Powered by Deep Web Technologies
Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Principal Component Analysis of X-ray Diffraction Patterns To Yield Morphological Classification of Brucite Particles  

Science Journals Connector (OSTI)

Principal Component Analysis of X-ray Diffraction Patterns To Yield Morphological Classification of Brucite Particles ... Finally, a comparison of the scanning electron microscopy images of the samples classified in each group revealed that in most of the cases a distinct morphology predominates within each group, which can be explained on the basis of the brucite growth mechanism. ... The increasing interest in the application of brucite (crystalline Mg(OH)2) as a flame retardant filler in polymer formulations is motivated by advantages of this material over halogenated flame retardants, which include environmental and health compatibility. ...

Charlene R. S. Matos; Maria José Xavier; Ledjane S. Barreto; Nivan B. Costa, Jr.; Iara F. Gimenez



X-ray Diffraction (XRD) 1.0 What is X-ray Diffraction  

E-Print Network (OSTI)

X-ray Diffraction (XRD) · 1.0 What is X-ray Diffraction · 2.0 Basics of Crystallography · 3.0 Production of X-rays · 4.0 Applications of XRD · 5.0 Instrumental Sources of Error · 6.0 Conclusions #12 why the cleavage faces of crystals appear to reflect X-ray beams at certain angles of incidence (theta

Moeck, Peter


J. Mol. Biol. (1984) 177, 201-206 Some X-ray Diffraction Patterns from  

E-Print Network (OSTI)

awaits a molecular model. In vivo and in vitro produced two-dimensional sheets and helices have been methanol (type M) or a mixture of methanol and ethylene glycol (type ME). Sharp, resolvable patterns% (v v methanol at pH 8.7, using a modified version of' the/ ) crystallization method described

Yonath, Ada E.


X-Ray Diffraction The X-Ray Diffraction facility is equipped with state-of-the-art  

E-Print Network (OSTI)

X-Ray Diffraction The X-Ray Diffraction facility is equipped with state-of-the-art diffractometers offering both single crystal and powder X-Ray diffraction. Powder X-Ray Diffraction High resolution data For more details on powder X-Ray analysis contact Dr J Hriljac on 0121 414 4458 or email: j

Birmingham, University of


Biological Imaging by Soft X-Ray Diffraction Microscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Biological Imaging by Soft X-Ray Diffraction Microscopy Print Wednesday, 30 November 2005 00:00 Electron and x-ray...


X-Ray Diffraction on NIF  

SciTech Connect

The National Ignition Facility (NIF) is currently a 192 beam, 1.6 MJ laser. NIF Ramp-Compression Experiments have already made the relevant exo-planet pressure range from 1 to 50 Mbar accessible. We Proposed to Study Carbon Phases by X-Ray Diffraction on NIF. Just a few years ago, ultra-high pressure phase diagrams for materials were very 'simple'. New experiments and theories point out surprising and decidedly complex behavior at the highest pressures considered. High pressures phases of aluminum are also predicted to be complex. Recent metadynamics survey of carbon proposed a dynamic pathway among multiple phases. We need to develop diagnostics and techniques to explore this new regime of highly compressed matter science. X-Ray Diffraction - Understand the phase diagram/EOS/strength/texture of materials to 10's of Mbar. Strategy and physics goals: (1) Powder diffraction; (2) Begin with diamond; (3) Continue with metals etc.; (4) Explore phase diagrams; (5) Develop liquid diffraction; and (6) Reduce background/improve resolution.

Eggert, J H; Wark, J



X-ray Diffraction Laboratory Department of Chemistry  

E-Print Network (OSTI)

X-ray Diffraction Laboratory Department of Chemistry Texas A & M University College Station, Texas Phone : 979-845-9125 www.chem.tamu.edu/xray xray@tamu.edu X-rayDiffractionLaboratory DepartmentofChemistry 3255TAMU CollegeStation,TX77843-3255 Mission The purpose of our laboratory is to provide X-ray

Meagher, Mary


X-ray Diffraction Practicals 1 Graphics Programs  

E-Print Network (OSTI)

X-ray Diffraction Practicals 1 Graphics Programs that will read SHELX or CIF files J. Reibenspies, N. Bhuvanesh ver 1.0.0 #12;X-ray Diffraction Practicals 2 Free software. Gretep : Reads SHELX files shelx files or output thermal ellipsoid plots. http://www.umass.edu/microbio/rasmol/ #12;X-ray

Meagher, Mary


X-Ray Diffraction Microscopy of Magnetic Structures  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Diffraction Microscopy of Magnetic Structures Print science brief icon Scientists working at ALS Beamline have demonstrated a new x-ray technique for producing...


X-ray diffraction study of zirconia pillared clays  

Science Journals Connector (OSTI)

X-ray powder diffraction (XRPD) and X-ray radial electronic distribution density (RED) of initial and zirconia-pillared interlayered clays (Zr-PILC) were studied. After pillaring, the basal ... under air to 17.7 ...

D.A. Zyuzin; E.M. Moroz; T.G. Kuznetsova…



Biological Imaging by Soft X-Ray Diffraction Microscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Print Electron and x-ray microscopes are a valuable tool for both the life and materials sciences, but they are limited in...


Definition: X-Ray Diffraction (XRD) | Open Energy Information  

Open Energy Info (EERE)

X-Ray Diffraction (XRD) X-Ray Diffraction (XRD) Jump to: navigation, search Dictionary.png X-Ray Diffraction (XRD) X-Ray Diffraction (XRD) is a laboratory-based technique commonly used for identification of crystalline materials and analysis of unit cell dimensions. One of two primary types of XRD analysis (X-ray powder diffraction and single-crystal XRD) is commonly applied to samples to obtain specific information about the crystalline material under investigation. X-ray powder diffraction is widely used in geology, environmental science, material science, and engineering to rapidly identify unknown crystalline substances (typically in less than 20 minutes). A pure, finely ground, and homogenized sample is required for determination of the bulk composition. Additional uses include detailed


X-Ray Diffraction (XRD) | Open Energy Information  

Open Energy Info (EERE)

X-Ray Diffraction (XRD) X-Ray Diffraction (XRD) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: X-Ray Diffraction (XRD) Details Activities (0) Areas (0) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Lab Analysis Techniques Exploration Sub Group: Rock Lab Analysis Parent Exploration Technique: Rock Lab Analysis Information Provided by Technique Lithology: Rapid and unambiguous identification of unknown minerals.[1] Stratigraphic/Structural: Hydrological: Thermal: Dictionary.png X-Ray Diffraction (XRD): X-Ray Diffraction (XRD) is a laboratory-based technique commonly used for identification of crystalline materials and analysis of unit cell dimensions. One of two primary types of XRD analysis (X-ray powder diffraction and single-crystal XRD) is commonly applied to samples to


Portable X-Ray Diffraction (XRD) | Open Energy Information  

Open Energy Info (EERE)

Portable X-Ray Diffraction (XRD) Portable X-Ray Diffraction (XRD) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: Portable X-Ray Diffraction (XRD) Details Activities (0) Areas (0) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Field Techniques Exploration Sub Group: Data Collection and Mapping Parent Exploration Technique: Data Collection and Mapping Information Provided by Technique Lithology: Rapid and unambiguous identification of unknown minerals.[1] Stratigraphic/Structural: Hydrological: Thermal: Dictionary.png Portable X-Ray Diffraction (XRD): Portable X-Ray Diffraction (XRD) is a field-based technique that can be used for identification of crystalline materials and analysis of unit cell dimensions. Portable XRD analysis is similar to X-ray powder diffraction,


Single-particle structure determination by correlations of snapshot X-ray diffraction patterns (CXIDB ID 20)  

DOE Data Explorer (OSTI)

This deposition includes the diffraction images generated by the paired polystyrene spheres in random orientations. These images were used to determine and phase the single particle diffraction volume from their autocorrelation functions.

Starodub, D.


Self-terminating diffraction gates femtosecond X-ray nanocrystallograp...  

NLE Websites -- All DOE Office Websites (Extended Search)

Self-terminating diffraction gates femtosecond X-ray nanocrystallography measurements Authors: Barty, A., Caleman, C., Aquila, A., Timneanu, N., Lomb, L., White, T. A., Andreasson,...


X-Ray Diffraction Microscopy of Magnetic Structures  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Diffraction Microscopy of Magnetic Structures Print X-Ray Diffraction Microscopy of Magnetic Structures Print science brief icon Scientists working at ALS Beamline have demonstrated a new x-ray technique for producing short-exposure nanoscale images of the magnetic structure of materials. The new method combines aspects of coherent x-ray diffraction, which can determine 3-D charge distributions, and resonant magnetic scattering, which is sensitive to magnetic structures. Physicists have used coherent x-ray diffraction to measure the electron density of complicated molecules. The formula used to make these calculations contains terms that relate to the electron spin of magnetic atoms, but these terms are traditionally ignored since coherent x-ray diffraction has not been used to retrieve magnetic information. Using the full formula allows for the determination of not only the electron density, but also the magnetic spin distribution and its orientation.


X-Ray Diffraction Microscopy of Magnetic Structures  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Diffraction Microscopy of Magnetic Structures Print X-Ray Diffraction Microscopy of Magnetic Structures Print science brief icon Scientists working at ALS Beamline have demonstrated a new x-ray technique for producing short-exposure nanoscale images of the magnetic structure of materials. The new method combines aspects of coherent x-ray diffraction, which can determine 3-D charge distributions, and resonant magnetic scattering, which is sensitive to magnetic structures. Physicists have used coherent x-ray diffraction to measure the electron density of complicated molecules. The formula used to make these calculations contains terms that relate to the electron spin of magnetic atoms, but these terms are traditionally ignored since coherent x-ray diffraction has not been used to retrieve magnetic information. Using the full formula allows for the determination of not only the electron density, but also the magnetic spin distribution and its orientation.


X-Ray Diffraction Microscopy of Magnetic Structures  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Diffraction Microscopy of Magnetic Structures Print X-Ray Diffraction Microscopy of Magnetic Structures Print science brief icon Scientists working at ALS Beamline have demonstrated a new x-ray technique for producing short-exposure nanoscale images of the magnetic structure of materials. The new method combines aspects of coherent x-ray diffraction, which can determine 3-D charge distributions, and resonant magnetic scattering, which is sensitive to magnetic structures. Physicists have used coherent x-ray diffraction to measure the electron density of complicated molecules. The formula used to make these calculations contains terms that relate to the electron spin of magnetic atoms, but these terms are traditionally ignored since coherent x-ray diffraction has not been used to retrieve magnetic information. Using the full formula allows for the determination of not only the electron density, but also the magnetic spin distribution and its orientation.


Biological Imaging by Soft X-Ray Diffraction Microscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Print Biological Imaging by Soft X-Ray Diffraction Microscopy Print Electron and x-ray microscopes are a valuable tool for both the life and materials sciences, but they are limited in their ability to image with nanometer-scale resolution in three dimensions nonperiodic objects that are several microns in size. To fill this gap, the technique of coherent x-ray diffraction imaging now under development takes advantage of the penetrating power of x rays while simultaneously removing the limitations imposed by lens-based optical systems. Researchers from Stony Brook University, in collaboration with scientists at the ALS and Cornell University, have taken a large step in this direction by using a lensless x-ray diffraction microscope to image a freeze-dried yeast cell to better than 30-nm resolution. Images were made at several angular orientations of the cell.

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Biological Imaging by Soft X-Ray Diffraction Microscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Print Biological Imaging by Soft X-Ray Diffraction Microscopy Print Electron and x-ray microscopes are a valuable tool for both the life and materials sciences, but they are limited in their ability to image with nanometer-scale resolution in three dimensions nonperiodic objects that are several microns in size. To fill this gap, the technique of coherent x-ray diffraction imaging now under development takes advantage of the penetrating power of x rays while simultaneously removing the limitations imposed by lens-based optical systems. Researchers from Stony Brook University, in collaboration with scientists at the ALS and Cornell University, have taken a large step in this direction by using a lensless x-ray diffraction microscope to image a freeze-dried yeast cell to better than 30-nm resolution. Images were made at several angular orientations of the cell.


Biological Imaging by Soft X-Ray Diffraction Microscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Print Biological Imaging by Soft X-Ray Diffraction Microscopy Print Electron and x-ray microscopes are a valuable tool for both the life and materials sciences, but they are limited in their ability to image with nanometer-scale resolution in three dimensions nonperiodic objects that are several microns in size. To fill this gap, the technique of coherent x-ray diffraction imaging now under development takes advantage of the penetrating power of x rays while simultaneously removing the limitations imposed by lens-based optical systems. Researchers from Stony Brook University, in collaboration with scientists at the ALS and Cornell University, have taken a large step in this direction by using a lensless x-ray diffraction microscope to image a freeze-dried yeast cell to better than 30-nm resolution. Images were made at several angular orientations of the cell.


Biological Imaging by Soft X-Ray Diffraction Microscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Print Biological Imaging by Soft X-Ray Diffraction Microscopy Print Electron and x-ray microscopes are a valuable tool for both the life and materials sciences, but they are limited in their ability to image with nanometer-scale resolution in three dimensions nonperiodic objects that are several microns in size. To fill this gap, the technique of coherent x-ray diffraction imaging now under development takes advantage of the penetrating power of x rays while simultaneously removing the limitations imposed by lens-based optical systems. Researchers from Stony Brook University, in collaboration with scientists at the ALS and Cornell University, have taken a large step in this direction by using a lensless x-ray diffraction microscope to image a freeze-dried yeast cell to better than 30-nm resolution. Images were made at several angular orientations of the cell.


The first X-ray diffraction measurements on Mars  

Science Journals Connector (OSTI)

The X-ray diffraction/X-ray fluorescence instrument CheMin on the Curiosity rover is a shoebox-sized device using transmission geometry and an energy-discriminating CCD detector. The instrument has returned the first X-ray diffraction data for soil and drilled samples from Mars outcrops, revealing a suite of primary basaltic minerals, amorphous components and varied hydrous alteration products including phyllosilicates.

Bish, D.



Beyond hard x-ray photoelectron spectroscopy: Simultaneous combination with x-ray diffraction  

SciTech Connect

Hard x-ray photoelectron spectroscopy (HAXPES) is a powerful and novel emerging technique for the nondestructive determination of electronic properties and chemical composition of bulk, buried interfaces and surfaces. It benefits from the exceptionally large escape depth of high kinetic energy photoelectrons, increasing the information depth up to several tens of nanometers. Complementing HAXPES with an atomic structure sensitive technique (such as x-ray diffraction) opens a new research field with major applications for materials science. At SpLine, the Spanish CRG beamline at the European Synchrotron Radiation Facility, we have developed a novel experimental set-up that combines HAXPES and x-ray diffraction (x-ray reflectivity, surface x-ray diffraction, grazing incidence x-ray diffraction, and reciprocal space maps). Both techniques can be operated simultaneously on the same sample and using the same excitation source. The set-up includes a robust 2S + 3D diffractometer hosting a ultrahigh vacuum chamber equipped with a unique photoelectron spectrometer (few eV < electron kinetic energy < 15 keV), x-ray tube (Mg/Ti), 15 keV electron gun, and auxiliary standard surface facilities (molecular beam epitaxy evaporator, ion gun, low energy electron diffraction, sample heating/cooling system, leak valves, load-lock sample transfer, etc.). This end-station offers the unique possibility of performing simultaneous HAXPES + x-ray diffraction studies. In the present work, we describe the experimental set-up together with two experimental examples that emphasize its outstanding capabilities: (i) nondestructive characterization of the Si/Ge and HfO{sub 2}/SiO{sub 2} interfaces on Ge-based CMOS devices, and (ii) strain study on La{sub 0.7}Ca{sub 0.3}MnO{sub 3} ultrathin films grown on SrTiO{sub 3}(001) substrate.

