National Library of Energy BETA

Sample records for yyyy mm dd

  1. As of , , (yyyy,mm dd) Academic Title

    E-Print Network [OSTI]

    Yamamoto, Hirosuke

    ## As of , , (yyyy,mm dd) 1 2 3 / / yrs old 4 5 6 ) ) ) ) 7 8 dd dd 10 yyyy mm yyyy Academic Title yyyy mm mm mm Major Field Attach a sharp print taken within six months, City/Town, Country) Mobile Résumé Name Date of Birth (yyyy/mm/dd) Family Name E-mail Address Home

  2. Summary of Decisions - MM DD YYYY - MM DD YYYY | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergyPlan | Department of Energy 1DepartmentS EM Pr7 -ofEnergy 9,7,3,MM DD

  3. BBIIOOLLOOGGYY SSEEMMIINNAARR TTOO MM MM YY EEDD MM OO NN DD SS OO NN EENN DD OO WW EE DD LLEE CC TT UU RR EE

    E-Print Network [OSTI]

    Brown, Sally

    BBIIOOLLOOGGYY SSEEMMIINNAARR TTOO MM MM YY EEDD MM OO NN DD SS OO NN EENN DD OO WW EE DD LLEE CC TT UU RR EE 44::0000 PPMM SSEE MM II NNAA RR HHII TTCC HH CC OOCC KK HH AA LL LL 113322 RREE FF RR EE

  4. Hickey -TT175, casts 220, line 222-229,231-232 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date/Time (MMDDYYHHMM) Total Scans

    E-Print Network [OSTI]

    Hickey, Barbara

    Hickey -TT175, casts 220, line 222- 229,231-232 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date,220 #12;Hickey -TT175, casts 220, line 222- 229,231-232 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date #12;Hickey -TT175, casts 220, line 222- 229,231-232 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date

  5. Hickey -TT174, casts 21, line 18 to cast 31, line 24 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date/Time (MMDDYYHHMM) Total Scans

    E-Print Network [OSTI]

    Hickey, Barbara

    Hickey -TT174, casts 21, line 18 to cast 31, line 24 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date;Hickey -TT174, casts 21, line 18 to cast 31, line 24 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date;Hickey -TT174, casts 21, line 18 to cast 31, line 24 Cruise cast lat(dd.mm.mm) lon(dd.mm.mm) Date

  6. Hickey -TT174, casts 1 to cast 11 Cruise cast lat (dd.mm.m) lon(dd.mm.m) Date/Time (MMDDYYHHMM) Total Scan

    E-Print Network [OSTI]

    Hickey, Barbara

    Hickey -TT174, casts 1 to cast 11 Cruise cast lat (dd.mm.m) lon(dd.mm.m) Date/Time (MMDDYYHHMM;Hickey -TT174, casts 1 to cast 11 Cruise cast lat (dd.mm.m) lon(dd.mm.m) Date/Time (MMDDYYHHMM) Total -TT174, casts 1 to cast 11 Cruise cast lat (dd.mm.m) lon(dd.mm.m) Date/Time (MMDDYYHHMM) Total Scan

  7. MISOSYS Disassembler -Disk version III DDDDD SSSSS MM MM BBBBB LL RRRRR

    E-Print Network [OSTI]

    Mann, Tim

    MISOSYS Disassembler - Disk version III DSMBLR - 1 DDDDD SSSSS MM MM BBBBB LL RRRRR DD DD SS SS MMM MMM BB BB LL RR RR DD DD SS MMMMMMM BB BB LL RR RR DD DD SSSSS MM M MM BBBBBB LL RRRRR DD DD SS MM MM BB BB LL RR RR DD DD SS SS MM MM BB BB LLLLLLL RR RR DDDDD SSSSS MM MM BBBBB LLLLLLL RR RR Copyright

  8. International Journal of Artificial Intelligence in Education Volume# (YYYY) Number 1560-4292/08/$17.00 YYYY IOS Press and the authors. All rights reserved.

    E-Print Network [OSTI]

    Mostow, Jack

    -4292/08/$17.00 © YYYY ­ IOS Press and the authors. All rights reserved. Toward Exploiting EEG Input in a Reading Tutor

  9. International Journal of Artificial Intelligence in Education Volume# (2011) Number 1560-4292/08/$17.00 YYYY IOS Press and the authors. All rights reserved.

    E-Print Network [OSTI]

    Young, R. Michael

    2011-01-01

    -4292/08/$17.00 © YYYY ­ IOS Press and the authors. All rights reserved. Integrating Learning, Problem Solving

  10. JSS Journal of Statistical Software MMMMMM YYYY, Volume VV, Issue II. http://www.jstatsoft.org/

    E-Print Network [OSTI]

    Biernacki, Christophe

    .3). The model selection criteria BIC, ICL, NEC and cross- validation are proposed according to the modeling in C++. Its core library (mix- modLib) can be interfaced with any other softwares or libraries, or canJSS Journal of Statistical Software MMMMMM YYYY, Volume VV, Issue II. http

  11. D&D and Risk Assessment Tools

    Broader source: Energy.gov [DOE]

    ORISE and PNNL both developed tools to assist in the risk assessment and planning of D&D activities. PNNL developed a Risk D&D tool, a rapid prototype computerbased model, to evaluate...

  12. BBIIOOLLOOGGYY SSEEMMIINNAARR PPRR OO MM OO TT II OO NN LLEE CC TT UU RR EE

    E-Print Network [OSTI]

    Brown, Sally

    BBIIOOLLOOGGYY SSEEMMIINNAARR PPRR OO MM OO TT II OO NN LLEE CC TT UU RR EE 44::0000 PPMM SSEE MM II NNAA RR PPHH YY SSII CCSS //AASS TTRR OONN OO MM YY AAUU DD .. AA110022 RREE FF RR EE SSHHMM EE NN

  13. Application Form Reference Number

    E-Print Network [OSTI]

    Po, Lai-Man

    /yyyy) (/) Title and Description of License/ Certificate/Activity // Date of Award (mm/yyyy) (/) Name Degree/Level Achieved Major Full-time or Part-time Date of Award (mm/yyyy) (/) Period From (mm-time Date of Award (mm/yyyy) (/) Period From (mm/yyyy) (/) To (mm/yyyy) (/) School

  14. 100% DD Energy Model Update

    SciTech Connect (OSTI)

    None

    2011-06-30

    The Miami Science Museum energy model has been used during DD to test the buildingâ??s potential for energy savings as measured by ASHRAE 90.1-2007 Appendix G. This standard compares the designed buildingâ??s yearly energy cost with that of a code-compliant building. The building is currently on track show 20% or better improvement over the ASHRAE 90.1-2007 Appendix G baseline; this performance would ensure minimum compliance with both LEED 2.2 and current Florida Energy Code, which both reference a less strict version of ASHRAE 90.1. In addition to being an exercise in energy code compliance, the energy model has been used as a design tool to show the relative performance benefit of individual energy conservation measures (ECMs). These ECMs are areas where the design team has improved upon code-minimum design paths to improve the energy performance of the building. By adding ECMs one a time to a code-compliant baseline building, the current analysis identifies which ECMs are most effective in helping the building meet its energy performance goals.

  15. High Intensity, Pulsed, D-D Neutron Generator

    E-Print Network [OSTI]

    Williams, D. L.

    2010-01-01

    Pulsed, D-D Neutron Generator Authors: D. L. Williams, J. H.of Advanced Neutron/Gamma Generators for Imaging and ActiveN. K. -N. Leung, “D-D neutron generator development at LBNL”

  16. Student Name: ______________________________ Birthdate (MM/DD/YY): ____________ PART I SCREENING: Please answer the following questions

    E-Print Network [OSTI]

    Faso Burundi Cambodia Cameroon Cape Verde Central African Republic Chad China Colombia Comoros Congo

  17. High Intensity, Pulsed, D-D Neutron Generator

    E-Print Network [OSTI]

    Williams, D. L.

    2010-01-01

    ½ ” OD pipe 3¼ ” OD pipe Polyethylene shielding Hole 10½ ” ?Hole 8 ¼ ” ? Polyethylene shielding Fig. 3.a. The DD-109

  18. Summary of the D&D Engineering Operations

    E-Print Network [OSTI]

    Physics Supervisor D&D Construction WBS Mgr. D&D HP/ Rad Waste WBS Manager #12;Work Planning Process of future fusion projects.! ! Scope! · 2398 cubic meters of low level radioactive waste.! · 1995 metric tons&D Work Control Center Organizational Chart Industrial Hygiene Construction Safety D&D Engineering WBS

  19. mm,50 mm) and (90 mm,50 mm). There is an eight-unit cell separation between the two ports.

    E-Print Network [OSTI]

    Wai, Ping-kong Alexander

    mm,50 mm) and (90 mm,50 mm). There is an eight-unit cell separation between the two ports reported in Ref. 6. The calculated results are shown in Figure 4. The overall board height h 2.84 mm (112 mil), a 0.51 mm (20 mil), d 8.00 mm (315 mil), g 0.76 mm (30 mil), s 7.24 mm (285 mil), t1 2.36 mm (93

  20. INEL D&D long-range plan

    SciTech Connect (OSTI)

    Buckland, R.J.; Kenoyer, D.J.; LaBuy, S.A.

    1995-09-01

    This Long-Range Plan presents the Decontamination and Dismantlement (D&D) Program planning status for facilities at the Idaho National Engineering Laboratory (INEL). The plan provides a general description of the D&D Program objectives, management criteria, and policy; discusses current activities; and documents the INEL D&D Program cost and schedule estimate projections for the next 15 years. Appendices are included that provide INEL D&D project historical information, a comprehensive descriptive summary of each current D&D surplus facility, and a summary database of all INEL contaminated facilities awaiting or undergoing the facility transition process.

  1. IEEE TRANSACTIONS ON COMPUTER-AIDED DESIGN OF INTEGRATED CIRCUITS AND SYSTEMS, VOL. XX, NO. NN, MMM YYYY 1 TCEC: Temperature-and Energy-Constrained

    E-Print Network [OSTI]

    Mishra, Prabhat

    method based on model checking for temperature- and energy-constrained (TCEC) scheduling in multitasking YYYY 1 TCEC: Temperature- and Energy-Constrained Scheduling in Real-Time Multitasking Systems Xiaoke in microprocessors. This urgently requires both power and thermal management during system design. In this paper, we

  2. BBIIOOLLOOGGYY SSEEMMIINNAARR AADD JJ UU NN CC TT AAPP PP OO II NN TT MM EE NN TT LLEE CC TT UU RR EE

    E-Print Network [OSTI]

    Brown, Sally

    BBIIOOLLOOGGYY SSEEMMIINNAARR AADD JJ UU NN CC TT AAPP PP OO II NN TT MM EE NN TT LLEE CC TT UU RR EE 44::0000 PPMM SSEE MM II NNAA RR PPHH YY SSII CCSS //AASS TTRR OONN OO MM YY AAUU DD .. AA110022

  3. BBIIOOLLOOGGYY SSEEMMIINNAARR AAFF FF II LL II AA TT EE AAPP PP OO II NN TT MM EE NN TT LLEE CC TT UU RR EE

    E-Print Network [OSTI]

    Brown, Sally

    BBIIOOLLOOGGYY SSEEMMIINNAARR AAFF FF II LL II AA TT EE AAPP PP OO II NN TT MM EE NN TT LLEE CC TT UU RR EE 44::0000 PPMM SSEE MM II NNAA RR PPHH YY SSII CCSS //AASS TTRR OONN OO MM YY AAUU DD .. AA

  4. D-D Nuclear Fusion Using Different Size Pyroelectric Crystals

    E-Print Network [OSTI]

    Danon, Yaron

    D-D Nuclear Fusion Using Different Size Pyroelectric Crystals A. M. Kovanen, D. J. Gillich, T. Z the conditions for D-D fusion in pyroelectric crystal accelerators. Three different pyroelectric crystal sizes are with the Department of Mechanical, Aerospace and Nuclear Engineering, Rensselaer Polytechnic Institute, Troy, NY. A. M

  5. D&D Technologies for Pollution Prevention

    SciTech Connect (OSTI)

    Tripp, Julia Lynn

    2002-02-01

    A new Accelerated Site Technology Deployment (ASTD) project was awarded in FY 2002 to the Idaho National Engineering and Environmental Laboratory (INEEL) to deploy technologies that decrease pollution and waste in the areas of facility characterization, sludge treatment, dust and contamination control, and concrete demolition. This project was called "D&D Technologies for Pollution Prevention" and planned to deploy four different technologies. To reduce protective equipment requirements, waste generation, and risk of radiation exposure during facility characterization, the Russian Gamma Locater Device (GLD) and Isotopic Identification Device (IID) for remote characterization was investigated. The GLD detects gamma ray readings and video images remotely and uses radio communication to transmit the readings to personnel located a safe distance from the contaminated area. The IID, an integral part of the GLD, provides real-time spectrometric analysis of radiation sources for remotely identifying the specific radioactive isotopes present in the facility. At the INEEL, sludge has accumulated in the bottom of a fuel storage pool and the presence of heavy metals in the sludge makes it a mixed waste. This project planned to use LEADX® to treat sludge in place to effectively make all heavy metals in the sludge insoluble. LEADX® is a dry granular chemical additive (apatite) used for in-situ treatment of heavy-metal-contaminated material. LEADX® chemically bonds to any free heavy metals that it contacts and forms a stable, non-leachable molecule. After treating the sludge with LEADX®, it was to be left in the basin and the pool filled with grout. The successful treatment of the sludge with LEADX® will reduce the amount of waste to be disposed at the burial ground by eliminating the need to remove the sludge from the basin. Many off-gas and duct systems being dismantled contain dust and lint that has been contaminated. Encapsulation Technologies, LLC has developed a patented process for eliminating airborne radioactivity and fixing contamination in place remotely without the need for people or equipment to enter the area being treated. The process uses a device called the Passive Aerosol Generator (PAG) to create an aerosol of a capture coating. The aerosol condenses on surfaces, capturing the contaminants in place. Use of this fogging technology will reduce or eliminate the requirement for glovebags and extensive contamination control during cutting and removal of ductwork. Demolition of building slabs and foundations is necessary at most DOE facilities undergoing D&D. The baseline method for their demolition at the INEEL is to use a hydraulic hammer on the end of a backhoe or trackhoe. However, the vibration of the hammer typically causes

  6. Tufts University OMFS Internship Application Background Information

    E-Print Network [OSTI]

    Dennett, Daniel

    Date of Graduation MM DD YYYY Class Rank 1st Year 2nd Year 3rd Year 4th Year No Rank, 1st Year Honors Pass Fail No Rank, 2nd Year Honors Pass Fail No Rank, 3rd Year Honors Pass Fail No Rank, 4th Year

  7. Tufts University OMFS Externship Application Background Information

    E-Print Network [OSTI]

    Dennett, Daniel

    Expected Date of Graduation MM DD YYYY Class Rank 1st Year 2nd Year 3rd Year No Rank, 1st Year Honors Pass Fail No Rank, 2nd Year Honors Pass Fail No Rank, 3rd Year Honors Pass Fail National Board of Dental

  8. GIFT OF TRAVEL OFFER FORWARDING MEMORANDUM Page 1 of 2

    E-Print Network [OSTI]

    GIFT OF TRAVEL OFFER FORWARDING MEMORANDUM From: Page 1 of 2 To: President, Naval Postgraduate School Subj: OFFER OF GIFT OF TRAVEL TO THE NAVAL POSTGRADUATE SCHOOL Ref: (a) NPS Gifts of Travel SOP Date(mm/dd/yyyy): (b) SECNAVINST 4001.2J Encl: (1) Offer of Gift of Travel from 1. Enclosure (1

  9. John A. Burns School of Medicine (JABSOM) Doctor of Medicine Early Acceptance Program (DMEAP) for Entering Hawaii Resident Freshman

    E-Print Network [OSTI]

    John A. Burns School of Medicine (JABSOM) Doctor of Medicine Early Acceptance Program (DMEAP: _____________________________________ Date of Birth (mm/dd/yyyy): _________________ Describe why you want to pursue a career in medicine (Please type) Print Form #12;John A. Burns School of Medicine (JABSOM) Doctor of Medicine Early Acceptance

  10. D&D TECHNOLOGIES FOR POLLUTION PREVENTION

    SciTech Connect (OSTI)

    Tripp, Julia L.

    2003-02-27

    A new Accelerated Site Technology Deployment (ASTD) project was awarded in FY 2002 to the Idaho National Engineering and Environmental Laboratory (INEEL) to deploy technologies that decrease pollution and waste in the areas of facility characterization, sludge treatment, dust and contamination control, and concrete demolition. This project was called ''D&D Technologies for Pollution Prevention'' and planned to deploy four different technologies. To reduce protective equipment requirements, waste generation, and risk of radiation exposure during facility characterization, the Russian Gamma Locater Device (GLD) and Isotopic Identification Device (IID) for remote characterization was investigated. The GLD detects gamma ray readings and video images remotely and uses radio communication to transmit the readings to personnel located a safe distance from the contaminated area. The IID, an integral part of the GLD, provides real-time spectrometric analysis of radiation sources for remotely identifying the specific radioactive isotopes present in the facility. At the INEEL, sludge has accumulated in the bottom of a fuel storage pool and the presence of heavy metals in the sludge makes it a mixed waste. This project planned to use LEADX{reg_sign} to treat sludge in place to effectively make all heavy metals in the sludge insoluble. LEADX{reg_sign} is a dry granular chemical additive (apatite) used for in-situ treatment of heavy-metal-contaminated material. LEADX{reg_sign} chemically bonds to any free heavy metals that it contacts and forms a stable, non-leachable molecule. After treating the sludge with LEADX{reg_sign}, it was to be left in the basin and the pool filled with grout. The successful treatment of the sludge with LEADX{reg_sign} will reduce the amount of waste to be disposed at the burial ground by eliminating the need to remove the sludge from the basin. Many off-gas and duct systems being dismantled contain dust and lint that has been contaminated. Encapsulation Technologies, LLC has developed a patented process for eliminating airborne radioactivity and fixing contamination in place remotely without the need for people or equipment to enter the area being treated. The process uses a device called the Passive Aerosol Generator (PAG) to create an aerosol of a capture coating. The aerosol condenses on surfaces, capturing the contaminants in place. Use of this fogging technology will reduce or eliminate the requirement for glovebags and extensive contamination control during cutting and removal of ductwork. Demolition of building slabs and foundations is necessary at most DOE facilities undergoing D&D. The baseline method for their demolition at the INEEL is to use a hydraulic hammer on the end of a backhoe or trackhoe. However, the vibration of the hammer typically causes excessive wear and tear on the equipment (resulting in additional maintenance), and dust control can be a problem. The SureStrike rock breaker, or Hammerhead, is used commercially in the mining and demolition industries . The modular impact hammer attaches to a conventional frontend loader or excavator and can be used to break up oversized materials such as equipment pedestals and heavy reinforced concrete foundations. The Hammerhead uses a coiled spring that generates 100,000 psi of single-blow impact energy through a breaker rod. It takes about 3 seconds for the equipment operator to load the spring and deliver the blow. The Hammerhead reduces noise pollution because it uses no motors, hydraulics, or air, and it reduces dust pollution because the single-blow impact energy forces the energy down into the concrete, rubblizing the concrete below the surface while leaving the surface with only breaks/cracks instead of a lot of loose pieces. In addition, equipment maintenance is reduced, and safety is improved because the amount of ''fly rock'' is minimal.

  11. mm-Wave Phase Shifters and Switches

    E-Print Network [OSTI]

    Adabi Firouzjaei, Ehsan

    2010-01-01

    combiners . . . . . . . . . . . 5.3 mm-Wave implementationfailed to predict current mm-wave design trend [1] . . . . .solutions . . . . . . . . mm-wave imaging for medical and

  12. Onion River OnionRiverReview2011dd

    E-Print Network [OSTI]

    Weaver, Adam Lee

    2011 d river run by Lauren Fish Heather Lessard Jenna McCarthy Philip Noonan Erica Sabelawski #12;TheOnion River Review OnionRiverReview2011dd 2011 Our Lives in Dance Alex Dugas We were born with bare. Then we tap-danced on our graves, and back through the womb again, shoeless. #12;d Onion River Review d

  13. Deactivation & Decommissioning Knowledge Management Information Tool (D&D KM-IT)

    Broader source: Energy.gov [DOE]

    The Deactivation and Decommissioning Knowledge Management Information Tool (D&D KM-IT) serves as a centralized repository providing a common interface for all D&D related activities.

  14. DEFLECTION MEASUREMENTS OF 25 mm ALUMINUM COLLARS

    E-Print Network [OSTI]

    Peters, C.

    2010-01-01

    DEFLECTION MEASUREMENTS OF 25 mm ALUMINUM COLLARS· C. PetersDEFLECTION MEASUREMENTS OF 25 mm ALUMINUM COLLARS" C. Peters

  15. Discrimination Report ESTCP Project #MM-0437

    E-Print Network [OSTI]

    Gasperikova, Erika

    2008-01-01

    AS A FUNCTION OF TIME FOR 60 MM MORTAR . 23 F IGURE 12. PPOLARIZABILITY CURVES AS A FUNCTION OF TIME FOR 75 MM APAS A FUNCTION OF TIME FOR 81 MM MORTAR . 24 F IGURE 15. P

  16. mm-Wave Phase Shifters and Switches

    E-Print Network [OSTI]

    Adabi Firouzjaei, Ehsan

    2010-01-01

    4.1.1 Slow wave transmissioncombiners . . . . . . . . . . . 5.3 mm-Wave implementationfailed to predict current mm-wave design trend [1] . . . . .

  17. Semi-automatic Teleoperation for D&D Young S. Park, Hyosig Kang, Thomas F. Ewing

    E-Print Network [OSTI]

    Amaral, Luis A.N.

    . INTRODUCTION For decontamination and dismantling (D&D) of highly contaminated and difficult Platform (DAWP) system for dismantling a research reactor, CP-5, at Argonne National Laboratory

  18. a 3.37 mm length b 3.32 mm diameter

    E-Print Network [OSTI]

    Marc, Robert E.

    5.2 ml retinal subtense 300 µm/deg retinal arc 51 mm retinal area* 1024 ± 184 mm2 total.3 µl retinal subtense 31 µm/deg retinal arc 4.9 mm retinal area 15.6 mm2 cone:rod ratio 0/deg retinal arc 10.6 mm retinal area 52 mm2 cone:rod ratio mean cone density* mm-2 mean rod

  19. D&D Toolbox Robotic Deployment of High Resolution Laser Imaging for Characterization

    Broader source: Energy.gov [DOE]

    The characterization of complex and/or hazardous facilities for the purposes of planning D&D projects can be excessively time consuming and present unacceptable hazards for personnel who enter...

  20. Maximizing the Benefit from the D&D Technology Development Program

    Broader source: Energy.gov [DOE]

    The Office of Deactivation and Decommissioning (D&D)/Facility Engineering (FE) is charged with reducing the technical risk and uncertainty of D&D activities across the Environmental...

  1. Synthesis of galactosaminyl DD-chiro-inositols Georgia Marnera and Marc d'Alarcao*

    E-Print Network [OSTI]

    d'Alarcao, Marc

    Synthesis of galactosaminyl DD-chiro-inositols Georgia Marnera and Marc d'Alarcao* Michael Research.carres.2006.03.031 * Corresponding author. Tel.: +1 617 627 3686; fax: +1 617 627 3443; e-mail: marc

  2. Gash-Mm APP21¢¢¢§Q$ Cr

    E-Print Network [OSTI]

    Gash-Mm APP21¢¢¢§Q$ Cr. Partial Transfers by. Daniel Henry Gottliebl. The transfer for compact fibrations has been studied for some time now, [l,2,3,4,6,7,8,

  3. IL DIRETTORE Visti i DD.MM. 4.10.2000 e 9.1.2001 concernenti la rideterminazione, l'aggiornamento

    E-Print Network [OSTI]

    Di Pillo, Gianni

    Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" e la Fondazione "Enrico ed Enrica Sovena", con chemiopreventivi"; Vista la Delibera del Consiglio del Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer Fisiologia e Farmacologia "Vittorio Erspamer" ad attivare la procedura per il reclutamento di un ricercatore

  4. Demonstration Report: ESTCP UXO Discrimination Study ESTCP PROJECT # MM-0838

    E-Print Network [OSTI]

    Gasperikova, Erika

    2010-01-01

    Certification Program Project MM-0838. 7. REFERENCESSTUDY ESTCP PROJECT # MM-0838 SITE LOCATION: FORMER CAMP SANdesigned to detect UXO in the 20 mm to 155 mm size range for

  5. Brain Tissue Depth (mm) LightPowerDensity(mW/mm2

    E-Print Network [OSTI]

    Schnitzer, Mark

    Brain Tissue Depth (mm) LightPowerDensity(mW/mm2 ) Power Meter Tissue block Bare Fiber = 12° = 6 with the beveled cannula over CeA. d) Chart indicating estimated light power density seen at various distances from the fiber tip in mouse brain tissue when the light power density seen at the fiber tip was 7 mW (~99 mW/mm2

  6. direction. Three different pipette solutions were used: Cs-gluconate solution (150 mM CsOH, 5 mM CsCl, 135 mM sucrose, 10 mM HEPES, 1.5 mM EGTA and 1.5 mM EDTA

    E-Print Network [OSTI]

    Vale, Ronald D.

    direction. Three different pipette solutions were used: Cs-gluconate solution (150 mM CsOH, 5 mM CsCl, 135 mM sucrose, 10 mM HEPES, 1.5 mM EGTA and 1.5 mM EDTA (pH 7.2 with D-gluconic acid)); Na-gluconate solution (150 mM Na-gluconate, 5 mM NaCl, 135 mM sucrose, 10 mM HEPES, 1.5 mM EGTA and 1.5 mM EDTA (pH 7

  7. Sub-mm Galaxies in Cosmological Simulations

    E-Print Network [OSTI]

    Mark A. Fardal; Neal Katz; David H. Weinberg; Romeel Davé; Lars Hernquist

    2001-07-16

    We study the predicted sub-mm emission from massive galaxies in a Lambda-CDM universe, using hydrodynamic cosmological simulations. Assuming that most of the emission from newly formed stars is absorbed and reradiated in the rest-frame far-IR, we calculate the number of galaxies that would be detected in sub-mm surveys conducted with SCUBA. The predicted number counts are strongly dependent on the assumed dust temperature and emissivity law. With plausible choices for SED parameters (e.g., T=35 K, beta=1.0), the simulation predictions reproduce the observed number counts above ~ 1 mJy. The sources have a broad redshift distribution with median z ~ 2, in reasonable agreement with observational constraints. However, the predicted count distribution may be too steep at the faint end, and the fraction of low redshift objects may be larger than observed. In this physical model of the sub-mm galaxy population, the objects detected in existing surveys consist mainly of massive galaxies (several M_*) forming stars fairly steadily over timescales ~ 10^8-10^9 years, at moderate rates ~100 Msun/yr. The typical descendants of these sub-mm sources are even more massive galaxies, with old stellar populations, found primarily in dense environments. While the resolution of our simulations is not sufficient to determine galaxy morphologies, these properties support the proposed identification of sub-mm sources with massive ellipticals in the process of formation. The most robust and distinctive prediction of this model, stemming directly from the long timescale and correspondingly moderate rate of star formation, is that the far-IR SEDs of SCUBA sources have a relative high 850 micron luminosity for a given bolometric luminosity. [Abridged

  8. Observation of d-d fusion neutrons during degassing of deuterium-loaded palladium

    SciTech Connect (OSTI)

    Bittner, M.; Meister, A.; Seeliger, D.; Schwierz, R.; Wuestner, P. )

    1993-05-01

    Experiments with two massive deuterium-loaded palladium samples designed to search for deuteron-deuteron (d-d) fusion during thermal degassing are described. In the heavier of the two samples, which has a total mass of [approximately] 0.5 kg, during deuterium expulsion from the metal, a significant neutron excess count rate was detected by two independent NE-213 scintillation neutron detectors. The maximum time-dependent excess count rate corresponds to a d-d reaction rate of (3 [+-] 1) [times] 10[sup [minus]25] per deuteron pair per second. From detector pulse height spectra, the energy of the neutrons is determined to be [approximately] 2.5 MeV, as expected for d-d fusion neutrons. 10 refs., 10 figs., 2 tabs.

  9. QM/MM description of periodic systems

    E-Print Network [OSTI]

    Doll, K

    2015-01-01

    A QM/MM implementation for periodic systems is reported. This is done for the case of molecules and for systems with two and three-dimensional periodicity, which is suitable to model electrolytes in contact with electrodes. Tests on different water-containing systems, ranging from the water dimer up to liquid water indicate the correctness of the scheme. Furthermore, molecular dynamics simulations are performed, as a possible direction to study realistic systems.

  10. Fusion Technologies for Tritium-Suppressed D-D Fusion White Paper prepared for FESAC Materials Science Subcommittee

    E-Print Network [OSTI]

    1 Fusion Technologies for Tritium-Suppressed D-D Fusion White Paper prepared for FESAC Materials, Columbia University 2 Plasma Science and Fusion Center, MIT December 19, 2011 Summary The proposal for tritium-suppressed D-D fusion and the understanding of the turbulent pinch in magnetically confined plasma

  11. Comparison of the mass preconditioned HMC and the DD-HMC algorithm for two-flavour QCD

    E-Print Network [OSTI]

    Marinkovic, Marina

    2010-01-01

    Mass preconditioned HMC and DD-HMC are among the most popular algorithms to simulate Wilson fermions. We present a comparison of the performance of the two algorithms for realistic quark masses and lattice sizes. In particular, we use the locally deflated solver of the DD-HMC environment also for the mass preconditioned simulations.

  12. Comparison of the mass preconditioned HMC and the DD-HMC algorithm for two-flavour QCD

    E-Print Network [OSTI]

    Marina Marinkovic; Stefan Schaefer

    2010-11-03

    Mass preconditioned HMC and DD-HMC are among the most popular algorithms to simulate Wilson fermions. We present a comparison of the performance of the two algorithms for realistic quark masses and lattice sizes. In particular, we use the locally deflated solver of the DD-HMC environment also for the mass preconditioned simulations.

  13. A 40 mm Bore Quadrupole Magnet for the SSC

    E-Print Network [OSTI]

    Taylor, C.E.

    2011-01-01

    No. DE-AC03-76SF00098. A 40 MM BORE QUADRUPOLE MAGNET FOR40mm 211 T/m+ 5.0m 1664 ( both rings) 6500A 0.648 mm9.78 mm 1.062/1.268 mm 1.2 deg. Coil bore diameter Gradient

  14. Physical analyses of crystal plasticity by DD simulations B. Devincre a,*, L. Kubin a

    E-Print Network [OSTI]

    Devincre, Benoit

    Physical analyses of crystal plasticity by DD simulations B. Devincre a,*, L. Kubin a , T. Hoc b the potentialities of dislocation dynamics simulations for performing analyses of crystal plasticity and obtaining that are critical for mod- eling strain hardening in face-centred cubic crystals, the mesoscopic coefficients

  15. Effects of aridity and vegetation on plant-wax dD in modern lake sediments

    E-Print Network [OSTI]

    Polissar, Pratigya J.

    Effects of aridity and vegetation on plant-wax dD in modern lake sediments Pratigya J. Polissar Abstract We analyzed the deuterium composition of individual plant-waxes in lake sediments from 28 fractionation (ea) between plant-wax n-alkanes and precipitation differs with watershed ecosystem type

  16. Appendix D: Coal Gasifier Control: A Process Engineering Approach 208 DD.. CCOOAALL GGAASSIIFFIIEERR CCOONNTTRROOLL

    E-Print Network [OSTI]

    Skogestad, Sigurd

    Appendix D: Coal Gasifier Control: A Process Engineering Approach 208 DD.. CCOOAALL 24 June 1998 Coventry University #12;Appendix D: Coal Gasifier Control: A Process Engineering Approach 209 Coal Gasifier Control: A Process Engineering Approach B N Asmar, W E Jones and J A Wilson

  17. D&D of the French High Enrichment Gaseous Diffusion Plant

    SciTech Connect (OSTI)

    BEHAR, Christophe; GUIBERTEAU, Philippe; DUPERRET, Bernard; TAUZIN, Claude

    2003-02-27

    This paper describes the D&D program that is being implemented at France's High Enrichment Gaseous Diffusion Plant, which was designed to supply France's Military with Highly Enriched Uranium. This plant was definitively shut down in June 1996, following French President Jacques Chirac's decision to end production of Highly Enriched Uranium and dismantle the corresponding facilities.

  18. Corrigendum Corrigendum to ddApplications of DNA tiling arrays for whole-genome

    E-Print Network [OSTI]

    Jacobsen, Steve

    Corrigendum Corrigendum to ddApplications of DNA tiling arrays for whole-genome analysisTT [Genomics 85 (2005) 1­15] Todd C. Mocklera , Simon Chanc , Ambika Sundaresana,b , Huaming Chenb , Steven E Jolla, CA 92037, USA b Genomic Analysis Laboratory, The Salk Institute for Biological Studies, La Jolla

  19. Helium Catalyzed D-D Fusion in a Levitated Dipole J. Kesner, D.T. Garnier

    E-Print Network [OSTI]

    , Columbia University, New York, N.Y. 10027 PACS 28.52.-S Abstract Fusion research has focused on the goal the breeding of tritium. We explore an alternative D-D based fuel cycle and show that a levitated dipole may a substantially better utilization of magnetic field energy with a comparable mass power density to a D-T based

  20. Enhanced Teleoperation for D&D Young S. Park, Hyosig Kang, Thomas F. Ewing

    E-Print Network [OSTI]

    Amaral, Luis A.N.

    Enhanced Teleoperation for D&D Young S. Park, Hyosig Kang, Thomas F. Ewing Nuclear Engineering-based control architecture and cobot control technology. Keywords ­ teleoperation, teleautonomy Platform (DAWP) system for dismantling the CP-5 reactor internals at Argonne National Laboratory. Despite

  1. d Onion River Review d OnionRiverReview2010dd

    E-Print Network [OSTI]

    Weaver, Adam Lee

    ://www.smcvt.edu/onionriver/. #12;d Onion River Review d 2010 d river run by Eireann Aspell Lauren Fish Jamie Gorton Heidi Lynchd Onion River Review d 2010 d OnionRiverReview2010dd #12;The Onion River Review is the literary Matt Serron #12;BLANK Editors' Note The only certainty of the Onion River Review is the editors' un

  2. Coordinated mm/sub-mm observations of Sagittarius A* in May 2007

    E-Print Network [OSTI]

    D. Kunneriath; A. Eckart; S. Vogel; L. Sjouwerman; H. Wiesemeyer; R. Schoedel; F. K. Baganoff; M. Morris; T. Bertram; M. Dovciak; D. Downes; W. J. Duschl; V. Karas; S. Koenig; T. Krichbaum; M. Krips; R. -S. Lu; S. Markoff; J. Mauerhan; L. Meyer; J. Moultaka; K. Muzic; F. Najarro; K. Schuster; C. Straubmeier; C. Thum; G. Witzel; M. Zamaninasab; A. Zensus

    2008-10-01

    At the center of the Milky Way, with a distance of ~8 kpc, the compact source Sagittarius A* (SgrA*) can be associated with a super massive black hole of ~4x10^6 solar masses. SgrA* shows strong variability from the radio to the X-ray wavelength domains. Here we report on simultaneous NIR/sub-millimeter/X-ray observations from May 2007 that involved the NACO adaptive optics (AO) instrument at the European Southern Observatory's Very Large Telescope, the Australian Telescope Compact Array (ATCA), the US mm-array CARMA, the IRAM 30m mm-telescope, and other telescopes. We concentrate on the time series of mm/sub-mm data from CARMA, ATCA, and the MAMBO bolometer at the IRAM 30m telescope.

  3. Viewing the Evolution of Massive Star Formation through FIR/Sub-mm/mm Eyes

    E-Print Network [OSTI]

    Lihong Yao; E. R. Seaquist

    2006-05-25

    In this paper, we present an overview of our method of constructing a family of models for the far-infrared, sub-millimeter, and millimeter (FIR/sub-mm/mm) line emission of molecular and atomic gas surrounding massive star formation in starburst galaxies. We show the results of a case study, an expanding supershell centered around a massive star cluster with a particular set of input parameters and its application to nearby starburst galaxy M 82. This set of models can be used not only to interpret the observations of FIR/sub-mm/mm line emission from molecular and atomic gas, but also to investigate the physical environment and the initial cloud conditions in massive star forming regions as well as the ages of the starbursts through simulations for a wide range of input parameters. Finally, we discuss limitations of our models, and outline future work.

  4. Discrimination Report: ESTCP UXO Discrimination Study, ESTCP Project #MM-0437

    E-Print Network [OSTI]

    Gasperikova, Erika; Smith, J. Torquil; Morrison, H. Frank; Becker, Alex

    2007-01-01

    STUDY ESTCP PROJECT # MM-0437 Courtesy of Chris Gardner,POLARIZABILITIES , LOCATION AND ORIENTATION OF 81 MM M821A1POLARIZABILITIES , LOCATION AND ORIENTATION OF 105 MM M60

  5. DESIGN OF 15 mm COLLARS FOR SSC DIPOLE MAGNETS

    E-Print Network [OSTI]

    Peters, C.

    2010-01-01

    and Deflection for Five 15 mm S.S. Collar Types Welded 5.5.11. Collar Stiffness 15 mm 5.5. Collar Types Correlation ofMechanical measurement of 15 mm 5.5. collars used on eight

  6. 40 MM Grenade Launcher Qualification Requirements at Department...

    Office of Environmental Management (EM)

    40 MM Grenade Launcher Qualification Requirements at Department of Energy Sites, IG-0806 40 MM Grenade Launcher Qualification Requirements at Department of Energy Sites, IG-0806...

  7. Radio-mm-FIR Photometric Redshifts for (sub-)mm Galaxies

    E-Print Network [OSTI]

    Itziar Aretxaga; David H. Hughes; James S. Dunlop

    2007-02-20

    We present a comparison between the published optical, IR and CO spectroscopic redshifts of 86 (sub-)mm galaxies and their photometric redshifts as derived from long-wavelength radio-mm-FIR photometric data. The redshift accuracy measured for 13 sub-mm galaxies with at least one robustly determined colour in the radio-mm-FIR regime and additional constraining upper limits is z \\~0.3. This accuracy degrades to z~0.65 when only the 1.4GHz/850um spectral index is used, as derived from the analysis of a subsample of 58 galaxies with robustly determined redshifts. Despite the wide range of spectral energy distributions in the local galaxies that are used in an un-biased manner as templates, this analysis demonstrates that photometric redshifts can be effciently derived for sub-mm galaxies with a precision of Delta z < 0.5 using only the rest-frame FIR to radio wavelength data, suficient to guide the tuning of broad-band heterodyne observations (e.g. 100m GBT, 50m LMT, ALMA) or aid their determination in the case of a single line detection by these experiments.

  8. A 40 mm BORE Nb-Ti MODEL DIPOLE MAGNET

    E-Print Network [OSTI]

    Taylor, C.

    2010-01-01

    September 9-13, 1984 A 40 mm BORE Nb-Ti MODEL DIPOLE MAGNETNo. DE- AC03- 76SF0009B. A 40 mm BORE Nb- Tl MOOEL OIPOLEMPa) Midplane Shim (mm) ColI Length (mm) Number of Strands

  9. SUPPORTING INFORMATION METHODS Buffers. Buffer U is 20 mM TrisHCl, 6 mM NaCl, 1.7 mM MgCl2, 5 mM 2-mercaptoethanol (2-ME),

    E-Print Network [OSTI]

    Lohman, Timothy M.

