skip to main content
OSTI.GOV title logo U.S. Department of Energy
Office of Scientific and Technical Information

Title: Effects of Overhangs on the Performance of ElectrochromicWindows

Authors:
;
Publication Date:
Research Org.:
COLLABORATION - Istanbul TechnicalU./Turkey
Sponsoring Org.:
USDOE. Assistant Secretary for Energy Efficiency andRenewable Energy. Office of Building Technology; California EnergyCommission, Scientific and R esearch Council of Turkey (TUBITAK) throughNATO-B2 Fellowship Program
OSTI Identifier:
927019
Report Number(s):
LBNL-61137
R&D Project: 0; BnR: YN0100000
DOE Contract Number:
DE-AC02-05CH11231
Resource Type:
Journal Article
Resource Relation:
Journal Name: Architectural Science Review; Journal Volume: 0; Journal Issue: 0; Related Information: Journal Publication Date: 12/2006
Country of Publication:
United States
Language:
English
Subject:
32

Citation Formats

Tavil, Aslihan, and Lee, Eleanor S. Effects of Overhangs on the Performance of ElectrochromicWindows. United States: N. p., 2005. Web.
Tavil, Aslihan, & Lee, Eleanor S. Effects of Overhangs on the Performance of ElectrochromicWindows. United States.
Tavil, Aslihan, and Lee, Eleanor S. Thu . "Effects of Overhangs on the Performance of ElectrochromicWindows". United States. doi:. https://www.osti.gov/servlets/purl/927019.
@article{osti_927019,
title = {Effects of Overhangs on the Performance of ElectrochromicWindows},
author = {Tavil, Aslihan and Lee, Eleanor S.},
abstractNote = {},
doi = {},
journal = {Architectural Science Review},
number = 0,
volume = 0,
place = {United States},
year = {Thu Dec 01 00:00:00 EST 2005},
month = {Thu Dec 01 00:00:00 EST 2005}
}
  • DOE-2 building energy simulations were conducted to determine if there were practical architectural and control strategy solutions that would enable electrochromic (EC) windows to significantly improve visual comfort without eroding energy-efficiency benefits. EC windows were combined with overhangs since opaque overhangs provide protection from direct sun which EC windows are unable to do alone. The window wall was divided into an upper and lower aperture so that various combinations of overhang position and control strategies could be considered. The overhang was positioned either at the top of the upper window aperture or between the upper and lower apertures. Overhang depthmore » was varied. EC control strategies were fully bleached at all times, modulated based on incident vertical solar radiation limits, or modulated to meet the design work plane illuminance with daylight. The EC performance was compared to a state-of-the-art spectrally selective low-e window with the same divided window wall, window size, and overhang as the EC configuration. The reference window was also combined with an interior shade which was manually deployed to control glare and direct sun. Both systems had the same daylighting control system to dim the electric lighting. Results were given for south-facing private offices in a typical commercial building. In hot and cold climates such as Houston and Chicago, EC windows with overhangs can significantly reduce the average annual daylight glare index (DGI) and deliver significant annual energy use savings if the window area is large. Total primary annual energy use was increased by 2-5% for moderate-area windows in either climate but decreased by 10% in Chicago and 5% in Houston for large-area windows. Peak electric demand can be reduced by 7-8% for moderate-area windows and by 14-16% for large-area windows in either climate. Energy and peak demand reductions can be significantly greater if the reference case does not have exterior shading or state-of-the-art glass.« less
  • This paper expands upon previously published techniques for calculating window shadow areas by computer to include tilted and horizontal glazing systems as well as vertical glazing systems. This methodology may be used for any rectangular window shaded by rectangular overhangs and/or side fins perpendicular to the plane of the window. Rectangular projections suspended from the end of an overhang are also accommodated. The technique yields a precise solution and requires minimum input. Computer processing is rapid because iterative algorithms are avoided. Shadow overlaps and end effects are completely treated. The glazing system may have any degree of tilt from horizontalmore » (looking upward) through vertical to horizontal (looking downward). Techniques for sorting window shadow shapes and equations for calculating shadow areas are included.« less
  • The method of Utzinger used to calculate overhang design was extended to include features such as local climate, thermostat setting, insulation level, window area and shape, and energy impact. The basic concepts of overhang functions are discussed and illustrated using Atlanta, Georgia and Phoenix, Arizona as site location examples. The goals of overhang design, to minimize energy used for heating and cooling, are discussed as well as the many variables involved and the best solution to the design problem. A three step procedure is described and illustrated as the best solution to the problem. (MJJ)
  • The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.