Rubio-Zuazo, Juan; Castro, German R. [SpLine, Spanish CRG beamline at the European Synchrotron Radiation Facility, B.P. 220, F-38043 Grenoble (France) and ICMM-CSIC Cantoblanco, E-28049 Madrid (Spain)



Combined energy dispersive EXAFS and x?ray diffraction  

Science Journals Connector (OSTI)

An in situ experiment to measure both x?ray absorption spectroscopy and x?ray diffraction of aurichalcite is described. The experiment uses position sensitive detectors to enable both data sets to be collected while the sample is slowly decomposed in air and then reduced in hydrogen. ?

A. J. Dent; M. P. Wells; R. C. Farrow; C. A. Ramsdale; G. E. Derbyshire; G. N. Greaves; J. W. Couves; J. M. Thomas



Definition: Portable X-Ray Diffraction (XRD) | Open Energy Information  

Open Energy Info (EERE)

Definition Definition Edit with form History Facebook icon Twitter icon » Definition: Portable X-Ray Diffraction (XRD) Jump to: navigation, search Dictionary.png Portable X-Ray Diffraction (XRD) Portable X-Ray Diffraction (XRD) is a field-based technique that can be used for identification of crystalline materials and analysis of unit cell dimensions. Portable XRD analysis is similar to X-ray powder diffraction, which has traditionally been used in geology, environmental science, material science, and engineering to rapidly identify unknown crystalline substances. Portable XRD analysis allows for simpler sample preparation, faster analytical times than traditional methods (less than 2 minutes), and can be performed at the sampling site in the field. A pure, finely ground


X-Ray Diffraction Studies of Copper Nanopowder  

E-Print Network (OSTI)

Copper nanopowder preparation and its X-Ray diffraction studies are reported in this paper. Electrolytic cathode deposition method is simple and cheapest process for its preparation. Copper nanopowder has been prepared from aqueous copper sulphate solution. Wide range of experimental conditions has been adopted in this process and its X-Ray diffraction characterizations have been studied. The results confirming copper nanopowder with size below 30 nm. Uniformed size Copper nanopowder preparation, in normal room temperature is importance of this study.

T. Theivasanthi; M. Alagar



Biological Imaging by Soft X-Ray Diffraction Microscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Biological Imaging by Soft X-Ray Biological Imaging by Soft X-Ray Diffraction Microscopy Biological Imaging by Soft X-Ray Diffraction Microscopy Print Wednesday, 30 November 2005 00:00 Electron and x-ray microscopes are a valuable tool for both the life and materials sciences, but they are limited in their ability to image with nanometer-scale resolution in three dimensions nonperiodic objects that are several microns in size. To fill this gap, the technique of coherent x-ray diffraction imaging now under development takes advantage of the penetrating power of x rays while simultaneously removing the limitations imposed by lens-based optical systems. Researchers from Stony Brook University, in collaboration with scientists at the ALS and Cornell University, have taken a large step in this direction by using a lensless x-ray diffraction microscope to image a freeze-dried yeast cell to better than 30-nm resolution. Images were made at several angular orientations of the cell.


Spectroscopic imaging, diffraction, and holography with x-ray photoemission  

SciTech Connect

X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimental fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons.

Not Available



Cryogenic X-Ray Diffraction Microscopy for Biological Samples  

Science Journals Connector (OSTI)

X-ray diffraction microscopy (XDM) is well suited for nondestructive, high-resolution biological imaging, especially for thick samples, with the high penetration power of x rays and without limitations imposed by a lens. We developed nonvacuum, cryogenic (cryo-) XDM with hard x rays at 8 keV and report the first frozen-hydrated imaging by XDM. By preserving samples in amorphous ice, the risk of artifacts associated with dehydration or chemical fixation is avoided, ensuring the imaging condition closest to their natural state. The reconstruction shows internal structures of intact D. radiodurans bacteria in their natural contrast.

Enju Lima; Lutz Wiegart; Petra Pernot; Malcolm Howells; Joanna Timmins; Federico Zontone; Anders Madsen



Cryogenic X-ray Diffraction Microscopy for Biological Samples  

SciTech Connect

X-ray diffraction microscopy (XDM) is well suited for nondestructive, high-resolution biological imaging, especially for thick samples, with the high penetration power of x rays and without limitations imposed by a lens. We developed nonvacuum, cryogenic (cryo-) XDM with hard x rays at 8 keV and report the first frozen-hydrated imaging by XDM. By preserving samples in amorphous ice, the risk of artifacts associated with dehydration or chemical fixation is avoided, ensuring the imaging condition closest to their natural state. The reconstruction shows internal structures of intact D. radiodurans bacteria in their natural contrast.

E Lima; L Wiegart; P Pernot; M Howells; J Timmins; F Zontone; A Madsen



X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network (OSTI)

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPUSERFD form that can be accessed by the X-ray diffraction webpage. RESPONSIBILITY: The X-ray Diffraction and suggestions in a timely manner. MATERIALS: · Computer Database · Web interface #12;X-ray Diffraction

Meagher, Mary


Photon Sciences | Beamlines | XPD: X-ray Powder Diffraction  

NLE Websites -- All DOE Office Websites (Extended Search)

XPD: X-ray Powder Diffraction XPD: X-ray Powder Diffraction Poster | Fact Sheet | Preliminary Design Report Scientific Scope XPD is a tunable facility with the ability to collect diffraction data at high x-ray energies (40keV-80keV), offering rapid acquisition (millisecond) and high angular resolution capabilities on the same instrument. XPD addresses future scientific challenges in, for example, hydrogen storage, CO2 sequestration, advanced structural ceramics, catalysis, and materials processing. Such materials of high technological value often are complex, nanostructured and heterogeneous. The scientific grand challenge is to obtain robust and quantitative (micro)structural information, not only in the ground state at ambient conditions, but also in situ or in operando with varying temperature, pressure, magnetic/electric/stress


Ultrafast x-ray diffraction of laser-irradiated crystals  

SciTech Connect

An apparatus has been developed for measuring time-dependent x-ray diffraction. X-ray pulses from an Advanced Light Source bend magnet are diffracted by a sagittally-focusing Si(111) crystal and then by a sample crystal, presently InSb(111). Laser pulses with 100 fs duration and a repetition rate of 1 KHz irradiate the sample inducing a phase transition. Two types of detectors are being employed: an x-ray streak camera and an avalanche photodiode. The streak camera is driven by a photoconductive switch and has a 2 ps temporal resolution determined by trigger jitter. The avalanche photodiode has high quantum efficiency and sufficient time resolution to detect single x-ray pulses in ALS two bunch or camshaft operation. A beamline is under construction dedicated for time resolved and micro-diffraction experiments. In the new beamline a toroidal mirror collects 3 mrad horizontally and makes a 1:1 image of the bend magnet source in the x-ray hutch. A laser induced phase transition has been observed in InSb occurring within 70 ps.

Heimann, P.A. [Lawrence Berkeley National Lab., CA (US). Advanced Light Source; Larsson, J. [Univ. of California, Berkeley, CA (US). Physics Dept.; Chang, Z. [Univ. of Michigan, Ann Arbor, MI (US). Center for Ultrafast Optical Science



High-Energy Diffraction-Enhanced X-ray Imaging  

SciTech Connect

In order to apply the diffraction-enhanced X-ray imaging (DEI) method for much wider variety of samples, we have developed the high-energy DEI system. The energy of X-ray was increased up to 70 keV to achieve high permeability for heavy elements. The diffraction of Si(440) was used to keep large field of view. Demonstrative observation of an electrical cable was performed using the X-ray emitted from the vertical wiggler. The obtained images visualized not only the core and ground wire made of copper but also the isolator and outer jacket made of polymer clearly. The comparison of images obtained by the DEI and the absorption-contrast imaging showed that the sensitivity of DEI is about 10 times higher than that of the absorption method for light elements, and 3 times for heavy elements.

Yoneyama, Akio; Ueda, Kazuhiro [Advanced Research Laboratory, Hitachi Ltd., 2520, Akanuma, Hatoyama, Saitama, 350-0395 (Japan); Takeda, Tohoru [Allied Health Sciences, Kitasato University, Sagamihara, Kanagawa 228-8555 (Japan); Yamazaki, Takanori [Research and Development Laboratory, Hitachi Cable, Ltd., 5-1-1, Hidakacho, Hitachi, Ibaraki, 319-1414 (Japan); Hyodo, Kazuyuki [Institute of Materials Science, High Energy Accelerator Research Organization, 1-1 Oho, Tsukuba, Ibaraki, 305-0801 (Japan)



Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell Xiaojing Huang,1  

E-Print Network (OSTI)

Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell Xiaojing Huang,1 Johanna Nelson,1 eukaryotic cell using x-ray diffraction microscopy, or coherent x-ray diffraction imaging. By plunge freezingV x rays were recorded and reconstructed to reveal a budding yeast cell at a resolution better than 25

Mohseni, Hooman


X-ray diffraction data for graphite to 20 GPa  

Science Journals Connector (OSTI)

X-ray diffraction data have been obtained on polycrystalline graphite at pressures up to 20 GPa. A phase transition is observed at ?11 GPa, as evidenced by softening in the interlayer spacing and the observation of new diffraction lines. Below this pressure the variation of the lattice parameters a and c are compared with elastic stiffnesses obtained from ultrasonic measurements. A new value for C13 is proposed. The variation c(P) is compared to the recently proposed universal isotherm equation.

You Xiang Zhao and Ian L. Spain



X-ray Diffraction / MSE 603 Spring 2002 Qun Shen / CHESS qs11@cornell.edu  

E-Print Network (OSTI)

X-ray Diffraction / MSE 603 Spring 2002 Qun Shen / CHESS qs11@cornell.edu 1. X-ray production & basic properties ­ common sources for diffraction experiments ­ synchrotron radiation ­ response to x-rays by an electron ­ refraction index ­ total external reflection & evanescent wave, TXRF 2. X-ray scattering basics

Shen, Qun


Borman effect in resonant diffraction of X-rays  

SciTech Connect

A dynamic theory of resonant diffraction (occurring when the energy of incident radiation is close to the energy of the absorption edge of an element in the composition of a given substance) of synchronous X-rays is developed in the two-wave approximation in the coplanar Laue geometry for large grazing angles in perfect crystals. A sharp decrease in the absorption coefficient in the substance with simultaneously satisfied diffraction conditions (Borman effect) is demonstrated, and the theoretical and first experimental results are compared. The calculations reveal the possibility of applying this approach in analyzing the quadrupole-quadrupole contribution to the absorption coefficient.

Oreshko, A. P., E-mail: ap.oreshko@physics.msu.ru [Moscow State University (Russian Federation)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Femtosecond X-ray diffraction from two-dimensional protein crystals  

Science Journals Connector (OSTI)

Bragg diffraction achieved from two-dimensional protein crystals using femtosecond X-ray laser snapshots is presented.

Frank, M.



Cryogenic x-ray diffraction microscopy utilizing high-pressure cryopreservation  

Science Journals Connector (OSTI)

We present cryo x-ray diffraction microscopy of high-pressure-cryofixed bacteria and report high-convergence imaging with multiple image reconstructions. Hydrated D. radiodurans cells were cryofixed at 200 MPa pressure into ?10??m-thick water layers and their unstained, hydrated cellular environments were imaged by phasing diffraction patterns, reaching sub-30-nm resolutions with hard x-rays. Comparisons were made with conventional ambient-pressure-cryofixed samples, with respect to both coherent small-angle x-ray scattering and the image reconstruction. The results show a correlation between the level of background ice signal and phasing convergence, suggesting that phasing difficulties with frozen-hydrated specimens may be caused by high-background ice scattering.

Enju Lima; Yuriy Chushkin; Peter van der Linden; Chae Un Kim; Federico Zontone; Philippe Carpentier; Sol M. Gruner; Petra Pernot



Geometry and X-ray diffraction characteristics of carbon nanotubes  

SciTech Connect

Algorithms for generating atomic coordinates in nanotubes with an arbitrary cell in the layer plane have been developed. The conditions for the seamless matching of a flat layer rolled up in any direction are formulated for cylindrical, conical, and faceted tubes. A method has been developed for generating different types of faceted nanotubes using a group transformation (obtained in this study) that leaves invariant an arbitrary polygon in the nanotube cross section. Equations are proposed for deriving the diameter and chirality of single-wall carbon cylindrical nanotubes from X-ray diffraction spectra.

Pleshakov, V. F., E-mail: victorpleshakov@list.ru [FGUP Scientific Research Institute of Electrical Carbon Products (Russian Federation)



High Pressure X-ray Diffraction Study of Potassium Azide  

SciTech Connect

Crystal structure and compressibility of potassium azide was investigated by in-situ synchrotron powder X-ray diffraction in a diamond anvil cell at room temperature up to 37.7 GPa. In the body-centered tetragonal (bct) phase, an anisotropic compressibility was observed with greater compressibility in the direction perpendicular to the plane containing N{sub 3}{sup -} ions than directions within that plane. The bulk modulus of the bct phase was determined to be 18.6(7) GPa. A pressure-induced phase transition may occur at 15.5 GPa.

C Ji; F Zhang; D Hong; H Zhu; J Wu; M Chyu; V Levitas; Y Ma



Femtosecond diffractive imaging with a soft-X-ray free-electron laser  

E-Print Network (OSTI)

LETTERS Femtosecond diffractive imaging with a soft-X-ray free-electron laser HENRY N. CHAPMAN1 of this principle using the FLASH soft-X-ray free-electron laser. An intense 25 fs, 4 Ã? 1013 W cm-2 pulse by one10 . X-ray free-electron lasers (FELs) are expected to permit diffractive imaging at high

Loss, Daniel


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network (OSTI)

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPPOWGAD data collection on the Bruker GADDS Powder X-ray Diffractometer. POLICY: Data must be collected AND PRECAUTIONS 1. Powder X-ray diffraction is a method by which investigators can identify the materials

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network (OSTI)

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPDATGAD to facilitate data collection on the Bruker GADDS Single-crystal X-ray Diffractometer. POLICY: Data must. BACKGROUND AND PRECAUTIONS 1. Single-Crystal X-ray diffraction is a method by which investigators can

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network (OSTI)

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPPOWD8 Standard Operating Procedure Title: X-ray Powder Diffraction: D8 Advanced Rev No: Issue date: 1.001 12/29/2008 Page: 1 of 3 SOP: SOPPOWD8 Last date revised: December 23 2009 Date approved: December 29 2009 X-ray

Meagher, Mary


High-Frequency X-ray Beam Chopper Based on Diffraction by Surface Acoustic Waves  

Science Journals Connector (OSTI)

The main characteristics of a new type of X-ray beam are presented. Diffraction of X-rays by a pulsed surface acoustic wave is used to perform a flexible high-frequency selection of synchrotron radiation pulses.

Tucoulou, R.



