skip to main content
OSTI.GOV title logo U.S. Department of Energy
Office of Scientific and Technical Information

Title: Synthesis, Oxidation Behavior, Crystallization and Structure of 2'-Methylseleno Guanosine Containing RNAs

Abstract

We have recently introduced a basic concept for the combined chemical and enzymatic preparation of site-specifically modified 2'-methylseleno RNAs which represent useful derivatives for phasing of X-ray crystallographic data during their three-dimensional structure determination. Here, we introduce the first synthesis of an appropriate guanosine phosphoramidite, which complements the thus far established set of 2'-methylseleno-modified uridine, cytidine, and adenosine building blocks for solid-phase synthesis. The novel building block was readily incorporated into RNA. Importantly, it was the 2'-methylseleno-guanosine-labeled RNA that allowed us to reveal the reversible oxidation/reduction behavior of the Se moiety and thus it represents a valuable contribution to the understanding of the action of threo-1,4-dimercapto-2,3-butanediol (DTT) required during solid-phase synthesis, deprotection, and crystallization of selenium-containing RNA. In addition, we investigated 2'-methylseleno RNA with respect to crystallization properties. Our studies revealed that the Se modification significantly increases the range of conditions leading to crystal growth. Moreover, we determined the crystal structures of model RNA helices and showed that the Se modification can affect crystal packing interactions, thus potentially expanding the possibilities for obtaining the best crystal form.

Authors:
; ; ; ;
Publication Date:
Research Org.:
Brookhaven National Laboratory (BNL) National Synchrotron Light Source
Sponsoring Org.:
Doe - Office Of Science
OSTI Identifier:
914283
Report Number(s):
BNL-78851-2007-JA
Journal ID: ISSN 0002-7863; JACSAT; TRN: US200809%%142
DOE Contract Number:
DE-AC02-98CH10886
Resource Type:
Journal Article
Resource Relation:
Journal Name: J. Am. Chem. Soc.; Journal Volume: 128
Country of Publication:
United States
Language:
English
Subject:
36 MATERIALS SCIENCE; ADENOSINE; CRYSTAL GROWTH; CRYSTAL STRUCTURE; CRYSTALLIZATION; CYTIDINE; GUANOSINE; MODIFICATIONS; OXIDATION; RNA; SYNTHESIS; URIDINE; national synchrotron light source

