting stack to bond the dissimilar layers together, for example, by compression rolling the stack. In a preferred embodiment, the individual flow constraining elements surrounding the layers of low flow stress material are formed of a material which may either be the same material as the material comprising the high flow stress layers, or have similar flow stress characteristics to the material comprising the high flow stress layers. Additional sacrificial layers may be added to the top and bottom of the stack to avoid damage to the stack during the bonding step; and these additional layers may then be removed after the bonding step.

  16. Method for ultra-trace cesium isotope ratio measurements from environmental samples using thermal ionization mass spectrometry

    SciTech Connect (OSTI)

    Snow, Mathew S.; Snyder, Darin C.; Mann, Nick R.; White, Byron M.


    135Cs/137Cs isotope ratios can provide the age, origin and history of environmental Cs contamination. Relatively high precision 135Cs/137Cs isotope ratio measurements from samples containing femtogram quantities of 137Cs are needed to accurately track contamination resuspension and redistribution following environmental 137Cs releases; however, mass spectrometric analyses of environmental samples are limited by the large quantities of ionization inhibitors and isobaric interferences which are present at relatively high concentrations in the environment. We report a new approach for Cs purification from environmental samples. An initial ammonium molybdophosphate-polyacrylonitrile (AMP-PAN) column provides a robust method for extracting Cs under a wide variety of sample matrices and mass loads. Cation exchange separations using a second AMP-PAN column result in more than two orders of magnitude greater Cs/Rb separation factors than commercially available strong cation exchangers. Coupling an AMP-PAN cation exchanging step to a microcation column (AG50W resin) enables consistent 2-4% (2?) measurement errors for samples containing 3-6,000 fg 137Cs, representing the highest precision 135Cs/137Cs ratio measurements currently reported for soil samples at the femtogram level.

  17. Method for measuring the rate of cell reproduction by analysis of nanoliter cell samples

    DOE Patents [OSTI]

    Gourley, Paul L.


    A method of detecting cancer using a laser biocavity having a semiconductor laser including a microchannel through which cells in fluid traverse, comprising determining the laser wavelength of the laser biocavity with only fluid in the microchannel; determining the wavelength shift of the biocavity when each cell passes through the microchannel; and determining the percentage of cells in G2 phase from the wavelength shift of the cells; wherein an increased percentage of G2 phase cells is an indication of cancer.

  18. High-throughput liquid-absorption air-sampling apparatus and methods

    DOE Patents [OSTI]

    Zaromb, Solomon


    A portable high-throughput liquid-absorption air sampler [PHTLAAS] has an asymmetric air inlet through which air is drawn upward by a small and light-weight centrifugal fan driven by a direct current motor that can be powered by a battery. The air inlet is so configured as to impart both rotational and downward components of motion to the sampled air near said inlet. The PHTLAAS comprises a glass tube of relatively small size through which air passes at a high rate in a swirling, highly turbulent motion, which facilitates rapid transfer of vapors and particulates to a liquid film covering the inner walls of the tube. The pressure drop through the glass tube is <10 cm of water, usually <5 cm of water. The sampler's collection efficiency is usually >20% for vapors or airborne particulates in the range and >50% for particles larger than In conjunction with various analyzers, the PHTLAAS can serve to monitor a variety of hazardous or illicit airborne substances, such as lead-containing particulates, tritiated water vapor, biological aerosols, or traces of concealed drugs or explosives.

  19. A New On-the-Fly Sampling Method for Incoherent Inelastic Thermal Neutron Scattering Data in MCNP6

    SciTech Connect (OSTI)

    Pavlou, Andrew Theodore; Brown, Forrest B.; Ji, Wei


    At thermal energies, the scattering of neutrons in a system is complicated by the comparable velocities of the neutron and target, resulting in competing upscattering and downscattering events. The neutron wavelength is also similar in size to the target's interatomic spacing making the scattering process a quantum mechanical problem. Because of the complicated nature of scattering at low energies, the thermal data files in ACE format used in continuous-energy Monte Carlo codes are quite large { on the order of megabytes for a single temperature and material. In this paper, a new storage and sampling method is introduced that is orders of magnitude less in size and is used to sample scattering parameters at any temperature on-the-fly. In addition to the reduction in storage, the need to pre-generate thermal scattering data tables at fine temperatures has been eliminated. This is advantageous for multiphysics simulations which may involve temperatures not known in advance. A new module was written for MCNP6 that bypasses the current S(?,?) table lookup in favor of the new format. The new on-the-fly sampling method was tested for graphite for two benchmark problems at ten temperatures: 1) an eigenvalue test with a fuel compact of uranium oxycarbide fuel homogenized into a graphite matrix, 2) a surface current test with a \\broomstick" problem with a monoenergetic point source. The largest eigenvalue difference was 152pcm for T= 1200K. For the temperatures and incident energies chosen for the broomstick problem, the secondary neutron spectrum showed good agreement with the traditional S(?,?) sampling method. These preliminary results show that sampling thermal scattering data on-the-fly is a viable option to eliminate both the storage burden of keeping thermal data at discrete temperatures and the need to know temperatures before simulation runtime.

  20. Method and system for selecting data sampling phase for self timed interface logic

    DOE Patents [OSTI]

    Hoke, Joseph Michael; Ferraiolo, Frank D.; Lo, Tin-Chee; Yarolin, John Michael


    An exemplary embodiment of the present invention is a method for transmitting data among processors over a plurality of parallel data lines and a clock signal line. A receiver processor receives both data and a clock signal from a sender processor. At the receiver processor a bit of the data is phased aligned with the transmitted clock signal. The phase aligning includes selecting a data phase from a plurality of data phases in a delay chain and then adjusting the selected data phase to compensate for a round-off error. Additional embodiments include a system and storage medium for transmitting data among processors over a plurality of parallel data lines and a clock signal line.

  1. Verification Of The Defense Waste Processing Facility's (DWPF) Process Digestion Methods For The Sludge Batch 8 Qualification Sample

    SciTech Connect (OSTI)

    Click, D. R.; Edwards, T. B.; Wiedenman, B. J.; Brown, L. W.


    This report contains the results and comparison of data generated from inductively coupled plasma – atomic emission spectroscopy (ICP-AES) analysis of Aqua Regia (AR), Sodium Peroxide/Sodium Hydroxide Fusion Dissolution (PF) and Cold Chem (CC) method digestions and Cold Vapor Atomic Absorption analysis of Hg digestions from the DWPF Hg digestion method of Sludge Batch 8 (SB8) Sludge Receipt and Adjustment Tank (SRAT) Receipt and SB8 SRAT Product samples. The SB8 SRAT Receipt and SB8 SRAT Product samples were prepared in the SRNL Shielded Cells, and the SRAT Receipt material is representative of the sludge that constitutes the SB8 Batch or qualification composition. This is the sludge in Tank 51 that is to be transferred into Tank 40, which will contain the heel of Sludge Batch 7b (SB7b), to form the SB8 Blend composition.

  2. Reexamination of Basal Plane Thermal Conductivity of Suspended Graphene Samples Measured by Electro-Thermal Micro-Bridge Methods


    Jo, Insun; Pettes, Michael; Lindsay, Lucas R.; Ou, Eric; Weathers, Annie; Moore, Arden; Yao, Zhen; Shi, Li


    Thermal transport in suspended graphene samples has been measured in prior works and this work with the use of a suspended electro-thermal micro-bridge method. These measurement results are analyzed here to evaluate and eliminate the errors caused by the extrinsic thermal contact resistance. It is noted that the thermal resistance measured in a recent work increases linearly with the suspended length of the single-layer graphene samples synthesized by chemical vapor deposition (CVD), and that such a feature does not reveal the failure of Fourier s law despite the increase in the apparent thermal conductivity with length. The re-analyzed thermal conductivitymore » of a single-layer CVD graphene sample reaches about ( 1680 180 )Wm-1K-1 at room temperature, which is close to the highest value reported for highly oriented pyrolytic graphite. In comparison, the thermal conductivity values measured for two suspended exfoliated bi-layer graphene samples are about ( 880 60 ) and ( 730 60 ) Wm-1K-1 at room temperature, and approach that of the natural graphite source above room temperature. However, the low-temperature thermal conductivities of these suspended graphene samples are still considerably lower than the graphite values, with the peak thermal conductivities shifted to much higher temperatures. Analysis of the thermal conductivity data reveals that the low temperature behavior is dominated by phonon scattering by polymer residue instead of by the lateral boundary.« less

  3. Reexamination of Basal Plane Thermal Conductivity of Suspended Graphene Samples Measured by Electro-Thermal Micro-Bridge Methods

    SciTech Connect (OSTI)

    Jo, Insun; Pettes, Michael; Lindsay, Lucas R; Ou, Eric; Weathers, Annie; Moore, Arden; Yao, Zhen; Shi, Li


    Thermal transport in suspended graphene samples has been measured in prior works and this work with the use of a suspended electro-thermal micro-bridge method. These measurement results are analyzed here to evaluate and eliminate the errors caused by the extrinsic thermal contact resistance. It is noted that the thermal resistance measured in a recent work increases linearly with the suspended length of the single-layer graphene samples synthesized by chemical vapor deposition (CVD), and that such a feature does not reveal the failure of Fourier s law despite the increase in the apparent thermal conductivity with length. The re-analyzed thermal conductivity of a single-layer CVD graphene sample reaches about ( 1680 180 )Wm-1K-1 at room temperature, which is close to the highest value reported for highly oriented pyrolytic graphite. In comparison, the thermal conductivity values measured for two suspended exfoliated bi-layer graphene samples are about ( 880 60 ) and ( 730 60 ) Wm-1K-1 at room temperature, and approach that of the natural graphite source above room temperature. However, the low-temperature thermal conductivities of these suspended graphene samples are still considerably lower than the graphite values, with the peak thermal conductivities shifted to much higher temperatures. Analysis of the thermal conductivity data reveals that the low temperature behavior is dominated by phonon scattering by polymer residue instead of by the lateral boundary.

  4. False negative rate and other performance measures of a sponge-wipe surface sampling method for low contaminant concentrations.

    SciTech Connect (OSTI)

    Einfeld, Wayne; Krauter, Paula A.; Boucher, Raymond M.; Tezak, Mathew; Amidan, Brett G.; Piepel, Greg F.


    Recovery of spores from environmental surfaces is known to vary due to sampling methodology, techniques, spore size and characteristics, surface materials, and environmental conditions. A series of tests were performed to evaluate a new, validated sponge-wipe method. Specific factors evaluated were the effects of contaminant concentrations and surface materials on recovery efficiency (RE), false negative rate (FNR), limit of detection (LOD) - and the uncertainties of these quantities. Ceramic tile and stainless steel had the highest mean RE values (48.9 and 48.1%, respectively). Faux leather, vinyl tile, and painted wood had mean RE values of 30.3, 25.6, and 25.5, respectively, while plastic had the lowest mean RE (9.8%). Results show a roughly linear dependence of surface roughness on RE, where the smoothest surfaces have the highest mean RE values. REs were not influenced by the low spore concentrations tested (3 x 10{sup -3} to 1.86 CFU/cm{sup 2}). The FNR data were consistent with RE data, showing a trend of smoother surfaces resulting in higher REs and lower FNRs. Stainless steel generally had the lowest mean FNR (0.123) and plastic had the highest mean FNR (0.479). The LOD{sub 90} varied with surface material, from 0.015 CFU/cm{sup 2} on stainless steel up to 0.039 on plastic. Selecting sampling locations on the basis of surface roughness and using roughness to interpret spore recovery data can improve sampling. Further, FNR values, calculated as a function of concentration and surface material, can be used pre-sampling to calculate the numbers of samples for statistical sampling plans with desired performance, and post-sampling to calculate the confidence in characterization and clearance decisions.


    SciTech Connect (OSTI)

    Click, D.; Jones, M.; Edwards, T.


    For each sludge batch that is processed in the Defense Waste Processing Facility (DWPF), the Savannah River National Laboratory (SRNL) confirms applicability of the digestion method to be used by the DWPF lab for elemental analysis of Sludge Receipt and Adjustment Tank (SRAT) receipt samples and SRAT product process control samples.1 DWPF SRAT samples are typically dissolved using a room temperature HF-HNO3 acid dissolution (i.e., DWPF Cold Chem (CC) Method, see DWPF Procedure SW4-15.201) and then analyzed by inductively coupled plasma - atomic emission spectroscopy (ICPAES). In addition to the CC method confirmation, the DWPF lab's mercury (Hg) digestion method was also evaluated for applicability to SB6 (see DWPF procedure 'Mercury System Operating Manual', Manual: SW4-15.204. Section 6.1, Revision 5, Effective date: 12-04-03). This report contains the results and comparison of data generated from performing the Aqua Regia (AR), Sodium Peroxide/Hydroxide Fusion (PF) and DWPF Cold Chem (CC) method digestion of Sludge Batch 6 (SB6) SRAT Receipt and SB6 SRAT Product samples. For validation of the DWPF lab's Hg method, only SRAT receipt material was used and compared to AR digestion results. The SB6 SRAT Receipt and SB6 SRAT Product samples were prepared in the SRNL Shielded Cells, and the SRAT Receipt material is representative of the sludge that constitutes the SB6 Batch or qualification composition. This is the sludge in Tank 51 that is to be transferred into Tank 40, which will contain the heel of Sludge Batch 5 (SB5), to form the SB6 Blend composition. In addition to the 16 elements currently measured by the DWPF, this report includes Hg and thorium (Th) data (Th comprising {approx}2.5 - 3 Wt% of the total solids in SRAT Receipt and SRAT Product, respectively) and provides specific details of ICP-AES analysis of Th. Thorium was found to interfere with the U 367.007 nm emission line, and an inter-element correction (IEC) had to be applied to U data, which is also

  6. Sub-micron particle sampler apparatus and method for sampling sub-micron particles

    DOE Patents [OSTI]

    Gay, D.D.; McMillan, W.G.


    Apparatus and method steps for collecting sub-micron sized particles include a collection chamber and cryogenic cooling. The cooling is accomplished by coil tubing carrying nitrogen in liquid form, with the liquid nitrogen changing to the gas phase before exiting from the collection chamber in the tubing. Standard filters are used to filter out particles of diameter greater than or equal to 0.3 microns; however, the present invention is used to trap particles of less than 0.3 micron in diameter. A blower draws air to said collection chamber through a filter which filters particles with diameters greater than or equal to 0.3 micron. The air is then cryogenically cooled so that moisture and sub-micron sized particles in the air condense into ice on the coil. The coil is then heated so that the ice melts, and the liquid is then drawn off and passed through a Buchner funnel where the liquid is passed through a Nuclepore membrane. A vacuum draws the liquid through the Nuclepore membrane, with the Nuclepore membrane trapping sub-micron sized particles therein. The Nuclepore membrane is then covered on its top and bottom surfaces with sheets of Mylar and the assembly is then crushed into a pellet. This effectively traps the sub-micron sized particles for later analysis. 6 figures.

  7. System and method for measuring particles in a sample stream of a flow cytometer or the like

    DOE Patents [OSTI]

    Graves, Steven W.; Habberset, Robert C.


    A system and method for analyzing a particle in a sample stream of a flow cytometer or the like. The system has a light source, such as a laser pointer module, for generating a low powered light beam and a fluidics apparatus which is configured to transport particles in the sample stream at substantially low velocity through the light beam for interrogation. Detectors, such as photomultiplier tubes, are configured to detect optical signals generated in response to the light beam impinging the particles. Signal conditioning circuitry is connected to each of the detectors to condition each detector output into electronic signals for processing and is designed to have a limited frequency response to filter high frequency noise from the detector output signals.

  8. System and method for measuring particles in a sample stream of a flow cytometer using low-power laser source

    DOE Patents [OSTI]

    Graves, Steven W.; Habbersett, Robert C.


    A system and method for analyzing a particle in a sample stream of a flow cytometer or the like. The system has a light source, such as a laser pointer module, for generating a low powered light beam and a fluidics apparatus which is configured to transport particles in the sample stream at substantially low velocity through the light beam for interrogation. Detectors, such as photomultiplier tubes, are configured to detect optical signals generated in response to the light beam impinging the particles. Signal conditioning circuitry is connected to each of the detectors to condition each detector output into electronic signals for processing and is designed to have a limited frequency response to filter high frequency noise from the detector output signals.

  9. System and method for measuring particles in a sample stream of a flow cytometer using a low power laser source

    DOE Patents [OSTI]

    Graves, Steven W; Habbersett, Robert C


    A system and method for analyzing a particle in a sample stream of a flow cytometer or the like. The system has a light source, such as a laser pointer module, for generating a low powered light beam and a fluidics apparatus which is configured to transport particles in the sample stream at substantially low velocity through the light beam for interrogation. Detectors, such as photomultiplier tubes, are configured to detect optical signals generated in response to the light beam impinging the particles. Signal conditioning circuitry is connected to each of the detectors to condition each detector output into electronic signals for processing and is designed to have a limited frequency response to filter high frequency noise from the detector output signals.

  10. Low flow fume hood

    DOE Patents [OSTI]

    Bell, Geoffrey C.; Feustel, Helmut E.; Dickerhoff, Darryl J.


    A fume hood is provided having an adequate level of safety while reducing the amount of air exhausted from the hood. A displacement flow fume hood works on the principal of a displacement flow which displaces the volume currently present in the hood using a push-pull system. The displacement flow includes a plurality of air supplies which provide fresh air, preferably having laminar flow, to the fume hood. The displacement flow fume hood also includes an air exhaust which pulls air from the work chamber in a minimally turbulent manner. As the displacement flow produces a substantially consistent and minimally turbulent flow in the hood, inconsistent flow patterns associated with contaminant escape from the hood are minimized. The displacement flow fume hood largely reduces the need to exhaust large amounts of air from the hood. It has been shown that exhaust air flow reductions of up to 70% are possible without a decrease in the hood's containment performance. The fume hood also includes a number of structural adaptations which facilitate consistent and minimally turbulent flow within a fume hood.

  11. SU-E-I-45: Reconstruction of CT Images From Sparsely-Sampled Data Using the Logarithmic Barrier Method

    SciTech Connect (OSTI)

    Xu, H


    Purpose: To develop and investigate whether the logarithmic barrier (LB) method can result in high-quality reconstructed CT images using sparsely-sampled noisy projection data Methods: The objective function is typically formulated as the sum of the total variation (TV) and a data fidelity (DF) term with a parameter ? that governs the relative weight between them. Finding the optimized value of ? is a critical step for this approach to give satisfactory results. The proposed LB method avoid using ? by constructing the objective function as the sum of the TV and a log function whose augment is the DF term. Newton's method was used to solve the optimization problem. The algorithm was coded in MatLab2013b. Both Shepp-Logan phantom and a patient lung CT image were used for demonstration of the algorithm. Measured data were simulated by calculating the projection data using radon transform. A Poisson noise model was used to account for the simulated detector noise. The iteration stopped when the difference of the current TV and the previous one was less than 1%. Results: Shepp-Logan phantom reconstruction study shows that filtered back-projection (FBP) gives high streak artifacts for 30 and 40 projections. Although visually the streak artifacts are less pronounced for 64 and 90 projections in FBP, the 1D pixel profiles indicate that FBP gives noisier reconstructed pixel values than LB does. A lung image reconstruction is presented. It shows that use of 64 projections gives satisfactory reconstructed image quality with regard to noise suppression and sharp edge preservation. Conclusion: This study demonstrates that the logarithmic barrier method can be used to reconstruct CT images from sparsely-amped data. The number of projections around 64 gives a balance between the over-smoothing of the sharp demarcation and noise suppression. Future study may extend to CBCT reconstruction and improvement on computation speed.

  12. Method of characterizing VOC concentration in vented waste drums with multiple layers of confinement using limited sampling data

    SciTech Connect (OSTI)

    Liekhus, K.J.; Vaughn, M.E.; Jensen, B.A.; Connolly, M.J.


    Characterization of transuranic waste destined for the Waste Isolation Pilot Plant currently requires detailed characterization of the volatile organic compound (VOC) concentration in the void volume headspaces (drum headspace, the large polymer bag headspace, and the innermost layers of confinement headspace) of the waste drums. A test program is underway at the Idaho National Engineering Laboratory (INEL) to determine if the drum headspace VOC concentration is representative of the concentration in the entire drum void space and demonstrate that the VOC concentration in the innermost layer of confinement can be estimated using a model incorporating diffusion and permeation transport principles and limited waste drum sampling data. A comparison of model predictions of VOC concentration in the innermost layer of confinement with actual measurement from transuranic waste drums demonstrate that this method may be useful in characterizing VOC concentration in a vented waste drum.

  13. Statistical assessment of fish behavior from split-beam hydro-acoustic sampling

    SciTech Connect (OSTI)

    McKinstry, Craig A.; Simmons, Mary Ann; Simmons, Carver S.; Johnson, Robert L.


    Statistical methods are presented for using echo-traces from split-beam hydro-acoustic sampling to assess fish behavior in response to a stimulus. The data presented are from a study designed to assess the response of free-ranging, lake-resident fish, primarily kokanee (Oncorhynchus nerka) and rainbow trout (Oncorhynchus mykiss) to high intensity strobe lights, and was conducted at Grand Coulee Dam on the Columbia River in Northern Washington State. The lights were deployed immediately upstream from the turbine intakes, in a region exposed to daily alternating periods of high and low flows. The study design included five down-looking split-beam transducers positioned in a line at incremental distances upstream from the strobe lights, and treatments applied in randomized pseudo-replicate blocks. Statistical methods included the use of odds-ratios from fitted loglinear models. Fish-track velocity vectors were modeled using circular probability distributions. Both analyses are depicted graphically. Study results suggest large increases of fish activity in the presence of the strobe lights, most notably at night and during periods of low flow. The lights also induced notable bimodality in the angular distributions of the fish track velocity vectors. Statistical summaries are presented along with interpretations on fish behavior.

  14. Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples. [Patent application

    DOE Patents [OSTI]

    Caldwell, J.T.; Kunz, W.E.; Cates, M.R.; Franks, L.A.


    Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fission are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for /sup 239/Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

  15. Method and apparatus for transport, introduction, atomization and excitation of emission spectrum for quantitative analysis of high temperature gas sample streams containing vapor and particulates without degradation of sample stream temperature

    DOE Patents [OSTI]

    Eckels, David E.; Hass, William J.


    A sample transport, sample introduction, and flame excitation system for spectrometric analysis of high temperature gas streams which eliminates degradation of the sample stream by condensation losses.

  16. A high sensitivity fiber optic macro-bend based gas flow rate transducer for low flow rates: Theory, working principle, and static calibration

    SciTech Connect (OSTI)

    Schena, Emiliano; Saccomandi, Paola; Silvestri, Sergio


    A novel fiber optic macro-bend based gas flowmeter for low flow rates is presented. Theoretical analysis of the sensor working principle, design, and static calibration were performed. The measuring system consists of: an optical fiber, a light emitting diode (LED), a Quadrant position sensitive Detector (QD), and an analog electronic circuit for signal processing. The fiber tip undergoes a deflection in the flow, acting like a cantilever. The consequent displacement of light spot center is monitored by the QD generating four unbalanced photocurrents which are function of fiber tip position. The analog electronic circuit processes the photocurrents providing voltage signal proportional to light spot position. A circular target was placed on the fiber in order to increase the sensing surface. Sensor, tested in the measurement range up to 10 l min{sup -1}, shows a discrimination threshold of 2 l min{sup -1}, extremely low fluid dynamic resistance (0.17 Pa min l{sup -1}), and high sensitivity, also at low flow rates (i.e., 33 mV min l{sup -1} up to 4 l min{sup -1} and 98 mV min l{sup -1} from 4 l min{sup -1} up to 10 l min{sup -1}). Experimental results agree with the theoretical predictions. The high sensitivity, along with the reduced dimension and negligible pressure drop, makes the proposed transducer suitable for medical applications in neonatal ventilation.

  17. Stopping Power of Different Ions in Si Measured with a Bulk Sample Method and Bayesian Inference Data Analysis

    SciTech Connect (OSTI)

    Barradas, N. P.; Alves, E.; Siketic, Z.; Radovic, I. Bogdanovic


    The accuracy of ion beam analysis experiments depends critically on the stopping power values available. While for H and He ions accuracies normally better than 5% are achieved by usual interpolative schemes such as SRIM, for heavier ions the accuracy is worse. One of the main reasons is that the experimental data bases are very sparse, even for important materials such as Si. New measurements are therefore needed. Measurement of stopping power is often made with transmission in thin films, with the usual problems of film thickness homogeneity. We have previously developed an alternative method based on measuring bulk spectra, and fitting the yield by treating the stopping power as a fit parameter in a Bayesian inference Markov chain Monte Carlo procedure included in the standard IBA code NDF. We report on improvements of the method and on its application to the determination of the stopping power of {sup 7}Li in Si. To validate the method, we also apply it to the stopping of {sup 4}He in Si, which is known with 2% accuracy.

  18. Apparatus and method for quantitative assay of samples of transuranic waste contained in barrels in the presence of matrix material

    DOE Patents [OSTI]

    Caldwell, J.T.; Herrera, G.C.; Hastings, R.D.; Shunk, E.R.; Kunz, W.E.


    Apparatus and method for performing corrections for matrix material effects on the neutron measurements generated from analysis of transuranic waste drums using the differential-dieaway technique. By measuring the absorption index and the moderator index for a particular drum, correction factors can be determined for the effects of matrix materials on the ''observed'' quantity of fissile and fertile material present therein in order to determine the actual assays thereof. A barrel flux monitor is introduced into the measurement chamber to accomplish these measurements as a new contribution to the differential-dieaway technology. 9 figs.

  19. Development testing of the chemical analysis automation polychlorinated biphenyl standard analysis method during surface soils sampling at the David Witherspoon 1630 site

    SciTech Connect (OSTI)

    Hunt, M.A.; Klatt, L.N.; Thompson, D.H.


    The Chemical Analysis Automation (CAA) project is developing standardized, software-driven, site-deployable robotic laboratory systems with the objective of lowering the per-sample analysis cost, decreasing sample turnaround time, and minimizing human exposure to hazardous and radioactive materials associated with DOE remediation projects. The first integrated system developed by the CAA project is designed to determine polychlorinated biphenyls (PCB) content in soil matrices. A demonstration and development testing of this system was conducted in conjuction with surface soil characterization activities at the David Witherspoon 1630 Site in Knoxville, Tennessee. The PCB system consists of five hardware standard laboratory modules (SLMs), one software SLM, the task sequence controller (TSC), and the human-computer interface (HCI). Four of the hardware SLMs included a four-channel Soxhlet extractor, a high-volume concentrator, a column cleanup, and a gas chromatograph. These SLMs performed the sample preparation and measurement steps within the total analysis protocol. The fifth hardware module was a robot that transports samples between the SLMs and the required consumable supplies to the SLMs. The software SLM is an automated data interpretation module that receives raw data from the gas chromatograph SLM and analyzes the data to yield the analyte information. The TSC is a software system that provides the scheduling, management of system resources, and the coordination of all SLM activities. The HCI is a graphical user interface that presents the automated laboratory to the analyst in terms of the analytical procedures and methods. Human control of the automated laboratory is accomplished via the HCI. Sample information required for processing by the automated laboratory is entered through the HCI. Information related to the sample and the system status is presented to the analyst via graphical icons.

  20. Implementation and testing of the on-the-fly thermal scattering Monte Carlo sampling method for graphite and light water in MCNP6


    Pavlou, Andrew T.; Ji, Wei; Brown, Forrest B.


    Here, a proper treatment of thermal neutron scattering requires accounting for chemical binding through a scattering law S(α,β,T). Monte Carlo codes sample the secondary neutron energy and angle after a thermal scattering event from probability tables generated from S(α,β,T) tables at discrete temperatures, requiring a large amount of data for multiscale and multiphysics problems with detailed temperature gradients. We have previously developed a method to handle this temperature dependence on-the-fly during the Monte Carlo random walk using polynomial expansions in 1/T to directly sample the secondary energy and angle. In this paper, the on-the-fly method is implemented into MCNP6 andmore » tested in both graphite-moderated and light water-moderated systems. The on-the-fly method is compared with the thermal ACE libraries that come standard with MCNP6, yielding good agreement with integral reactor quantities like k-eigenvalue and differential quantities like single-scatter secondary energy and angle distributions. The simulation runtimes are comparable between the two methods (on the order of 5–15% difference for the problems tested) and the on-the-fly fit coefficients only require 5–15 MB of total data storage.« less

  1. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, David A.; Keller, Richard A.