Bruker Workshop on Single Crystal X-Ray Diffraction  

NLE Websites -- All DOE Office Websites (Extended Search)

Diagnosis and Treatment of Problem Structures: Diagnosis and Treatment of Problem Structures: A Bruker Workshop on Single Crystal X-Ray Diffraction May 30, 2008 Chemistry Department University of Tennessee Knoxville, TN This meeting focuses on the scientific resources of four ORNL user facilities funded by the DOE Office of Basic Energy Sciences. Who Should Attend Synopsis Goals Scheduled Agenda Workshop Materials Confirmed Speakers Important Dates Registration - now open Location - Directions and Map Sponsors Organizing and Local Committee Contacts Relevant Literature, References, Websites Local Information Bruker - UT Workshop Who Should Attend? The Workshop is directed to the newcomer as well as the experienced user of a Bruker Apex / Apex-II system and SHELX software. It will concentrate on hard to solve and/or refine problem structures. We envision it to be


Preparation and X-Ray diffraction studies of curium hydrides  

SciTech Connect

Curium hydrides were prepared by reaction of curium-248 metal with hydrogen and characterized by X-ray powder diffraction. Several of the syntheses resulted in a hexagonal compound with average lattice parameters of a/sub 0/ = 0.3769(8) nm and c/sub 0/ = 0.6732(12) nm. These products are considere to be CmH/sub 3//sup -//sub 8/ by analogy with the behavior of lanthanide-hydrogen and lighter actinide-hydrogen systems. Face-centered cubic products with an average lattice parameter of a/sub 0/ = 0.5322(4) nm were obtained from other curium hydride preparations. This parameter is slightly smaller than that reported previously for cubic curium dihydride, CmH /SUB 2-x/ (B.M. Bansal and D. Damien. Inorg. Nucl. Chem. Lett. 6 603, 1970). The present results established a continuation of typical heavy trivalent lanthanidelike behavior of the transuranium actinide-hydrogen systems through curium.

Gibson, J.K.; Maire, R.G.



Diffracted X-ray tracking for monitoring intramolecular motion in individual protein molecules using broad band X-ray  

SciTech Connect

Diffracted X-ray tracking (DXT) enables the tilting and twisting motions of single protein molecules to be monitored with micro- to milliradian resolution using a highly brilliant X-ray source with a wide energy bandwidth. We have developed a technique to monitor single molecules using gold nanocrystals attached to individual protein molecules using the BL28B2 beamline at SPring-8. In this paper we present the installation of a single toroidal X-ray mirror at BL28B2 to focus X-rays in an energy range of 10–20 keV (?E/E = 82% for an X-ray with a wide energy bandwidth). With this beamline we tracked diffraction spots from gold nanocrystals over a wide angle range than that using quasi-monochromatic X-rays. Application of the wide angle DXT technique to biological systems enabled us to observe the on-site motions of single protein molecules that have been functionalized in vivo. We further extend the capability of DXT by observing the fractional tilting and twisting motions of inner proteins under various conditions. As a proof of this methodology and to determine instrumental performance the intramolecular motions of a human serum albumin complex with 2-anthracenecarboxylic acid was investigated using the BL28B2 beamline. The random tilting and twisting intramolecular motions are shown to be directly linked to the movement of individual protein molecules in the buffer solution.

Ichiyanagi, Kouhei; Sasaki, Yuji C. [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan) [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan); Japan Science and Technology Agency, CREST, CREST, Sasaki-Team, 609 Kiban Building, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Sekiguchi, Hiroshi; Hoshino, Masato; Kajiwara, Kentaro; Senba, Yasunori; Ohashi, Haruhiko; Ohta, Noboru [Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan)] [Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan); Hoshisashi, Kentaro; Jae-won, Chang; Tokue, Maki; Matsushita, Yufuku [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan)] [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan); Nishijima, Masaki; Inoue, Yoshihisa [Department of Applied Chemistry and Office for University-Industry Collaboration, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan)] [Department of Applied Chemistry and Office for University-Industry Collaboration, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yagi, Naoto [Japan Science and Technology Agency, CREST, CREST, Sasaki-Team, 609 Kiban Building, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan) [Japan Science and Technology Agency, CREST, CREST, Sasaki-Team, 609 Kiban Building, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan)



A Curved Image-Plate Detector System for High-Resolution Synchrotron X-ray Diffraction  

SciTech Connect

The developed curved image plate (CIP) is a one-dimensional detector which simultaneously records high-resolution X-ray diffraction (XRD) patterns over a 38.7 2{theta} range. In addition, an on-site reader enables rapid extraction, transfer and storage of X-ray intensity information in {le}30 s, and further qualifies this detector to study kinetic processes in materials science. The CIP detector can detect and store X-ray intensity information linearly proportional to the incident photon flux over a dynamical range of about five orders of magnitude. The linearity and uniformity of the CIP detector response is not compromised in the unsaturated regions of the image plate, regardless of saturation in another region. The speed of XRD data acquisition together with excellent resolution afforded by the CIP detector is unique and opens up wide possibilities in materials research accessible through X-ray diffraction. This article presents details of the basic features, operation and performance of the CIP detector along with some examples of applications, including high-temperature XRD.

Sarin, P.; Haggerty, R; Yoon, W; Knapp, M; Berghaeuser, A; Zschack, P; Karapetrova, E; Yang, N; Kriven, W



X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network (OSTI)

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPALIGNA Standard Operating Procedure Title: X-ray Instrument Alignment ­ APEXII Rev No: Issue date: 1.001 6 the alignment of the APEXII single crystal X-ray diffractometer. POLICY: The instrument must be aligned

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network (OSTI)

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPALIGNS Standard Operating Procedure Title: X-ray Instrument Alignment ­ SMART1000 Rev No: Issue date: 1.001 6 the alignment of the SMART1000 single crystal X-ray diffractometer. POLICY: The instrument must be aligned

Meagher, Mary


Cyclic olefin homopolymer-based microfluidics for protein crystallization and in situ X-ray diffraction  

Science Journals Connector (OSTI)

A cyclic olefin homopolymer-based microfluidics system has been established for protein crystallization and in situ X-ray diffraction.

Emamzadah, S.



Attenuation corrections for X-ray and neutron fibre diffraction studies  

Science Journals Connector (OSTI)

The form of the transmission factor for sample geometries encountered in X-ray and neutron fibre diffraction studies is considered.

Langan, P.



Thermal expansion of manganese dioxide using high-temperature in situ X-ray diffraction  

Science Journals Connector (OSTI)

The thermal expansion behaviour of manganese dioxide, an important battery material, is reported using high-temperature in situ X-ray diffraction between 298 and 673 K.

Dose, W.M.



Smoothing of low-intensity noisy X-ray diffraction data by Fourier filtering: application to supported metal catalyst studies  

Science Journals Connector (OSTI)

A Wiener filtering algorithm was used to smooth broad and noisy X-ray diffraction (XRD) patterns from highly dispersed catalysts with low metal loading. It enabled extraction of XRD patterns from the active phases of the catalysts interpretable in terms of phase composition.

Mierzwa, B.



Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell  

SciTech Connect

We report the first image of an intact, frozen hydrated eukaryotic cell using x-ray diffraction microscopy, or coherent x-ray diffraction imaging. By plunge freezing the specimen in liquid ethane and maintaining it below -170 deg. C, artifacts due to dehydration, ice crystallization, and radiation damage are greatly reduced. In this example, coherent diffraction data using 520 eV x rays were recorded and reconstructed to reveal a budding yeast cell at a resolution better than 25 nm. This demonstration represents an important step towards high resolution imaging of cells in their natural, hydrated state, without limitations imposed by x-ray optics.

Huang Xiaojing; Nelson, Johanna; Lima, Enju; Miao, Huijie; Steinbrener, Jan; Stewart, Andrew; Turner, Joshua J.; Jacobsen, Chris [Department of Physics and Astronomy, Stony Brook University, Stony Brook, New York 11794-3800 (United States); Kirz, Janos [Department of Physics and Astronomy, Stony Brook University, Stony Brook, New York 11794-3800 (United States); Advanced Light Source, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Marchesini, Stefano; Shapiro, David [Advanced Light Source, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Neiman, Aaron M. [Department of Biochemistry and Cell Biology, Stony Brook University, Stony Brook, New York 11794-5215 (United States)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The suppression of fluorescence peaks in energy-dispersive X-ray diffraction  

Science Journals Connector (OSTI)

It is shown experimentally that diffraction peaks which are normally obscured by fluorescence peaks in energy-dispersive X-ray diffraction can be revealed by tuning of the X-ray tube excitation voltage in order to suppress the fluorescence peaks.

Hansford, G.M.



Oxides: neutron and synchrotron X-ray diffraction studies  

Science Journals Connector (OSTI)

......cells. Their thermal stability and high proton conductivity are particu- 15000 15500 16000 16500 17000 Time-of-flight, usec Fig. 6 Neutron diffraction pattern of the high temperature protonic conductor Ba3Ca! uNb].82O9-5 with and without D2O......

Izabela M. Sosnowska; Makoto Shiojiri



Radiation-induced melting in coherent X-ray diffractive imaging at the nanoscale  

Science Journals Connector (OSTI)

Coherent X-ray diffraction techniques play an increasingly significant role in imaging nanoscale structures which range from metallic and semiconductor samples to biological objects. The conventional knowledge about radiation damage effects caused by ever higher brilliance X-ray sources has to be critically revised while studying nanostructured materials.

Ponomarenko, O.



Tracking the catalyzed growth process of nanowires by in situ x-ray diffraction  

E-Print Network (OSTI)

capacity.4­7 Silicon nanowires have also found application in solar cells, both as ab- sorber OF NANOSTRUCTURES Gold-catalyzed silicon nanowires were grown in an x-ray furnace so that in situ x-ray diffraction-type furnace attached to a Pana- lytical X'Pert PRO diffractometer. The temperature of the furnace

Wang, Zhong L.


E-Print Network 3.0 - angle x-ray diffraction Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

; Materials Science 60 Page 12 CHESS News Magazine 2005 FacilityHighlight Impact of a Future Energy Recovery Linac Summary: -rolled Aluminum SR X-ray diffraction. Map grain...


Nano structure of low crystallinity carbon materials analyzed by using high energy X-ray diffraction  

Science Journals Connector (OSTI)

In this study, we tried to characterize a kind of low crystallinity carbon materials. The structure of polyparaphenylene(PPP)-based carbon was analyzed by means of high energy X-ray diffraction using the apparatu...

Kyoichi Oshida; Tatsuo Nakazawa; Kozo Osawa…



Method for improving x-ray diffraction determinations of residual stress in nickel-base alloys  

DOE Patents (OSTI)

A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys is discussed. Part of a predetermined area of the surface of a nickel-base alloy is covered with a dispersion. This exposes the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose, since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample. 2 figs.

Berman, R.M.; Cohen, I.



Stratigraphic correlation with X-ray powder patterns  

E-Print Network (OSTI)

of certain metallic trace elements, notably magnesium, iron, aluminum, and strontium, and on this basis were able to pick out sones within a thick limestone section which could not be difi'erentiated by ord1nary methods. As an alternative or ad...STRATIGRAPHIC CORRELATION MITH X-RAY PONDER PATTERNS John B. Singletary A Thesis Submitted to the Graduate School Agricultural and Mechanical College of Texas in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE MA...

Singletary, John B



Quantitative determination of mineral composition by powder x-ray diffraction  

DOE Patents (OSTI)

An external standard intensity ratio method is used for quantitatively determining mineralogic compositions of samples by x-ray diffraction. The method uses ratios of x-ray intensity peaks from a single run. Constants are previously determined for each mineral which is to be quantitatively measured. Ratios of the highest intensity peak of each mineral to be quantified in the sample and the highest intensity peak of a reference mineral contained in the sample are used to calculate sample composition.

Pawloski, G.A.



Combined X-ray and neutron fibre diffraction studies of biological and synthetic polymers.  

SciTech Connect

The fibrous state is a natural one for polymer molecules which tend to assume regular helical conformations rather than the globular structures characteristic of many proteins. Fibre diffraction therefore has broad application to the study of a wide range of biological and synthetic polymers. The purpose of this paper is to illustrate the general scope of the method and in particular to demonstrate the impact of a combined approach involving both X-ray and neutron diffraction methods. While the flux of modern X-ray synchrotron radiation sources allows high quality datasets to be recorded with good resolution within a very short space of time, neutron studies can provide unique information through the ability to locate hydrogen or deuterium atoms that are often difficult or impossible to locate using X-ray methods. Furthermore, neutron fibre diffraction methods can, through the ability to selectively label specific parts of a structure, be used to highlight novel aspects of polymer structure that can not be studied using X-rays. Two examples are given. The first describes X-ray and neutron diffraction studies of conformational transitions in DNA. The second describes structural studies of the synthetic high-performance polymer poly(p-phenylene terephthalamide) (PPTA), known commercially as Kevlar{reg_sign} or Twaron{reg_sign}.

Parrot, I. M. [Institut Laue-Langevin (ILL); Urban, Volker S [ORNL; Gardner, K. H. [DuPont Experimental Station; Forsyth, V. T. [Institut Laue Langevin and Keele University



Note: Application of a pixel-array area detector to simultaneous single crystal x-ray diffraction and x-ray absorption spectroscopy measurements  

SciTech Connect

X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorption near edge structure for Pr{sub 0.67}Sr{sub 0.33}MnO{sub 3} film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam.

Sun, Cheng-Jun, E-mail: cjsun@aps.anl.gov; Brewe, Dale L.; Heald, Steve M. [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States)] [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Zhang, Bangmin [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States) [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Department of Materials Science and Engineering, National University of Singapore, 117575 Singapore (Singapore); NUSNNI-Nanocore, National University of Singapore, 117411 Singapore (Singapore); Chen, Jing-Sheng; Chow, G. M. [Department of Materials Science and Engineering, National University of Singapore, 117575 Singapore (Singapore)] [Department of Materials Science and Engineering, National University of Singapore, 117575 Singapore (Singapore); Venkatesan, T. [NUSNNI-Nanocore, National University of Singapore, 117411 Singapore (Singapore) [NUSNNI-Nanocore, National University of Singapore, 117411 Singapore (Singapore); Department of Physics, National University of Singapore, 117542 Singapore (Singapore); Department of Electrical and Computer Engineering, National University of Singapore, 117575 Singapore (Singapore)



Toward atomic resolution diffractive imaging of isolated molecules with x-ray free-electron lasers  

E-Print Network (OSTI)

We give a detailed account of the theoretical analysis and the experimental results of an x-ray-diffraction experiment on quantum-state selected and strongly laser-aligned gas-phase ensembles of the prototypical large asymmetric rotor molecule 2,5-diiodobenzonitrile, performed at the Linac Coherent Light Source [Phys. Rev. Lett. 112, 083002 (2014)]. This experiment is the first step toward coherent diffractive imaging of structures and structural dynamics of isolated molecules at atomic resolution, i. e., picometers and femtoseconds, using x-ray free-electron lasers.

Stern, Stephan; Filsinger, Frank; Rouzée, Arnaud; Rudenko, Artem; Johnsson, Per; Martin, Andrew V; Barty, Anton; Bostedt, Christoph; Bozek, John D; Coffee, Ryan N; Epp, Sascha; Erk, Benjamin; Foucar, Lutz; Hartmann, Robert; Kimmel, Nils; Kühnel, Kai-Uwe; Maurer, Jochen; Messerschmidt, Marc; Rudek, Benedikt; Starodub, Dmitri G; Thøgersen, Jan; Weidenspointner, Georg; White, Thomas A; Stapelfeldt, Henrik; Rolles, Daniel; Chapman, Henry N; Küpper, Jochen



Neutron and X-ray diffraction and empirical potential structure refinement modelling of magnesium stabilised amorphous calcium  

E-Print Network (OSTI)

Neutron and X-ray diffraction and empirical potential structure refinement modelling of magnesium online xxxx Keywords: Amorphous calcium carbonate; EPSR modelling; Neutron diffraction; X-ray diffraction Amorphous calcium carbonate (ACC) plays a key role in biomineralisation processes in sea organisms. Neutron

Benning, Liane G.