    SUPPORTING INFORMATION METHODS Buffers. Buffer U is 20 mM Tris·HCl, 6 mM NaCl, 1.7 mM MgCl2, 5 mM 2H 7.5 at 25°C. SM buffer is 50 mM Tris·HCl, 0.1 M NaCl, 8 mM MgSO4, 0.01% gelatin, pH 7.5 at 25°C. Lysis buffer is 50 mM Tris·HCl, 0.2 M NaCl, 20% (w/v) sucrose, 15% (v/v) glycerol, 1 mM EDTA, 2 mM 2-ME

  10. Polarized mm And sub-mm Emission From Sgr A* At The Galactic Center

    E-Print Network [OSTI]

    Fulvio Melia; Siming Liu; Robert Coker

    2001-01-18

    The recent detection of significant linear polarization at mm and sub-mm wavelengths in the spectrum of Sgr A* (if confirmed) will be a useful probe of the conditions within several Schwarzschild radii ($r_S$) of the event horizon at the Galactic Center. Hydrodynamic simulations of gas flowing in the vicinity of this object suggest that the infalling gas circularizes when it approaches within $5-25 r_S$ of the black hole. We suggest that the sub-mm ``excess'' of emission seen in the spectrum of Sgr A* may be associated with radiation produced within the inner Keplerian region and that the observed polarization characteristics provide direct evidence for this phenomenon. The overall spectrum from this region, including the high-energy component due to bremsstrahlung and inverse Compton scattering processes, is at or below the recent {\\it Chandra} measurement, and may account for the X-ray source if it turns out to be the actual counterpart to Sgr A*.

  11. Digital Frequency Domain Multiplexer for mm-Wavelength Telescopes

    E-Print Network [OSTI]

    Dobbs, Matt

    2008-01-01

    for Large Scale Bolometer Arrays”, Monterey Far-IR, Sub-mmand mm Detector Technology Workshop proceedings, 2002, pp.Domain Multiplexer for mm-Wavelength Telescopes Matt Dobbs,

  12. MEASUREMENTS OF THE 1MM RECEIVER OPTICS Dick Plambeck

    E-Print Network [OSTI]

    MEASUREMENTS OF THE 1MM RECEIVER OPTICS Dick Plambeck Radio Astronomy laboratory, University of California, Berkeley, CA, 94720 March 2000 ABSTRACT When 1mm receivers were first installed on the BIMA of the 1mm receiver optics finally identified the problem -- two of the optical components in each dewar

  13. (Sub)mm Interferometry Applications in Star Formation Research

    E-Print Network [OSTI]

    Beuther, Henrik

    (Sub)mm Interferometry Applications in Star Formation Research H. Beuther1 Max-Planck Institute for Astronomy, K¨onigstuhl 17, 69117 Heidelberg, Germany beuther@mpia.de Abstract. Interferometry at (sub)mm structure e.g. details of accretion disks or molecular outflows and the sub(mm) wavelength bands

  14. A Tutorial on MM Algorithms David R. Hunter1

    E-Print Network [OSTI]

    Babu, G. Jogesh

    A Tutorial on MM Algorithms David R. Hunter1 Kenneth Lange2 Department of Statistics1 Penn State is a special case of the more general class of MM optimization algorithms, which typically exploit convexity rather than missing data in ma- jorizing or minorizing an objective function. In our opinion, MM

  15. Creating 35 mm Camera Active Pixel Sensors by Glenn Chapman*

    E-Print Network [OSTI]

    Chapman, Glenn H.

    #12;Creating 35 mm Camera Active Pixel Sensors by Glenn Chapman* and Yves Audet** * Simon Fraser Pixel Sensor imaging area device is studied which would be ideal for use with standard 35 mm cameras.5 per sq. cm. By being a retrofit for current 35 mm cameras, and having larger photodiode pixels than

  16. Spectral Line Survey toward Young Massive Protostar NGC 2264 CMM3 in the 4 mm, 3 mm, and 0.8 mm Bands

    E-Print Network [OSTI]

    Watanabe, Yoshimasa; Lopez-Sepulcre, Ana; Furuya, Ryuta; Sakai, Takeshi; Hirota, Tomoya; Liu, Sheng-Yuan; Su, Yu-Nung; Yamamoto, Satoshi

    2015-01-01

    Spectral line survey observations are conducted toward the high-mass protostar candidate NGC 2264 CMM3 in the 4 mm, 3 mm, and 0.8 mm bands with the Nobeyama 45 m telescope and the Atacama Submillimeter Telescope Experiment (ASTE) 10 m telescope. In total, 265 emission lines are detected in the 4 mm and 3 mm bands, and 74 emission lines in the 0.8 mm band. As a result, 36 molecular species and 30 isotopologues are identified. In addition to the fundamental molecular species, many emission lines of carbon-chain molecules such as HC5N, C4H, CCS, and C3S are detected in the 4 mm and 3 mm bands. Deuterated molecular species are also detected with relatively strong intensities. On the other hand, emission lines of complex organic molecules such as HCOOCH3, and CH3OCH3 are found to be weak. For the molecules for which multiple transitions are detected, rotation temperatures are derived to be 7-33 K except for CH3OH. Emission lines with high upper-state energies (Eu > 150 K) are detected for CH3OH, indicating existen...

  17. QCD with light Wilson quarks on fine lattices (II): DD-HMC simulations and data analysis

    E-Print Network [OSTI]

    L. Del Debbio; L. Giusti; M. Lüscher; R. Petronzio; N. Tantalo

    2007-01-12

    In this second report on our recent numerical simulations of two-flavour QCD, we provide further technical details on the simulations and describe the methods we used to extract the meson masses and decay constants from the generated ensembles of gauge fields. Among the topics covered are the choice of the DD-HMC parameters, the issue of stability, autocorrelations and the statistical error analysis. Extensive data tables are included as well as a short discussion of the quark-mass dependence in partially quenched QCD, supplementing the physics analysis that was presented in the first paper in this series.

  18. A sub-mm imaging survey of ultracompact HII regions

    E-Print Network [OSTI]

    M. A. Thompson; J. Hatchell; G. H. Macdonald; T. J. Millar

    2001-12-19

    We present the preliminary results of a sub-mm imaging survey of ultracompact HII regions, conducted with the SCUBA bolometer array on JCMT.

  19. PPPL3207, Preprint: October 1996, UC420, 421, 423, 426 Core Vf and T i Profiles and Transport in TFTR DD and DT

    E-Print Network [OSTI]

    interactions relative to performance of advanced tokamaks. The effects of lithium on plasma performance were neutral beam heating with lithium (Li) conditioned graphite walls in TFTR. Values of tE > 300 ms have been carried out in both DD and DT plasmas with well­degassed and conditioned walls. Here DD means neutral beam

  20. DD22O Detection usingO Detection using UltraUltra--high Qhigh Q ToroidalToroidal MicrocavitiesMicrocavities

    E-Print Network [OSTI]

    DD22O Detection usingO Detection using UltraUltra--high Qhigh Q ToroidalToroidal MicrocavitiesMicrocavities A. M. Armani, K. J. Vahala California Institute of Technology #12;DD22O detection methodsO detection Radiation 30 ppmv (0.003%) Annyas, J., et. al. Appl. Spec., 53 3 (1999). · UHQ Microtoroid Resonant

  1. Evidence for water use efficiency as an important factor in determining the dD values of tree leaf waxes

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    leaf waxes Juzhi Hou, William J. D'Andrea, Dana MacDonald, Yongsong Huang * Department of Geological waxes can provide useful information about past climate change. However, factors con- trolling dD values of higher plant leaf waxes (dDwax) are poorly understood. Here we show that dDwax values are negatively

  2. Modeling Foamy Oil Flow in Porous Media D.D. Joseph, A.M. Kamp, R. Bai

    E-Print Network [OSTI]

    Joseph, Daniel D.

    Modeling Foamy Oil Flow in Porous Media D.D. Joseph½, A.M. Kamp¾, R. Bai½ ½Univ. of Minnesota, Dept, PO Box 76343, Caracas 1070-A, Venezuela October 2001 Abstract Certain heavy oils which foam under so- lution gas drive. These oils not only stabilize foam, but also stabilize dis- persion of gas

  3. 663 900 1000 1100 1200 3514 Annual precipitation (mm)

    E-Print Network [OSTI]

    Beckage, Brian

    663 900 1000 1100 1200 3514 Annual precipitation (mm) -72.6 -71.5 -70.3 -69.2 -68.1 42 precipitation (mm) -72.6 -71.5 -70.3 -69.2 -68.1 42.143.144.245.346.4 Longitude (degree) Latitude(degree) (b) Baseline (1961-1990) 663 900 1000 1100 1200 3514 Annual precipitation (mm) -72.6 -71.5 -70.3 -69.2 -68.1 42

  4. The Innermost AGNs with Future mm-VLBI

    E-Print Network [OSTI]

    I. Agudo; T. P. Krichbaum; U. Bach; A. Pagels; B. W. Sohn; D. A. Graham; A. Witzel; J. A. Zensus; J. L. Gomez; M. Bremer; M. Grewing

    2005-10-31

    The capabilities of the Global mm-VLBI Array are summarized and demonstrated through actual images from our monitoring of extragalactic radio jets. This sensitive 3mm-VLBI interferometer is able to provide images of up to 50 microarcseconds resolution. For the near future, ALMA, the GBT, the LMT, CARMA, SRT, Yebes, Nobeyama and Noto are some of the most sensitive stations suitable to participate in mm-VLBI. This future array, together with the present Global mm-VLBI Array, would achieve 10 times better sensitivities than nowadays. Image fidelity would also largely increased. T he addition of ALMA would improve the (u,v)-coverage for sources with low declination (<20 deg.) and facilitate the VLBI imaging of the Galactic Centre source SgrA*.

  5. INTRODUCTION Pipunculidae are small (2-12 mm), inconspicuous

    E-Print Network [OSTI]

    Cotton, Sam

    INTRODUCTION Pipunculidae are small (2-12 mm), inconspicuous dark flies belonging. Humeri yellowish brown, mesonotum black with predominantly brown pollinosity. Femora yellow with dark, Hungary (foldvari@gmx.net) Keywords: faunistics, Tomosvaryella, Eudorylas #12;Eudorylas sp. Material

  6. (ISLiM) 2011 (2011.12.21-22) Platypus MM/CG

    E-Print Network [OSTI]

    Fukai, Tomoki

    #12;15 (ISLiM) 2011 (2011.12.21-22) 1 Platypus MM/CG 1982 3 1982 8 Cornell 1986 2 1988 4 1996 4 2001 4 2006 10 2011 4 HPCI #12;16 (ISLiM) 2011 (2011.12.21-22) 2 Platypus MM/CG 1. QM MM MM CG QM-MM-CG 3 QM MM QM/MM MM CG MM/CG 2. 2.1 ProteinDF QM DFT B3LYP 8,000 6 c 2.2 Platypus-QM/MM QM/MM QM MM QM/MM

  7. Galaxy formation & evolution: the far-ir/sub-mm view

    E-Print Network [OSTI]

    M. Cirasuolo; J. S. Dunlop

    2008-10-07

    We review our current knowledge of the population of high-redshift sub-mm/mm galaxies, with particular emphasis on recent results from the SCUBA HAlf Degree Extragalactic Survey (SHADES). All available evidence indicates that these objects form the high-redshift, high-luminosity, high-mass tail of the dusty starforming galaxy population revealed at lower redshifts and luminosities by Spitzer. Current theoretical models of galaxy formation struggle to reproduce these extreme objects in the numbers indicated by current surveys.

  8. 320 Herpetological Review 34(4), 2003 range = 17.028.7 mm; mean width = 11.6 mm, s = 0.73, range =

    E-Print Network [OSTI]

    Blouin-Demers, Gabriel

    320 Herpetological Review 34(4), 2003 range = 17.0­28.7 mm; mean width = 11.6 mm, s = 0.73, range = 10.5­12.5 mm). The third specimen collected in January is poorly preserved (IB 65538, 648 mm SVL, 150 mm TL) and had five oviductal eggs (mean length = 15.8 mm, s = 5.11, range = 10.0­ 22.2 mm; mean

  9. MM_swapImgRestore() { //v3.0 var i,x,a=document.MM_sr; for(i=0;a&&i

    E-Print Network [OSTI]

    MM_swapImgRestore() { //v3.0 var i,x,a=document.MM_sr; for(i=0;a&&i=a[i])&&x.oSrc;i++) x.src=x.oSrc; } function MM_preloadImages() { //v3.0 var d=document; if(d.images){ if(!d.MM_p) d.MM_p=new Array(); var i,j=d.MM_p.length,a=MM_preloadImages.arguments; for(i=0; i

  10. The Properties of Sub-mm Galaxies in Hierarchical Models

    E-Print Network [OSTI]

    Mark Swinbank; Cedric Lacey; Ian Smail; Carlton Baugh; Carlos Frenk; Andrew Blain; Scott Chapman; Kristen Coppin; Rob Ivison; Laura Hainline; Juan Gonzalez

    2008-09-11

    We use the combined GALFORM semi-analytical model of galaxy formation and GRASIL spectrophotometric code to investigate the properties of galaxies selected via their sub-mm emission. Our fiducial model has previously been shown to fit the properties of local ULIRGs, as well as the number counts of faint sub-mm galaxies. Here, we test the model in detail by comparing the SEDs and stellar, dynamical, gas and halo masses of sub-mm galaxies against observational data. We precisely mimic the sub-mm and radio selection function of the observations and show that the predicted far-infrared properties of model galaxies with S_850>5mJy and S_1.4>30uJy are in good agreement with observations. Although the dust emission model does not assume a single dust temperature, the far-infrared SEDs are well described by single component modified black-body spectrum with characteristic temperature 32+/-5K. We also find evidence that the observations may have uncovered evolution in the far-infrared--radio relation in ULIRGs out to z~2. We show that the predicted redshift distribution of sub-mm galaxies provides a reasonable fit to the observational data with a median redshift z=2.0, with the radio-selected subset predicted to make up approximately 75% of the population. However, the predicted K-band and mid-infrared (3--8um) flux densities of the sub-mm galaxies (and LBGs) are up to a factor 10x fainter than observed. This discrepancy may indicate that the stellar masses of the sub-mm galaxies in the model are too low: M~10^10Mo, while observations suggest more massive systems, M~10^11Mo. Finally, we discuss the potential modifications to the models which may improve the fit to the observational data. [Abridged

  11. Starburst Models For FIR/sub-mm/mm Line Emission. I. An Expanding Supershell Surrounding A Massive Star Cluster

    E-Print Network [OSTI]

    Lihong Yao; T. A. Bell; S. Viti; J. A. Yates; E. R. Seaquist

    2005-09-19

    The effect of a newly born star cluster inside a giant molecular cloud (GMC) is to produce a hot bubble and a thin, dense shell of interstellar gas and dust swept up by the H II expansion, strong stellar winds, and repeated supernova explosions. Lying at the inner side of the shell is the photodissociation region (PDR), the origin of much of the far-infrared/sub-millimeter/millimeter (FIR/sub-mm/mm) radiation from the interstellar medium (ISM). We present a model for the expanding shell at different stages of its expansion which predict mm/sub-mm and far-IR emission line intensities from a series of key molecular and atomic constituents in the shell. The kinematic properties of the swept-up shell predicted by our model are in very good agreement with the measurements of the supershell detected in the nearby starburst galaxy M 82. We compare the modeling results with the ratio-ratio plots of the FIR/sub-mm/mm line emission in the central 1.0 kpc region to investigate the mechanism of star forming activity in M 82. Our model has yielded appropriate gas densities, temperatures, and structure scales compared to those measured in M 82, and the total H2 content is compatible with the observations. This implies that the neutral ISM of the central star-forming region is a product of fragments of the evolving shells.

  12. Discrimination Report: A Multisensor system for detection and characterization of UXO, ESTCP Project MM-0437,

    E-Print Network [OSTI]

    Gasperikova, Erika; Smith, J. Torquil; Morrison, H.Frank; Becker, Alex

    2008-01-01

    characterization of UXO (MM-0437) - Demonstration report:AND CHARACTERIZATION OF UXO MM-0437 SITE LOCATION: U.S. ARMYcharacterization of UXO (MM-0437) - Demonstration report,

  13. Quadruply Bonded Dimetal Units Supported by 2,4,6-Triisopropylbenzoates MM(TiPB)4 (MM ) Mo2, MoW, and W2)

    E-Print Network [OSTI]

    Turro, Claudia

    Quadruply Bonded Dimetal Units Supported by 2,4,6-Triisopropylbenzoates MM(TiPB)4 (MM ) Mo2, Mo, and cyclic voltammetry) of the new compounds MM(TiPB)4, where MM ) MoW and W2 and TiPB ) 2 in the visible region of the spectrum that are assigned to MM to arylcarboxylate * transitions, 1 MLCT. Each

  14. Measurement of the Enhanced Screening Effect of the d+d Reactions in Metals

    E-Print Network [OSTI]

    A. Huke; K. Czerski; P. Heide

    2007-01-26

    The investigation of the d+d fusion reactions in metallic environments at sub-Coulomb energies demands especially adapted techniques beyond standard procedures in nuclear physics. The measurements which were performed with an electrostatic accelerator at different self-implanted metallic target materials show an enhancement of the reaction cross-section compared to the gas target experiments. The resulting electron screening energy values are about one order of magnitude larger relative to the gas target experiments and exceed significantly the theoretical predictions. The measurements on deuterium inside metals are heavily affected by the interference of two peculiarities of this system: the possibly very high mobility of deuterium in solids and the formation of surface contamination layers under ion beam irradiation in high vacuum systems. Thorough investigations of these processes show their crucial influence on the interpretation of the experimental raw data. The differential data acquisition and analysis method employed to it is outlined. Non observance of these problems by using standard procedures results in fatal errors for the extraction of the screening energies.

  15. ORNL Soils Remediation and Slabs Removal The Bridge from D&D to Redevelopment

    SciTech Connect (OSTI)

    Conger, M Malinda; Schneider, Ken R

    2012-01-01

    The landscape of the Oak Ridge National Laboratory (ORNL) has dramatically changed over the past 2 years with demolition of aging facilities in the Central Campus. Removal of these infrastructure legacies was possible due to an influx of DOE-Environmental Management funding through the American Recovery and Reinvestment Act of 2009 (ARRA). Facility D&D traditionally removes everything down to the building slab, and the Soils and Sediments Program is responsible for slabs, below-grade footers, abandoned waste utilities, and soils contaminated above certain risk levels that must be removed before the site can be considered for redevelopment. , DOE-EM has used a combination of base and ARRA funding to facilitate the clean-up process in ORNL s 2000 Area. Demolition of 13 buildings in the area was funded by the ARRA. Characterization of the remaining slabs, underground pipelines and soils was funded by DOE-EM base funding. Additional ARRA funding was provided for the removal of the slabs, pipelines and contaminated soils. Removal work is in progress and consists of removing and disposing of approximately 10,000 cubic yards (CY) of concrete, 2,500 CY of debris, and 500 CY of contaminated soil. The completion of this work will allow the site to be available for redevelopment and site reuse efforts at ORNL.

  16. (Sub-)mm interferometry in massive star-forming regions

    E-Print Network [OSTI]

    H. Beuther

    2003-08-21

    (Sub-)mm interferometry is the most favorable technique to investigate the earliest stages of massive star formation. I will outline general applications in that field and discuss results of different sub-topics (hot core chemistry and massive molecular outflows). Furthermore, recent data obtained with the Submillimeter Array will be shown to present the unique capabilities of this new instrument. Finally, I will give a short outlook on the main physical topics of massive star formation to be tackled with (sub-)mm interferometry within the next decade.

  17. Powering mm-Size Wireless Implants for Brain-Machine Interfaces

    E-Print Network [OSTI]

    Mark, Michael

    2011-01-01

    4 Proof-of-Concept: A 1 mm 3 Neural Transponder Linkfor power transfer to a 1 x 1 mm 2 implanted antenna withantenna with a diameter of 15 mm and a 1 mm 2 implant

  18. Ferrite-Cored Solenoidal Induction Coil Sensor for BUD (MM-1667)

    E-Print Network [OSTI]

    Morrison, F.

    2012-01-01

    Research and Development Program Project MM-1667.INDUCTION COIL SENSOR FOR BUD (MM-1667) Frank Morrison 1 ,

  19. 3 mm Anisotropy Measurement: On the Quadrupole Component in the Cosmic Background Radiation

    E-Print Network [OSTI]

    Lubin, Philip M.; Epstein, Gerald L.; Smoot, George F.

    1982-01-01

    Mixer Impedance transformer 3 mm local oscillator X m 4°K -Frequency (GHz) I Wavelength (mm) XBL SOUTH CELESTIAL POLE

  20. The simultaneous spectrum of Sgr A* from 20cm to 1mm and the nature of the mm-excess

    E-Print Network [OSTI]

    Heino Falcke; W. M. Goss; Hiroshi Matsuo; Peter Teuben; Jun-Hui Zhao; Robert Zylka

    1998-01-12

    We report results from a multiwavelength campaign to measure the simultaneous spectrum of the super-massive black hole candidate Sgr A* in the Galactic Center from cm to mm-wavelengths using the VLA, BIMA, the Nobeyama 45m, and the IRAM 30m telescopes. The observations confirm that the previously detected mm-excess is an intrinsic feature of the spectrum of Sgr A*. The excess can be interpreted as due to the presence of an ultra-compact component of relativistic plasma with a size of a few Schwarzschild radii near the black hole. If so, Sgr A* might offer the unique possibility to image the putative black hole against the background of this component with future mm-VLBI experiments.

  1. Course Outline Engineer 2MM3 Electrical Circuits & Power

    E-Print Network [OSTI]

    Haykin, Simon

    .ece.mcmaster.ca/~mrhowlader/2mm3/notes.htm Text Book: S.J. Chapman, Electric Machinery Fundamentals, McGraw Hill, Fifth Edition Course Description: Fundamentals of electromechanical energy conversion. Motors and generators. Fundamentals of Magnetic Circuits; 2. Fundamentals of Electrical Circuits, Phasors; 3. Power in AC Circuits; 4

  2. Mm/submm observations of symbiotic binary stars

    E-Print Network [OSTI]

    J. Mikolajewska; R. J. Ivison; A. Omont

    2002-10-22

    We present and discuss mm/submm observations of quiescent S-type symbiotic systems, and compare them with popular models proposed to account for their radio emission. We find that the M giant mass-loss rates derived from our observations are systematically higher than those reported for single M giants.

  3. FISHERY STATISTICS I OF THE UNITED STATESmmmMM

    E-Print Network [OSTI]

    ^^ FISHERY STATISTICS I OF THE UNITED STATESmmmMM 'f^ gjIP^Ws^WI'l STATISTICAL DIGEST NO. 25 Fish Statistical Digest 25 FISHERY STATISTICS OF THE UNITED STATES 1949 BY A. W. ANDERSON and C. E. PETERSON UNITED. Government Printing Office, Washington 25, D. C. - - - Price $1.25 (paper) #12;Fishery Statistics

  4. In-vehicle mm-Wave Channel Model and Measurement

    E-Print Network [OSTI]

    Zemen, Thomas

    . I. INTRODUCTION The ever increasing vehicle efficiency goes hand in hand with weight savings. OneIn-vehicle mm-Wave Channel Model and Measurement Jiri Blumenstein, Tomas Mikulasek, Roman Marsalek measurements carried out in the intra­ vehicle environment. Channels in the millimeter-wave (MMW) frequency

  5. Data:0a710392-0262-4cde-a5ba-d1dd41e15527 | Open Energy Information

    Open Energy Info (EERE)

    cde-a5ba-d1dd41e15527 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic...

  6. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  7. Sub-mm clues to elliptical galaxy formation

    E-Print Network [OSTI]

    James S. Dunlop

    2000-11-03

    There is growing evidence that, at the S(850) mm galaxy population (and hence a potentially significant fraction of the sub-mm background) is associated with the star-forming Lyman-break population already detected at optical wavelengths. However, the implied star-formation rates in such objects (typically 3-30 solar masses per year) fall one or two orders of magnitude short of the level of star-forming activity required to produce the most massive elliptical galaxies on a timescale ~ 1 Gyr. If a significant fraction of massive ellipticals did form the bulk of their stars in short-lived massive starbursts at high redshift, then they should presumably be found among the brighter, S(850) ~ 10 mJy sub-mm sources which are undoubtedly not part of the Lyman-break population. A first powerful clue that this is indeed the case comes from our major SCUBA survey of radio galaxies, which indicates that massive dust-enshrouded star-formation in at least this subset of massive ellipticals is largely confined to z > 2.5, with a mean redshift z = 3.5. While radio selection raises concerns about bias, I argue that our current knowledge of the brightest (S(850) ~ 10 mJy) sub-mm sources detected in unbiased SCUBA imaging surveys indicates that they are also largely confined to this same high-z regime. Consequently, while the most recent number counts imply such extreme sources can contribute only 5-10% of the sub-mm background, their comoving number density (in the redshift band 3 < z < 5) is 1-2 x 10^{-5} per cubic megaparsec, sufficient to account for the formation of all ellipticals of comparable mass to radio galaxies (~4L-star) in the present-day universe.

  8. RNase T2 Digestion 1. Resuspend RNA pellet in 10 l ddH2O (not DEPC-treated). Up to 10 g of RNA is OK.

    E-Print Network [OSTI]

    Aris, John P.

    64 RNase T2 Digestion 1. Resuspend RNA pellet in 10 µl ddH2O (not DEPC-treated). Up to 10 µg of RNA pellet should be visible at bottom of tube. Transfer aqueous phase to fresh tube, and measure the volume in the process with a micropipettor. Wash gelantinous pellet with enough ddH2O to bring final volume in the fresh

  9. Taiwan geology Plate collision at 80 mm/yr

    E-Print Network [OSTI]

    Gung, Yuancheng

    4 #12;Meander #12;#12;#12;=/ #12;: () () () () () : : 2.0 1.51.75 1.25 1.0 #12/yr (Ratio: 1.9%, Area: 0.024%) Average sediment discharge to ocean: 384 Mt/yr --- 160 Mt/yr (544 Mt.m.s) = Sediments (ton.s-1) Sediments (ton.s-1) ÷ Density (t/m3) ÷ Area (m2) = Erosion (mm.s-1) Calculation: Stream

  10. BB UU LL GG AA RR II AA NN AA CC AA DD EE MM YY OO FF SS CC II EE NN CC EE SS IINNSSTTIITTUUTTEE OOFF IINNFFOORRMMAATTIIOONN AANNDD CCOOMMMMUUNNIICCAATTIIOONN TTEECCHHNNOOLLOOGGIIEESS

    E-Print Network [OSTI]

    Borissova, Daniela

    Library (ITIL) ­ essence development, open problems Abstract: This article aims to give an overview over the ITIL framework objective. It is going to explain the rapidly growing IT business needs which had caused the development of this library. We are also going to follow the ITIL evolution history and find the circumstances

  11. VLBA Imaging at 7 mm and Linear Polarimetric Observations at 6 cm and 3 mm of Sagittarius A*

    E-Print Network [OSTI]

    Geoffrey C. Bower; Heino Falcke; Don Backer; Melvyn Wright

    1998-11-13

    We summarize the results of 7 mm VLBA imaging of Sgr A* and discuss some of the difficulties of accurately constraining the size of Sgr A* with VLBI observations. Our imaging results are fully consistent with the hypothesis that the VLBA image of Sgr A* is a resolved elliptical Gaussian caused by the scattering of an intervening thermal plasma. We show that determination of the minor axis size at 7 mm with the VLBA is very unreliable. We also present new polarimetric observations from the VLA and from the BIMA array of Sgr A*. At 4.8 GHz, we find an upper limit to the polarization of 0.1%. At 86 GHz, we report a marginal detection of $1 \\pm 1$% linear polarization. We discuss the effects of interstellar propagation on the linear polarization and consider the significance of very low intrinsic linear polarization in Sgr A*.

  12. What we need to return at the telescope New array at 1mm with better sensitvity

    E-Print Network [OSTI]

    Leclercq, Samuel

    What we need to return at the telescope New array at 1mm with better sensitvity Magnetic field pixels with 3 preamplifiers (1 at 2mm and 2 at 1mm) · 300 pixels at 2mm · 600 pixels at 1mm Automatic

  13. SUB-MM-WAVE TECHNOLOGIES: SYSTEMS, ICS, THZ TRANSISTORS M. J. W. Rodwell

    E-Print Network [OSTI]

    Rodwell, Mark J. W.

    SUB-MM-WAVE TECHNOLOGIES: SYSTEMS, ICS, THZ TRANSISTORS M. J. W. Rodwell Department of Electrical Engineering University of California, Santa Barbara, CA 93105 Abstract mm-wave and sub-mm-wave outdoor, bipolar transistors, mm- waves, sub-mm-waves, THz. I. INTRODUCTION With progressive scaling of junction

  14. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM2, Wireless TCP

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM2, Wireless TCP Wireless Networks Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad Schwefel Wireless Networks III, Fall 2005: MM2, Wireless TCP Background: IP Protocol Stack Network Layer

  15. Pulling of 3 mm diameter AlSb rods by micro-pulling down method

    E-Print Network [OSTI]

    Bourret-Courchesne Ph.D., Edith

    2009-01-01

    SUBCONTRACT #6836278 Pulling of 3 mm diameter AlSb rods by1 cm long, and at least 3 mm in diameter. provided by LBNL.l Crucible Power/T° Speed (mm/min) Seed Results Crucible

  16. Ab initio simulations of two-dimensional electronic spectra: The SOS//QM/MM approach

    E-Print Network [OSTI]

    Rivalta, I; Nenov, A; Cerullo, G; Mukamel, S; Garavelli, M; Garavelli, M

    2013-01-01

    working on hybrid QM/MM molecular dynamics simulations. InElectronic Spectra: The SOS//QM/MM Approach Ivan Rivalta,* [molecular mechanics (QM/MM) scheme and the sum-over-states (

  17. Fabrication and Test of TQS01 - a 90 mm Nb3Sn Quadrupole Magnet for LARP

    E-Print Network [OSTI]

    Dietderich, D.

    2008-01-01

    and Test of TQS01 – a 90 mm Nb 3 Sn Quadrupole Magnet forTQS and TQC) with a 90-mm aperture are being constructed atStructure for an LHC 90 mm Nb 3 Sn quadrupole magnet”, IEEE

  18. Atherosclerotic Plaque Characterization by 0.5-mm-Slice Multislice Computed Tomographic Imaging

    E-Print Network [OSTI]

    2007-01-01

    PIaque Characterization by O.5-mm- SIice Multislice ComputedIt has been proposed that O.5-mm-slice multislice computedperformed to compare the O.5-mm-slice ultrasound findings.

  19. DESIGN AND CONSTRUCTION OF A 15 T, 120 MM BORE IR QUADRUPOLE MAGNET FOR LARP

    E-Print Network [OSTI]

    Caspi, S.

    2011-01-01

    is developing a large bore (120 mm) IR quadrupole ( H Q )quadrupole ( H Q ) that extends the bore size from 90 mm to120 mm and pushes the field at the conductor just over 15 T.

  20. MECHANICAL TEST RESULTS ON DIPOLE MODEL C-l 25 mm ALUMINUM COLLARS

    E-Print Network [OSTI]

    Peters, C.

    2010-01-01

    RESULTS ON DIPOLE MODEL C-1 25 mm ALUMINUM COLLARS C. PetersRESULTS ON DIPOLE MODEL C-I 25 mm ALUMINUM COLLARS· CraigON DIPOLE MODEL C-I 25 mm ALUMINUM COLLARS Craig Peters

  1. High-efficiency 5000 lines/mm multilayer-coated blazed grating for EUV wavelengths

    E-Print Network [OSTI]

    Voronov, Dmitriy

    2010-01-01

    High-efficiency 5000 lines/mm multilayer-coated blazedthat show, for a 5000 l/mm grating diffracting in the 3 rdof 12.5 nm with a 1000 groove/mm grating [7]. A denser 2400

  2. A multisensor system for detection and characterization of UXO (MM-0437) - Demonstration Report

    E-Print Network [OSTI]

    Gasperikova, Erika; Smith, J.T.; Morrison, H.F.; Becker, A.

    2006-01-01

    AND CHARACTERIZATION OF UXO MM-0437 SITE LOCATION: U.S. ARMYwas designed to detect and characterize UXO in the 20 mm to155 mm size range for depths between 0 and 1 m. The

  3. Fabrication and Test of TQS01 -- a 90 mm Nb3Sn Quadrupole Magnet for LARP

    E-Print Network [OSTI]

    Caspi, S.

    2008-01-01

    and Test of TQS01 – a 90 mm Nb 3 Sn Quadrupole Magnet forTQS and TQC) with a 90-mm aperture are being constructed atStructure for an LHC 90 mm Nb 3 Sn quadrupole magnet”, IEEE

  4. A Multisensor system for the detection and characterization of UXO MM-0437

    E-Print Network [OSTI]

    Gasperikova, Erika; Becker, A.; Morrison, H.F.; Smith, J.T.

    2006-01-01

    AND CHARACTERIZATION OF UXO MM-0437 SITE LOCATION: U.S. ARMYwas designed to detect and characterize UXO in the 20 mm to155 mm size range for depths between 0 and 1 m. The

  5. Design of HD2: a 15 T Nb3Sn dipole with a 35 mm bore

    E-Print Network [OSTI]

    Sabbi, G.

    2009-01-01

    a 15 Tesla Nb 3 Sn Dipole with a 35 mm Bore G. Sabbi, S.E.dipole field above 15 T, a 35 mm bore, and nominal fieldstainless steel tube, providing a 35 mm diameter clear bore.

  6. Solar ALMA: Observation-Based Simulations of the mm and sub-mm Emissions from Active Regions

    E-Print Network [OSTI]

    Fleishman, Gregory; Nita, Gelu

    2015-01-01

    We developed an efficient algorithm integrated in our 3D modeling tool, GX Simulator (Nita et al. 2015), allowing quick computation of the synthetic intensity and polarization maps of solar active regions (AR) in the ALMA spectral range. The algorithm analyzes the photospheric input (white light and magnetogram) to classify a given photospheric pixel to belong to a given photospheric structure. Then, a 1D chromospheric model (Fontenla et al. 2009) is added on top of each pixel, which forms a chromospheric model of the AR. Next step is computation of the mm and sub-mm emission produced from this chromosphere model. A huge advantage of this approach is that emission from any given AR can be synthesized very fast, on the order of a few minutes after the AR selection. Using the GX Simulator tool it is also possible to produce synthetic maps of the microwave (gyroresonance) and EUV emission from the same AR model and compare them with the ALMA synthetic maps and with the corresponding observed microwave and/or EUV...

  7. Length: 4-15 mm Larvae (maggots): Creamy-white to green or

    E-Print Network [OSTI]

    Isaacs, Rufus

    Hover fly Syrphidae Length: 4-15 mm Larvae (maggots): Creamy-white to green or brown. Worm flies" or "flower flies"). Eggs: Small (1 mm in length). Cylindrical, white and laid singly on leaves or shoots near aphid colonies. 15 mm4 mm #12;Pupae: Green, tan or brown. Typically pear- shaped with a pair

  8. Oct. 12, 2005 QM/MM: What have we learned, where are we, and where

    E-Print Network [OSTI]

    Truhlar, Donald G

    1 Oct. 12, 2005 QM/MM: What have we learned, where are we, and where do we go from here? Hai Lin1/molecular mechanical (QM/MM) calculations, including their advantages and disadvantages. There is a special emphasis tests of QM/MM methods and summarize what we learn about QM/MM from these studies. We also discuss some

  9. Steering with Eyes Closed: mm-Wave Beam Steering without In-Band Measurement

    E-Print Network [OSTI]

    Knightly, Edward W.

    Steering with Eyes Closed: mm-Wave Beam Steering without In-Band Measurement Thomas Nitsche that removes in-band overhead for directional mm-Wave link establishment. Our sys- tem architecture couples mm-Wave and legacy 2.4/5 GHz bands using out-of-band direction inference to establish (overhead-free) multi-Gbps mm

  10. SSC 50 mm dipole magnet cryostat thermal measurement results

    SciTech Connect (OSTI)

    Boroski, W.N.; Nicol, T.H.; Ruschman, M.K.; Schoo, C.J.

    1993-05-01

    A prototype Superconducting Super Collider (SSC) 50 mm dipole magnet cryostat, DCA323, was instrumented at Fermilab and delivered to the SSC Laboratory for installation into the accelerator systems string test facility. In series with other magnets, the instrumented cryostat will be used to quantify and verify cryostat thermal performance with respect to design requirements. Prior to leaving Fermilab, DCA323 was subjected to magnetic testing at the Magnet Test Facility (MTF). This presented an opportunity to obtain preliminary thermal performance data under simulated operating conditions. It should be noted that measurements of overall cryostat thermal performance were not possible during the MTF measurements as the magnet test stands are designed for magnetic rather than thermal testing. They are not designed to limit heat inleak to the ends of the cryostat, which has been shown to have a significant effect on overall measured thermal performance. Nonetheless, these measurements do offer insight into the performance of several of the cryostat components and sub-systems.

  11. Elsevier AMS Ch19-N53138 Job code: CPC 5-2-2007 4:45p.m. Page:441 Trimsize:165240MM Basal Fonts:Times Margins:Top:13MM Gutter:20MM Font Size:10/12pt Text Width:125MM Depth:47 Lines

    E-Print Network [OSTI]

    Jones, William D.

    .m. Page:441 Trimsize:165×240MM Basal Fonts:Times Margins:Top:13MM Gutter:20MM Font Size:10/12pt Text Width:125MM Depth:47 Lines CHAPTER 19 Perspective and prospects for pincer ligand chemistry William D. Jones 45 46 47 Elsevier AMS Ch19-N53138 Job code: CPC 5-2-2007 4:45p.m. Page:442 Trimsize:165×240MM Basal

  12. MM + MSE Student Initiated Dual Degree Information Pg. 1 of 4 Master of Management (Ross School of Business)

    E-Print Network [OSTI]

    Awtar, Shorya

    MM + MSE Student Initiated Dual Degree Information Pg. 1 of 4 Master of Management (Ross School Normal MM Program Requirements 24.75cr MM Business Core + 6cr MM Business Electives = 30.75cr MM Core(s): 6 Credits + #12;MM + MSE Student Initiated Dual Degree Information Pg. 2 of 4 MM Boot Camp

  13. Aridity and vegetation composition are important determinants of leaf-wax dD values in southeastern Mexico and Central America

    E-Print Network [OSTI]

    Aridity and vegetation composition are important determinants of leaf-wax dD values in southeastern September 2012 Abstract Leaf-wax hydrogen isotope composition (dDwax) is increasingly applied as a proxy remain poorly understood. We measured dDwax and the stable carbon isotope composition of leaf-waxes (d13

  14. PPPL-3207, Preprint: October 1996, UC-420, 421, 423, 426 Core V and Ti Profiles and Transport in TFTR DD and DT

    E-Print Network [OSTI]

    interactions relative to performance of advanced tokamaks. The effects of lithium on plasma performance were with lithium (Li) conditioned graphite walls in TFTR. Values of E > 300 ms have been obtained with neutron-degassed and conditioned walls. Here DD means neutral beam injection heating (NBI) using Do beams into D+ plasma and DT

  15. A method for in situ absolute DD yield calibration of neutron time-of-flight detectors on OMEGA using CR-39-based proton detectors

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Waugh, C. J.; Rosenberg, M. J.; Zylstra, A. B.; Frenje, J. A.; Seguin, F. H.; Petrasso, R. D.; Glebov, V. Yu.; Sangster, T. C.; Stoeckl, C.