    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect has been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical pathlength of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10.sup.-5 cm.sup.-1 can then be determined in the presence of background absorptions in excess of 10.sup.-3 cm.sup.-1. In addition, the smallest absorption measured with the instant apparatus and method is about 5.times. 10.sup.-6 cm.sup.-1.

  2. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, D.A.; Keller, R.A.


    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect have been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical path length of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10[sup [minus]5] cm[sup [minus]1] can then be determined in the presence of background absorptions in excess of 10[sup [minus]3] cm[sup [minus]1]. In addition, the smallest absorption measured with the instant apparatus and method is about 5 [times] 10[sup [minus]6] cm[sup [minus]1]. 6 figs.

  3. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, D.A.; Keller, R.A.


    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect has been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical pathlength of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10/sup -5/ cm/sup -1/ can then be determined in the presence of background absorptions in excess of 10/sup -3/ cm/sup -1/. In addition, the smallest absorption measured with the instant apparatus and method is about 5 x 10/sup -6/ cm/sup -1/.

  4. Study on critical heat flux enhancement in flow boiling of SiC nano-fluids under low pressure and low flow conditions

    SciTech Connect (OSTI)

    Lee, S. W.; Park, S. D.; Kang, S.; Kim, S. M.; Seo, H.; Lee, D. W.; Bang, I. C.


    Critical heat flux (CHF) is the thermal limit of a phenomenon in which a phase change occurs during heating (such as bubbles forming on a metal surface used to heat water), which suddenly decreases the heat transfer efficiency, thus causing localized overheating of the heating surface. The enhancement of CHF can increase the safety margins and allow operation at higher heat fluxes; thus, it can increase the economy. A very interesting characteristics of nano-fluids is their ability to significantly enhance the CHF. nano-fluids are nano-technology-based colloidal dispersions engineered through stable suspending of nanoparticles. All experiments were performed in round tubes with an inner diameter of 0.01041 m and a length of 0.5 m under low pressure and low flow (LPLF) conditions at a fixed inlet temperature using water, 0.01 vol. % Al{sub 2}O{sub 3}/water and SiC/water nano-fluids. It was found that the CHF of the nano-fluids was enhanced and the CHF of the SiC/water nano-fluid was more enhanced than that of the Al{sub 2}O{sub 3}/water nano-fluid. (authors)

  5. False Negative Rates of a Macrofoam-Swab Sampling Method with Low Surface Concentrations of Two Bacillus anthracis Surrogates via Real-Time PCR

    SciTech Connect (OSTI)

    Hutchison, Janine R.; Piepel, Gregory F.; Amidan, Brett G.; Sydor, Michael A.; Deatherage Kaiser, Brooke L


    Surface sampling for Bacillus anthracis spores has traditionally relied on detection via bacterial cultivation methods. Although effective, this approach does not provide the level of organism specificity that can be gained through molecular techniques. False negative rates (FNR) and limits of detection (LOD) were determined for two B. anthracis surrogates with modified rapid viability-polymerase chain reaction (mRV-PCR) following macrofoam-swab sampling. This study was conducted in parallel with a previously reported study that analyzed spores using a plate-culture method. B. anthracis Sterne (BAS) or B. atrophaeus Nakamura (BG) spores were deposited onto four surface materials (glass, stainless steel, vinyl tile, and plastic) at nine target concentrations (2 to 500 spores/coupon; 0.078 to 19.375 colony-forming units [CFU] per cm²). Mean FNR values for mRV-PCR analysis ranged from 0 to 0.917 for BAS and 0 to 0.875 for BG and increased as spore concentration decreased (over the concentrations investigated) for each surface material. FNRs based on mRV-PCR data were not statistically different for BAS and BG, but were significantly lower for glass than for vinyl tile. FNRs also tended to be lower for the mRV-PCR method compared to the culture method. The mRV-PCR LOD₉₅ was lowest for glass (0.429 CFU/cm² with BAS and 0.341 CFU/cm² with BG) and highest for vinyl tile (0.919 CFU/cm² with BAS and 0.917 CFU/cm² with BG). These mRV-PCR LOD₉₅ values were lower than the culture values (BAS: 0.678 to 1.023 CFU/cm² and BG: 0.820 to 1.489 CFU/cm²). The FNR and LOD₉₅ values reported in this work provide guidance for environmental sampling of Bacillus spores at low concentrations.

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... The gross alpha, gross beta, radium-226, and radium-228 method blank results were below the DLC. Inductively Coupled Plasma (ICP) Interference Check Sample (ICS) Analysis ICP ...

  7. Hazard surveillance for workplace magnetic fields. 1: Walkaround sampling method for measuring ambient field magnitude; 2: Field characteristics from waveform measurements

    SciTech Connect (OSTI)

    Methner, M.M.; Bowman, J.D.


    Recent epidemiologic research has suggested that exposure to extremely low frequency (ELF) magnetic fields (MF) may be associated with leukemia, brain cancer, spontaneous abortions, and Alzheimer`s disease. A walkaround sampling method for measuring ambient ELF-MF levels was developed for use in conducting occupational hazard surveillance. This survey was designed to determine the range of MF levels at different industrial facilities so they could be categorized by MF levels and identified for possible subsequent personal exposure assessments. Industries were selected based on their annual electric power consumption in accordance with the hypothesis that large power consumers would have higher ambient MFs when compared with lower power consumers. Sixty-two facilities within thirteen 2-digit Standard Industrial Classifications (SIC) were selected based on their willingness to participate. A traditional industrial hygiene walkaround survey was conducted to identify MF sources, with a special emphasis on work stations.

  8. Recovery Efficiency, False Negative Rate, and Limit of Detection Performance of a Validated Macrofoam-Swab Sampling Method with Low Surface Concentrations of Two Bacillus anthracis Surrogates

    SciTech Connect (OSTI)

    Piepel, Gregory F.; Hutchison, Janine R.; Deatherage Kaiser, Brooke L; Amidan, Brett G.; Sydor, Michael A.; Barrett, Christopher A.


    The performance of a macrofoam-swab sampling method was evaluated using Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus Nakamura (BG) spores applied at nine low target amounts (2-500 spores) to positive-control plates and test coupons (2 in. × 2 in.) of four surface materials (glass, stainless steel, vinyl tile, and plastic). Test results from cultured samples were used to evaluate the effects of surrogate, surface concentration, and surface material on recovery efficiency (RE), false negative rate (FNR), and limit of detection. For RE, surrogate and surface material had statistically significant effects, but concentration did not. Mean REs were the lowest for vinyl tile (50.8% with BAS, 40.2% with BG) and the highest for glass (92.8% with BAS, 71.4% with BG). FNR values ranged from 0 to 0.833 for BAS and 0 to 0.806 for BG, with values increasing as concentration decreased in the range tested (0.078 to 19.375 CFU/cm2, where CFU denotes ‘colony forming units’). Surface material also had a statistically significant effect. A FNR-concentration curve was fit for each combination of surrogate and surface material. For both surrogates, the FNR curves tended to be the lowest for glass and highest for vinyl title. The FNR curves for BG tended to be higher than for BAS at lower concentrations, especially for glass. Results using a modified Rapid Viability-Polymerase Chain Reaction (mRV-PCR) analysis method were also obtained. The mRV-PCR results and comparisons to the culture results will be discussed in a subsequent report.

  9. Stochastic Engine Final Report: Applying Markov Chain Monte Carlo Methods with Importance Sampling to Large-Scale Data-Driven Simulation

    SciTech Connect (OSTI)

    Glaser, R E; Johannesson, G; Sengupta, S; Kosovic, B; Carle, S; Franz, G A; Aines, R D; Nitao, J J; Hanley, W G; Ramirez, A L; Newmark, R L; Johnson, V M; Dyer, K M; Henderson, K A; Sugiyama, G A; Hickling, T L; Pasyanos, M E; Jones, D A; Grimm, R J; Levine, R A


    Accurate prediction of complex phenomena can be greatly enhanced through the use of data and observations to update simulations. The ability to create these data-driven simulations is limited by error and uncertainty in both the data and the simulation. The stochastic engine project addressed this problem through the development and application of a family of Markov Chain Monte Carlo methods utilizing importance sampling driven by forward simulators to minimize time spent search very large state spaces. The stochastic engine rapidly chooses among a very large number of hypothesized states and selects those that are consistent (within error) with all the information at hand. Predicted measurements from the simulator are used to estimate the likelihood of actual measurements, which in turn reduces the uncertainty in the original sample space via a conditional probability method called Bayesian inferencing. This highly efficient, staged Metropolis-type search algorithm allows us to address extremely complex problems and opens the door to solving many data-driven, nonlinear, multidimensional problems. A key challenge has been developing representation methods that integrate the local details of real data with the global physics of the simulations, enabling supercomputers to efficiently solve the problem. Development focused on large-scale problems, and on examining the mathematical robustness of the approach in diverse applications. Multiple data types were combined with large-scale simulations to evaluate systems with {approx}{sup 10}20,000 possible states (detecting underground leaks at the Hanford waste tanks). The probable uses of chemical process facilities were assessed using an evidence-tree representation and in-process updating. Other applications included contaminant flow paths at the Savannah River Site, locating structural flaws in buildings, improving models for seismic travel times systems used to monitor nuclear proliferation, characterizing the source

  10. Protections: Sampling

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Protections: Sampling Protections: Sampling Protection #3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece of the Strategy, ensures that LANL collects relevant and appropriate data to answer questions about the protection of human and environmental health, and to satisfy regulatory requirements. LANL must demonstrate the data are technically justified

  11. Protections: Sampling

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Protection 3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental ...

  12. Protections: Sampling

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece...

  13. Development and Evaluation of an Externally Air-Cooled Low-Flow torch and the Attenuation of Space Charge and Matrix Effects in Inductively Coupled Plasma Mass Spectrometry

    SciTech Connect (OSTI)

    Praphairaksit, N.


    An externally air-cooled low-flow torch has been constructed and successfully demonstrated for applications in inductively coupled plasma mass spectrometry (ICP-MS). The torch is cooled by pressurized air flowing at {approximately}70 L/min through a quartz air jacket onto the exterior of the outer tube. The outer gas flow rate and operating RF forward power are reduced considerably. Although plasmas can be sustained at the operating power as low as 400 W with a 2 L/min of outer gas flow, somewhat higher power and outer gas flows are advisable. A stable and analytical useful plasma can be obtained at 850 W with an outer gas flow rate of {approximately}4 L/min. Under these conditions, the air-cooled plasma produces comparable sensitivities, doubly charged ion ratios, matrix effects and other analytical merits as those produced by a conventional torch while using significantly less argon and power requirements. Metal oxide ion ratios are slightly higher with the air-cooled plasma but can be mitigated by reducing the aerosol gas flow rate slightly with only minor sacrifice in analyte sensitivity. A methodology to alleviate the space charge and matrix effects in ICP-MS has been developed. A supplemental electron source adapted from a conventional electron impact ionizer is added to the base of the skimmer. Electrons supplied from this source downstream of the skimmer with suitable amount and energy can neutralize the positive ions in the beam extracted from the plasma and diminish the space charge repulsion between them. As a result, the overall ion transmission efficiency and consequent analyte ion sensitivities are significantly improved while other important analytical aspects, such as metal oxide ion ratio, doubly charged ion ratio and background ions remain relatively unchanged with the operation of this electron source. This technique not only improves the ion transmission efficiency but also minimizes the matrix effects drastically. The matrix-induced suppression

  14. Sample Proficiency Test exercise

    SciTech Connect (OSTI)

    Alcaraz, A; Gregg, H; Koester, C


    The current format of the OPCW proficiency tests has multiple sets of 2 samples sent to an analysis laboratory. In each sample set, one is identified as a sample, the other as a blank. This method of conducting proficiency tests differs from how an OPCW designated laboratory would receive authentic samples (a set of three containers, each not identified, consisting of the authentic sample, a control sample, and a blank sample). This exercise was designed to test the reporting if the proficiency tests were to be conducted. As such, this is not an official OPCW proficiency test, and the attached report is one method by which LLNL might report their analyses under a more realistic testing scheme. Therefore, the title on the report ''Report of the Umpteenth Official OPCW Proficiency Test'' is meaningless, and provides a bit of whimsy for the analyses and readers of the report.


    DOE Patents [OSTI]

    Hannaford, B.A.; Rosenberg, R.; Segaser, C.L.; Terry, C.L.


    An apparatus is given for the batch sampling of radioactive liquids such as slurries from a system by remote control, while providing shielding for protection of operating personnel from the harmful effects of radiation.

  16. Sampling box

    DOE Patents [OSTI]

    Phillips, Terrance D.; Johnson, Craig


    An air sampling box that uses a slidable filter tray and a removable filter cartridge to allow for the easy replacement of a filter which catches radioactive particles is disclosed.


    DOE Patents [OSTI]

    Sugarman, R.M.


    An oscilloscope is designed for displaying transient signal waveforms having random time and amplitude distributions. The oscilloscopc is a sampling device that selects for display a portion of only those waveforms having a particular range of amplitudes. For this purpose a pulse-height analyzer is provided to screen the pulses. A variable voltage-level shifter and a time-scale rampvoltage generator take the pulse height relative to the start of the waveform. The variable voltage shifter produces a voltage level raised one step for each sequential signal waveform to be sampled and this results in an unsmeared record of input signal waveforms. Appropriate delay devices permit each sample waveform to pass its peak amplitude before the circuit selects it for display.

  18. Sampling apparatus

    DOE Patents [OSTI]

    Gordon, Norman R.; King, Lloyd L.; Jackson, Peter O.; Zulich, Alan W.


    A sampling apparatus is provided for sampling substances from solid surfaces. The apparatus includes first and second elongated tubular bodies which telescopically and sealingly join relative to one another. An absorbent pad is mounted to the end of a rod which is slidably received through a passageway in the end of one of the joined bodies. The rod is preferably slidably and rotatably received through the passageway, yet provides a selective fluid tight seal relative thereto. A recess is formed in the rod. When the recess and passageway are positioned to be coincident, fluid is permitted to flow through the passageway and around the rod. The pad is preferably laterally orientable relative to the rod and foldably retractable to within one of the bodies. A solvent is provided for wetting of the pad and solubilizing or suspending the material being sampled from a particular surface.

  19. Sampling apparatus

    DOE Patents [OSTI]

    Gordon, N.R.; King, L.L.; Jackson, P.O.; Zulich, A.W.


    A sampling apparatus is provided for sampling substances from solid surfaces. The apparatus includes first and second elongated tubular bodies which telescopically and sealingly join relative to one another. An absorbent pad is mounted to the end of a rod which is slidably received through a passageway in the end of one of the joined bodies. The rod is preferably slidably and rotatably received through the passageway, yet provides a selective fluid tight seal relative thereto. A recess is formed in the rod. When the recess and passageway are positioned to be coincident, fluid is permitted to flow through the passageway and around the rod. The pad is preferably laterally orientable relative to the rod and foldably retractable to within one of the bodies. A solvent is provided for wetting of the pad and solubilizing or suspending the material being sampled from a particular surface. 15 figs.

  20. Method and apparatus utilizing ionizing and microwave radiation for saturation determination of water, oil and a gas in a core sample

    DOE Patents [OSTI]

    Maerefat, N.L.; Parmeswar, R.; Brinkmeyer, A.D.; Honarpour, M.


    A system is described for determining the relative permeabilities of gas, water and oil in a core sample has a microwave emitter/detector subsystem and an X-ray emitter/detector subsystem. A core holder positions the core sample between microwave absorbers which prevent diffracted microwaves from reaching a microwave detector where they would reduce the signal-to-noise ratio of the microwave measurements. The microwave emitter/detector subsystem and the X-ray emitter/detector subsystem each have linear calibration characteristics, allowing one subsystem to be calibrated with respect to the other subsystem. The dynamic range of microwave measurements is extended through the use of adjustable attenuators. This also facilitates the use of core samples with wide diameters. The stratification characteristics of the fluids may be observed with a windowed cell separator at the outlet of the core sample. The condensation of heavy hydrocarbon gas and the dynamic characteristics of the fluids are observed with a sight glass at the outlet of the core sample. 11 figs.

  1. Method and apparatus utilizing ionizing and microwave radiation for saturation determination of water, oil and a gas in a core sample

    DOE Patents [OSTI]

    Maerefat, Nicida L.; Parmeswar, Ravi; Brinkmeyer, Alan D.; Honarpour, Mehdi


    A system for determining the relative permeabilities of gas, water and oil in a core sample has a microwave emitter/detector subsystem and an X-ray emitter/detector subsystem. A core holder positions the core sample between microwave absorbers which prevent diffracted microwaves from reaching a microwave detector where they would reduce the signal-to-noise ratio of the microwave measurements. The microwave emitter/detector subsystem and the X-ray emitter/detector subsystem each have linear calibration characteristics, allowing one subsystem to be calibrated with respect to the other subsystem. The dynamic range of microwave measurements is extended through the use of adjustable attenuators. This also facilitates the use of core samples with wide diameters. The stratification characteristics of the fluids may be observed with a windowed cell separator at the outlet of the core sample. The condensation of heavy hydrocarbon gas and the dynamic characteristics of the fluids are observed with a sight glass at the outlet of the core sample.

  2. Method for determination of .sup.18 O/.sup.16 O and .sup.2 H/.sup.1 H ratios and .sup.3 H (tritium) concentrations of xylem waters and subsurface waters using time series sampling

    DOE Patents [OSTI]

    Smith, Brian; Menchaca, Leticia


    A method for determination of .sup.18 O/.sup.16 O and .sup.2 H/.sup.1 H ratios and .sup.3 H concentrations of xylem and subsurface waters using time series sampling, insulating sampling chambers, and combined .sup.18 O/.sup.16 O, .sup.2 H/.sup.1 H and .sup.3 H concentration data on transpired water. The method involves collecting water samples transpired from living plants and correcting the measured isotopic compositions of oxygen (.sup.18 O/.sup.16 O) and hydrogen (.sup.2 H/.sup.1 H and/or .sup.3 H concentrations) to account for evaporative isotopic fractionation in the leafy material of the plant.

  3. Measurement of the top quark mass at CDF using the `neutrino phi weighting' template method on a lepton plus isolated track sample

    SciTech Connect (OSTI)

    Aaltonen, T.; Adelman, J.; Akimoto, T.; Alvarez Gonzalez, B.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Apresyan, A.; /Purdue U. /Waseda U.


    We present a measurement of the top quark mass with t{bar t} dilepton events produced in p{bar p} collisions at the Fermilab Tevatron ({radical}s = 1.96 TeV) and collected by the CDF II detector. A sample of 328 events with a charged electron or muon and an isolated track, corresponding to an integrated luminosity of 2.9 fb{sup -1}, are selected as t{bar t} candidates. To account for the unconstrained event kinematics, we scan over the phase space of the azimuthal angles ({phi}{sub {nu}1}, {phi}{sub {nu}2}) of neutrinos and reconstruct the top quark mass for each {phi}{sub {nu}1}, {phi}{sub {nu}2} pair by minimizing a {chi}{sup 2} function in the t{bar t} dilepton hypothesis. We assign {chi}{sup 2}-dependent weights to the solutions in order to build a preferred mass for each event. Preferred mass distributions (templates) are built from simulated t{bar t} and background events, and parameterized in order to provide continuous probability density functions. A likelihood fit to the mass distribution in data as a weighted sum of signal and background probability density functions gives a top quark mass of 165.5{sub -3.3}{sup +3.4}(stat.){+-}3.1(syst.) GeV/c{sup 2}.

  4. Ball assisted device for analytical surface sampling

    SciTech Connect (OSTI)

    ElNaggar, Mariam S; Van Berkel, Gary J; Covey, Thomas R


    A system for sampling a surface includes a sampling probe having a housing and a socket, and a rolling sampling sphere within the socket. The housing has a sampling fluid supply conduit and a sampling fluid exhaust conduit. The sampling fluid supply conduit supplies sampling fluid to the sampling sphere. The sampling fluid exhaust conduit has an inlet opening for receiving sampling fluid carried from the surface by the sampling sphere. A surface sampling probe and a method for sampling a surface are also disclosed.

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Salmon, Mississippi, Site, Water Sampling Location Map .........5 Water Sampling Field Activities Verification ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........1 Water Sampling Locations at the Rulison, .........3 Water Sampling Field Activities Verification ...

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Slick Rock, Colorado, Processing Sites .........7 Water Sampling Field Activities Verification ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Green River, Utah, Disposal Site August 2014 LMSGRN.........7 Water Sampling Field Activities Verification ...

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and May 2014 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal .........9 Water Sampling Field Activities Verification ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2014 LMSRBLS00514 .........5 Water Sampling Field Activities Verification ...

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Rulison, Colorado, Site November 2014 LMS.........3 Water Sampling Field Activities Verification ...

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Rulison, Colorado, Site October 2015 LMS.........5 Water Sampling Field Activities Verification ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2015 LMSMNT.........7 Water Sampling Field Activities Verification ...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    2015 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal Site .........9 Water Sampling Field Activities Verification ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2015 LMSRBLS00515 .........5 Water Sampling Field Activities Verification ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Produced Water Sampling at the Rulison, Colorado, Site May 2015 LMSRULS00115 Available .........3 Water Sampling Field Activities Verification ...

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Gasbuggy, New Mexico, Site December 2013 .........5 Water Sampling Field Activities Verification ...

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Produced Water Sampling at the Rulison, Colorado, Site January 2016 LMSRULS00915 .........3 Water Sampling Field Activities Verification ...

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Groundwater and Surface Water Sampling at the Monument Valley, Arizona, Processing Site .........7 Water Sampling Field Activities Verification ...

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    July 2015 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing .........5 Water Sampling Field Activities Verification ...

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2014 LMSMNT.........7 Water Sampling Field Activities Verification ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Water Sampling at the Monticello, Utah, Processing Site January 2014 LMSMNTS01013 This .........7 Water Sampling Field Activities Verification ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Naturita, Colorado Processing Site October 2013 LMSNAP.........5 Water Sampling Field Activities Verification ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing Site .........5 Water Sampling Field Activities Verification ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Tuba City, Arizona, Disposal Site November 2013 LMSTUB.........9 Water Sampling Field Activities Verification ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Monticello, Utah, Processing Site January .........7 Water Sampling Field Activities Verification ...

  7. Pulsed field sample neutralization

    DOE Patents [OSTI]

    Appelhans, Anthony D.; Dahl, David A.; Delmore, James E.


    An apparatus and method for alternating voltage and for varying the rate of extraction during the extraction of secondary particles, resulting in periods when either positive ions, or negative ions and electrons are extracted at varying rates. Using voltage with alternating charge during successive periods to extract particles from materials which accumulate charge opposite that being extracted causes accumulation of surface charge of opposite sign. Charge accumulation can then be adjusted to a ratio which maintains a balance of positive and negative charge emission, thus maintaining the charge neutrality of the sample.

  8. LCLS Sample Preparation Laboratory | Sample Preparation Laboratories

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    LCLS Sample Preparation Laboratory Kayla Zimmerman | (650) 926-6281 Lisa Hammon, LCLS Lab Coordinator Welcome to the LCLS Sample Preparation Laboratory. This small general use wet lab is located in Rm 109 of the Far Experimental Hall near the MEC, CXI, and XCS hutches. It conveniently serves all LCLS hutches and is available for final stage sample preparation. Due to space limitations, certain types of activities may be restricted and all access must be scheduled in advance. User lab bench

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... Inductively Coupled Plasma (ICP) Interference Check Sample (ICS) Analysis ICP interference check samples ICSA and ICSAB were analyzed at the required frequency to verify the ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Tuba City, Arizona Disposal Site June 2015 .........7 Water Sampling Field Activities Verification ...

  11. Visual Sample Plan Flyer

    Office of Energy Efficiency and Renewable Energy (EERE)

    This flyer better explains that VSP is a free, easy-to-use software tool that supports development of optimal sampling plans based on statistical sampling theory.

  12. Principles for Sampling Airborne Radioactivity from Stacks

    SciTech Connect (OSTI)

    Glissmeyer, John A.


    This book chapter describes the special processes involved in sampling the airborne effluents from nuclear faciities. The title of the book is Radioactive Air Sampling Methods. The abstract for this chapter was cleared as PNNL-SA-45941.

  13. Acceptance sampling using judgmental and randomly selected samples

    SciTech Connect (OSTI)

    Sego, Landon H.; Shulman, Stanley A.; Anderson, Kevin K.; Wilson, John E.; Pulsipher, Brent A.; Sieber, W. Karl


    We present a Bayesian model for acceptance sampling where the population consists of two groups, each with different levels of risk of containing unacceptable items. Expert opinion, or judgment, may be required to distinguish between the high and low-risk groups. Hence, high-risk items are likely to be identifed (and sampled) using expert judgment, while the remaining low-risk items are sampled randomly. We focus on the situation where all observed samples must be acceptable. Consequently, the objective of the statistical inference is to quantify the probability that a large percentage of the unsampled items in the population are also acceptable. We demonstrate that traditional (frequentist) acceptance sampling and simpler Bayesian formulations of the problem are essentially special cases of the proposed model. We explore the properties of the model in detail, and discuss the conditions necessary to ensure that required samples sizes are non-decreasing function of the population size. The method is applicable to a variety of acceptance sampling problems, and, in particular, to environmental sampling where the objective is to demonstrate the safety of reoccupying a remediated facility that has been contaminated with a lethal agent.

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data ...

  15. Fluid sampling tool

    DOE Patents [OSTI]

    Garcia, Anthony R.; Johnston, Roger G.; Martinez, Ronald K.


    A fluid-sampling tool for obtaining a fluid sample from a container. When used in combination with a rotatable drill, the tool bores a hole into a container wall, withdraws a fluid sample from the container, and seals the borehole. The tool collects fluid sample without exposing the operator or the environment to the fluid or to wall shavings from the container.

  16. The Sample Preparation Laboratories | Sample Preparation Laboratories

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Cynthia Patty 1 Sam Webb 2 John Bargar 3 Arizona 4 Chemicals 5 Team Work 6 Bottles 7 Glass 8 Plan Ahead! See the tabs above for Laboratory Access and forms you'll need to complete. Equipment and Chemicals tabs detail resources already available on site. Avoid delays! Hazardous materials use may require a written Standard Operating Procedure (SOP) before you work. Check the Chemicals tab for more information. The Sample Preparation Laboratories The Sample Preparation Laboratories provide wet lab

  17. Rain sampling device

    DOE Patents [OSTI]

    Nelson, D.A.; Tomich, S.D.; Glover, D.W.; Allen, E.V.; Hales, J.M.; Dana, M.T.


    The present invention constitutes a rain sampling device adapted for independent operation at locations remote from the user which allows rainfall to be sampled in accordance with any schedule desired by the user. The rain sampling device includes a mechanism for directing wet precipitation into a chamber, a chamber for temporarily holding the precipitation during the process of collection, a valve mechanism for controllably releasing samples of the precipitation from the chamber, a means for distributing the samples released from the holding chamber into vessels adapted for permanently retaining these samples, and an electrical mechanism for regulating the operation of the device. 11 figures.

  18. Rain sampling device

    DOE Patents [OSTI]

    Nelson, Danny A.; Tomich, Stanley D.; Glover, Donald W.; Allen, Errol V.; Hales, Jeremy M.; Dana, Marshall T.


    The present invention constitutes a rain sampling device adapted for independent operation at locations remote from the user which allows rainfall to be sampled in accordance with any schedule desired by the user. The rain sampling device includes a mechanism for directing wet precipitation into a chamber, a chamber for temporarily holding the precipitation during the process of collection, a valve mechanism for controllably releasing samples of said precipitation from said chamber, a means for distributing the samples released from the holding chamber into vessels adapted for permanently retaining these samples, and an electrical mechanism for regulating the operation of the device.

