skip to main content
OSTI.GOV title logo U.S. Department of Energy
Office of Scientific and Technical Information

Title: Identification of a nuclear matrix attachment region like sequence in the last intron of PI3K{gamma}

Abstract

MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3K{gamma} gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3K{gamma}. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intronmore » of human PI3K{gamma}.« less

Authors:
 [1];  [1];  [1];  [1];  [1];  [1];  [2]
  1. Department of Biochemistry and Molecular Biology, Shanghai Second Medical University, Shanghai 2000 25 (China)
  2. Department of Biochemistry and Molecular Biology, Shanghai Second Medical University, Shanghai 2000 25 (China). E-mail: sundai0@163.com
Publication Date:
OSTI Identifier:
20798836
Resource Type:
Journal Article
Resource Relation:
Journal Name: Biochemical and Biophysical Research Communications; Journal Volume: 341; Journal Issue: 2; Other Information: DOI: 10.1016/j.bbrc.2005.12.212; PII: S0006-291X(06)00039-8; Copyright (c) 2006 Elsevier Science B.V., Amsterdam, The Netherlands, All rights reserved; Country of input: International Atomic Energy Agency (IAEA)
Country of Publication:
United States
Language:
English
Subject:
60 APPLIED LIFE SCIENCES; CHROMATIN; COMPUTER CODES; GENE REGULATION; GENES; HELA CELLS; IN VITRO; IN VIVO; LUCIFERASE; NUCLEAR MATRIX; TRANSIENTS

Citation Formats

Dai Bingbing, Ying Lei, Cai Rong, Li Ying, Zhang Xingqian, Lu Jian, and Qian Guanxiang. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3K{gamma}. United States: N. p., 2006. Web.
Dai Bingbing, Ying Lei, Cai Rong, Li Ying, Zhang Xingqian, Lu Jian, & Qian Guanxiang. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3K{gamma}. United States.
Dai Bingbing, Ying Lei, Cai Rong, Li Ying, Zhang Xingqian, Lu Jian, and Qian Guanxiang. Fri . "Identification of a nuclear matrix attachment region like sequence in the last intron of PI3K{gamma}". United States. doi:.
@article{osti_20798836,
title = {Identification of a nuclear matrix attachment region like sequence in the last intron of PI3K{gamma}},
author = {Dai Bingbing and Ying Lei and Cai Rong and Li Ying and Zhang Xingqian and Lu Jian and Qian Guanxiang},
abstractNote = {MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3K{gamma} gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3K{gamma}. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3K{gamma}.},
doi = {},
journal = {Biochemical and Biophysical Research Communications},
number = 2,
volume = 341,
place = {United States},
year = {Fri Mar 10 00:00:00 EST 2006},
month = {Fri Mar 10 00:00:00 EST 2006}
}
  • We determined the complete genomic sequence of the human CD79b (Ig{beta}/B29) gene. The CD79b gene product is associated with the membrane immunoglobulin signaling complex which is composed of immunoglobulin (Ig) itself, associated in a noncovalent fashion with CD79b and a second polypeptide chain, CD79a (Ig{alpha}/mb1). The sequence and exon/intron organization of the human and mouse CD79b genes are highly similar. The gene organization suggests that some variant forms of CD79b may arise by virtue of alternative splicing of mRNA. In addition, a number of conserved regulatory sequences commonly found in Ig genes are present in sequences which flank the humanmore » CD79b gene. Some of these sequences are distinct from those found in the CD79a promoter. These differences may explain why transcription of CD79b, but not CD79a, is observed in plasma cells. A new Taq 1 restriction fragment length polymorphism is described that is not associated with any structural polymorphisms of the expressed CD79b polypeptide. 13 refs., 3 figs., 1 tab.« less
  • Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but themore » binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development.« less
  • Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identifiedmore » in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.« less
  • Glucose phosphate isomerase (GPI, glucose 6-phosphate ketol-isomerase, EC 5.3.1.9) is a housekeeping gene expressed in all tissues and organisms that utilize glycolysis and gluconeogenesis. Deficiency in humans leads to a rare form of nonspherocytic hemolytic anemia. The authors have isolated a 3.2-kb mouse cDNA containing glucose phosphate isomerase coding sequence and a 2.1-kb intronic sequence and a large proportion of the human gene (approaching 55 kb) in four phage [lambda] recombinants. A 4-kb intronic fragment from the human gene showing homology to the mouse intronic sequence has been isolated and sequenced. The fragment contains approximately 1.5 kb of sequence thatmore » is composited of 30 repeat units of a novel 50-kb tandemly repeated unit. The mouse intronic sequence contains 18 similar units. The human consensus sequence differs from the mouse consensus sequence at only 7 positions out of 50 (positions 16, 26, 27, 42, 43, 47, and 48). A probe containing the repeat element detects polymorphisms, specific to glucose phosphate isomerase, in human DNA. The repeat element does not appear to be present at any other loci in human DNA. The conservation of this intronic repeat element extends to pig and Chinese hamster. 26 refs., 4 figs.« less