    2015-05-27

    Neutron time of flight (nTOF) detectors are used routinely to measure the absolute DD neutron yield at OMEGA. To check the DD yield calibration of these detectors, originally calibrated using indium activation systems, which in turn were cross-calibrated to NOVA nTOF detectors in the early 1990s, a direct in situ calibration method using CR-39 range filter proton detectors has been successfully developed. By measuring DD neutron and proton yields from a series of exploding pusher implosions at OMEGA, a yield calibration coefficient of 1.09 ± 0.02 (relative to the previous coefficient) was determined for the 3m nTOF detector. In addition,more »comparison of these and other shots indicates that significant reduction in charged particle flux anisotropies is achieved when bang time occurs significantly (on the order of 500 ps) after the trailing edge of the laser pulse. This is an important observation as the main source of the yield calibration error is due to particle anisotropies caused by field effects. The results indicate that the CR-39-nTOF in situ calibration method can serve as a valuable technique for calibrating and reducing the uncertainty in the DD absolute yield calibration of nTOF detector systems on OMEGA, the National Ignition Facility, and laser megajoule.« less

  16. Data:Eac1dd3a-0268-4e5c-b1d1-ed9feeb2a12a | Open Energy Information

    Open Energy Info (EERE)

    Eac1dd3a-0268-4e5c-b1d1-ed9feeb2a12a No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading......

  17. A method for in situ absolute DD yield calibration of neutron time-of-flight detectors on OMEGA using CR-39-based proton detectors

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Waugh, C. J.; Rosenberg, M. J.; Zylstra, A. B.; Frenje, J. A.; Seguin, F. H.; Petrasso, R. D.; Glebov, V. Yu.; Sangster, T. C.; Stoeckl, C.

    2015-05-01

    Neutron time of flight (nTOF) detectors are used routinely to measure the absolute DD neutron yield at OMEGA. To check the DD yield calibration of these detectors, originally calibrated using indium activation systems, which in turn were cross-calibrated to NOVA nTOF detectors in the early 1990s, a direct in situ calibration method using CR-39 range filter proton detectors has been successfully developed. By measuring DD neutron and proton yields from a series of exploding pusher implosions at OMEGA, a yield calibration coefficient of 1.09 ± 0.02 (relative to the previous coefficient) was determined for the 3m nTOF detector. In addition,more »comparison of these and other shots indicates that significant reduction in charged particle flux anisotropies is achieved when bang time occurs significantly (on the order of 500 ps) after the trailing edge of the laser pulse. This is an important observation as the main source of the yield calibration error is due to particle anisotropies caused by field effects. The results indicate that the CR-39-nTOF in situ calibration method can serve as a valuable technique for calibrating and reducing the uncertainty in the DD absolute yield calibration of nTOF detector systems on OMEGA, the National Ignition Facility, and laser megajoule.« less

  18. Novel Photo-Aligned Twisted Nematic Liquid Crystal Cell D.D. Huang, V.M. Kozenkov, V.G. Chigrinov, H.S. Kwok

    E-Print Network [OSTI]

    Novel Photo-Aligned Twisted Nematic Liquid Crystal Cell D.D. Huang, V.M. Kozenkov, V.G. Chigrinov Novel photo-aligned twisted nematic liquid crystal (LC) cell based on one- step illumination azo-dye layer in comparison with the upper one. Thus the photo-alignment of azo-dye layer

  19. A method for in situ absolute DD yield calibration of neutron time-of-flight detectors on OMEGA using CR-39-based proton detectors

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Waugh, C. J. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States).; Rosenberg, M. J. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States).; Zylstra, A. B. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States).; Frenje, J. A. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States).; Seguin, F. H. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States).; Petrasso, R. D. [MIT (Massachusetts Inst. of Technology), Cambridge, MA (United States).; Glebov, V. Yu. [Lab. for Laser Energetics, Rochester, NY (United States); Sangster, T. C. [Lab. for Laser Energetics, Rochester, NY (United States); Stoeckl, C. [Lab. for Laser Energetics, Rochester, NY (United States)

    2015-05-01

    Neutron time of flight (nTOF) detectors are used routinely to measure the absolute DD neutron yield at OMEGA. To check the DD yield calibration of these detectors, originally calibrated using indium activation systems, which in turn were cross-calibrated to NOVA nTOF detectors in the early 1990s, a direct in situ calibration method using CR-39 range filter proton detectors has been successfully developed. By measuring DD neutron and proton yields from a series of exploding pusher implosions at OMEGA, a yield calibration coefficient of 1.09 ± 0.02 (relative to the previous coefficient) was determined for the 3m nTOF detector. In addition, comparison of these and other shots indicates that significant reduction in charged particle flux anisotropies is achieved when bang time occurs significantly (on the order of 500 ps) after the trailing edge of the laser pulse. This is an important observation as the main source of the yield calibration error is due to particle anisotropies caused by field effects. The results indicate that the CR-39-nTOF in situ calibration method can serve as a valuable technique for calibrating and reducing the uncertainty in the DD absolute yield calibration of nTOF detector systems on OMEGA, the National Ignition Facility, and laser megajoule.

  20. Vapor deposition of platinum alloyed nickel aluminide coatings Z. Yu , K.P. Dharmasena, D.D. Hass, H.N.G. Wadley

    E-Print Network [OSTI]

    Wadley, Haydn

    for the thermal and oxidation protection of high temperature components used in advanced gas turbine and dieselVapor deposition of platinum alloyed nickel aluminide coatings Z. Yu , K.P. Dharmasena, D.D. Hass, H.N.G. Wadley Department of Materials Science and Engineering University of Virginia Charlottesville

  1. Flow of wet powder in a conical centrifugal filter--an analytical model A.F.M. Bizard, D.D. Symons n

    E-Print Network [OSTI]

    Symons, Digby

    Flow of wet powder in a conical centrifugal filter--an analytical model A.F.M. Bizard, D.D. Symons 14 August 2011 Available online 25 August 2011 Keywords: Centrifugation Filtration Laminar flow the wall of the cone along a generator under centrifugal force, which also forces the fluid out of the cone

  2. Evidence for Low-Intensity D-D Reaction as a Result of Exothermic Deuterium Desorption from Au/Pd/PdO:D Heterostructure

    SciTech Connect (OSTI)

    Lipson, A.G.; Lyakhov, B.F.; Roussetski, A.S.; Akimoto, T.; Mizuno, T.; Asami, N.; Shimada, R.; Miyashita, S.; Takahashi, A.

    2000-09-15

    Low-intensity nuclear emissions (neutrons and charged particles) due to exothermic deuterium desorption from Au/Pd/PdO heterostructure loaded with deuterium by electrolysis have been studied by NE213 neutron detection as well as SSB and CR-39 charged-particle detectors in low-background conditions with large statistics. Similar measurements were performed with the Au/Pd/PdO:H heterostructure as a control. It has been established that in experiments with the Au/Pd/PdO:D system, the excessive 2.45-MeV neutrons and 3.0-MeV protons are better detected than with the Au/Pd/PdO:H system, where those detection rates for n and p did not exceed the cosmic background level. The levels of neutron and proton emissions for 40- to 60-{mu}m-thick samples are found to be close to one another and after subtracting background (Au/Pd/PdO:H count rate) consist of I{sub n} = (19 {+-} 2).10{sup -3} n/s and I{sub p} (4.0 {+-} 1.0).10{sup -3} p/s in a 4{pi} solid angle, respectively. These yields of D-D reaction products in Au/Pd/PdO heterostructure comply with the mean D-D reaction rate of {lambda}{sub dd} {approx} 10{sup -23}s{sup -1} per D-D pair.

  3. GPS interseismic periods interseismic slip rate deficit 23.6 mm/yr 294

    E-Print Network [OSTI]

    Chen, Wen-Shan

    interseismic slip rate deficit 23.6 mm/yr 294° 21.6-27.7 mm/y lock 8-12 700 0.65 3.4 26.4 mm/yr 285 Kuochen et al., 2004 40 km1991-2002ML3 19831992 2000 1983 1974 16-23°30 mm/yrChen et al., 199119141979 Biq, 198411° Yu et al., 199028.5±3.0mm/yr 353-1°2004-2006GPS 30°19.3 mm/yr 300° 1954 #12

  4. Sub-mm Jet Properties of the X-Ray Binary Swift J1745$-$26

    E-Print Network [OSTI]

    Tetarenko, A J; Miller-Jones, J C A; Curran, P A; Russell, T D; Coulson, I M; Heinz, S; Maitra, D; Markoff, S B; Migliari, S; Petitpas, G R; Rupen, M P; Rushton, A P; Russell, D M; Sarazin, C L

    2015-01-01

    We present the results of our observations of the early stages of the 2012--2013 outburst of the transient black hole X-ray binary (BHXRB), Swift J1745$-$26, with the VLA, SMA, and JCMT (SCUBA--2). Our data mark the first multiple-band mm & sub-mm observations of a BHXRB. During our observations the system was in the hard accretion state producing a steady, compact jet. The unique combination of radio and mm/sub-mm data allows us to directly measure the spectral indices in and between the radio and mm/sub-mm regimes, including the first mm/sub-mm spectral index measured for a BHXRB. Spectral fitting revealed that both the mm (230 GHz) and sub-mm (350 GHz) measurements are consistent with extrapolations of an inverted power-law from contemporaneous radio data (1--30 GHz). This indicates that, as standard jet models predict, a power-law extending up to mm/sub-mm frequencies can adequately describe the spectrum, and suggests that the mechanism driving spectral inversion could be responsible for the high mm/s...

  5. National Conference on Mechanisms and Machines (NaCoMM07), IISc, Bangalore, India, December 12-13, 2007 NaCoMM-2007-60

    E-Print Network [OSTI]

    Saha, Subir Kumar

    ). Rotational input is provided to the crankshaft of the machine by a flexible coupling connected to an electric13th National Conference on Mechanisms and Machines (NaCoMM07), IISc, Bangalore, India, December 12-13, 2007 NaCoMM-2007-60 Synthesis and Analysis of a New Mechanism for Sheep Shearing Machine Vineet

  6. Heat Transfer -2 A pure platinum wire with diameter D = 3 mm and length L = 20 mm is placed outside on a day when air temperature

    E-Print Network [OSTI]

    Virginia Tech

    Heat Transfer - 2 A pure platinum wire with diameter D = 3 mm and length L = 20 mm is placed outside on a day when air temperature T = 10o C. The heat transfer coefficient at the wire's surface h equation that includes all heat transfer mechanisms involved in this problem. Write this energy balance

  7. A Polarizable QM/MM Explicit Solvent Model for Computational Electrochemistry in Water

    E-Print Network [OSTI]

    Wang, Lee-Ping

    We present a quantum mechanical/molecular mechanical (QM/MM) explicit solvent model for the computation of standard reduction potentials E[subscript 0]. The QM/MM model uses density functional theory (DFT) to model the ...

  8. Ultraviolet Spectroscopy of Protein Backbone Transitions in Aqueous Solution: Combined QM and MM Simulations

    E-Print Network [OSTI]

    Mukamel, Shaul

    Ultraviolet Spectroscopy of Protein Backbone Transitions in Aqueous Solution: Combined QM and MM (MM) calculations is developed to simulate the n f * and f * backbone transitions of proteins using a new algorithm, EHEF, which combines a molecular dynamics (MD) trajectory obtained with a MM

  9. Design of HD2: a 15 T Nb3Sn dipole with a 35 mm bore

    E-Print Network [OSTI]

    Sabbi, G.

    2009-01-01

    Nb 3 Sn Dipole with a 35 mm Bore G. Sabbi, S.E. Bartlett, S.T Copper current density kA/ mm 2 Inductance mH/m Storedminimum winding radius of 12.5 mm. There are 28 turns in the

  10. Geometry Optimization with QM/MM, ONIOM, and Other Combined Methods. I. Microiterations

    E-Print Network [OSTI]

    Schlegel, H. Bernhard

    Geometry Optimization with QM/MM, ONIOM, and Other Combined Methods. I. Microiterations Abstract: Hybrid energy methods such as QM/MM and ONIOM, that combine different levels of theory into one of theory and the larger, remaining region treated by an inexpensive method such as molecular mechanics (MM

  11. DESIGN AND PERFORMANCE OF 40 mm, 6.5 T, COLLARED, COLD-IRON MODEL MAGNETS

    E-Print Network [OSTI]

    Peters, C.

    2010-01-01

    DESIGN AND PERFORMANCE OF 40 MM, 6.5 T, COLLARED, COLD-IRONAND P,E RFORMANCE OF 40 MM, 6.5 T, COLLARED, COLD-IRON MODELmagnet winding is 1.574 inches (40 mm), which is the same as

  12. Breakdown of 2mm symmetry in electron diffraction from multiwalled carbon nanotubes

    E-Print Network [OSTI]

    Qin, Lu-Chang

    Breakdown of 2mm symmetry in electron diffraction from multiwalled carbon nanotubes Zejian Liu of single-walled carbon nanotubes always have 2mm symmetry regardless if the nanotubes them- selves have such symmetry. We here show that, for the case of multiwalled carbon nanotubes, the 2mm symmetry can break down

  13. HEAT TRANSFER THROUGH He II IN A 9.6 m LONG 35 mm ID TUBE

    E-Print Network [OSTI]

    Caspi, S.

    2010-01-01

    He II IN A 9.6 m LONG 35 mm ID TUBE S. Caspi and R.V.He II IN A 9.6 m LONG 35 mm ID TUBE* S. Caspi and R. V.He II IN A 9.6 m LONG 35 mm 10 TUBE S. Caspi and R. V.

  14. The 69-mm forsterite band as a dust temperature indicator J. E. Bowey,1P

    E-Print Network [OSTI]

    Bowey, Janet

    The 69-mm forsterite band as a dust temperature indicator J. E. Bowey,1P M. J. Barlow,1 F. J) occurs at 69.67 mm at room temperature (295 K); for olivines with *10 per cent Fe the corresponding feature is at *73 mm. The Mg-rich forsterite feature is observed in a variety of ISO LWS spectra

  15. A 10,000 groove/mm multilayer coated grating for EUV spectroscopy

    E-Print Network [OSTI]

    Voronov, Dmytro

    2011-01-01

    a groove density of 5000 lines/mm using a process based ongroove density of 10,000 lines/mm, and coated it with an Al/groove density of 10,000 lines/mm (a); 3D AFM images of the

  16. MM5 Contrail Forecasting in Alaska Martin Stuefer, Xiande Meng and Gerd Wendler

    E-Print Network [OSTI]

    Stuefer, Martin

    MM5 Contrail Forecasting in Alaska Martin Stuefer, Xiande Meng and Gerd Wendler Geophysical Institute, University of Alaska, Fairbanks 1. Abstract Fifth-generation mesoscale model (MM5) is being used air. Algorithm input data are MM5 forecasted temperature and humidity values at defined pressure

  17. Fragment-Based QM/MM Method for Modeling Molecular Crystals and Clusters

    E-Print Network [OSTI]

    Nanda, Kaushik

    2013-01-01

    of Molecular Crystals With a Fragment-Based QM/MM Method 5.1Theory: A Fragment-Based QM/MM Study 6.1 Outline . . . . .off from the QM PES to the MM PES due to the spatial damping

  18. Measurements of the Cosmic Background Radiation Temperature at 3.3 and 9.1 MM

    E-Print Network [OSTI]

    Witebsky, C.; De Amici, G.; Smoot, G.F.; Friedman, S.D.

    1983-01-01

    TEMPERATURE- AT 3.3 AND 9.1 MM C. Witebsky, G. De Amici, andTEMPERATURE AT 3.3 AND 9.1 MM Chris Witebsky, Giovanni Decharacteristics of the 3.3 and 9.1 mm radiometers Wavelength

  19. HEAT TRANSFER THROUGH He II IN A 9.6 m LONG 35 mm ID TUBE

    E-Print Network [OSTI]

    Caspi, S.

    2010-01-01

    THROUGH He II IN A 9.6 m LONG 35 mm ID TUBE S. Caspi andTHROUGH He II IN A 9.6 m LONG 35 mm ID TUBE* S. Caspi and R.THROUGH He II IN A 9.6 m LONG 35 mm 10 TUBE S. Caspi and R.

  20. A compact proton spectrometer for measurement of the absolute DD proton spectrum from which yield and ?R are determined in thin-shell inertial-confinement-fusion implosions

    SciTech Connect (OSTI)

    Rosenberg, M. J., E-mail: mrosenbe@mit.edu; Zylstra, A. B.; Frenje, J. A.; Rinderknecht, H. G.; Gatu Johnson, M.; Waugh, C. J.; Séguin, F. H.; Sio, H.; Sinenian, N.; Li, C. K.; Petrasso, R. D. [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Glebov, V. Yu.; Hohenberger, M.; Stoeckl, C.; Sangster, T. C. [Laboratory for Laser Energetics, University of Rochester, Rochester, New York 14623 (United States); Yeamans, C. B.; LePape, S.; Mackinnon, A. J.; Bionta, R. M.; Talison, B. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); and others

    2014-10-01

    A compact, step range filter proton spectrometer has been developed for the measurement of the absolute DD proton spectrum, from which yield and areal density (?R) are inferred for deuterium-filled thin-shell inertial confinement fusion implosions. This spectrometer, which is based on tantalum step-range filters, is sensitive to protons in the energy range 1-9 MeV and can be used to measure proton spectra at mean energies of ~1-3 MeV. It has been developed and implemented using a linear accelerator and applied to experiments at the OMEGA laser facility and the National Ignition Facility (NIF). Modeling of the proton slowing in the filters is necessary to construct the spectrum, and the yield and energy uncertainties are ±<10% in yield and ±120 keV, respectively. This spectrometer can be used for in situ calibration of DD-neutron yield diagnostics at the NIF.

  1. Search for $\\eta$-mesic helium via $dd\\to {}^3{\\rm He}\\,n\\pi^0$ reaction by means of the WASA-at-COSY facility

    E-Print Network [OSTI]

    Skurzok, Magdalena

    2015-01-01

    In November 2010, we performed a search for a $^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta$ bound state by measuring the excitation function for the $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ and $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} p \\pi{}^{-}$ reactions in the vicinity of the $\\eta$ production threshold with the WASA detector.~The experiment was carried out using a deuteron COSY beam and deuteron pellet target. The beam momentum varied continuously in each of acceleration cycle from 2.127 GeV/c to 2.422 GeV/c, which corresponds to a range of excess energy $Q$ $\\in$(-70,30)MeV. This dissertation is about the search for $^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta$ bound state in $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ reaction. The excitation function for the process was determined after identification of all outgoing particles and the application of the selection conditions based on Monte Carlo simulations of $\\eta$-mesic helium production and its decay via excitation of the...

  2. Supporting Information for Mixed Quantum Mechanical/Molecular Mechanical (QM/MM) Study

    E-Print Network [OSTI]

    Gherman, Benjamin F.

    S1 Supporting Information for Mixed Quantum Mechanical/Molecular Mechanical (QM/MM) Study geometries for the QM/MM-optimized R61 acyl-enzyme intermediate protonation/hydrogen bond configurations-blue, O-red, H-gray, S-yellow. (1) (2a) #12;S3 (3) #12;S4 Figure S2. Active site geometries for the QM/MM

  3. THE CREATIVE APPLICATION OF SCIENCE TECHNOLOGY & WORK FORCE INNOVATIONS TO THE D&D OF PLUTONIUM FINISHING PLANT (PFP) AT THE HANFORD NUCLEAR RESERVATION

    SciTech Connect (OSTI)

    CHARBONEAU, S.L.

    2006-02-01

    The Plutonium Finishing Plant (PFP) consists of a number of process and support buildings for handling plutonium. Building construction began in the late 1940's to meet national priorities and became operational in 1950 producing refined plutonium salts and metal for the United States nuclear weapons program. The primary mission of the PFP was to provide plutonium used as special nuclear material for fabrication into a nuclear device for the war effort. Subsequent to the end of World War II, the PFP's mission expanded to support the Cold War effort through plutonium production during the nuclear arms race. PFP has now completed its mission and is fully engaged in deactivation, decontamination and decommissioning (D&D). At this time the PFP buildings are planned to be reduced to ground level (slab-on-grade) and the site remediated to satisfy national, Department of Energy (DOE) and Washington state requirements. The D&D of a highly contaminated plutonium processing facility presents a plethora of challenges. PFP personnel approached the D&D mission with a can-do attitude. They went into D&D knowing they were facing a lot of challenges and unknowns. There were concerns about the configuration control associated with drawings of these old process facilities. There were unknowns regarding the location of electrical lines and process piping containing chemical residues such as strong acids and caustics. The gloveboxes were highly contaminated with plutonium and chemical residues. Most of the glovebox windows were opaque with splashed process chemicals that coated the windows or etched them, reducing visibility to near zero. Visibility into the glovebox was a serious worker concern. Additionally, all the gloves in the gloveboxes were degraded and unusable. Replacing gloves in gloveboxes was necessary to even begin glovebox cleanout. The sheer volume of breathing air needed was also an issue. These and other challenges and PFP's approach to overcome these challengers are described. Many of the challenges to the D&D work at PFP were met with innovative approaches based on new science and/or technology and many were also based on the creativity and motivation of the work force personnel.

  4. QM/MM methods for crystalline defects. Part 2: Consistent energy and force-mixing

    E-Print Network [OSTI]

    Chen, Huajie

    2015-01-01

    QM/MM hybrid methods employ accurate quantum (QM) models only in regions of interest (defects) and switch to computationally cheaper interatomic potential (MM) models to describe the crystalline bulk. We develop two QM/MM hybrid methods for crystalline defect simulations, an energy-based and a force-based formulation, employing a tight binding QM model. Both methods build on two principles: (i) locality of the QM model; and (ii) constructing the MM model as an explicit and controllable approximation of the QM model. This approach enables us to establish explicit convergence rates in terms of the size of QM region.

  5. Observed Multi-Decade DD and DT Z-Pinch Fusion Rate Scaling in 5 Dense Plasma Focus Fusion Machines

    SciTech Connect (OSTI)

    Hagen, E. C. [National Security Technologies, LLC; Lowe, D. R. [National Security Technologies, LLC; O'Brien, R. [University of Nevada, Las Vegas; Meehan, B. T. [National Security Technologies, LLC

    2013-06-18

    Dense Plasma Focus (DPF) machines are in use worldwide or a wide variety of applications; one of these is to produce intense, short bursts of fusion via r-Z pinch heating and compression of a working gas. We have designed and constructed a series of these, ranging from portable to a maximum energy storage capacity of 2 MJ. Fusion rates from 5 DPF pulsed fusion generators have been measured in a single laboratory using calibrated activation detectors. Measured rates range from ~ 1015 to more than 1019 fusions per second have been measured. Fusion rates from the intense short (20 – 50 ns) periods of production were inferred from measurement of neutron production using both calibrated activation detectors and scintillator-PMT neutron time of flight (NTOF) detectors. The NTOF detectors are arranged to measure neutrons versus time over flight paths of 30 Meters. Fusion rate scaling versus energy and current will be discussed. Data showing observed fusion cutoff at D-D fusion yield levels of approximately 1?1012, and corresponding tube currents of ~ 3 MA will be shown. Energy asymmetry of product neutrons will also be discussed. Data from the NTOF lines of sight have been used to measure energy asymmetries of the fusion neutrons. From this, center of mass energies for the D(d,n)3He reaction are inferred. A novel re-entrant chamber that allows extremely high single pulse neutron doses (> 109 neutrons/cm2 in 50 ns) to be supplied to samples will be described. Machine characteristics and detector types will be discussed.

  6. Progresses in Ab Initio QM/MM Free Energy Simulations of Electrostatic Energies in Proteins: Accelerated QM/MM Studies of pKa, Redox Reactions and Solvation Free Energies

    E-Print Network [OSTI]

    Kamerlin, Shina C. L.

    2009-01-01

    J. ; Glennon, T. ; Warshel, A. QM/MM approaches for studyingProgresses in Ab Initio QM/MM Free Energy Simulations ofin Proteins: Accelerated QM/MM Studies of pK a , Redox

  7. Fabrication and characterization of a 0.5-mm lutetium oxyorthosilicate detector array for high-resolution PET applications

    E-Print Network [OSTI]

    Stickel, Jennifer R; Qi, Jinyi; Cherry, Simon R

    2007-01-01

    2006;51:2131–2142. 0.5- MM LSO A RRAY FOR PET • Stickel etand Characterization of a 0.5-mm Lutetium Oxyorthosilicatelicate (LSO) arrays with 0.5-mm pixels was coupled to

  8. MM versus ML estimates of structural equation models with interaction terms: robustness to non-normality of the consistency property

    E-Print Network [OSTI]

    Mooijaart, Ab; Satorra, Albert

    2011-01-01

    of-?t summaries for the MM method degrees of freedom chi-regarding the robustness of the MM method to non-normality.MM versus ML estimates of structural equation models with

  9. Development of TQC01, a 90 mm Nb3 Sn Model Quadrupole for LHC Upgrade Based on SS Collar

    E-Print Network [OSTI]

    Bossert, R. C.

    2009-01-01

    Development of TQC01, a 90 mm Nb 3 Sn Model Quadrupole foriron yoke laminations and 12 mm thick stainless steel skinsby ap- proximately 10 MPa per mm of key depth. During the

  10. Water Management EC Kumbur and MM Mench, The Pennsylvania State University, University Park, PA, USA

    E-Print Network [OSTI]

    Mench, Matthew M.

    , and molten carbonate fuel cell have been, or continue to be, developed. However, ubiquitous integration a schematic of a typical PEMFC assembly. In a PEMFC, the electrolyte (15­180 mm thick) is a flexible polymer- ported on larger carbon particles (B45­90 mm diameter). The fuel (typically hydrogen (H2)) and oxidizer

  11. Mountain Lion 'MmJUN7-r946 WQDOS HOLE, MASS

    E-Print Network [OSTI]

    mm ^m' ''AzM. Mountain Lion 'MmJUN7-r946 WQDOS HOLE, MASS CIRCULAR 6 FISH AND WILDLIFE SERVICE U. S For sale by the Superintendent of Documents Washinston 25, D. C. : Price 5 cents #12;MOUNTAIN LION TRAPPING Service nPHE AMERICAN MOUNTAIN LION (Felis concolor) is one of J- the largest predatory animals

  12. Evaluation of Offshore Wind Simulations with MM5 in the Japanese and Danish Coastal Waters

    E-Print Network [OSTI]

    Heinemann, Detlev

    Evaluation of Offshore Wind Simulations with MM5 in the Japanese and Danish Coastal Waters Teruo to evaluate the accuracy of offshore wind simulation with the mesoscale model MM5, long-term simulations to simulate offshore wind conditions in the Japanese coastal waters even using a mesoscale model, compared

  13. Hybrid QM/MM Car-Parrinello Simulations of Catalytic and Enzymatic Reactions

    E-Print Network [OSTI]

    Guidoni, Leonardo

    1 Hybrid QM/MM Car-Parrinello Simulations of Catalytic and Enzymatic Reactions MariaCarola Colombo, we review some recent applications of hybrid Car-Parrinello simulations of chemical and biological recently developed a combination of these two techniques into a hybrid QM/MM Car-Parrinello scheme [4

  14. Chemical Vapor Deposition Growth of 5 mm Hexagonal Single-Crystal Graphene from Ethanol

    E-Print Network [OSTI]

    Maruyama, Shigeo

    Chemical Vapor Deposition Growth of 5 mm Hexagonal Single-Crystal Graphene from Ethanol Xiao Chen1 as large as 5 mm can be synthesized from ethanol via chemical vapor deposition (CVD). Key conditions for the successful reduction in nucleation density are extremely low partial pressure of ethanol vapor and pre

  15. Condensation heat transfer characteristics of R410A-oil mixture in 5 mm and 4 mm outside diameter horizontal microfin tubes

    SciTech Connect (OSTI)

    Huang, Xiangchao; Ding, Guoliang; Hu, Haitao; Zhu, Yu. [Institute of Refrigeration and Cryogenics, Shanghai Jiaotong University, Shanghai 200240 (China); Gao, Yifeng [International Copper Association Shanghai Office, Shanghai 200020 (China); Deng, Bin [Institute of Heat Transfer Technology, Golden Dragon Precise Copper Tube Group Inc., Shanghai 200135 (China)

    2010-10-15

    Condensation heat transfer characteristics of R410A-oil mixture in 5 mm and 4 mm outside diameter horizontal microfin tubes were investigated experimentally. The experimental condensing temperature is 40 C, and nominal oil concentration range is from 0% to 5%. The test results indicate that the presence of oil deteriorates the heat transfer. The deterioration effect is negligible at nominal oil concentration of 1%, and becomes obvious with the increase of nominal oil concentration. At 5% nominal oil concentration, the heat transfer coefficient of R410A-oil mixture is found to have a maximum reduction of 25.1% and 23.8% for 5 mm and 4 mm tubes, respectively. The predictabilities of the existing condensation heat transfer correlations were verified with the experimental data, and Yu and Koyama correlation shows the best predictability. By replacing the pure refrigerant properties with the mixture's properties, Yu and Koyama correlation has a deviation of -15% to + 20% in predicting the local condensation heat transfer coefficient of R410A-oil mixture. (author)

  16. Search for $?$-mesic helium via $dd\\to {}^3{\\rm He}\\,n?^0$ reaction by means of the WASA-at-COSY facility

    E-Print Network [OSTI]

    Magdalena Skurzok

    2015-09-09

    In November 2010, we performed a search for a $^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta$ bound state by measuring the excitation function for the $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ and $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} p \\pi{}^{-}$ reactions in the vicinity of the $\\eta$ production threshold with the WASA detector.~The experiment was carried out using a deuteron COSY beam and deuteron pellet target. The beam momentum varied continuously in each of acceleration cycle from 2.127 GeV/c to 2.422 GeV/c, which corresponds to a range of excess energy $Q$ $\\in$(-70,30)MeV. This dissertation is about the search for $^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta$ bound state in $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ reaction. The excitation function for the process was determined after identification of all outgoing particles and the application of the selection conditions based on Monte Carlo simulations of $\\eta$-mesic helium production and its decay via excitation of the $N^{*}$ resonance. No narrow structure of the $\\eta$-mesic helium was observed in the excitation function. The upper limit of the total cross section for the bound state formation and its decay in $dd\\rightarrow({}^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta)_{bound} \\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ process was determined on the 90% confidence level. It varies from 21 to 36 nb for the bound state width ranging from 5 MeV to 50 MeV, respectively. However, an indication for a broad state was observed. The kinematic region, where we expect the evidence of the signal from the bound state, cannot be fully described only by the combination of the considered background processes. In contrast, the experimental excitation function is very well fitted by the background contributions for the region where the signal is not expected.

  17. Search for $?$-mesic helium via $dd\\to {}^3{\\rm He}\\,n?^0$ reaction by means of the WASA-at-COSY facility

    E-Print Network [OSTI]

    Magdalena Skurzok

    2015-09-24

    In November 2010, we performed a search for a $^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta$ bound state by measuring the excitation function for the $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ and $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} p \\pi{}^{-}$ reactions in the vicinity of the $\\eta$ production threshold with the WASA detector.~The experiment was carried out using a deuteron COSY beam and deuteron pellet target. The beam momentum varied continuously in each of acceleration cycle from 2.127 GeV/c to 2.422 GeV/c, which corresponds to a range of excess energy $Q$ $\\in$(-70,30)MeV. This dissertation is about the search for $^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta$ bound state in $dd\\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ reaction. The excitation function for the process was determined after identification of all outgoing particles and the application of the selection conditions based on Monte Carlo simulations of $\\eta$-mesic helium production and its decay via excitation of the $N^{*}$ resonance. No narrow structure of the $\\eta$-mesic helium was observed in the excitation function. The upper limit of the total cross section for the bound state formation and its decay in $dd\\rightarrow({}^{4}\\hspace{-0.03cm}\\mbox{He}$-$\\eta)_{bound} \\rightarrow$ $^{3}\\hspace{-0.03cm}\\mbox{He} n \\pi{}^{0}$ process was determined on the 90% confidence level. It varies from 21 to 36 nb for the bound state width ranging from 5 MeV to 50 MeV, respectively. However, an indication for a broad state was observed. The kinematic region, where we expect the evidence of the signal from the bound state, cannot be fully described only by the combination of the considered background processes. In contrast, the experimental excitation function is very well fitted by the background contributions for the region where the signal is not expected.

  18. Convergence in the QM-Only and QM/MM Modeling of Enzymatic Reactions: A Case Study for Acetylene

    E-Print Network [OSTI]

    Liao, Rongzhen

    Convergence in the QM-Only and QM/MM Modeling of Enzymatic Reactions: A Case Study for Acetylene/molecular mechanics (MM) calculations on an enzyme- catalyzed reaction to assess the convergence behavior of QM- only and QM/MM energies with respect to the size of the cho- sen QM region. The QM and MM parts are described

  19. Comparison of QM-Only and QM/MM Models for the Mechanism of Tungsten-Dependent Acetylene Hydratase

    E-Print Network [OSTI]

    Liao, Rongzhen

    Comparison of QM-Only and QM/MM Models for the Mechanism of Tungsten-Dependent Acetylene Hydratase-only and QM/MM approaches for the modeling of enzymatic reactions. For this purpose, we present a QM/MM case of the previously suggested one-water attack mechanism. The QM/MM calculations with the minimal QM region M1 (32

  20. 1. The derivative of y = mm“ at x = 2. A bacteria culture starts with ...

    E-Print Network [OSTI]

    The derivative of y = mm“ at x = 2. A bacteria culture starts with 200 bacteria and grows at a rate proportional to its size. After 2 hours there were 400 bacteria.

  1. Simulating the high-redshift universe in the sub-mm

    E-Print Network [OSTI]

    Eelco van Kampen

    2003-10-10

    I present various simulations of an on-going large sub-mm survey, SHADES, showing how constraints can be put on galaxy formation models and cosmology from this survey.

  2. Artist's rendition of a 1.54 mm-emitting laser

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    Artist's rendition of a 1.54 mm-emitting laser made by solution- processing a colloidal quantum dot detectivity, represented by the symbol D*. Epitaxially grown InGaAs devices on an InP substrate achieve

  3. Power supply switching for a mm-wave asymmetric multilevel outphasing power amplifier system

    E-Print Network [OSTI]

    Spaulding, Jonathon David

    2010-01-01

    This thesis demonstrates power switches to be used in our new Asymmetric Multilevel Outphasing (AMO) transmitter architecture at mm-wave frequencies. The AMO topology breaks the linearity vs. efficiency design objective ...

  4. Can the supermassive objects at the centers of galaxies be traversable wormholes? The first test of strong gravity for mm/sub-mm VLBI facilities

    E-Print Network [OSTI]

    Cosimo Bambi

    2013-04-29

    The near future mm/sub-mm VLBI experiments are ambitious projects aiming at imaging the "shadow" of the supermassive black hole candidate at the center of the Milky Way and of the ones in nearby galaxies. An accurate observation of the shape of the shadow can potentially test the nature of these objects and verify if they are Kerr black holes, as predicted by general relativity. However, previous work on the subject has shown that the shadows produced in other spacetimes are very similar to the one of the Kerr background, suggesting that tests of strong gravity are not really possible with these facilities in the near future. In this work, I instead point out that it will be relatively easy to distinguish black holes from wormholes, topologically non-trivial structures of the spacetime that might have been formed in the early Universe and might connect our Universe with other universes.

  5. On the cross-correlation of sub-mm sources and optically-selected galaxies

    E-Print Network [OSTI]

    Chris Blake; Alexandra Pope; Douglas Scott; Bahram Mobasher

    2006-02-20

    Bright sub-mm galaxies are expected to arise in massive highly-biased haloes, and hence exhibit strong clustering. We argue that a valuable tool for measuring these clustering properties is the cross-correlation of sub-mm galaxies with faint optically-selected sources. We analyze populations of SCUBA-detected and optical galaxies in the GOODS-N survey area. Using optical/IR photometric-redshift information, we search for correlations induced by two separate effects: (1) cosmic magnification of background sub-mm sources by foreground dark matter haloes traced by optical galaxies at lower redshifts; and (2) galaxy clustering due to sub-mm and optical sources tracing the same population of haloes where their redshift distributions overlap. Regarding cosmic magnification, we find no detectable correlation. Our null result is consistent with a theoretical model for the cosmic magnification, and we show that a dramatic increase in the number of sub-mm sources will be required to measure the effect reliably. Regarding clustering, we find evidence at the 3.5-sigma level for a cross-correlation between sub-mm and optical galaxies analyzed in identical photometric redshift slices. The data hint that the sub-mm sources have an enhanced bias parameter compared to the optically-selected population (with a significance of 2-sigma). The next generation of deep sub-mm surveys can potentially perform an accurate measurement of each of these cross-correlations, adding a new set of diagnostics for understanding the development of massive structure in the Universe.

  6. Intel Corporation Intel IXP2400 Network Processor -

    E-Print Network [OSTI]

    Bhuyan, Laxmi N.

    DD RR SS DD RR AA MM QQ DD RR DDR SDRAM Packet Memory QDR SRAM Queues & Tables DDR SDRAM Packet DD RR DDR SDRAM Packet Memory QDR SRAM Queues & Tables DDR SDRAM Packet Memory QDR SRAM Queues

  7. The local sub-mm luminosity functions and predictions from ASTRO-F/SIRTF to Herschel

    E-Print Network [OSTI]

    Stephen Serjeant; Diana Harrison

    2003-09-23

    We present new determinations of the local sub-mm luminosity functions. We find the local sub-mm luminosity density converging to 7.3+/-0.2 x 10^19 W/Hz/Mpc^3 /h_65 at 850um solving the ``sub-mm Olbers' Paradox.'' Using the sub-mm colour temperature relations from the SCUBA Local Universe Galaxy Survey, and the discovery of excess 450um excess emission in these galaxies, we interpolate and extrapolate the IRAS detections to make predictions of the SEDs of all 15411 PSC-z galaxies from 50-3000um. Despite the long extrapolations we find excellent agreement with (a) the 90um luminosity function of Serjeant et al. (2001), (b) the 850um luminosity function of Dunne et al. (2000), (c) the mm-wave photometry of Andreani & Franceschini (1996); (d) the asymptotic differential and integral source count predictions at 50-3000um by Rowan-Robinson (2001). Remarkably, the local luminosity density and the extragalactic background light together strongly constrain the cosmic star formation history for a wide class of evolutionary assumptions. We find that the extragalactic background light, the 850um 8mJy source counts, and the Omega_* constraints all independently point to a decline in the comoving star formation rate at z>1.