  19. Selection of Sampling Pumps Used for Groundwater Monitoring at the Hanford Site

    SciTech Connect (OSTI)

    Schalla, Ronald; Webber, William D.; Smith, Ronald M.


    The variable frequency drive centrifugal submersible pump, Redi-Flo2a made by Grundfosa, was selected for universal application for Hanford Site groundwater monitoring. Specifications for the selected pump and five other pumps were evaluated against current and future Hanford groundwater monitoring performance requirements, and the Redi-Flo2 was selected as the most versatile and applicable for the range of monitoring conditions. The Redi-Flo2 pump distinguished itself from the other pumps considered because of its wide range in output flow rate and its comparatively moderate maintenance and low capital costs. The Redi-Flo2 pump is able to purge a well at a high flow rate and then supply water for sampling at a low flow rate. Groundwater sampling using a low-volume-purging technique (e.g., low flow, minimal purge, no purge, or micropurgea) is planned in the future, eliminating the need for the pump to supply a high-output flow rate. Under those conditions, the Well Wizard bladder pump, manufactured by QED Environmental Systems, Inc., may be the preferred pump because of the lower capital cost.

  20. Analysis procedure for americium in environmental samples

    SciTech Connect (OSTI)

    Holloway, R.W.; Hayes, D.W.


    Several methods for the analysis of /sup 241/Am in environmental samples were evaluated and a preferred method was selected. This method was modified and used to determine the /sup 241/Am content in sediments, biota, and water. The advantages and limitations of the method are discussed. The method is also suitable for /sup 244/Cm analysis.

  1. Water and Sediment Sampling

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    MDC Blank 7222014 Below MDC Below MDC Water Sampling Results Location Sample Date WIPP ... Tut Tank 3132014 Below MDC Below MDC Fresh Water Tank 3122014 Below MDC Below MDC Hill ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... 100, 17B, 1A, 72, and 81 were classified as Category II. The sample results were qualified with a "Q" flag, indicating the data are qualitative because of the sampling technique. ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... the applicable MDL. Inductively Coupled Plasma Interference Check Sample Analysis ... and background correction factors for all inductively coupled plasma instruments. ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........7 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Time-Concentration Graphs ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........9 Water Sampling Field Activities Verification ... Data Durango Processing Site Surface Water Quality Data Equipment Blank Data Static ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........3 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Natural Gas Analysis Data ...

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrographs Time-Concentration ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrograph Time-Concentration ...

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Time-Concentration Graph ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Quality Data Equipment Blank Data Static Water Level Data Time-Concentration Graphs ...

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Time-Concentration Graphs ...

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........9 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Static Water Level Data ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........3 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Time-Concentration Graphs ...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........7 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data Static ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data Static ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Water Sampling at the Ambrosia Lake, New Mexico, Disposal Site February 2015 LMS/AMB/S01114 This page intentionally left blank U.S. Department of Energy DVP-November 2014, Ambrosia Lake, New Mexico February 2015 RIN 14116607 Page i Contents Sampling Event Summary ...............................................................................................................1 Ambrosia Lake, NM, Disposal Site Planned Sampling Map...........................................................3 Data

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Sampling at the Ambrosia Lake, New Mexico, Disposal Site March 2016 LMS/AMB/S01215 This page intentionally left blank U.S. Department of Energy DVP-December 2015, Ambrosia Lake, New Mexico March 2016 RIN 15117494 Page i Contents Sampling Event Summary ...............................................................................................................1 Ambrosia Lake, NM, Disposal Site Planned Sampling Map...........................................................3 Data Assessment

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    October 2013 Groundwater Sampling at the Bluewater, New Mexico, Disposal Site December 2013 LMS/BLU/S00813 This page intentionally left blank U.S. Department of Energy DVP-August and October 2013, Bluewater, New Mexico December 2013 RIN 13085537 and 13095651 Page i Contents Sampling Event Summary ...............................................................................................................1 Private Wells Sampled August 2013 and October 2013, Bluewater, NM, Disposal Site

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monument Valley, Arizona, Processing Site February 2015 LMS/MON/S01214 This page intentionally left blank U.S. Department of Energy DVP-December 2014, Monument Valley, Arizona February 2015 RIN 14126645 Page i Contents Sampling Event Summary ...............................................................................................................1 Monument Valley, Arizona, Disposal Site Sample Location Map ..................................................5

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Alternate Water Supply System Sampling at the Riverton, Wyoming, Processing Site May 2014 LMS/RVT/S00314 This page intentionally left blank U.S. Department of Energy DVP-March 2014, Riverton, Wyoming May 2014 RIN 14035986 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, WY, Processing Site, Sample Location Map ...................................................................3 Data

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    February 2015 Groundwater and Surface Water Sampling at the Grand Junction, Colorado, Site April 2015 LMS/GJO/S00215 This page intentionally left blank U.S. Department of Energy DVP-February 2015, Grand Junction, Colorado, Site April 2015 RIN 15026795 Page i Contents Sampling Event Summary ...............................................................................................................1 Grand Junction, Colorado, Site Sample Location Map

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Sampling at the Grand Junction, Colorado, Disposal Site November 2013 LMS/GRJ/S00813 This page intentionally left blank U.S. Department of Energy DVP-August 2013, Grand Junction, Colorado November 2013 RIN 13075515 Page i Contents Sampling Event Summary ...............................................................................................................1 Grand Junction, Colorado, Disposal Site Sample Location Map ....................................................3 Data Assessment

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Old and New Rifle, Colorado, Processing Sites August 2013 LMS/RFN/RFO/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Rifle, Colorado August 2013 RIN 13065380 Page i Contents Sampling Event Summary ...............................................................................................................1 Sample Location Map, New Rifle, Colorado, Processing Site ........................................................5 Sample Location Map, Old Rifle,

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Groundwater and Surface Water Sampling at the Slick Rock East and West, Colorado, Processing Sites November 2013 LMS/SRE/SRW/S0913 This page intentionally left blank U.S. Department of Energy DVP-September 2013, Slick Rock, Colorado November 2013 RIN 13095593 Page i Contents Sampling Event Summary ...............................................................................................................1 Slick Rock East and West, Colorado, Processing Sites, Sample Location Map

  5. Aerosol sampling system

    DOE Patents [OSTI]

    Masquelier, Donald A.


    A system for sampling air and collecting particulate of a predetermined particle size range. A low pass section has an opening of a preselected size for gathering the air but excluding particles larger than the sample particles. An impactor section is connected to the low pass section and separates the air flow into a bypass air flow that does not contain the sample particles and a product air flow that does contain the sample particles. A wetted-wall cyclone collector, connected to the impactor section, receives the product air flow and traps the sample particles in a liquid.

  6. Defining And Characterizing Sample Representativeness For DWPF Melter Feed Samples

    SciTech Connect (OSTI)

    Shine, E. P.; Poirier, M. R.


    Representative sampling is important throughout the Defense Waste Processing Facility (DWPF) process, and the demonstrated success of the DWPF process to achieve glass product quality over the past two decades is a direct result of the quality of information obtained from the process. The objective of this report was to present sampling methods that the Savannah River Site (SRS) used to qualify waste being dispositioned at the DWPF. The goal was to emphasize the methodology, not a list of outcomes from those studies. This methodology includes proven methods for taking representative samples, the use of controlled analytical methods, and data interpretation and reporting that considers the uncertainty of all error sources. Numerous sampling studies were conducted during the development of the DWPF process and still continue to be performed in order to evaluate options for process improvement. Study designs were based on use of statistical tools applicable to the determination of uncertainties associated with the data needs. Successful designs are apt to be repeated, so this report chose only to include prototypic case studies that typify the characteristics of frequently used designs. Case studies have been presented for studying in-tank homogeneity, evaluating the suitability of sampler systems, determining factors that affect mixing and sampling, comparing the final waste glass product chemical composition and durability to that of the glass pour stream sample and other samples from process vessels, and assessing the uniformity of the chemical composition in the waste glass product. Many of these studies efficiently addressed more than one of these areas of concern associated with demonstrating sample representativeness and provide examples of statistical tools in use for DWPF. The time when many of these designs were implemented was in an age when the sampling ideas of Pierre Gy were not as widespread as they are today. Nonetheless, the engineers and

  7. May 2015 Groundwater Sampling at the Shoal, Nevada, Site

    Office of Legacy Management (LM)

    ... The radiochemistry method blank results were less than the DLC. Inductively Coupled Plasma Interference Check Sample Analysis Interference check samples were analyzed at the ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and September 2013 Groundwater and Surface Water Sampling at the Durango, Colorado, Disposal and Processing Sites March 2014 LMS/DUD/DUP/S00613 This page intentionally left blank U.S. Department of Energy DVP-June and September 2013, Durango, Colorado March 2014 RIN 13055370 and 13085577 Page i Contents Sampling Event Summary ...............................................................................................................1 Durango, Colorado, Disposal Site Sample Location Map-June

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Groundwater, Surface Water, and Alternate Water Supply System Sampling at the Riverton, Wyoming, Processing Site December 2013 LMSRVTS00913 This page intentionally left blank ...

  10. Creating Sample Plans

    Energy Science and Technology Software Center (OSTI)


    The program has been designed to increase the accuracy and reduce the preparation time for completing sampling plans. It consists of our files 1. Analyte/Combination (AnalCombo) A list of analytes and combinations of analytes that can be requested of the onsite and offsite labs. Whenever a specific combination of analytes or suite names appear on the same line as the code number, this indicates that one sample can be placed in one bottle to bemore » analyzed for these paremeters. A code number is assigned for each analyte and combination of analytes. 2. Sampling Plans Database (SPDb) A database that contains all of the analytes and combinations of analytes along with the basic information required for preparing a sample plan. That basic information includes the following fields; matrix, hold time, preservation, sample volume, container size, if the bottle caps are taped, acceptable choices. 3. Sampling plans create (SPcreate) a file that will lookup information from the Sampling Plans Database and the Job Log File (JLF98) A major database used by Sample Managemnet Services for recording more than 100 fields of information.« less

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Bluewater, New Mexico, Disposal Site February 2014 LMS/BLU/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Bluewater, New Mexico February 2014 RIN 13115746 Page i Contents Sampling Event Summary ...............................................................................................................1 Bluewater, New Mexico, Disposal Site Sample Location Map.......................................................5 Data Assessment Summary

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Burrell, Pennsylvania, Disposal Site January 2014 LMS/BUR/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Burrell, Pennsylvania January 2014 RIN 13095638 Page i Contents Sampling Event Summary ...............................................................................................................1 Burrell, Pennsylvania, Disposal Site, Sample Location Map ..........................................................3 Data Assessment Summary

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Canonsburg, Pennsylvania, Disposal Site February 2014 LMS/CAN/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Canonsburg, Pennsylvania February 2014 RIN 13095639 Page i Contents Sampling Event Summary ...............................................................................................................1 Canonsburg, Pennsylvania, Disposal Site, Sample Location Map ..................................................3 Data Assessment Summary

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Green River, Utah, Disposal Site August 2013 LMS/GRN/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Green River, Utah August 2013 RIN 13065402 Page i Contents Sampling Event Summary ...............................................................................................................1 Data Assessment Summary ..............................................................................................................7 Water Sampling Field Activities

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Disposal Site August 2014 LMS/LKD/S00514 This page intentionally left blank U.S. Department of Energy DVP-May 2014, Lakeview, Oregon, Disposal August 2014 RIN 14056157 Page i Contents Sampling Event Summary ...............................................................................................................1 Lakeview, Oregon, Disposal Site, Sample Location Map ...............................................................3 Data Assessment Summary

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Processing Site August 2014 LMS/LKP/S00514 This page intentionally left blank U.S. Department of Energy DVP-May 2014, Lakeview, Oregon, Processing August 2014 RIN 14056157 and 14056158 Page i Contents Sampling Event Summary ...............................................................................................................1 Lakeview, Oregon, Processing Site, Sample Location Map ............................................................3 Data Assessment Summary

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Riverton, Wyoming, Processing Site September 2013 LMS/RVT/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Riverton, Wyoming September 2013 RIN 13065379 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, Wyoming, Processing Site, Sample Location Map .........................................................5 Data Assessment Summary

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Riverton, Wyoming, Processing Site February 2016 LMS/RVT/S00915 This page intentionally left blank U.S. Department of Energy DVP-September 2015, Riverton, Wyoming February 2016 RINs 15097345, 15097346, and 15097347 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, Wyoming, Processing Site Planned Sampling Location Map .........................................7 Data Assessment Summary

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Rifle, Colorado, New and Old Processing Sites January 2014 LMS/RFN/RFO/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Rifle, Colorado January 2014 RIN 13115731 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Sample Location Map ........................................................5 Old Rifle, Colorado, Processing

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Old and New Rifle, Colorado, Processing Sites January 2015 LMS/RFN/RFO/S01114 This page intentionally left blank U.S. Department of Energy DVP-November 2014, Rifle, Colorado January 2015 RINs 14106568 and 14106569 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Planned Sampling Map ......................................................3 Old Rifle,

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Slick Rock, Colorado, Processing Sites January 2016 LMS/SRE/SRW/S00915 This page intentionally left blank U.S. Department of Energy DVP-September 2015, Slick Rock, Colorado January 2016 RINs 15087319 and 15107424 Page i Contents Sampling Event Summary ...............................................................................................................1 Slick Rock, Colorado, Processing Sites, Sample Location Map .....................................................5 Data Assessment

  2. Adaptive Sampling Proxy Application

    Energy Science and Technology Software Center (OSTI)


    ASPA is an implementation of an adaptive sampling algorithm [1-3], which is used to reduce the computational expense of computer simulations that couple disparate physical scales. The purpose of ASPA is to encapsulate the algorithms required for adaptive sampling independently from any specific application, so that alternative algorithms and programming models for exascale computers can be investigated more easily.

  3. Biological sample collector

    DOE Patents [OSTI]

    Murphy, Gloria A.


    A biological sample collector is adapted to a collect several biological samples in a plurality of filter wells. A biological sample collector may comprise a manifold plate for mounting a filter plate thereon, the filter plate having a plurality of filter wells therein; a hollow slider for engaging and positioning a tube that slides therethrough; and a slide case within which the hollow slider travels to allow the tube to be aligned with a selected filter well of the plurality of filter wells, wherein when the tube is aligned with the selected filter well, the tube is pushed through the hollow slider and into the selected filter well to sealingly engage the selected filter well and to allow the tube to deposit a biological sample onto a filter in the bottom of the selected filter well. The biological sample collector may be portable.

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... 10 pCiL Liquid Scintillation LMR-15 Uranium Vanadium Zinc Total No. of Analytes 4 0 ... 26, 2013 TO: Rick Findlay FROM: Jeff Price SUBJECT: Trip Report (LTHMP Sampling) ...

  5. Water Sample Concentrator

    ScienceCinema (OSTI)

    Idaho National Laboratory


    Automated portable device that concentrates and packages a sample of suspected contaminated water for safe, efficient transport to a qualified analytical laboratory. This technology will help safeguard against pathogen contamination or chemical and biolog

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Groundwater, Surface Water, Produced Water, and Natural Gas Sampling at the Gasbuggy, New Mexico, Site October 2014 LMSGSBS00614 Available for sale to the public from: U.S. ...

  7. Dissolution actuated sample container

    DOE Patents [OSTI]

    Nance, Thomas A.; McCoy, Frank T.


    A sample collection vial and process of using a vial is provided. The sample collection vial has an opening secured by a dissolvable plug. When dissolved, liquids may enter into the interior of the collection vial passing along one or more edges of a dissolvable blocking member. As the blocking member is dissolved, a spring actuated closure is directed towards the opening of the vial which, when engaged, secures the vial contents against loss or contamination.


    SciTech Connect (OSTI)

    Jannik, T; P Fledderman, P


    Radiological sampling and analyses are performed to collect data for a variety of specific reasons covering a wide range of projects. These activities include: Effluent monitoring; Environmental surveillance; Emergency response; Routine ambient monitoring; Background assessments; Nuclear license termination; Remediation; Deactivation and decommissioning (D&D); and Waste management. In this chapter, effluent monitoring and environmental surveillance programs at nuclear operating facilities and radiological sampling and analysis plans for remediation and D&D activities will be discussed.

  9. Liquid sampling system

    DOE Patents [OSTI]

    Larson, L.L.


    A conduit extends from a reservoir through a sampling station and back to the reservoir in a closed loop. A jet ejector in the conduit establishes suction for withdrawing liquid from the reservoir. The conduit has a self-healing septum therein upstream of the jet ejector for receiving one end of a double-ended cannula, the other end of which is received in a serum bottle for sample collection. Gas is introduced into the conduit at a gas bleed between the sample collection bottle and the reservoir. The jet ejector evacuates gas from the conduit and the bottle and aspirates a column of liquid from the reservoir at a high rate. When the withdrawn liquid reaches the jet ejector the rate of flow therethrough reduces substantially and the gas bleed increases the pressure in the conduit for driving liquid into the sample bottle, the gas bleed forming a column of gas behind the withdrawn liquid column and interrupting the withdrawal of liquid from the reservoir. In the case of hazardous and toxic liquids, the sample bottle and the jet ejector may be isolated from the reservoir and may be further isolated from a control station containing remote manipulation means for the sample bottle and control valves for the jet ejector and gas bleed. 5 figs.

  10. Liquid sampling system

    DOE Patents [OSTI]

    Larson, Loren L.


    A conduit extends from a reservoir through a sampling station and back to the reservoir in a closed loop. A jet ejector in the conduit establishes suction for withdrawing liquid from the reservoir. The conduit has a self-healing septum therein upstream of the jet ejector for receiving one end of a double-ended cannula, the other end of which is received in a serum bottle for sample collection. Gas is introduced into the conduit at a gas bleed between the sample collection bottle and the reservoir. The jet ejector evacuates gas from the conduit and the bottle and aspirates a column of liquid from the reservoir at a high rate. When the withdrawn liquid reaches the jet ejector the rate of flow therethrough reduces substantially and the gas bleed increases the pressure in the conduit for driving liquid into the sample bottle, the gas bleed forming a column of gas behind the withdrawn liquid column and interrupting the withdrawal of liquid from the reservoir. In the case of hazardous and toxic liquids, the sample bottle and the jet ejector may be isolated from the reservoir and may be further isolated from a control station containing remote manipulation means for the sample bottle and control valves for the jet ejector and gas bleed.

  11. Air sampling in the workplace. Final report

    SciTech Connect (OSTI)

    Hickey, E.E.; Stoetzel, G.A.; Strom, D.J.; Cicotte, G.R.; Wiblin, C.M.; McGuire, S.A.


    This report provides technical information on air sampling that will be useful for facilities following the recommendations in the NRC`s Regulatory Guide 8.25, Revision 1, ``Air sampling in the Workplace.`` That guide addresses air sampling to meet the requirements in NRC`s regulations on radiation protection, 10 CFR Part 20. This report describes how to determine the need for air sampling based on the amount of material in process modified by the type of material, release potential, and confinement of the material. The purposes of air sampling and how the purposes affect the types of air sampling provided are discussed. The report discusses how to locate air samplers to accurately determine the concentrations of airborne radioactive materials that workers will be exposed to. The need for and the methods of performing airflow pattern studies to improve the accuracy of air sampling results are included. The report presents and gives examples of several techniques that can be used to evaluate whether the airborne concentrations of material are representative of the air inhaled by workers. Methods to adjust derived air concentrations for particle size are described. Methods to calibrate for volume of air sampled and estimate the uncertainty in the volume of air sampled are described. Statistical tests for determining minimum detectable concentrations are presented. How to perform an annual evaluation of the adequacy of the air sampling is also discussed.

  12. Optimal sampling efficiency in Monte Carlo sampling with an approximat...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Optimal sampling efficiency in Monte Carlo sampling with an approximate potential Citation Details In-Document Search Title: Optimal sampling efficiency in Monte ...

  13. Fluid sampling system

    DOE Patents [OSTI]

    Houck, Edward D.


    An fluid sampling system allows sampling of radioactive liquid without spillage. A feed tank is connected to a liquid transfer jet powered by a pumping chamber pressurized by compressed air. The liquid is pumped upwardly into a sampling jet of a venturi design having a lumen with an inlet, an outlet, a constricted middle portion, and a port located above the constricted middle portion. The liquid is passed under pressure through the constricted portion causing its velocity to increase and its pressure to decreased, thereby preventing liquid from escaping. A septum sealing the port can be pierced by a two pointed hollow needle leading into a sample bottle also sealed by a pierceable septum affixed to one end. The bottle is evacuated by flow through the sample jet, cyclic variation in the sampler jet pressure periodically leaves the evacuated bottle with lower pressure than that of the port, thus causing solution to pass into the bottle. The remaining solution in the system is returned to the feed tank via a holding tank.

  14. Fluid sampling system

    DOE Patents [OSTI]

    Houck, E.D.


    An fluid sampling system allows sampling of radioactive liquid without spillage. A feed tank is connected to a liquid transfer jet powered by a pumping chamber pressurized by compressed air. The liquid is pumped upwardly into a sampling jet of a venturi design having a lumen with an inlet, an outlet, a constricted middle portion, and a port located above the constricted middle portion. The liquid is passed under pressure through the constricted portion causing its velocity to increase and its pressure to be decreased, thereby preventing liquid from escaping. A septum sealing the port can be pierced by a two pointed hollow needle leading into a sample bottle also sealed by a pierceable septum affixed to one end. The bottle is evacuated by flow through the sample jet, cyclic variation in the sampler jet pressure periodically leaves the evacuated bottle with lower pressure than that of the port, thus causing solution to pass into the bottle. The remaining solution in the system is returned to the feed tank via a holding tank. 4 figs.

  15. Visual Sample Plan

    Energy Science and Technology Software Center (OSTI)


    VSP selects the appropriate number and location of environmental samples to ensure that the results of statistical tests performed to provide input to risk decisions have the required confidence and performance. VSP Version 5.0 provides sample-size equations or algorithms needed by specific statistical tests appropriate for specific environmental sampling objectives. It also provides data quality assessment and statistical analysis functions to support evaluation of the data and determine whether the data support decisions regarding sitesmore » suspected of contamination. The easy-to-use program is highly visual and graphic. VSP runs on personal computers with Microsoft Windows operating systems (98, NT, 2000, Millennium Edition, CE, and XP) Designed primarily for project managers and users without expertise in statistics, VSP is applicable to two- and three-dimensional populations to be sampled (e.g., rooms and buildings, surface soil, a defined layer of subsurface soil, water bodies, and other similar applications) for studies of environmental quality. VSP is also applicable for designing sampling plans for assessing chem./rad/bio threat and hazard identification within rooms and buildings, and for designing geophysical surveys for UXO identification.« less

  16. Viscous sludge sample collector

    DOE Patents [OSTI]

    Beitel, George A [Richland, WA


    A vertical core sample collection system for viscous sludge. A sample tube's upper end has a flange and is attached to a piston. The tube and piston are located in the upper end of a bore in a housing. The bore's lower end leads outside the housing and has an inwardly extending rim. Compressed gas, from a storage cylinder, is quickly introduced into the bore's upper end to rapidly accelerate the piston and tube down the bore. The lower end of the tube has a high sludge entering velocity to obtain a full-length sludge sample without disturbing strata detail. The tube's downward motion is stopped when its upper end flange impacts against the bore's lower end inwardly extending rim.

  17. Sampling Report for August 15, 2014 WIPP Samples

    Office of Environmental Management (EM)

    X X X X X Sampling Report for August 15, 2014 WIPP Samples UNCLASSIFIED Forensic Science Center December 19, 2014 Sampling Report for August 15 2014 WIPP Samples Lawrence ...

  18. Sampling and Analysis of Pond 2, Pond 5, and the P-Reactor Canal Sediments

    SciTech Connect (OSTI)

    Halverson, N.V.


    This report discusses the procedures used to perform the sampling, the methods used to analyze the samples, and the results.


    DOE Patents [OSTI]

    Tait, G.W.C.


    A high-rate air sampler capable of sampling alphaemitting particles as small as 0.5 microns is described. The device is a cylindrical shaped cup that fits in front of a suction tube and which has sticky grease coating along its base. Suction forces contaminated air against the periodically monitored particle absorbing grease.

  20. Field Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Field Mapping Hand-held X-Ray Fluorescence (XRF) Macrophotography Portable X-Ray Diffraction (XRD) Field Sampling Gas Sampling Gas Flux Sampling Soil Gas Sampling Surface Gas...

  1. Rapid determination of actinides in seawater samples


    Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.; Utsey, Robin C.; McAlister, Daniel R.


    A new rapid method for the determination of actinides in seawater samples has been developed at the Savannah River National Laboratory. The actinides can be measured by alpha spectrometry or inductively-coupled plasma mass spectrometry. The new method employs novel pre-concentration steps to collect the actinide isotopes quickly from 80 L or more of seawater. Actinides are co-precipitated using an iron hydroxide co-precipitation step enhanced with Ti+3 reductant, followed by lanthanum fluoride co-precipitation. Stacked TEVA Resin and TRU Resin cartridges are used to rapidly separate Pu, U, and Np isotopes from seawater samples. TEVA Resin and DGA Resin were used tomore » separate and measure Pu, Am and Cm isotopes in seawater volumes up to 80 L. This robust method is ideal for emergency seawater samples following a radiological incident. It can also be used, however, for the routine analysis of seawater samples for oceanographic studies to enhance efficiency and productivity. In contrast, many current methods to determine actinides in seawater can take 1–2 weeks and provide chemical yields of ~30–60 %. This new sample preparation method can be performed in 4–8 h with tracer yields of ~85–95 %. By employing a rapid, robust sample preparation method with high chemical yields, less seawater is needed to achieve lower or comparable detection limits for actinide isotopes with less time and effort.« less

  2. Spectroscopic diagnostics for bacteria in biologic sample

    DOE Patents [OSTI]

    El-Sayed, Mostafa A.; El-Sayed, Ivan H.


    A method to analyze and diagnose specific bacteria in a biologic sample using spectroscopy is disclosed. The method includes obtaining the spectra of a biologic sample of a non-infected patient for use as a reference, subtracting the reference from the spectra of an infected sample, and comparing the fingerprint regions of the resulting differential spectrum with reference spectra of bacteria in saline. Using this diagnostic technique, specific bacteria can be identified sooner and without culturing, bacteria-specific antibiotics can be prescribed sooner, resulting in decreased likelihood of antibiotic resistance and an overall reduction of medical costs.

  3. Surface sampling concentration and reaction probe

    DOE Patents [OSTI]

    Van Berkel, Gary J; Elnaggar, Mariam S


    A method of analyzing a chemical composition of a specimen is described. The method can include providing a probe comprising an outer capillary tube and an inner capillary tube disposed co-axially within the outer capillary tube, where the inner and outer capillary tubes define a solvent capillary and a sampling capillary in fluid communication with one another at a distal end of the probe; contacting a target site on a surface of a specimen with a solvent in fluid communication with the probe; maintaining a plug volume proximate a solvent-specimen interface, wherein the plug volume is in fluid communication with the probe; draining plug sampling fluid from the plug volume through the sampling capillary; and analyzing a chemical composition of the plug sampling fluid with an analytical instrument. A system for performing the method is also described.

