skip to main content
OSTI.GOV title logo U.S. Department of Energy
Office of Scientific and Technical Information

Title: Differences in Electrostatic Potential Around DNA Fragments Containing Guanine and 8-oxo-Guanine

Abstract

hanges of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotoides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained guanine in the middle layer, while the “damaged” fragment had the guanine replaced with 8-oxo-guanine. The electrostatic potential around these DNA fragments was projected on a surface around the double helix. The 2D maps of EP of intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-guanine. It was found that distortions of the phosphate groups and displacements of the accompanying countercations are clearly reflected in the EP maps.

Authors:
;
Publication Date:
Research Org.:
Pacific Northwest National Laboratory (PNNL), Richland, WA (US), Environmental Molecular Sciences Laboratory (EMSL)
Sponsoring Org.:
USDOE
OSTI Identifier:
901748
Report Number(s):
PNNL-SA-45790
3687; KP1102020; TRN: US200715%%128
DOE Contract Number:
AC05-76RL01830
Resource Type:
Journal Article
Resource Relation:
Journal Name: Theoretical Chemistry Accounts, 117(2):291-296; Journal Volume: 117; Journal Issue: 2
Country of Publication:
United States
Language:
English
Subject:
59 BASIC BIOLOGICAL SCIENCES; DNA; ELECTROSTATICS; FUNCTIONALS; GUANINE; MODIFICATIONS; NUCLEOTIDES; PHOSPHATES; Environmental Molecular Sciences Laboratory

Citation Formats

Haranczyk, Maciej, and Gutowski, Maciej S. Differences in Electrostatic Potential Around DNA Fragments Containing Guanine and 8-oxo-Guanine. United States: N. p., 2007. Web. doi:10.1007/s00214-006-0133-1.
Haranczyk, Maciej, & Gutowski, Maciej S. Differences in Electrostatic Potential Around DNA Fragments Containing Guanine and 8-oxo-Guanine. United States. doi:10.1007/s00214-006-0133-1.
Haranczyk, Maciej, and Gutowski, Maciej S. Thu . "Differences in Electrostatic Potential Around DNA Fragments Containing Guanine and 8-oxo-Guanine". United States. doi:10.1007/s00214-006-0133-1.
@article{osti_901748,
title = {Differences in Electrostatic Potential Around DNA Fragments Containing Guanine and 8-oxo-Guanine},
author = {Haranczyk, Maciej and Gutowski, Maciej S.},
abstractNote = {hanges of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotoides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained guanine in the middle layer, while the “damaged” fragment had the guanine replaced with 8-oxo-guanine. The electrostatic potential around these DNA fragments was projected on a surface around the double helix. The 2D maps of EP of intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-guanine. It was found that distortions of the phosphate groups and displacements of the accompanying countercations are clearly reflected in the EP maps.},
doi = {10.1007/s00214-006-0133-1},
journal = {Theoretical Chemistry Accounts, 117(2):291-296},
number = 2,
volume = 117,
place = {United States},
year = {Thu Feb 01 00:00:00 EST 2007},
month = {Thu Feb 01 00:00:00 EST 2007}
}
  • Changes of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained adenine in the middle layer, while the “damaged” fragment had the adenine replaced with 8-oxo-adenine. The electrostatic potential around these DNA fragments wasmore » projected on a cylindrical surface around the double helix. The two-dimensional maps of EP of the intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-adenine (8oA). It was found that distortions of a phosphate group neighboring 8oA and displacements of the accompanying countercation are clearly reflected in the EP maps. Helpful discussions Michel Dupuis are gratefully acknowledged. Authors wish to thank Marcel Swart for directing us to a compilation of van der Waals radii. This work was supported by the: (i) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G. and M.H.), (ii) the Office of Science (BER), U. S. Department of Energy, Grant No. DE-FG03-02ER63470 (JHM), (iii) Polish State Committee for Scientific Research (KBN) Grant DS/8221-4-0140-6 (MG), (iv) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic Computer Center in Gdansk (TASK) and at the Molecular Science Computing Facility (MSCF) in the William R. Wiley Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the U.S. Department of Energy's Office of Biological and Environmental Research and located at the Pacific Northwest National Laboratory, which is operated by Battelle for the US Department of Energy. The MSCF resources were available through a pilot project.« less
  • To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{supmore » 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.« less
  • 8-Oxo-7, 8-dihydroguanosine (8oG) is a highly mutagenic DNA lesion that stably pairs with adenosine, forming 8oG(syn){center_dot}dA(anti) Hoogsteen base pairs. DNA polymerases show different propensities to insert dCMP or dAMP opposite 8oG, but the molecular mechanisms that determine faithful or mutagenic bypass are poorly understood. Here, we report kinetic and structural data providing evidence that, in T7 DNA polymerase, residue Lys536 is responsible for attenuating the miscoding potential of 8oG. The Lys536Ala polymerase shows a significant increase in mutagenic 8oG bypass versus wild-type polymerase, and a crystal structure of the Lys536Ala mutant reveals a closed complex with an 8oG(syn){center_dot}dATP mismatch inmore » the polymerase active site, in contrast to the unproductive, open complex previously obtained by using wild-type polymerase. We propose that Lys536 acts as a steric and/or electrostatic filter that attenuates the miscoding potential of 8oG by normally interfering with the binding of 8oG in a syn conformation that pairs with dATP.« less
  • A signature of ionizing radiation is the induction of DNA clustered damaged sites. Non-double strand break (DSB) clustered damage has been shown to compromise the base excision repair pathway, extending the lifetimes of the lesions within the cluster, compared to isolated lesions. This increases the likelihood the lesions persist to replication and thus increasing the mutagenic potential of the lesions within the cluster. Lesions formed by ionizing radiation include 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) and 2-deoxyribonolactone (dL). dL poses an additional challenge to the cell as it is not repaired by the short-patch base excision repair pathway. Here we show recalcitrant dL repairmore » is reflected in mutations observed when DNA containing it and a proximal 8-oxodGuo is replicated in Escherichia coli. 8-oxodGuo in close proximity to dL on the opposing DNA strand results in an enhanced frequency of mutation of the lesions within the cluster and a 20 base sequence flanking the clustered damage site in an E. coli based plasmid assay. In vitro repair of a dL lesion is reduced when compared to the repair of an abasic (AP) site and a tetrahydrofuran (THF), and this is due mainly to a reduction in the activity of polymerase β, leading to retarded FEN1 and ligase 1 activities. This study has given insights in to the biological effects of clusters containing dL.« less
    Cited by 15
  • Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12){center dot}d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG{center dot}dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH{submore » 2}-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG{center dot}dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H{sub 2}O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8){center dot}d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn){center dot}dA(anti) pair between stable Watson-Crick dA6{center dot}dT19 and dT8{center dot}A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn){center dot}dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base.« less