X-ray diffraction experiments with femtosecond time D. VON DER LINDE and K. SOKOLOWSKI-TINTEN  

E-Print Network (OSTI)

X-ray diffraction experiments with femtosecond time resolution D. VON DER LINDE and K. SOKOLOWSKI-essen.de (Received 4 March 2002) Abstract. Intense ultrashort laser pulses enable the generation of subpico- second X-ray pulses in the multi-kilovolt range of photon energies. These X- ray pulses have opened the door

von der Linde, D.


Purification, crystallization and preliminary X-ray diffraction analysis of pyridoxal kinase from Plasmodium falciparum (PfPdxK)  

Science Journals Connector (OSTI)

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of PdxK from P. falciparum are described.

Kronenberger, T.



Observation and simulation of hard x ray photoelectron diffraction to determine polarity of polycrystalline zinc oxide films with rotation domains  

SciTech Connect

X ray photoelectron diffraction (XPD) patterns of polar zinc oxide (ZnO) surfaces were investigated experimentally using hard x rays and monochromatized Cr K{alpha} radiation and theoretically using a cluster model approach and a dynamical Bloch wave approach. We focused on photoelectrons emitted from the Zn 2p{sub 3/2} and O 1s orbitals in the analysis. The obtained XPD patterns for the (0001) and (0001) surfaces of a ZnO single crystal were distinct for a given emitter and polarity. Polarity determination of c-axis-textured polycrystalline ZnO thin films was also achieved with the concept of XPD, even though the in-plane orientation of the columnar ZnO grains was random.

Williams, Jesse R.; Adachi, Yutaka; Ohashi, Naoki [International Center for Materials Nanoarchitectonics (MANA), National Institute for Materials Science (NIMS), 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); NIMS Saint-Gobain Research Center of Excellence for Advanced Materials, NIMS, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Pis, Igor [Synchrotron X-ray Station at SPring-8, NIMS, SPring-8, 1-1-1 Kouto, Sayo-cho, Sayo-gun, Hyogo 679-5198 (Japan); Department of Surface and Plasma Science, Faculty of Mathematics and Physics, Charles University, V Holesovickach 2, Prague 8 18000 (Czech Republic); Kobata, Masaaki [Synchrotron X-ray Station at SPring-8, NIMS, SPring-8, 1-1-1 Kouto, Sayo-cho, Sayo-gun, Hyogo 679-5198 (Japan); Winkelmann, Aimo [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Matsushita, Tomohiro [Japan Synchrotron Radiation Research Institute (JASRI), SPring-8, 1-1-1 Kouto, Sayo-cho, Sayo-gun, Hyogo 679-5148 (Japan); Kobayashi, Keisuke [Synchrotron X-ray Station at SPring-8, NIMS, SPring-8, 1-1-1 Kouto, Sayo-cho, Sayo-gun, Hyogo 679-5198 (Japan); Hiroshima Synchrotron Radiation Center, Hiroshima University, 2-313 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-0046 (Japan)



High spatial resolution X-ray and gamma ray imaging system using diffraction crystals  

DOE Patents (OSTI)

A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

Smither, Robert K. (Hinsdale, IL)



Equation of state of adamite up to 11 GPa: a synchrotron X-ray diffraction study  

Science Journals Connector (OSTI)

The compression behavior of natural adamite [Zn2AsO4OH] has been investigated up to 11.07 GPa at room temperature utilizing in situ angle-dispersive X-ray diffraction and a diamond anvil cell. No phase transitio...

Jingui Xu; Maining Ma; Shuyi Wei; Xianxu Hu…



Capability of X-ray diffraction for the study of microstructure of metastable thin films  

Science Journals Connector (OSTI)

The capability of X-ray diffraction for the microstructure investigations of metastable systems is illustrated on supersaturated and partially decomposed thin films of titanium aluminium nitrides with high aluminium content. The anisotropy of the elastic constants and their role in these investigations is discussed.

Rafaja, D.



Single-crystal x-ray diffraction of brucite to 14 GPa  

Science Journals Connector (OSTI)

Single-crystal brucite, Mg(OH)2, was studied to 14 GPa in a quasi-hydrostatic pressure medium using a diamond anvil cell and energy-dispersive synchrotron x-ray diffraction. The parameters of a third-order Birch-...

Thomas S. Duffy; Jinfu Shu; Ho-kwang Mao…


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Stereochemistry Determination by Powder X-ray Diffraction Analysis and NMR Spectroscopy Residual Dipolar Couplings  

SciTech Connect

A matter of technique: For a new steroidal lactol, jaborosalactol 24 (1), isolated from Jaborosa parviflora, NMR spectroscopy residual dipolar couplings and powder X-ray diffraction analysis independently gave the same stereochemistry at C23-C26. Conventional NMR spectroscopic techniques, such as NOE and {sup 3}J coupling-constant analysis failed to unambiguously determine this stereochemistry.

Garcia, M.; Pagola, S; Navarro-Vasquez, A; Phillips, D; Gayathri, C; Krakauer, H; Stephens, P; Nicotra, V; Gil, R



Online in situ x-ray diffraction setup for structural modification studies during swift heavy ion irradiation  

SciTech Connect

The high energy density of electronic excitations due to the impact of swift heavy ions can induce structural modifications in materials. We present an x-ray diffractometer called ALIX (''Analyse en Ligne sur IRRSUD par diffraction de rayons X''), which has been set up at the low-energy beamline (IRRadiation SUD - IRRSUD) of the Grand Accelerateur National d'Ions Lourds facility, to allow the study of structural modification kinetics as a function of the ion fluence. The x-ray setup has been modified and optimized to enable irradiation by swift heavy ions simultaneously to x-ray pattern recording. We present the capability of ALIX to perform simultaneous irradiation-diffraction by using energy discrimination between x-rays from diffraction and from ion-target interaction. To illustrate its potential, results of sequential or simultaneous irradiation-diffraction are presented in this article to show radiation effects on the structural properties of ceramics. Phase transition kinetics have been studied during xenon ion irradiation of polycrystalline MgO and SrTiO{sub 3}. We have observed that MgO oxide is radiation-resistant to high electronic excitations, contrary to the high sensitivity of SrTiO{sub 3}, which exhibits transition from the crystalline to the amorphous state during irradiation. By interpreting the amorphization kinetics of SrTiO{sub 3}, defect overlapping models are discussed as well as latent track characteristics. Together with a transmission electron microscopy study, we conclude that a single impact model describes the phase transition mechanism.

Grygiel, C.; Lebius, H.; Bouffard, S.; Quentin, A.; Ramillon, J. M.; Madi, T.; Guillous, S.; Been, T.; Guinement, P.; Lelievre, D.; Monnet, I. [CIMAP, CEA-CNRS-ENSICAEN-UCBN, BP 5133, 14070 Caen Cedex 5 (France)



High-pressure structural studies of dysprosium using angle-dispersive x-ray diffraction  

SciTech Connect

We present structural results under pressure for elemental dysprosium (Dy) up to 87 GPa using in situ angle-dispersive x-ray diffraction measurements with synchrotron x rays and a diamond-anvil cell. Dy exhibits the structural transition sequence, hP2{yields}hR9{yields}hP4{yields}distorted cF4, from Rietveld full-profile refinements. Clear evidence is documented for the high-pressure distorted cF4 phase observed above 45 GPa to be an orthorhombic oS8 (Cmmm) structure for Dy in the lanthanide phase diagram.

Shen Yongrong; Kumar, Ravhi S.; Cornelius, Andrew L.; Nicol, Malcolm F. [Department of Physics and High Pressure Science and Engineering Center, University of Nevada Las Vegas, Las Vegas, Nevada 89154-4002 (United States)



Investigation of white etching layers on rails by optical microscopy, electron microscopy, X-ray and synchrotron X-ray diffraction  

Science Journals Connector (OSTI)

Patches of white etching layers on rail surfaces were investigated using sophisticated techniques like cross-sectional transmission electron microscopy (XTEM) and synchroton X-ray diffraction. Optical microscopy failed to resolve the microstructure, but in the TEM submicron grains with high dislocation densities and occasional twins, which are characteristic features of high carbon martensite, were observed. The martensitic structure was confirmed by evaluation of synchroton X-ray diffraction line profiles. The latter technique also allowed to determine dislocation densities of the order of 1012 cm?2 and residual compressive stresses of about 200 MPa.

W. Österle; H. Rooch; A. Pyzalla; L. Wang



X-ray Imaging Shows Feather Patterns of First Birds | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

X-ray Imaging Shows Feather Patterns of First Birds X-ray Imaging Shows Feather Patterns of First Birds X-ray Imaging Shows Feather Patterns of First Birds June 30, 2011 - 2:56pm Addthis A collage of images. Top, optical images of: blue jay feather, squid, and fossil fish with feather. Bottom: x-ray images showing the distribution of copper (red) in the same organisms. | Photo Courtesy of Gregory Stewart, SLAC National Accelerator Laboratory A collage of images. Top, optical images of: blue jay feather, squid, and fossil fish with feather. Bottom: x-ray images showing the distribution of copper (red) in the same organisms. | Photo Courtesy of Gregory Stewart, SLAC National Accelerator Laboratory Niketa Kumar Niketa Kumar Public Affairs Specialist, Office of Public Affairs What are the key facts? Through x-ray fluorescent imaging techniques developed at the


Nanoscale Imaging with Resonant Coherent X Rays: Extension of Multiple-Wavelength Anomalous Diffraction to Nonperiodic Structures  

Science Journals Connector (OSTI)

The methodology of multiple-wavelength anomalous diffraction, widely used for macromolecular structure determination, is extended to the imaging of nonperiodic nanostructures. We demonstrate the solution of the phase problem by a combination of two resonantly recorded coherent scattering patterns at the carbon K edge (285 eV). Our approach merges iterative phase retrieval and x-ray holography approaches, yielding unique and rapid reconstructions. The element, chemical, and magnetic state specificity of our method further renders it widely applicable to a broad range of nanostructures, providing a spatial resolution that is limited, in principle, by wavelength only.

A. Scherz; D. Zhu; R. Rick; W. F. Schlotter; S. Roy; J. Lüning; J. Stöhr



High-Energy X-ray Diffraction Study of Internal Stresses in Metal Matrix  

NLE Websites -- All DOE Office Websites (Extended Search)

High-Energy X-ray Diffraction Study of Internal Stresses in Metal Matrix High-Energy X-ray Diffraction Study of Internal Stresses in Metal Matrix Composites Metal matrix composites (MMCs) comprise an intriguing new class of materials coming to prominence in the aerospace, electronics, and automotive industries. Internal stresses play an important role in the behavior and successful application of MMCs and multi-phase alloys. These stresses form during processing and service due to transformation or thermal expansion mismatch, as well as elastic and plastic mismatch during deformation. In order to develop a deeper understanding of the thermo-mechanical behavior of these materials, it is of key interest to examine the development of mean stresses in the phases of the composite as a function of time upon changes of temperature and/or external load.


X-ray dynamical diffraction from single crystals with arbitrary shape and strain field: A universal approach to modeling  

Science Journals Connector (OSTI)

The effects of dynamical diffraction in single crystals engender many unique diffraction phenomena that cannot be interpreted by the kinematical-diffraction theory, yet knowledge of them is vital to resolving a vast variety of scientific problems ranging from crystal optics to strain measurements in crystalline specimens. Although the fundamental dynamical-diffraction theory was established decades ago, modeling it remains a challenge in a general case wherein the crystal has complex boundaries and mixed diffraction geometries (Bragg or Laue). Here, we propose a universal approach for modeling x-ray dynamical diffraction from a single crystal with arbitrary shape and strain field that is based on the integral representation of the Takagi-Taupin equations. Using it, we can construct the solution iteratively via a converging series, independent of the diffraction geometry. Moreover, the integral equations offer additional insights into the diffraction physics that are not readily apparent in its differential counterparts. To demonstrate this approach, we studied the dynamical diffraction from a slab of single crystal with both Bragg and Laue diffraction excited on the entrance boundaries, a problem that is difficult to model by other methods. We also explored the mirage effect caused by the presence of a linear strain field and compared it to the Eikonal theory. Lastly, we derived a dynamical-diffraction equation correlating the structural properties of a particle to its far-field Bragg-diffraction pattern, shedding light on how dynamical diffraction affects these kinematical-diffraction-based inverse techniques for reconstructing the shape and the strain field.

Hanfei Yan and Li Li



Elimination of higher-order diffraction using zigzag transmission grating in soft x-ray region  

SciTech Connect

We present a realization of the sinusoidal transmission function using a series of zigzag-profiled strips where the transmission takes on the binary values 0 and 1 in a two-dimensional distribution. A zigzag transmission grating of 1000 line/mm has been fabricated and demonstrated on the soft x-ray beam of synchrotron radiation. The axial single-order diffraction indicates that the zigzag transmission grating is adequate for spectroscopic application.

Zang, H. P.; Wang, C. K. [Research Center of Laser Fusion, China Academy of Engineering Physics, Mianyang, Sichuan 621900 (China); Institute of Atomic and Molecular Physics, Sichuan University, Chengdu 610065 (China); Gao, Y. L.; Zhou, W. M.; Kuang, L. Y.; Wei, L.; Fan, W.; Zhang, W. H.; Zhao, Z. Q.; Cao, L. F.; Gu, Y. Q.; Zhang, B. H. [Research Center of Laser Fusion, China Academy of Engineering Physics, Mianyang, Sichuan 621900 (China); Jiang, G. [Institute of Atomic and Molecular Physics, Sichuan University, Chengdu 610065 (China); Zhu, X. L.; Xie, C. Q. [Institute of Microelectronics, Chinese Academy of Sciences, Beijing 100029 (China); Zhao, Y. D.; Cui, M. Q. [Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China)



On the microstructure of nanoporous gold: an x-ray diffraction study  

SciTech Connect

The evolution of the grain structure, internal stresses, and the lattice misorientations of nanoporous gold (npAu) during dealloying of bulk (3D) Ag-Au alloy samples was studied by various in-situ and ex-situ X-ray diffraction techniques including powder and Laue diffraction. The experiments reveal that the dealloying process preserves the original crystallographic structure, but leads to a small spread in orientations within individual grains. Furthermore, most grains develop in-plane tensile stress. The feature size of the developing nanoporous structure increases with increasing dealloying time.

Van Petegem, S; Brandstetter, S; Maa?, R; Schmitt, B; Borca, C; Van Swygenhoven, H; Hodge, A M; El-Dasher, B S; Biener, J



Diffractive imaging at large Fresnel number: Challenge of dynamic mesoscale imaging with hard x rays  

Science Journals Connector (OSTI)

Real materials have structure at both the atomic or crystalline scale as well as at interfaces and defects at the larger scale of grains. There is a need for the study of materials at the “mesoscale,” the scale at which subgranular physical processes and intergranular organization couple to determine microstructure, crucially impacting constitutive response at the engineering macroscale. Diffractive imaging using photons that can penetrate multiple grains of material would be a transformative technique for the study of the performance of materials in dynamic extremes. Thicker samples imply higher energy photons of shorter wavelength, and imaging of multiple grains implies bigger spot sizes. Such imaging requires the use of future planned and proposed hard x-ray free electron lasers (such as the European XFEL) to provide both the spatial coherence transverse to the large spots and the peak brilliance to provide the short illumination times. The result is that the Fresnel number of the system becomes large and is no longer in the Fraunhofer far-field limit. The interrelated issues of diffractive imaging at large Fresnel number are analyzed, including proof that diffractive imaging is possible in this limit and estimates of the signal-to-noise possible. In addition, derivation of the heating rates for brilliant pulses of x rays are presented. The potential and limitations on multiple dynamic images are derived. This paper will present a study of x-ray interactions with materials in this new regime of spatially coherent but relatively large mesoscale spots at very hard energies. It should provide the theory and design background for the experiments and facilities required to control materials in extreme environments, in particular for the next generation of very-hard-x-ray free electron lasers.