  4. NID Copper Sample Analysis

    SciTech Connect (OSTI)

    Kouzes, Richard T.; Zhu, Zihua


    The current focal point of the nuclear physics program at PNNL is the MAJORANA DEMONSTRATOR, and the follow-on Tonne-Scale experiment, a large array of ultra-low background high-purity germanium detectors, enriched in 76Ge, designed to search for zero-neutrino double-beta decay (0νββ). This experiment requires the use of germanium isotopically enriched in 76Ge. The MAJORANA DEMONSTRATOR is a DOE and NSF funded project with a major science impact. The DEMONSTRATOR will utilize 76Ge from Russia, but for the Tonne-Scale experiment it is hoped that an alternate technology, possibly one under development at Nonlinear Ion Dynamics (NID), will be a viable, US-based, lower-cost source of separated material. Samples of separated material from NID require analysis to determine the isotopic distribution and impurities. DOE is funding NID through an SBIR grant for development of their separation technology for application to the Tonne-Scale experiment. The Environmental Molecular Sciences facility (EMSL), a DOE user facility at PNNL, has the required mass spectroscopy instruments for making isotopic measurements that are essential to the quality assurance for the MAJORANA DEMONSTRATOR and for the development of the future separation technology required for the Tonne-Scale experiment. A sample of isotopically separated copper was provided by NID to PNNL in January 2011 for isotopic analysis as a test of the NID technology. The results of that analysis are reported here. A second sample of isotopically separated copper was provided by NID to PNNL in August 2011 for isotopic analysis as a test of the NID technology. The results of that analysis are also reported here.

  5. Stack sampling apparatus

    DOE Patents [OSTI]

    Lind, Randall F; Lloyd, Peter D; Love, Lonnie J; Noakes, Mark W; Pin, Francois G; Richardson, Bradley S; Rowe, John C


    An apparatus for obtaining samples from a structure includes a support member, at least one stabilizing member, and at least one moveable member. The stabilizing member has a first portion coupled to the support member and a second portion configured to engage with the structure to restrict relative movement between the support member and the structure. The stabilizing member is radially expandable from a first configuration where the second portion does not engage with a surface of the structure to a second configuration where the second portion engages with the surface of the structure.

  6. Germanium-76 Sample Analysis

    SciTech Connect (OSTI)

    Kouzes, Richard T.; Engelhard, Mark H.; Zhu, Zihua


    The MAJORANA DEMONSTRATOR is a large array of ultra-low background high-purity germanium detectors, enriched in 76Ge, designed to search for zero-neutrino double-beta decay (0???). The DEMONSTRATOR will utilize 76Ge from Russia, and the first one gram sample was received from the supplier for analysis on April 24, 2011. The Environmental Molecular Sciences facility, a DOE user facility at PNNL, was used to make the required isotopic and chemical purity measurements that are essential to the quality assurance for the MAJORANA DEMONSTRATOR. The results of this first analysis are reported here.

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater Sampling at the Central Nevada Test Area February 2015 LMS/CNT/S01214 Available for sale to the public from: U.S. Department of Commerce National Technical Information Service 5301 Shawnee Road Alexandria, VA 22312 Telephone: 800.553.6847 Fax: 703.605.6900 E-mail: Online Ordering: Available electronically at Available for a processing fee to U.S. Department of Energy and its contractors, in

  8. Post-Award Deliverables Sample (Part 2 of Sample Deliverables...

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    J-4) Post-Award Deliverables Sample (Part 2 of Sample Deliverables for Task Orders, IDIQ Attachment. J-4) Document offers a post-award deliverables sample for an energy savings ...

  9. Methods for purifying carbon materials

    DOE Patents [OSTI]

    Dailly, Anne; Ahn, Channing; Yazami, Rachid; Fultz, Brent T.


    Methods of purifying samples are provided that are capable of removing carbonaceous and noncarbonaceous impurities from a sample containing a carbon material having a selected structure. Purification methods are provided for removing residual metal catalyst particles enclosed in multilayer carbonaceous impurities in samples generate by catalytic synthesis methods. Purification methods are provided wherein carbonaceous impurities in a sample are at least partially exfoliated, thereby facilitating subsequent removal of carbonaceous and noncarbonaceous impurities from the sample. Methods of purifying carbon nanotube-containing samples are provided wherein an intercalant is added to the sample and subsequently reacted with an exfoliation initiator to achieve exfoliation of carbonaceous impurities.

  10. Fluid sampling tool

    DOE Patents [OSTI]

    Garcia, Anthony R.; Johnston, Roger G.; Martinez, Ronald K.


    A fluid sampling tool for sampling fluid from a container. The tool has a fluid collecting portion which is drilled into the container wall, thereby affixing it to the wall. The tool may have a fluid extracting section which withdraws fluid collected by the fluid collecting section. The fluid collecting section has a fluted shank with an end configured to drill a hole into a container wall. The shank has a threaded portion for tapping the borehole. The shank is threadably engaged to a cylindrical housing having an inner axial passageway sealed at one end by a septum. A flexible member having a cylindrical portion and a bulbous portion is provided. The housing can be slid into an inner axial passageway in the cylindrical portion and sealed to the flexible member. The bulbous portion has an outer lip defining an opening. The housing is clamped into the chuck of a drill, the lip of the bulbous section is pressed against a container wall until the shank touches the wall, and the user operates the drill. Wall shavings (kerf) are confined in a chamber formed in the bulbous section as it folds when the shank advances inside the container. After sufficient advancement of the shank, an o-ring makes a seal with the container wall.

  11. NID Copper Sample Analysis

    SciTech Connect (OSTI)

    Kouzes, Richard T.; Zhu, Zihua


    The current focal point of the nuclear physics program at PNNL is the MAJORANA DEMONSTRATOR, and the follow-on Tonne-Scale experiment, a large array of ultra-low background high-purity germanium detectors, enriched in 76Ge, designed to search for zero-neutrino double-beta decay (0νββ). This experiment requires the use of germanium isotopically enriched in 76Ge. The DEMONSTRATOR will utilize 76Ge from Russia, but for the Tonne-Scale experiment it is hoped that an alternate technology under development at Nonlinear Ion Dynamics (NID) will be a viable, US-based, lower-cost source of separated material. Samples of separated material from NID require analysis to determine the isotopic distribution and impurities. The MAJORANA DEMONSTRATOR is a DOE and NSF funded project with a major science impact. DOE is funding NID through an SBIR grant for development of their separation technology for application to the Tonne-Scale experiment. The Environmental Molecular Sciences facility (EMSL), a DOE user facility at PNNL, has the required mass spectroscopy instruments for making these isotopic measurements that are essential to the quality assurance for the MAJORANA DEMONSTRATOR and for the development of the future separation technology required for the Tonne-Scale experiment. A sample of isotopically separated copper was provided by NID to PNNL for isotopic analysis as a test of the NID technology. The results of that analysis are reported here.

  12. Fluid sampling tool

    DOE Patents [OSTI]

    Garcia, A.R.; Johnston, R.G.; Martinez, R.K.


    A fluid sampling tool is described for sampling fluid from a container. The tool has a fluid collecting portion which is drilled into the container wall, thereby affixing it to the wall. The tool may have a fluid extracting section which withdraws fluid collected by the fluid collecting section. The fluid collecting section has a fluted shank with an end configured to drill a hole into a container wall. The shank has a threaded portion for tapping the borehole. The shank is threadably engaged to a cylindrical housing having an inner axial passageway sealed at one end by a septum. A flexible member having a cylindrical portion and a bulbous portion is provided. The housing can be slid into an inner axial passageway in the cylindrical portion and sealed to the flexible member. The bulbous portion has an outer lip defining an opening. The housing is clamped into the chuck of a drill, the lip of the bulbous section is pressed against a container wall until the shank touches the wall, and the user operates the drill. Wall shavings (kerf) are confined in a chamber formed in the bulbous section as it folds when the shank advances inside the container. After sufficient advancement of the shank, an o-ring makes a seal with the container wall. 6 figs.

  13. Sample introducing apparatus and sample modules for mass spectrometer

    DOE Patents [OSTI]

    Thompson, Cyril V.; Wise, Marcus B.


    An apparatus for introducing gaseous samples from a wide range of environmental matrices into a mass spectrometer for analysis of the samples is described. Several sample preparing modules including a real-time air monitoring module, a soil/liquid purge module, and a thermal desorption module are individually and rapidly attachable to the sample introducing apparatus for supplying gaseous samples to the mass spectrometer. The sample-introducing apparatus uses a capillary column for conveying the gaseous samples into the mass spectrometer and is provided with an open/split interface in communication with the capillary and a sample archiving port through which at least about 90 percent of the gaseous sample in a mixture with an inert gas that was introduced into the sample introducing apparatus is separated from a minor portion of the mixture entering the capillary discharged from the sample introducing apparatus.

  14. Sample introducing apparatus and sample modules for mass spectrometer

    DOE Patents [OSTI]

    Thompson, C.V.; Wise, M.B.


    An apparatus for introducing gaseous samples from a wide range of environmental matrices into a mass spectrometer for analysis of the samples is described. Several sample preparing modules including a real-time air monitoring module, a soil/liquid purge module, and a thermal desorption module are individually and rapidly attachable to the sample introducing apparatus for supplying gaseous samples to the mass spectrometer. The sample-introducing apparatus uses a capillary column for conveying the gaseous samples into the mass spectrometer and is provided with an open/split interface in communication with the capillary and a sample archiving port through which at least about 90 percent of the gaseous sample in a mixture with an inert gas that was introduced into the sample introducing apparatus is separated from a minor portion of the mixture entering the capillary discharged from the sample introducing apparatus. 5 figures.

  15. Fluid sampling tool

    DOE Patents [OSTI]

    Johnston, Roger G.; Garcia, Anthony R. E.; Martinez, Ronald K.


    The invention includes a rotatable tool for collecting fluid through the wall of a container. The tool includes a fluid collection section with a cylindrical shank having an end portion for drilling a hole in the container wall when the tool is rotated, and a threaded portion for tapping the hole in the container wall. A passageway in the shank in communication with at least one radial inlet hole in the drilling end and an opening at the end of the shank is adapted to receive fluid from the container. The tool also includes a cylindrical chamber affixed to the end of the shank opposite to the drilling portion thereof for receiving and storing fluid passing through the passageway. The tool also includes a flexible, deformable gasket that provides a fluid-tight chamber to confine kerf generated during the drilling and tapping of the hole. The invention also includes a fluid extractor section for extracting fluid samples from the fluid collecting section.

  16. Microfluidic-Based Robotic Sampling System for Radioactive Solutions

    SciTech Connect (OSTI)

    Jack D. Law; Julia L. Tripp; Tara E. Smith; Veronica J. Rutledge; Troy G. Garn; John Svoboda; Larry Macaluso


    A novel microfluidic based robotic sampling system has been developed for sampling and analysis of liquid solutions in nuclear processes. This system couples the use of a microfluidic sample chip with a robotic system designed to allow remote, automated sampling of process solutions in-cell and facilitates direct coupling of the microfluidic sample chip with analytical instrumentation. This system provides the capability for near real time analysis, reduces analytical waste, and minimizes the potential for personnel exposure associated with traditional sampling methods. A prototype sampling system was designed, built and tested. System testing demonstrated operability of the microfluidic based sample system and identified system modifications to optimize performance.

  17. Rock Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    resource at depth. These hand samples can be collected using a rock hammer or sledge. Data Access and Acquisition Under a detailed investigation, a systematic sampling procedure...

  18. Water Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Water Sampling Details Activities (63) Areas (51) Regions (5) NEPA(2) Exploration Technique Information Exploration Group: Field Techniques Exploration Sub Group: Field Sampling...

  19. Sample holder with optical features

    DOE Patents [OSTI]

    Milas, Mirko; Zhu, Yimei; Rameau, Jonathan David


    A sample holder for holding a sample to be observed for research purposes, particularly in a transmission electron microscope (TEM), generally includes an external alignment part for directing a light beam in a predetermined beam direction, a sample holder body in optical communication with the external alignment part and a sample support member disposed at a distal end of the sample holder body opposite the external alignment part for holding a sample to be analyzed. The sample holder body defines an internal conduit for the light beam and the sample support member includes a light beam positioner for directing the light beam between the sample holder body and the sample held by the sample support member.

  20. Sample injector for high pressure liquid chromatography

    DOE Patents [OSTI]

    Paul, Phillip H.; Arnold, Don W.; Neyer, David W.


    Apparatus and method for driving a sample, having a well-defined volume, under pressure into a chromatography column. A conventional high pressure sampling valve is replaced by a sample injector composed of a pair of injector components connected in series to a common junction. The injector components are containers of porous dielectric material constructed so as to provide for electroosmotic flow of a sample into the junction. At an appropriate time, a pressure pulse from a high pressure source, that can be an electrokinetic pump, connected to the common junction, drives a portion of the sample, whose size is determined by the dead volume of the common junction, into the chromatographic column for subsequent separation and analysis. The apparatus can be fabricated on a substrate for microanalytical applications.

  1. Atmospheric sampling glow discharge ionization source

    DOE Patents [OSTI]

    McLuckey, S.A.; Glish, G.L.


    An atmospheric sampling glow discharge ionization source that can be used in combination with an analytical instrument which operates at high vacuum, such as a mass spectrometer. The atmospheric sampling glow discharge ionization source comprises a chamber with at least one pair of electrodes disposed therein, an inlet for a gaseous sample to be analyzed and an outlet communicating with an analyzer which operates at subatmospheric pressure. The ionization chamber is maintained at a pressure below atmospheric pressure, and a voltage difference is applied across the electrodes to induce a glow discharge between the electrodes, so that molecules passing through the inlet are ionized by the glow discharge and directed into the analyzer. The ionization source accepts the sample under atmospheric pressure conditions and processes it directly into the high vacuum instrument, bridging the pressure gap and drawing off unwanted atmospheric gases. The invention also includes a method for analyzing a gaseous sample using the glow discharge ionization source described above. 3 figs.

  2. Atmospheric sampling glow discharge ionization source

    DOE Patents [OSTI]

    McLuckey, Scott A. (Oak Ridge, TN); Glish, Gary L. (Oak Ridge, TN)


    An atmospheric sampling glow discharge ionization source that can be used in combination with an analytical instrument which operates at high vacuum, such as a mass spectrometer. The atmospheric sampling glow discharge ionization source comprises a chamber with at least one pair of electrodes disposed therein, an inlet for a gaseous sample to be analyzed and an outlet communicating with an analyzer which operates at subatmospheric pressure. The ionization chamber is maintained at a pressure below atmospheric pressure, and a voltage difference is applied across the electrodes to induce a glow discharge between the electrodes, so that molecules passing through the inlet are ionized by the glow discharge and directed into the analyzer. The ionization source accepts the sample under atmospheric pressure conditions and processes it directly into the high vacuum instrument, bridging the pressure gap and drawing off unwanted atmospheric gases. The invention also includes a method for analyzing a gaseous sample using the glow discharge ionization source described above.

  3. Vapor port and groundwater sampling well

    DOE Patents [OSTI]

    Hubbell, Joel M.; Wylie, Allan H.


    A method and apparatus has been developed for combining groundwater monitoring wells with unsaturated-zone vapor sampling ports. The apparatus allows concurrent monitoring of both the unsaturated and the saturated zone from the same well at contaminated areas. The innovative well design allows for concurrent sampling of groundwater and volatile organic compounds (VOCs) in the vadose (unsaturated) zone from a single well, saving considerable time and money. The sample tubes are banded to the outer well casing during installation of the well casing.

  4. Vapor port and groundwater sampling well

    DOE Patents [OSTI]

    Hubbell, J.M.; Wylie, A.H.


    A method and apparatus have been developed for combining groundwater monitoring wells with unsaturated-zone vapor sampling ports. The apparatus allows concurrent monitoring of both the unsaturated and the saturated zone from the same well at contaminated areas. The innovative well design allows for concurrent sampling of groundwater and volatile organic compounds (VOCs) in the vadose (unsaturated) zone from a single well, saving considerable time and money. The sample tubes are banded to the outer well casing during installation of the well casing. 10 figs.

  5. Creating ensembles of decision trees through sampling

    DOE Patents [OSTI]

    Kamath, Chandrika; Cantu-Paz, Erick


    A system for decision tree ensembles that includes a module to read the data, a module to sort the data, a module to evaluate a potential split of the data according to some criterion using a random sample of the data, a module to split the data, and a module to combine multiple decision trees in ensembles. The decision tree method is based on statistical sampling techniques and includes the steps of reading the data; sorting the data; evaluating a potential split according to some criterion using a random sample of the data, splitting the data, and combining multiple decision trees in ensembles.

  6. Rapid determination of actinides in asphalt samples


    Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.


    A new rapid method for the determination of actinides in asphalt samples has been developed that can be used in emergency response situations or for routine analysis If a radiological dispersive device (RDD), Improvised Nuclear Device (IND) or a nuclear accident such as the accident at the Fukushima Nuclear Power Plant in March, 2011 occurs, there will be an urgent need for rapid analyses of many different environmental matrices, including asphalt materials, to support dose mitigation and environmental clean up. The new method for the determination of actinides in asphalt utilizes a rapid furnace step to destroy bitumen and organicsmore » present in the asphalt and sodium hydroxide fusion to digest the remaining sample. Sample preconcentration steps are used to collect the actinides and a new stacked TRU Resin + DGA Resin column method is employed to separate the actinide isotopes in the asphalt samples. The TRU Resin plus DGA Resin separation approach, which allows sequential separation of plutonium, uranium, americium and curium isotopes in asphalt samples, can be applied to soil samples as well.« less

  7. Rapid determination of actinides in asphalt samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.


    A new rapid method for the determination of actinides in asphalt samples has been developed that can be used in emergency response situations or for routine analysis If a radiological dispersive device (RDD), Improvised Nuclear Device (IND) or a nuclear accident such as the accident at the Fukushima Nuclear Power Plant in March, 2011 occurs, there will be an urgent need for rapid analyses of many different environmental matrices, including asphalt materials, to support dose mitigation and environmental clean up. The new method for the determination of actinides in asphalt utilizes a rapid furnace step to destroy bitumen and organics present in the asphalt and sodium hydroxide fusion to digest the remaining sample. Sample preconcentration steps are used to collect the actinides and a new stacked TRU Resin + DGA Resin column method is employed to separate the actinide isotopes in the asphalt samples. The TRU Resin plus DGA Resin separation approach, which allows sequential separation of plutonium, uranium, americium and curium isotopes in asphalt samples, can be applied to soil samples as well.

  8. Accurate LPG analysis begins with sampling procedures, equipment

    SciTech Connect (OSTI)

    Wilkins, C.M. )


    Proper equipment and procedures are essential for obtaining representative samples from an LPG stream. This paper discusses how sampling of light liquid hydrocarbons generally involves one of two methods: flow- proportional composite sampling by a mechanical device or physical transfer of hydrocarbon fluids from a flowing pipeline or other source into a suitable portable sample container. If sampling by proper techniques and equipment supports careful chromatographic analysis, full advantage of accurate mass measurement of LPG can be realized.

  9. Validation of Statistical Sampling Algorithms in Visual Sample Plan (VSP): Summary Report

    SciTech Connect (OSTI)

    Nuffer, Lisa L; Sego, Landon H.; Wilson, John E.; Hassig, Nancy L.; Pulsipher, Brent A.; Matzke, Brett D.


    The U.S. Department of Homeland Security, Office of Technology Development (OTD) contracted with a set of U.S. Department of Energy national laboratories, including the Pacific Northwest National Laboratory (PNNL), to write a Remediation Guidance for Major Airports After a Chemical Attack. The report identifies key activities and issues that should be considered by a typical major airport following an incident involving release of a toxic chemical agent. Four experimental tasks were identified that would require further research in order to supplement the Remediation Guidance. One of the tasks, Task 4, OTD Chemical Remediation Statistical Sampling Design Validation, dealt with statistical sampling algorithm validation. This report documents the results of the sampling design validation conducted for Task 4. In 2005, the Government Accountability Office (GAO) performed a review of the past U.S. responses to Anthrax terrorist cases. Part of the motivation for this PNNL report was a major GAO finding that there was a lack of validated sampling strategies in the U.S. response to Anthrax cases. The report (GAO 2005) recommended that probability-based methods be used for sampling design in order to address confidence in the results, particularly when all sample results showed no remaining contamination. The GAO also expressed a desire that the methods be validated, which is the main purpose of this PNNL report. The objective of this study was to validate probability-based statistical sampling designs and the algorithms pertinent to within-building sampling that allow the user to prescribe or evaluate confidence levels of conclusions based on data collected as guided by the statistical sampling designs. Specifically, the designs found in the Visual Sample Plan (VSP) software were evaluated. VSP was used to calculate the number of samples and the sample location for a variety of sampling plans applied to an actual release site. Most of the sampling designs validated are

  10. Sampling Report for May-June, 2014 WIPP Samples

    Office of Environmental Management (EM)

    UNCLASSIFIED iii Table of Contents WIPP Panel 7 Sampling May-June, 2014 ... 15 LLNL-TR-667001 Section 1 WIPP Panel 7 Sampling May-June, 2014 1. Summary of ...

  11. Experimental and Sampling Design for the INL-2 Sample Collection Operational Test

    SciTech Connect (OSTI)

    Piepel, Gregory F.; Amidan, Brett G.; Matzke, Brett D.


    This report describes the experimental and sampling design developed to assess sampling approaches and methods for detecting contamination in a building and clearing the building for use after decontamination. An Idaho National Laboratory (INL) building will be contaminated with BG (Bacillus globigii, renamed Bacillus atrophaeus), a simulant for Bacillus anthracis (BA). The contamination, sampling, decontamination, and re-sampling will occur per the experimental and sampling design. This INL-2 Sample Collection Operational Test is being planned by the Validated Sampling Plan Working Group (VSPWG). The primary objectives are: 1) Evaluate judgmental and probabilistic sampling for characterization as well as probabilistic and combined (judgment and probabilistic) sampling approaches for clearance, 2) Conduct these evaluations for gradient contamination (from low or moderate down to absent or undetectable) for different initial concentrations of the contaminant, 3) Explore judgment composite sampling approaches to reduce sample numbers, 4) Collect baseline data to serve as an indication of the actual levels of contamination in the tests. A combined judgmental and random (CJR) approach uses Bayesian methodology to combine judgmental and probabilistic samples to make clearance statements of the form "X% confidence that at least Y% of an area does not contain detectable contamination” (X%/Y% clearance statements). The INL-2 experimental design has five test events, which 1) vary the floor of the INL building on which the contaminant will be released, 2) provide for varying the amount of contaminant released to obtain desired concentration gradients, and 3) investigate overt as well as covert release of contaminants. Desirable contaminant gradients would have moderate to low concentrations of contaminant in rooms near the release point, with concentrations down to zero in other rooms. Such gradients would provide a range of contamination levels to challenge the sampling

  12. Sampling Report for August 15, 2014 WIPP Samples

    Office of Environmental Management (EM)

    0 L L N L - X X X X - X X X X X Sampling Report for August 15, 2014 WIPP Samples UNCLASSIFIED Forensic Science Center December 19, 2014 Sampling Report for August 15 2014 WIPP Samples Lawrence Livermore National Laboratory UNCLASSIFIED ii Disclaimer This document was prepared as an account of work sponsored by an agency of the United States government. Neither the United States government nor Lawrence Livermore National Security, LLC, nor any of their employees makes any warranty, expressed or

  13. Method for the chromatographic separation of cations from aqueous samples

    DOE Patents [OSTI]

    Horwitz, E. Philip (Naperville, IL); Chiarizia, Renato (Elmhurst, IL); Dietz, Mark L. (Evanston, IL)


    An extraction chromatographic material for extracting metal cations from a liquid stream. The extraction chromatographic material is prepared by adsorbing a diesterified methanediphosphonic acid on an inert particulate support.

  14. Method and apparatus for optimized sampling of volatilizable target substances

    DOE Patents [OSTI]

    Lindgren, Eric R.; Phelan, James M.


    An apparatus for capturing, from gases such as soil gas, target analytes. Target analytes may include emanations from explosive materials or from residues of explosive materials. The apparatus employs principles of sorption common to solid phase microextraction, and is best used in conjunction with analysis means such as a gas chromatograph. To sorb target analytes, the apparatus functions using various sorptive structures to capture target analyte. Depending upon the embodiment, those structures may include 1) a conventional solid-phase microextraction (SPME) fiber, 2) a SPME fiber suspended in a capillary tube (with means provided for moving gases through the capillary tube so that the gases come into close proximity to the suspended fiber), and 3) a capillary tube including an interior surface on which sorptive material (similar to that on the surface of a SPME fiber) is supported (along with means for moving gases through the capillary tube so that the gases come into close proximity to the sorptive material). In one disclosed embodiment, at least one such sorptive structure is associated with an enclosure including an opening in communication with the surface of a soil region potentially contaminated with buried explosive material such as unexploded ordnance. Emanations from explosive materials can pass into and accumulate in the enclosure where they are sorbed by the sorptive structures. Also disclosed is the use of heating means such as microwave horns to drive target analytes into the soil gas from solid and liquid phase components of the soil.

  15. Method and apparatus for optimized sampling of volatilizable target substances

    DOE Patents [OSTI]

    Lindgren, Eric R.; Phelan, James M.


    An apparatus for capturing, from gases such as soil gas, target analytes. Target analytes may include emanations from explosive materials or from residues of explosive materials. The apparatus employs principles of sorption common to solid phase microextraction, and is best used in conjunction with analysis means such as a gas chromatograph. To sorb target analytes, the apparatus functions using various sorptive structures to capture target analyte. Depending upon the embodiment, those structures may include a capillary tube including an interior surface on which sorptive material (similar to that on the surface of a SPME fiber) is supported (along with means for moving gases through the capillary tube so that the gases come into close proximity to the sorptive material). In one disclosed embodiment, at least one such sorptive structure is associated with an enclosure including an opening in communication with the surface of a soil region potentially contaminated with buried explosive material such as unexploded ordnance. Emanations from explosive materials can pass into and accumulate in the enclosure where they are sorbed by the sorptive structures. Also disclosed is the use of heating means such as microwave horns to drive target analytes into the soil gas from solid and liquid phase components of the soil.

  16. Method for the chromatographic separation of cations from aqueous samples

    DOE Patents [OSTI]

    Horwitz, E. Philip (Naperville, IL); Chiarizia, Renato (Elmhurst, IL); Dietz, Mark L. (Evanston, IL)


    An extraction chromatographic material for extracting metal cations from a iquid stream. The extraction chromatographic material is prepared by adsorbing a diesterified methanediphosphonic acid on an inert particulate support.

  17. Method for the chromatographic separation of cations from aqueous samples

    DOE Patents [OSTI]

    Horwitz, E.P.; Chiarizia, R.; Dietz, M.L.


    An extraction chromatographic material is described for extracting metal cations from a liquid stream. The extraction chromatographic material is prepared by adsorbing a diesterified methanediphosphonic acid on an inert particulate support. 7 figs.

  18. Method for the chromatographic separation of cations from aqueous samples

    DOE Patents [OSTI]

    Horwitz, E.P.; Chiarizia, R.; Dietz, M.L.


    An extraction chromatographic material is described for extracting metal cations from a liquid stream. The extraction chromatographic material is prepared by adsorbing a diesterified methane-diphosphonic acid on an inert particulate support. 7 figs.

  19. Sample Contract Language for Construction Using Energy-Efficient...

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    ... Method of Assessment - Random Sampling. (3) Performance Threshold - Up to 100 compliance, assuming life cycle cost efficient. Section H - Special Contract Requirements H-xx. ...

  20. Specified assurance level sampling procedure

    SciTech Connect (OSTI)

    Willner, O.


    In the nuclear industry design specifications for certain quality characteristics require that the final product be inspected by a sampling plan which can demonstrate product conformance to stated assurance levels. The Specified Assurance Level (SAL) Sampling Procedure has been developed to permit the direct selection of attribute sampling plans which can meet commonly used assurance levels. The SAL procedure contains sampling plans which yield the minimum sample size at stated assurance levels. The SAL procedure also provides sampling plans with acceptance numbers ranging from 0 to 10, thus, making available to the user a wide choice of plans all designed to comply with a stated assurance level.


    SciTech Connect (OSTI)

    Oji, L.; Diprete, D.; Click, D.


    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 19F closure samples. Tank 19F slurry samples analyzed included the liquid and solid fractions derived from the slurry materials along with the floor scrape bottom Tank 19F wet solids. These samples were taken from Tank 19F in April 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 19F samples, the samples from the north quadrants of the tank were combined into one Tank 19F North Hemisphere sample and similarly the south quadrant samples were combined into one Tank 19F South Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 19F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were based on detection values of 1E-04 {micro}Ci/g for most radionuclides and customer desired detection values of 1E-05 {micro}Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the target detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 19F, some were not met. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.