  8. A spectral line survey in the 2 mm and 1.3 mm windows toward the carbon rich envelope of IRC +10216

    E-Print Network [OSTI]

    J. H. He; Dinh-V-Trung; S. Kwok; H. S. P. Mueller; Y. Zhang; T. Hasegawa; T. C. Peng; Y. C. Huang

    2008-04-14

    We present the results of our spectral line surveys in the 2 mm and 1.3 mm windows toward the carbon rich envelope of IRC +10216. Totally 377 lines are detected, among which 360 lines are assigned to 57 known molecules (including 29 rare isotopomers and 2 cyclic isomers). Only 17 weak lines remain unidentified. Rotational lines of isotopomers 13CCH and HN13C are detected for the first time in IRC +10216. The detection of the formaldehyde lines in this star is also confirmed. Possible abundance difference among the three 13C substituted isotopic isomers of HC3N is reported. Isotopic ratios of C and O are confirmed to be non-solar while those of S and Si to be nearly solar. Column densities have been estimated for 15 molecular species. Modified spectroscopic parameters have been calculated for NaCN, Na13CN, KCN and SiC2. Transition frequencies from the present observations were used to improve the spectroscopic parameters of Si13CC, 29SiC2 and 30SiC2.

  9. High Heat Flux Exposure Tests on 10mm Beryllium Tiles Brazed on Actively Cooled Vapotron made from CUCRZR

    E-Print Network [OSTI]

    High Heat Flux Exposure Tests on 10mm Beryllium Tiles Brazed on Actively Cooled Vapotron made from CUCRZR

  10. MM5 Aids Forecasters Over the past five years a group in the Atmospheric

    E-Print Network [OSTI]

    Doty, Sharon Lafferty

    Jaeglé's specialty is atmospheric chemistry. Her research deals with analysis and modelingMM5 Aids Forecasters Over the past five years a group in the Atmospheric Sciences department has around the region. (see Page 8) New Faculty Join Atmospheric Sciences In the past year, Atmospheric

  11. ENGINEER 2MM3 -Electrical Circuits & Power TERM 1, 2014/15

    E-Print Network [OSTI]

    Haykin, Simon

    Machinery Fundamentals, McGraw Hill, Fourth Edition, 2005. Reference Book: T. Wildi, Electrical machines of electric circuits, phasors 3. Transformers 4. AC generators and motors 5. Three-phase circuits 7. 3-phaseENGINEER 2MM3 - Electrical Circuits & Power TERM 1, 2014/15 Course Outline Instructor: Shiva

  12. Sub-mm imaging of a proto-cluster region at z=3.09

    E-Print Network [OSTI]

    S. C. Chapman; G. F. Lewis; D. Scott; E. Richards; C. Borys; C. C. Steidel; K. L. Adelberger; A. E. Shapley

    2000-10-04

    We have used the Submillimetre Common-User Bolometer Array (SCUBA) detector on the James Clerk Maxwell Telescope (JCMT) to measure bright sub-mm emission associated with a recently discovered extensive (>100/h kpc) and highly luminous, `blob' of Ly-alpha emission at z=3.09. The blob lies within a known large overdensity of optical sources in the z=3.07-3.11 range, and is centered on a locally overdense peak within this region. The best explanation for the copious sub-mm emission is a dust obscured continuum source, which may produce the ionizing flux for the Ly-alpha cloud. Cooling gas explanations are plausible but excessively complicated, and the 450/850 micron ratio rules out a significant fraction of the signal arising from the Sunyaev-Zel'dovich increment. At least two additional ~10 mJy sub-mm detections in the SCUBA map, with a surface density significantly higher than in blank field surveys, suggests that they may be associated with the z=3.09 structure. A SCUBA `photometry' observation of a second nearby Ly-alpha blob tentatively detects a weaker sub-mm counterpart.

  13. Interferometric detections of GOODS 850-5 at 1 mm and 1.4 GHz

    E-Print Network [OSTI]

    H. Dannerbauer; F. Walter; G. Morrison

    2007-12-19

    We have obtained a position (at sub-arcsecond accuracy) of the submillimeter bright source GOODS 850-5 (also known as GN10) in the GOODS North field using the IRAM Plateau de Bure interferometer at 1.25 mm wavelengths (MM J123633+6214.1, flux density: S(1.25 mm)=5.0+-1.0 mJy). This source has no optical counterpart in deep ACS imaging down to a limiting magnitude of i(775)=28.4 mag and its position is coincident with the position found in recent sub-millimeter mapping obtained at the SMA (Wang et al. 2007). Using deep VLA imaging at 20 cm, we find a radio source (S(20 cm)=32.7+-4.3 microJy) at the same position that is significantly brighter than reported in Wang et al. The source is detected by Spitzer in IRAC as well as at 24 microns. We apply different photometric redshift estimators using measurements of the dusty, mid/far-infrared part of the SED and derive a redshift z~4. Given our detection in the millimeter and radio we consider a significantly higher redshift (e.g., z~6 Wang et al. 2007) unlikely. MM J123633+6214.1 alias GOODS 850-5 nevertheless constitutes a bright representative of the high-redshift tail of the submillimeter galaxy population that may contribute a significant fraction to the (sub)millimeter background.

  14. Using 50-mm electrostatic membrane deformable mirror in astronomical adaptive optics

    E-Print Network [OSTI]

    Tokovinin, Andrei A.

    achievable modulation of the local radius of curvature of the mirror is ±25 m. Simulations of the AO system with 37 electrodes (hereafter DM-37) is used in the AO system at McMath-Pierce solar telescope2 telescope.4 A larger number of actuators is needed, so we select a DM with 79 electrodes and 50-mm membrane

  15. Press Advertising 39x3col (390mm x 3 cols)

    E-Print Network [OSTI]

    Press Advertising 39x3col (390mm x 3 cols) Total cost of ad Canberra Times $1,682.49 HES $4. 200 words Canberra Times $1,037.29 HES $2,785.00 STANDALONE Press advertising describes job advertisements in a printed medium such as newspapers, magazines and journals. We currently primarily advertised

  16. Formaldehyde around 3.5 and 5.7-mm: Measurement and calculation of broadening coefficients

    E-Print Network [OSTI]

    Gamache, Robert R.

    Formaldehyde around 3.5 and 5.7-mm: Measurement and calculation of broadening coefficients D February 2010 Keywords: Formaldehyde Broadening coefficients Widths H2CO Fourier transform spectroscopy has been generated to complete the whole HITRAN 2008 version of formaldehyde (available

  17. High-Resolution Regional Climate Simulations over Iceland Using Polar MM5* DAVID H. BROMWICH

    E-Print Network [OSTI]

    Howat, Ian M.

    High-Resolution Regional Climate Simulations over Iceland Using Polar MM5* DAVID H. BROMWICH Polar, Environmental and Food Agency, Reykjavik, Iceland (Manuscript received 9 August 2004, in final form 23 June 2005) ABSTRACT High-resolution regional climate simulations of Iceland for 1991­2000 have been performed using

  18. THE JOURNAL OF CHEMICAL PHYSICS 139, 244108 (2013) Periodic boundary conditions for QM/MM calculations: Ewald summation

    E-Print Network [OSTI]

    Herbert, John

    2013-01-01

    THE JOURNAL OF CHEMICAL PHYSICS 139, 244108 (2013) Periodic boundary conditions for QM/MM of Ewald summation for use in mixed quantum mechanics/molecular mechanics (QM/MM) calculations is presented a method for applying PBC to mixed quantum mechanics/molecular mechanics (QM/MM) simula- tions. We

  19. Reflective Cracking Study: First-level Report on HVS Testing on Section 587RF - 45 mm RAC-G Overlay

    E-Print Network [OSTI]

    Wu, R; Jones, David; Harvey, John T

    2008-01-01

    Testing on Section 589RF — 45 mm MB4-G Overlay (UCPRC-RR-Testing on Section 587RF — 45 mm RAC-G Overlay (UCPRC-RR-Testing on Section 588RF — 90 mm AR4000-D Overlay (UCPRC-RR-

  20. ASSEMBLY AND TEST OF A 120 MM BORE 15 T NB3SN QUADRUPOLE FOR THE LHC UPGRADE

    E-Print Network [OSTI]

    Felice, H.

    2011-01-01

    ASSEMBLY AND TEST OF A 120 MM BORE 15 T NB SN QUADRUPOLE FORdeveloping a 1-meter long, 120 mm bore N b S n IR quadrupoleH Q is a 1-meter long 120 mm aperture cos29 quadrupole. The

  1. Mechanical Design of HD2, a 15 T Nb3Sn Dipole Magnet with a 35 mm Bore

    E-Print Network [OSTI]

    Ferracin, P.

    2008-01-01

    T Nb 3 Sn Dipole Magnet with a 35 mm Bore P. Ferracin, S. E.a 15 T Nb 3 Sn Dipole with a 35 mm Bore”, IEEE Trans. Appl.design uses 51 strands of 0.8 mm diameter. With respect to

  2. Reflective Cracking Study: First-level Report on HVS Testing on Section 586RF - 45 mm MB15-GOverlay

    E-Print Network [OSTI]

    Jones, David; Wu, R; Harvey, John T

    2008-01-01

    Testing on Section 590RF — 90 mm MB4-G Overlay (UCPRC-RR-Testing on Section 589RF — 45 mm MB4-G Overlay (UCPRC-RR-Testing on Section 587RF — 45 mm RAC-G Overlay (UCPRC-RR-

  3. Assembly and Test of HD2, a 36 mm bore high field Nb3Sn Dipole Magnet

    E-Print Network [OSTI]

    Ferracin, P.

    2010-01-01

    Assembly and Test of HD2, a 36 mm bore high field Nb 3 Sna 15 T Nb 3 Sn dipole with a 35 mm bore”, IEEE Trans. Appl.Nb 3 Sn dipole magnet with a 35 mm bore”, IEEE Trans. Appl.

  4. Reflective Cracking Study: First-Level Report on HVS Testing on Section 589RF - 45 mm MB4-G Overlay

    E-Print Network [OSTI]

    Jones, David; Harvey, John T; Wu, R; Lea, J.

    2008-01-01

    Testing on Section 590RF — 90 mm MB4-G Overlay (UCPRC-RR-Testing on Section 589RF — 45 mm MB4-G Overlay (UCPRC-RR-Testing on Section 587RF — 45 mm RAC-G Overlay (UCPRC-RR-

  5. Wyko Optical Profiler This machine investigates variations in topography for surfaces ranging from very smooth to 2mm step

    E-Print Network [OSTI]

    ranging from very smooth to 2mm step height. Basic interferometric principles are used with light. Range Vertical Resolution PSI up to 150 nm 3 VSI up to 2mm 3 nm Operation 1. Power up: · Log In · Power sample, lower objectives to a position that is approximately 1mm above sample. Closely watch all

  6. Reflective Cracking Study: First-Level Report on HVS Testing on Section 590RF - 90 mm MB4-G Overlay

    E-Print Network [OSTI]

    Jones, David; Tsai, Bor-Wen; Harvey, John T

    2008-01-01

    Testing on Section 587RF — 45 mm RAC-G Overlay (UCPRC-RR-Testing on Section 588RF — 90 mm AR4000-D Overlay (UCPRC-RR-Testing on Section 586RF — 45 mm MB15-G Overlay (UCPRC-RR-

  7. Test Results of HD2, A High Field Nb3Sn Dipole with A 36 MM Bore

    E-Print Network [OSTI]

    Ferracin, Paolo

    2010-01-01

    a 15 T Nb 3 Sn dipole with a 35 mm bore”, IEEE Trans. Appl.Nb 3 Sn dipole magnet with a 35 mm bore”, IEEE Trans. Appl.NB 3 SN DIPOLE WITH A 36 MM BORE * P. Ferracin # , LBNL,

  8. Reflective Cracking Study: First-level Report on HVS Testing on Section 588RF - 90 mm AR4000-DOverlay

    E-Print Network [OSTI]

    Jones, David; Wu, R; Harvey, John T

    2008-01-01

    Testing on Section 590RF — 90 mm MB4-G Overlay (UCPRC-RR-Testing on Section 589RF — 45 mm MB4-G Overlay (UCPRC-RR-Testing on Section 587RF — 45 mm RAC-G Overlay (UCPRC-RR-

  9. Mechanical Design of HD2, a 15 T Nb3Sn Dipole Magnet with a 35 mm Bore

    E-Print Network [OSTI]

    Ferracin, P.

    2008-01-01

    T Nb 3 Sn Dipole Magnet with a 35 mm Bore P. Ferracin, S. E.a 15 T Nb 3 Sn Dipole with a 35 mm Bore”, IEEE Trans. Appl.a dipole field above 15 T, a 35 mm clear bore, and nominal

  10. [MMS] M.S. Manasse, L.A. McGeoch, and D.D. Sleator. Competitive Algorithms for OnLine Problems. Journal of Algorithms, 11:208--230, 1990.

    E-Print Network [OSTI]

    Fiat, Amos

    [MMS] M.S. Manasse, L.A. McGeoch, and D.D. Sleator. Competitive Algorithms for On­Line Problems. Journal of Algorithms, 11:208--230, 1990. [PY] C.H. Papadimitriou and M. Yannakakis. Shortest Paths Randomization in On­Line Algorithms. In Proc. 16th ICALP, July 1989. [Ram] H. Ramesh. On Traversing Layered

  11. Two-Dimensional Thin Layer Chromatography (2D-TLC) 1. Resuspend RNA pellet in 5 l ddH2O. Place at room temperature for 5-15 minutes. Use pipette tip

    E-Print Network [OSTI]

    Aris, John P.

    119 Two-Dimensional Thin Layer Chromatography (2D-TLC) 1. Resuspend RNA pellet in 5 µl ddH2O. Place and pellet any insoluble material. · If a pellet is visible, carefully transfer supernatant to fresh tube. 3

  12. Radio, Sub-mm, and X-ray Studies of Gamma-Ray Burst Host Galaxies

    E-Print Network [OSTI]

    E. Berger

    2001-12-29

    The study of gamma-ray burst (GRB) host galaxies in the radio, sub-mm, and X-ray wavelength regimes began only recently, in contrast to optical studies. This is mainly due to the long timescale on which the radio afterglow emission decays, and to the intrinsic faintness of radio emission from star-forming galaxies at z~1, as well as source confusion in sub-mm observations; X-ray observations of GRB hosts have simply not been attempted yet. Despite these difficulties, we have recently made the first detections of radio and sub-mm emission from the host galaxies of GRB980703 and GRB010222, respectively, using the VLA and the SCUBA instrument on JCMT. In both cases we find that the inferred star formation rates (~500 solar masses per year) and bolometric luminosities (~few 10^12 solar luminosities) indicate that these galaxies are possibly analogous to the local population of Ultra-Luminous Infrared Galaxies (ULIRGs) undergoing a starburst. However, there is a modest probability that the observed emission is due to AGN activity rather than star formation, thus requiring observations with Chandra or XMM. The sample of GRB hosts offers a number of unique advantages to the broader question of the evolution of galaxies and star formation from high redshift to the present time since: (i) GRBs trace massive stars, (ii) are detectable to high redshifts, and (iii) have immense dust penetrating power. Therefore, radio/sub-mm/X-ray observations of GRB hosts can potentially provide crucial information both on the nature of the GRB host galaxies, and on the history of star formation.

  13. Performance of HQ02, an optimized version of the 120 mm $Nb_3Sn$ LARP quadrupole

    E-Print Network [OSTI]

    Chlachidze, G; Anerella, M; Borgnolutti, F; Bossert, R; Caspi, S; Cheng, D W; Dietderich, D; Felice, H; Ferracin, P; Ghosh, A; Godeke, A; Hafalia A R; Marchevsky, M; Orris, D; Roy, P K; Sabbi, G L; Salmi, T; Schmalzle, J; Sylvester, C; Tartaglia, M; Tompkins, J; Wanderer, P; Wang, X R; Zlobin, A V

    2013-01-01

    In preparation for the high luminosity upgrade of the Large Hadron Collider (LHC), the LHC Accelerator Research Program (LARP) is developing a new generation of large aperture high-field quadrupoles based on Nb3Sn technology. One meter long and 120 mm diameter HQ quadrupoles are currently produced as a step toward the eventual aperture of 150 mm. Tests of the first series of HQ coils revealed the necessity for further optimization of the coil design and fabrication process. A new model (HQ02) has been fabricated with several design modifications, including a reduction of the cable size and an improved insulation scheme. Coils in this magnet are made of a cored cable using 0.778 mm diameter Nb3Sn strands of RRP 108/127 sub-element design. The HQ02 magnet has been fabricated at LBNL and BNL, and then tested at Fermilab. This paper summarizes the performance of HQ02 at 4.5 K and 1.9 K temperatures.

  14. The Contribution of Faint Blue Galaxies to the Sub-mm Counts and Background

    E-Print Network [OSTI]

    Geoff S. Busswell; Tom Shanks

    2000-10-24

    Observations in the submillimetre waveband have recently revealed a new population of luminous, sub-mm sources. These are proposed to lie at high redshift and to be optically faint due to their high intrinsic dust obscuration. The presence of dust has been previously invoked in optical galaxy count models which assume $\\tau=9$ Gyr Bruzual & Charlot evolution for spirals and these fit the count data well from U to K. We now show that by using either a 1/$\\lambda$ or Calzetti absorption law for the dust and re-distributing the evolved spiral galaxy UV radiation into the far infra-red(FIR), these models can account for all of the `faint'($\\leq1$mJy) $850\\mu$m galaxy counts, but fail to fit 'bright'($\\ge2$mJy) sources, indicating that another explanation for the sub-mm counts may apply at brighter fluxes(e.g. QSOs, ULIRGs). We find that the main contribution to the faint, sub-mm number counts is in the redshift range $0.5 < z < 3$, peaking at $z\\approx 1.8$. The above model, using either dust law, can also explain a significant proportion of the extra-galactic background at $850\\mu$m as well as producing a reasonable fit to the bright $60\\mu m$ IRAS counts.

  15. Fabrication and characterization of a 0.5-mm lutetium oxyorthosilicate detector array for high-resolution PET applications

    E-Print Network [OSTI]

    Stickel, Jennifer R; Qi, Jinyi; Cherry, Simon R

    2007-01-01

    and Characterization of a 0.5-mm Lutetium OxyorthosilicateIn this work, a pair of lutetium oxyorthosi- licate (LSO)PET; high spatial resolution; lutetium oxyorthosilicate;

  16. Self-consistent QM/MM methodologies for structural refinement of photosystem II and other macromolecules of biological interest

    SciTech Connect (OSTI)

    Batista, Enrique R [Los Alamos National Laboratory; Sproviero, Eduardo M [YALE UNIV; Newcomer, Michael [YALE UNIV; Gascon, Jose A [YALE UNIV; Batista, Victor S [YALE UNIV

    2008-01-01

    The combination of quantum mechanics and molecular mechanics (QM/MM) is one of the most promising approaches to study the structure, function, and properties of proteins and nucleic acids. However, there some instances in which the limitations of either the MM (lack of a proper electronic description) or QM (limited to a few number of atoms) methods prevent a proper description of the system. To address this issue, we review here our approach to fine-tune the structure of biological systems using post-QM/MM refinements. These protocols are based on spectroscopy data, and/or partitioning of the system to extend the QM description to a larger region of a protein. We illustrate these methodologies through applications to several biomolecules, which were pre-optimized at the QM/MM level and then further refined using postQM/MM refinement methodologies: mod(QM/MM), which refines the atomic charges of the residues included in the MM region accounting for polarization effects; mod(QM/MM)-opt that partition the MM region in smaller parts and optimizes each part in an iterative. self-consistent way, and the Polarized-Extended X-Ray Absorption Fine Structure (P-EXAFS) fitting procedure, which fine-tune the atomic coordinates to reproduce experimental polarized EXAFS spectra. The first two techniques were applied to the guanine quadruplex. while the P-EXAFS refinement was applied to the oxygen evolving complex of photosystem II.

  17. CEE Illinois Newsletter http://universityofillinois.createsend5.com/...mail/r/223E1D1015588E362540EF23F30FEDED/159959431C95E5BCEBAD456BEB5F1DD6[11/26/2013 11:34:34 AM

    E-Print Network [OSTI]

    Minsker, Barbara S.

    EF23F30FEDED/159959431C95E5BCEBAD456BEB5F1DD6[11/26/2013 11:34:34 AM] NEWS FROM CEE AT ILLINOIS95E5BCEBAD456BEB5F1DD6[11/26/2013 11:34:34 AM] The Department of Civil and Environmental EngineeringEF23F30FEDED/159959431C95E5BCEBAD456BEB5F1DD6[11/26/2013 11:34:34 AM] #12;

  18. An experiment to detect gravity at sub-mm scale with high-Q mechanical oscillators

    E-Print Network [OSTI]

    L. Haiberger; M. Weingran; H. Wenz; S. Schiller

    2005-10-20

    Silicon double paddle oscillators are well suited for the detection of weak forces because of their high Q factor (about 10^5 at room temperature). We describe an experiment aimed at the detection of gravitational forces between masses at sub-mm distance using such an oscillator. Gravitational excitation is produced by a rotating aluminium disk with platinum segments. The force sensitivity of this apparatus is about 10 fN at room temperature for 1000 s averaging time at room temperature. The current limitations to detection of the gravitational force are mentioned.

  19. Sub-mm tests of the gravitational inverse-square law

    E-Print Network [OSTI]

    E. G. Adelberger

    2002-02-02

    Sub-mm tests of the gravitational inverse-square law are interesting from several quite different perspectives. This paper discusses work by the Eot-Wash group performed since the publication of our initial result in February 2001. We find no evidence for short-range Yukawa interactions. Our results provide an upper limit of 200 micrometers on the size of the largest ``extra'' dimension, and for the unification scenario with 2 large extra dimensions, set an upper limit of 150 micrometers on the size of those dimensions.

  20. QM/MM Studies of the Triosephosphate Isomerase-Catalyzed Reaction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeedingProgramExemptionsProteinTotal natural gasPurchase,PyFEHM716,EnergyQM/MM

  1. TITLE: AUTHOR(S) SUBMITTED TO: Mm EVOLUTIO:l C: S!LICIC

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnicalInformation FederatedInformationTITLE: AUTHOR(S) SUBMITTED TO: Mm EVOLUTIO:l

  2. Type II Cepheids in the Milky Way disc. Chemical composition of two new W Vir stars: DD Vel and HQ Car

    E-Print Network [OSTI]

    Lemasle, B; Bono, G; François, P; Saviane, I; Yegorova, I; Genovali, K; Inno, L; Galazutdinov, G; da Silva, R

    2015-01-01

    A robust classification of Cepheids into their different sub-classes and, in particular, between classical and Type II Cepheids, is necessary to properly calibrate the period-luminosity relations and for populations studies in the Galactic disc. Type II Cepheids are, however, very diverse, and classifications based either on intrinsic (period, light curve) or external parameters (e.g., [Fe/H], |z|) do not provide a unique classification. We want to ascertain the classification of two Cepheids, HQ Car and DD Vel, that are sometimes classified as classical Cepheids and sometimes as Type II Cepheids. To achieve this goal, we examine both their chemical composition and the presence of specific features in their spectra. We find emission features in the H{\\alpha} and in the 5875.64 {\\AA} He I lines that are typical of W Vir stars. The [Na/Fe] (or [Na/Zn]) abundances are typical of thick-disc stars, while BL Her stars are Na-overabundant ([Na/Fe]>+0.5 dex). Finally, the two Cepheids show a possible (HQ Car) or prob...

  3. System Description for the K-25/K-27 D&D Project Polyurethane Foam Delivery System, East Tennessee Technology Park, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Boris, G.

    2008-02-21

    The Foam Delivery System used in the decontamination and decommissioning (D&D) project for the K-25/K-27 Buildings at the East Tennessee Technology Park (ETTP) is comprised of a trailer-mounted Gusmer{reg_sign} H20/35 Pro-TEC Proportioning Unit and the associated equipment to convey electrical power, air, and foam component material to the unit. This high-pressure, plural-component polyurethane foam pouring system will be used to fill process gas and non-process equipment/piping (PGE/P) within the K-25/K-27 Buildings with polyurethane foam to immobilize contaminants prior to removal. The system creates foam by mixing isocyanate and polyol resin (Resin) component materials. Currently, the project plans to utilize up to six foaming units simultaneously during peak foaming activities. Also included in this system description are the foam component material storage containers that will be used for storage of the component material drums in a staging area outside of the K-25/K-27 Buildings. The Foam Delivery System and foam component material storage enclosures (i.e., Foaming Component Protective Enclosures) used to store polymeric methylene diphenyl diisocyanate (PMDI) component material are identified as Safety Significant (SS) Structures, Systems and Components (SSC) in the Documented Safety Analysis (DSA) for the project, Documented Safety Analysis for the K-25 and K-27 Facilities at the East Tennessee Technology Park, Oak Ridge, Tennessee, DSA-ET-K-25/K-27-0001.

  4. A compact proton spectrometer for measurement of the absolute DD proton spectrum from which yield and pR are determined in thin-shell inertial-confinement-fusion implosions

    SciTech Connect (OSTI)

    Rosenberg, M. J.; Zylstra, A. B.; Frenje, J. A.; Rinderknecht, H. G.; Gatu Johnson, M.; Waugh, C. J.; Seguin, F. H.; Sio, H.; Sinenian, N.; Li, C. K.; Petrasso, R. D.; Glebov, V. Yu.; Hohenberger, M.; Stoeckl, C.; Sangster, T. C.; Yeamans, C. B.; LePape, S.; Mackinnon, A. J.; Bionta, R. M.; Talison, B.; Casey, D. T.; Landen, O. L.; Moran, M. J.; Zacharias, R. A.; Kilkenny, J. D.; Nikroo, A.

    2014-10-10

    A compact, step range filter proton spectrometer has been developed for the measurement of the absolute DD proton spectrum, from which yield and areal density (?R) are inferred for deuterium-filled thin-shell inertial confinement fusion implosions. This spectrometer, which is based on tantalum step-range filters, is sensitive to protons in the energy range 1-9 MeV and can be used to measure proton spectra at mean energies of ~1-3 MeV. It has been developed and implemented using a linear accelerator and applied to experiments at the OMEGA laser facility and the National Ignition Facility (NIF). Modeling of the proton slowing in the filters is necessary to construct the spectrum, and the yield and energy uncertainties are ±<10% in yield and ±120 keV, respectively. This spectrometer can be used for in situ calibration of DD-neutron yield diagnostics at the NIF

  5. A compact proton spectrometer for measurement of the absolute DD proton spectrum from which yield and pR are determined in thin-shell inertial-confinement-fusion implosions

    SciTech Connect (OSTI)

    Rosenberg, M. J. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Zylstra, A. B. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Frenje, J. A. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Rinderknecht, H. G. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Gatu Johnson, M. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Waugh, C. J. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Seguin, F. H. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Sio, H. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Sinenian, N. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Li, C. K. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Petrasso, R. D. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States). Plasma Science and Fusion Center; Glebov, V. Yu. [Univ. of Rochester, NY (United States). Lab. for Laser Energetics; Hohenberger, M. [Univ. of Rochester, NY (United States). Lab. for Laser Energetics; Stoeckl, C. [Univ. of Rochester, NY (United States). Lab. for Laser Energetics; Sangster, T. C. [Univ. of Rochester, NY (United States). Lab. for Laser Energetics; Yeamans, C. B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); LePape, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Mackinnon, A. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bionta, R. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Talison, B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Casey, D. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Landen, O. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Moran, M. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Zacharias, R. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kilkenny, J. D. [General Atomics, San Diego, CA (United States); Nikroo, A. [General Atomics, San Diego, CA (United States)

    2014-10-01

    A compact, step range filter proton spectrometer has been developed for the measurement of the absolute DD proton spectrum, from which yield and areal density (?R) are inferred for deuterium-filled thin-shell inertial confinement fusion implosions. This spectrometer, which is based on tantalum step-range filters, is sensitive to protons in the energy range 1-9 MeV and can be used to measure proton spectra at mean energies of ~1-3 MeV. It has been developed and implemented using a linear accelerator and applied to experiments at the OMEGA laser facility and the National Ignition Facility (NIF). Modeling of the proton slowing in the filters is necessary to construct the spectrum, and the yield and energy uncertainties are ±<10% in yield and ±120 keV, respectively. This spectrometer can be used for in situ calibration of DD-neutron yield diagnostics at the NIF

  6. Optical-Infrared Properties of Faint 1.3 mm Sources Detected with ALMA

    E-Print Network [OSTI]

    Hatsukade, Bunyo; Yabe, Kiyoto; Seko, Akifumi; Makiya, Ryu; Akiyama, Masayuki

    2015-01-01

    We report optical-infrared (IR) properties of faint 1.3 mm sources (S_1.3mm = 0.2-1.0 mJy) detected with the Atacama Large Millimeter/submillimeter Array (ALMA) in the Subaru/XMM-Newton Deep Survey (SXDS) field. We searched for optical/IR counterparts of 8 ALMA-detected sources (>=4.0 sigma, the sum of the probability of spurious source contamination is ~1) in a K-band source catalog. Four ALMA sources have K-band counterpart candidates within a 0.4" radius. Comparison between ALMA-detected and undetected K-band sources in the same observing fields shows that ALMA-detected sources tend to be brighter, more massive, and more actively forming stars. While many of the ALMA-identified submillimeter-bright galaxies (SMGs) in previous studies lie above the sequence of star-forming galaxies in stellar mass--star-formation rate plane, our ALMA sources are located in the sequence, suggesting that the ALMA-detected faint sources are more like `normal' star-forming galaxies rather than `classical' SMGs. We found a regio...

  7. Design development for the 50mm Superconducting Super Collider dipole cryostat

    SciTech Connect (OSTI)

    Nicol, T.H.

    1991-03-01

    The cryostat of a Superconducting Super Collider (SSC) dipole magnet consists of all magnet components except the magnet assembly itself. It serves to support the magnet accurately and reliably within the vacuum vessel, provide all required cryogenic piping, and to insulate the cold mass from heat radiated and conducted from the environment. It must function reliably during storage, shipping and handling, normal magnet operation, quenches, and seismic excitations, and must be manufacturable at low cost. The major components of the cryostat are the vacuum vessel, thermal shields, multilayer insulation system, cryogenic piping, interconnections, and suspension system. The overall design of a cryostat for superconducting accelerator magnets requires consideration of fluid flow, proper selection of materials for their thermal and structural performance at both ambient and operating temperature, and knowledge of the environment to which the magnets will be subjected over the course their expected operating life. This paper describes the design of the current 50mm SSC collider dipole cryostat and includes discussions on the structural and thermal considerations involved in the development of each of the major systems. Where appropriate, comparisons will be made with the 40mm cryostat. 7 refs., 5 figs., 4 tabs.

  8. Design and Analysis of TQS01, a 90 mm Nb3Sn Model Quadrupole for LHC Luminosity Upgrade Based on a Key and Bladder Assembly

    E-Print Network [OSTI]

    Caspi, S.

    2008-01-01

    and Analysis of TQS01, a 90 mm Nb 3 Sn Model Quadrupole forStructure for an LHC 90 mm Nb 3 Sn quadrupole magnet”, IEEEal. , “Development of a 90-mm Nb3Sn Technological Quadrupole

  9. DEVELOPMENT OF A 40 mm BORE MAGNET CROSS SECTION WITH HIGH FIELD UNIFORMITY FOR THE 6.6T SSC DIPOLE

    E-Print Network [OSTI]

    Caspi, S.

    2010-01-01

    76SF00098. DEVELOPHENT OF A 40 mm BORE KAGNET CROSS SECTIONuniform dipole field. A 40 mm bo~e diameter winding cross3, 1986 DEVELOPMENT OF A 40 mm BORE MAGNET CROSS SECTION

  10. Imaging structure and composition homogeneity of 300 mm SiGe virtual substrates for advanced CMOS applications by scanning X-ray diffraction microscopy

    E-Print Network [OSTI]

    2015-01-01

    of New Materials on 300 mm Silicon Wafers. ECS Trans. 2012,Composition Homogeneity of 300 mm SiGe Virtual Substratesrelaxed bu?er layers on 300 mm Si(001) wafers treated with

  11. 5000 groove/mm multilayer-coated blazed grating with 33percent efficiency in the 3rd order in the EUV wavelength range

    E-Print Network [OSTI]

    Voronov, Dmitriy L.

    2010-01-01

    5000 groove/mm multilayer-coated blazed grating with 33%groove density 2400 grooves/mm optimized for diffraction inorder. 6 A denser 3000 grooves/mm grating has demonstrated

  12. First Lasing of Volume FEL (VFEL) at Wavelength Range $?\\sim $ 4-6 mm

    E-Print Network [OSTI]

    V. Baryshevsky; K. Batrakov; A. Gurinovich; I. Ilienko; A. Lobko; V. Moroz; P. Sofronov; V. Stolyarsky

    2001-07-18

    First lasing of volume free electron laser (VFEL) is described. The generating system consists of two metal diffraction grating with different spatial periods. The first grating creates the conditions for Smith Purcell emission mechanism. The second grating provides the distributed feedback for emitted wave. The length of diffraction grating is 10 cm. Electron beam pulse with a time duration $\\tau \\sim$ 10 ms has a sinusoidal form with the amplitude varied from 1 to ~10 kV. The measured microwave power reached the value of about 3-4 W in mm wavelength range. The generation stops at threshold current value. When the current tends to the threshold value, the region of generation tends to a narrow band near to 5 kV. At higher current values the radiation appears in electron energy range 5 - 7.5 KeV.

  13. A 1 mm Scintillating Fibre Tracker Readout by a Multi-anode Photomultiplier

    E-Print Network [OSTI]

    B. D. Leverington; M. Anelli; P. Campana; R. Rosellini

    2011-07-05

    This note describes a prototype particle tracking detector constructed with 1 mm plastic scintillating fibres with a 64 channel Hamamatsu H8500 flat-panel multi-anode photomultiplier readout. Cosmic ray tracks from an array of 11 gas-filled drift tubes were matched to signals in the scintillating fibres in order to measure the resolution and efficiency of tracks reconstructed in the fibre-based tracker. A GEANT4 detector simulation was also developed to compare cosmic ray data with MC results and is discussed in the note. Using the parameters measured in this experimental setup, modified fibre tracker designs are suggested to improve resolution and efficiency in future prototypes to meet modern detector specifications.

  14. The 1.3 mm Full-Stokes Polarization System at CARMA

    E-Print Network [OSTI]

    Hull, Charles L H

    2015-01-01

    The CARMA 1.3 mm polarization system consists of dual-polarization receivers that are sensitive to right- (R) and left-circular (L) polarization, and a spectral-line correlator that measures all four cross polarizations (RR, LL, LR, RL) on each of the 105 baselines connecting the 15 telescopes. Each receiver comprises a single feed horn, a waveguide circular polarizer, an orthomode transducer (OMT), two heterodyne mixers, and two low-noise amplifiers (LNAs), all mounted in a cryogenically cooled dewar. Here we review the basics of polarization observations, describe the construction and performance of key receiver components (circular polarizer, OMT, and mixers -- but not the correlator), and discuss in detail the calibration of the system, particularly the calibration of the R-L phase offsets and the polarization leakage corrections. The absolute accuracy of polarization position angle measurements was checked by mapping the radial polarization pattern across the disk of Mars. Transferring the Mars calibrati...

  15. A photocathode rf gun design for a mm-wave linac-based FEL

    SciTech Connect (OSTI)

    Nassiri, A.; Berenc, T,; Foster, J.; Waldschmidt, G.; Zhou, J.

    1995-07-01

    In recent years, advances in the rf gun technology have made it possible to produce small beam emittances suitable for short period microundulators which take advantage of the low emittance beam to reduce the wavelength of FELs. At the Advanced Photon Source, we are studying the design of a compact 50-MeV superconducting mm-wave linac-based FEL for the production of short wavelengths ({approximately}300 nm) to carry out FEL demonstration experiments. The electron source considered for the linac is a 30- GHz, 3 1/2-cell {pi}-mode photocathode rf gun. For cold model rf measurements a 15-GHz prototype structure was fabricated. Here we report on the design, numerical modelling and the initial cold-model rf measurement results on the 15-GHz prototype structure.

  16. Measurement of the large-scale anisotropy of the cosmic background radiation at 3mm

    SciTech Connect (OSTI)

    Epstein, G.L.

    1983-12-01

    A balloon-borne differential radiometer has measured the large-scale anisotropy of the cosmic background radiation (CBR) with high sensitivity. The antenna temperature dipole anistropy at 90 GHz (3 mm wavelength) is 2.82 +- 0.19 mK, corresponding to a thermodynamic anistropy of 3.48 +- mK for a 2.7 K blackbody CBR. The dipole direction, 11.3 +- 0.1 hours right ascension and -5.7/sup 0/ +- 1.8/sup 0/ declination, agrees well with measurements at other frequencies. Calibration error dominates magnitude uncertainty, with statistical errors on dipole terms being under 0.1 mK. No significant quadrupole power is found, placing a 90% confidence-level upper limit of 0.27 mK on the RMS thermodynamic quadrupolar anistropy. 22 figures, 17 tables.

  17. Hydrides of CeNi/sub 5/, MmNi/sub 5/, Ca/sub 0/ /sub 2/(Ce/sub 0/ /sub 65/Mm/sub 0/ /sub 35/)/sub 0/ /sub 8/Ni/sub 5/, Ca/sub 0/ /sub 2/Ce/sub 0/ /sub 8/Ni/sub 5/, Ca/sub 0/ /sub 2/Mm/sub 0/ /sub 8/Ni/sub 5/, and mixed CeNi/sub 5//MmNi/sub 5/

    SciTech Connect (OSTI)

    Lakner, J.F.; Chow, T.S.

    1982-09-01

    Six intermetallic alloys (CeNi/sub 5/, MmNi/sub 5/, Ca/sub 0/ /sub 2/(Ce/sub 0/ /sub 65/Mm/sub 0/ /sub 35/)/sub 0/ /sub 8/Ni/sub 5/, Ca/sub 0/ /sub 2/Ce/sub 0/ /sub 8/Ni/sub 5/, Ca/sub 0/ /sub 2/Mm/sub 0/ /sub 8/Ni/sub 5/, and a mixed alloy, CeNi/sub 5//MmNi/sub 5/) were investigated with respect to their suitability to provide high hydrogen capacity and their potential for use in providing substantial hydrogen pressure at both low and high temperatures. A second phase of our investigation dealt with ball-milling and hydriding and dehydriding cycles to produce fine particles for use in hydride powder transfer studies. A summary of several Van't Hoff plots is also included for hydride-forming alloys.

  18. The Growth of Black Holes and Their Host Spheroids in (Sub)mm-loud QSOs at High Redshift

    E-Print Network [OSTI]

    C. N. Hao; X. Y. Xia; S. Mao; Z. G. Deng; Hong Wu

    2007-04-24

    We study the growth of black holes and stellar population in spheroids at high redshift using several (sub)mm-loud QSO samples. Applying the same criteria established in an earlier work, we find that, similar to IR QSOs at low redshift, the far-infrared emission of these (sub)mm-loud QSOs mainly originates from dust heated by starbursts. By combining low-z IR QSOs and high-z (sub)mm-loud QSOs, we find a trend that the star formation rate ($\\Mstardot$) increases with the accretion rate ($\\Mdot$). We compare the values of $\\Mstardot/\\Mdot$ for submm emitting galaxies (SMGs), far-infrared ultraluminous/hyperluminous QSOs and typical QSOs, and construct a likely evolution scenario for these objects. The (sub)mm-loud QSO transition phase has both high $\\Mdot$ and $\\Mstardot$ and hence is important for establishing the correlation between the masses of black holes and spheroids.