John L. Barber; Cris W. Barnes; Richard L. Sandberg; Richard L. Sheffield



Absolute x-ray energy calibration over a wide energy range using a diffraction-based iterative method  

E-Print Network (OSTI)

Mineral Physics Institute, Stony Brook University, Stony Brook, New York 11794, USA 2 DepartmentAbsolute x-ray energy calibration over a wide energy range using a diffraction-based iterative;REVIEW OF SCIENTIFIC INSTRUMENTS 83, 063901 (2012) Absolute x-ray energy calibration over a wide energy

Duffy, Thomas S.


7 Å Resolution in Protein 2-Dimentional-Crystal X-Ray Diffraction at Linac Coherent Light Source  

SciTech Connect

Membrane proteins arranged as two-dimensional (2D) crystals in the lipid en- vironment provide close-to-physiological structural information, which is essential for understanding the molecular mechanisms of protein function. X-ray diffraction from individual 2D crystals did not represent a suitable investigation tool because of radiation damage. The recent availability of ultrashort pulses from X-ray Free Electron Lasers (X-FELs) has now provided a mean to outrun the damage. Here we report on measurements performed at the LCLS X-FEL on bacteriorhodopsin 2D crystals mounted on a solid support and kept at room temperature. By merg- ing data from about a dozen of single crystal diffraction images, we unambiguously identified the diffraction peaks to a resolution of 7 °A, thus improving the observable resolution with respect to that achievable from a single pattern alone. This indicates that a larger dataset will allow for reliable quantification of peak intensities, and in turn a corresponding increase of resolution. The presented results pave the way to further X-FEL studies on 2D crystals, which may include pump-probe experiments at subpicosecond time resolution.

Pedrini, Bill; Tsai, Ching-Ju; Capitani, Guido; Padeste, Celestino; Hunter, Mark; Zatsepin, Nadia A.; Barty, Anton; Benner, Henry; Boutet, Sebastien; Feld, Geoffrey K.; Hau-Riege, Stefan; Kirian, Rick; Kupitz, Christopher; Messerschmidt, Marc; Ogren, John I.; Pardini, Tommaso; Segelke, Brent; Williams, Garth J.; Spence , John C.; Abela, Rafael; Coleman, Matthew A.; Evans, James E.; Schertler, Gebhard; Frank, Matthias; Li, Xiao-Dan



Synchroton x-ray diffraction study of an interfacial super-structure: a-Si on Ge0.2Si0.8 (111)-5 × 5  

Science Journals Connector (OSTI)

The interfacial structure between amorphous Si (a-Si) and Ge0.2Si0.8 is investigated by grazing incidence X-ray diffraction with the use of a synchroton radiation X-ray source. The sample, a-Si/Ge0.2Si0.8/Si(111) was prepared by molecular beam epitaxy. An a-Si film of 100 Å in thickness was deposited on the surface of Ge0.2Si0.8/Si(111), whose structure was 5 × 5 as confirmed by a RHEED pattern. The Bragg peaks of the X-ray diffraction wereobserved at (45, 45) and(?45, 85)in the two-dimensional reciprocal lattice space. This result indicates that the period of the 5 × 5 reconstructed surface structure is preserved even when the surface is covered with a-Si.

K. Akimoto; J. Mizuki; T. Tatsumi; N. Aizaki; J. Matsui



Portable chamber for the study of UHV prepared electrochemical interfaces by hard x-ray diffraction  

SciTech Connect

We report on a new electrochemical cell setup, combined with a portable UHV chamber, for in situ x-ray diffraction using synchrotron radiation. In contrast to more traditional electrochemical sample preparation schemes, atomically clean and well-ordered surfaces are routinely prepared by UHV methods, even in the case of reactive elements or alloys. Samples can be transferred from larger UHV systems into the portable chamber without exposure to ambient air. They can then be studied successively in UHV, in controlled gas atmospheres, and in contact with electrolyte solutions under applied electrochemical potential. The electrochemical setup employs a droplet geometry, which guarantees good electrochemical conditions during in situ x-ray measurements combined with voltammetry. We present first experimental results of Cu deposition on GaAs(001) and on freshly produced nanometric Pd(001) islands on Cu{sub 0.83}Pd{sub 0.17}(001), respectively.

Renner, Frank Uwe; Gruender, Yvonne; Zegenhagen, Joerg [European Synchrotron Radiation Facility, BP 220, 38043 Grenoble (France)



Structure determination of thin CoFe films by anomalous x-ray diffraction  

SciTech Connect

This work reports on the investigation of structure-property relationships in thin CoFe films grown on MgO. Because of the very similar scattering factors of Fe and Co, it is not possible to distinguish the random A2 (W-type) structure from the ordered B2 (CsCl-type) structure with commonly used x-ray sources. Synchrotron radiation based anomalous x-ray diffraction overcomes this problem. It is shown that as grown thin films and 300 K post annealed films exhibit the A2 structure with a random distribution of Co and Fe. In contrast, films annealed at 400 K adopt the ordered B2 structure.

Gloskovskii, Andrei; Stryganyuk, Gregory; Ouardi, Siham [Institut fuer Anorganische und Analytische Chemie, Johannes Gutenberg-Universitaet, 55099 Mainz (Germany); Fecher, Gerhard H.; Felser, Claudia [Institut fuer Anorganische und Analytische Chemie, Johannes Gutenberg-Universitaet, 55099 Mainz (Germany); Max Planck Institute for Chemical Physics of Solids, D-01187 Dresden (Germany); Hamrle, Jaroslav; Pistora, Jaromir [Department of Physics and Nanotechnology Centre, VSB-Technical University of Ostrava, 70833 Ostrava (Czech Republic); Bosu, Subrojati; Saito, Kesami; Sakuraba, Yuya; Takanashi, Koki [Institute for Materials Research (IMR), Tohoku University, Sendai 980-8577 (Japan)



Time-, Frequency-, and Wavevector-Resolved X-Ray Diffraction from Single Molecules  

E-Print Network (OSTI)

Using a quantum electrodynamic framework, we calculate the off-resonant scattering of a broad-band X-ray pulse from a sample initially prepared in an arbitrary superposition of electronic states. The signal consists of single-particle (incoherent) and two-particle (coherent) contributions that carry different particle form factors that involve different material transitions. Single-molecule experiments involving incoherent scattering are more influenced by inelastic processes compared to bulk measurements. The conditions under which the technique directly measures charge densities (and can be considered as diffraction) as opposed to correlation functions of the charge-density are specified. The results are illustrated with time- and wavevector-resolved signals from a single amino acid molecule (cysteine) following an impulsive excitation by a stimulated X-ray Raman process resonant with the sulfur K-edge. Our theory and simulations can guide future experimental studies on the structures of nano-particles and ...

Bennett, Kochise; Zhang, Yu; Dorfman, Konstantin E; Mukamel, Shaul



Raman scattering and X-ray diffraction study of the thermal decomposition of an ettringite-group crystal  

Science Journals Connector (OSTI)

...?A Raman scattering and X-ray diffraction study of the thermal decomposition of a naturally occurring, ettringite-group crystal is presented. Raman spectra, ... previous studies that reported higher temperatur...

S. K. Deb; M. H. Manghnani; K. Ross; R. A. Livingston…



KOTOBUKI-1 apparatus for cryogenic coherent X-ray diffraction imaging  

SciTech Connect

We have developed an experimental apparatus named KOTOBUKI-1 for use in coherent X-ray diffraction imaging experiments of frozen-hydrated non-crystalline particles at cryogenic temperature. For cryogenic specimen stage with small positional fluctuation for a long exposure time of more than several minutes, we here use a cryogenic pot cooled by the evaporation cooling effect for liquid nitrogen. In addition, a loading device is developed to bring specimens stored in liquid nitrogen to the specimen stage in vacuum. The apparatus allows diffraction data collection for frozen-hydrated specimens at 66 K with a positional fluctuation of less than 0.4 ?m and provides an experimental environment to easily exchange specimens from liquid nitrogen storage to the specimen stage. The apparatus was developed and utilized in diffraction data collection of non-crystalline particles with dimensions of ?m from material and biological sciences, such as metal colloid particles and chloroplast, at BL29XU of SPring-8. Recently, it has been applied for single-shot diffraction data collection of non-crystalline particles with dimensions of sub-?m using X-ray free electron laser at BL3 of SACLA.

Nakasako, Masayoshi; Takayama, Yuki; Oroguchi, Tomotaka; Sekiguchi, Yuki; Kobayashi, Amane [Department of Physics, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan) [Department of Physics, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); RIKEN SPring-8 Center, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Shirahama, Keiya [Department of Physics, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan)] [Department of Physics, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); Yamamoto, Masaki; Hikima, Takaaki; Yonekura, Koji; Maki-Yonekura, Saori; Kohmura, Yoshiki; Inubushi, Yuichi [RIKEN SPring-8 Center, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan)] [RIKEN SPring-8 Center, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Takahashi, Yukio; Suzuki, Akihiro [RIKEN SPring-8 Center, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan) [RIKEN SPring-8 Center, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Department of Precision Science and Technology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Matsunaga, Sachihiro; Inui, Yayoi [Department of Applied Biological Science Faculty of Science and Technology, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510 (Japan)] [Department of Applied Biological Science Faculty of Science and Technology, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510 (Japan); Tono, Kensuke; Kameshima, Takashi; Joti, Yasumasa [Japan Synchrotron Radiation Research Institute, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan)] [Japan Synchrotron Radiation Research Institute, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan); Hoshi, Takahiko [Kohzu Precision Co., Ltd., 2-6-15 Kurigi, Aso-ku, Kawasaki, Kanagawa 215-8521 (Japan)] [Kohzu Precision Co., Ltd., 2-6-15 Kurigi, Aso-ku, Kawasaki, Kanagawa 215-8521 (Japan)



Fixture for supporting and aligning a sample to be analyzed in an x-ray diffraction apparatus  

DOE Patents (OSTI)

A fixture is provided for supporting and aligning small samples of material on a goniometer for x-ray diffraction analysis. A sample-containing capillary is accurately positioned for rotation in the x-ray beam by selectively adjusting the fixture to position the capillary relative to the x and y axes thereof to prevent wobble and position the sample along the z axis or the axis of rotation. By employing the subject fixture relatively small samples of materials can be analyzed in an x-ray diffraction apparatus previously limited to the analysis of much larger samples.

Green, L.A.; Heck, J.L. Jr.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


High resolution x-ray and gamma ray imaging using diffraction lenses with mechanically bent crystals  

DOE Patents (OSTI)

A method for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation is provided. High quality mechanically bent diffracting crystals of 0.1 mm radial width are used for focusing the radiation and directing the radiation to an array of detectors which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for the use of a multi-component high resolution detector array and for narrow source and detector apertures.

Smither, Robert K. (Hinsdale, IL)



Anisotropic dynamic model of forbidden reflections in x-ray diffraction  

Science Journals Connector (OSTI)

A dynamic model of anisotropic x-ray diffraction is developed using two-wave approximation. A dispersion surface equation is derived for the screw-axis and glide-plane forbidden reflections. Propagation and polarization phenomena of waves are discussed. The deductions show that all these forbidden reflections may be excited except the 00l (l=2n+1) reflections for a 63 screw axis and the 00l (l=6n+3) reflections for 61 and 65 screw axes. The general methods are illustrated by their application to the rutile structure.

Yong Li, Yi Ding, X. R. Huang, X. S. Wu, W. J. Liu, and S. S. Jiang



Characterization of GaSb/GaAs interfacial misfit arrays using x-ray diffraction  

Science Journals Connector (OSTI)

We report a nondestructive large-area method to characterize dislocation formation at a highly lattice-mismatched interface. The analysis is based on x-ray diffraction and reciprocal space mapping using a standard lab-based diffractometer. We use this technique to identify and analyze a two-dimensional array of 90° misfit dislocations at a GaSb/GaAs interface. The full width at half maximum of the GaSb 004 reciprocal lattice point is shown to decrease with increasing GaSb epilayer thickness as expected from theoretical models. Based on these measurements the variation in the spatial dislocation frequency is calculated to be 1%.

Charles J. Reyner; Jin Wang; Kalyan Nunna; Andrew Lin; Baolai Liang; Mark S. Goorsky; D. L. Huffaker



Stoichiometry optimization of homoepitaxial oxide thin films using x-ray diffraction  

E-Print Network (OSTI)

a “MBE growth window” in which the film stoichiometry iswindow, the best fits of the diffraction patterns were obtained with film

Stemmer, Susanne



X–ray and neutron diffraction studies and MD simulation of atomic configurations in polyamorphic Y2O3-Al2O3 systems  

Science Journals Connector (OSTI)

...McMillan and David C. Clary X-ray and neutron diffraction studies and MD simulation...new results of structural studies using neutron and high-energy X-ray diffraction...pair-correlation functions obtained from X-ray and neutron scattering data. Unexpectedly large density...



X-ray Diffraction Laboratory Rev 1.0.3 1/20/2009 Approved by Department of Chemistry and EHSD Texas A & M University (1997)  

E-Print Network (OSTI)

X-ray Diffraction Laboratory Rev 1.0.3 1/20/2009 Approved by Department of Chemistry and EHSD Texas A & M University (1997) Name : ______________________________ UIN _____________________ X-ray Safety Release form for the X-ray Diffraction Laboratory Department of Chemistry, Texas A & M University Answer

Meagher, Mary


Quantitative description of microstructure defects in hexagonal boron nitrides using X-ray diffraction analysis  

SciTech Connect

A routine for simultaneous quantification of turbostratic disorder, amount of puckering and the dislocation and stacking fault density in hexagonal materials was proposed and tested on boron nitride powder samples that were synthesised using different methods. The routine allows the individual microstructure defects to be recognised according to their effect on the anisotropy of the X-ray diffraction line broadening. For quantification of the microstructure defects, the total line broadening is regarded as a linear combination of the contributions from the particular defects. The total line broadening is obtained from the line profile fitting. As testing material, graphitic boron nitride (h-BN) was employed in the form of hot-isostatically pressed h-BN, pyrolytic h-BN or a h-BN, which was chemically vapour deposited at a low temperature. The kind of the dominant microstructure defects determined from the broadening of the X-ray diffraction lines was verified by high resolution transmission electron microscopy. Their amount was attempted to be verified by alternative methods. - Highlights: • Reliable method for quantification of microstructure defects in BN was suggested. • The method is based on the analysis of anisotropic XRD line broadening. • This XRD line broadening is unique and characteristic of the respective defect. • Thus, the quantification of coexistent microstructure defects is possible. • The method was tested on hexagonal BN, which was produced by different techniques.

Schimpf, C., E-mail: schimpf@iww.tu-freiberg.de; Motylenko, M.; Rafaja, D.



X-ray diffraction studies of the structure of nanometer-sized crystalline materials  

Science Journals Connector (OSTI)

Recently, nanometer-sized crystalline materials have been proposed to represent a new solid-state structure which exhibits neither long-range order (like crystals) nor short-range order (like glasses). It was the purpose of this study to test this idea by x-ray diffraction experiments. Nanometer-sized crystalline materials are polycrystals in which the size of the crystallites is a few (1–10) nanometers. Structurally, these materials consist of the following two components, the volume fraction of which is about 50% each: a crystalline component, formed by all atoms located in the lattice of the crystallites, and an interfacial component comprising the atoms situated in the interfaces. It is this interfacial component which was proposed to exhibit an atomic arrangement without short- or long-range order. In order to test this idea, the interference function of nanometer-sized crystalline iron (6-nm crystal size) was measured by x-ray diffraction. The measured interference function was compared with the interference function computed by assuming the interfacial component to be short-range ordered or to consist of randomly displaced atoms (no short- or long-range order). It was found that the experimental interference function can only be matched by the computed one if the interfacial component is assumed to have no short- or long-range order.