    SciTech Connect (OSTI)

    Oji, L.; Click, D.; Diprete, D.


    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 18F closure samples. Tank 18F slurry samples analyzed included the liquid and solid fractions derived from the 'as-received' slurry materials along with the floor scrape bottom Tank 18F wet solids. These samples were taken from Tank 18F in March 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 18F samples, the samples from the north quadrants of the tank were combined into one North Tank 18F Hemisphere sample and similarly the south quadrant samples were combined into one South Tank 18F Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 18F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were 1E-04 {micro}Ci/g for most radionuclides and customer desired detection values of 1E-05 {micro}Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the minimum detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 18F, some were not met due to spectral interferences. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.

  3. Groundwater Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    500 mL), whereas analysis for stable isotopes that are present in greater abundance in natural samples requires less water to be sampled by a full order of magnitude (approximately...

  4. Geoscience Laboratory | Sample Preparation Laboratories

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    preparation and other relatively straight-forward laboratory manipulations. These include buffer preparations, solid sample grinding, solution concentration, filtration, and...

  5. Visual Sample Plan (VSP) - FIELDS Integration

    SciTech Connect (OSTI)

    Pulsipher, Brent A.; Wilson, John E.; Gilbert, Richard O.; Hassig, Nancy L.; Carlson, Deborah K.; Bing-Canar, John; Cooper, Brian; Roth, Chuck


    Two software packages, VSP 2.1 and FIELDS 3.5, are being used by environmental scientists to plan the number and type of samples required to meet project objectives, display those samples on maps, query a database of past sample results, produce spatial models of the data, and analyze the data in order to arrive at defensible decisions. VSP 2.0 is an interactive tool to calculate optimal sample size and optimal sample location based on user goals, risk tolerance, and variability in the environment and in lab methods. FIELDS 3.0 is a set of tools to explore the sample results in a variety of ways to make defensible decisions with quantified levels of risk and uncertainty. However, FIELDS 3.0 has a small sample design module. VSP 2.0, on the other hand, has over 20 sampling goals, allowing the user to input site-specific assumptions such as non-normality of sample results, separate variability between field and laboratory measurements, make two-sample comparisons, perform confidence interval estimation, use sequential search sampling methods, and much more. Over 1,000 copies of VSP are in use today. FIELDS is used in nine of the ten U.S. EPA regions, by state regulatory agencies, and most recently by several international countries. Both software packages have been peer-reviewed, enjoy broad usage, and have been accepted by regulatory agencies as well as site project managers as key tools to help collect data and make environmental cleanup decisions. Recently, the two software packages were integrated, allowing the user to take advantage of the many design options of VSP, and the analysis and modeling options of FIELDS. The transition between the two is simple for the user – VSP can be called from within FIELDS, automatically passing a map to VSP and automatically retrieving sample locations and design information when the user returns to FIELDS. This paper will describe the integration, give a demonstration of the integrated package, and give users download

  6. Analysis of large soil samples for actinides

    DOE Patents [OSTI]

    Maxwell, III; Sherrod L.


    A method of analyzing relatively large soil samples for actinides by employing a separation process that includes cerium fluoride precipitation for removing the soil matrix and precipitates plutonium, americium, and curium with cerium and hydrofluoric acid followed by separating these actinides using chromatography cartridges.

  7. High heating rate thermal desorption for molecular surface sampling

    DOE Patents [OSTI]

    Ovchinnikova, Olga S.; Van Berkel, Gary J.


    A method for analyzing a sample having at least one analyte includes the step of heating the sample at a rate of at least 10.sup.6 K/s to thermally desorb at least one analyte from the sample. The desorbed analyte is collected. The analyte can then be analyzed.


    SciTech Connect (OSTI)

    Maxwell, S.


    A new method for the determination of radiostrontium in seawater samples has been developed at the Savannah River National Laboratory (SRNL) that allows rapid preconcentration and separation of strontium and yttrium isotopes in seawater samples for measurement. The new SRNL method employs a novel and effective pre-concentration step that utilizes a blend of calcium phosphate with iron hydroxide to collect both strontium and yttrium rapidly from the seawater matrix with enhanced chemical yields. The pre-concentration steps, in combination with rapid Sr Resin and DGA Resin cartridge separation options using vacuum box technology, allow seawater samples up to 10 liters to be analyzed. The total {sup 89}Sr + {sup 90}Sr activity may be determined by gas flow proportional counting and recounted after ingrowth of {sup 90}Y to differentiate {sup 89}Sr from {sup 90}Sr. Gas flow proportional counting provides a lower method detection limit than liquid scintillation or Cerenkov counting and allows simultaneous counting of samples. Simultaneous counting allows for longer count times and lower method detection limits without handling very large aliquots of seawater. Seawater samples up to 6 liters may be analyzed using Sr Resin for {sup 89}Sr and {sup 90}Sr with a Minimum Detectable Activity (MDA) of 1-10 mBq/L, depending on count times. Seawater samples up to 10 liters may be analyzed for {sup 90}Sr using a DGA Resin method via collection and purification of {sup 90}Y only. If {sup 89}Sr and other fission products are present, then {sup 91}Y (beta energy 1.55 MeV, 58.5 day half-life) is also likely to be present. {sup 91}Y interferes with attempts to collect {sup 90}Y directly from the seawater sample without initial purification of Sr isotopes first and {sup 90}Y ingrowth. The DGA Resin option can be used to determine {sup 90}Sr, and if {sup 91}Y is also present, an ingrowth option with using DGA Resin again to collect {sup 90}Y can be performed. An MDA for {sup 90}Sr of <1 m

  9. Sampling Report for May-June, 2014 WIPP Samples

    Office of Environmental Management (EM)

    1 L L N L - X X X X - X X X X X Sampling Report for May- June, 2014 WIPP Samples UNCLASSIFIED Forensic Science Center January 8, 2015 Sampling Report for May-June, 2014 WIPP Samples Lawrence Livermore National Laboratory UNCLASSIFIED ii Disclaimer This document was prepared as an account of work sponsored by an agency of the United States government. Neither the United States government nor Lawrence Livermore National Security, LLC, nor any of their employees makes any warranty, expressed or

  10. Gas sampling system for reactive gas-solid mixtures

    DOE Patents [OSTI]

    Daum, Edward D.; Downs, William; Jankura, Bryan J.; McCoury, Jr., John M.


    An apparatus and method for sampling gas containing a reactive particulate solid phase flowing through a duct and for communicating a representative sample to a gas analyzer. A sample probe sheath 32 with an angular opening 34 extends vertically into a sample gas duct 30. The angular opening 34 is opposite the gas flow. A gas sampling probe 36 concentrically located within sheath 32 along with calibration probe 40 partly extends in the sheath 32. Calibration probe 40 extends further in the sheath 32 than gas sampling probe 36 for purging the probe sheath area with a calibration gas during calibration.

  11. Gas sampling system for reactive gas-solid mixtures

    DOE Patents [OSTI]

    Daum, Edward D.; Downs, William; Jankura, Bryan J.; McCoury, Jr., John M.


    An apparatus and method for sampling a gas containing a reactive particulate solid phase flowing through a duct and for communicating a representative sample to a gas analyzer. A sample probe sheath 32 with an angular opening 34 extends vertically into a sample gas duct 30. The angular opening 34 is opposite the gas flow. A gas sampling probe 36 concentrically located within sheath 32 along with calibration probe 40 partly extend in the sheath 32. Calibration probe 40 extends further in the sheath 32 than gas sampling probe 36 for purging the probe sheath area with a calibration gas during calibration.

  12. Performance evaluation soil samples utilizing encapsulation technology

    DOE Patents [OSTI]

    Dahlgran, James R.


    Performance evaluation soil samples and method of their preparation using encapsulation technology to encapsulate analytes which are introduced into a soil matrix for analysis and evaluation by analytical laboratories. Target analytes are mixed in an appropriate solvent at predetermined concentrations. The mixture is emulsified in a solution of polymeric film forming material. The emulsified solution is polymerized to form microcapsules. The microcapsules are recovered, quantitated and introduced into a soil matrix in a predetermined ratio to form soil samples with the desired analyte concentration.

  13. Performance evaluation soil samples utilizing encapsulation technology

    DOE Patents [OSTI]

    Dahlgran, J.R.


    Performance evaluation soil samples and method of their preparation uses encapsulation technology to encapsulate analytes which are introduced into a soil matrix for analysis and evaluation by analytical laboratories. Target analytes are mixed in an appropriate solvent at predetermined concentrations. The mixture is emulsified in a solution of polymeric film forming material. The emulsified solution is polymerized to form microcapsules. The microcapsules are recovered, quantitated and introduced into a soil matrix in a predetermined ratio to form soil samples with the desired analyte concentration. 1 fig.

  14. Sample page | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Sample pages; Help pages; References Francis C. Monastero. 2002. An overview of industry-military cooperation in the development of power operations at the Coso...

  15. Chemical Resources | Sample Preparation Laboratories

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Chemical Resources Chemical Inventory All Sample Preparation Labs are stocked with an assortment of common solvents, acids, bases, buffers, and other reagents. See our Chemical ...

  16. Gas Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    of geothermometric calculations and geochemical modeling of the data. In the case of gas flux sampling, different measurement techniques and devices may disrupt or alter the...

  17. Calculating Confidence, Uncertainty, and Numbers of Samples When Using Statistical Sampling Approaches to Characterize and Clear Contaminated Areas

    SciTech Connect (OSTI)

    Piepel, Gregory F.; Matzke, Brett D.; Sego, Landon H.; Amidan, Brett G.


    This report discusses the methodology, formulas, and inputs needed to make characterization and clearance decisions for Bacillus anthracis-contaminated and uncontaminated (or decontaminated) areas using a statistical sampling approach. Specifically, the report includes the methods and formulas for calculating the • number of samples required to achieve a specified confidence in characterization and clearance decisions • confidence in making characterization and clearance decisions for a specified number of samples for two common statistically based environmental sampling approaches. In particular, the report addresses an issue raised by the Government Accountability Office by providing methods and formulas to calculate the confidence that a decision area is uncontaminated (or successfully decontaminated) if all samples collected according to a statistical sampling approach have negative results. Key to addressing this topic is the probability that an individual sample result is a false negative, which is commonly referred to as the false negative rate (FNR). The two statistical sampling approaches currently discussed in this report are 1) hotspot sampling to detect small isolated contaminated locations during the characterization phase, and 2) combined judgment and random (CJR) sampling during the clearance phase. Typically if contamination is widely distributed in a decision area, it will be detectable via judgment sampling during the characterization phrase. Hotspot sampling is appropriate for characterization situations where contamination is not widely distributed and may not be detected by judgment sampling. CJR sampling is appropriate during the clearance phase when it is desired to augment judgment samples with statistical (random) samples. The hotspot and CJR statistical sampling approaches are discussed in the report for four situations: 1. qualitative data (detect and non-detect) when the FNR = 0 or when using statistical sampling methods that account

  18. Environmental surveillance master sampling schedule

    SciTech Connect (OSTI)

    Bisping, L.E.


    Environmental surveillance of the Hanford Site and surrounding areas is conducted by the Pacific Northwest Laboratory (PNL) for the U.S. Department of Energy (DOE). This document contains the planned 1994 schedules for routine collection of samples for the Surface Environmental Surveillance Project (SESP), Drinking Water Project, and Ground-Water Surveillance Project. Samples are routinely collected for the SESP and analyzed to determine the quality of air, surface water, soil, sediment, wildlife, vegetation, foodstuffs, and farm products at Hanford Site and surrounding communities. The responsibility for monitoring onsite drinking water falls outside the scope of the SESP. PNL conducts the drinking water monitoring project concurrent with the SESP to promote efficiency and consistency, utilize expertise developed over the years, and reduce costs associated with management, procedure development, data management, quality control, and reporting. The ground-water sampling schedule identifies ground-water sampling .events used by PNL for environmental surveillance of the Hanford Site. Sampling is indicated as annual, semi-annual, quarterly, or monthly in the sampling schedule. Some samples are collected and analyzed as part of ground-water monitoring and characterization programs at Hanford (e.g. Resources Conservation and Recovery Act (RCRA), Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), or Operational). The number of samples planned by other programs are identified in the sampling schedule by a number in the analysis column and a project designation in the Cosample column. Well sampling events may be merged to avoid redundancy in cases where sampling is planned by both-environmental surveillance and another program.

  19. Lysimeter methods and apparatus

    DOE Patents [OSTI]

    Clark, Don T.; Erickson, Eugene E.; Casper, William L.; Everett, David M.; Hubbell, Joel M.; Sisson, James B.


    A suction lysimeter for sampling subsurface liquids includes a lysimeter casing having a drive portion, a reservoir portion, and a tip portion, the tip portion including a membrane through which subsurface liquids may be sampled; a fluid conduit coupled in fluid flowing relation relative to the membrane, and which in operation facilitates the delivery of the sampled subsurface liquids from the membrane to the reservoir portion; and a plurality of tubes coupled in fluid flowing relation relative to the reservoir portion, the tubes in operation facilitating delivery of the sampled subsurface liquids from the reservoir portion for testing. A method of sampling subsurface liquids comprises using this lysimeter.


    SciTech Connect (OSTI)

    Bannochie, C.; Crawford, C.


    On April 2, 2013, a solid sample of material collected from the Defense Waste Processing Facilitys Process Vessel Vent (PVV) jumper for the Slurry Mix Evaporator Condensate Tank (SMECT) was received at the Savannah River National Laboratory (SRNL). DWPF has experienced pressure spikes within the SMECT and other process vessels which have resulted in processing delays while a vacuum was re-established. Work on this sample was requested in a Technical Assistance Request (TAR). This document reports the results of chemical and physical property measurements made on the sample, as well as insights into the possible impact to the material using DWPFs proposed remediation methods. DWPF was interested in what the facility could expect when the material was exposed to either 8M nitric acid or 90% formic acid, the two materials they have the ability to flush through the PVV line in addition to process water once the line is capped off during a facility outage.

  1. Rapid surface sampling and archival record system

    SciTech Connect (OSTI)

    Barren, E.; Penney, C.M.; Sheldon, R.B.


    A number of contamination sites exist in this country where the area and volume of material to be remediated is very large, approaching or exceeding 10{sup 6} m{sup 2} and 10{sup 6} m{sup 3}. Typically, only a small fraction of this material is actually contaminated. In such cases there is a strong economic motivation to test the material with a sufficient density of measurements to identify which portions are uncontaminated, so extensively they be left in place or be disposed of as uncontaminated waste. Unfortunately, since contamination often varies rapidly from position to position, this procedure can involve upwards of one million measurements per site. The situation is complicated further in many cases by the difficulties of sampling porous surfaces, such as concrete. This report describes a method for sampling concretes in which an immediate distinction can be made between contaminated and uncontaminated surfaces. Sample acquisition and analysis will be automated.

  2. Temperature Control Diagnostics for Sample Environments

    SciTech Connect (OSTI)

    Santodonato, Louis J; Walker, Lakeisha MH; Church, Andrew J; Redmon, Christopher Mckenzie


    In a scientific laboratory setting, standard equipment such as cryocoolers are often used as part of a custom sample environment system designed to regulate temperature over a wide range. The end user may be more concerned with precise sample temperature control than with base temperature. But cryogenic systems tend to be specified mainly in terms of cooling capacity and base temperature. Technical staff at scientific user facilities (and perhaps elsewhere) often wonder how to best specify and evaluate temperature control capabilities. Here we describe test methods and give results obtained at a user facility that operates a large sample environment inventory. Although this inventory includes a wide variety of temperature, pressure, and magnetic field devices, the present work focuses on cryocooler-based systems.

  3. Creating Ensembles of Decision Trees Through Sampling

    SciTech Connect (OSTI)

    Kamath,C; Cantu-Paz, E


    Recent work in classification indicates that significant improvements in accuracy can be obtained by growing an ensemble of classifiers and having them vote for the most popular class. This paper focuses on ensembles of decision trees that are created with a randomized procedure based on sampling. Randomization can be introduced by using random samples of the training data (as in bagging or boosting) and running a conventional tree-building algorithm, or by randomizing the induction algorithm itself. The objective of this paper is to describe the first experiences with a novel randomized tree induction method that uses a sub-sample of instances at a node to determine the split. The empirical results show that ensembles generated using this approach yield results that are competitive in accuracy and superior in computational cost to boosting and bagging.

  4. 200 area TEDF sample schedule

    SciTech Connect (OSTI)

    Brown, M.J.


    This document summarizes the sampling criteria associated with the 200 Area Treatment Effluent Facility (TEDF) that are needed to comply with the requirements of the Washington State Discharge Permit No. WA ST 4502 and good engineering practices at the generator streams that feed into TEDF. In addition, this document Identifies the responsible parties for both sampling and data transference.

  5. Sample push-out fixture

    DOE Patents [OSTI]

    Biernat, John L.


    This invention generally relates to the remote removal of pelletized samples from cylindrical containment capsules. V-blocks are used to receive the samples and provide guidance to push out rods. Stainless steel liners fit into the v-channels on the v-blocks which permits them to be remotely removed and replaced or cleaned to prevent cross contamination between capsules and samples. A capsule holder securely holds the capsule while allowing manual up/down and in/out movement to align each sample hole with the v-blocks. Both end sections contain identical v-blocks; one that guides the drive out screw and rods or manual push out rods and the other to receive the samples as they are driven out of the capsule.

  6. Sample Preparation Laboratory Training - Course 204 | Sample Preparation

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Laboratories Sample Preparation Laboratory Training - Course 204 Who Should Attend This course is mandatory for: SLAC employees and non-employees who need unescorted access to SSRL or LCLS Sample Preparation Laboratories Note: This course may be taken in lieu of Course 199, Laboratory CHP training for SLAC employees. Prerequisites 115 - General Employee Radiological Training (GERT) Take Training Please see the notes section below for information on how to take this training. Course Details

  7. Environmental surveillance master sampling schedule

    SciTech Connect (OSTI)

    Bisping, L.E.


    Environmental surveillance of the Hanford Site and surrounding areas is conducted by the Pacific Northwest Laboratory (PNL) for the US Department of Energy (DOE). This document contains the planned schedule for routine sample collection for the Surface Environmental Surveillance Project (SESP) and Ground-Water Monitoring Project. The routine sampling plan for the SESP has been revised this year to reflect changing site operations and priorities. Some sampling previously performed at least annually has been reduced in frequency, and some new sampling to be performed at a less than annual frequency has been added. Therefore, the SESP schedule reflects sampling to be conducted in calendar year 1991 as well as future years. The ground-water sampling schedule is for 1991. This schedule is subject to modification during the year in response to changes in Site operation, program requirements, and the nature of the observed results. Operational limitations such as weather, mechanical failures, sample availability, etc., may also require schedule modifications. Changes will be documented in the respective project files, but this plan will not be reissued. The purpose of these monitoring projects is to evaluate levels of radioactive and nonradioactive pollutants in the Hanford evirons.

  8. Rheology and TIC/TOC results of ORNL tank samples

    SciTech Connect (OSTI)

    Pareizs, J. M.; Hansen, E. K.


    The Savannah River National Laboratory (SRNL)) was requested by Oak Ridge National Laboratory (ORNL) to perform total inorganic carbon (TIC), total organic carbon (TOC), and rheological measurements for several Oak Ridge tank samples. As received slurry samples were diluted and submitted to SRNL-Analytical for TIC and TOC analyses. Settled solids yield stress (also known as settled shear strength) of the as received settled sludge samples were determined using the vane method and these measurements were obtained 24 hours after the samples were allowed to settled undisturbed. Rheological or flow properties (Bingham Plastic viscosity and Bingham Plastic yield stress) were determined from flow curves of the homogenized or well mixed samples. Other targeted total suspended solids (TSS) concentrations samples were also analyzed for flow properties and these samples were obtained by diluting the as-received sample with de-ionized (DI) water.

  9. Sample Business Plan Framework 5 [DOE]

    U.S. Department of Energy Better Buildings Neighborhood Program: Sample Business Plan Framework 5: A program that establishes itself as a government entity, then operates using a fee-based structure.

  10. Sample Business Plan Framework 2 [DOE]

    U.S. Department of Energy Better Buildings Neighborhood Program: Sample Business Plan Framework 1: A program seeking to continue operations in the post-grant period as a not-for-profit (NGO) entity.

  11. Sample Business Plan Framework 4 [DOE]

    U.S. Department of Energy Better Buildings Neighborhood Program: Sample Business Plan Framework 4: A program seeking to continue in the post-grant period as a marketing contractor to a utility.

  12. Sample Business Plan Framework 3 [DOE]

    U.S. Department of Energy Better Buildings Neighborhood Program: Sample Business Plan Framework 3: A government entity running a Commercial PACE program in the post-grant period.


    U.S. Department of Energy (DOE) all webpages (Extended Search)

    For more comparisons, see the millirem comparisons poster. Dose estimates have been calculated based on the low-volume air sampler results. Low-volume air samplers collect samples ...

  14. Air Sampling System Evaluation Template

    Energy Science and Technology Software Center (OSTI)


    The ASSET1.0 software provides a template with which a user can evaluate an Air Sampling System against the latest version of ANSI N13.1 "Sampling and Monitoring Releases of Airborne Radioactive Substances from the Stacks and Ducts of Nuclear Facilities". The software uses the ANSI N13.1 PIC levels to establish basic design criteria for the existing or proposed sampling system. The software looks at such criteria as PIC level, type of radionuclide emissions, physical state ofmore » the radionuclide, nozzle entrance effects, particulate transmission effects, system and component accuracy and precision evaluations, and basic system operations to provide a detailed look at the subsystems of a monitoring and sampling system/program. A GAP evaluation can then be completed which leads to identification of design and operational flaws in the proposed systems. Corrective measures can then be limited to the GAPs.« less

  15. Equipment Inventory | Sample Preparation Laboratories

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    21KBr Centrifuge Centrifuge SSRL BioChemMat Prep Lab 2 131 209 Saint Gobain K-104 Sanyo MIR-154 Cooled Incubator Temperature Control LCLS Sample Prep Lab 999 109 Sanyo MPR-215F...

  16. Sample Business Plan Framework 1 [DOE]

    U.S. Department of Energy Better Buildings Neighborhood Program: Sample Business Plan Framework 1: A program seeking to continue operations in the post-grant period as a not-for-profit (NGO) entity.

  17. Prospecting by sampling and analysis of airborne particulates and gases

    DOE Patents [OSTI]

    Sehmel, G.A.


    A method is claimed for prospecting by sampling airborne particulates or gases at a ground position and recording wind direction values at the time of sampling. The samples are subsequently analyzed to determine the concentrations of a desired material or the ratios of the desired material to other identifiable materials in the collected samples. By comparing the measured concentrations or ratios to expected background data in the vicinity sampled, one can select recorded wind directions indicative of the upwind position of the land-based source of the desired material.

  18. Depth-discrete sampling port

    DOE Patents [OSTI]

    Pemberton, Bradley E.; May, Christopher P.; Rossabi, Joseph; Riha, Brian D.; Nichols, Ralph L.


    A sampling port is provided which has threaded ends for incorporating the port into a length of subsurface pipe. The port defines an internal receptacle which is in communication with subsurface fluids through a series of fine filtering slits. The receptacle is in further communication through a bore with a fitting carrying a length of tubing there which samples are transported to the surface. Each port further defines an additional bore through which tubing, cables, or similar components of adjacent ports may pass.

  19. Depth-discrete sampling port

    DOE Patents [OSTI]

    Pemberton, Bradley E.; May, Christopher P.; Rossabi, Joseph; Riha, Brian D.; Nichols, Ralph L.


    A sampling port is provided which has threaded ends for incorporating the port into a length of subsurface pipe. The port defines an internal receptacle which is in communication with subsurface fluids through a series of fine filtering slits. The receptacle is in further communication through a bore with a fitting carrying a length of tubing there which samples are transported to the surface. Each port further defines an additional bore through which tubing, cables, or similar components of adjacent ports may pass.

  20. Tank farms solid waste characterization guide with sampling and analysis plan attachment

    SciTech Connect (OSTI)

    Quigley, J.T.


    This document describes methods used, including sampling and analysis, to characterize hazardous chemical constituent in Tank Farms containerized solid waste.

  1. Tank characterization technical sampling basis

    SciTech Connect (OSTI)

    Brown, T.M.


    Tank Characterization Technical Sampling Basis (this document) is the first step of an in place working process to plan characterization activities in an optimal manner. This document will be used to develop the revision of the Waste Information Requirements Document (WIRD) (Winkelman et al. 1997) and ultimately, to create sampling schedules. The revised WIRD will define all Characterization Project activities over the course of subsequent fiscal years 1999 through 2002. This document establishes priorities for sampling and characterization activities conducted under the Tank Waste Remediation System (TWRS) Tank Waste Characterization Project. The Tank Waste Characterization Project is designed to provide all TWRS programs with information describing the physical, chemical, and radiological properties of the contents of waste storage tanks at the Hanford Site. These tanks contain radioactive waste generated from the production of nuclear weapons materials at the Hanford Site. The waste composition varies from tank to tank because of the large number of chemical processes that were used when producing nuclear weapons materials over the years and because the wastes were mixed during efforts to better use tank storage space. The Tank Waste Characterization Project mission is to provide information and waste sample material necessary for TWRS to define and maintain safe interim storage and to process waste fractions into stable forms for ultimate disposal. This document integrates the information needed to address safety issues, regulatory requirements, and retrieval, treatment, and immobilization requirements. Characterization sampling to support tank farm operational needs is also discussed.

  2. Sample Results from Routine Salt Batch 7 Samples

    SciTech Connect (OSTI)

    Peters, T.


    Strip Effluent Hold Tank (SEHT) and Decontaminated Salt Solution Hold Tank (DSSHT) samples from several of the microbatches of Integrated Salt Disposition Project (ISDP) Salt Batch (Macrobatch) 7B have been analyzed for 238Pu, 90Sr, 137Cs, Inductively Coupled Plasma Emission Spectroscopy (ICPES), and Ion Chromatography Anions (IC-A). The results from the current microbatch samples are similar to those from earlier samples from this and previous macrobatches. The Actinide Removal Process (ARP) and the Modular Caustic-Side Solvent Extraction Unit (MCU) continue to show more than adequate Pu and Sr removal, and there is a distinct positive trend in Cs removal, due to the use of the Next Generation Solvent (NGS). The Savannah River National Laboratory (SRNL) notes that historically, most measured Concentration Factor (CF) values during salt processing have been in the 12-14 range. However, recent processing gives CF values closer to 11. This observation does not indicate that the solvent performance is suffering, as the Decontamination Factor (DF) has still maintained consistently high values. Nevertheless, SRNL will continue to monitor for indications of process upsets. The bulk chemistry of the DSSHT and SEHT samples do not show any signs of unusual behavior.


    SciTech Connect (OSTI)

    Brisson, M


    Because of its unique properties as a lightweight metal with high tensile strength, beryllium is widely used in applications including cell phones, golf clubs, aerospace, and nuclear weapons. Beryllium is also encountered in industries such as aluminium manufacturing, and in environmental remediation projects. Workplace exposure to beryllium particulates is a growing concern, as exposure to minute quantities of anthropogenic forms of beryllium may lead to sensitization and to chronic beryllium disease, which can be fatal and for which no cure is currently known. Furthermore, there is no known exposure-response relationship with which to establish a 'safe' maximum level of beryllium exposure. As a result, the current trend is toward ever lower occupational exposure limits, which in turn make exposure assessment, both in terms of sampling and analysis, more challenging. The problems are exacerbated by difficulties in sample preparation for refractory forms of beryllium, such as beryllium oxide, and by indications that some beryllium forms may be more toxic than others. This chapter provides an overview of sources and uses of beryllium, health risks, and occupational exposure limits. It also provides a general overview of sampling, analysis, and data evaluation issues that will be explored in greater depth in the remaining chapters. The goal of this book is to provide a comprehensive resource to aid personnel in a wide variety of disciplines in selecting sampling and analysis methods that will facilitate informed decision-making in workplace and environmental settings.