  19. Freezing / Thawing mammalian cells (AG/2-96) 1. Grow cells to confluency in 100 mm plates.

    E-Print Network [OSTI]

    Ghosh, Anirvan

    Freezing / Thawing mammalian cells (AG/2-96) Freezing: 1. Grow cells to confluency in 100 mm plates ml per vial), seal, place between styrofoam tube holders, and freeze at -70 C. 7. Transfer tubes

  20. Sensitivity analysis of the MM5 weather model using automatic differentiation

    SciTech Connect (OSTI)

    Bischof, C.H. [Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States)] [Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Pusch, G.D. [Physics Department, Michigan State University, East Lansing, Michigan 48842 (United States)] [Physics Department, Michigan State University, East Lansing, Michigan 48842 (United States); Knoesel, R. [Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States)] [Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States)

    1996-11-01

    We present a general method for using automatic differentiation to facilitate model sensitivity analysis. Automatic differentiation techniques augment, in a completely mechanical fashion, an existing code such that it also simultaneously and efficiently computes derivatives. Our method allows the sensitivities of the code{close_quote}s outputs to its parameters and inputs to be determined with minimal human effort by exploiting the relationship between differentiation and formal perturbation theory. Employing this methodology, we performed a sensitivity study of the MM5 code, a mesoscale weather model jointly developed by Penn State University and the National Center for Atmospheric Research, that is composed of roughly 40,000 lines of Fortran 77 code. Our results show that automatic differentiation-computed sensitivities exhibit superior accuracy compared to divided difference approximations computed from finite-amplitude perturbations. We also comment on a numerically induced precursor wave that would almost certainly have been undetectable if one used a divided difference method. {copyright} {ital 1996 American Institute of Physics.}

  1. 1400 OPTICS LETTERS / Vol. 27, No. 16 / August 15, 2002 Low-loss, wide-angle Y splitter at 1.6-mm wavelengths built

    E-Print Network [OSTI]

    1400 OPTICS LETTERS / Vol. 27, No. 16 / August 15, 2002 Low-loss, wide-angle Y splitter at 1.6-mm at l 1.6 mm. Our device has a large splitting angle of 120± and a miniature size of 3 mm 3 3 mm of guiding and bending efficiency at l 1.5 1.6 mm wavelengths has also been carried out.3

  2. 3.2 mm lightcurve observations of (4) Vesta and (9) Metis with the Australia Telescope Compact Array

    E-Print Network [OSTI]

    T. G. Müller; P. J. Barnes

    2007-03-09

    (4) Vesta and (9) Metis are large main-belt asteroids with high albedos. With millimetre-observations at 93.0 and 95.5 GHz we characterised the emission properties of the surface material. The coverage of the full rotation period allowed a detailed study of the heterogeneity of the surface. The rotationally averaged fluxes are explained very well by our thermophysical model techniques when using an emissivity in the mm-range of about 0.6 for (4) Vesta and about 0.7 for (9) Metis. The mm-lightcurves follow for a large fraction of the rotation period the shape-introduced variations. The rotational phases with clear deviations are connected to structures which are visible in the HST images of (4) Vesta and the Keck AO-images of (9) Metis. The observed lightcurve amplitudes are peak-to-peak ~30% for (4) Vesta and ~25% for (9) Metis, while the shape-related amplitudes are only 5 and 4%, respectively. The emissivities at mm-wavelengths are lower than in the far-IR, confirming that particles with sizes of about 100 mikron influence the mm-behaviour. The 3-mm observations are very powerful for the study of asteroid surface heterogeneities.

  3. THE RAFFLESBULLETIN OF ZOOLOGY199644(1) Fig. 1. a, Orcovita saltatrix Ng & Tomascik, 1994,paratypemale (17.0by 13.0 mm) (MNHNB-

    E-Print Network [OSTI]

    Iliffe, Thomas M.

    ,paratypemale (17.0by 13.0 mm) (MNHNB- 22891); b, O. gracilipes, new species,holotype male (18.5 by 13.1 mm) (MNHN B-22892); c, O. mollitia, newspecies,holotypemale (12.6by 9.6 mm) (MNHN B-22895). #12;Ng et al. 2. a, Orcovitafictilia, newspecies,holotypemale (21.5by 15.3 mm)(NMCR); b, O. angulata

  4. .225 2 QQw 85 255mm 5:5 95 £< H an 882? .525 05 B @220 g 8 Ga ...

    E-Print Network [OSTI]

    on E “mm. :oaw: . 83:8 ta: 2? #53 @025 @822 g a 6 é 3: Gd 68 EN. 6 JV Am “8 2w Siam @228 .560 2t 35 850% on SS m .o n <6w was ESQ Route @ 2 8 “8 35 ...

  5. MALARIA I N NIGERIA: CDNSTRAINED CaYTINUXIS-TIE MARKDV MmLS A3R DISCRETE-TIME

    E-Print Network [OSTI]

    Cohen, Joel E.

    MALARIA I N NIGERIA: CDNSTRAINED CaYTINUXIS-TIE MARKDV MmLS A3R DISCRETE-TIME ~ I T U D I N t of northern Nigeria included 8 baseline surveys a t approximately - AHS(1OS) subject classifications (1970 grant SOC76-17706 t o Columbia University. #12;JOEL E. COHEN AND BURTON SINGER UALARIA I N NIGERIA 10

  6. e x ecu tiv e su mm a ry of accomp lishmen t s resea rch & development

    E-Print Network [OSTI]

    Subramanian, Venkat

    . Biswas) » Clean CoalTechnology Fund = $479,651 (R. Axelbaum) » Two NSF CAREER Awards: $400,000 (Y.-S. Jun is the first university to join the Advanced Coal Technology Consortia of the U.S.-China Clean Energy Researche x ecu tiv e su mm a ry of accomp lishmen t s resea rch & development » The Consortium for Clean

  7. Phase Referencing at the Palomar Testbed Interferometer B.F. Lane & M.M. Colavita (for the PTI Collaboration)

    E-Print Network [OSTI]

    Phase Referencing at the Palomar Testbed Interferometer B.F. Lane & M.M. Colavita (for the PTI Collaboration) Abstract We discuss implementation and testing of phase-referencing at the Palomar Testbed. The Instrument The Palomar Testbed Interferometer (PTI) is a long-baseline infrared interferometer installed

  8. A Virtual DSP System for Design Instruction of Power Converters AA.. KKeeyyhhaannii aanndd MM.. NN.. MMaarrwwaallii GGeerraalldd BBaauummggaarrttnneerr

    E-Print Network [OSTI]

    Baumgartner, Gerald

    1 A Virtual DSP System for Design Instruction of Power Converters AA.. KKeeyyhhaannii aanndd MM the development of an object oriented DSP based for design and control of power converters. The testbed `hard' switching power converters, a resonant converter utilizes a controlled series or parallel LC

  9. MM000422.R1 1 Abstract--In this paper we present a secure and robust content

    E-Print Network [OSTI]

    Chang, Shih-Fu

    MM000422.R1 1 Abstract--In this paper we present a secure and robust content based digital protecting the integrity of content and non-repudiation from the image sender. Content integrity protection means that the content isn't allowed to be modified in such a way that the content meaning is altered

  10. 0 10 20 30 40 50 60 70 80 90 100 Half spreading rate (mm per year)

    E-Print Network [OSTI]

    Müller, Dietmar

    60° 30° 0° 30° 60° 0 10 20 30 40 50 60 70 80 90 100 Half spreading rate (mm per year) Pacific Ocean you increase the speed of a continent ploughing through Earth's viscous, churning mantle? Kumar et al palaeomagnetic data and rates of seafloor spreading, and sets India apart from all its neighbours. Africa, Antarc

  11. WRF/MM5 User's Workshop, Boulder, CO, June 22-25, 2004, pp. 225-228. A Better Understanding of the Effects of

    E-Print Network [OSTI]

    Berleant, Daniel

    WRF/MM5 User's Workshop, Boulder, CO, June 22-25, 2004, pp. 225-228. A Better Understanding the impact of bugs in a well-known weather simulation system, MM5. The findings help fill a gap in knowledge questions. In the research reported here, bugs were artificially added to MM5. Their effects were analyzed

  12. Molecular Physics, Vol. 104, Nos. 57, 10 March10 April 2006, 701714 Geometry optimization with QM/MM methods II: Explicit

    E-Print Network [OSTI]

    Schlegel, H. Bernhard

    with QM/MM methods II: Explicit quadratic coupling T. VREVEN*y, M. J. FRISCHy, K. N. KUDINz, H. B QM/MM systems is usually carried out by alternating a second-order optimization of the QM region using internal coordinates (`macro-iterations'), and a first-order optimization of the MM region using

  13. Reflective Cracking Study: First-level Report on HVS Testing on Section 591RF - 45 mm MAC15TR-GOverlay

    E-Print Network [OSTI]

    Jones, David; Wu, R.; Harvey, John T

    2008-01-01

    Testing on Section 588RF — 90 mm AR4000-D Overlay (UCPRC-RR-Testing on Section 586RF — 45 mm MB15-G Overlay (UCPRC-RR-Testing on Section 591RF — 45 mm MAC15TR-G Overlay (UCPRC-

  14. Test Results of 15 T Nb3Sn Quadrupole Magnet HQ01 with a 120 mm Bore for the LHC Luminosity Upgrade

    E-Print Network [OSTI]

    Caspi, S.

    2012-01-01

    Magnet HQ01 with a 120 mm Bore for the L H C LuminosityFessia el ai, "Design of a 120 mm bore quadrupole for the LStructure for an L H C 90 mm N b S n quadrupole magnet,"

  15. Vol. 7, 1361-1368, October 1996 Cell Growth & Differentiation 1361 Action of Mm and Momi on Neoplasia in Ectopic Intestinal

    E-Print Network [OSTI]

    Dove, William

    Vol. 7, 1361-1368, October 1996 Cell Growth & Differentiation 1361 Action of Mm and Momi.] Abstract Mice heterozygous for Mm, a mutant allele of Apc, develop adenomas throughout the intestinal tract. Tumor multiplicity in Mm mice is influenced by genetic modifier loci. Previously, we mapped one

  16. Frequency synthesis using concurrency: Reaching a solution to a few classical and hard headed RF and mm-wave integrated circuit problems

    E-Print Network [OSTI]

    Jooyaie, Alborz

    2012-01-01

    18] A. H-T. Yu, et. al. , “a mm-wave arbitrary 2 N bandItoh, M.C.F. Chang, “A mm-wave arbitrary 2N band oscillatorand analysis of a 90 nm mm-wave oscillator using inductive

  17. A 19.1dBm Segmented Power-Mixer Based Multi-Gbps mm-Wave Transmitter in 32nm SOI CMOS

    E-Print Network [OSTI]

    Hajimiri, Ali

    A 19.1dBm Segmented Power-Mixer Based Multi-Gbps mm-Wave Transmitter in 32nm SOI CMOS Kaushik Abstract -- A high-power, fully-integrated, mm-wave power mixer based transmitter capable of generating case segmentation at 30% higher supply voltage. Index Terms -- mm-wave, , Power Mixer, CMOS Power

  18. The millimetre variability of M81* -- Multi-epoch dual frequency mm-observations of the nucleus of M81

    E-Print Network [OSTI]

    R. Schoedel; M. Krips; S. Markoff; R. Neri; A. Eckart

    2006-11-28

    There are still many open questions as to the physical mechanisms at work in Low Luminosity AGN that accrete in the extreme sub-Eddington regime. Simultaneous multi-wavelength studies have been very successful in constraining the properties of SgrA*, the extremely sub-Eddington black hole at the centre of our Milky Way. M81*, the nucleus of the nearby spiral galaxy M81, is an ideal source to extend the insights obtained on SgrA* toward higher luminosity AGN. Here we present observations at 3 and 1 mm that were obtained within the framework of a coordinated,multi-wavelength campaign on M81*. The continuum emission from M81* was observed during three epochs with the IRAM Plateau de Bure Interferometer simultaneously at wavelengths of 3 and 1 mm. We present the first flux measurements of M81* at wavelengths around 1 mm. We find that M81* is a continuously variable source with the higher variability observed at the shorter wavelength. Also, the variability at 3 and 1 mm appears to be correlated. Like SgrA*, M81* appears to display the strongest flux density and variability in the mm-to-submm regime. There remains still some ambiguity concerning the exact location of the turnover frequency from optically thick to optically thin emission. The observed variability time scales point to an upper size limit of the emitting region of the order 25 Schwarzschild radii. The data show that M81* is indeed a system with very similar physical properties to SgrA* and an ideal bridge toward high luminosity AGN. The data obtained clearly demonstrate the usefulness and, above all, the necessity of simultaneous multi-wavelength observations of LLAGN.

  19. Ability of the Confined Explosive Component Water Gap Test STANAG 4363 to Assess the Shock Sensitivity of MM-Scale Detonators

    SciTech Connect (OSTI)

    Lefrancois, A S; Roeske, F; Benterou, J; Tarver, C M; Lee, R S; Hannah, B

    2006-02-10

    The Explosive Component Water Gap Test (ECWGT) has been validated to assess the shock sensitivity of lead and booster components having a diameter larger than 5 mm. Several countries have investigated by experiments and numerical simulations the effect of confinement on the go/no go threshold for Pentaerythritol Tetranitrate (PETN) pellets having a height and diameter of 3 mm, confined by a steel annulus of wall thickness 1-3.5 mm. Confinement of the PETN by a steel annulus of the same height of the pellet with 1-mm wall thickness makes the component more sensitive (larger gap). As the wall thickness is increased to 2-mm, the gap increases a lesser amount, but when the wall thickness is increased to 3.5-mm a decrease in sensitivity is observed (smaller gap). This decrease of the water gap has been reproduced experimentally. Recent numerical simulations using Ignition and Growth model [1] for the PETN Pellet have reproduced the experimental results for the steel confinement up to 2 mm thick [2]. The presence of a stronger re-shock following the first input shock from the water and focusing on the axis have been identified in the pellet due to the steel confinement. The double shock configuration is well-known to lead in some cases to shock desensitization. This work presents the numerical simulations using Ignition and Growth model for LX16 (PETN based HE) and LX19 (CL20 based HE) Pellets [3] in order to assess the shock sensitivity of mm-scale detonators. The pellets are 0.6 mm in diameter and 3 mm length with different type of steel confinement 2.2 mm thick and 4.7 mm thick. The influence of an aluminum confinement is calculated for the standard LX 16 pellet 3 mm in diameter and 3 mm in height. The question of reducing the size of the donor charge is also investigated to small scale the test itself.

  20. A unique gun application for both high velocity and low velocity projectiles in a standard 155mm long tom gun

    SciTech Connect (OSTI)

    Garcia, J.R.

    1990-01-01

    The Terminal Ballistics Facility at Sandia National Laboratores in Albuquerque, New Mexico has developed an inexpensive and reliable capability for environmental testing of nuclear and kinetic energy weapon systems using the standard military 155 mm long tom gun. An unusual priming technique and charge configuration developed by Sandia National laboratories provides repeatable results such that payloads may be launched outside of the normal operating regime (both high and low) for the 155 mm gun. A 15 pound payload was reliably launched at 1000 fps with a breech pressure of 3000 psi. Another 20 pound payload was reliably launched to 5000 fps with a breech pressure of 50000 psi. A detailed description of charge configuration and test results is presented. 21 figs., 4 tabs.

  1. Accelerator Quality HTS Dipole Magnet Demonstrator Designs for the EuCARD-2, 5 Tesla 40 mm Clear Aperture Magnet

    E-Print Network [OSTI]

    Kirby, G A; Ballarino, A; Bottura, L; Chouika, N; Clement, S; Datskov, V; Fajardo, L; Fleiter, J; Gauthier, R; Gentini, L; Lambert, L; Lopes, M; Perez, J C; de Rijk, G; Rijllart, A; Rossi, L; ten Kate, H; Durante, M; Fazilleau, P; Lorin, C; Härö, E; Stenvall, A; Caspi, S; Marchevsky, M; Goldacker, W; Kario, A

    2015-01-01

    Future high-energy accelerators will need very high magnetic fields in the range of 20 T. The EuCARD-2 work-package-10 is a collaborative push to take HTS materials into an accelerator quality demonstrator magnet. The demonstrator will produce 5 T standalone and between 17 T and 20 T, when inserted into the 100 mm aperture of Fresca-2 high field out-sert magnet. The HTS magnet will demonstrate the field strength and field quality that can be achieved. An effective quench detection and protection system will have to be developed to operate with the HTS superconducting materials. This paper presents a ReBCO magnet design using multi strand Roebel cable that develops a stand-alone field of 5 T in a 40 mm clear aperture and discusses the challenges associated with good field quality using this type of material. A selection of magnet designs is presented as result of a first phase of development.

  2. Accelerator Quality HTS Dipole Magnet Demonstrator designs for the EuCARD-2, 5 Tesla 40 mm Clear Aperture Magnet

    E-Print Network [OSTI]

    Kirby, G; Ballarino, A; Bottura, L; Chouika, N; Clement, S; Datskov, V; Fajardo, L; Fleiter, J; Gauthier, R; Lambert, L; Lopes, M; Perez, J; DeRijk, G; Rijllart, A; Rossi, L; Ten Kate, H; Durante, M; Fazilleau, P; Lorin, C; Haro, E; Stenvall, A; Caspi, S; Marchevsky, M; Goldacker, W; Kario, A

    2014-01-01

    Future high-energy accelerators will need very high magnetic fields in the range of 20 T. The EuCARD-2 work-package-10 is a collaborative push to take HTS materials into an accelerator quality demonstrator magnet. The demonstrator will produce 5 T standalone and between 17 T and 20 T, when inserted into the 100 mm aperture of Fresca-2 high field out-sert magnet. The HTS magnet will demonstrate the field strength and field quality that can be achieved. An effective quench detection and protection system will have to be developed to operate with the HTS superconducting materials. This paper presents a ReBCO magnet design using multi strand Roebel cable that develops a stand-alone field of 5 T in a 40 mm clear aperture and discusses the challenges associated with good field quality using this type of material. A selection of magnet designs is presented as result of a first phase of development.

  3. How large should the QM region be in QM/MM calculations? The case of catechol O-methyltransferase

    E-Print Network [OSTI]

    Heather J. Kulik; Jianyu Zhang; Judith P. Klinman; Todd J. Martinez

    2015-05-21

    Hybrid quantum mechanical-molecular mechanical (QM/MM) simulations are widely used in studies of enzymatic catalysis. Up until now, it has usually been cost prohibitive to determine the convergence of these calculations with respect to the size of the QM region. Recent advances in reformulating electronic structure algorithms for stream processors such as graphical processing units have made QM/MM calculations of optimized reaction paths with QM regions comprising up to O(10^3) atoms feasible. Here, we leverage these GPU-accelerated quantum chemistry methods to investigate catalytic properties in catechol O-methyltransferase. Using QM regions ranging in size from the reactant only (63 atoms) up to nearly one-third of the entire protein (940 atoms), we show that convergence of properties such as the activation energy of the catalyzed reaction can be quite slow. Convergence to within chemical accuracy for this case requires a quantum mechanical region with approximately 500 atoms. These results call for a more careful determination of QM region sizes in future QM/MM studies of enzymes.

  4. A compact proton spectrometer for measurement of the absolute DD proton spectrum from which yield and pR are determined in thin-shell inertial-confinement-fusion implosions

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rosenberg, M. J.; Zylstra, A. B.; Frenje, J. A.; Rinderknecht, H. G.; Gatu Johnson, M.; Waugh, C. J.; Seguin, F. H.; Sio, H.; Sinenian, N.; Li, C. K.; et al

    2014-10-10

    A compact, step range filter proton spectrometer has been developed for the measurement of the absolute DD proton spectrum, from which yield and areal density (?R) are inferred for deuterium-filled thin-shell inertial confinement fusion implosions. This spectrometer, which is based on tantalum step-range filters, is sensitive to protons in the energy range 1-9 MeV and can be used to measure proton spectra at mean energies of ~1-3 MeV. It has been developed and implemented using a linear accelerator and applied to experiments at the OMEGA laser facility and the National Ignition Facility (NIF). Modeling of the proton slowing in themore »filters is necessary to construct the spectrum, and the yield and energy uncertainties are ±« less

  5. Magnetic Materials (MM)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousandReport) |Administration Savannah River

  6. The Three-mm Ultimate Mopra Milky Way Survey. I. Survey Overview, Initial Data Releases, and First Results

    E-Print Network [OSTI]

    Barnes, Peter J; Indermuehle, Balthasar; O'Dougherty, Stefan N; Lowe, Vicki; Cunningham, Maria R; Hernandez, Audra K; Fuller, Gary A

    2015-01-01

    We describe a new mm-wave molecular-line mapping survey of the southern Galactic Plane and its first data releases. The Three-mm Ultimate Mopra Milky Way Survey (ThrUMMS) maps a 60{\\deg}x2{\\deg} sector of our Galaxy's fourth quadrant, using a combination of fast mapping techniques with the Mopra radio telescope, simultaneously in the J=1-0 lines of $^{12}$CO, $^{13}$CO, C$^{18}$O, and CN near 112 GHz at ~arcminute and ~0.3 km s$^{-1}$ resolution, with ~2 K channel$^{-1}$ sensitivity for $^{12}$CO and ~1 K channel$^{-1}$ for the other transitions. The calibrated data cubes from these observations are made available to the community after processing through our pipeline. Here, we describe the motivation for ThrUMMS, the development of new observing techniques for Mopra, and how these techniques were optimised to the objectives of the survey. We showcase some sample data products and describe the first science results on CO-isotopologue line ratios. These vary dramatically across the Galactic Plane, indicating a...

  7. How large should the QM region be in QM/MM calculations? The case of catechol O-methyltransferase

    E-Print Network [OSTI]

    Kulik, Heather J; Klinman, Judith P; Martinez, Todd J

    2015-01-01

    Hybrid quantum mechanical-molecular mechanical (QM/MM) simulations are widely used in studies of enzymatic catalysis. Up until now, it has usually been cost prohibitive to determine the convergence of these calculations with respect to the size of the QM region. Recent advances in reformulating electronic structure algorithms for stream processors such as graphical processing units have made QM/MM calculations of optimized reaction paths with QM regions comprising up to O(10^3) atoms feasible. Here, we leverage these GPU-accelerated quantum chemistry methods to investigate catalytic properties in catechol O-methyltransferase. Using QM regions ranging in size from the reactant only (63 atoms) up to nearly one-third of the entire protein (940 atoms), we show that convergence of properties such as the activation energy of the catalyzed reaction can be quite slow. Convergence to within chemical accuracy for this case requires a quantum mechanical region with approximately 500 atoms. These results call for a more ...

  8. New Applications of Gamma Spectroscopy: Characterization Tools for D&D Process Development, Inventory Reduction Planning & Shipping, Safety Analysis & Facility Management During the Heavy Element Facility Risk Reduction Program

    SciTech Connect (OSTI)

    Mitchell, M; Anderson, B; Gray, L; Vellinger, R; West, M; Gaylord, R; Larson, J; Jones, G; Shingleton, J; Harris, L; Harward, N

    2006-01-23

    Novel applications of gamma ray spectroscopy for D&D process development, inventory reduction, safety analysis and facility management are discussed in this paper. These applications of gamma spectroscopy were developed and implemented during the Risk Reduction Program (RPP) to successfully downgrade the Heavy Element Facility (B251) at Lawrence Livermore National Laboratory (LLNL) from a Category II Nuclear Facility to a Radiological Facility. Non-destructive assay in general, gamma spectroscopy in particular, were found to be important tools in project management, work planning, and work control (''Expect the unexpected and confirm the expected''), minimizing worker dose, and resulted in significant safety improvements and operational efficiencies. Inventory reduction activities utilized gamma spectroscopy to identify and confirm isotopics of legacy inventory, ingrowth of daughter products and the presence of process impurities; quantify inventory; prioritize work activities for project management; and to supply information to satisfy shipper/receiver documentation requirements. D&D activities utilize in-situ gamma spectroscopy to identify and confirm isotopics of legacy contamination; quantify contamination levels and monitor the progress of decontamination efforts; and determine the point of diminishing returns in decontaminating enclosures and glove boxes containing high specific activity isotopes such as {sup 244}Cm and {sup 238}Pu. In-situ gamma spectroscopy provided quantitative comparisons of several decontamination techniques (e.g. TLC-free Stripcoat{trademark}, Radiac{trademark} wash, acid wash, scrubbing) and was used as a part of an iterative process to determine the appropriate level of decontamination and optimal cost to benefit ratio. Facility management followed a formal, rigorous process utilizing an independent, state certified, peer-reviewed gamma spectroscopy program, in conjunction with other characterization techniques, process knowledge, and historical records, to provide information for work planning, work prioritization, work control, and safety analyses (e.g. development of hold points, stop work points); and resulted in B251 successfully achieving Radiological status on schedule. Gamma spectroscopy helped to define operational approaches to achieve radiation exposure ALARA, e.g. hold points, appropriate engineering controls, PPE, workstations, and time/distance/shielding in the development of ALARA plans. These applications of gamma spectroscopy can be used to improve similar activities at other facilities.

  9. Electron dynamics in complex environments with real-time time dependent density functional theory in a QM-MM framework

    SciTech Connect (OSTI)

    Morzan, Uriel N.; Ramírez, Francisco F.; Scherlis, Damián A. E-mail: mcgl@qb.ffyb.uba.ar; Lebrero, Mariano C. González E-mail: mcgl@qb.ffyb.uba.ar

    2014-04-28

    This article presents a time dependent density functional theory (TDDFT) implementation to propagate the Kohn-Sham equations in real time, including the effects of a molecular environment through a Quantum-Mechanics Molecular-Mechanics (QM-MM) hamiltonian. The code delivers an all-electron description employing Gaussian basis functions, and incorporates the Amber force-field in the QM-MM treatment. The most expensive parts of the computation, comprising the commutators between the hamiltonian and the density matrix—required to propagate the electron dynamics—, and the evaluation of the exchange-correlation energy, were migrated to the CUDA platform to run on graphics processing units, which remarkably accelerates the performance of the code. The method was validated by reproducing linear-response TDDFT results for the absorption spectra of several molecular species. Two different schemes were tested to propagate the quantum dynamics: (i) a leap-frog Verlet algorithm, and (ii) the Magnus expansion to first-order. These two approaches were confronted, to find that the Magnus scheme is more efficient by a factor of six in small molecules. Interestingly, the presence of iron was found to seriously limitate the length of the integration time step, due to the high frequencies associated with the core-electrons. This highlights the importance of pseudopotentials to alleviate the cost of the propagation of the inner states when heavy nuclei are present. Finally, the methodology was applied to investigate the shifts induced by the chemical environment on the most intense UV absorption bands of two model systems of general relevance: the formamide molecule in water solution, and the carboxy-heme group in Flavohemoglobin. In both cases, shifts of several nanometers are observed, consistently with the available experimental data.

  10. To obtain representative temperatures, sensors were made with a length of 35 cm. The stainless steel needles have a diameter of 3 mm. Inside are five

    E-Print Network [OSTI]

    Haak, Hein

    To obtain representative temperatures, sensors were made with a length of 35 cm. The stainless steel needles have a diameter of 3 mm. Inside are five Platinum Pt-100 sensors, that are cascaded

  11. 8/25/13 6:41 PMAbstract Print View Page 1 of 2http://www.abstractsonline.com/Plan/AbstractPrintView.aspx?mID=3...48dd-a694-5da17aaea24b&cKey=23bd58e1-58ec-43de-bfb3-e28918cc3ba0

    E-Print Network [OSTI]

    Shenoy, Krishna V.

    .abstractsonline.com/Plan/AbstractPrintView.aspx?mID=3...48dd-a694-5da17aaea24b&cKey=23bd58e1-58ec-43de-bfb3-e28918cc3ba0 Print this Page Presentation&cKey=23bd58e1-58ec-43de-bfb3-e28918cc3ba0 movements. We summarize results from 7 sessions in which

  12. Methanol Masers Observations in the 3-mm Bandwidth at the Radio Telescope RT-22 CrAO

    E-Print Network [OSTI]

    S. Yu. Zubrin; A. V. Antyufeyev; V. V. Myshenko; V. M. Shulga

    2007-12-10

    We report the beginning of the astronomical masers investigations in the 3-mm bandwidth at the radio telescope RT-22 (CrAO, Ukraine). For this purpose the special complex for maser lines investigation in 85...115 GHz frequency band is developed. It is made on the base of the low noise cryogenic Shottky-diode receiver and the high resolution Fourier-spectrometer. The cryogenic receiver has the DSB noise temperature less than 100K. The spectral channel separation of the Fourier-spectrometer is about 4kHz and the spectrometer bandwidth is 8 MHz. Results of maser observations of 8$^{0}-7^{1} $A$^{+}$ transition of methanol (95.169 GHz) towards DR-21(OH), DR-21W and NGC7538 are in good agreement with early obtained results by other authors. On the basis of the analysis of the location of masers in the NGC7538 direction we can assume that the origin of all known class I methanol masers in this region is connected with existing molecular outflows from young stars.

  13. A 0.042 mm^2 programmable biphasic stimulator for cochlear implants suitable for a large number of channels

    E-Print Network [OSTI]

    Ngamkham, W; Serdijn, W A; Bes, C J; Briaire, J J; Frijns, J H M

    2015-01-01

    This paper presents a compact programmable biphasic stimulator for cochlear implants. By employing double-loop negative feedback, the output impedance of the current generator is increased, while maximizing the voltage compliance of the output transistor. To make the stimulator circuit compact, the stimulation current is set by scaling a reference current using a two stage binary-weighted transistor DAC (comprising a 3 bit high-voltage transistor DAC and a 4 bit low-voltage transistor DAC). With this structure the power consumption and the area of the circuit can be minimized. The proposed circuit has been implemented in AMS 0.18um high-voltage CMOS IC technology, using an active chip area of about 0.042mm^2. Measurement results show that proper charge balance of the anodic and cathodic stimulation phases is achieved and a dc blocking capacitor can be omitted. The resulting reduction in the required area makes the proposed system suitable for a large number of channels.

  14. Mathematical Model for the Optimal Utilization Percentile in M/M/1 Systems: A Contribution about Knees in Performance Curves

    E-Print Network [OSTI]

    Gonzalez-Horta, Francisco A; Ramirez-Cortes, Juan M; Martinez-Carballido, Jorge; Buenfil-Alpuche, Eldamira

    2011-01-01

    Performance curves of queueing systems can be analyzed by separating them into three regions: the flat region, the knee region, and the exponential region. Practical considerations, usually locate the knee region between 70-90% of the theoretical maximum utilization. However, there is not a clear agreement about where the boundaries between regions are, and where exactly the utilization knee is located. An open debate about knees in performance curves was undertaken at least 20 years ago. This historical debate is mainly divided between those who claim that a knee in the curve is not a well defined term in mathematics, or it is a subjective and not really meaningful concept, and those who define knees mathematically and consider their relevance and application. In this paper, we present a mathematical model and analysis for identifying the three mentioned regions on performance curves for M/M/1 systems; specifically, we found the knees, or optimal utilization percentiles, at the vertices of the hyperbolas tha...

  15. Operating characteristics of a 7. 6 mm (0. 30 inch) diameter two-stage light-gas gun

    SciTech Connect (OSTI)

    Susoeff, A R; Hawke, R S; Bowen, P R; Greenwood, D W; Marshall, F R

    1992-07-01

    a series of tests was conducted to determine the operating requirements needed to obtain maximum projectile velocity within the engineering design limits of a two-stage light-gas gun with a 7.6 mm (0.30 inch) diameter bore launch tube. The tests were conducted in a medium vacuum flight range. Previous experience with the gun was used to establish the minimum requirements for optimum efficiency. Two operating parameters, propellant load and drive gas pressure, were varied in order to find an initial optimum operating condition at a conservative propellant load. Propellant load and driver gas pressure were then incrementally increased. This procedure was methodically applied until significant mechanical deformation of a critical gun component took place. This report presents the results of these tests. Projectile velocity was measured to better than 3 percent accuracy using a magnetic induction technique. A 0.485 gram polycarbonate projectile was launched to a velocity of 7.77 km/s during the tests. 13 refs.

  16. US graphite reactor D&D experience

    SciTech Connect (OSTI)

    Garrett, S.M.K.; Williams, N.C.

    1997-02-01

    This report describes the results of the U.S. Graphite Reactor Experience Task for the Decommissioning Strategy Plan for the Leningrad Nuclear Power Plant (NPP) Unit 1 Study. The work described in this report was performed by the Pacific Northwest National Laboratory (PNNL) for the Department of Energy (DOE).

  17. D&D Engineering & Design Guidance

    Broader source: Energy.gov (indexed) [DOE]

    remain active is closely linked with heating needs to prevent wet pipe systems from freezing, which in turn relates to steam and electrical systems. Ongoing maintenance must also...

  18. Understanding foams & foaming D.D. Joseph

    E-Print Network [OSTI]

    Joseph, Daniel D.

    in applications ranging from the transport of cuttings in drilling and the placement of sands in cracks in oil. To keep a foam To appear in the column entitled Signi cant Questions in Fluid Mechanics," in the Journal of Fluids Engineering. 1 #12;CMC CMC Figure 1: Surface tension versus bulk concentration . CMC

  19. D&D Engineering & Design Guidance

    Broader source: Energy.gov (indexed) [DOE]

    piping and equipment arrangement drawings, electrical one-line diagrams, electrical termination and instrument loop schematics, and other documents as required. Decisions on...

  20. Microsoft Word - turner-dd2.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetection ofOctober10 Years2, 199926,4989BRDF

  1. Microsoft Word - turner-dd3.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetection ofOctober10 Years2, 199926,4989BRDFImproved PWV

  2. Director's Discretionary (DD) Program | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB PacketDiesel pricesCenter at Cornell Director

  3. JSS Journal of Statistical Software MMMMMM YYYY, Volume VV, Issue II. http://www.jstatsoft.org/

    E-Print Network [OSTI]

    Dahl, David B.

    . The jvmr package also provides the reverse functionality for embedding JVM languages in R using, is statistically typed, and is often more concise and expressive than equivalent Java code. R is a scripting language and environment devel- oped by statisticians for statistical computing and graphics with a large

  4. JSS Journal of Statistical Software MMMMMM YYYY, Volume VV, Issue II. http://www.jstatsoft.org/

    E-Print Network [OSTI]

    Gelman, Andrew

    began by adding custom vectorized logistic regressions to JAGS using C++ to overcome the cost reverse-mode algorithmic differentiation, which, given a templated C++ function for the log posterior

  5. The MagLab's ultra-wide-bore (105mm) 21.1T NMR/MRI magnet provides an opportunity to use low gamma, low

    E-Print Network [OSTI]

    McQuade, D. Tyler

    The MagLab's ultra-wide-bore (105mm) 21.1T NMR/MRI magnet provides an opportunity to use low gamma, low sensitive nuclei for MR imaging. The potential of nuclei such as chlorine remains largely and the capability of MRI at ultra high magnetic fields to observe glioma. The finding of an increased concentration

  6. 10 to 70% methanol in 50 mM KH2PO4 over 25 min, 10 ml/min, monitor at 380 nm). Next, the HPLC-

    E-Print Network [OSTI]

    Gao, Jinming

    10 to 70% methanol in 50 mM KH2PO4 over 25 min, 10 ml/min, monitor at 380 nm). Next, the HPLC- purified mixture was desalted on the same column (methanol was removed on a rotary evaporator, and the sample loaded in H2O and eluted with 90% methanol) and lyophilized, yielding the purified Nvoc

  7. Machine Design -2 Consider a machined 60mm diameter shaft made of AISI 1020 HR (Sut = 380 MPa at 20C) quenched

    E-Print Network [OSTI]

    Battaglia, Francine

    Machine Design - 2 Consider a machined 60mm diameter shaft made of AISI 1020 HR (Sut = 380 MPa at 20°C) quenched steel shown below. The shaft is supported by bearings at the ends. Mounted upon the shaft are two collars through which fluctuating loads are applied as shown. A groove is machined

  8. Palomar Testbed Interferometer -Update B.F. Lane a , M.M. Colavita b , A.F. Boden b , P.R. Lawson b (for the PTI Collaboration)

    E-Print Network [OSTI]

    Palomar Testbed Interferometer - Update B.F. Lane a , M.M. Colavita b , A.F. Boden b , P.R. Lawson, 4800 Oak Grove Dr., Pasadena, CA., 91109, USA. ABSTRACT The Palomar Testbed Interferometer (PTI) is a long-baseline near-infrared interferometer operating at Palomar Observatory, CA. The interferometer has

  9. AzTEC/ASTE 1.1-mm survey of SSA22: Counterpart identification and photometric redshift survey of submillimetre galaxies

    E-Print Network [OSTI]

    Umehata, H.; Tamura, Y.; Kohno, K.; Hatsukade, B.; Scott, K. S.; Kubo, M.; Yamada, T.; Ivison, R. J.; Cybulski, R.; Aretxaga, I.; Austermann, J.; Hughes, D. H.; Ezawa, H.; Hayashino, T.; Ikarashi, S.; Iono, D.; Kawabe, R.; Matsuda, Y.; Matsuo, H.; Nakanishi, K.; Oshima, T.; Perera, Thushara A.; Takata, T.; Wilson, Graham Wallace; Yun, M. S.

    2014-06-01

    We present the results from a 1.1-mm imaging survey of the SSA22 field, known for having an overdensity of z = 3.1 Lyman ? emitting galaxies (LAEs), taken with the astronomical thermal emission camera (AzTEC) on the Atacama ...

  10. A self-consistent MoD-WM/MM structural refinement method: characterization of hydrogen bonding in the orytricha nova G-1uar

    SciTech Connect (OSTI)

    Batista, Enrique R [Los Alamos National Laboratory; Newcomer, Micharel B [YALE UNIV; Raggin, Christina M [YALE UNIV; Gascon, Jose A [YALE UNIV; Loria, J Patrick [YALE UNIV; Batista, Victor S [YALE UNIV

    2008-01-01

    This paper generalizes the MoD-QM/MM hybrid method, developed for ab initio computations of protein electrostatic potentials [Gasc6n, l.A.; Leung, S.S.F.; Batista, E.R.; Batista, V.S. J. Chem. Theory Comput. 2006,2, 175-186], as a practical algorithm for structural refinement of extended systems. The computational protocol involves a space-domain decomposition scheme for the formal fragmentation of extended systems into smaller, partially overlapping, molecular domains and the iterative self-consistent energy minimization of the constituent domains by relaxation of their geometry and electronic structure. The method accounts for mutual polarization of the molecular domains, modeled as Quantum-Mechanical (QM) layers embedded in the otherwise classical Molecular-Mechanics (MM) environment according to QM/MM hybrid methods. The method is applied to the description of benchmark models systems that allow for direct comparisons with full QM calculations, and subsequently applied to the structural characterization of the DNA Oxytricha nova Guanine quadruplex (G4). The resulting MoD-QM/MM structural model of the DNA G4 is compared to recently reported highresolution X-ray diffraction and NMR models, and partially validated by direct comparisons between {sup 1}H NMR chemical shifts that are highly sensitive to hydrogen-bonding and stacking interactions and the corresponding theoretical values obtained at the density functional theory DFT QM/MM (BH&H/6-31 G*:Amber) level in conjunction with the gauge independent atomic orbital (GIAO) method for the ab initio self consistent-field (SCF) calculation of NMR chemical shifts.