X. Zhu, R. Birringer, U. Herr, and H. Gleiter



Crystallization and preliminary X-ray diffraction analysis of a flavoenzyme amine dehydrogenase/oxidase from Pyrococcus furiosus DSM 3638  

Science Journals Connector (OSTI)

This report describes the crystallization of a recombinant flavoprotein amine dehydrogenase/oxidase with specificity for L-proline from the hyperthermophile P. furiosus DSM 3638 and X-ray diffraction data collection. Crystals belonged to space group P1 and diffracted to a resolution of 3.3 ?.

Monaghan, P.J.



New reactor dedicated to in operando studies of model catalysts by means of surface x-ray diffraction and grazing incidence small angle x-ray scattering  

SciTech Connect

A new experimental setup has been developed to enable in situ studies of catalyst surfaces during chemical reactions by means of surface x-ray diffraction (SXRD) and grazing incidence small angle x-ray scattering. The x-ray reactor chamber was designed for both ultrahigh-vacuum (UHV) and reactive gas environments. A laser beam heating of the sample was implemented; the sample temperature reaches 1100 K in UHV and 600 K in the presence of reactive gases. The reactor equipment allows dynamical observations of the surface with various, perfectly mixed gases at controlled partial pressures. It can run in two modes: as a bath reactor in the pressure range of 1-1000 mbars and as a continuous flow cell for pressure lower than 10{sup -3} mbar. The reactor is connected to an UHV preparation chamber also equipped with low energy electron diffraction and Auger spectroscopy. This setup is thus perfectly well suited to extend in situ studies to more complex surfaces, such as epitaxial films or supported nanoparticles. It offers the possibility to follow the chemically induced changes of the morphology, the structure, the composition, and growth processes of the model catalyst surface during exposure to reactive gases. As an example the Pd{sub 8}Ni{sub 92}(110) surface structure was followed by SXRD under a few millibars of hydrogen and during butadiene hydrogenation while the reaction was monitored by quadrupole mass spectrometry. This experiment evidenced the great sensitivity of the diffracted intensity to the subtle interaction between the surface atoms and the gas molecules.

Saint-Lager, M.-C.; Bailly, A.; Dolle, P.; Baudoing-Savois, R.; Taunier, P.; Garaudee, S.; Cuccaro, S.; Douillet, S.; Geaymond, O.; Perroux, G.; Tissot, O.; Micha, J.-S.; Ulrich, O.; Rieutord, F. [Institut Neel, CNRS and Universite Joseph Fourier, BP 166, F-38042 Grenoble Cedex 9 (France); CEA/DRFMC, 17 rue des Martyrs, 38054 Grenoble Cedex 9 (France)



The resonant X-ray diffraction in Co-Akermanite: Theory and experiment  

SciTech Connect

The structural factors for X-ray resonant diffraction near the K-absorption edge of cobalt in Co-akermanite have been calculated with allowance for the known data about its incommensurate 2D modulation. It is shown that the local symmetry of Co atoms in the basic structure does not allow any pure resonant reflections in the dipole-dipole approximation. However, pure resonant reflections of the h00 (h = 2n + 1) type are possible owing to the dipole-quadrupole contribution. The 5D formalism is used for the incommensurately modulated structure. It is shown that the displacement terms in the anisotropic tensor atomic factors could mainly contribute to the first-order satellites, providing pure resonant satellite reflections of the hhlm0 (m = 2n + 1) or h00mm-bar (h = 2n + 1) types.

Bindi, L. [Universitae di Firenze, Dipartimento di Scienze della Terra (Italy); Dmitrienko, V. E. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Ovchinnikova, E. N. [Moscow State University (Russian Federation); Soedzhima, Yu. [Kyushu University, Department of Physics (Japan)



E-Print Network 3.0 - anomalous x-ray diffraction Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

National Laboratory Superconducting wiggler 7. Low-energy Anomalous X-ray... 1. High-energy x-ray micro-mapping of materials for advanced energy and structural engineering......


High-resolution X-ray diffraction analyses of protein crystals  

Science Journals Connector (OSTI)

...illustration of the X-ray optical system used in the current study...illustrates the X-ray optical system that was used for this study...in a novel X-ray optical system (Matyi et al. 1999), produced...well as a two-dimensional collimation of the incident beam. Both...



A Diffractive-Optic Telescope for X-Ray Astronomy D. Dewey, T.H. Markert, and M.L. Schattenburg  

E-Print Network (OSTI)

A Diffractive-Optic Telescope for X-Ray Astronomy D. Dewey, T.H. Markert, and M.L. Schattenburg for a light-weight X-ray astronomical telescope that uses a diffractive optical element is described (200-1000 cm2 ) through the use of a blazed diffractive optic. State-of-the-art grating technology

Dewey, Daniel


X-ray shearing interferometer  

DOE Patents (OSTI)

An x-ray interferometer for analyzing high density plasmas and optically opaque materials includes a point-like x-ray source for providing a broadband x-ray source. The x-rays are directed through a target material and then are reflected by a high-quality ellipsoidally-bent imaging crystal to a diffraction grating disposed at 1.times. magnification. A spherically-bent imaging crystal is employed when the x-rays that are incident on the crystal surface are normal to that surface. The diffraction grating produces multiple beams which interfere with one another to produce an interference pattern which contains information about the target. A detector is disposed at the position of the image of the target produced by the interfering beams.

Koch, Jeffrey A. (Livermore, CA)



Time-Resolved Synchrotron X-ray Diffraction on Pulse Laser Heated Iron in Diamond Anvil Cell  

SciTech Connect

The authors present time-resolved synchrotron x-ray diffraction to probe the {var_epsilon}-{delta} phase transition of iron during pulse-laser heating in a diamond anvil cell. The system utilizes a monochromatic synchrotron x-ray beam, a two-dimensional pixel array x-ray detector and a dual beam, double side laser-heating system. Multiple frames of the diffraction images are obtained in real-time every 22 ms over 500 ms of the entire pulse heating period. The results show the structural evolution of iron phases at 17 GPa, resulting in thermal expansion coefficient 1/V({Delta}V/{Delta}T){sub p} = 7.1 * 10{sup -6}/K for {var_epsilon}-Fe and 2.4 * 10{sup -5}/K for {gamma}-Fe, as well as the evidence for metastability of {gamma}-Fe at low temperatures below the {var_epsilon}-{gamma} phase boundary.

Yoo, C S; Wei, H; Dias, R; Shen, G; Smith, J; Chen, J Y; Evans, W



Sound velocities of compressed Fe3C from simultaneous synchrotron X-ray diffraction and nuclear resonant scattering measurements  

Science Journals Connector (OSTI)

A recently installed X-ray diffraction facility that is integrated with existing nuclear resonant scattering set-ups at Sector 3 of the Advanced Photon Source at Argonne National Laboratory is introduced. Its applications for measuring the sound velocities of compressed Fe3C are reported.

Gao, L.



First spin-resolved electron distributions in crystals from combined polarized neutron and X-ray diffraction experiments  

Science Journals Connector (OSTI)

A method to map spin-resolved electron distribution from combined polarized neutron and X-ray diffraction is described and applied for the first time to a molecular magnet and it is shown that spin up density is 5% more contracted than spin down density.

Deutsch, M.



X-ray diffraction studies and equation of state of methane at 202 GPa Liling Sun a,*, Wei Yi a  

E-Print Network (OSTI)

X-ray diffraction studies and equation of state of methane at 202 GPa Liling Sun a,*, Wei Yi that at room temperature compressed CH4 remains an insulator with cubic structure to 202 GPa. Ã? 2009 Elsevier B of planetary interiors and the origin of their magnetic field distribution. CH4 has a very rich phase diagram

Shen, Guoyin


Three-dimensional plastic response in polycrystalline copper via near-field high-energy X-ray diffraction microscopy  

Science Journals Connector (OSTI)

The evolution of the crystallographic orientation field in a polycrystalline sample of copper is mapped in three dimensions as tensile strain is applied. Using forward-modeling analysis of high-energy X-ray diffraction microscopy data, the ability to track intragranular orientation variations is demonstrated.

Li, S.F.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


In-situ X-ray diffraction activation study on an Fe/TiO2 pre-catalyst  

Science Journals Connector (OSTI)

It is well known that pre-treatment procedures affect catalyst performance. In situ X-ray diffraction was used in this study to monitor the changes in phase composition and crystallite size during the pre-treatment of Fe/TiO2 catalysts, yielding insight into crystalline and non-crystalline phase changes and metal-support interactions.

Rayner, M.K.



Thick-mode resonance of a PZT/Si wafer stack investigated by X-ray diffraction in Bragg geometry  

Science Journals Connector (OSTI)

X-ray diffraction in Bragg geometry was used to investigate the effects of longitudinal standing waves on an Si(111) wafer, constructing a PZT/Si(111) stack with a resonant frequency of 2.34 MHz. In addition to the ultrasonic vibration, a thermal effect is evident, which has been mostly ignored or avoided in previous reports.

Souza, P.E.N; de



Smoothing of X-ray diffraction data and K2 elimination using penalized likelihood and the composite link model  

Science Journals Connector (OSTI)

This article proposes a framework for smoothing of and K doublet elimination from X-ray diffraction scans in an automated fashion. Smoothing is performed using penalized likelihood estimation, while for doublet elimination the model is extended using the composite link model.

Rooi, J.J; de



X-ray diffraction study of thermal stress relaxation in ZnO films deposited by magnetron sputtering  

E-Print Network (OSTI)

are in a high compressive stress state. In situ X-ray diffraction measurements inside a furnace revealed a relaxation of the as-grown stresses at temperatures which vary with the atmosphere in the furnace and change in many application domains such as ultraviolet detectors, light-emitting diodes, solar cells. As a II


Diffraction with a coherent X-ray beam: dynamics and imaging  

Science Journals Connector (OSTI)

Techniques for coherent X-ray scattering measurements are detailed. Applications in the study of the dynamics of fluctuations and in lensless high-resolution imaging are described.

Livet, F.



Ultrafast x-ray diffraction for measurements of structural dynamics in shocked metals  

SciTech Connect

An experiment on structural dynamics at the ultrafast time scale in shocked metal samples is presented. The technique development of an ultrafast x-ray diffractometer to generate 'molecular movies' is described. Preliminary results of static x-ray measurements of thin unshocked Ga samples are presented. Initial experiments use 200-300 mJ of a 100fs Ti:Sapphire laser to excite K-alpha x-ray emission in an aluminum wire. The x-ray emission is relayed using a spherical crystal to the sample target. Plans for experiments using Cu K-alpha emission will also be described.

Workman, J. B. (Jonathan B.); Keiter, P. A. (Paul A.); Kyrala, George A.; Roberts, J. P. (Jeffrey); Taylor, Antoinette J.,; Funk, D. J. (David J.)



X-Ray Diffraction from Calcite for Wave-Lengths 1.5 to 5 Angstroms  

Science Journals Connector (OSTI)

Theoretical expressions for the coefficient of reflection, percent reflection, and width of the line to be expected from the second crystal of a double spectrometer in the (1, -1) position, based on Darwin's theory of reflection from a perfect crystal, as modified by Prins, are evaluated for calcite for six lines in the region 1.54 to 5A. This region includes, at 3.06A, the critical absorption limit of calcium. With a specially designed double-crystal spectrometer, these properties of the rocking curve from the second crystal for ten wave-lengths, copper K? radiation and nine spectrum lines selected from the uranium M series, are experimentally measured and these results compared with the calculated values. The agreement between the observed and calculated rocking curve widths is excellent throughout the entire region and gives no evidence of mosaic structure in the crystals. The calculated values of percent reflection are consistently above those observed by some 16 percent. Good agreement is obtained for the values of the coefficient of reflection for wave-lengths shorter than 4A including those close to and on either side of the calcium absorption limit. No correction for temperature motion of the atoms has been attempted, but it seems possible that such a correction would give very satisfactory agreement between theory and experiment, showing that calcite surfaces may be obtained for which there is no evidence of mosaic structure from the diffraction of x-rays.

Lyman G. Parratt



DXRD (Dynamic X-Ray Diffraction) studies of oil shale mineral reactions  

SciTech Connect

With the advent of second generation, above-ground oil shale processes, retorted shale is likely to be combusted at temperatures between 1000{degree}K and 1200{degree}K. At these temperatures the mineral matrix of the shale will undergo a variety of chemical reactions including carbonate decomposition, sulfation and recombination reactions to form silicates. This complex set of reactions can be very important to the optimum design of a retorted shale combustor. For example the net heat of combustion is very dependent on these reactions since the carbonate mineral decomposition reactions are highly endothermic and some of the silication reactions only mildly endothermic. In addition, the combusted shale (ash) will have to be disposed and revegetated and the environmental consequences of this process will be highly dependent on the mineral composition of the ash. The degree to which the mineral reactions influence these considerations will depend on the time-temperature history to which the shale is exposed. Thus it is important to have a knowledge of the kinetics of these reactions. Previous attempts to study these kinetics have been made at Lawrence Livermore Laboratories and in our own laboratory. However, these studies all employed TGA techniques and, since there is usually more than one reaction occurring simultaneously, there is no way to distinguish between competing reactions. What is described here is the application of a new technique - Dynamic X-Ray Diffraction (DXRD), which has been successfully applied to studies of oil shale mineral reactions under typical retorted shale combustion conditions.

Helling, K.A.; Thomson, W.J.



X-ray Diffraction of Cubic Gd2)3/Er under High Pressure  

SciTech Connect

In this paper, we report the in situ high pressure X-ray diffraction studies on Er{sup 3+} doped Gd{sub 2}O{sub 3} in a diamond anvil cell up to 39.8 GPa at room temperature. Several phase transitions have been identified in our studies. The structural transformation from a starting cubic phase to a hexagonal phase occurred during the sample compression process, at 8.57 GPa. And the hexagonal phase was stable from 12.5 GPa up to the highest pressure in this study but was not quenchable and transformed to a monoclinic phase after pressure release. An anomalous high pressure behavior in the hexagonal type Gd{sub 2}O{sub 3} phase was observed, which might be caused by an electron transition influenced by Er{sup 3+} ions doping. By fitting the compression data to the Birch-Murnaghan equation of state, the bulk moduli of the cubic and two hexagonal (at p < 19.9 GPa and p > 27.0 GPa) Gd{sub 2}O{sub 3} phases were determined to be 164 {+-} 3, 185 {+-} 7, and 150 {+-} 10 GPa with B'{sub 0} = 4, respectively.

X Zou; C Gong; B Liu; Q Li; Z Li; B Liu; R Liu; J Liu; Z Chen; et al.



Accelerated Synchrotron X-ray Diffraction Data Analysis on a Heterogeneous High Performance Computing System  

Science Journals Connector (OSTI)

The analysis of synchrotron X-ray Diffraction (XRD) data has been used by scientists and engineers to understand and predict properties of materials. However, the large volume of XRD image data and the intensive computations involved in the data analysis makes it hard for researchers to quickly reach any conclusions about the images from an experiment when using conventional XRD data analysis software. Synchrotron time is valuable and delays in XRD data analysis can impact decisions about subsequent experiments or about materials that they are investigating. In order to improve the data analysis performance, ideally to achieve near real time data analysis during an XRD experiment, we designed and implemented software for accelerated XRD data analysis. The software has been developed for a heterogeneous high performance computing (HPC) system, comprised of IBM PowerXCell 8i processors and Intel quad-core Xeon processors. This paper describes the software and reports on the improved performance. The results indicate that it is possible for XRD data to be analyzed at the rate it is being produced.