  4. Model-Based Sampling and Inference

    U.S. Energy Information Administration (EIA) (indexed site)

    Model-Based Sampling, Inference and Imputation James R. Knaub, Jr., Energy Information Administration, EI-53.1 Key Words: Survey statistics, Randomization, Conditionality, Random sampling, Cutoff sampling Abstract: Picking a sample through some randomization mechanism, such as random sampling within groups (stratified random sampling), or, say, sampling every fifth item (systematic random sampling), may be familiar to a lot of people. These are design-based samples.

  5. Viscous-sludge sample collector

    DOE Patents [OSTI]

    Not Available


    A vertical core sample collection system for viscous sludge is disclosed. A sample tube's upper end has a flange and is attached to a piston. The tube and piston are located in the upper end of a bore in a housing. The bore's lower end leads outside the housing and has an inwardly extending rim. Compressed gas, from a storage cylinder, is quickly introduced into the bore's upper end to rapidly accelerate the piston and tube down the bore. The lower end of the tube has a high sludge entering velocity to obtain a full-length sludge sample without disturbing strata detail. The tube's downward motion is stopped when its upper end flange impacts against the bore's lower end inwardly extending rim.

  6. Water-Gas Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Water-Gas Sampling (Redirected from Water-Gas Samples) Redirect page Jump to: navigation, search REDIRECT Downhole Fluid Sampling Retrieved from "http:en.openei.orgw...

  7. Category:Water Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Water Sampling Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermalpower.jpg Looking for the Water Sampling page? For detailed information on Water Sampling as...

  8. Inertial impaction air sampling device

    DOE Patents [OSTI]

    Dewhurst, K.H.


    An inertial impactor to be used in an air sampling device for collection of respirable size particles in ambient air which may include a graphite furnace as the impaction substrate in a small-size, portable, direct analysis structure that gives immediate results and is totally self-contained allowing for remote and/or personal sampling. The graphite furnace collects suspended particles transported through the housing by means of the air flow system, and these particles may be analyzed for elements, quantitatively and qualitatively, by atomic absorption spectrophotometry. 3 figs.

  9. Inertial impaction air sampling device

    DOE Patents [OSTI]

    Dewhurst, K.H.


    An inertial impactor is designed which is to be used in an air sampling device for collection of respirable size particles in ambient air. The device may include a graphite furnace as the impaction substrate in a small-size, portable, direct analysis structure that gives immediate results and is totally self-contained allowing for remote and/or personal sampling. The graphite furnace collects suspended particles transported through the housing by means of the air flow system, and these particles may be analyzed for elements, quantitatively and qualitatively, by atomic absorption spectrophotometry. 3 figs.

  10. Inertial impaction air sampling device

    DOE Patents [OSTI]

    Dewhurst, Katharine H.


    An inertial impactor to be used in an air sampling device for collection of respirable size particles in ambient air which may include a graphite furnace as the impaction substrate in a small-size, portable, direct analysis structure that gives immediate results and is totally self-contained allowing for remote and/or personal sampling. The graphite furnace collects suspended particles transported through the housing by means of the air flow system, and these particles may be analyzed for elements, quantitatively and qualitatively, by atomic absorption spectrophotometry.

  11. The Ocean Sampling Day Consortium

    SciTech Connect (OSTI)

    Kopf, Anna; Bicak, Mesude; Kottmann, Renzo; Schnetzer, Julia; Kostadinov, Ivaylo; Lehmann, Katja; Fernandez-Guerra, Antonio; Jeanthon, Christian; Rahav, Eyal; Ullrich, Matthias; Wichels, Antje; Gerdts, Gunnar; Polymenakou, Paraskevi; Kotoulas, Giorgos; Siam, Rania; Abdallah, Rehab Z.; Sonnenschein, Eva C.; Cariou, Thierry; O’Gara, Fergal; Jackson, Stephen; Orlic, Sandi; Steinke, Michael; Busch, Julia; Duarte, Bernardo; Caçador, Isabel; Canning-Clode, João; Bobrova, Oleksandra; Marteinsson, Viggo; Reynisson, Eyjolfur; Loureiro, Clara Magalhães; Luna, Gian Marco; Quero, Grazia Marina; Löscher, Carolin R.; Kremp, Anke; DeLorenzo, Marie E.; Øvreås, Lise; Tolman, Jennifer; LaRoche, Julie; Penna, Antonella; Frischer, Marc; Davis, Timothy; Katherine, Barker; Meyer, Christopher P.; Ramos, Sandra; Magalhães, Catarina; Jude-Lemeilleur, Florence; Aguirre-Macedo, Ma Leopoldina; Wang, Shiao; Poulton, Nicole; Jones, Scott; Collin, Rachel; Fuhrman, Jed A.; Conan, Pascal; Alonso, Cecilia; Stambler, Noga; Goodwin, Kelly; Yakimov, Michael M.; Baltar, Federico; Bodrossy, Levente; Van De Kamp, Jodie; Frampton, Dion M. F.; Ostrowski, Martin; Van Ruth, Paul; Malthouse, Paul; Claus, Simon; Deneudt, Klaas; Mortelmans, Jonas; Pitois, Sophie; Wallom, David; Salter, Ian; Costa, Rodrigo; Schroeder, Declan C.; Kandil, Mahrous M.; Amaral, Valentina; Biancalana, Florencia; Santana, Rafael; Pedrotti, Maria Luiza; Yoshida, Takashi; Ogata, Hiroyuki; Ingleton, Tim; Munnik, Kate; Rodriguez-Ezpeleta, Naiara; Berteaux-Lecellier, Veronique; Wecker, Patricia; Cancio, Ibon; Vaulot, Daniel; Bienhold, Christina; Ghazal, Hassan; Chaouni, Bouchra; Essayeh, Soumya; Ettamimi, Sara; Zaid, El Houcine; Boukhatem, Noureddine; Bouali, Abderrahim; Chahboune, Rajaa; Barrijal, Said; Timinouni, Mohammed; El Otmani, Fatima; Bennani, Mohamed; Mea, Marianna; Todorova, Nadezhda; Karamfilov, Ventzislav; ten Hoopen, Petra; Cochrane, Guy; L’Haridon, Stephane; Bizsel, Kemal Can; Vezzi, Alessandro; Lauro, Federico M.; Martin, Patrick; Jensen, Rachelle M.; Hinks, Jamie; Gebbels, Susan; Rosselli, Riccardo; De Pascale, Fabio; Schiavon, Riccardo; dos Santos, Antonina; Villar, Emilie; Pesant, Stéphane; Cataletto, Bruno; Malfatti, Francesca; Edirisinghe, Ranjith; Silveira, Jorge A. Herrera; Barbier, Michele; Turk, Valentina; Tinta, Tinkara; Fuller, Wayne J.; Salihoglu, Ilkay; Serakinci, Nedime; Ergoren, Mahmut Cerkez; Bresnan, Eileen; Iriberri, Juan; Nyhus, Paul Anders Fronth; Bente, Edvardsen; Karlsen, Hans Erik; Golyshin, Peter N.; Gasol, Josep M.; Moncheva, Snejana; Dzhembekova, Nina; Johnson, Zackary; Sinigalliano, Christopher David; Gidley, Maribeth Louise; Zingone, Adriana; Danovaro, Roberto; Tsiamis, George; Clark, Melody S.; Costa, Ana Cristina; El Bour, Monia; Martins, Ana M.; Collins, R. Eric; Ducluzeau, Anne-Lise; Martinez, Jonathan; Costello, Mark J.; Amaral-Zettler, Linda A.; Gilbert, Jack A.; Davies, Neil; Field, Dawn; Glöckner, Frank Oliver


    In this study, Ocean Sampling Day was initiated by the EU-funded Micro B3 (Marine Microbial Biodiversity, Bioinformatics, Biotechnology) project to obtain a snapshot of the marine microbial biodiversity and function of the world’s oceans. It is a simultaneous global mega-sequencing campaign aiming to generate the largest standardized microbial data set in a single day. This will be achievable only through the coordinated efforts of an Ocean Sampling Day Consortium, supportive partnerships and networks between sites. This commentary outlines the establishment, function and aims of the Consortium and describes our vision for a sustainable study of marine microbial communities and their embedded functional traits.

  12. 384 Power plant waste water sampling and analysis plan

    SciTech Connect (OSTI)

    Hagerty, K.J.; Knotek, H.M.


    This document presents the 384 Power House Sampling and Analysis Plan. The Plan describes sampling methods, locations, frequency, analytes, and stream descriptions. The effluent streams from 384, were characterized in 1989, in support of the Stream Specific Report (WHC-EP-0342, Addendum 1).

  13. Probe for high resolution NMR with sample reorientation

    DOE Patents [OSTI]

    Pines, A.; Samoson, A.


    An improved NMR probe and method are described which substantially improve the resolution of NMR measurements made on powdered or amorphous or otherwise orientationally disordered samples. The apparatus mechanically varies the orientation of the sample such that the time average of two or more sets of spherical harmonic functions are zero. 8 figs.

  14. Probe for high resolution NMR with sample reorientation

    DOE Patents [OSTI]

    Pines, Alexander; Samoson, Ago


    An improved NMR probe and method are described which substantially improve the resolution of NMR measurements made on powdered or amorphous or otherwise orientationally disordered samples. The apparatus mechanically varies the orientation of the sample such that the time average of two or more sets of spherical harmonic functions are zero.

  15. B-Cell waste classification sampling and analysis plan

    SciTech Connect (OSTI)

    HOBART, R.L.


    This report documents the methods used to collect and analyze samples to obtain data necessary to verify and/or determine the radionuclide content of the 324 Facility B-Cell decontamination and decommissioning waste stream.

  16. Sample rotating turntable kit for infrared spectrometers

    DOE Patents [OSTI]

    Eckels, Joel Del (Livermore, CA); Klunder, Gregory L. (Oakland, CA)


    An infrared spectrometer sample rotating turntable kit has a rotatable sample cup containing the sample. The infrared spectrometer has an infrared spectrometer probe for analyzing the sample and the rotatable sample cup is adapted to receive the infrared spectrometer probe. A reflectance standard is located in the rotatable sample cup. A sleeve is positioned proximate the sample cup and adapted to receive the probe. A rotator rotates the rotatable sample cup. A battery is connected to the rotator.

  17. Sonochemical Digestion of Soil and Sediment Samples

    SciTech Connect (OSTI)

    Sinkov, Sergei I.; Lumetta, Gregg J.


    This work was performed as part of a broader effort to automate analytical methods for determination of plutonium and other radioisotopes in environmental samples. The work described here represented a screening study to determine the potential for applying ultrasonic irradiation to sample digestion. Two standard reference materials (SRMs) were used in this study: Columbia River Sediment and Rocky Flats Soil. The key experiments performed are listed below along with a summary of the results. The action of nitric acid, regardless of its concentration and liquid-to-solid ratio, did not achieve dissolution efficiency better that 20%. The major fraction of natural organic matter (NOM) remained undissolved by this treatment. Sonication did not result in improved dissolution for the SRMs tested. The action of hydrofluoric acid at concentrations of 8 M and higher achieved much more pronounced dissolution (up to 97% dissolved for the Rocky Flats soil sample and up to 78% dissolved for the Columbia River Sediment sample). Dissolution efficiency remains constant for solid-to-liquid ratios of up to 0.05 to 1 and decreases for the higher loadings of the solid phase. Sonication produced no measurable effect in improving the dissolution of the samples compared with the control digestion experiments. Combined treatment of the SRM by mixtures of HNO3 and HF showed inferior performance compared with the HF alone. An adverse effect of sonication was found for the Rocky Flats soil material, which became more noticeable at higher HF concentrations. Sonication of the Columbia River sediment samples had no positive effect in the mixed acid treatment. The results indicate that applying ultrasound in an isolated cup horn configuration does not offer any advantage over conventional ''heat and mix'' treatment for dissolution of the soil and sediment based on the SRM examined here. This conclusion, however, is based on an approach that uses gravimetric analysis to determine gross dissolution

  18. Environmental surveillance master sampling schedule

    SciTech Connect (OSTI)

    Bisping, L E


    Environmental surveillance of the Hanford Site and surrounding areas is conducted by the Pacific Northwest Laboratory (PNL) for the US Department of Energy (DOE). This document contains the planned schedule for routine sample collection for the Surface Environmental Surveillance Project (SESP) and Ground-Water Monitoring Project. Samples for radiological analyses include Air-Particulate Filter, gases and vapor; Water/Columbia River, Onsite Pond, Spring, Irrigation, and Drinking; Foodstuffs/Animal Products including Whole Milk, Poultry and Eggs, and Beef; Foodstuffs/Produce including Leafy Vegetables, Vegetables, and Fruit; Foodstuffs/Farm Products including Wine, Wheat and Alfalfa; Wildlife; Soil; Vegetation; and Sediment. Direct Radiation Measurements include Terrestrial Locations, Columbia River Shoreline Locations, and Onsite Roadway, Railway and Aerial, Radiation Surveys.

  19. The Ocean Sampling Day Consortium


    Kopf, Anna; Bicak, Mesude; Kottmann, Renzo; Schnetzer, Julia; Kostadinov, Ivaylo; Lehmann, Katja; Fernandez-Guerra, Antonio; Jeanthon, Christian; Rahav, Eyal; Ullrich, Matthias; et al


    In this study, Ocean Sampling Day was initiated by the EU-funded Micro B3 (Marine Microbial Biodiversity, Bioinformatics, Biotechnology) project to obtain a snapshot of the marine microbial biodiversity and function of the world’s oceans. It is a simultaneous global mega-sequencing campaign aiming to generate the largest standardized microbial data set in a single day. This will be achievable only through the coordinated efforts of an Ocean Sampling Day Consortium, supportive partnerships and networks between sites. This commentary outlines the establishment, function and aims of the Consortium and describes our vision for a sustainable study of marine microbial communities and theirmore » embedded functional traits.« less

  20. Latin Hypercube Sampling (LHS) UNIX Library/Standalone

    Energy Science and Technology Software Center (OSTI)


    The LHS UNIX Library/Standalone software provides the capability to draw random samples from over 30 distribution types. It performs the sampling by a stratified sampling method called Latin Hypercube Sampling (LHS). Multiple distributions can be sampled simultaneously, with user-specified correlations amongst the input distributions, LHS UNIX Library/ Standalone provides a way to generate multi-variate samples. The LHS samples can be generated either as a callable library (e.g., from within the DAKOTA software framework) or asmore » a standalone capability. LHS UNIX Library/Standalone uses the Latin Hypercube Sampling method (LHS) to generate samples. LHS is a constrained Monte Carlo sampling scheme. In LHS, the range of each variable is divided into non-overlapping intervals on the basis of equal probability. A sample is selected at random with respect to the probability density in each interval, If multiple variables are sampled simultaneously, then values obtained for each are paired in a random manner with the n values of the other variables. In some cases, the pairing is restricted to obtain specified correlations amongst the input variables. Many simulation codes have input parameters that are uncertain and can be specified by a distribution, To perform uncertainty analysis and sensitivity analysis, random values are drawn from the input parameter distributions, and the simulation is run with these values to obtain output values. If this is done repeatedly, with many input samples drawn, one can build up a distribution of the output as well as examine correlations between input and output variables.« less

  1. Laboratory Access | Sample Preparation Laboratories

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Access Planning Ahead Planning Ahead Please complete the Beam Time Request (BTR) and Support Request forms thourgh the User Portal. Thorough chemical and sample information must be included in your BTR. Support Request forms include a list of collaborators that require laboratory access and your group's laboratory equipment requests. Researcher safety is taken seriously at SLAC. Please remember that radioactive materials, nanomaterials, and biohazardous materials have additional safety

  2. Laboratory Waste | Sample Preparation Laboratories

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Laboratory Waste Sharps Broken Glass Containment Hazardous Waste All waste produced in the Sample Prep Labs should be appropriately disposed of at SLAC. You are prohibited to transport waste back to your home institution. Designated areas exist in the labs for sharps, broken glass, and hazardous waste. Sharps, broken glass, and hazardous waste must never be disposed of in the trash cans or sink drains. Containment Bottles, jars, and plastic bags are available for containing chemical waste. Place

  3. Rapid determination of 226Ra in emergency urine samples


    Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.; Utsey, Robin C.; McAlister, Daniel R.


    A new method has been developed at the Savannah River National Laboratory (SRNL) that can be used for the rapid determination of 226Ra in emergency urine samples following a radiological incident. If a radiological dispersive device event or a nuclear accident occurs, there will be an urgent need for rapid analyses of radionuclides in urine samples to ensure the safety of the public. Large numbers of urine samples will have to be analyzed very quickly. This new SRNL method was applied to 100 mL urine aliquots, however this method can be applied to smaller or larger sample aliquots as needed.more » The method was optimized for rapid turnaround times; urine samples may be prepared for counting in <3 h. A rapid calcium phosphate precipitation method was used to pre-concentrate 226Ra from the urine sample matrix, followed by removal of calcium by cation exchange separation. A stacked elution method using DGA Resin was used to purify the 226Ra during the cation exchange elution step. This approach combines the cation resin elution step with the simultaneous purification of 226Ra with DGA Resin, saving time. 133Ba was used instead of 225Ra as tracer to allow immediate counting; however, 225Ra can still be used as an option. The rapid purification of 226Ra to remove interferences using DGA Resin was compared with a slightly longer Ln Resin approach. A final barium sulfate micro-precipitation step was used with isopropanol present to reduce solubility; producing alpha spectrometry sources with peaks typically <40 keV FWHM (full width half max). This new rapid method is fast, has very high tracer yield (>90 %), and removes interferences effectively. The sample preparation method can also be adapted to ICP-MS measurement of 226Ra, with rapid removal of isobaric interferences.« less

  4. Ensemble Sampling vs. Time Sampling in Molecular Dynamics Simulations of Thermal Conductivity


    Gordiz, Kiarash; Singh, David J.; Henry, Asegun


    In this report we compare time sampling and ensemble averaging as two different methods available for phase space sampling. For the comparison, we calculate thermal conductivities of solid argon and silicon structures, using equilibrium molecular dynamics. We introduce two different schemes for the ensemble averaging approach, and show that both can reduce the total simulation time as compared to time averaging. It is also found that velocity rescaling is an efficient mechanism for phase space exploration. Although our methodology is tested using classical molecular dynamics, the ensemble generation approaches may find their greatest utility in computationally expensive simulations such asmore » first principles molecular dynamics. For such simulations, where each time step is costly, time sampling can require long simulation times because each time step must be evaluated sequentially and therefore phase space averaging is achieved through sequential operations. On the other hand, with ensemble averaging, phase space sampling can be achieved through parallel operations, since each ensemble is independent. For this reason, particularly when using massively parallel architectures, ensemble sampling can result in much shorter simulation times and exhibits similar overall computational effort.« less

  5. Sample Preparation Report of the Fourth OPCW Confidence Building Exercise on Biomedical Sample Analysis

    SciTech Connect (OSTI)

    Udey, R. N.; Corzett, T. H.; Alcaraz, A.


    Following the successful completion of the 3rd biomedical confidence building exercise (February 2013 – March 2013), which included the analysis of plasma and urine samples spiked at low ppb levels as part of the exercise scenario, another confidence building exercise was targeted to be conducted in 2014. In this 4th exercise, it was desired to focus specifically on the analysis of plasma samples. The scenario was designed as an investigation of an alleged use of chemical weapons where plasma samples were collected, as plasma has been reported to contain CWA adducts which remain present in the human body for several weeks (Solano et al. 2008). In the 3rd exercise most participants used the fluoride regeneration method to analyze for the presence of nerve agents in plasma samples. For the 4th biomedical exercise it was decided to evaluate the analysis of human plasma samples for the presence/absence of the VX adducts and aged adducts to blood proteins (e.g., VX-butyrylcholinesterase (BuChE) and aged BuChE adducts using a pepsin digest technique to yield nonapeptides; or equivalent). As the aging of VX-BuChE adducts is relatively slow (t1/2 = 77 hr at 37 °C [Aurbek et al. 2009]), soman (GD), which ages much more quickly (t1/2 = 9 min at 37 °C [Masson et al. 2010]), was used to simulate an aged VX sample. Additional objectives of this exercise included having laboratories assess novel OP-adducted plasma sample preparation techniques and analytical instrumentation methodologies, as well as refining/designating the reporting formats for these new techniques.

  6. Enhanced AFCI Sampling, Analysis, and Safeguards Technology Review

    SciTech Connect (OSTI)

    John Svoboda


    The focus of this study includes the investigation of sampling technologies used in industry and their potential application to nuclear fuel processing. The goal is to identify innovative sampling methods using state of the art techniques that could evolve into the next generation sampling and analysis system for metallic elements. Sampling and analysis of nuclear fuel recycling plant processes is required both to monitor the operations and ensure Safeguards and Security goals are met. In addition, environmental regulations lead to additional samples and analysis to meet licensing requirements. The volume of samples taken by conventional means, can restrain productivity while results samples are analyzed, require process holding tanks that are sized to meet analytical issues rather than process issues (and that create a larger facility footprint), or, in some cases, simply overwhelm analytical laboratory capabilities. These issues only grow when process flowsheets propose new separations systems and new byproduct material for transmutation purposes. Novel means of streamlining both sampling and analysis are being evaluated to increase the efficiency while meeting all requirements for information. This report addresses just a part of the effort to develop and study novel methods by focusing on the sampling and analysis of aqueous samples for metallic elements. It presents an overview of the sampling requirements, including frequency, sensitivity, accuracy, and programmatic drivers, to demonstrate the magnitude of the task. The sampling and analysis system needed for metallic element measurements is then discussed, and novel options being applied to other industrial analytical needs are presented. Inductively coupled mass spectrometry instruments are the most versatile for metallic element analyses and are thus chosen as the focus for the study. Candidate novel means of process sampling, as well as modifications that are necessary to couple such instruments to

  7. Microsoft Word - Ventilation System Sampling Results 1

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Ventilation System Sampling Results Air sampling results before and after the High Efficiency Particulate Air (HEPA) filters at WIPP are available here. Station A samples air before the filters and Station B samples air after passing through the filters. These samples were analyzed following the detection of airborne radioactivity on February 14, 2014. They are not environmental samples, and are not representative of the public or worker breathing zone air samples. They do provide assurance that

  8. Biological tracer method

    DOE Patents [OSTI]

    Strong-Gunderson, Janet M. (Ten Mile, TN); Palumbo, Anthony V. (Oak Ridge, TN)


    The present invention is a biological tracer method for characterizing the movement of a material through a medium, comprising the steps of: introducing a biological tracer comprising a microorganism having ice nucleating activity into a medium; collecting at least one sample of the medium from a point removed from the introduction point; and analyzing the sample for the presence of the biological tracer. The present invention is also a method for using a biological tracer as a label for material identification by introducing a biological tracer having ice nucleating activity into a material, collecting a sample of a portion of the labelled material and analyzing the sample for the presence of the biological tracer.

  9. Biological tracer method

    DOE Patents [OSTI]

    Strong-Gunderson, J.M.; Palumbo, A.V.


    The present invention is a biological tracer method for characterizing the movement of a material through a medium, comprising the steps of: introducing a biological tracer comprising a microorganism having ice nucleating activity into a medium; collecting at least one sample of the medium from a point removed from the introduction point; and analyzing the sample for the presence of the biological tracer. The present invention is also a method for using a biological tracer as a label for material identification by introducing a biological tracer having ice nucleating activity into a material, collecting a sample of a portion of the labelled material and analyzing the sample for the presence of the biological tracer. 2 figs.

  10. Single-point representative sampling with shrouded probes

    SciTech Connect (OSTI)

    McFarland, A.R.; Rodgers, J.C.


    The Environmental Protection Agency (EPA) prescribed methodologies for sampling radionuclides in air effluents from stacks and ducts at US Department of Energy (DOE) facilities. Requirements include use of EPA Method 1 for the location of sampling sites and use of American National Standards Institute (ANSI) N13.1 for guidance in design of sampling probes and the number of probes at a given site. Application of ANSI N13.1 results in sampling being performed with multiprobe rakes that have as many as 20 probes. There can be substantial losses of aerosol particles in such sampling that will degrade the quality of emission estimates from a nuclear facility. Three alternate methods, technically justified herein, are proposed for effluent sampling. First, a shrouded aerosol sampling probe should replace the sharp-edged elbowed-nozzle recommended by ANSI. This would reduce the losses of aerosol particles in probes and result in the acquisition of more representative aerosol samples. Second, the rakes of multiple probes that are intended to acquire representative samples through spatial coverage should be replaced by a single probe located where contaminant mass and fluid momentum are both well mixed. A representative sample can be obtained from a well-mixed flow. Some effluent flows will need to be engineered to achieve acceptable mixing. Third, sample extraction should be performed at a constant flow rate through a suitable designed shrouded probe rather than at a variable flow rate through isokinetic probes. A shrouded probe is shown to have constant sampling characteristics over a broad range of stack velocities when operated at a fixed flow rate.

  11. Licensing Guide and Sample License

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    TEI:HNOL06Y TRANSFER WORKIN6 6ROUP Lic:en!iing Guide and Sample Lic:en!ie *~ ICan.u City Plan I OFermilab ~OAK ~RIDGE Nuioul~.<o-.,. Arg9..QDe t.AIOUTOlY SRNL .............. ~ A o LOs Alamos MATIO NA L l .U ORUORY / BROOKHAVEN NATIONAL LABORATORY :.:..,/ PRIN. C£loN PlASMA PHYSICS t ABOAATORV .:~ Ul!J Lawrence Uvermore National Laboratory Jef[;?on Lab t1NREL ~ ..................... sandia National Laboratories Laboratory or Facility Representative Email Addresses Phone # Ames Laboratory

  12. Offline solid phase microextraction sampling system

    DOE Patents [OSTI]

    Harvey, Chris A.


    An offline solid phase microextraction (SPME) sampling apparatus for enabling SPME samples to be taken a number of times from a previously collected fluid sample (e.g. sample atmosphere) stored in a fused silica lined bottle which keeps volatile organics in the fluid sample stable for weeks at a time. The offline SPME sampling apparatus has a hollow body surrounding a sampling chamber, with multiple ports through which a portion of a previously collected fluid sample may be (a) released into the sampling chamber, (b) SPME sampled to collect analytes for subsequent GC analysis, and (c) flushed/purged using a fluidically connected vacuum source and purging fluid source to prepare the sampling chamber for additional SPME samplings of the same original fluid sample, such as may have been collected in situ from a headspace.

  13. Vapor spill monitoring method

    DOE Patents [OSTI]

    Bianchini, Gregory M.; McRae, Thomas G.


    Method for continuous sampling of liquified natural gas effluent from a spill pipe, vaporizing the cold liquified natural gas, and feeding the vaporized gas into an infrared detector to measure the gas composition. The apparatus utilizes a probe having an inner channel for receiving samples of liquified natural gas and a surrounding water jacket through which warm water is flowed to flash vaporize the liquified natural gas.

  14. CFCNCA Sample Pledge Form | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    CFCNCA Sample Pledge Form CFCNCA Sample Pledge Form This file contains a sample pledge form and instructions for completing a paper donation through the CFC. CFCNCA Fall 2012 Sample Pledge Form.pdf (151.39 KB) More Documents & Publications CFCNCA Sample Pledge Form 2012 CFCNCA Catalog of Caring DOE F 3630.1 Rights and Benefits of Reservists Called to Active Duty

  15. Multicanonical sampling of rare events in random matrices

    SciTech Connect (OSTI)

    Saito, Nen; Iba, Yukito; Hukushima, Koji


    A method based on multicanonical Monte Carlo is applied to the calculation of large deviations in the largest eigenvalue of random matrices. The method is successfully tested with the Gaussian orthogonal ensemble, sparse random matrices, and matrices whose components are subject to uniform density. Specifically, the probability that all eigenvalues of a matrix are negative is estimated in these cases down to the values of {approx}10{sup -200}, a region where simple random sampling is ineffective. The method can be applied to any ensemble of matrices and used for sampling rare events characterized by any statistics.