  11. The effect of temperature and gas flow on the physical vapour growth of mm-scale rubrene crystals for organic FETs

    E-Print Network [OSTI]

    A. R. Ullah; A. P. Micolich; J. W. Cochrane; A. R. Hamilton

    2007-11-12

    There has recently been significant interest in rubrene single-crystals grown using physical vapour transport techniques due to their application in high-mobility organic field-effect transistor (OFET) devices. Despite numerous studies of the electrical properties of such crystals, there has only been one study to date focussing on characterising and optimising the crystal growth as a function of the relevant growth parameters. Here we present a study of the dependence of the yield of useful crystals (defined as crystals with at least one dimension of order 1 mm) on the temperature and volume flow of carrier gas used in the physical vapour growth process.

  12. Coupling MM5 with ISOLSM:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit the followingConcentratingPortalCoolCoronaryCosts Associated4-Year/%2A Yun

  13. Photometric study of southern SU UMa-type dwarf novae and candidates -- III: NSV 10934, MM Sco, AB Nor, CAL 86

    E-Print Network [OSTI]

    T. Kato; P. Nelson; C. Stockdale; B. Monard; T. Richards; R. Stubbings; H. Yamaoka; B. Heathcote; R. Santallo

    2003-10-01

    We photometrically observed four southern dwarf novae in outburst (NSV 10934, MM Sco, AB Nor and CAL 86). NSV 10934 was confirmed to be an SU UMa-type dwarf nova with a mean superhump period of 0.07478(1) d. This star also showed transient appearance of quasi-periodic oscillations (QPOs) during the final growing stage of the superhumps. Combined with the recent theoretical interpretation and with the rather unusual rapid terminal fading of normal outbursts, NSV 10934 may be a candidate intermediate polar showing SU UMa-type properties. The mean superhump periods of MM Sco and AB Nor were determined to be 0.06136(4) d and 0.08438(2) d, respectively. We suggest that AB Nor belongs to a rather rare class of long-period SU UMa-type dwarf novae with low mass-transfer rates. We also observed an outburst of the suspected SU UMa-type dwarf nova CAL 86. We identified this outburst as a normal outburst and determined the mean decline rate of 1.1 mag/d.

  14. 2/1/2014 Micro Windmill-Powered Chargers -This 1.88MM Wide Windmill Can Recharge Your Smartphone Battery(VIDEO) http://www.trendhunter.com/trends/windmill-powered 1/7

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    2/1/2014 Micro Windmill-Powered Chargers - This 1.88MM Wide Windmill Can Recharge Your Smartphone Battery(VIDEO) http://www.trendhunter.com/trends/windmill-powered 1/7 Select Category TECH Wholesale Solar: Jan 22, 2014 · References: youtube and gizmag This 1.88MM Wide Windmill Can Recharge Your Smartphone

  15. Comparing Terminal Performance of .357 SIG and 9mm Bullets in Ballistic Gelatin Using Retarding Force Analysis from High Speed Video

    E-Print Network [OSTI]

    Keys, Elizabeth; Courtney, Michael

    2015-01-01

    High-speed video has emerged as an valuable tool for quantifying bullet performance in ballistic gelatin. This paper presents the results of testing four .357 SIG bullets using high-speed video of bullet impacts in ballistic gelatin to determine retarding force curves, permanent cavities, temporary cavities, and energy deposit vs. penetration depth. Since the methods are identical, results are meaningfully compared with four 9mm NATO bullets studied in an earlier project. Though .357 SIG bullets perform slightly better due to higher impact energy, the principal finding is that there is a much bigger difference in performance between the best and worst performing bullets in each cartridge than there is between bullets of similar design in the two cartridges. In each cartridge, higher performing expanding bullets (jacketed hollow points) outperform non-expanding bullets (full metal jacket) by a wide margin, showing a much higher probability of rapid incapacitation according to an Army Research Laboratory model ...

  16. An AzTEC 1.1-mm Survey for ULIRGs in the field of the Galaxy Cluster MS 0451.6-0305

    E-Print Network [OSTI]

    Wardlow, J L; Wilson, G W; Yun, M S; Coppin, K E K; Cybulski, R; Geach, J E; Ivison, R J; Aretxaga, I; Austermann, J E; Edge, A C; Fazio, G G; Huang, J; Hughes, D H; Kodama, T; Kang, Y; Kim, S; Mauskopf, P D; Perera, T A; Scott, K S

    2009-01-01

    We have undertaken a deep (sigma~1.1 mJy) 1.1-mm survey of the z=0.54 cluster MS 0451.6-0305 using the AzTEC camera on the James Clerk Maxwell Telescope. We detect 36 sources with S/N>3.5 in the central 0.10 deg^2 and present the AzTEC map, catalogue and number counts. We identify counterparts to 18 sources (50%) using radio, mid-infrared, Spitzer IRAC and Submillimeter Array data. Optical, near- and mid-infrared spectral energy distributions are compiled for the 14 of these galaxies with detectable counterparts, which are expected to contain all likely cluster members. We then use photometric redshifts and colour selection to separate background galaxies from potential cluster members and test the reliability of this technique using archival observations of submillimetre galaxies. We find two potential MS 0451-03 members, which, if they are both cluster galaxies have a total star-formation rate (SFR) of ~100 solar masses per year -- a significant fraction of the combined SFR of all the other galaxies in MS 0...

  17. A mm-Scale Dosimetry System Based on Optically Stimulated Luminescence of Beryllium Oxide for Investigation of Dose Rate Profiles in Constricted Environments - 12219

    SciTech Connect (OSTI)

    Sommer, Marian; Jahn, Axel; Sommer, Dora; Henniger, Juergen [Technische Universitaet Dresden, Institute for Nuclear and Particle Physics, Radiation Physics Group, D-01062 Dresden (Germany); Praetorius, Reiner M. [Wiederaufarbeitungsanlage Karlsruhe Rueckbau- und Entsorgungs- GmbH, POB 1263, D-76339 Eggenstein-Leopoldshafen (Germany)

    2012-07-01

    The dismantling of the former German fuel reprocessing research center Wiederaufbeitungsanlage Karlsruhe requires extensive investigations of contamination and dose rate inside of the shielded areas. Particularly for first the exploration of radiation field existing thermo-element pipes may offer access to the tanks and to other interesting points without the risk of contamination. Because of their small dimension, almost no active dosimetry systems are able to measure inside the pipes. New mm-scale luminescence dosimeters in combination with a packing and transport technique are presented. The dosimeters could measure doses from 0.1 mGy up to more than 100 Gy. Hence, over the possible exposure time durations, dose rates from ?Gyh{sup -1} up to 1000 Gyh{sup -1} are ascertainable. For potential users the system opens the opportunity for investigation of dose rates inside of shielding and in contaminated environments. Particularly in constricted environments the technique is a unique solution for dose and dose rate measurement tasks. Within the linear dose range up to several ten Gy, the uncertainty of the results is less than 5%. 100 Gy-doses can be specified within 20%, with individual high dose calibration of the detectors even better. For WAK and other potential users the system offers the opportunity to investigate dose rates inside of shieldings and in contaminated environments. Particularly in constricted environments the technique is an unique solution for dose and dose rate measurements. (authors)

  18. High moisture corn stover pelleting in a flat die pellet mill fitted with a 6 mm die: physical properties and specific energy consumption

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Tumuluru, Jaya Shankar

    2015-06-15

    The quality and specific energy consumption (SEC) of the biomass pellets produced depend upon pelleting process conditions. The present study includes understanding the effect of feedstock moisture in the range of 28–38% (wet basis [w.b.]) and preheating in the range of 30–110°C at two die speeds of 40 and 60 Hz on the physical properties and SEC. A flat die pellet mill fitted with a 6 mm die was used in the present study. The physical properties of pellets such as moisture content, unit, bulk and tapped density, durability, and expansion ratio and SEC of the pelleting process are measured.more »The results indicate that the pellets produced have durability values in the range of 87–98%, and unit bulk and tapped density in the range of 670–1100, 375–575, and 420–620 kg/m³. Increasing the feedstock moisture content from 33% to 38% (w.b) decreased the unit, bulk and tapped density by about 30–40%. Increasing feedstock moisture content increased the expansion ratio and decreased the density values. A higher feedstock moisture content of 38% (w.b.) and higher preheating temperature of 110°C resulted in lower density and a higher expansion ratio, which can be attributed to flash off of moisture as the material extrudes out of the die. The SEC was in the range of 75–275 kWh/ton. Higher feedstock moisture content of 38% (w.b.) and a lower die speed of 40 Hz increased the SEC, whereas lower to medium preheating temperature (30–70°C), medium feedstock moisture content of 33% (w.b.), and a higher die speed of 60 Hz minimized the SEC to « less

  19. Computation of the free energy due to electron density fluctuation of a solute in solution: A QM/MM method with perturbation approach combined with a theory of solutions

    SciTech Connect (OSTI)

    Suzuoka, Daiki; Takahashi, Hideaki Morita, Akihiro

    2014-04-07

    We developed a perturbation approach to compute solvation free energy ?? within the framework of QM (quantum mechanical)/MM (molecular mechanical) method combined with a theory of energy representation (QM/MM-ER). The energy shift ? of the whole system due to the electronic polarization of the solute is evaluated using the second-order perturbation theory (PT2), where the electric field formed by surrounding solvent molecules is treated as the perturbation to the electronic Hamiltonian of the isolated solute. The point of our approach is that the energy shift ?, thus obtained, is to be adopted for a novel energy coordinate of the distribution functions which serve as fundamental variables in the free energy functional developed in our previous work. The most time-consuming part in the QM/MM-ER simulation can be, thus, avoided without serious loss of accuracy. For our benchmark set of molecules, it is demonstrated that the PT2 approach coupled with QM/MM-ER gives hydration free energies in excellent agreements with those given by the conventional method utilizing the Kohn-Sham SCF procedure except for a few molecules in the benchmark set. A variant of the approach is also proposed to deal with such difficulties associated with the problematic systems. The present approach is also advantageous to parallel implementations. We examined the parallel efficiency of our PT2 code on multi-core processors and found that the speedup increases almost linearly with respect to the number of cores. Thus, it was demonstrated that QM/MM-ER coupled with PT2 deserves practical applications to systems of interest.

  20. MHD Simulations of a Supernova-driven ISM Alex S Hill1, MR Joung2,5, RA Benjamin3, LM Haffner1, C Klingenberg4, M-M Mac Low5, K Waagan6, KA Wood7

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    Klingenberg4, M-M Mac Low5, K Waagan6, KA Wood7 1U of Wisconsin-Madison, 2Columbia U, 3U of Wisconsin, implying that the simulations have more low density and more high density gas than the real ISM (Wood et al, resulting in the near-absence of the warm ionized medium at those heights (Wood et al 2010). 3) The model

  1. Acid Washed Glass Beads 1. Weigh 50 g of 0.5 mm glass beads (Sigma G-9268, 425-600 m) into a 100 ml-orange cap Pyrex

    E-Print Network [OSTI]

    Aris, John P.

    Acid Washed Glass Beads 1. Weigh 50 g of 0.5 mm glass beads (Sigma G-9268, 425-600 µm) into a 100 ml-orange cap Pyrex bottle. The volume of glass beads should be no more than 1/5 of the volume of the bottle used for washes. To scale up, use 100 g of glass beads and a 250 ml orange cap Pyrex bottle. 2

  2. RNA Extraction and Labeling 1. To IP pellet (~ 25 l vol), add 175 l of: 10 mM HEPES-NaOH, pH 7.5

    E-Print Network [OSTI]

    Aris, John P.

    85 RNA Extraction and Labeling 1. To IP pellet (~ 25 µl vol), add 175 µl of: 10 mM HEPES-NaOH, pH 7 Speed-Vac. 7. Labeling 3' ends. To each pellet, add 10 µl containing: 1 X NEB RNA Ligase buffer 10% DMSO precipitate. Use DEPC-treated 3M NaOAc, pH 5. Wash with 75% EtOH and dry. 12. Resuspend pellet completely in 5

  3. High Intensity, Pulsed, D-D Neutron Generator

    E-Print Network [OSTI]

    Williams, D. L.

    2010-01-01

    application. Whether thermal activation (measuring prompt orthermal neutrons for both prompt and delayed gamma neutron activation

  4. Helium Catalyzed D-D Fusion in a Levitated Dipole

    E-Print Network [OSTI]

    such as a hard core z-pinch or a dipole. The HEI instability and the MHD-like centrifugally-driven mode have been LDX will explore stability & confinement limits in a dipole field. Fusion concept for advanced fuels . This property makes LDX particularly interesting for advanced fuels. (pV ) (S) = 0, where V dl B , = 5 3 p

  5. First observation of the decay B-0 -> D*D+*(-)

    E-Print Network [OSTI]

    Ammar, Raymond G.; Baringer, Philip S.; Bean, Alice; Besson, David Zeke; Coppage, Don; Davis, Robin E. P.; Kotov, S.; Kravchenko, I.; Kwak, Nowhan; Zhou, L.

    1999-04-01

    ] Particle Data Group, C. Caso et al., Eur. Phys. J. C 3,1 (1998). [4] R. Aleksan et al., Phys. Lett. B 317, 173 (1993). [5] I. Dunietz et al., Phys. Rev. D 43, 2193 (1991). [6] CLEO Collaboration, D. Gibaut et al., Phys. Rev. D 53, 4734 (1996); ARGUS...

  6. Search for the decays B-0->D(*)D+(*)(-)

    E-Print Network [OSTI]

    Ammar, Raymond G.; Baringer, Philip S.; Bean, Alice; Besson, David Zeke; Coppage, Don; Darling, C.; Davis, Robin E. P.; Hancock, N.; Kotov, S.; Kravchenko, I.; Kwak, Nowhan

    1997-08-01

    . B 317, 173 (1993). [2] The BaBar Collaboration, Technical Design Report No. SLAC-R-95-457, 1995. [3] K. Lingel et al., Report No. CLNS 91-1043, 1991. [4] CLEO Collaboration, D. Gibaut et al., Phys. Rev. D 53, 4734 (1996). [5] CLEO Collaboration, Y...

  7. Section E Nuclear Facility D&D, Remainder of Hanford

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    months Completed annual surveillance of Redox facilities. Completed replacement of PUREX uninterruptible power supply (UPS) battery cell. EMS Objectives and Target Status...

  8. DD FORM 882, JUL 2005 REPORT OF INVENTIONS AND SUBCONTRACTS

    E-Print Network [OSTI]

    Maryland, Baltimore County, University of

    " REQUIRED TO BE REPORTED BY CONTRACTOR/SUBCONTRACTOR (If "None," so state) a. NAME(S) OF INVENTOR(S) (Last) NO f. EMPLOYER OF INVENTOR(S) NOT EMPLOYED BY CONTRACTOR/SUBCONTRACTOR (1) (a) NAME OF INVENTOR (Last OF INVENTOR (Last, First, Middle Initial) (b) NAME OF EMPLOYER (c) ADDRESS OF EMPLOYER (Include ZIP Code) g

  9. d+d Fusions with Log-normal Model

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MacKenzie Warrens 1 Cryo-cooled gas mixture of D 2 + 3 He was released from the gas jet 90-180J pulse from the Texas Pettawatt Laser irradiated the D 2 clusters Coulomb...

  10. DD FORM 2813, SEP 2006 DEPARTMENT OF DEFENSE

    E-Print Network [OSTI]

    /Restorations: Dental caries or fractures with moderate or advanced extension into dentin; defective restorations. (d) Periodontal Conditions: Acute gingivitis or pericoronitis, active moderate to advanced periodontitis, periodontal abscess, progressive mucogingival condition, moderate to heavy subgingival calculus

  11. SIMULATION OF CARGO CONTAINER INTERROGATION BY D-D NEUTRONS

    E-Print Network [OSTI]

    Lou, Tak Pui; Antolak, Arlyn

    2007-01-01

    of Energy’s National Nuclear Security Administration underof Homeland Security, Domestic Nuclear Detection Office,nuclear material hidden in cargo containers has become an important research topic for homeland security.

  12. Microsoft Word - 25788WDC_DOE DD FS.docx

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy May 28MarEnergyDanielJune 14, 2011 REPLY TO ATTN

  13. SS TT UU DD EE NN TT HH AA NN DD BB OOOO KK 22001122--22001133

    E-Print Network [OSTI]

    Vertes, Akos

    , creativity, and openness to the exploration of new ideas. The George Washington University, centered, and the professions by encouraging interaction among its students, faculty, staff, alumni, and the communities

  14. A conventional one-channel Thomson scattering (TS) system was implemented to measure the electron temperature and density profiles on the ETE tokamak plasma with a resolution of 15 mm along 50 cm inside the plasma. The TS is based on a 10 J Q-switched rub

    E-Print Network [OSTI]

    temperature and density profiles on the ETE tokamak plasma with a resolution of 15 mm along 50 cm inside.5mmx1.5mm that is spectral analyzed by a 5-channel filter polychromator. Temperatures from 20 eV to 160 uses large core monofibers (d = 0.8 mm, NA = 0.39, average attenuation: 7 dB/Km) with micro-lenses (d

  15. Physical Consequences of a Momenta-Transfering Particle Theory of Induced Gravity and New Measurements Indicating Variation from Inverse Square Law at Length Scale of .1 mm: Statistical Time Properties of Gravitational Interaction and Analysis Thereof

    E-Print Network [OSTI]

    Gary Christopher Vezzoli

    2001-04-04

    This work presents physical consequences of our theory of induced gravity (Ref.1) regarding: 1) the requirement to consider shape and materials properties when calculating graviton cross section collision area; 2) use of Special Relativity; 3) implications regarding the shape of cosmos; 4) comparison to explanations using General Relativity; 5) properties of black holes; 6) relationship to the strong force and the theorized Higgs boson; 7) the possible origin of magnetic attraction; 8) new measurements showing variation from gravitational inverse square behavior at length scales of 0.1 mm and relationship to the Cosmological constant, and proof of the statistical time properties of the gravitational interaction.

  16. Le JJ/MM/AAAA RELATIONS INTERNATIONALES

    E-Print Network [OSTI]

    Sart, Remi

    and industrial base of 60 000 companies with some big names : Michelin, Limagrain, Volvic IBM... sectors of Engineering University Institute of Computer Science and Modelling 1 University Institute of Technology (2;Research 25 laboratories centred on 6 main areas of research: - Mathematics and computer sciences - Science

  17. Concept : Cell Yield Glucose, mM

    E-Print Network [OSTI]

    Málaga, Universidad de

    on Limiting Substrate. Specific growth rate reaches a maximum value of 0.5 h-1. Value of KS here is 0.5 g L-1 body, degeneration) Limitation in the length of cDNA Lacks post-translational modification específico (Baculovirus) Cultivo fastidioso Tiempo de crecimiento my lento (tiempo de doblaje es 20h) #12

  18. mm-Wave Phase Shifters and Switches

    E-Print Network [OSTI]

    Adabi Firouzjaei, Ehsan

    2010-01-01

    a transformer-based shunt switch and its equivalent circuitTraditional shunt switches occupy a large footprint as a2.4 Transformer based switch design example in 90nm CMOS

  19. Totsl length (mm) Sample 95% confidence

    E-Print Network [OSTI]

    . Bear Mountain, N.Y., March 28-301976. Hudson River Environmen- tal Society, Inc. FISHERY BULLETIN: VOL

  20. SSC 50 mm collider dipole cryostat design

    SciTech Connect (OSTI)

    Nicol, T.H.

    1992-04-01

    The cryostat of a Superconducting Super Collider (SSC) dipole magnet consists of all magnet components except the magnet assembly itself. It serves to support the magnet accurately and reliably within the vacuum vessel, provide all required cryogenic piping, and to insulate the cold mass from heat radiated and conducted from the environment. It must function reliably during storage, shipping and handling, normal magnet operation, quenches, and seismic excitations, and must be manufacturable at low cost. The major components of the cryostat are the vacuum vessel, thermal shields, multilayer insulation system, cryogenic piping, interconnections, and suspension system. The overall design of a cryostat for superconducting accelerator magnets requires consideration of fluid flow, proper selection of materials for their thermal and structural performance at both ambient and operating temperature, and knowledge of the environment to which the magnets will be subjected over the course of their expected operating life. This paper describes the design of the current SSC dipole magnet cryostat and includes discussions on the structural and thermal considerations involved in the development of each of the major systems.

  1. p'/raws SOCETICS mm 'FEB 241987

    E-Print Network [OSTI]

    McLeod, Ian

    REVIEWERS OF THE JOURNAL OF WATER RESOURCES PLANNING AND MANAGEMENT 159 in Downloaded 29 Jul 2010 to 129.100.76.58. Redistribution subject to ASCE license or copyright. Visit #12;#12;#12;#12;#12;#12;#12;#12;#12;#12;#12;#12;#12;#12;

  2. ARM - Campaign Instrument - 5mm-mwr

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016StudyCHAPS:

  3. 20% (AM1.5) efficiency GaAs solar cells on sub-mm grain-size poly-Ge and its transition to low-cost substrates

    SciTech Connect (OSTI)

    Venkatasubramanian, R.; O`Quinn, B.C.; Siivola, E.; Keyes, B.; Ahrenkiel, R.

    1997-12-31

    Some of the key material and device issues related to the development of GaAs solar cells on poly-Ge substrates, including the dark-current reduction mechanism with an undoped spacer at the p{sup +}-n depletion layer, are discussed. Device-structure optimization studies that have led the authors to achieve an AM1.5 efficiency of {approximately}20% for a 4-cm{sup 2}-area GaAs cell on sub-mm grain-size poly-Ge and an efficiency of {approximately}21% for a 0.25-cm{sup 2}-area cell are presented. This successful demonstration of high-efficiency GaAs cells on sub-mm grain-size poly-Ge substrates have motivated us to consider the development of high-quality GaAs materials on significantly lower-cost substrates such as glass and moly foils. To date, the authors have achieved a best minority-carrier lifetime of 0.41 nsec in an n-GaAs thin-film on moly. The role of Group-VI dopant in the possible passivation of grain-boundaries in poly-GaAs is discussed. Development of PV-quality GaAs material, with minority-carrier lifetime of 1 to 2 nsec, on los-cost moly foils can significantly impact both the terrestrial and the space PV applications.

  4. Els UK Job: CDI Ch06-I047172 13-11-2007 11:15a.m. Page:245 Trim:165240MM Float:Top/Bot TS: Integra, India Fonts: Palatino & Helvetica 9/11 Margins:Top:4PC Gutter:5PC T. W:30PC open recto 1 Color 49 Lines

    E-Print Network [OSTI]

    Oren, Shmuel S.

    Els UK Job: CDI Ch06-I047172 13-11-2007 11:15a.m. Page:245 Trim:165×240MM Float:Top/Bot TS: Integra: CDI Ch06-I047172 13-11-2007 11:15a.m. Page:246 Trim:165×240MM Float:Top/Bot TS: Integra, India Fonts

  5. Complete 2mm Spectral Line Survey (130-170 GHz) of Sgr B2N, Sgr B2OH, IRC +10 216, Orion (KL), Orion-S, W51M, and W3(IRS5)

    E-Print Network [OSTI]

    Anthony. J. Remijan; Diane P. Leigh; A. J. Markwick-Kemper; B. E. Turner

    2008-02-15

    We report a complete 2mm spectral line survey (130-170 GHz) taken with the NRAO 12m Telescope between 1993 and 1995 toward the following sources: Sgr B2N, Sgr B2OH, IRC +10 216, Orion (KL), Orion-S, W51M, and W3(IRS5). Until very recently, this project was entirely the work of B. E. Turner. He wrote the original proposal, given below without changes or updates, and did all of the observing. B.E. Turner has fallen seriously ill and can no longer continue to work on the analysis of these data. The notes that follow the proposal give further information about the project and important information for users of these data. The data are distributed using the Spectral Line Search Engine (SLiSE) developed by A. J. Remijan and M. J. Remijan. SLiSE is a data display tool that will contain all the fully reduced and calibrated archived data taken as part of this 2mm survey. SLiSE is fast, easy to use, and contains the necessary functionality to display the data taken from spectral line searches. For example, SLiSE contains functions to overlay possible molecule identifications based on a current line catalog as well as overlaying H and He recombination lines. It is a Java-based applet, so it is platform independent and easily accessed online. The only caveat is that SLiSE was built using Java 1.5, so an update to the user's Java may be necessary. We request users of these data to give B.E. Turner and this work the appropriate citation and credit.

  6. Item # Value Description Manufacturer Manufacturer Part # Vendor Vendor Part Number Layout Part Ref Qty 1 POWER 3pin 2mm right angle connector Hirose Electronic Co. Ltd. DF3-3P-2DS Digikey H2106-ND J1 1

    E-Print Network [OSTI]

    Virginia Tech

    Qty 1 POWER 3pin 2mm right angle connector Hirose Electronic Co. Ltd. DF3-3P-2DS Digikey H2106-ND J1 1 2 SER A 3pin 2mm right angle connector Hirose Electronic Co. Ltd. DF3-3P-2DS Digikey H2106-ND J2 1 3 SER B 3pin 2mm right angle connector Hirose Electronic Co. Ltd. DF3-3P-2DS Digikey H2106-ND J3 1 4 SER

  7. Noncommutativity from the string perspective: modification of gravity at a mm without mm sized extra dimensions

    E-Print Network [OSTI]

    Steven Abel; Chong-Sun Chu; Mark Goodsell

    2006-09-27

    We explore how the IR pathologies of noncommutative field theory are resolved when the theory is realized as open strings in background B-fields: essentially, since the IR singularities are induced by UV/IR mixing, string theory brings them under control in much the same way as it does the UV singularities. We show that at intermediate scales (where the Seiberg-Witten limit is a good approximation) the theory reproduces the noncommutative field theory with all the (un)usual features such as UV/IR mixing, but that outside this regime, in the deep infra-red, the theory flows continuously to the commutative theory and normal Wilsonian behaviour is restored. The resulting low energy physics resembles normal commutative physics, but with additional suppressed Lorentz violating operators. We also show that the phenomenon of UV/IR mixing occurs for the graviton as well, with the result that, in configurations where Planck's constant receives a significant one-loop correction (for example brane-induced gravity), the distance scale below which gravity becomes non-Newtonian can be much greater than any compact dimensions.

  8. Coupling MM5 with LSM1: Development, Testing, and Application - MM5_workshop

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit the followingConcentratingPortalCoolCoronaryCosts Associated4-Year/%2A

  9. IEEE TRANSACTIONS ON VERY LARGE SCALE INTEGRATION (VLSI) SYSTEMS, VOL. XX, NO. NN, MMM YYYY 1 System-Wide Leakage-Aware Energy Minimization

    E-Print Network [OSTI]

    Mishra, Prabhat

    the advantage of the fact that linear reduction in the supply voltage can quadratically reduce the power System-Wide Leakage-Aware Energy Minimization using Dynamic Voltage Scaling and Cache Reconfiguration voltage scaling (DVS) is well studied and known to be successful in reducing processor energy consumption

  10. Item # Value Description Manufacturer Manufacturer Part # Vendor Vendor Part Number Cost Layout Part Ref Qty 1 POWER 2pin 2mm right angle connector Hirose Electronic Co. Ltd. DF3-2P-2DS Digikey H2105-ND $0.18 J1 1

    E-Print Network [OSTI]

    Virginia Tech

    Backup Battery Circuit Diode D1 1 18 POWER LED 0603 SM LEDs (Red) Lite-On Trading USA, Inc. LTST-C190KRKT Part Ref Qty 1 POWER 2pin 2mm right angle connector Hirose Electronic Co. Ltd. DF3-2P-2DS Digikey H2105 SM (Battery Backup Circuit) R1 1 8 100 Ohm Resistor 0402 SM (Red,Orange, Green LEDs) R2, R3, R4 3 9

  11. A 76GHz PLL for mm-wave imaging applications

    E-Print Network [OSTI]

    Nguyen, Khoa M.

    A 76 GHz phase-locked loop (PLL) was designed in 0.13 ?m IBM BiCMOS8HP technology with the intended application of millimeter-wave imaging. The PLL has a type II second order loop filter. The voltage-controlled oscillator ...

  12. Discrimination Report: ESTCP UXO Discrimination Study, ESTCP Project #MM-0437

    E-Print Network [OSTI]

    Gasperikova, Erika; Smith, J. Torquil; Morrison, H. Frank; Becker, Alex

    2007-01-01

    UXO Detection and Discrimination: Partners in EnvironmentalDISCRIMINATION . .and characterization/ discrimination, and (2) the cued mode.

  13. A mm-scale aeroelastic oscillation-based anemometer

    E-Print Network [OSTI]

    McKay, Ian Salmon

    2012-01-01

    The flutter of a thin filament can provide a good indication of fluid velocity at small scales. By combining a 'fishtail'-shaped filament's aeroelastic and vortex-forced flutter modes, its oscillation frequency can be ...

  14. A mm-Scale Aeroelastic Oscillation-Based Anemometer

    E-Print Network [OSTI]

    McKay, Ian

    By combining the aeroelastic and vortex-forced flutter modes of a thin plastic strip, its oscillation frequency can be confined to scale monotonically with fluid velocity. This principle has been used to produce a low-cost, ...

  15. DESIGN OF 15 mm COLLARS FOR SSC DIPOLE MAGNETS

    E-Print Network [OSTI]

    Peters, C.

    2010-01-01

    layer. The Preliminary Design Criteria It will be helpful atand preliminary design criteria. Finite element analysisto meet the suggested design criteria. Three designs are

  16. Trim: 247mm 174mm Top: 14.762mm Gutter: 23.198mm CUUK2786-26 CUUK2786/Tong 978 1 107 04172 1 December 26, 2014 12:51

    E-Print Network [OSTI]

    Utrecht, Universiteit

    , as long as the wavelength of the waves is very much less than their path length, the ray approximation, T is the travel time, and ds is an increment along the ray path. Obtaining models of the solar or terrestrial wave construct images of a body's interior using seismic waves ­ is an inverse problem; that is, our goal

  17. Dimensions are shown in inch (mm ) Dimensions subject to change

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    at 40°C, 93% RH SALT MIST RESISTANCE: 96 hours Materials COVER & BASE: Thermoplastic PPS ACTUATOR: PA Thermoplastic KNOB: Thermoplastic MOVABLE CONTACTS: Brass, gold or silver plated. STATIONARY CONTACTS: Brass

  18. NaCoMM-2003 Sponsors National Advisory Committee

    E-Print Network [OSTI]

    Saha, Subir Kumar

    SuwamaB. Torgal, Tripthi K. And N. K. Nagar TheStudy Of Five-Bar Mechanism With Variable Topology Mechanismsand Manipulators Optimal Design Of Mechanism For Stirrup Making Machine -A Computer Approach V SandijmnBandyopadhyayAnd Ashitava Gbosal Simulation Of SoftwareFor Four-Bar Function GeneratorMechanism

  19. Microsoft Word - MM5_LSM_JGR.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OF PAGESpersonal CERTIFIEDPUB-3140September0 3.Impact of

  20. Posters Surface Flux Intercomparison Between the MM5 Model

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeedingProgram Guidelines This document outlines the majorL.Posters955

  1. 40 MM Grenade Launcher Qualification Requirements at Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s iof1 of 8 2 of 8of|under23-25,Chairman

  2. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    D&D 100K Area D&D 100K Area D&D 100K Area D&D 100K Area D&D 100K Area D&D U Plant D&D (Radiological Surveys) U Plant D&D (Radiological Surveys) U Plant D&D U Plant D&D U Plant...

  3. Initiating the D&D Project for the EBR-II

    SciTech Connect (OSTI)

    Rick Demmer

    2010-08-01

    A novel decommissioning project is underway to close the Experimental Breeder Reactor-II (EBR-II) “fast” reactor at the Idaho National Laboratory (INL), Materials and Fuels Complex (MFC) facility near Idaho Falls, ID. The facility was placed in cold shutdown in 1994 and work began on the removal of the metallic sodium coolant. The bulk of the sodium was drained and treated beginning in 2001. The residual sodium heel was chemically passivated to render it less reactive in 2005 using a novel carbon dioxide treatment. Approximately 700 kg of metallic sodium and 3500 kg of sodium bicarbonate remain in the facility. A RCRA Waste Treatment Permit, issued in 2002 by the State of Idaho Department of Environmental Quality, requires annual progress toward closure of the facility, and that all regulated materials be removed or deactivated, and the waste products removed by 2022. The baseline sodium removal technology would result in about 100,000 gallons of low-level waste solution requiring treatment along with separate handling of the large components (intermediate heat exchanger, rotating plug, etc) outside of the primary tank.

  4. Lochon Catalyzed D-D Fusion in Deuterated Palladium in the Solid State

    E-Print Network [OSTI]

    K. P. Sinha; A. Meulenberg

    2007-05-04

    Lochons (local charged bosons or local electron pairs) can form on D+ to give D- (bosonic ions) in Palladium Deuteride in the solid state. Such entities will occur at special sites or in linear channel owing to strong electron-phonon interaction or due to potential inversion on metallic electrodes. These lochons can catalyze D- - D+ fusion as a consequence of internal conversion leading to the formation of He-4 plus production of energy (Q=23.8 MeV) which is carried by the alpha particle and the ejected electron-pair. The reaction rate for this fusion process is calculated.

  5. Risk D&D Rapid Prototype: Scenario Documentation and Analysis Tool

    SciTech Connect (OSTI)

    Unwin, Stephen D.; Seiple, Timothy E.

    2009-05-28

    Report describes process and methodology associated with a rapid prototype tool for integrating project risk analysis and health & safety risk analysis for decontamination and decommissioning projects.

  6. DD-PREF: A Language for Expressing Preferences Over Sets Marie desJardins

    E-Print Network [OSTI]

    Wagstaff, Kiri L.

    . highly ranked students who also comprise a diverse incom- ing class. These examples show that the simple an objective function that, when maximized, iden- tifies the subset of objects that best satisfies a statement to scientists on Earth; · a college wants to select a group of 100 incoming students from the 1500 applications

  7. Demonstration of Fixatives to Control Contamination and Accelerate D&D

    Office of Energy Efficiency and Renewable Energy (EERE)

    The 2000 Complex at the Oak Ridge National Laboratory (ORNL) has been identified as a high risk facility. The 50-year-old series of connected metal buildings has deteriorated to the point that it...

  8. A compact stilbene crystal neutron spectrometer for EAST D-D plasma neutron diagnostics

    SciTech Connect (OSTI)

    Zhang Xing; Yuan Xi; Xie Xufei; Chen Zhongjing; Peng Xingyu; Chen Jinxiang; Zhang Guohui; Li Xiangqing; Fan Tieshuan [School of Physics and State Key Laboratory of Nuclear Physics and Technology, Peking University, Chengfu Road 201, 100871 Beijing (China); Zhong Guoqiang; Hu Liqun; Wan Baonian [Institute of Plasma Physics, Chinese Academy of Sciences, PO Box 1126, 230031 Hefei, Anhui (China)

    2013-03-15

    A new compact stilbene crystal neutron spectrometer has been investigated and applied in the neutron emission spectroscopy on the EAST tokamak. A new components analysis method is presented to study the anisotropic light output in the stilbene crystal detector. A Geant4 code was developed to simulate the neutron responses in the spectrometer. Based on both the optimal light output function and the fitted pulse height resolution function, a reliable neutron response matrix was obtained by Geant4 simulations and validated by 2.5 MeV and 14 MeV neutron measurements at a 4.5 MV Van de Graaff accelerator. The spectrometer was used to diagnose the ion temperature in plasma discharges with lower hybrid wave injection and ion cyclotron resonance heating on the EAST tokamak.

  9. Idaho Site D&D Crew Uses Specialized Tools to Cut Apart Massive...

    Broader source: Energy.gov (indexed) [DOE]

    used heated sodium from the Experimental Breeder Reactor-II (EBR-II) to produce steam to drive a turbine and generate electricity. The building is located in the site's...

  10. DDaanniieell BB.. SShhoorrtt,, PPhh..DD.. Email: short@rmu.edu

    E-Print Network [OSTI]

    Short, Daniel

    on the origins of lead and the contributions from sources such as coal burning, mining, smelting and vehicle, Educational Technology Committee. Instructor Spring 2000 State University of New York at Cortland, Cortland, Austria. Sampled soil cores and remotely located Austrian lake waters using ultra clean techniques

  11. D.D n. 27/2014 del 29/05/2014 Dipartimento di Chimica

    E-Print Network [OSTI]

    Di Pillo, Gianni

    lithium and lithium ion batteries) presso il Dipartimento di Chimica -settore concorsuale 03/A2, SSD CHIM al litio ed al litio ione di nuova generazione ad elevata energia (New generation of high energy

  12. ScriDta Materialia. Vol. 37. No. 9. DD.1373-1378. 1997 Pergamon , ...

    E-Print Network [OSTI]

    Rosakis, Ares J.

    the remarkable properties of such amorphous metals, are listed in Table 1. The purpose of this paper is to report's Modulus 96 GPa Shear Modulus 34.3 GPa Poisson's ratio 0.36 Tensile yield strength 1.9 GPa Tensile strain measurements taken from specimen loading in 3-point bending configuration. Specimens were loaded until failure

  13. PHYSICAL REVIEW C 88, 014004 (2013) Investigation of the dd 3

    E-Print Network [OSTI]

    Magiera, Andrzej

    2013-01-01

    , 35392 Giessen, Germany 16 Department of Physics, Indian Institute of Technology Indore, Khandwa Road, Indore 452017, Madhya Pradesh, India 17 High Energy Physics Division, Petersburg Nuclear Physics

  14. Website Collects EM's D&D Lessons Learned | Department of Energy

    Office of Environmental Management (EM)

    Engineering is preparing a five-year strategic plan to include key areas such as robotic and remote system development. EM has employed robots such as Tizzy, shown here,...

  15. DOE Presents Proposed D&D and Waste Disposition Plans for EM...

    Broader source: Energy.gov (indexed) [DOE]

    was held prior to the meetings comment session. The panel included, from left, Marc Jewett, Fluor-B&W Regulatory Planning and Stakeholder Affairs; Fluor-B&W Site Project...

  16. Multireference Ab Initio Study of Ligand Field d-d Transitions...

    Office of Scientific and Technical Information (OSTI)

    University Research Org: Energy Frontier Research Centers (EFRC); Argonne-Northwestern Solar Energy Research Center (ANSER) Sponsoring Org: USDOE SC Office of Basic Energy...

  17. KDG, Robinson Lab RR EE CC II PP EE SS II NN DD EE XX

    E-Print Network [OSTI]

    Robinson, Douglas N.

    Stock Drugs_________ ________________ 02 LB, LB-Agar, & Pouring LB-Agar Plates______ 03 15% Acrylamide is dissolved. Takes 5-10 min. WATER EQUILIBRATED BUTANOL 35mL isobutyl alcohol 15mL 18 M dH2O Mix in 50m gel when making Acrylamide Gels. #12;KDG, Robinson Lab 2 AMPICILLIN Want 50mg/mL stock Mix 2.5g

  18. STICHTING KATHOLIEKE UNIVERSITEIT sku13N.047 d.d. 30 januari 2013

    E-Print Network [OSTI]

    Bosma, Wieb

    possess personal qualities such as integrity, independence and reliability, and should evaluate his at any particular moment. The SKU Board critically and independently assesses the integrity includes a mix of personal qualities as well as requirements with respect to position, experience

  19. Report on D&D of Large Components with Valuable EM Contributions is Available on Powerpedia

    Broader source: Energy.gov [DOE]

    WASHINGTON, D.C. – EM’s Office of Deactivation and Decommissioning/Facility Engineering (D&D/FE), representing DOE on the Nuclear Energy Agency’s (NEA) Working Party on Decommissioning and Dismantling (WPDD) of the Radioactive Waste Management Committee, provided significant contributions to the recently published report titled, “The Management of Large Components from Decommissioning to Storage and Disposal.”