J Qin; M A Bauer



Thermal equation-of-state of TiC: a synchrotron x-ray diffraction study  

SciTech Connect

The pressure (P)-volume (V)-temperature (T) measurements were carried out for titanium carbide at pressures and temperatures up to 8.1 GPa and 1273 K using energy-dispersive synchrotron x-ray diffraction. Thermoelastic parameters were derived for TiC based on a modified high-temperature Birch-Murnaghan equation of state and a thermal-pressure approach. With the pressure derivative of the bulk modulus, K'{sub 0}, fixed at 4.0, we obtain: the ambient bulk modulus K{sub 0} = 268(6) GPa, temperature derivative of bulk modulus at constant pressure ({partial_derivative}K{sub T}/{partial_derivative}T){sub p} = -0.026(9) GPa K{sup -1}, volumetric thermal expansivity a{sub T}(K{sup -1}) = a + bT with a = 1.62(12) x 10{sup -5} K{sup -1} and b = 1.07(17) x 10{sup -8} K{sup -2}, pressure derivative of thermal expansion ({partial_derivative}a/{partial_derivative}P){sub T} = (-3.62 {+-} 1.14) x 10{sup -7} GPa{sup -1} K{sup -1}, and temperature derivative of bulk modulus at constant volume ({partial_derivative}K{sub T}/{partial_derivative}T){sub v} = -0.015 (8) GPa K{sup -1}. These results provide fundamental thermo physical properties for TiC and are important to theoretical and computational modeling of transition metal carbides.

Yu, Xiaohui [Los Alamos National Laboratory; Lin, Zhijun [Los Alamos National Laboratory; Zhang, Jianzhong [Los Alamos National Laboratory; Zhao, Yusheng [Los Alamos National Laboratory; Wang, Liping [STATE UNIV OF NEW YORK; Ding, Zejun [CHINA; Jin, Changqing [CHINA




SciTech Connect

The F-Area Tank Farm (FTF) Performance Assessment (PA) utilizes waste speciation in the waste release model used in the FTF fate and transport modeling. The waste release modeling associated with the residual plutonium in Tank 18 has been identified as a primary contributor to the Tank 18 dose uncertainty. In order to reduce the uncertainty related to plutonium in Tank 18, a better understanding of the plutonium speciation in the Tank 18 waste (including the oxidation state and stoichiometry) is desired. Savannah River National Laboratory (SRNL) utilized Scanning Electron Microscopy (SEM) and X-ray Diffraction (XRD) to analyze Tank 18 samples to provide information on the speciation of plutonium in the waste material. XRD analysis of the Tank 18 samples did not identify any plutonium mineral phases in the samples. These indicates the crystalline mineral phases of plutonium are below the detection limits of the XRD method or that the plutonium phase(s) lack long range order and are present as amorphous or microcrystalline solids. SEM analysis of the Tank 18 samples did locate particles containing plutonium. The plutonium was found as small particles, usually <1 {micro}m but ranging up to several micrometers in diameter, associated with particles of an iron matrix and at low concentration in other elemental matrices. This suggests the plutonium has an affinity for the iron matrix. Qualitatively, the particles of plutonium found in the SEM analysis do not appear to account for all of the plutonium in the sample based on concentrations determined from the chemical analysis of the Tank 18 samples. This suggests that plutonium is also distributed throughout the solids in low concentrations.

Hay, M.; O'Rourke, P.; Ajo, H.



Thermal Equation of State of TiC: A Synchrotron X-ray Diffraction  

SciTech Connect

The pressure-volume-temperature measurements were carried out for titanium carbide (TiC) at pressures and temperatures up to 8.1 GPa and 1273 K using energy-dispersive synchrotron x-ray diffraction. Thermoelastic parameters were derived for TiC based on a modified high-temperature Birch-Murnaghan equation of state and a thermal pressure approach. With the pressure derivative of the bulk modulus, K{prime}{sub 0}, fixed at 4.0, we obtain: the ambient bulk modulus K{sub 0} = 268(6) GPa, which is comparable to previously reported value; temperature derivative of bulk modulus at constant pressure ({partial_derivative}K{sub T}/{partial_derivative}T){sub P} = -0.026(9) GPa K{sup -1}, volumetric thermal expansivity {alpha}{sub T}(K{sup -1}) = a+b T with a = 1.62(12) x 10{sup -5} K{sup -1} and b = 1.07(17) x 10{sup -8}K{sup -2}, pressure derivative of thermal expansion ({partial_derivative}{sub {alpha}}/{partial_derivative}{sub P}){sub T} = (-3.62 {+-} 1.14) x 10{sup -7} GPa{sup -1} K{sup -1}, and temperature derivative of bulk modulus at constant volume ({partial_derivative}K{sub T}/{partial_derivative}T){sub V} = -0.015(8) GPa K{sup -1}. These results provide fundamental thermophysical properties for TiC for the first time and are important to theoretical and computational modeling of transition metal carbides.

Yu, X.; Lin, Z; Zhang, J; Wang, L; Ding, Z; Jin, C; Zhao, Y



Thermal equation of state of TiC: A synchrotron x-ray diffraction study  

SciTech Connect

The pressure-volume-temperature measurements were carried out for titanium carbide (TiC) at pressures and temperatures up to 8.1 GPa and 1273 K using energy-dispersive synchrotron x-ray diffraction. Thermoelastic parameters were derived for TiC based on a modified high-temperature Birch-Murnaghan equation of state and a thermal pressure approach. With the pressure derivative of the bulk modulus, K{sub 0}{sup '}, fixed at 4.0, we obtain: the ambient bulk modulus K{sub 0}=268(6) GPa, which is comparable to previously reported value; temperature derivative of bulk modulus at constant pressure ({partial_derivative}K{sub T}/{partial_derivative}T){sub P}=-0.026(9) GPa K{sup -1}, volumetric thermal expansivity {alpha}{sub T}(K{sup -1})=a+bT with a=1.62(12)x10{sup -5} K{sup -1} and b=1.07(17)x10{sup -8} K{sup -2}, pressure derivative of thermal expansion ({partial_derivative}{alpha}/{partial_derivative}P){sub T}=(-3.62{+-}1.14)x10{sup -7} GPa{sup -1} K{sup -1}, and temperature derivative of bulk modulus at constant volume ({partial_derivative}K{sub T}/{partial_derivative}T){sub V}=-0.015(8) GPa K{sup -1}. These results provide fundamental thermophysical properties for TiC for the first time and are important to theoretical and computational modeling of transition metal carbides.

Yu Xiaohui [LANSCE Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); National Lab for Condensed Matter Physics, Institute of Physics, CAS, Beijing 100080 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China); Lin Zhijun; Zhang Jianzhong; Zhao Yusheng [LANSCE Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Wang Liping [Mineral Physics Institute, State University of New York, Stony Brook, New York 11794 (United States); Ding Zejun [Department of Physics, University of Science and Technology of China, Hefei 230026 (China); Jin Changqing [National Lab for Condensed Matter Physics, Institute of Physics, CAS, Beijing 100080 (China)



X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network (OSTI)

, Rotating Anode Page: 1 of 5 Approved: JHR 1/8/2009 SOP: SOPSAXSLA Last date revised: December 26 2009 Date approved: December 26 2009 Small Angle X-ray Scattering, Rotating Anode PURPOSE: This Standard Operating

Meagher, Mary


Signal-to-noise and radiation exposure considerations in conventional and diffraction x-ray microscopy  

Science Journals Connector (OSTI)

Using a signal-to-noise ratio estimation based on correlations between multiple simulated images, we compare the dose efficiency of two soft x-ray imaging systems: incoherent...

Huang, Xiaojing; Miao, Huijie; Steinbrener, Jan; Nelson, Johanna; Shapiro, David; Stewart, Andrew; Turner, Joshua; Jacobsen, Chris



Location of Cu2+ in CHA zeolite investigated by X-ray diffraction using the Rietveld/maximum entropy method  

Science Journals Connector (OSTI)

Rietveld/MEM analysis applied to synchrotron powder X-ray diffraction data of dehydrated CHA zeolites with catalytically active Cu2+ reveals Cu2+ in both the six- and eight-membered rings in the CHA framework, providing the first complete structural model that accounts for all Cu2+. Density functional theory calculations are used to corroborate the experimental structure and to discuss the Cu2+ coordination in terms of the Al distribution in the framework.

Andersen, C.W.



High brightness--multiple beamlets source for patterned X-ray production  

DOE Patents (OSTI)

Techniques for controllably directing beamlets to a target substrate are disclosed. The beamlets may be either positive ions or electrons. It has been shown that beamlets may be produced with a diameter of 1 .mu.m, with inter-aperture spacings of 12 .mu.m. An array of such beamlets, may be used for maskless lithography. By step-wise movement of the beamlets relative to the target substrate, individual devices may be directly e-beam written. Ion beams may be directly written as well. Due to the high brightness of the beamlets from extraction from a multicusp source, exposure times for lithographic exposure are thought to be minimized. Alternatively, the beamlets may be electrons striking a high Z material for X-ray production, thereafter collimated to provide patterned X-ray exposures such as those used in CAT scans. Such a device may be used for remote detection of explosives.

Leung, Ka-Ngo (Hercules, CA); Ji, Qing (Albany, CA); Barletta, William A. (Oakland, CA); Jiang, Ximan (El Cerrito, CA); Ji, Lili (Albany, CA)



A criterion for the dynamical to kinematical transition of x-ray diffraction on a bent crystal  

SciTech Connect

It is well known that the peak reflectivity of a bent crystal, generally speaking, is smaller than that of a plane crystal, and it goes to zero when the crystal curvature goes to infinity. The reason for this is the transition between dynamical and kinematical diffraction that takes place as the crystal curvature increases. The physical explanation is as follows: the deviation from exact Bragg position along the beam changes so fast that the thickness over which the beam is within a Darwin width becomes too small to reflect the beam. Bent crystals are widely used as focusing elements in X-ray optics, and estimation of whether or not a bent crystal is still perfect enough to provide good reflectivity is of great importance. Currently the Advanced Photon Source (APS) is considering a number of bent crystals as focusing elements for future APS beamlines, including a sagittaly focusing monochromator and bent backscattering analyzer for inelastic X-ray scattering experiments. A criterion is given in answer to the question: To what extent is it possible to bend a crystal without loss of X-ray peak reflectivity? An expression based on the work of Chukhovskii, Gabrielyan and Petrashen, is formulated that applies to anisotropic cubic crystal and that can be used not only for conventional asymmetric Bragg diffraction, but also for inclined crystal diffraction. The following special cases are treated as examples: isotropic crystal, standard symmetrical Bragg diffraction, extremely asymmetric diffraction, and backscattering with Bragg angles near 90{degree}. In addition, an asymptotic behavior for high energies is detailed.

Kushnir, V.I.; Macrander, A.T.



Novel Cell Design for Combined In Situ Acoustic Emission and X-ray Diffraction of Cycling Lithium Ion Batteries  

SciTech Connect

An in situ acoustic emission (AE) and X-ray diffraction (XRD) cell for use in the study of battery electrode materials has been devised and tested. This cell uses commercially available coin cell hardware retrofitted with a metalized polyethylene terephthalate (PET) disk which acts as both an X-ray window and a current collector. In this manner the use of beryllium and its associated cost and hazard is avoided. An AE sensor may be affixed to the cell face opposite the PET window in order to monitor degradation effects, such as particle fracture, during cell cycling. Silicon particles which were previously studied by the AE technique were tested in this cell as a model material. The performance of these cells compared well with unmodified coin cells while providing information about structural changes in the active material as the cell is repeatedly charged and discharged.

Rhodes, Kevin J [ORNL; Kirkham, Melanie J [ORNL; Meisner, Roberta Ann [ORNL; Parish, Chad M [ORNL; Dudney, Nancy J [ORNL; Daniel, Claus [ORNL


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Novel cell design for combined in situ acoustic emission and x-ray diffraction study during electrochemical cycling of batteries  

SciTech Connect

An in situ acoustic emission (AE) and x-ray diffraction cell for use in the study of battery electrode materials has been designed and tested. This cell uses commercially available coin cell hardware retrofitted with a metalized polyethylene terephthalate (PET) disk, which acts as both an x-ray window and a current collector. In this manner, the use of beryllium and its associated cost and hazards is avoided. An AE sensor may be affixed to the cell face opposite the PET window in order to monitor degradation effects, such as particle fracture, during cell cycling. Silicon particles, which were previously studied by the AE technique, were tested in this cell as a model material. The performance of these cells compared well with unmodified coin cells, while providing information about structural changes in the active material as the cell is repeatedly charged and discharged.

Rhodes, Kevin; Meisner, Roberta; Daniel, Claus [Materials Science and Technology Division, Oak Ridge National Laboratory, 1 Bethel Valley Rd., MS 6083, Oak Ridge, Tennessee 37931-6083 (United States); Materials Science and Engineering Department, University of Tennessee, 434 Dougherty Hall, Knoxville, Tennessee 37996-2200 (United States); Kirkham, Melanie; Parish, Chad M.; Dudney, Nancy [Materials Science and Technology Division, Oak Ridge National Laboratory, 1 Bethel Valley Rd., MS 6083, Oak Ridge, Tennessee 37931-6083 (United States)



Grain orientation measurement of passivated aluminum interconnectsby x-ray micro diffraction  

SciTech Connect

The crystallographic orientations of individual grains in apassivated aluminum interconnect line of 0.7-mu m width were investigatedby using an incidentwhite x-ray microbeam at the Advanced Light Source,Berkeley National Laboratory. Intergrain orientation mapping was obtainedwith about 0.05o sensitivity by the micro Laue diffractiontechnique.

Chang, Chang-Hwan; Valek, B.C.; Padmore,H.A.; MacDowell, A.A.; Celestre, R.; Marieb, T.; Bravman, J.C.; Koo, Y.M.; Patel, J.R.



Ris-R-747(EN) Neutron and X-Ray Diffraction  

E-Print Network (OSTI)

describes X-ray and neutron scattering experiments per- formed on two examples of modulated structures is divided in three parts. A single crystal elastic neutron scattering experiment between 4.2 and 115 K has shift across the layers. A small-angle neutron scattering experiment has been performed on the mag


Expression, crystallization and preliminary X-ray diffraction studies of thermostable -1,3-xylanase from Thermotoga neapolitana strain DSM 4359  

Science Journals Connector (OSTI)

Highly thermostable -1,3-xylanase from T. neapolitana strain DSM 4359 was prepared and crystallized. X-ray diffraction data were collected to a resolution of 1.82 ?.

Okazaki, F.



Idempotent density matrices for correlated systems from x-ray-diffraction structure factors  

Science Journals Connector (OSTI)

X-ray structure-factor data can be used to obtain an electron-density matrix corresponding to a wave function that is a single determinant of orbitals. Equations are derived which treat this problem for the case of electronic open shells. The equations are solved for model numerical problems of lithium and berylium atoms. For these cases the structure-factor data are obtained from essentially exact wave functions.

C. Frishberg and L. J. Massa



Self-propagating high-temperature synthesis by the method of x-ray diffraction analysis using synchrotron radiation  

SciTech Connect

Investigations of the dynamics of phase transformations accompanying self-propagating high-temperature synthesis by the method of x-ray diffraction analysis on a synchroton-radiation diffractometer offers the possibility of obtaining data on the dynamics of phase transformations, of observing unstable or unknown phases, of discovering liquid phases, of refining the models of the wave structure, and of obtaining data on the kinetics of formation of each of the phases participating in the synthesis process. This paper reviews the actual results in all of these areas to date and anticipates advances likely under each possibility.