  16. Sampling for Beryllium Surface Contamination using Wet, Dry and Alcohol Wipe Sampling

    SciTech Connect (OSTI)

    Kerr, Kent


    This research project was conducted at the National Nuclear Security Administration's Kansas City Plant, operated by Honeywell Federal Manufacturing and Technologies, in conjunction with the Safety Sciences Department of Central Missouri State University, to compare relative removal efficiencies of three wipe sampling techniques currently used at Department of Energy facilities. Efficiencies of removal of beryllium contamination from typical painted surfaces were tested by wipe sampling with dry Whatman 42 filter paper, with water-moistened (Ghost Wipe) materials, and by methanol-moistened wipes. Test plates were prepared using 100 mm X 15 mm Pyrex Petri dishes with interior surfaces spray painted with a bond coat primer. To achieve uniform deposition over the test plate surface, 10 ml aliquots of solution containing 1 beryllium and 0.1 ml of metal working fluid were transferred to the test plates and subsequently evaporated. Metal working fluid was added to simulate the slight oiliness common on surfaces in metal working shops where fugitive oil mist accumulates over time. Sixteen test plates for each wipe method (dry, water, and methanol) were processed and sampled using a modification of wiping patterns recommended by OSHA Method 125G. Laboratory and statistical analysis showed that methanol-moistened wipe sampling removed significantly more (about twice as much) beryllium/oil-film surface contamination as water-moistened wipes (p< 0.001), which removed significantly more (about twice as much) residue as dry wipes (p <0.001). Evidence for beryllium sensitization via skin exposure argues in favor of wipe sampling with wetting agents that provide enhanced residue removal efficiency.


    SciTech Connect (OSTI)

    Dennis L. Laudal


    At the request of the Minnesota Power, Inc., the Energy & Environmental Research Center (EERC) sampled for lead at the stack (or duct directly leading to the stack) for three units at the Boswell Energy Center. All sampling was done in triplicate using U.S. Environmental Protection Agency (EPA) Method 12, with sampling procedures following EPA Methods 1 through 4. During the test program, lead sampling was done using EPA Method 12 in the duct at the outlet of the baghouse serving Unit 2 and the duct at the outlet of the wet particulate scrubber serving Unit 3. For Unit 4, lead sampling was done at the stack. The specific objective for the project was to determine the concentration of lead in the flue gas being emitted into the atmosphere from the Boswell Energy Center. The test program was performed during the period of May 8 through 11, 2000. This report presents the test data, sample calculations, and results, and a discussion of the lead sampling performed at the Boswell Energy Center. The detailed test data and test results, raw test data, process data, laboratory reports, and equipment calibration records are provided in Appendices A, B, and C.

  18. Rapid determination of 226Ra in environmental samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Culligan, Brian K.


    A new rapid method for the determination of {sup 228}Ra in natural water samples has been developed at the SRNL/EBL (Savannah River National Lab/ Environmental Bioassay Laboratory) that can be used for emergency response or routine samples. While gamma spectrometry can be employed with sufficient detection limits to determine {sup 228}Ra in solid samples (via {sup 228}Ac) , radiochemical methods that employ gas flow proportional counting techniques typically provide lower MDA (Minimal Detectable Activity) levels for the determination of {sup 228}Ra in water samples. Most radiochemical methods for {sup 228}Ra collect and purify {sup 228}Ra and allow for {sup 228}Ac daughter ingrowth for ~36 hours. In this new SRNL/EBL approach, {sup 228}Ac is collected and purified from the water sample without waiting to eliminate this delay. The sample preparation requires only about 4 hours so that {sup 228}Ra assay results on water samples can be achieved in < 6 hours. The method uses a rapid calcium carbonate precipitation enhanced with a small amount of phosphate added to enhance chemical yields (typically >90%), followed by rapid cation exchange removal of calcium. Lead, bismuth, uranium, thorium and protactinium isotopes are also removed by the cation exchange separation. {sup 228}Ac is eluted from the cation resin directly onto a DGA Resin cartridge attached to the bottom of the cation column to purify {sup 228}Ac. DGA Resin also removes lead and bismuth isotopes, along with Sr isotopes and {sup 90}Y. La is used to determine {sup 228}Ac chemical yield via ICP-MS, but {sup 133}Ba can also be used instead if ICP-MS assay is not available. Unlike some older methods, no lead or strontium holdback carriers or continual readjustment of sample pH is required.

  19. Hanford analytical sample projections 1996 - 2000

    SciTech Connect (OSTI)

    Joyce, S.M.


    Sample projections are compiled for the Hanford site based on inputs from the major programs for the years 1996 through 2000. Sample projections are categorized by radiation level, protocol, sample matrix and Program. Analyses requirements are also presented.

  20. Heuristic-biased stochastic sampling

    SciTech Connect (OSTI)

    Bresina, J.L.


    This paper presents a search technique for scheduling problems, called Heuristic-Biased Stochastic Sampling (HBSS). The underlying assumption behind the HBSS approach is that strictly adhering to a search heuristic often does not yield the best solution and, therefore, exploration off the heuristic path can prove fruitful. Within the HBSS approach, the balance between heuristic adherence and exploration can be controlled according to the confidence one has in the heuristic. By varying this balance, encoded as a bias function, the HBSS approach encompasses a family of search algorithms of which greedy search and completely random search are extreme members. We present empirical results from an application of HBSS to the realworld problem of observation scheduling. These results show that with the proper bias function, it can be easy to outperform greedy search.

  1. Draft Sample Collection Instrument | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    Draft Sample Collection Instrument Draft Sample Collection Instrument Davis-Bacon Semi-annual Labor Compliance Report OMB Control Number 1910-New PDF icon dbacollectioninstrument...

  2. Category:Gas Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Technique Subcategories This category has the following 3 subcategories, out of 3 total. G Gas Flux Sampling 1 pages S Soil Gas Sampling 1 pages Surface Gas...

  3. Category:Field Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Technique Subcategories This category has the following 2 subcategories, out of 2 total. G + Gas Sampling (3 categories) 4 pages W + Water Sampling (2 categories) 3...

  4. Laboratory begins environmental sampling in townsite

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Laboratory begins environmental sampling Laboratory begins environmental sampling in townsite Environmental assessment of areas that have been or could have been affected by...

  5. Direct analysis of air filter samples for alpha emitting isotopes

    SciTech Connect (OSTI)

    Mohagheghi, A.H.; Ghanbari, F.; Ebara, S.B.; Enghauser, M.E. [Sandia National Labs., Albuquerque, NM (United States); Bakhtiar, S.N. [Westinghouse WIPP, Carlsbad, NM (United States)


    The traditional method for determination of alpha emitting isotopes on air filters has been to process the samples by radiochemical methods. However, this method is too slow for cases of incidents involving radioactive materials where the determination of personnel received dose is urgent. A method is developed to directly analyze the air filters taken from personal and area air monitors. The site knowledge is used in combination with alpha spectral information to identify isotopes. A mathematical function is developed to estimate the activity for each isotope. The strengths and weaknesses of the method are discussed.


    SciTech Connect (OSTI)

    Maxwell, S.


    A new rapid method for the determination of {sup 210}Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that can be used for emergency response or routine water analyses. If a radiological dispersive device (RDD) event or a radiological attack associated with drinking water supplies occurs, there will be an urgent need for rapid analyses of water samples, including drinking water, ground water and other water effluents. Current analytical methods for the assay of {sup 210}Po in water samples have typically involved spontaneous auto-deposition of {sup 210}Po onto silver or other metal disks followed by counting by alpha spectrometry. The auto-deposition times range from 90 minutes to 24 hours or more, at times with yields that may be less than desirable. If sample interferences are present, decreased yields and degraded alpha spectrums can occur due to unpredictable thickening in the deposited layer. Separation methods have focused on the use of Sr Resin?, often in combination with 210Pb analysis. A new rapid method for {sup 210}Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that utilizes a rapid calcium phosphate co-precipitation method, separation using DGA Resin? (N,N,N?,N? tetraoctyldiglycolamide extractant-coated resin, Eichrom Technologies or Triskem-International), followed by rapid microprecipitation of {sup 210}Po using bismuth phosphate for counting by alpha spectrometry. This new method can be performed quickly with excellent removal of interferences, high chemical yields and very good alpha peak resolution, eliminating any potential problems with the alpha source preparation for emergency or routine samples. A rapid sequential separation method to separate {sup 210} Po and actinide isotopes was also developed. This new approach, rapid separation with DGA Resin plus microprecipitation for alpha source preparation, is a significant advance in radiochemistry for the rapid

  7. Apparatus for sectioning demountable semiconductor samples

    DOE Patents [OSTI]

    Sopori, Bhushan L.; Wolf, Abraham


    Apparatus for use during polishing and sectioning operations of a ribbon sample is described. The sample holder includes a cylinder having an axially extending sample cavity terminated in a first funnel-shaped opening and a second slot-like opening. A spring-loaded pressure plunger is located adjacent the second opening of the sample cavity for frictional engagement of the sample prior to introduction of a molding medium in the sample cavity. A heat softenable molding medium is inserted in the funnel-shaped opening, to surround the sample. After polishing, the heater is energized to allow draining of the molding medium from the sample cavity. During manual polishing, the second end of the sample holder is inserted in a support ring which provides mechanical support as well as alignment of the sample holder during polishing. A gauge block for measuring the protrusion of a sample beyond the second wall of the holder is also disclosed.

  8. Amplitude sorting of oscillatory burst signals by sampling

    DOE Patents [OSTI]

    Davis, Thomas J.


    A method and apparatus for amplitude sorting of oscillatory burst signals is described in which the burst signal is detected to produce a burst envelope signal and an intermediate or midportion of such envelope signal is sampled to provide a sample pulse output. The height of the sample pulse is proportional to the amplitude of the envelope signal and to the maximum burst signal amplitude. The sample pulses are fed to a pulse height analyzer for sorting. The present invention is used in an acoustic emission testing system to convert the amplitude of the acoustic emission burst signals into sample pulse heights which are measured by a pulse height analyzer for sorting the pulses in groups according to their height in order to identify the material anomalies in the test material which emit the acoustic signals.

  9. Determination of actinides in urine and fecal samples

    DOE Patents [OSTI]

    McKibbin, T.T.


    A method of determining the radioactivity of specific actinides that are carried in urine or fecal sample material is disclosed. The samples are ashed in a muffle furnace, dissolved in an acid, and then treated in a series of steps of reduction, oxidation, dissolution, and precipitation, including a unique step of passing a solution through a chloride form anion exchange resin for separation of uranium and plutonium from americium.

  10. Determination of actinides in urine and fecal samples

    DOE Patents [OSTI]

    McKibbin, Terry T.


    A method of determining the radioactivity of specific actinides that are carried in urine or fecal sample material is disclosed. The samples are ashed in a muffle furnace, dissolved in an acid, and then treated in a series of steps of reduction, oxidation, dissolution, and precipitation, including a unique step of passing a solution through a chloride form anion exchange resin for separation of uranium and plutonium from americium.

  11. Determination of actinides in urine and fecal samples

    SciTech Connect (OSTI)

    McKibbin, T.T.


    A method of determining the radioactivity of specific actinides that are carried in urine or fecal sample material is disclosed. The samples are ashed in a muffle furnace, dissolved in an acid, and then treated in a series of steps of reduction, oxidation, dissolution, and precipitation, including a unique step of passing a solution through a chloride form anion exchange resin for separation of uranium and plutonium from americium.

  12. Electrphoretic Sample Excitation Light Assembly.

    DOE Patents [OSTI]

    Li, Qingbo; Liu, Changsheng


    An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carrousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.


    SciTech Connect (OSTI)

    Maxwell, S.


    A new rapid method for the determination of {sup 226}Ra in environmental samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used for emergency response or routine sample analyses. The need for rapid analyses in the event of a Radiological Dispersive Device or Improvised Nuclear Device event is well-known. In addition, the recent accident at Fukushima Nuclear Power Plant in March, 2011 reinforces the need to have rapid analyses for radionuclides in environmental samples in the event of a nuclear accident. {sup 226}Ra (T1/2 = 1,620 years) is one of the most toxic of the long-lived alpha-emitters present in the environment due to its long life and its tendency to concentrate in bones, which increases the internal radiation dose of individuals. The new method to determine {sup 226}Ra in environmental samples utilizes a rapid sodium hydroxide fusion method for solid samples, calcium carbonate precipitation to preconcentrate Ra, and rapid column separation steps to remove interferences. The column separation process uses cation exchange resin to remove large amounts of calcium, Sr Resin to remove barium and Ln Resin as a final purification step to remove {sup 225}Ac and potential interferences. The purified {sup 226}Ra sample test sources are prepared using barium sulfate microprecipitation in the presence of isopropanol for counting by alpha spectrometry. The method showed good chemical recoveries and effective removal of interferences. The determination of {sup 226}Ra in environmental samples can be performed in less than 16 h for vegetation, concrete, brick, soil, and air filter samples with excellent quality for emergency or routine analyses. The sample preparation work takes less than 6 h. {sup 225}Ra (T1/2 = 14.9 day) tracer is used and the {sup 225}Ra progeny {sup 217}At is used to determine chemical yield via alpha spectrometry. The rapid fusion technique is a rugged sample digestion method that ensures that any

  14. High throughput analysis of samples in flowing liquid

    DOE Patents [OSTI]

    Ambrose, W. Patrick; Grace, W. Kevin; Goodwin, Peter M.; Jett, James H.; Orden, Alan Van; Keller, Richard A.


    Apparatus and method enable imaging multiple fluorescent sample particles in a single flow channel. A flow channel defines a flow direction for samples in a flow stream and has a viewing plane perpendicular to the flow direction. A laser beam is formed as a ribbon having a width effective to cover the viewing plane. Imaging optics are arranged to view the viewing plane to form an image of the fluorescent sample particles in the flow stream, and a camera records the image formed by the imaging optics.

  15. Enhanced Sampling and Analysis, Selection of Technology for Testing

    SciTech Connect (OSTI)

    Svoboda, John; Meikrantz, David


    The focus of this study includes the investigation of sampling technologies used in industry and their potential application to nuclear fuel processing. The goal is to identify innovative sampling methods using state of the art techniques that could evolve into the next generation sampling and analysis system for metallic elements. This report details the progress made in the first half of FY 2010 and includes a further consideration of the research focus and goals for this year. Our sampling options and focus for the next generation sampling method are presented along with the criteria used for choosing our path forward. We have decided to pursue the option of evaluating the feasibility of microcapillary based chips to remotely collect, transfer, track and supply microliters of sample solutions to analytical equipment in support of aqueous processes for used nuclear fuel cycles. Microchip vendors have been screened and a choice made for the development of a suitable microchip design followed by production of samples for evaluation by ANL, LANL, and INL on an independent basis.

  16. Elimination of ``memory`` from sample handling and inlet system of a mass spectrometer

    DOE Patents [OSTI]

    Chastgner, P.


    This paper describes a method for preparing the sample handling and inlet system of a mass spectrometer for analysis of a subsequent sample following analysis of a previous sample comprising the flushing of the system interior with supercritical CO{sub 2} and venting the interior. The method eliminates the effect of system ``memory`` on the subsequent analysis, especially following persistent samples such as xenon and krypton.

  17. Core sampling system spare parts assessment

    SciTech Connect (OSTI)

    Walter, E.J.


    Soon, there will be 4 independent core sampling systems obtaining samples from the underground tanks. It is desirable that these systems be available for sampling during the next 2 years. This assessment was prepared to evaluate the adequacy of the spare parts identified for the core sampling system and to provide recommendations that may remediate overages or inadequacies of spare parts.

  18. Tank 12H residuals sample analysis report

    SciTech Connect (OSTI)

    Oji, L. N.; Shine, E. P.; Diprete, D. P.; Coleman, C. J.; Hay, M. S.


    The Savannah River National Laboratory (SRNL) was requested by Savannah River Remediation (SRR) to provide sample preparation and analysis of the Tank 12H final characterization samples to determine the residual tank inventory prior to grouting. Eleven Tank 12H floor and mound residual material samples and three cooling coil scrape samples were collected and delivered to SRNL between May and August of 2014.

  19. Apparatus for sectioning demountable semiconductor samples

    DOE Patents [OSTI]

    Sopori, B.L.; Wolf, A.


    Apparatus for use during polishing and sectioning operations of a ribbon sample is described. The sample holder includes a cylinder having an axially extending sample cavity terminated in a first funnel-shaped opening and a second slot-like opening. A spring-loaded pressure plunger is located adjacent the second opening of the sample cavity for frictional engagement of the sample cavity. A heat softenable molding medium is inserted in the funnel-shaped opening, to surround the sample. After polishing, the heater is energized to allow draining of the molding medium from the sample cavity. During manual polishing, the second end of the sample holder is inserted in a support ring which provides mechanical support as well as alignment of the sample holder during polishing. A gauge block for measuring the protrusion of a sample beyond the second wall of the holder is also disclosed.

  20. Sample introduction system for a flow cytometer

    DOE Patents [OSTI]

    Van den Engh, Ger


    A sample introduction system for a flow cytometer allows easy change of sample containers such as test tubes and facilitates use in high pressure environments. The sample container includes a cap having a pressure supply chamber and a sample container attachment cavity. A sample container may be automatically positioned into the attachment cavity so as to sealably engage the end of the sample container as its outer surface. This positioning may be accomplished through some sample introduction mechanism. To facilitate cleaning, HPLC tubing and fittings may be used in a manner which facilitates removing of the entire tubing from both the nozzle container and other sample container cap to permit its replacement to avoid contamination. The sample container support may include horizontal stops which loosely limit the movement of the sample container and thus avoid further stresses upon it.

  1. Sample introduction apparatus for a flow cytometer

    DOE Patents [OSTI]

    Van den Engh, Ger


    A sample introduction system for a flow cytometer allows easy change of sample containers such as test tubes and facilitates use in high pressure environments. The sample container includes a cap having a pressure supply chamber and a sample container attachment cavity. A sample container may be automatically positioned into the attachment cavity so as to sealably engage the end of the sample container as its outer surface. This positioning may be accomplished through some sample introduction mechanism. To facilitate cleaning HPLC tubing and fittings may be used in a manner which facilitates removable of the entire tubing from both the nozzle container and other sample container cap to permit its replacement to avoid contamination. The sample container support may include horizontal stops which loosely limit the movement of the sample container and thus avoid further stresses upon it.

  2. Sample introduction apparatus for a flow cytometer

    DOE Patents [OSTI]

    Van den Engh, G.


    A sample introduction system for a flow cytometer allows easy change of sample containers such as test tubes and facilitates use in high pressure environments. The sample container includes a cap having a pressure supply chamber and a sample container attachment cavity. A sample container may be automatically positioned into the attachment cavity so as to sealably engage the end of the sample container as its outer surface. This positioning may be accomplished through some sample introduction mechanism. To facilitate cleaning HPLC tubing and fittings may be used in a manner which facilitates removable of the entire tubing from both the nozzle container and other sample container cap to permit its replacement to avoid contamination. The sample container support may include horizontal stops which loosely limit the movement of the sample container and thus avoid further stresses upon it. 3 figs.

  3. Sample introduction system for a flow cytometer

    DOE Patents [OSTI]

    Engh, G. van den


    A sample introduction system for a flow cytometer allows easy change of sample containers such as test tubes and facilitates use in high pressure environments. The sample container includes a cap having a pressure supply chamber and a sample container attachment cavity. A sample container may be automatically positioned into the attachment cavity so as to sealably engage the end of the sample container as its outer surface. This positioning may be accomplished through some sample introduction mechanism. To facilitate cleaning, HPLC tubing and fittings may be used in a manner which facilitates removing of the entire tubing from both the nozzle container and other sample container cap to permit its replacement to avoid contamination. The sample container support may include horizontal stops which loosely limit the movement of the sample container and thus avoid further stresses upon it. 3 figs.


    SciTech Connect (OSTI)

    Kittelson, D; Watts, W; Johnson, J; Zarling, D Schauer,J Kasper, K; Baltensperger, U; Burtscher, H


    The University of Minnesota collaborated with the Paul Scherrer Institute, the University of Wisconsin (UWI) and Ricardo, Inc to physically and chemically characterize the exhaust plume from recruited gasoline spark ignition (SI) vehicles. The project objectives were: (1) Measure representative particle size distributions from a set of on-road SI vehicles and compare these data to similar data collected on a small subset of light-duty gasoline vehicles tested on a chassis dynamometer with a dilution tunnel using the Unified Drive Cycle, at both room temperature (cold start) and 0 C (cold-cold start). (2) Compare data collected from SI vehicles to similar data collected from Diesel engines during the Coordinating Research Council E-43 project. (3) Characterize on-road aerosol during mixed midweek traffic and Sunday midday periods and determine fleet-specific emission rates. (4) Characterize bulk- and size-segregated chemical composition of the particulate matter (PM) emitted in the exhaust from the gasoline vehicles. Particle number concentrations and size distributions are strongly influenced by dilution and sampling conditions. Laboratory methods were evaluated to dilute SI exhaust in a way that would produce size distributions that were similar to those measured during laboratory experiments. Size fractionated samples were collected for chemical analysis using a nano-microorifice uniform deposit impactor (nano-MOUDI). In addition, bulk samples were collected and analyzed. A mixture of low, mid and high mileage vehicles were recruited for testing during the study. Under steady highway cruise conditions a significant particle signature above background was not measured, but during hard accelerations number size distributions for the test fleet were similar to modern heavy-duty Diesel vehicles. Number emissions were much higher at high speed and during cold-cold starts. Fuel specific number emissions range from 1012 to 3 x 1016 particles/kg fuel. A simple

  5. {sup 235}U accountability measurements on small samples

    SciTech Connect (OSTI)

    Sigg, R.A.


    Savannah River Site (SRS) is improving uranium accountability at its fuel fabrication facility through measurements of {sup 235}U in samples taken from uranium/aluminum alloy melts. Since area personnel desired a method that would minimize mixed waste, low volume samples are prepared from dissolutions of production melt grab samples. The solution assay monitor (SAM) analyzes for {sup 235}U gamm-rays by using a high-efficiency germanium well detector. The detector`s high counting efficiency permits analysis of small samples (7 mL) from these dissolutions, and the counting geometry minimizes sample geometry uncertainties. Counting each sample for thirty minutes delivers excellent precision across the calibration range of 3 to 12 g uranium per liter. As shown by interlaboratory calibration, the gamma-ray spectrometer provides overall (counting, calibration, geometric,...) uncertainties less than 0.7% one sigma. Gamma-rays from a reference source, used to provide live-time corrections, are collimated to avoid absorption by the sample in the detector well. Since sample masses are small, minor self-attenuation corrections are calculated from chemical composition data rather than determined in separate transmission measurements. This avoids employing short-lived transmission sources for self-attenuation corrections.

  6. sup 235 U accountability measurements on small samples

    SciTech Connect (OSTI)

    Sigg, R.A.


    Savannah River Site (SRS) is improving uranium accountability at its fuel fabrication facility through measurements of {sup 235}U in samples taken from uranium/aluminum alloy melts. Since area personnel desired a method that would minimize mixed waste, low volume samples are prepared from dissolutions of production melt grab samples. The solution assay monitor (SAM) analyzes for {sup 235}U gamm-rays by using a high-efficiency germanium well detector. The detector's high counting efficiency permits analysis of small samples (7 mL) from these dissolutions, and the counting geometry minimizes sample geometry uncertainties. Counting each sample for thirty minutes delivers excellent precision across the calibration range of 3 to 12 g uranium per liter. As shown by interlaboratory calibration, the gamma-ray spectrometer provides overall (counting, calibration, geometric,...) uncertainties less than 0.7% one sigma. Gamma-rays from a reference source, used to provide live-time corrections, are collimated to avoid absorption by the sample in the detector well. Since sample masses are small, minor self-attenuation corrections are calculated from chemical composition data rather than determined in separate transmission measurements. This avoids employing short-lived transmission sources for self-attenuation corrections.

  7. Method for isolating nucleic acids

    SciTech Connect (OSTI)

    Hurt, Jr., Richard Ashley; Elias, Dwayne A.


    The current disclosure provides methods and kits for isolating nucleic acid from an environmental sample. The current methods and compositions further provide methods for isolating nucleic acids by reducing adsorption of nucleic acids by charged ions and particles within an environmental sample. The methods of the current disclosure provide methods for isolating nucleic acids by releasing adsorbed nucleic acids from charged particles during the nucleic acid isolation process. The current disclosure facilitates the isolation of nucleic acids of sufficient quality and quantity to enable one of ordinary skill in the art to utilize or analyze the isolated nucleic acids for a wide variety of applications including, sequencing or species population analysis.

  8. Sample Indirect Rate Proposal (Pre-Award) and For-Profit Compliance Audit

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    Information | Department of Energy Sample Indirect Rate Proposal (Pre-Award) and For-Profit Compliance Audit Information Sample Indirect Rate Proposal (Pre-Award) and For-Profit Compliance Audit Information Indirect rate and audit forms for the financial opportunities process: Sample Indirect Rate Proposal (Pre-Award): There are several methods for allocating indirect cost/expenses to projects, activities and programs, DCAA "ICE" model, Single Rate Method, and Two Rate Method.


    SciTech Connect (OSTI)

    Maxwell, S.


    A new rapid method for the determination of actinides and radiostrontium in vegetation samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used in emergency response situations or for routine analysis. The actinides in vegetation method utilizes a rapid sodium hydroxide fusion method, a lanthanum fluoride matrix removal step, and a streamlined column separation process with stacked TEVA, TRU and DGA Resin cartridges. Lanthanum was separated rapidly and effectively from Am and Cm on DGA Resin. Alpha emitters are prepared using rare earth microprecipitation for counting by alpha spectrometry. The purified {sup 90}Sr fractions are mounted directly on planchets and counted by gas flow proportional counting. The method showed high chemical recoveries and effective removal of interferences. The actinide and {sup 90}Sr in vegetation sample analysis can be performed in less than 8 h with excellent quality for emergency samples. The rapid fusion technique is a rugged sample digestion method that ensures that any refractory actinide particles or vegetation residue after furnace heating is effectively digested.

  10. Fluid sampling system for a nuclear reactor

    DOE Patents [OSTI]

    Lau, L.K.; Alper, N.I.


    A system of extracting fluid samples, either liquid or gas, from the interior of a nuclear reactor containment utilizes a jet pump. To extract the sample fluid, a nonradioactive motive fluid is forced through the inlet and discharge ports of a jet pump located outside the containment, creating a suction that draws the sample fluid from the containment through a sample conduit connected to the pump suction port. The mixture of motive fluid and sample fluid is discharged through a return conduit to the interior of the containment. The jet pump and means for removing a portion of the sample fluid from the sample conduit can be located in a shielded sample grab station located next to the containment. A non-nuclear grade active pump can be located outside the grab sampling station and the containment to pump the nonradioactive motive fluid through the jet pump. 1 fig.

  11. Fluid sampling system for a nuclear reactor

    DOE Patents [OSTI]

    Lau, Louis K.; Alper, Naum I.


    A system of extracting fluid samples, either liquid or gas, from the interior of a nuclear reactor containment utilizes a jet pump. To extract the sample fluid, a nonradioactive motive fluid is forced through the inlet and discharge ports of a jet pump located outside the containment, creating a suction that draws the sample fluid from the containment through a sample conduit connected to the pump suction port. The mixture of motive fluid and sample fluid is discharged through a return conduit to the interior of the containment. The jet pump and means for removing a portion of the sample fluid from the sample conduit can be located in a shielded sample grab station located next to the containment. A non-nuclear grade active pump can be located outside the grab sampling station and the containment to pump the nonradioactive motive fluid through the jet pump.

  12. Methods for making nucleotide probes for sequencing and synthesis...

    Office of Scientific and Technical Information (OSTI)

    of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence ...