  20. D.D. n. 12/2013 del 08.04.2013 IL DIRETTORE

    E-Print Network [OSTI]

    Di Pillo, Gianni

    nei soggetti operati di protesi d'anca con accoppiamento "metal on metal"; VISTA la delibera del operati di protesi d'anca con accoppiamento "metal on metal" (Responsabile Scientifico: Prof. Ciro Villani nei soggetti operati di protesi d'anca con accoppiamento "metal Università degli Studi di Roma "La

  1. PPrreeppaarreedd bbyy LLaarrrryy PP.. WWaallkkeerr,, PPhh..DD.. PPrrooffeessssoorr,, DDeeppaarrttmmeenntt ooff BBiioollooggiiccaall aanndd EEnnvviirroonnmmeennttaall EEnnggiinneeeerriinngg

    E-Print Network [OSTI]

    of diverse issues including rural economic development, regional energy security and climate change, agricultural education, weed science, plant biology, biological and environmental engineering) renewable energy, and chemical compositional characteristics related to downstream energy conversion. The Cornell project is also

  2. DOE Presents Proposed D&D and Waste Disposition Plans for EM...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    City Library, 21 Broad St., Jackson; the ChillicotheRoss County Public Library, 140 S. Paint St., Chillicothe; the Portsmouth Public Library, 1220 Gallia St., Portsmouth; at the...

  3. Application of deuteron-deuteron (d-d) fusion neutrons to 40 ar/39/ar geochronology

    E-Print Network [OSTI]

    Renne, P.; Knight, K.B.; Nomade, S.; Leung, K.-N.; Lou, T.P.

    2005-01-01

    Harrison, T.M. , 1999. Geochronology and Thermochronology byDating, Quaternary Geochronology: methods and applications.R. , 1995. Argon Geochronology of Small Samples Using the

  4. DD. 50/2014 del 6/05/2014 (Bando RTD n..1_2014)

    E-Print Network [OSTI]

    Di Pillo, Gianni

    Nucleare, con sede legale in Frascati, e il Dipartimento di Fisica in data 9/12/2013; Visto il parere particelle cariche di energia minore di 100 MeV finalizzato alla misura del profilo di dose rilasciata

  5. Multireference Ab Initio Study of Ligand Field d-d Transitions in

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(JournalspectroscopyReport)Fermentativea(Patent) | SciTechMultiplexOctahedral

  6. The Production & Generation of Radionuclides from Deuterium-Deuterium (D-D)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S.Week Day Year(activeInforumMILC& Deuterium-Tritium (D-T)

  7. IEF and NEPHGE 2-D PAGE Basic tube gel recipe, 5 ml volume

    E-Print Network [OSTI]

    Aris, John P.

    40 IEF and NEPHGE 2-D PAGE Basic tube gel recipe, 5 ml volume: Urea 2.75 g (ultrapure only) ddH2O 1 overnight with 5% Chem-Solv prior to pouring gels. Lysis buffer recipe, 1 ml volume: Urea 0.55 g (ultrapure) ( - ) (+) Final, 20 mM NaOH and 10 mM H3PO4. Agarose sealer recipe, 10 ml volume: 5X upper (6.8) 2 ml ddH2O 6 ml ß

  8. BANDO PER IL RECLUTAMENTO DI UN RICERCATORE CON RAPPORTO DI LAVORO A TEMPO DETERMINATO TIPOLOGIA A

    E-Print Network [OSTI]

    Di Pillo, Gianni

    Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" Visti i DD.MM. 4.10.2000 e 9.1.2001 concernenti.03.2012; Vista la Convenzione stipulata tra il Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" e la Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" nella seduta del 28.05.2013; Visto il parere

  9. BANDO PER IL RECLUTAMENTO DI UN RICERCATORE CON RAPPORTO DI LAVORO A TEMPO DETERMINATO TIPOLOGIA A

    E-Print Network [OSTI]

    Di Pillo, Gianni

    di Fisiologia e Farmacologia "Vittorio Erspamer" Visti i DD.MM. 4.10.2000 e 9.1.2001 concernenti la a disposizione del Dipartimento; Viste le delibere del Consiglio del Dipartimento di Fisiologia e Farmacologia ed esami» - n° 75 del 26 settembre 2014; Considerato che per il Dipartimento di Fisiologia e

  10. BANDO PER IL RECLUTAMENTO DI UN RICERCATORE CON RAPPORTO DI LAVORO A TEMPO DETERMINATO TIPOLOGIA A

    E-Print Network [OSTI]

    Di Pillo, Gianni

    Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" Visti i DD.MM. 4.10.2000 e 9.1.2001 concernenti" a disposizione del Dipartimento; Viste le delibere del Consiglio del Dipartimento di Fisiologia e Farmacologia del 6 giugno 2014; Considerato che per il Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer

  11. NCSCTL Statement of Work Revision Level: 03 Revision Date: 10/21/13 Page 1 of 3 The following Statement of Work is set forth between

    E-Print Network [OSTI]

    ___________________________________Country On this date: MM/DD/YY For the following work: Testing of the collector to the Solar(company name for Certifying Solar Collectors (Glazed Liquid Based Collectors only) 1.3.2. ISO 17025 1.3.3. Those mandated Statement of Work is set forth between: North Carolina Solar Center North Carolina State University 1101

  12. Basketball - Mens- 2001-2010 - 12 

    E-Print Network [OSTI]

    Allen Pearson

    2011-08-17

    analysis, experimental results are shown for the following standard bearing configurations Bl and B3: BI) C, = 0. 1270 mm (0. 005 in), d, = 2. 504 mm (0. 0986 in), p?= 0. 535, and B3) C, = 0. 1470 mm (0. 003 in), d, = 1. 410 mm (0. 0555 in), p?= 0. 452... UNWRAP 189' 333' 4r 225' Py 247 5' 261' Il 292. 5 4y 315' dd1' I dly I Iy 310' 22W 139 Idly N 11 Fig. 2 Test bearing geometry 10 compensated, smooth-land, cylindrical journal bearings with a diameter D of 0. 0762 m (3 in) and L/D ratio...

  13. Spatial Sketch: Bridging Between Movement & Fabrication Karl D.D. Willis1, 2 Juncong Lin2 Jun Mitani2 Takeo Igarashi2Karl D.D. Willis1, 2 Juncong Lin2 Jun Mitani2 Takeo Igarashi2

    E-Print Network [OSTI]

    Igarashi, Takeo

    of embodied forms of human computer interaction for use in digital fabrication. Author Keywords Sketching Classification Keywords H5.m. Information interfaces and presentation (e.g., HCI): User Interfaces: Input devices in this field has focused predominantly on developing novel input systems to support the creation of digital

  14. Large Scale DD Simulation Results for Crystal Plasticity Parameters in Fe-Cr And Fe-Ni Systems

    SciTech Connect (OSTI)

    Zbib, Hussein M.; Li, Dongsheng; Sun, Xin; Khaleel, Mohammad A.

    2012-04-30

    The development of viable nuclear energy source depends on ensuring structural materials integrity. Structural materials in nuclear reactors will operate in harsh radiation conditions coupled with high level hydrogen and helium production, as well as formation of high density of point defects and defect clusters, and thus will experience severe degradation of mechanical properties. Therefore, the main objective of this work is to develop a capability that predicts aging behavior and in-service lifetime of nuclear reactor components and, thus provide an instrumental tool for tailoring materials design and development for application in future nuclear reactor technologies. Towards this end goal, the long term effort is to develop a physically based multiscale modeling hierarchy, validated and verified, to address outstanding questions regarding the effects of irradiation on materials microstructure and mechanical properties during extended service in the fission and fusion environments. The focus of the current investigation is on modern steels for use in nuclear reactors including high strength ferritic-martensitic steels (Fe-Cr-Ni alloys). The effort is to develop a predicative capability for the influence of irradiation on mechanical behavior. Irradiation hardening is related to structural information crossing different length scales, such as composition, dislocation, and crystal orientation distribution. To predict effective hardening, the influence factors along different length scales should be considered. Therefore, a hierarchical upscaling methodology is implemented in this work in which relevant information is passed between models at three scales, namely, from molecular dynamics to dislocation dynamics to dislocation-based crystal plasticity. The molecular dynamics (MD) was used to predict the dislocation mobility in body centered cubic (bcc) Fe and its Ni and Cr alloys. The results are then passed on to dislocation dynamics to predict the critical resolved shear stress (CRSS) from the evolution of local dislocation and defects. In this report the focus is on the results obtained from large scale dislocation dynamics simulations. The effect of defect density, materials structure was investigated, and evolution laws are obtained. These results will form the bases for the development of evolution and hardening laws for a dislocation-based crystal plasticity framework. The hierarchical upscaling method being developed in this project can provide a guidance tool to evaluate performance of structural materials for next-generation nuclear reactors. Combined with other tools developed in the Nuclear Energy Advanced Modeling and Simulation (NEAMS) program, the models developed will have more impact in improving the reliability of current reactors and affordability of new reactors.

  15. /fzilsa Vision Res. Vol. 34. No. 22. DD.3005-3012. 1994 0042_6989(94)EOO81-U

    E-Print Network [OSTI]

    Johnston, Alan

    27 Ma-v 1993; in revisedform 13 December 1993 Marr [(1982) Vision, San Francisco, Calif.: Freeman1 (Barrow & Tenenbaum, 1978; Brady, Ponce, Yuille & Asada, 1985; Koenderink, 1990; Marr, 1978, 1982. Horn (1975) and Marr (1978) emphasized the surface orientation map as a means of representing surface

  16. A gas chromatography/pyrolysis/isotope ratio mass spectrometry system for high-precision dD measurements

    E-Print Network [OSTI]

    Fischer, Hubertus

    A gas chromatography/pyrolysis/isotope ratio mass spectrometry system for high-precision d we present a highly automated, high-precision online gas chromatography/pyrolysis/isotope ratio from ice, preconcentration, gas chromatographic separation and pyrolysis of CH4 from roughly 500 g

  17. Automation of System Safety Analysis: Possibilities and Pitfalls Andrew Galloway, University of York, Heslington, York YO10 5DD UK

    E-Print Network [OSTI]

    Pumfrey, David

    hazard identification/analysis and confirmatory safety analyses, e.g. FMEA and FTA, present significant

  18. Measurement of the Time-Dependent CP Asymmetry of Partially Reconstructed B0 to D*+D*- Decays

    SciTech Connect (OSTI)

    Lees, J. P.

    2012-08-13

    We present a new measurement of the time-dependent CP asymmetry of B{sup 0} {yields}D*{sup +}D*{sup -} decays using (471 {+-} 5) million B{bar B} pairs collected with the BABAR detector at the PEP-II B Factory at the SLAC National Accelerator Laboratory. Using the technique of partial reconstruction, we measure the time-dependent CP asymmetry parameters S = -0.34 {+-} 0.12 {+-} 0.05 and C = +0:15 {+-} 0.09 {+-} 0.04. Using the value for the CP-odd fraction R{perpendicular} = 0.158 {+-} 0.028 {+-} 0.006, previously measured by BABAR with fully reconstructed B{sup 0} {yields} D{sup *+}D{sup *-} events, we extract the CP-even components S{sub +} = -0.49 {+-} 0.18 {+-} 0.07 {+-} 0.04 and C{sub +} = +0.15 {+-} 0.09 {+-} 0.04. In each case, the first uncertainty is statistical and the second is systematic; the third uncertainty on S{sub +} is the contribution from the uncertainty on R{perpendicular}. The measured value of the CP-even component S{sub +} is consistent with the value of sin 2{beta} measured in b {yields} (c{bar c})s transitions, and with the Standard Model expectation of small penguin contributions.

  19. Goal-Based Safety Standards: Opportunities and Challenges Tim Kelly, University of York, Heslington, York, YO10 5DD UK

    E-Print Network [OSTI]

    Kelly, Tim

    with how systems are developed and assessed, e.g. methods of safety analysis and criteria for risk, in safety, this is to establish safety requirements, design to meet the agreed requirements, and to showGoal-Based Safety Standards: Opportunities and Challenges Tim Kelly, University of York, Heslington

  20. THE CM-, MM-, AND SUB-MM-WAVE SPECTRUM OF ALLYL ISOCYANIDE AND RADIOASTRONOMICAL OBSERVATIONS IN ORION KL AND THE SgrB2 LINE SURVEYS

    SciTech Connect (OSTI)

    Haykal, I.; Margulès, L.; Huet, T. R.; Motyienko, R. A.; Écija, P.; Cocinero, E. J.; Basterretxea, F.; Fernández, J. A.; Castaño, F.; Guillemin, J. C.; Tercero, B.; Cernicharo, J.

    2013-11-10

    Organic isocyanides have an interesting astrochemistry and some of these molecules have been detected in the interstellar medium (ISM). However, rotational spectral data for this class of compounds are still scarce. We provide laboratory spectra of the four-carbon allyl isocyanide covering the full microwave region, thus allowing a potential astrophysical identification in the ISM. We assigned the rotational spectrum of the two cis (synperiplanar) and gauche (anticlinal) conformations of allyl isocyanide in the centimeter-wave region (4-18 GHz), resolved its {sup 14}N nuclear quadrupole coupling (NQC) hyperfine structure, and extended the measurements into the millimeter and submillimeter-wave (150-900 GHz) ranges for the title compound. Rotational constants for all the monosubstituted {sup 13}C and {sup 15}N isotopologues are additionally provided. Laboratory observations are supplemented with initial radioastronomical observations. Following analysis of an extensive dataset (>11000 rotational transitions), accurate ground-state molecular parameters are reported for the cis and gauche conformations of the molecule, including rotational constants, NQC parameters, and centrifugal distortion terms up to octic contributions. Molecular parameters have also been obtained for the two first excited states of the cis conformation, with a dataset of more than 3300 lines. The isotopic data allowed determining substitution and effective structures for the title compound. We did not detect allyl isocyanide either in the IRAM 30 m line survey of Orion KL or in the PRIMOS survey toward SgrB2. Nevertheless, we provided an upper limit to its column density in Orion KL.

  1. Trim size: 189mm x 246mm Tedesco c07.tex V3 -10/01/2014 2:16 P.M. Page 123 Remote sensing

    E-Print Network [OSTI]

    Raup, Bruce H.

    of Colorado, Boulder, USA 2Norwegian Water Resources and Energy Directorate, Oslo, Norway 3University accuracy over large regions in a short time. New sensors will be coming online soon that will continue, in the form of snow, avalanches and wind-blown snow, and ablation, which occurs principally through melt

  2. A MOLECULAR LINE SURVEY OF THE CARBON-RICH PROTOPLANETARY NEBULA AFGL 2688 IN THE 3 mm AND 1.3 mm WINDOWS

    SciTech Connect (OSTI)

    Zhang Yong; Kwok, Sun; Nakashima, Jun-ichi; Chau, Wayne [Department of Physics, University of Hong Kong, Pokfulam Road, Hong Kong (Hong Kong); Dinh-V-Trung, E-mail: zhangy96@hku.hk, E-mail: sunkwok@hku.hk, E-mail: junichi@hku.hk, E-mail: dvtrung@iop.vast.ac.vn [Institute of Physics, Vietnam Academy of Science and Technology, 10 DaoTan Street, BaDinh, Hanoi (Viet Nam)

    2013-08-10

    We present a spectral line survey of the protoplanetary nebula (PPN) AFGL 2688 in the frequency ranges of 71-111 GHz, 157-160 GHz, and 218-267 GHz using the Arizona Radio Observatory 12 m telescope and the Heinrich Hertz Submillimeter Telescope. A total of 143 individual spectral features associated with 32 different molecular species and isotopologues were identified. The molecules C{sub 3}H, CH{sub 3}CN, H{sub 2}CO, H{sub 2}CS, and HCO{sup +} were detected for the first time in this object. By comparing the integrated line strengths of different transitions, we are able to determine the rotation temperatures, column densities, and fractional abundances of the detected molecules. The C, O, and N isotopic ratios in AFGL 2688 are compared with those in IRC+10216 and the Sun, and were found to be consistent with stellar nucleosynthesis theory. Through comparisons of molecular line strengths in asymptotic giant branch stars, PPNs, and planetary nebulae, we discuss the evolution in circumstellar chemistry in the late stages of evolution.

  3. Ypres 

    E-Print Network [OSTI]

    2012-03-05

    the polymerase chain reaction (PCR) with primers ?Jerry? (5? CAACATTTATTTTGATTTTTTGG 3?; location 2183 within the Drosophila yukuba COI) and ?Pat? (5 ATCCATTACATATAATCTGCCATA 3?; location 3014 in tRNA region flanking COI). Each reaction contained 35?L ddH20..., 5?L 10 X Taq DNA polymerase buffer (Promega Corporation, Madison, Wisconsin), 4?L 25mM Promega MgCl2, 1?L 40mM deoxynucleotide triphosphates (dNTPs), 2?L of each 5mM oligonucleotide primer, 0.5?L of Promega Taq DNA polymerase and 1.5?L of DNA...

  4. Biological effects in unirradiated human tissue induced by radiation damage up to 1 mm away

    E-Print Network [OSTI]

    Brenner, David Jonathan

    in extrapolating radiation risk estimates from epidemi- ologically accessible doses down to very low doses where) and for assessing the risk from a low-dose exposure to a carcinogen such as ionizing radiation, where only a small, New York, NY 10032; Radiation Biology Laboratory, Research and Environmental Surveillance, Radiation

  5. Assessing the Performance of 5mm White LED Light Sources for Developing-Country Applications

    E-Print Network [OSTI]

    Mills, Evan

    2007-01-01

    lamp. Off-grid lighting products using the poorer LEDs wouldLED products encountered in the market by firms designing and assembling complete lightingLED) light sources have recently attained levels of efficiency and cost that allow them to compete with fluorescent lighting

  6. MM@MMaking Maths at Manchester General Course Information for the 2013 event.

    E-Print Network [OSTI]

    Glendinning, Paul

    walk away from the Alan Turing (Mathematics) building. Students will have their own room, with working minutes. There is a multi-storey car park next door to the Alan Turing building. A map and detailed

  7. Particle Image Velocimetry Measurements and Analysis of Bypass Data for a Scaled 6mm Gap

    SciTech Connect (OSTI)

    J.R. Wolf; T.E. Conder; R.R. Schultz

    2012-09-01

    The purpose of the fluid dynamics experiments in the MIR (Matched Index of-Refraction) flow system at Idaho National Laboratory (INL) is to develop benchmark databases for the assessment of Computational Fluid Dynamics (CFD) solutions of the momentum equations, scalar mixing, and turbulence models for the flow ratios between coolant channels and bypass gaps in the interstitial regions of typical prismatic standard fuel element (SFE) or upper reflector block geometries of typical Modular High-temperature Gas-cooled Reactors (MHTGR) in the limiting case of negligible buoyancy and constant fluid properties. The experiments will use optical techniques, primarily particle image velocimetry (PIV) in the INL Matched Index of Refraction (MIR) flow system.

  8. The off-axis jet structure in Mrk 501 at mm-wavelengths

    E-Print Network [OSTI]

    Shoko Koyama; Motoki Kino; Marcello Giroletti; Akihiro Doi; Hiroshi Nagai; Kazuhiro Hada; Kotaro Niinuma; Monica Orienti; Gabriele Giovannini; Eduardo Ros; Tuomas Savolainen; Miguel A. Pérez-Torres; Thomas P. Krichbaum

    2015-05-17

    We present results from 43 GHz (VLBA, six epochs from 2012.2 to 2013.2) and 86 GHz (GMVA, one epoch in 2012.4) observations toward the basis of the jet in the TeV Blazar Mrk 501. The 43-GHz data analysis reveals a new feature located northeast of the radio core, with a flux density of several tens of mJy, perpendicularly to the jet axis. The 86-GHz image shows the jet feature located 0.75 mas southeast of the radio core, which is consistent with the previous result. The location of Gaussian model for 0.75 mas feature does not coincide with those for the jets in the 43-GHz image, however, a distribution of emission is found. We also discuss the spectral indices of the core, the northeast feature, and the jet feature between 43 GHz and 86 GHz, which show flat-to-steep, steep, and flat-to-invert, respectively.

  9. An ATCA Survey of Sagittarius~B2 at 7~mm: Chemical Complexity Meets Broadband Interferometry

    E-Print Network [OSTI]

    Corby, Joanna F; Cunningham, Maria R; Menten, Karl M; Belloche, Arnaud; Schwab, Frederic R; Walsh, Andrew J; Balnozan, Egon; Bronfman, Leonardo; Lo, Nadia; Remijan, Anthony J

    2015-01-01

    We present a 30 - 50 GHz survey of Sagittarius B2(N) conducted with the Australia Telescope Compact Array (ATCA) with 5 - 10 arcsec resolution. This work releases the survey data and demonstrates the utility of scripts that perform automated spectral line fitting on broadband line data. We describe the line-fitting procedure, evaluate the performance of the method, and provide access to all data and scripts. The scripts are used to characterize the spectra at the positions of three HII regions, each with recombination line emission and molecular line absorption. Towards the most line-dense of the three regions characterised in this work, we detect ~500 spectral line components of which ~90 per cent are confidently assigned to H and He recombination lines and to 53 molecular species and their isotopologues. The data reveal extremely subthermally excited molecular gas absorbing against the continuum background at two primary velocity components. Based on the line radiation over the full spectra, the molecular a...

  10. SPECTROSCOPIE DES ONDES DE 1 A 5 mm (1) Par WALTER GORDY,

    E-Print Network [OSTI]

    Boyer, Edmond

    'effectua,it la transition dont j'ai parlé plus haut, Loubser et Townes [3] détectèrent le rayon- nement des'atténuation de cer- taines substances à des fréquences bien déterminées. Le klystron a beaucoup d'avantages sur

  11. rspb.royalsocietypublishing.org Cite this article: Turcotte MM, Davies TJ,

    E-Print Network [OSTI]

    Dhindsa, Rajinder

    . Proc. R. Soc. B 281: 20140555. http://dx.doi.org/10.1098/rspb.2014.0555 Received: 6 March 2014 Accepted://dx.doi.org/10.1098/rspb.2014.0555 or via http://rspb.royalsocietypublishing.org. Macroecological

  12. The Flare Activity of SgrA*; New Coordinated mm to X-Ray Observations

    E-Print Network [OSTI]

    A. Eckart; F. K. Baganoff; R. Schoedel; M. Morris; R. Genzel; G. C. Bower; D. Marrone; J. M. Moran; T. Viehmann; M. W. Bautz; W. N. Brandt; G. P. Garmire; T. Ott; S. Trippe; G. R. Ricker; C. Straubmeier; D. A. Roberts; F. Yusef-Zadeh; J. H. Zhao; R. Rao

    2005-12-16

    We report new simultaneous near-infrared/sub-millimeter/X-ray observations of the SgrA* counterpart associated with the massive 3-4x10**6 solar mass black hole at the Galactic Center. The main aim is to investigate the physical processes responsible for the variable emission from SgrA*. The observations have been carried out using the NACO adaptive optics (AO) instrument at the European Southern Observatory's Very Large Telescope and the ACIS-I instrument aboard the Chandra X-ray Observatory as well as the Submillimeter Array SMA on Mauna Kea, Hawaii, and the Very Large Array in New Mexico. We detected one moderately bright flare event in the X-ray domain and 5 events at infrared wavelengths.

  13. Scavenging Elemental Sb Through Addition of NbSb to Mm0.9Fe3...

    Office of Scientific and Technical Information (OSTI)

    Energy Sciences (SC-22) Country of Publication: United States Language: English Subject: solar (thermal), phonons, thermal conductivity, thermoelectric, mechanical behavior,...

  14. G6943y: Myths and Methods in Modeling (M&M's in M)

    E-Print Network [OSTI]

    Spiegelman, Marc W.

    favourite language here) , 2nd Edition (Press et al., 1992) is a useful reference. Other useful background methods of data analysis by providing a fundamental set of quantitative tools that would benefit all earth will illustrate the fundamental behavior of the most commonly occurring equa- tions and demonstrate how to choose

  15. Ferrite-Cored Solenoidal Induction Coil Sensor for BUD (MM-1667)

    E-Print Network [OSTI]

    Morrison, F.

    2012-01-01

    simple measurements with a spectrum analyzer to estimate thethis experiment we used the spectrum analyzer to measure the

  16. Vibrational Spectra of Water Solutions of Azoles from QM/MM Calculations: Effects of Solvation

    E-Print Network [OSTI]

    Guidoni, Leonardo

    the decomposition of the vibrational density of states of the gas phase and solution dynamics. The calculated shifts the structural and dynamical aspects of water solutions. X-ray as well as neutron diffraction are the main source and electronic structure of the molecule.1 We expect therefore that also its vibrational properties could

  17. Ab initio simulations of two-dimensional electronic spectra: The SOS//QM/MM approach

    E-Print Network [OSTI]

    Rivalta, I; Nenov, A; Cerullo, G; Mukamel, S; Garavelli, M; Garavelli, M

    2013-01-01

    calculations. Conclusions Two-dimensional electronic spectroscopy holds great potential for studying structure, dynamics,

  18. Electronic Properties of Disordered Organic Semiconductors via QM/MM Simulations

    E-Print Network [OSTI]

    Difley, Seth

    Organic semiconductors (OSCs) have recently received significant attention for their potential use in photovoltaic, light emitting diode, and field effect transistor devices. Part of the appeal of OSCs is the disordered, ...

  19. TITLE: AUTHOR(S) SUBMITTED TO: Mm EVOLUTIO:l C: S!LICIC

    Office of Scientific and Technical Information (OSTI)

    ?bul are vesicular ase they ar cole.:j nc;trssl:IIt, C,IIJC,- ing vapor saturation of the residual liquid. Direct rnixi:':; of rrlfic ariisilicic liquids is...

  20. Powering mm-Size Wireless Implants for Brain-Machine Interfaces

    E-Print Network [OSTI]

    Mark, Michael

    2011-01-01

    be another way of trading input power for rectificationbe chosen, trading off available power for a more efficientTrading-off channel loss for increased transmit power as

  1. UNIVERSIT`A DEGLI STUDI DI PERUGIA Facolt`a di Scienze MM. FF. e NN.

    E-Print Network [OSTI]

    Filippucci, Roberta

    gravemente non solo sul comportamento ma anche sulla fisiologia. Si considerano 12560 balene che vivono nell

  2. Laser amplifier based on a neodymium glass rod 150 mm in diameter

    SciTech Connect (OSTI)

    Shaykin, A A; Fokin, A P; Soloviev, A A; Kuzmin, A A; Shaikin, I A; Burdonov, K F; Khazanov, E A [Institute of Applied Physics, Russian Academy of Sciences, Nizhnii Novgorod (Russian Federation); Charukhchev, A V [Public Limited Company "Scientific research Institute for Optoelectronic Instrument Engineering", Leningrad region (Russian Federation)

    2014-05-30

    A unique large-aperture neodymium glass rod amplifier is experimentally studied. The small-signal gain distribution is measured at different pump energies. The aperture-averaged gain is found to be 2.3. The stored energy (500 J), the maximum possible pump pulse repetition rate, and the depolarisation in a single pulse and in a series of pulses with a repetition rate of one pulse per five minutes are calculated based on the investigations performed. It is shown that the use of this amplifier at the exit of the existing laser can increase the output pulse energy from 300 to 600 J. (lasers)

  3. Injection-locked composite lasers for mm-wave modulation : LDRD 117819 final report.

    SciTech Connect (OSTI)

    Wendt, Joel Robert; Vawter, Gregory Allen; Raring, James; Tauke-Pedretti, Anna; Alford, Charles Fred; Skogen, Erik J.; Chow, Weng Wah; Cajas, Florante G.; Overberg, Mark E.; Torres, David L.; Peake, Gregory Merwin

    2010-09-01

    This report summarizes a 3-year LDRD program at Sandia National Laboratories exploring mutual injection locking of composite-cavity lasers for enhanced modulation responses. The program focused on developing a fundamental understanding of the frequency enhancement previously demonstrated for optically injection locked lasers. This was then applied to the development of a theoretical description of strongly coupled laser microsystems. This understanding was validated experimentally with a novel 'photonic lab bench on a chip'.

  4. Small object transporter. [Patent: for objects 0. 01 to 2. 00 mm dia

    DOE Patents [OSTI]

    Winkler, M.A.

    1980-05-21

    The disclosure relates to a small object transporter. Gas is passed through a conduit having a venturi. Small objects are picked up at a first location by a pickup tube in communication with the venturi and are forced out one end of the conduit at a desired second location.

  5. HighFidelity Rapid Prototyping of 300mm Fabs through Discrete Event System Modeling #

    E-Print Network [OSTI]

    Reveliotis, Spiridon "Spyros"

    manufacturing industry has been driven by continuous technological advancement of the underlying production processes. Yet, as the industry matures, mere technology development is no longer su#cient. The e#ective deployment and exploitation of the system production capacity and operational capability become crit­ ical

  6. 0.5mm Pitch Board to Board Connector DF17 Series

    E-Print Network [OSTI]

    developed a new connector structure utilizing its unique technology, and greatly enhanced the resistance in a BOX structure and has also enhanced shock-proof, pinch-proof and scoop-proof performance. In addition

  7. SubstrateSubstrate Commercially available high density -alumina plate (14x14 mm2)

    E-Print Network [OSTI]

    Azad, Abdul-Majeed

    440 450 460 470 480 490 500 510 520 530 540 OHM SubstrateSubstrate Commercially available high followed by oxidation in a well-defined pO2 regime near the M-MOx proximity line by a suitable buffer gas Model. Fig. 4. Thermodynamic criteria for several M/MOx coexistence and practical pO2 regimes for phase

  8. Assessing the Performance of 5mm White LED Light Sources for Developing-Country Applications

    E-Print Network [OSTI]

    Mills, Evan

    2007-01-01

    with fluorescent lighting for off-grid applications in theProject includes an Off-Grid Lighting Technology Assessmentand the market success of off-grid lighting solutions for

  9. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM3, Wireless Services

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    in wireless settings 3. Video Streaming · Encoding and tranmission principles, buffering issues · Enhancements

  10. Pulling of 3 mm diameter AlSb rods by micro-pulling down method

    E-Print Network [OSTI]

    Bourret-Courchesne Ph.D., Edith

    2009-01-01

    Sb) and AlSb crystal zirconia were expected as crucibles,crucible shape with zirconia. Page 3/10 Fig 1 : vitreous

  11. Cryostat design for the Superconducting Super Collider 50mm aperture dipole magnet

    SciTech Connect (OSTI)

    Nicol, T.H. ); Tsavalas, Y.P. . Medical Systems)

    1990-09-01

    The cryostat of an SSC dipole magnet consists of all magnet components except the cold mass assembly. It serves to support the cold mass accurately and reliably within the vacuum vessel, provide all required cryogenic piping, and to insulate the cold mass from heat radiated and conducted from the environment. It must function reliably during storage, shipping and handling, normal magnet operation, quenches, and seismic excitations and must be manufacturable at low cost. The major components of the cryostat are the vacuum vessel, thermal shields, multilayer insulation (MLI) system, cryogenic piping, interconnections, and suspension system. The overall design of a cryostat for superconducting accelerator magnets requires consideration of fluid flow, proper selection of materials for their thermal and structural performance at both ambient and operating temperature, and knowledge of the environment to which the magnets will be subjected over the course their 25 year expected life. This paper describes the design of the current SSC collider dipole magnet cryostat and includes discussions on the thermal, structural, and dynamic considerations involved in the development of each of the major systems. 7 refs., 1 fig., 2 tabs.

  12. Exploring the Multidimensional Free Energy Surface of Phosphoester Hydrolysis with Constrained QM/MM Dynamics

    E-Print Network [OSTI]

    Gerwert, Klaus

    , it is involved in the regulation of protein function, energy production, and other biochemical pathways in cellsExploring the Multidimensional Free Energy Surface of Phosphoester Hydrolysis with Constrained QM for Theoretical Studies, Schloss-Wolfsbrunnenweg 35, 69118 Heidelberg, Germany § Ruhr-Universitat Bochum

  13. rsif.royalsocietypublishing.org Cite this article: Ankarali MM, Sefati S,

    E-Print Network [OSTI]

    . The Roman text De Architectura by Vitruvius and the epon- ymous Vitruvian Man by Leornado Da Vinci exemplify applications. The ubiquity of bilateral (left­right, sagittal plane) symmetry in animals is genetically encoded by the fact that the left­right axis is unbiased either by gravity or by direction of movement. However

  14. Facolt di Scienze MM.FF.NN Corso di Laurea in informatica

    E-Print Network [OSTI]

    Lo Cigno, Renato Antonio

    della SSTHRESH; 2. tempo di trasferimento; 3. numero totale di pacchetti inviati in rete ed efficienza

  15. DESIGN AND PERFORMANCE OF 40 mm, 6.5 T, COLLARED, COLD-IRON MODEL MAGNETS

    E-Print Network [OSTI]

    Peters, C.

    2010-01-01

    i. J Cu to S.C. , i.6S' keystone Outer Jo strands of 0.0255I.S Cu to S.C. , i.24' keystone Fig. i shows the aluminum

  16. Powering mm-Size Wireless Implants for Brain-Machine Interfaces

    E-Print Network [OSTI]

    Mark, Michael

    2011-01-01

    Interfaces . . . . . . . . . . . . . . . . . . . . . . . . . . . . .machine interfaces [Lebedev06] . . . . . . . . . . . . .rectifier interface . . . . . . . . . . . . . . . A half-

  17. MHK ISDB/Sensors/0.2 mm Rainfall (2m cable) Smart Sensor | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHK ISDB/Instruments/NortekMonitor ADCP

  18. Compression of 1-mm-thick M9763 cellular silicone foam under lateral

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing BacteriaConnect Collider Tests ofO y (Journal Article)ethanollipolyticaconfinement

  19. Compression of 1-mm-thick M9763 cellular silicone foam under lateral

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing BacteriaConnect Collider Tests ofO y (Journal

  20. 0.1 nm0.1 nm1 nm1 nm10 nm10 nm100 nm100 nm11 mm1010 mm100100 mm1 mm1 mm1 cm1 cm10 cm10 cm1 m1 m10 m10 m100 m100 m1 km1 kmWWAVELENGTHAVELENGTHWAVELENGTHWWAVELENGTHW 0.01K (-273C) 100K 5000K5000K5000K5000K5000K 30,000K 30,000,000K

    E-Print Network [OSTI]

    visible and invisible light from across the Cosmos SKA (Square Kilometre Array) SKA will be the world nuclear power ALMA E-ELT GAIAJWST XMM SKA sea level 690km 384,400km ALMA (Atacama Large Millimetre Array) ALMA is a giant array of 66 antennas observing at millimetre/submillimetre wavelengths. Location

  1. Data:Ffe2fb55-352f-473b-a2dd-50ae8b27f0a6 | Open Energy Information

    Open Energy Info (EERE)

    under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information...

  2. Data:1f590a33-1ff5-482b-91c2-e8dd847f3b0a | Open Energy Information

    Open Energy Info (EERE)

    under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information...

  3. Safety Analysis and Certification of Open Distributed Systems P. M. Conmy; Department of Computer Science, University of York, York, YO10 5DD U.K.

    E-Print Network [OSTI]

    Nicholson, Mark

    Safety Analysis and Certification of Open Distributed Systems P. M. Conmy; Department of Computer system is a network of computer modules upon which one or more computer applications can run and inter to the safety analysis and certification of avionics computer systems. At present aircraft computing systems are

  4. An improved method for measuring the absolute DD neutron yield and calibrating neutron time-of-flight detectors in inertial confinement fusion experiments

    E-Print Network [OSTI]

    Waugh, C. (Caleb Joseph)

    2014-01-01

    Since the establishment of nuclear physics in the early 1900's and the development of the hydrogen bomb in the 1950's, inertial confinement fusion (ICF) has been an important field in physics. Funded largely though the ...

  5. CONTAMINATED PROCESS EQUIPMENT REMOVAL FOR THE D&D OF THE 232-Z CONTAMINATED WASTE RECOVERY PROCESS FACILITY AT THE PLUTONIUM FINISHING PLANT (PFP)

    SciTech Connect (OSTI)

    HOPKINS, A.M.; MINETTE, M.J.; KLOS, D.B.

    2007-01-25

    This paper describes the unique challenges encountered and subsequent resolutions to accomplish the deactivation and decontamination of a plutonium ash contaminated building. The 232-Z Contaminated Waste Recovery Process Facility at the Plutonium Finishing Plant was used to recover plutonium from process wastes such as rags, gloves, containers and other items by incinerating the items and dissolving the resulting ash. The incineration process resulted in a light-weight plutonium ash residue that was highly mobile in air. This light-weight ash coated the incinerator's process equipment, which included gloveboxes, blowers, filters, furnaces, ducts, and filter boxes. Significant airborne contamination (over 1 million derived air concentration hours [DAC]) was found in the scrubber cell of the facility. Over 1300 grams of plutonium held up in the process equipment and attached to the walls had to be removed, packaged and disposed. This ash had to be removed before demolition of the building could take place.

  6. RICHIESTA INCENTIVO PER UTILIZZO SERVIZIO CAR SHARING per aziende con Mobility Manager nominato (ai sensi della D.D. 1487 del 30/12/2010)

    E-Print Network [OSTI]

    Di Pillo, Gianni

    RICHIESTA INCENTIVO PER UTILIZZO SERVIZIO CAR SHARING per aziende con Mobility Manager nominato (ai _________________________________________________________________________ codice cliente Car Sharing ________________________________________________________ Codice Fiscale iscrizione, integra la documentazione di iscrizione stessa al servizio Car Sharing e va inviata all

  7. Road Rash: Ecological and Social Impacts of Road Networks on First Nations Kneeshaw, D.D., Larouche, M., Asselin, H., Adam, M.-C.,

    E-Print Network [OSTI]

    Asselin, Hugo

    communities are confronted with many environmental and social issues associated with natural resource communities (Aboriginal or not). The effects of road networks linked to resources extraction continue regions for the exploitation of natural resources (primarily wood, minerals and fossil fuels). However

  8. Linear combination of Gaussian-type orbitals--local-density-functional cluster studies of D-D interactions in titanium and palladium

    SciTech Connect (OSTI)

    Dunlap, B.I.; Brenner, D.W.; Mowrey, R.C.; Mintmire, J.W.; White, C.T. )

    1990-05-15

    Linear combination of Gaussian-type orbitals (LCGTO) --local-density-functional (LDF) cluster calculations give the interaction energy of two deuterium atoms in the interstices of titanium and palladium. Octahedral and tetrahedral interstices of the face-centered-cubic (fcc) lattice are modeled by six and four metal atoms, respectively. No short equilibrium separations, compared to the gas-phase equilibrium separation, are found even when expansion of the lattice and loading with additional deuterium and metal atoms are considered. The deuteron affinities of these clusters are in accord with the experimental site preference.

  9. A compact proton spectrometer for measurement of the absolute DD proton spectrum from which yield and R are determined in thin-shell inertial-confinement-fusion

    E-Print Network [OSTI]

    . Landen,3 M. J. Moran,3 R. A. Zacharias,3 J. D. Kilkenny,4 and A. Nikroo4 1 Plasma Science and Fusion Energetics, University of Rochester, Rochester, New York 14623, USA 3 Lawrence Livermore National Laboratory and implemented using a linear accelerator and applied to experiments at the OMEGA laser facility and the National

  10. outbind://6-000000007B09B0C78182DD468D210820B7D48C0A070041ECF0B

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 20123/%2A en46Afedkcp8/%2A 11/17/2010 Dear Mr.