Citation Formats

Moroder,H., Kreutz, C., Lang, K., Serganov, A., and Micura, R. Synthesis, Oxidation Behavior, Crystallization and Structure of 2'-Methylseleno Guanosine Containing RNAs. United States: N. p., 2006. Web. doi:10.1021/ja0621400.
Moroder,H., Kreutz, C., Lang, K., Serganov, A., & Micura, R. Synthesis, Oxidation Behavior, Crystallization and Structure of 2'-Methylseleno Guanosine Containing RNAs. United States. doi:10.1021/ja0621400.
Moroder,H., Kreutz, C., Lang, K., Serganov, A., and Micura, R. Sun . "Synthesis, Oxidation Behavior, Crystallization and Structure of 2'-Methylseleno Guanosine Containing RNAs". United States. doi:10.1021/ja0621400.
@article{osti_914283,
title = {Synthesis, Oxidation Behavior, Crystallization and Structure of 2'-Methylseleno Guanosine Containing RNAs},
author = {Moroder,H. and Kreutz, C. and Lang, K. and Serganov, A. and Micura, R.},
abstractNote = {We have recently introduced a basic concept for the combined chemical and enzymatic preparation of site-specifically modified 2'-methylseleno RNAs which represent useful derivatives for phasing of X-ray crystallographic data during their three-dimensional structure determination. Here, we introduce the first synthesis of an appropriate guanosine phosphoramidite, which complements the thus far established set of 2'-methylseleno-modified uridine, cytidine, and adenosine building blocks for solid-phase synthesis. The novel building block was readily incorporated into RNA. Importantly, it was the 2'-methylseleno-guanosine-labeled RNA that allowed us to reveal the reversible oxidation/reduction behavior of the Se moiety and thus it represents a valuable contribution to the understanding of the action of threo-1,4-dimercapto-2,3-butanediol (DTT) required during solid-phase synthesis, deprotection, and crystallization of selenium-containing RNA. In addition, we investigated 2'-methylseleno RNA with respect to crystallization properties. Our studies revealed that the Se modification significantly increases the range of conditions leading to crystal growth. Moreover, we determined the crystal structures of model RNA helices and showed that the Se modification can affect crystal packing interactions, thus potentially expanding the possibilities for obtaining the best crystal form.},
doi = {10.1021/ja0621400},
journal = {J. Am. Chem. Soc.},
number = ,
volume = 128,
place = {United States},
year = {Sun Jan 01 00:00:00 EST 2006},
month = {Sun Jan 01 00:00:00 EST 2006}
}
  • Selenium modification of nucleic acids is of great importance in X-ray crystal structure determination and functional study of nucleic acids. Herein, we describe a convenient synthesis of a new building block, the 2{prime}-SeMe-modified guanosine (G{sub Se}) phosphoramidite, and report the first incorporation of the 2{prime}-Se-G moiety into DNA. The X-ray crystal structure of the 2{prime}-Se-modified octamer DNA (5{prime}-GTG{sub Se}TACAC-3{prime}) was determined at a resolution of 1.20 {angstrom}. We also found that the 2{prime}-Se modification points to the minor groove and that the modified and native structures are virtually identical. Furthermore, we observed that the 2{prime}-Se-G modification can significantly facilitate themore » crystal growth with respect to the corresponding native DNA.« less
  • The derivatization of nucleic acids with selenium is a new and highly promising approach to facilitate their three-dimensional structure determination by X-ray crystallography. Here, we report a comprehensive study on the chemical and enzymatic syntheses of RNAs containing 2'-methylseleno (2'-Se-methyl) nucleoside labels. Our approach includes the first synthesis of an appropriate purine nucleoside phosphoramidite building block. Most importantly, a substantially changed RNA solid-phase synthesis cycle, comprising treatment with threo-1, 4-dimercapto-2, 3-butanediol (DTT) after the oxidation step, is required for a reliable strand elongation. This novel operation allows for the chemical syntheses of multiple Se-labeled RNAs in sizes that can typicallymore » be achieved only for nonmodified RNAs. In combination with enzymatic ligation, biologically important RNA targets become accessible for crystallography. Exemplarily, this has been demonstrated for the Diels-Alder ribozyme and the add adenine riboswitch sequences. We point out that the approach documented here has been the chemical basis for the very recent structure determination of the Diels-Alder ribozyme which represents the first novel RNA fold that has been solved via its Se-derivatives.« less
  • 2-Methyl-4-nitroaniline ethylene dimethylammonium hydrobromide forms a crystalline complex with the self-complementary dinucleoside monophosphate, 5-iodocytidylyl(3'-5')guanosine. The crystals are tetragonal, with a = b = 32.192 A and c = 23.964 A, space group P4/sub 3/2/sub 1/2. The structure has been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. 5-Iodocytidylyl(3'-5')guanosine molecules are held together in pairs through Watson-Crick base-pairing, forming an antiparallel duplex structure. Nitroaniline molecules stack above and below guanine-cytosine pairs in this duplex structure. In addition, a third nitroaniline molecule stacks on one of the other two nitroaniline molecules. The asymmetric unitmore » contains two 5-iodocytidylyl(3'-5')guanosine molecules, three nitroaniline molecules, one bromide ion and thirty-one water molecules, at total of 160 atoms. Details of the structure are described. 15 references, 4 figures, 2 tables.« less
  • Cobalt(III) complexes of two ligands containing two tertiary stibine groups, (Co)o-C6H4(SbMe2)2)2X2)O (X = Cl, Br, I) and (Co)Me2Sb(CH2)3SbMe2)2X2)X (X = Br, I), have been prepared and shown to have trans pseudooctahedral cations. The synthesis of trans-(Co)o-C6H4(SbMe2)(PMe2))2(PMe2))2X2)Y (X = Cl, Br, I; Y = X, BF4), trans-(Co)o-C6H4(PPh2)(SMe)2)2O2)BF4, trans-(Co)o-C6H4(PPh2)(SeMe))2X2)BF4 (X = Cl, Br), and fac-(Co)o-C6H4(PPh2)(Sme))3)(BF4)3 are described. The complexes have been characterized by UV-visible spectroscopy and multinuclear ( H, T P) H)) NMR as appropriate. VZCo NMR spectra are reported for these complexes, and the characteristic ranges of the VZCo chemical shifts for Co(III) complexes containing neutral heavy groups VB and VIBmore » (groups 15 and 16) donor ligands are established. The X-ray structure of (Co)o-CWH4(SbMe2)2)2Cl2)2(CoCl4) has been determined. Crystals belong to the tetragonal system, space group I41/a (No. 88), with a = 25.264 (6) A, c = 9.720 (9) A, and Z = 4. The structure was refined to an R of 0.058 from 1237 observed reflections (F > 3sigma(F)). The cobalt of the cation is located on a center of symmetry (Co-Sb = 2.505 (1), 2.478 (1) A; Co-Cl = 2.263 (4) A), and the anion has 4 symmetry (Co-Cl = 2.287 (6) A). 32 references, 3 figures, 3 tables.« less
  • To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{supmore » 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.« less