  13. In-situ sampling of a large-scale particle simulation for interactive...

    Office of Scientific and Technical Information (OSTI)

    Sponsoring Org: DOE Country of Publication: United States Language: English Subject: 97 MATHEMATICAL METHODS AND COMPUTING; APPROXIMATIONS; SAMPLING; SIMULATION; STORAGE Word Cloud ...

  14. Effects of Sample Preparation on the Infrared Reflectance Spectra of Powders

    SciTech Connect (OSTI)

    Brauer, Carolyn S.; Johnson, Timothy J.; Myers, Tanya L.; Su, Yin-Fong; Blake, Thomas A.; Forland, Brenda M.


    While reflectance spectroscopy is a useful tool in identifying molecular compounds, laboratory measurement of solid (particularly powder) samples often is confounded by sample preparation methods. For example, both the packing density and surface roughness can have an effect on the quantitative reflectance spectra of powdered samples. Recent efforts in our group have focused on developing standard methods for measuring reflectance spectra that accounts for sample preparation, as well as other factors such as particle size and provenance. In this work, the effect of preparation method on sample reflectivity was investigated by measuring the directional-hemispherical spectra of samples that were hand-packed as well as pressed into pellets using an integrating sphere attached to a Fourier transform infrared spectrometer. The results show that the methods used to prepare the sample have a substantial effect on the measured reflectance spectra, as do other factors such as particle size.

  15. Cleaning method and apparatus

    DOE Patents [OSTI]

    Jackson, D.D.; Hollen, R.M.


    A method of very thoroughly and quikcly cleaning a guaze electrode used in chemical analyses is given, as well as an automobile cleaning apparatus which makes use of the method. The method generates very little waste solution, and this is very important in analyzing radioactive materials, especially in aqueous solutions. The cleaning apparatus can be used in a larger, fully automated controlled potential coulometric apparatus. About 99.98% of a 5 mg plutonium sample was removed in less than 3 minutes, using only about 60 ml of rinse solution and two main rinse steps.

  16. Rapid Determination Of Radiostrontium In Large Soil Samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Culligan, Brian K.; Shaw, Patrick J.


    A new method for the determination of radiostrontium in large soil samples has been developed at the Savannah River Environmental Laboratory (Aiken, SC, USA) that allows rapid preconcentration and separation of strontium in large soil samples for the measurement of strontium isotopes by gas flow proportional counting. The need for rapid analyses in the event of a Radiological Dispersive Device (RDD) or Improvised Nuclear Device (IND) event is well-known. In addition, the recent accident at Fukushima Nuclear Power Plant in March, 2011 reinforces the need to have rapid analyses for radionuclides in environmental samples in the event of a nuclear accident. The method employs a novel pre-concentration step that utilizes an iron hydroxide precipitation (enhanced with calcium phosphate) followed by a final calcium fluoride precipitation to remove silicates and other matrix components. The pre-concentration steps, in combination with a rapid Sr Resin separation using vacuum box technology, allow very large soil samples to be analyzed for {sup 89,90}Sr using gas flow proportional counting with a lower method detection limit. The calcium fluoride precipitation eliminates column flow problems typically associated with large amounts of silicates in large soil samples.

  17. Post-Award Deliverables Sample (Part 2 of Sample Deliverables for Task

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    Orders, IDIQ Attachment. J-4) | Department of Energy Award Deliverables Sample (Part 2 of Sample Deliverables for Task Orders, IDIQ Attachment. J-4) Post-Award Deliverables Sample (Part 2 of Sample Deliverables for Task Orders, IDIQ Attachment. J-4) Document offers a post-award deliverables sample for an energy savings performance contract. Download part 2 of the post-award deliverables sample document. (33.67 KB) More Documents & Publications Pre-Award Deliverables Sample (Part 1 of

  18. Why does LANL sample the air?

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Why does LANL sample the air? Why does LANL sample the air? As the most significant pathway, air is monitored to ensure that any possible release is quickly detected. Diagram of ...

  19. Sampling Report for Parent Drum S855793

    Office of Environmental Management (EM)

    L L N L - X X X X - X X X X X Sampling Report for Parent Drum S855793 UNCLASSIFIED Forensic Science Center January 6, 2015 Sampling Report for Parent Drum S855793 Lawrence ...

  20. Template:SampleTemplate | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    is the SampleTemplate template. It is designed for use by Sample Pages. To define a test page, please use this form. Parameters Awesomeness - The numeric level of awesomeness...

  1. Why does LANL sample the air?

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Why does LANL sample the air? Why does LANL sample the air? As the most significant pathway, air is monitored to ensure that any possible release is quickly detected. Diagram of air quality monitors within an exhaust stack. Nuclear facilities have three additional air sampling systems. LANL samples and analyzes air to assess effects on workers, the public, animals, and plants. As the most significant pathway, air is monitored to ensure that any possible release is quickly detected. How we do it

  2. Sample holder for X-ray diffractometry

    DOE Patents [OSTI]

    Hesch, Victor L.


    A sample holder for use with X-ray diffractometers with the capability to rotate the sample, as well as to adjust the position of the sample in the x, y, and z directions. Adjustment in the x direction is accomplished through loosening set screws, moving a platform, and retightening the set screws. Motion translators are used for adjustment in the y and z directions. An electric motor rotates the sample, and receives power from the diffractometer.

  3. Water Sampling (Healy, 1970) | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling (Healy, 1970) Exploration Activity Details Location Unspecified Exploration...

  4. Water Sampling At International Geothermal Area, Philippines...

    Open Energy Information (Open El) [EERE & EIA]

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At International Geothermal Area, Philippines (Wood, 2002) Exploration...

  5. The development of radioactive sample surrogates for training and exercises

    SciTech Connect (OSTI)

    Martha Finck; Bevin Brush; Dick Jansen; David Chamberlain; Don Dry; George Brooks; Margaret Goldberg


    The development of radioactive sample surrogates for training and exercises Source term information is required for to reconstruct a device used in a dispersed radiological dispersal device. Simulating a radioactive environment to train and exercise sampling and sample characterization methods with suitable sample materials is a continued challenge. The Idaho National Laboratory has developed and permitted a Radioactive Response Training Range (RRTR), an 800 acre test range that is approved for open air dispersal of activated KBr, for training first responders in the entry and exit from radioactively contaminated areas, and testing protocols for environmental sampling and field characterization. Members from the Department of Defense, Law Enforcement, and the Department of Energy participated in the first contamination exercise that was conducted at the RRTR in the July 2011. The range was contaminated using a short lived radioactive Br-82 isotope (activated KBr). Soil samples contaminated with KBr (dispersed as a solution) and glass particles containing activated potassium bromide that emulated dispersed radioactive materials (such as ceramic-based sealed source materials) were collected to assess environmental sampling and characterization techniques. This presentation summarizes the performance of a radioactive materials surrogate for use as a training aide for nuclear forensics.

  6. POF-Darts: Geometric adaptive sampling for probability of failure


    Ebeida, Mohamed S.; Mitchell, Scott A.; Swiler, Laura P.; Romero, Vicente J.; Rushdi, Ahmad A.


    We introduce a novel technique, POF-Darts, to estimate the Probability Of Failure based on random disk-packing in the uncertain parameter space. POF-Darts uses hyperplane sampling to explore the unexplored part of the uncertain space. We use the function evaluation at a sample point to determine whether it belongs to failure or non-failure regions, and surround it with a protection sphere region to avoid clustering. We decompose the domain into Voronoi cells around the function evaluations as seeds and choose the radius of the protection sphere depending on the local Lipschitz continuity. As sampling proceeds, regions uncovered with spheres will shrink,more » improving the estimation accuracy. After exhausting the function evaluation budget, we build a surrogate model using the function evaluations associated with the sample points and estimate the probability of failure by exhaustive sampling of that surrogate. In comparison to other similar methods, our algorithm has the advantages of decoupling the sampling step from the surrogate construction one, the ability to reach target POF values with fewer samples, and the capability of estimating the number and locations of disconnected failure regions, not just the POF value. Furthermore, we present various examples to demonstrate the efficiency of our novel approach.« less

  7. WRAP Module 1 sampling strategy and waste characterization alternatives study

    SciTech Connect (OSTI)

    Bergeson, C.L.


    The Waste Receiving and Processing Module 1 Facility is designed to examine, process, certify, and ship drums and boxes of solid wastes that have a surface dose equivalent of less than 200 mrem/h. These wastes will include low-level and transuranic wastes that are retrievably stored in the 200 Area burial grounds and facilities in addition to newly generated wastes. Certification of retrievably stored wastes processing in WRAP 1 is required to meet the waste acceptance criteria for onsite treatment and disposal of low-level waste and mixed low-level waste and the Waste Isolation Pilot Plant Waste Acceptance Criteria for the disposal of TRU waste. In addition, these wastes will need to be certified for packaging in TRUPACT-II shipping containers. Characterization of the retrievably stored waste is needed to support the certification process. Characterization data will be obtained from historical records, process knowledge, nondestructive examination nondestructive assay, visual inspection of the waste, head-gas sampling, and analysis of samples taken from the waste containers. Sample characterization refers to the method or methods that are used to test waste samples for specific analytes. The focus of this study is the sample characterization needed to accurately identify the hazardous and radioactive constituents present in the retrieved wastes that will be processed in WRAP 1. In addition, some sampling and characterization will be required to support NDA calculations and to provide an over-check for the characterization of newly generated wastes. This study results in the baseline definition of WRAP 1 sampling and analysis requirements and identifies alternative methods to meet these requirements in an efficient and economical manner.

  8. Anthrax Sampling and Decontamination: Technology Trade-Offs

    SciTech Connect (OSTI)

    Price, Phillip N.; Hamachi, Kristina; McWilliams, Jennifer; Sohn, Michael D.


    The goal of this project was to answer the following questions concerning response to a future anthrax release (or suspected release) in a building: 1. Based on past experience, what rules of thumb can be determined concerning: (a) the amount of sampling that may be needed to determine the extent of contamination within a given building; (b) what portions of a building should be sampled; (c) the cost per square foot to decontaminate a given type of building using a given method; (d) the time required to prepare for, and perform, decontamination; (e) the effectiveness of a given decontamination method in a given type of building? 2. Based on past experience, what resources will be spent on evaluating the extent of contamination, performing decontamination, and assessing the effectiveness of the decontamination in abuilding of a given type and size? 3. What are the trade-offs between cost, time, and effectiveness for the various sampling plans, sampling methods, and decontamination methods that have been used in the past?

  9. Correlation methods

    SciTech Connect (OSTI)

    Balcomb, J.D.


    Correlation methods have been developed to provide a quick and relatively simple technique for estimating the performance of passive solar systems. The correlations are done with respect to data generated from simulation models. The techniques and accuracies are described. Both the Solar Load Ratio and Un-Utilizability methods are described. The advantages and limitations of correlation methods as design tools are discussed.

  10. Rotary Mode Core Sample System availability improvement

    SciTech Connect (OSTI)

    Jenkins, W.W.; Bennett, K.L.; Potter, J.D.; Cross, B.T.; Burkes, J.M.; Rogers, A.C.


    The Rotary Mode Core Sample System (RMCSS) is used to obtain stratified samples of the waste deposits in single-shell and double-shell waste tanks at the Hanford Site. The samples are used to characterize the waste in support of ongoing and future waste remediation efforts. Four sampling trucks have been developed to obtain these samples. Truck I was the first in operation and is currently being used to obtain samples where the push mode is appropriate (i.e., no rotation of drill). Truck 2 is similar to truck 1, except for added safety features, and is in operation to obtain samples using either a push mode or rotary drill mode. Trucks 3 and 4 are now being fabricated to be essentially identical to truck 2.

  11. Organically bound tritium analysis in environmental samples

    SciTech Connect (OSTI)

    Baglan, N.; Cossonnet, C.; Fournier, M.; Momoshima, N.; Ansoborlo, E.


    Organically bound tritium (OBT) has become of increased interest within the last decade, with a focus on its behaviour and also its analysis, which are important to assess tritium distribution in the environment. In contrast, there are no certified reference materials and no standard analytical method through the international organization related to OBT. In order to resolve this issue, an OBT international working group was created in May 2012. Over 20 labs from around the world participated and submitted their results for the first intercomparison exercise results on potato (Sep 2013). The samples, specially-prepared potatoes, were provided in March 2013 to each participant. Technical information and results from this first exercise are discussed here for all the labs which have realised the five replicates necessary to allow a reliable statistical treatment. The results are encouraging as the increased number of participating labs did not degrade the observed dispersion of the results for a similar activity level. Therefore, the results do not seem to depend on the analytical procedure used. From this work an optimised procedure can start to be developed to deal with OBT analysis and will guide subsequent planned OBT trials by the international group.

  12. Use of passive sampling devices to determine soil contaminant concentrations

    SciTech Connect (OSTI)

    Johnson, K.A. |; Hooper, M.J.; Weisskopf, C.P.


    The effective remediation of contaminated sites requires accurate identification of chemical distributions. A rapid sampling method using passive sampling devices (PSDs) can provide a thorough site assessment. We have been pursuing their application in terrestrial systems and have found that they increase the ease and speed of analysis, decrease solvent usage and overall cost, and minimize the transport of contaminated soils. Time and cost savings allow a higher sampling frequency than is generally the case using traditional methods. PSDs have been used in the field in soils of varying physical properties and have been successful in estimating soil concentrations ranging from 1 {mu}g/kg (parts per billion) to greater than 200 mg/kg (parts per million). They were also helpful in identifying hot spots within the sites. Passive sampling devices show extreme promise as an analytical tool to rapidly characterize contaminant distributions in soil. There are substantial time and cost savings in laboratory personnel and supplies. By selectively excluding common interferences that require sample cleanup, PSDs can be retrieved from the field and processed rapidly (one technician can process approximately 90 PSDs in an 8-h work day). The results of our studies indicate that PSDs can be used to accurately estimate soil contaminant concentrations and provide lower detection limits. Further, time and cost savings will allow a more thorough and detailed characterization of contaminant distributions. 13 refs., 4 figs., 2 tabs.

  13. Connection method

    DOE Patents [OSTI]

    Weyand, John D.


    A method of making a region exhibiting a range of compositions, comprising plasma spraying various compositions on top of one another onto a base.

  14. Connection method

    DOE Patents [OSTI]

    Weyand, J.D.


    A method is disclosed of making a region exhibiting a range of compositions, comprising plasma spraying various compositions on top of one another onto a base. 2 figs.

  15. Effects of Sample Treatments on Genome Recovery via Single-Cell Genomics

    SciTech Connect (OSTI)

    Woyke, Tanja; Clingenpeel, Scott; Schwientek, Patrick; Hugenholtz, Philip


    Single-cell genomics is a powerful tool for accessing genetic information from uncultivated microorganisms. Methods of handling samples before single-cell genomic amplification may affect the quality of the genomes obtained. Using three bacterial strains we show that compared to cryopreservation, lower quality single-cell genomes are recovered when the sample is preserved in ethanol or if the sample undergoes fluorescence in situ hybridization, while sample preservation in paraformaldehyde renders it completely unsuitable for sequencing

  16. Enhanced spot preparation for liquid extractive sampling and analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J.; King, Richard C.


    A method for performing surface sampling of an analyte, includes the step of placing the analyte on a stage with a material in molar excess to the analyte, such that analyte-analyte interactions are prevented and the analyte can be solubilized for further analysis. The material can be a matrix material that is mixed with the analyte. The material can be provided on a sample support. The analyte can then be contacted with a solvent to extract the analyte for further processing, such as by electrospray mass spectrometry.

  17. 200 Area TEDF effluent sampling and analysis plan

    SciTech Connect (OSTI)

    Alaconis, W.C.; Ballantyne, N.A.; Boom, R.J. [and others


    This sampling analysis sets forth the effluent sampling requirements, analytical methods, statistical analyses, and reporting requirements to satisfy the State Waste Discharge Permit No. ST4502 for the Treated Effluent Disposal Facility. These requirements are listed below: Determine the variability in the effluent of all constituents for which enforcement limits, early warning values and monitoring requirements; demonstrate compliance with the permit; and verify that BAT/AKART (Best Available Technology/All know and Reasonable Treatment) source, treatment, and technology controls are being met.

  18. Analysis of core soil and water samples from the Cactus Crater Disposal Site at Enewetak atoll

    SciTech Connect (OSTI)

    Robison, W.L.; Noshkin, V.E.


    Core soil samples and water samples were collected from the Cactus Crater Disposal Site at Enewetak for analysis of /sup 137/Cs, /sup 90/Sr, /sup 239 +240/Pu and /sup 241/Am by both gamma spectroscopy and, through a contractor laboratory, by wet chemistry procedures. The samples processing methods, the analytical methods and the analytical quality control are all procedures developed for the continuing Marshall Island radioecology and dose assessment work.

  19. Nuclear methods in environmental and energy research

    SciTech Connect (OSTI)

    Vogt, J R


    A total of 75 papers were presented on nuclear methods for analysis of environmental and biological samples. Sessions were devoted to software and mathematical methods; nuclear methods in atmospheric and water research; nuclear and atomic methodology; nuclear methods in biology and medicine; and nuclear methods in energy research.

  20. Direct impact aerosol sampling by electrostatic precipitation

    DOE Patents [OSTI]

    Braden, Jason D.; Harter, Andrew G.; Stinson, Brad J.; Sullivan, Nicholas M.


    The present disclosure provides apparatuses for collecting aerosol samples by ionizing an air sample at different degrees. An air flow is generated through a cavity in which at least one corona wire is disposed and electrically charged to form a corona therearound. At least one grounded sample collection plate is provided downstream of the at least one corona wire so that aerosol ions generated within the corona are deposited on the at least one grounded sample collection plate. A plurality of aerosol samples ionized to different degrees can be generated. The at least one corona wire may be perpendicular to the direction of the flow, or may be parallel to the direction of the flow. The apparatus can include a serial connection of a plurality of stages such that each stage is capable of generating at least one aerosol sample, and the air flow passes through the plurality of stages serially.

  1. Reconstruction of Intensity From Covered Samples

    SciTech Connect (OSTI)

    Barabash, Rozaliya; Watkins, Thomas R; Meisner, Roberta Ann; Burchell, Timothy D; Rosseel, Thomas M


    The safe handling of activated samples requires containment and covering the sample to eliminate any potential for contamination. Subsequent characterization of the surface with x-rays ideally necessitates a thin film. While many films appear visually transparent, they are not necessarily x-ray transparent. Each film material has a unique beam attenuation and sometimes have amorphous peaks that can superimpose with those of the sample. To reconstruct the intensity of the underlying activated sample, the x-ray attenuation and signal due to the film needs to be removed from that of the sample. This requires the calculation of unique deconvolution parameters for the film. The development of a reconstruction procedure for a contained/covered sample is described.

  2. Methods Research

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Research Methods Research Methods being developed by MANTISSA Researchers Celeste: Bayesian modeling for astronomical images Randomized Linear Algebra for BioImaging Large-Scale PCA for Climate Efficient Graph Analytics for Genomics Unsupervised Learning for Neuroscience Deep Learning for Object Recognition Deep Learning for Daya Bay Unsupervised Learning in Neuroscience Last edited: 2016-07-18 16:52:3


    SciTech Connect (OSTI)

    Peters, T.; Fink, S.


    As part of the implementation process for the Next Generation Cesium Extraction Solvent (NGCS), SRNL and F/H Lab performed a series of analytical cross-checks to ensure that the components in the NGCS solvent system do not constitute an undue analytical challenge. For measurement of entrained Isopar{reg_sign} L in aqueous solutions, both labs performed similarly with results more reliable at higher concentrations (near 50 mg/L). Low bias occurred in both labs, as seen previously for comparable blind studies for the baseline solvent system. SRNL recommends consideration to use of Teflon{trademark} caps on all sample containers used for this purpose. For pH measurements, the labs showed reasonable agreement but considerable positive bias for dilute boric acid solutions. SRNL recommends consideration of using an alternate analytical method for qualification of boric acid concentrations.

  4. Requirements for Samples | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    Requirements for Samples Requirements for Samples This presentation by James Fenton was given at the High Temperature Membrane Working Group Meeting in October 10, 2007 in Washington, D.C. htmwg_oct07_fenton_samples.pdf (134.79 KB) More Documents & Publications In-Plane Conductivity Testing Procedures and Results In Plane Conductivity Testing, BekkTech LLC Procedure for Performing In-Plane Membrane Conductivity Testing

  5. PCB Analysis Plan for Tank Archive Samples

    SciTech Connect (OSTI)

    NGUYEN, D.M.


    This analysis plan specifies laboratory analysis, quality assurance/quality control (QA/QC), and data reporting requirements for analyzing polychlorinated biphenyls (PCB) concentrations in archive samples. Tank waste archive samples that are planned for PCB analysis are identified in Nguyen 2001. The tanks and samples are summarized in Table 1-1. The analytical data will be used to establish a PCB baseline inventory in Hanford tanks.

  6. LANSCE | Lujan Center | Chemical & Sample Prep

    U.S. Department of Energy (DOE) all webpages (Extended Search)

    Chemical & Sample Preparation For general questions, please contact the Lujan Center Chemical and Sample Preparation Laboratory responsible: Charles Kelsey | | 505.665.5579 Sample and Equipment Shipping Instructions For questions regarding shipping procedures, contact theLujan Center Experiment Coordinator: TBA Chemistry Laboratories High-Pressure Laboratory X-ray Laboratory Spectroscopy Laboratory Clean Room Laboratory Glove box - He atmosphere High-purity water Diamond

  7. Disc valve for sampling erosive process streams

    DOE Patents [OSTI]

    Mrochek, John E.; Dinsmore, Stanley R.; Chandler, Edward W.


    A four-port disc valve for sampling erosive, high temperature process streams. A rotatable disc defining opposed first and second sampling cavities rotates between fired faceplates defining flow passageways positioned to be alternatively in axial alignment with the first and second cavities. Silicon carbide inserts and liners composed of .alpha. silicon carbide are provided in the faceplates and in the sampling cavities to limit erosion while providing lubricity for a smooth and precise operation when used under harsh process conditions.

  8. Remote possibly hazardous content container sampling device

    DOE Patents [OSTI]

    Volz, David L.


    The present invention relates to an apparatus capable of sampling enclosed containers, where the contents of the container is unknown. The invention includes a compressed air device capable of supplying air pressure, device for controlling the amount of air pressure applied, a pneumatic valve, a sampling device having a hollow, sampling insertion needle suspended therein and device to communicate fluid flow between the container and a containment vessel, pump or direct reading instrument.

  9. Hanford Sampling Quality Management Plan (HSQMP)

    SciTech Connect (OSTI)

    Hyatt, J.E.


    HSQMP establishes quality requirements in response to DOE Order 5700. 6C and to 10 Code of Federal Regulations 830.120. HSQMP is designed to meet the needs of Richland Operations Office for controlling the quality of services provided by sampling operations. It is issued through the Analytical Services Program of the Waste Programs Division. This document describes the Environmental Sampling and Analysis Program activities considered to represent the best management activities necessary to achieve a sampling program with adequate control.

  10. Cleaning method and apparatus

    DOE Patents [OSTI]

    Jackson, Darryl D. (Los Alamos, NM); Hollen, Robert M. (Los Alamos, NM)


    A new automatable cleaning apparatus which makes use of a method of very thoroughly and quickly cleaning a gauze electrode used in chemical analyses is given. The method generates very little waste solution, and this is very important in analyzing radioactive materials, especially in aqueous solutions. The cleaning apparatus can be used in a larger, fully automated controlled potential coulometric apparatus. About 99.98% of a 5 mg. plutonium sample was removed in less than 3 minutes, using only about 60 ml. of rinse solution and two main rinse steps.

  11. Innovative, Safer Alternatives Improve Environmental Sampling...

    Office of Environmental Management (EM)

    Innovative, Safer Alternatives Improve Environmental Sampling at Savannah River Site ... Ruth Patrick was working as a consultant at the Savannah River Plant when the Atomic ...

  12. Surface Gas Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    In The Past 20 Years- Geochemistry In Geothermal Exploration Resource Evaluation And Reservoir Management Surface Gas Sampling At Fenton Hill HDR Geothermal Area (Goff &...

  13. Bayesian Approaches to Adaptive Spatial Sampling

    Energy Science and Technology Software Center (OSTI)


    The purpose of this software is to support the design of spatial sampling data collection programs to delineate contamination footprints in response to an environmental contamination release.

  14. Surface Water Sampling | Open Energy Information

    Open Energy Information (Open El) [EERE & EIA]

    Surface Water Sampling Details Activities (3) Areas (2) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Field Techniques Exploration Sub Group: Field...

  15. Hanford analytical sample projections 1996--2001

    SciTech Connect (OSTI)

    Joyce, S.M.


    This document summarizes the biannual Hanford sample projections for fiscal years 1996 to 2001. Sample projections are based on inputs submitted to Analytical Services covering Environmental Restoration, Tank Waste Remediation Systems (TWRS), Solid Waste, Liquid Effluents, Spent Nuclear Fuels, Transition Projects, Analytical Services, Site Monitoring, and Industrial Hygiene. This information will be used by Hanford Analytical Services to assure that laboratories and resources are available and effectively utilized to meet these documented needs. Sample projections are categorized by radiation level, protocol, sample matrix and Program. Analyses requirements are also presented.

  16. Sample Employee Survey for Workplace Charging Planning (indexed) [DOE]

    WORKPLACE CHARGING CHALLENGE Sample Employee Survey for Workplace Charging Planning ... Your responses to this survey will be used to determine employee interest in this benefit. ...

  17. Workplace Charging Challenge: Sample Workplace Charging Policy...

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    Workplace Charging Policy Workplace Charging Challenge: Sample Workplace Charging Policy Review the policy guidelines used by one Workplace Charging Challenge partner to keep their ...

  18. Workplace Charging Challenge: Sample Municipal Workplace Charging...

    Office of Energy Efficiency and Renewable Energy (EERE) (indexed site)

    Municipal Workplace Charging Agreement Workplace Charging Challenge: Sample Municipal Workplace Charging Agreement Review the agreement proposed by one municipality to register PEV ...

  19. Sample Forms | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Sample Forms U.S. Department of Energy / U.S. Nuclear Regulatory Commission Nuclear Materials Management & Safeguards System Sample Forms The below completed example forms contain "dummy" data for information purposes. For current up to date blank forms please go to the DOE/NRC forms link located on the NMMSS information page. Sample 740s DOE/NRC Form 740M Sample 742s and 742Cs 742 Example 1 Example 1A Example 2 Example 3 Example 3A Example 4 DOE/NRC Form 742 742C Example 1 Example

  20. Colloid characterization and quantification in groundwater samples

    SciTech Connect (OSTI)

    K. Stephen Kung


    This report describes the work conducted at Los Alamos National Laboratory for studying the groundwater colloids for the Yucca Mountain Project in conjunction with the Hydrologic Resources Management Program (HRMP) and the Underground Test Area (UGTA) Project. Colloidal particle size distributions and total particle concentration in groundwater samples are quantified and characterized. Colloid materials from cavity waters collected near underground nuclear explosion sites by HRMP field sampling personnel at the Nevada Test Site (NTS) were quantified. Selected colloid samples were further characterized by electron microscope to evaluate the colloid shapes, elemental compositions, and mineral phases. The authors have evaluated the colloid size and concentration in the natural groundwater sample that was collected from the ER-20-5 well and stored in a 50-gallon (about 200-liter) barrel for several months. This groundwater sample was studied because HRMP personnel have identified trace levels of radionuclides in the water sample. Colloid results show that even though the water sample had filtered through a series of Millipore filters, high-colloid concentrations were identified in all unfiltered and filtered samples. They had studied the samples that were diluted with distilled water and found that diluted samples contained more colloids than the undiluted ones. These results imply that colloids are probably not stable during the storage conditions. Furthermore, results demonstrate that undesired colloids have been introduced into the samples during the storage, filtration, and dilution processes. They have evaluated possible sources of colloid contamination associated with sample collection, filtrating, storage, and analyses of natural groundwaters. The effects of container types and sample storage time on colloid size distribution and total concentration were studied to evaluate colloid stability by using J13 groundwater. The data suggests that groundwater samples