  11. An airborne digital processor for radar scatterometer data 

    E-Print Network [OSTI]

    Yeadon, David Steven

    1977-01-01

    0 4J 0 CD Cd O CD M O M Ccd M 0 dl dd H H H H H H 0d n H ccd H C/l 9 0W MM HH Cd P1 0 Id HHi+ g H H P CV W H dd H M O H 86 84 82 BO D6 DB D2 DO D7 D5 D3 Dl 15 17 19 21 DBE 2 8212 Data Bus Input IC23 16 18 20... DR10 DA9 DRB 14 11 5 4 13 12 193 IC30 10 15 10 193 IC34 14 ll 5 4 13 12 SR11 SR10 SR9 SRS DR7 DR6 DR5 DR4 RESETr 14 ll 5 4 13 12 193 IC31 10 15 193 IC35 14 11 5 4 13 12 SR7 SR6 SR5 SR4 DR3 DR2 DRl...

  12. 1Il!11: m:mm:lli11I,111 Illili:llili!!ill,1ll ill ill!!ii111,111,111 mm; 206 THE HUMAN FACTOR HAS KNOCKED THREE TIMES

    E-Print Network [OSTI]

    Meyer, Bertrand

    ................................................................................................................................ THE HUMAN FACTOR HAS KNOCKED THREE TIMES Three books on the ergonomics of computing systems B. Meyer vanous names to it: the ergonomics of computing systems, the study of human factors, software psy style, evaluation of software quality, data base management systems, use o.f natural language and design

  13. 0.5 mm 1.5 mm Within the framework of fusion technology research and development, a neutron source has long been considered a key facility to perform irradiation tests

    E-Print Network [OSTI]

    McDonald, Kirk

    at populating materials engineering database ­ supporting DEMO reactor design and licensing. New Sorgentina - impinging on a hydride thin layer which is on-line D-T reloaded via ion implantation. Metal hydride hydride layer as DT enriched target Rotating wheel target to manage high heat flux Continuous online layer

  14. P1: aaa Trim: 174mm 247mm Top: 0.553in Gutter: 0.747in CUUK632-10 CUUK632-Watters ISBN: 978 0 521 76573 2 June 26, 2009 21:33

    E-Print Network [OSTI]

    Mege, Daniel

    76573 2 June 26, 2009 21:33 10 Fault populations Richard A. Schultz Geomechanics ­ Rock Fracture Group

  15. Yeast Genomic DNA Preparation from Spheroplasts 1. Resuspend with 50 mM Tris, 25 mM EDTA (pH 8) in 10X the spheroplast pellet volume.

    E-Print Network [OSTI]

    Aris, John P.

    ) in 10X the spheroplast pellet volume. 2. Immediately add 1/10 volume of 10% SDS. Mix. 3. Incubate 30 up pellets. Wash for at least 5 minutes at 25°C. 11. Centrifuge 10 minutes in SS-34 rotor at 10,000 rpm at 4°C. Discard supernatant. 12. Drain and dry pellets on bench. Dissolve each pellet completely

  16. Portable TXRF Spectrometer with 10{sup -11}g Detection Limit and Portable XRF Spectromicroscope with Sub-mm Spatial Resolution

    SciTech Connect (OSTI)

    Kunimura, Shinsuke; Hatakeyama, So; Sasaki, Nobuharu; Yamamoto, Takashi; Kawai, Jun

    2010-04-06

    A portable total reflection X-ray fluorescence (TXRF) spectrometer that we have developed is applied to trace elemental analysis of water solutions. Although a 5 W X-ray tube is used in the portable TXRF spectrometer, detection limits of several ppb are achieved for 3d transition metal elements and trace elements in a leaching solution of soils, a leaching solution of solder, and alcoholic beverages are detected. Portable X-ray fluorescence (XRF) spectromicroscopes with a 1 W X-ray tube and an 8 W X-ray tube are also presented. Using the portable XRF spectromicroscope with the 1 W X-ray tube, 93 ppm of Cr is detected with an about 700 {mu}m spatial resolution. Spatially resolved elemental analysis of a mug painted with blue, red, green, and white is performed using the two portable spectromicroscopes, and the difference in elemental composition at each paint is detected.

  17. RELATIVISTIC JETS FROM ACCRETION DISKS R.V.E. LOVELACE, P.R. GANDHI and M.M. ROMANOVA

    E-Print Network [OSTI]

    momentum and energy from the disk. Two main regimes have been discussed, hydro- magnetic jets, which have and, Poynting jets, where the mass flux is small and energy and angular momentum are carried The powerful jets observed from active galaxies and quasars are probably not hydro- magnetic outflows

  18. 1 M-M@0?t$N@0=--3 2 O"J,?t 11

    E-Print Network [OSTI]

    Sato, Atsushi

    + · · · + anZ = dZ. [ ¿ZL@] Nc1.2 $HDjM1.4 $h$j, a1Z + · · · + anZ = aZ a Z+ { 0 } ($?$@1 $D) B8:$9$k. $3 ai a1Z + · · · + anZ = aZ , a a1, . . . , an t . $h$C$Fd . B ja d. 0J¿e$h$j a = d k k. 1.7 a1

  19. CC UU RR RR II CC UU LL UU MM VV II TT AA EE Thursday, 25 September 2014

    E-Print Network [OSTI]

    Synthesis of nanomaterials such as nanoparticles, carbon nanotubes, graphene structures, metal oxide: 2007: Helmi Keskinen "Synthesis of nanoparticles and preparation of deposits by liquid flamme spray

  20. 1010 OPTICS LETTERS / Vol. 23, No. 13 / July 1, 1998 16-mm infrared generation by difference-frequency mixing

    E-Print Network [OSTI]

    Byer, Robert L.

    -tal Technol- ogy) were diced into 1-cm squares, stacked together, and put into a bonding furnace. The furnace- plied at 600 ± C, and the pressure in the furnace was maintained at 30 mTorr of H2. The furnace

  1. Temperature effects on the 1585 mm spectra of olivines and pyroxenes J. E. Bowey,1,2P

    E-Print Network [OSTI]

    Bowey, Janet

    and planetary nebulae (e.g. Waters et al. 1996; Cohen et al. 1999; Malfait et al. 1999; Sylvester et al. 1999 emission occurs at temperatures in the 50­100 K range (e.g. Sylvester et al. 1999). However, previous laboratory studies (e.g. Day 1976; Agladze et al. 1996; Henning & Mutschke 1997; Mennella et al. 1998) have

  2. Elements for the design of precision machine tools and their application to a prototype 450mm Si-wafer grinder

    E-Print Network [OSTI]

    Rothenhöfer, Gerald S. (Gerald Sven)

    2010-01-01

    Next generation precision machines will require ever more rigid elements to achieve the required machining tolerances. The presented work focuses on the application of ultra stiff servo-controllable kinematic couplings and ...

  3. Development of TQC01, a 90 mm Nb3 Sn Model Quadrupole for LHC Upgrade Based on SS Collar

    E-Print Network [OSTI]

    Bossert, R. C.

    2009-01-01

    A ) keys are inserted and hydraulic press load is released,coils and closed in a hydraulic press. Col- laring keys are

  4. [Km 100 to 1000 mM (17)] and to S. cerevisiae hexose transporters' apparent affinity for glucose

    E-Print Network [OSTI]

    Severson, David

    , and British Petroleum Technology Ventures (through the Energy Biosciences Institute) have submitted a patent

  5. Absence of correlation between Sry polymorphisms and XY sex reversal caused by the M.m. domesticus Y chromosome

    SciTech Connect (OSTI)

    Carlisle, C.; Nagamine, C.M. [Vanderbilt Univ., School of Medicine, Nashville, TN (United States)] [Vanderbilt Univ., School of Medicine, Nashville, TN (United States); Winkinig, H.; Weichenhan, D. [Medizinische Universitaet Zu Luebeck (Germany)] [Medizinische Universitaet Zu Luebeck (Germany)

    1996-04-01

    Mus musculus domesticus Y chromosomes (Y{sup DOM} Chrs) vary in their ability to induce testes in the strain C57BL/6J. In severe cases, XY females develop (XY{sup DOM} sex reversal). To identify the molecular basis for the sex reversal, a 2.7-kb region of Sry, the testis-determining gene, was sequenced from Y{sup DOM} Chrs linked to normal testis determination, transient sex reversal, and severe sex reversal. Four mutations were identified. However, no correlation exists between these mutations and severity of XY{sup DOM} sex reversal. RT-PCR identified Sry transcripts in XY{sup DOM} sex-reversed fetal gonads at 11 d.p.c., the age when Sry is hypothesized to function. In addition, no correlation exists between XY{sup DOM} sex reversal and copy numbers of pSx1, a Y-repetitive sequence whose deletion is linked to XY sex reversal. We conclude that SRY protein variants, blockade of Sry transcription, and deletion of pSx1 sequences are not the underlying causes of XY{sup DOM} sex reversal. 63 refs., 6 figs., 6 tabs.

  6. Stratus Cloud Structure from MM-Radar Transects and Satellite Images: Scaling Properties and Artifact Detection with Semi-...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541C.3X-rays3 PreparedcordiallyGlobalHigh-LevelStructure from

  7. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    20 117KE crane lifting roof panel.JPG Gallery: American Recovery and Reinvestment Act Title: 100K Area D&D 100K Area D&D Name: 100K Area D&D Document Date: 10162009 Keywords:...

  8. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8 117KE workers lifting roof.JPG Gallery: American Recovery and Reinvestment Act Title: 100K Area D&D 100K Area D&D Name: 100K Area D&D Document Date: 10162009 Keywords:...

  9. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    19 117KE Worker directing roof panel lift.JPG Gallery: American Recovery and Reinvestment Act Title: 100K Area D&D 100K Area D&D Name: 100K Area D&D Document Date: 10162009...

  10. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 workers document a chemical inventory in U Plant Canyon.JPG Gallery: American Recovery and Reinvestment Act Title: U Plant D&D U Plant D&D Name: U Plant D&D Document Date: 1016...

  11. An Analysis of the Murine Neocortex: Normal Development and the Impact of Prenatal Ethanol Exposure on Connectivity, Gene Expression, and Behavior

    E-Print Network [OSTI]

    El Shawa, Hani

    2012-01-01

    K,  Goudreau  G,  and  O'Leary  DD.  2000.  Regulation  of  Perez-­?Garcia  CG,  Kroll  TT,  O'Leary  DD.  2009.  Lhx2  Y,  Johnson  JE  and  O'Leary  DD.  1999.  Graded   and  

  12. Non-laminated FRP Strap Elements for Reinforced Concrete, Timber and Masonry Applications

    E-Print Network [OSTI]

    Lees, Janet M.; Winistörfer, A. U.

    2010-05-11

    - metallic versions of support pads of the type shown in Fig. 5 have also been developed (Nägeli 2006). Straps consisting of 10 layers of 0.13 mm CFRP tape supported on high density polyethylene (HDPE), GFRP or CFRP prestressed concrete pads have been... for Reinforced Concrete Structures (FRPRCS-7). SP-230 , eds: C.K. Shield, J.P. Busel, S.L. Walkup and D.D. Gremel, ACI International SP-230-40, pp.685-704. 7. Hoult, N.A. and Lees, J.M. (2009), Efficient CFRP strap configurations for the shear...

  13. 2014-2015 Verification of Social Security Number & Date of Birth A. STUDENT INFORMATION SPIRE ID#: ____________________

    E-Print Network [OSTI]

    Mountziaris, T. J.

    2014-2015 Verification of Social Security Number & Date of Birth A. STUDENT INFORMATION SPIRE ID YYYY My correct Social Security Number is: ________ - _____ - _________ B. SIGNATURE- For corrections to date of birth. · Signed Social Security card or passport- For corrections to social security

  14. 0016-7622/yy-vv-n-000/$ 1.00 GEOL. SOC. INDIA JOURNAL GEOLOGICAL SOCIETY OF INDIA

    E-Print Network [OSTI]

    Chappell, Nick A

    0016-7622/yy-vv-n-000/$ 1.00 © GEOL. SOC. INDIA JOURNAL GEOLOGICAL SOCIETY OF INDIA Vol.nn, mon yyyy, pp. Statistical Modelling of Rainfall and River Flow in Thailand K. BOOCHABUN 1 , W. TYCH 2 , N and discharge and their spatial distribution. Statistical patterns in the frequency of extreme rainfall and flow

  15. Instructions for Downloading, Compiling, and Running MHDCLAW by J.A. Rossmanith

    E-Print Network [OSTI]

    Rossmanith, James A.

    a line of the following form: export MHDCLAW = /XXXX/YYYYY/MHDCLAW where XXXX and YYYY need if solving the MHD equations. 5. pressure fix: on can either have OPTION 1: E = En+1 (keep energy the same) The first option guarantees exact energy conservation, the second does not. However, the second is very

  16. College of Graduate Studies and Research Room C180 Administration Building, 105 Administration Place, Saskatoon SK S7N 5A2

    E-Print Network [OSTI]

    Saskatchewan, University of

    College of Graduate Studies and Research Room C180 Administration Building, 105 Administration and Research Room C180 Administration Building, 105 Administration Place, Saskatoon SK S7N 5A2 Telephone (306/yyyy) Value #12;College of Graduate Studies and Research Room C180 Administration Buil

  17. Volume 156,number 9 PHYSICS LETFERS A 8 July 1991 An efficient control algorithm for nonlinear systems

    E-Print Network [OSTI]

    Sinha, Sudeshna

    D.D. Holm We suggest a schemeto step up the efficiencyof arecentlyproposed adaptivecontrol algorithm

  18. BANDO N. D.D. 118/2010 PER IL RECLUTAMENTO DI UN RICERCATORE CON RAPPORTO DI LAVORO A TEMPO DETERMINATO CO FINANZIATO DALLA REGIONE LAZIO PER IL SETTORE S/D

    E-Print Network [OSTI]

    Di Pillo, Gianni

    caratterizzazione dei materiali per l'energia e l'ambiente. I suddetti requisiti devono essere posseduti alla data conversione di energia. Il ricercatore dovrà possedere competenze nelle procedure di sintesi e

  19. 414 Solutions Manual x Fluid Mechanics, Fifth Edition Solution: Given 'p fcn(U, V, d/D), then by dimensional analysis 'p/(UV2) fcn(d/D). For

    E-Print Network [OSTI]

    Bahrami, Majid

    .73 The power P generated by a certain windmill design depends upon its diameter D, the air density U, the wind form. A model windmill, of diameter 50 cm, develops 2.7 kW at sea level when V 40 m/s and when rotating

  20. Effectiveness of Training Families of Individuals with ASD and Other DD in Social-Communication Interventions: A Single-Case Research, Examination of Evidence-Based Practice, and Meta-Analytic Review 

    E-Print Network [OSTI]

    Hong, Eerea

    2015-05-26

    interventions can be broadly considered evidence-based practices for individuals with ASD; and (3) to conduct a meta-analytic review determining the effects of family-implemented social-communication intervention in promoting social-communication skills...

  1. D.D. Luong et al. / Journal of Alloys and Compounds 550 (2013) 412422 412 Development of high performance lightweight aluminum alloy/SiC hollow sphere syntactic foams and compressive

    E-Print Network [OSTI]

    Gupta, Nikhil

    2013-01-01

    with silicon carbide hollow spheres (SiCHS) is investigated for quasi-static (10-3 s-1 ) and high strain rate into reduced fuel consumption. Reduction in the weight of aircraft and marine vessels can lead to increased

  2. 2/17/2014 Individual.com http://www.individual.com/storyrss.php?story=187041904&hash=60cc388427344e151660dd160421ff9d 1/2

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    Telecom Transportation *XH Correct: Coal stocks at 4 Bohai-Rim ports down 3.29 pct on wk to 21.78 mln to efficiently power medical devices, Chiao said. The team used a cost-effective approach that opens the door

  3. IdentIfIcacIn Mariposa diurna mediana (ala anterior: 24-28 mm). adulto de alas pardas, dorso con gruesos

    E-Print Network [OSTI]

    García-Barros, Enrique

    no interconectados, en los Picos de europa y su entorno (provincias de asturias, León y cantabria). estas zonas de provincia. núcleo occidental en asturias (amieva, Ponga y cabrales), León (Posada de Valdeón) y cantabria

  4. 190 2008 IEEE International Solid-State Circuits Conference ISSCC 2008 / SESSION 9 / mm-Wave & PHASED ARRAYS / 9.6

    E-Print Network [OSTI]

    Razavi, Behzad

    , and (3) a component shifted to -90GHz. Since the output currents of these mixers flow through load tanks of a single RF mixer and quadrature IF mixers suffers from an additional image introduced by the third of the RF mixer convolves the +90GHz harmonic with the signal spectrum at -60GHz, thus translating

  5. 12th IFToMM World Congress, Besancon, June 18-21, 2007 A Method to Determine the Motion of Overconstrained 6R-Mechanisms

    E-Print Network [OSTI]

    Nawratil, Georg

    -loop. The mechanism becomes overcon- strained, when the inverse kinematics yields infinitely many solutions. The Inverse Kinematics Problem A serial 6R-mechanism can be modeled as a kinematic chain with a fixed link of Overconstrained 6R-Mechanisms M. Pfurner M.L. Husty University Innsbruck, Institute for Basic Sciences

  6. Artificial neural network modeling of the spontaneous combustion occurring in the industrial-scale coal stockpiles with 10-18 mm coal grain sizes

    SciTech Connect (OSTI)

    Ozdeniz, A.H.; Yilmaz, N. [Selcuk University, Konya (Turkey). Dept. of Mining Engineering

    2009-07-01

    Companies consuming large amounts of coal should work with coal stocks in order to not face problems due to production delays. The industrial-scale stockpiles formed for the aforementioned reasons cause environmental problems and economic losses for the companies. This study was performed in a coal stock area of a large company in Konya, which uses large amounts of coal in its manufacturing units. The coal stockpile with 5 m width, 10 m length, 3 m height, and having 120 tons of weight was formed in the coal stock area of the company. The inner temperature data of the stockpile was recorded by 17 temperature sensors placed inside the stockpile at certain points. In order to achieve this goal, the electrical signal conversion of temperatures sensed by 17 temperature sensors placed in certain points inside the coal stockpile, the transfer of these electrical signals into computer media by using analog-digital conversion unit after applying necessary filtration and upgrading processes, and the record of these information into a database in particular time intervals are provided. Additionally, the data relating to the air temperature, air humidity, atmospheric pressure, wind velocity, and wind direction that are the parameters affecting the coal stockpile were also recorded. Afterwards, these measurement values were used for training and testing of an artificial neural network model. Comparison of the experimental and artificial neural network results, accuracy rates of training and testing were found to be 99.5% and 99.17%, respectively. It is shown that possible coal stockpile behavior with this artificial neural network model is powerfully estimated.

  7. Feasibility study for a 10 MM GPY fuel ethanol plant, Brady Hot Springs, Nevada. Volume II. Geothermal resource, agricultural feedstock, markets and economic viability

    SciTech Connect (OSTI)

    Not Available

    1980-09-01

    The issues of the geothermal resource at Brady's Hot Springs are dealt with: the prospective supply of feedstocks to the ethanol plant, the markets for the spent grain by-products of the plant, the storage, handling and transshipment requirements for the feedstocks and by-products from a rail siding facility at Fernley, the probable market for fuel ethanol in the region, and an assessment of the economic viability of the entire undertaking.

  8. Feasibility study for a 10-MM-GPY fuel ethanol plant, Brady Hot Springs, Nevada. Volume 1. Process and plant design

    SciTech Connect (OSTI)

    Not Available

    1980-09-01

    An investigation was performed to determine the technical and economic viability of constructing and operating a geothermally heated, biomass, motor fuel alcohol plant at Brady's Hot Springs. The results of the study are positive, showing that a plant of innovative, yet proven design can be built to adapt current commerical fermentation-distillation technology to the application of geothermal heat energy. The specific method of heat production from the Brady's Hot Spring wells has been successful for some time at an onion drying plant. Further development of the geothermal resource to add the capacity needed for an ethanol plant is found to be feasible for a plant sized to produce 10 million gallons of motor fuel grade ethanol per year. A very adequate supply of feedgrains is found to be available for use in the plant without impact on the local or regional feedgrain market. The effect of diverting supplies from the animal feedlots in Northern Nevada and California will be mitigated by the by-product output of high-protein feed supplements that the plant will produce. The plant will have a favorable impact on the local farming economies of Fallon, Lovelock, Winnemucca and Elko, Nevada. It will make a positive and significant socioeconomic contribution to Churchill County, providing direct employment for an additional 61 persons. Environmental impact will be negligible, involving mostly a moderate increase in local truck traffic and railroad siding activity. The report is presented in two volumes. Volume 1 deals with the technical design aspects of the plant. The second volume addresses the issue of expanded geothermal heat production at Brady's Hot Springs, goes into the details of feedstock supply economics, and looks at the markets for the plant's primary ethanol product, and the markets for its feed supplement by-products. The report concludes with an analysis of the economic viability of the proposed project.

  9. Plasma Physics Challenges of MMPlasma Physics Challenges of MM--toto--THz and High Power MicrowaveTHz and High Power Microwave

    E-Print Network [OSTI]

    of radio waves, confirming Maxwell's theory · 1917: Tesla proposed radio wave radar H. Hertz, Karlsrühe hardware enabled basic research in microwave spectroscopy, atmospheric science, radar, maser, and radio energy research Charged particle accelerators Atmospheric radar Radio astronomy Medical

  10. Total RNA From Yeast Using Glass Beads In advance, prepare 2 ml tubes containing 0.25 g acid washed glass beads (0.5 mm diameter) and

    E-Print Network [OSTI]

    Aris, John P.

    Total RNA From Yeast Using Glass Beads In advance, prepare 2 ml tubes containing 0.25 g acid washed. 1. Collect 5 OD600 units of yeast (e.g., 10 mls of OD600 = 0.5). Centrifuge for 5 minutes at 2000 different time points by centrifugation and store at -80°C. At step 6: collect exactly the same volume

  11. Combining quantum wavepacket ab initio molecular dynamics with QM/MM and QM/QM techniques: Implementation blending ONIOM and empirical

    E-Print Network [OSTI]

    Iyengar, Srinivasan S.

    : Implementation blending ONIOM and empirical valence bond theory Isaiah Sumner and Srinivasan S. Iyengara. All components of the methodology, namely, quantum dynamics and ONIOM molecular dynamics

  12. 5000 groove/mm multilayer-coated blazed grating with 33percent efficiency in the 3rd order in the EUV wavelength range

    SciTech Connect (OSTI)

    Advanced Light Source; Voronov, Dmitriy L.; Anderson, Erik; Cambie, Rossana; Salmassi, Farhad; Gullikson, Eric; Yashchuk, Valeriy; Padmore, Howard; Ahn, Minseung; Chang, Chih-Hao; Heilmann, Ralf; Schattenburg, Mark

    2009-07-07

    We report on recent progress in developing diffraction gratings which can potentially provide extremely high spectral resolution of 105-106 in the EUV and soft x-ray photon energy ranges. Such a grating was fabricated by deposition of a multilayer on a substrate which consists ofa 6-degree blazed grating with a high groove density. The fabrication of the substrate gratings was based on scanning interference lithography and anisotropic wet etch of silicon single crystals. The optimized fabrication process provided precise control of the grating periodicity, and the grating groove profile, together with very short anti-blazed facets, and near atomically smooth surface blazed facets. The blazed grating coated with 20 Mo/Si bilayers demonstrated a diffraction efficiency in the third order as high as 33percent at an incidence angle of 11? and wavelength of 14.18 nm.

  13. A Large System of 500 MHz Transient M.S. Atiya, J.S. Haggerty, M.M. Ito, C. Ng

    E-Print Network [OSTI]

    elements has often enriched our understanding of the devices generating the signals and fre­ quently the detector in both the barrel and endcap regions. A 1 Tesla solenoidal coil surrounds the entire detector

  14. eyeROBOT -Heterogeneous Robotic Platform for Real-time Computer Vision Mohit Modi (mm2675), Sravya Chinthalapati (sc2655), Shang Dang (sd687), Yunong Liu (yl2494)

    E-Print Network [OSTI]

    Afshari, Ehsan

    is a mobile robotic platform which can be driven based on the input commands provided over serial interface-software co-design including FPGA prototyping, High-Level Digital Synthesis (HLS), Embedded System Development Window FPGA Video Accelerator TX RX OpCode Velocity (MSB) Velocity (LSB) Radius (MSB) Radius (LSB) 1 Byte

  15. Multiscale QM/MM Molecular Dynamics Study on the First Steps of Guanine-Damage by Free Hydroxyl Radicals in Solution

    E-Print Network [OSTI]

    Abolfath, Ramin M; Rajnarayanam, R; Brabec, Thomas; Kodym, Reinhard; Papiez, Lech

    2012-01-01

    Understanding the damage of DNA bases from hydrogen abstraction by free OH radicals is of particular importance to reveal the effect of hydroxyl radicals produced by the secondary effect of radiation. Previous studies address the problem with truncated DNA bases as ab-initio quantum simulation required to study such electronic spin dependent processes are computationally expensive. Here, for the first time, we employ a multiscale and hybrid Quantum-Mechanical-Molecular-Mechanical simulation to study the interaction of OH radicals with guanine-deoxyribose-phosphate DNA molecular unit in the presence of water where all the water molecules and the deoxyribose-phosphate fragment are treated with the simplistic classical Molecular-Mechanical scheme. Our result illustrates that the presence of water strongly alters the hydrogen-abstraction reaction as the hydrogen bonding of OH radicals with water restricts the relative orientation of the OH-radicals with respective to the the DNA base (here guanine). This results ...

  16. J.A. Leenheer & M.M. Reddy, Annals of Environmental Science / 2008, Vol 2, 11-25 www.aes.northeastern.edu, ISSN 1939-2621 11

    E-Print Network [OSTI]

    , including the Green River Formation oil shale, which is well known as one the world's largest potential

  17. Investigation of surface inhomogeneity and estimation of the GOES skin temperature assimilation errors of the MM5 implied by the inhomogeneity over Houston metropolitan area 

    E-Print Network [OSTI]

    Han, Sang-Ok

    2005-11-01

    by about 25 %, thereby inducing the warmer (0.7 %) and drier (-1.0 %) PBL and the colder and moister PBL top induced by greater turbulent diffusivities. The 3-d application of the inhomogeneity parameterization indicated consistent results with the 1-d...

  18. 1.1 0.2 were bound to the column and were eluted by 30 mM and 1 M HCI, respec-

    E-Print Network [OSTI]

    Boyer, Edmond

    infusion on postabsorp- tive glycemia in non insulin dependent diabetes mellitus (NIDDM). V Rigalleau previously reported a hyper- glycemic effect of a lipid infusion in the postabsorptive state in NIDD patients patients. Fifteen received a 180 min lipid infusion (')veiip20%'; 0.0155 mUkg/min) and 15 received saline

  19. Investigating the chemical and morphological evolution of GaAs capped InAs/InP quantum dots emitting at 1.5 mm using aberration-corrected

    E-Print Network [OSTI]

    Dunin-Borkowski, Rafal E.

    s t r a c t The emission wavelength of InAs quantum dots grown on InP has been shown to shiftInvestigating the chemical and morphological evolution of GaAs capped InAs/InP quantum dots microscopy A3. Metalorganic vapour-phase epitaxy A3. Quantum dots B2. Semiconducting III/V materials a b

  20. 23.2 A Modular 1mm3 Die-Stacked Sensing Platform With Optical Communication and Multi-Modal Energy

    E-Print Network [OSTI]

    Dutta, Prabal

    and synchronization. It also includes an ultra-low power PMU (Power Management Unit) with BOD (Brown-Out Detector ranges from 11nW in sleep mode up to ~40µW in active mode. A flexible PMU allows harvesting for perpetual

  1. horizontal de 60 cm de long, avec une tension de 100 200 volts et du papier Whatman No 3MM de 5 cul de

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    source, déposée à une extrémité, migrer environ jusqu'aux 2/3 de la longueur du papier. 147 Pm additionné même pour toutes les fractions de,1 /2 cm correspondant à la zone Sm - Pm - Nd. La raie de 121 ke carbone absorbant les p-, est (3 :1: 0,5)10-1 /P- de 14'Pm. C. Conclusion : Origine du rayonnement de 121

  2. Structural properties of free-standing 50 mm diameter GaN waferswith (101_0) orientation grown on LiAlO2

    SciTech Connect (OSTI)

    Jasinski, Jacek; Liliental-Weber, Zuzanna; Maruska, Herbert-Paul; Chai, Bruce H.; Hill, David W.; Chou, Mitch M.C.; Gallagher, John J.; Brown, Stephen

    2005-09-27

    (10{und 1}0) GaN wafers grown on (100) face of {gamma}-LiAlO{sub 2} were studied using transmission electron microscopy. Despite good lattice matching in this heteroepitaxial system, high densities of planar structural defects in the form of stacking faults on the basal plane and networks of boundaries located on prism planes inclined to the layer/substrate interface were present in these GaN layers. In addition, significant numbers of threading dislocations were observed. High-resolution electron microscopy indicates that stacking faults present on the basal plane in these layers are of low-energy intrinsic I1type. This is consistent with diffraction contrast experiments.

  3. Exploring the molecular chemistry and excitation in obscured luminous infrared galaxies: An ALMA mm-wave spectral scan of NGC 4418

    E-Print Network [OSTI]

    Costagliola, F; Muller, S; Martín, S; Aalto, S; Harada, N; van der Werf, P; Viti, S; Garcia-Burillo, S; Spaans, M

    2015-01-01

    We obtained an ALMA Cycle 0 spectral scan of the dusty LIRG NGC 4418, spanning a total of 70.7 GHz in bands 3, 6, and 7. We use a combined local thermal equilibrium (LTE) and non-LTE (NLTE) fit of the spectrum in order to identify the molecular species and derive column densities and excitation temperatures. We derive molecular abundances and compare them with other Galactic and extragalactic sources by means of a principal component analysis. We detect 317 emission lines from a total of 45 molecular species, including 15 isotopic substitutions and six vibrationally excited variants. Our LTE/NLTE fit find kinetic temperatures from 20 to 350 K, and densities between 10$^5$ and 10$^7$ cm$^{-3}$. The spectrum is dominated by vibrationally excited HC$_3$N, HCN, and HNC, with vibrational temperatures from 300 to 450 K. We find high abundances of HC$_3$N, SiO, H$_2$S, and c-HCCCH and a low CH$_3$OH abundance. A principal component analysis shows that NGC 4418 and Arp 220 share very similar molecular abundances and ...

  4. 5000 Groove/mm multilayer-coated blazed grating with 33% efficiency in the 3rd order in the EUV wavelength range

    E-Print Network [OSTI]

    Schattenburg, Mark Lee

    We report on recent progress in developing diffraction gratings which can potentially provide extremely high spectral resolution of 10[superscript 5]-10[superscript 6] in the EUV and soft x-ray photon energy ranges. Such ...

  5. The Ability of MM5 to Simulate Ice Clouds: Systematic Comparison between Simulated and Measured Fluxes and Lidar/Radar Profiles at the

    E-Print Network [OSTI]

    Protat, Alain

    -term meteorological measurements by active (radar and lidar) and passive (infrared and visible fluxes) remote sensing effect is governed primarily by the equi- librium between their albedo effect and their green- house

  6. JvMF:210x280mmKunde:RWE 13410/10/10005/01Produkt:energiewelt.de;Stromberg,,Dmmung"

    E-Print Network [OSTI]

    Falge, Eva

    feststellt, werden neue Techniken und Investitionschancen in Kohlen- dioxid-arme und erneuerbare Energien

  7. The sensitivity of the PSU-NCAR model (MM5) to cumulus parameterization in simulating the mesoscale environment associated with 2 June 1995 West Texas tornado outbreak 

    E-Print Network [OSTI]

    Han, Sang-Ok

    1998-01-01

    important role in producing tornadic supercedes. This study presents observational features of the event, performs model simulations with three disparate cumulus parameterization schemes, and does a careful comparison between the simulations and observations...

  8. Scavenging Elemental Sb Through Addition of NbSb to Mm0.9Fe3.5Co0.5S12

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference) | SciTechsaturated fractured rock (Journal(Journal

  9. Measurement of Boundary-Layer Temperature Profiles by a Scanning 5-MM Radiometer During the 1999 Winter NSA/AAO Radiometer Exp

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter By SarahMODELING CLOUD1 H( 7 Be, 8Measurement

  10. STRENGTH AND PERMEABILITY TESTS ON ULTRA-LARGE STRIPA GRANITE CORE

    E-Print Network [OSTI]

    Thorpe, R.

    2009-01-01

    2-0.0598 mm 16-0.0241 mm 58.5 rns 0 em :C mm mnl mm ms dC 4mm mm mm ms dC mm mm mm mm rns 5-0.0697 mm 12-0.2679 mm 19-KPa mm mm ms em mm mm mm rns dC mm mm mm ms mm mm mm ms 6

  11. Els UK SOI Ch04-N52975 Trim:165MM240MM 5-9-2007 9:30p.m. Page:117 Float:Top/Bot TS: Integra, India Fonts: Times & Copperplate 32BC 10/12pt Margins:Top:4pc Gutter:5pc T.Area:29pcx43p9 open recto 1 Color 44 Lines

    E-Print Network [OSTI]

    Lieth, J. Heinrich

    for the fraction of water that ends up tied up in biomass. While transpiration cools the leaves, this flux) of the total water actually ends up as fresh matter (Raviv and Blom, 2001). The rest of the water is transpired and most of this water use is necessary as part of the plant's need to cool itself. The total amount

  12. Evaluation of two-stage system for neutron measurement aiming at increase in count rate at Japan Atomic Energy Agency-Fusion Neutronics Source

    SciTech Connect (OSTI)

    Shinohara, K., E-mail: shinohara.koji@jaea.go.jp; Ochiai, K.; Sukegawa, A. [Japan Atomic Energy Agency, Naka, Ibaraki 311-0193 (Japan); Ishii, K.; Kitajima, S. [Department of Quantum Science and Energy Engineering, Tohoku University, Sendai, Miyagi 980-8579 (Japan); Baba, M. [Cyclotron and Radioisotope Center, Tohoku University, Sendai, Miyagi 980-8578 (Japan); Sasao, M. [Organization for Research Initiatives and Development, Doshisha University, Kyoto 602-8580 (Japan)

    2014-11-15

    In order to increase the count rate capability of a neutron detection system as a whole, we propose a multi-stage neutron detection system. Experiments to test the effectiveness of this concept were carried out on Fusion Neutronics Source. Comparing four configurations of alignment, it was found that the influence of an anterior stage on a posterior stage was negligible for the pulse height distribution. The two-stage system using 25 mm thickness scintillator was about 1.65 times the count rate capability of a single detector system for d-D neutrons and was about 1.8 times the count rate capability for d-T neutrons. The results suggested that the concept of a multi-stage detection system will work in practice.

  13. Time of flight emission spectroscopy of laser produced nickel plasma: Short-pulse and ultrafast excitations

    SciTech Connect (OSTI)

    Smijesh, N.; Chandrasekharan, K. [Laser and Nonlinear Optics Laboratory, Department of Physics, National Institute of Technology Calicut, Calicut 673601 (India); Joshi, Jagdish C.; Philip, Reji, E-mail: reji@rri.res.in [Ultrafast and Nonlinear Optics Lab, Light and Matter Physics Group, Raman Research Institute, Bangalore 560080 (India)

    2014-07-07

    We report the experimental investigation and comparison of the temporal features of short-pulse (7 ns) and ultrafast (100 fs) laser produced plasmas generated from a solid nickel target, expanding into a nitrogen background. When the ambient pressure is varied in a large range of 10??Torr to 10²Torr, the plume intensity is found to increase rapidly as the pressure crosses 1 Torr. Time of flight (TOF) spectroscopy of emission from neutral nickel (Ni I) at 361.9 nm (3d?(²D) 4p ? 3d?(²D) 4s transition) reveals two peaks (fast and slow species) in short-pulse excitation and a single peak in ultrafast excitation. The fast and slow peaks represent recombined neutrals and un-ionized neutrals, respectively. TOF emission from singly ionized nickel (Ni II) studied using the 428.5 nm (3p?3d?(³P) 4s? 3p?3d? 4s) transition shows only a single peak for either excitation. Velocities of the neutral and ionic species are determined from TOF measurements carried out at different positions (i.e., at distances of 2 mm and 4 mm, respectively, from the target surface) on the plume axis. Measured velocities indicate acceleration of neutrals and ions, which is caused by the Coulomb pull of the electrons enveloping the plume front in the case of ultrafast excitation. Both Coulomb pull and laser-plasma interaction contribute to the acceleration in the case of short-pulse excitation. These investigations provide new information on the pressure dependent temporal behavior of nickel plasmas produced by short-pulse and ultrafast laser pulses, which have potential uses in applications such as pulsed laser deposition and laser-induced nanoparticle generation.

  14. Low Power Band to Band Tunnel Transistors

    E-Print Network [OSTI]

    Bowonder, Anupama

    2010-01-01

    DD Scaling Path for Future Low Power ICs”, VLSI Technology,la-doping on the reliability of low V th high-k/metal gateDD Scaling Path for Future Low Power ICs”, VLSI Technology,

  15. Advanced Penning-type ion source development and passive beam focusing techniques for an associated particle imaging neutron generator

    E-Print Network [OSTI]

    Sy, Amy

    2013-01-01

    Accelerator-based neutron generators . . 1.3.1 D-D and D-Tyields . . . 1.4 Compact API generator components . . 2based neutron generator. . . . . D-D and D-T fusion reaction

  16. Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Demolition (212-P) 200 North Area Facility Demolition (212-P) U Plant D&D U Plant D&D Drilling Groundwater Well 200 West Area Drilling Groundwater Well 200 West Area Drilling...

  17. INSTITUTE OF PHYSICS PUBLISHING JOURNAL OF MICROMECHANICS AND MICROENGINEERING J. Micromech. Microeng. 14 (2004) R35R64 PII: S0960-1317(04)06813-5

    E-Print Network [OSTI]

    Santiago, Juan G.

    2004-01-01

    /capillary/channel radius B magnetic flux density C capacitance Dd hydraulic diameter dd diaphragm diameter E electric field applications, macroscale pumps, pressure/vacuum chambers and valves provide adequate microfluidic transport

  18. MetAMOS: a modular and open source metagenomic assembly and analysis pipeline

    E-Print Network [OSTI]

    2013-01-01

    Namiki et al. 2011 [24]; Sommer et al. 2008 [40]; Margulies39. Schatz MC, Phillippy AM, Sommer DD, Delcher AL, Puiu D,2013, 14:213-224. 40. Sommer DD, Delcher AL, Salzberg SL,

  19. Chloroquine Resistance in Plasmodium falciparum Malaria

    E-Print Network [OSTI]

    Symington, Lorraine S.

    (clones C3Dd2 and C4Dd2 ), K76I (C5K76I ), and 7G8 (C67G8 ). We also obtained the C2GC03 clone in which re

  20. LOW-POWER METHODOLOGY FOR FAULT TOLERANT NANOSCALE MEMORY DESIGN

    E-Print Network [OSTI]

    Kim, Seokjoong

    2012-01-01

    con?icts while considering memory cell power and reliabilitysize improving the cell power and reliability. This aspectP dyn (V dd ), and cell leakage power P leak (V dd ) at a