Aleksandrov, V.V.; Korchagin, M.A.; Sheromov, M.A.; Tolochko, B.P.



X-ray nano-diffraction study of Sr intermetallic phase during solidification of Al-Si hypoeutectic alloy  

SciTech Connect

The evolution of strontium (Sr) containing intermetallic phase in the eutectic reaction of Sr-modified Al-Si hypoeutectic alloy was studied with high energy synchrotron beam source for nano-diffraction experiments and x-ray fluorescence elemental mapping. Contrary to popular belief, Sr does not seem to interfere with the Twin Plane Re-entrant Edge (TPRE) growth mechanism of eutectic Si, but evolves as the Al{sub 2}Si{sub 2}Sr phase during the eutectic reaction at the boundary between the eutectic Si and Al grains.

Manickaraj, Jeyakumar; Gorny, Anton; Shankar, Sumanth, E-mail: shankar@mcmaster.ca [Light Metal Casting Research Centre (LMCRC), Department of Mechanical Engineering, McMaster University, 1280 Main Street W, Hamilton, Ontario L8S 4L7 (Canada); Cai, Zhonghou [Advanced Photon Source, Argonne National Laboratory, 9700 South Cass Avenue, Argonne, Illinois 60439 (United States)



Investigation of the near-surface structures of polar InN films by chemical-state-discriminated hard X-ray photoelectron diffraction  

SciTech Connect

Near-surface structures of polar InN films were investigated by laboratory-based hard X-ray photoelectron diffraction (HXPD) with chemical-state-discrimination. HXPD patterns from In 3d{sub 5/2} and N 1s core levels of the In-polar and N-polar InN films were different from each other and compared with the simulation results using a multiple-scattering cluster model. It was found that the near-surface structure of the In-polar InN film was close to the ideal wurtzite structure. On the other hand, on the N-polar InN film, defects-rich surface was formed. In addition, the existence of the In-polar domains was observed in the HXPD patterns.

Yang, A. L.; Yamashita, Y.; Kobata, M.; Yoshikawa, H.; Sakata, O.; Kobayashi, K. [Synchrotron X-ray Station at SPring-8, National Institute for Materials Science, Sayo-cho, Hyogo 679-5148 (Japan)] [Synchrotron X-ray Station at SPring-8, National Institute for Materials Science, Sayo-cho, Hyogo 679-5148 (Japan); Matsushita, T. [Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo-cho, Hyogo 679-5198 (Japan)] [Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo-cho, Hyogo 679-5198 (Japan); Pis, I. [Department of Surface and Plasma Science, Faculty of Mathematics and Physics, Charles University, V Holesovickach 2, 18000 Prague 8 (Czech Republic)] [Department of Surface and Plasma Science, Faculty of Mathematics and Physics, Charles University, V Holesovickach 2, 18000 Prague 8 (Czech Republic); Imura, M. [Wide Bandgap Materials Group, National Institute for Materials Science, Tsukuba, Ibaraki 305-0044 (Japan)] [Wide Bandgap Materials Group, National Institute for Materials Science, Tsukuba, Ibaraki 305-0044 (Japan); Yamaguchi, T. [Department of Photonics, Ritsumeikan University, Kusatsu, Shiga 525-8577 (Japan)] [Department of Photonics, Ritsumeikan University, Kusatsu, Shiga 525-8577 (Japan); Nanishi, Y. [WCU Hybrid Materials Program, Department of Materials Science and Engineering, Seoul National University, Seoul 151-744, South Korea and Research Organization of Science and Engineering, Ritsumeikan University, 1-1-1 Noji Higashi, Kusatsu, Shiga 525-8577 (Japan)] [WCU Hybrid Materials Program, Department of Materials Science and Engineering, Seoul National University, Seoul 151-744, South Korea and Research Organization of Science and Engineering, Ritsumeikan University, 1-1-1 Noji Higashi, Kusatsu, Shiga 525-8577 (Japan)



X-ray diffraction line profile analysis of deformation microstructure in boron modified Ti-6Al-4V alloy  

SciTech Connect

X-ray diffraction line profile analysis (XRDLPA) techniques have been applied to investigate the deformed microstructure of a recently developed boron modified two-phase titanium alloy Ti-6Al-4V. The alloy was hot compressed at 750 deg. C up to 50% height reduction at two different strain rates (10{sup -3} S{sup -1} and 1 S{sup -1}). Microstructural parameters like average domain size, average microstrain within the domain and dislocation density of the two phases were determined using X-ray diffraction line profile analysis. The results indicate an increase in the microstrain and dislocation density for the {alpha}-phase and decrease for the {beta}-phase in the case of boron modified alloys as compared to the normal material. Microstructural modifications viz. the grain refinement and the presence of hard, brittle TiB particles in the case of boron modified alloy are held responsible for the observed difference in the dislocation density. - Research Highlights: {yields} Microstructural examination of hot compressed Ti64 with and without boron addition by XRDLPA. {yields} Smaller average domain size in alpha-phase compared to the corresponding alpha-phase in all cases. {yields} Higher microstrain and dislocation density for {alpha} phase and lower for {beta} phase in case of Ti64+B. {yields} Decrease in domain size while increase in micro-strain and dislocation density with strain rate. {yields} Strain accumulation around TiB particles responsible for high dislocation density in {alpha} phase.

Sarkar, Apu; Roy, Shibayan; Suwas, Satyam, E-mail: satyamsuwas@materials.iisc.ernet.in



Oxygen diffusivity in silicon derived from dynamical X-ray diffraction  

SciTech Connect

Thickness dependent Pendelloesung oscillations are highly sensitive to strain fields from defects in a host crystal. Based on this, we present a novel technique to measure the precipitation kinetics of oxygen in silicon already at its early stage of clustering at high temperatures. At 900 Degree-Sign C, precipitates with a radius smaller than 4 nm and with a density of 1 {+-} 0.5 Multiplication-Sign 10{sup 13} 1/cm{sup 3} were observed. The technique was calibrated by complementary scanning transmission electron microscope and energy dispersive X-ray measurements in the range of normal diffusivity yielding a diffusion constant of 1.7 {+-} 0.1 Multiplication-Sign 10{sup -12}cm{sup 2}/s, which is close to the literature value of 2.074 Multiplication-Sign 10{sup -12}cm{sup 2}/s. The measurements have been made with the characteristic K{sub {alpha}1}-line of a high voltage tungsten X-ray tube at 59.31 keV, which provides the opportunity to illuminate through complex sample environments like high temperature scattering furnaces.

Will, J.; Groeschel, A.; Bergmann, C.; Steinrueck, H.-G.; Magerl, A. [Crystallography and Structural Physics, University of Erlangen-Nuernberg, Staudtstr. 3, 91058 Erlangen (Germany); Kot, D.; Schubert, M. A.; Kissinger, G. [IHP, Im Technologiepark 25, 15236 Frankfurt (Oder) (Germany)



A grating-based single-shot x-ray phase contrast and diffraction method for in vivo imaging  

SciTech Connect

Purpose: The purpose of this study is to develop a single-shot version of the grating-based phase contrast x-ray imaging method and demonstrate its capability of in vivo animal imaging. Here, the authors describe the principle and experimental results. They show the source of artifacts in the phase contrast signal and optimal designs that minimize them. They also discuss its current limitations and ways to overcome them. Methods: A single lead grid was inserted midway between an x-ray tube and an x-ray camera in the planar radiography setting. The grid acted as a transmission grating and cast periodic dark fringes on the camera. The camera had sufficient spatial resolution to resolve the fringes. Refraction and diffraction in the imaged object manifested as position shifts and amplitude attenuation of the fringes, respectively. In order to quantify these changes precisely without imposing a fixed geometric relationship between the camera pixel array and the fringes, a spatial harmonic method in the Fourier domain was developed. The level of the differential phase (refraction) contrast as a function of hardware specifications and device geometry was derived and used to guide the optimal placement of the grid and object. Both ex vivo and in vivo images of rodent extremities were collected to demonstrate the capability of the method. The exposure time using a 50 W tube was 28 s. Results: Differential phase contrast images of glass beads acquired at various grid and object positions confirmed theoretical predictions of how phase contrast and extraneous artifacts vary with the device geometry. In anesthetized rats, a single exposure yielded artifact-free images of absorption, differential phase contrast, and diffraction. Differential phase contrast was strongest at bone-soft tissue interfaces, while diffraction was strongest in bone. Conclusions: The spatial harmonic method allowed us to obtain absorption, differential phase contrast, and diffraction images, all from a single raw image and is feasible in live animals. Because the sensitivity of the method scales with the density of the gratings, custom microfabricated gratings should be superior to off-the-shelf lead grids.

Bennett, Eric E.; Kopace, Rael; Stein, Ashley F.; Wen Han [National Heart, Lung, and Blood Institute, National Institutes of Health, Imaging Physics Section, Translational Medicine Branch, 10 Center Drive, MSC 1061, Bethesda, Maryland 20892 (United States)



The BioCAT undulator beamline 18ID: A facility for biological non-crystalline diffraction and x-ray absorption spectroscopy at the APS  

SciTech Connect

The 18ID undulator beamline of the Biophysics Collaborative Access Team at the Advanced Photon Source, Argonne, IL, USA, is a high-performance instrument designed for, and dedicated to, the study of partially ordered and disordered biological materials using the techniques of small-angle X-ray scattering, fiber diffraction, and X-ray absorption spectroscopy. The beamline and associated instrumentation are described in detail and examples of the representative experimental results are presented.

Fischetti, R.; Stepanov, S.; Rosenbaum, G.; Barrea, R.; Black, E.; Gore, D.; Heurich, R.; Kondrashkina, E.; Kropf, A.J.; Wang, S.; Zhang, K.; Irving, T.C.; Bunker, G.B. (IIT); (Georgia)



Controllable variation of the intensity of diffracted X-ray beams and double modulation of such beams for transmission and reception of audio information  

Science Journals Connector (OSTI)

This paper discusses research devoted to the study of the intensity change of diffracted and transmitted X-ray beams under the action of a temperature gradient or acoustic oscillations, as well as the techniques for `controllable complete reflection' of transmitted X-radiation in the direction of the diffracted beam.

Navasardyan, M.A.



In-situ stress analysis with X-Ray diffraction for yield locus characterization of sheet metals  

SciTech Connect

A main problem in the field of sheet metal characterization is the inhomogeneous plastic deformation in the gauge regions of specimens which causes the analytically calculated stresses to differ from the sought state of stress acting in the middle of the gauge region. To overcome this problem, application of X-Ray diffraction is analyzed. For that purpose a mobile X-ray diffractometer and an optical strain measurement system are mounted on a universal tensile testing machine. This enables the recording of the whole strain and stress history of a material point. The method is applied to uniaxial tension tests, plane strain tension tests and shear tests to characterize the interstitial free steel alloy DC06. The applicability of the concepts of stress factors is verified by uniaxial tension tests. The experimentally obtained values are compared with the theoretical values calculated with crystal elasticity models utilizing the orientation distribution functions (ODF). The relaxation problem is addressed which shows itself as drops in the stress values with the strain kept at a constant level. This drop is analyzed with elasto-viscoplastic material models to correct the measured stresses. Results show that the XRD is applicable to measure the stresses in sheet metals with preferred orientation. The obtained yield locus is expressed with the Yld2000–2D material model and an industry oriented workpiece is analyzed numerically. The comparison of the strain distribution on the workpiece verifies the identified material parameters.

Güner, A.; Tekkaya, A. E. [Institute of Forming Technology and Lightweight Construction, TU Dortmund University, Baroper Str. 301, 44227 Dortmund (Germany); Zillmann, B.; Lampke, T. [Institute of Materials Science and Engineering, Chemnitz University of Technology, Erfenschlager Strasse 73 D-09125 Chemnitz (Germany)



Crystallization and preliminary X-ray diffraction analysis of GCIP/HHM transcriptional regulator  

Science Journals Connector (OSTI)

Native and selenomethionine-derivatized crystals of full-length human GCIP/HHM protein were obtained. The crystals belonged to space group P3221 and the best native crystal diffracted to 3.5 ? resolution.

Seto, A.



Lensless Imaging of Magnetic Nanostructures by X-ray Spectro...  

NLE Websites -- All DOE Office Websites (Extended Search)

co-workers. Their implementation of the technique is an extension of lensless Fourier transform holography to the x-ray regime, which detects the far field diffraction pattern of a...


A new two-dimensional X-ray drift chamber for diffraction studies with pulsed synchroton radiation  

Science Journals Connector (OSTI)

A two-dimensional position-sensitive detector (drift-chamber) for X-ray difraction experiments with pulsed synchrotron radiation is described. For the measurements of drift direction (x), the small drift chamber uses a reference signal generated by the electron bunches circulating in the storage ring. A flat geometry delay-line, inductively connected to the anode, detects the position of avalanche electrons on the anode wire (y-direction). The main features are: spatial resolution in drift direction (x), 100 ?m for 5 keV photons; spatial resolution in y direction, 400 ?m; maximum counting-rate 5×105 cps; quantum efficiency ar 5 keV, 52%. The systems has been succesfully tested at the ADONE storage ring at Frascati by measuring the small-angle diffraction spectrum of a dry tendon collagen.

Mario Iannuzzi; Andrea La Monaca



Preferred orientation of n-hexane crystallized in silicon nanochannels: A combined x-ray diffraction and sorption isotherm study  

E-Print Network (OSTI)

We present an x-ray diffraction study on n-hexane in tubular silicon channels of approximately 10 nm diameter both as a function of the filling fraction f of the channels and as a function of temperature. Upon cooling, confined n-hexane crystallizes in a triclinic phase typical of the bulk crystalline state. However, the anisotropic spatial confinement leads to a preferred orientation of the confined crystallites, where the crystallographic direction coincides with the long axis of the channels. The magnitude of this preferred orientation increases with the filling fraction, which corroborates the assumption of a Bridgman-type crystallization process being responsible for the peculiar crystalline texture. This growth process predicts for a channel-like confinement an alignment of the fastest crystallization direction parallel to the long channel axis. It is expected to be increasingly effective with the length of solidifying liquid parcels and thus with increasing f. In fact, the fastest solidification front...

Henschel, Anke; Hofmann, Tommy; Knorr, Klaus; Huber, Patrick; 10.1103/PhysRevE.79.032601



Synthesis and single crystal x-ray diffraction study of a Schiff base derived from 4-acylpyrazolone and 2-aminophenol  

SciTech Connect

The title compound, (Z)-1-(3-chlorophenyl)-4[1((2hydroxyphenyl)amino)propylidene] -3-methyl-1H-pyrazol-5(4H)-one was synthesized by refluxing compound 1-(m-chlorophenyl)-3-methyl-4-propionyl-5-pyrazolone, with 2-aminophenol in ethanol. The compound crystallizes in the orthorhombic crystal system with space group Pca2{sub 1} having unit cell parameters: a = 26.2993(8), b = 7.0724(2) and c = 18.7170(5)Å. The structure contains two crystallographically independent molecules, A, and, B, in the asymmetric unit cell. The crystal structure was solved by direct method using single crystal X-ray diffraction data collected at room temperature and refined by full-matrix least-squares procedures to a final R- value of 0.049 for 5207 observed reflections.

Sharma, Naresh; Kant, Rajni, E-mail: vivek-gupta2k2@hotmail.com; Gupta, Vivek K., E-mail: vivek-gupta2k2@hotmail.com [Department of Physics and Electronics, University of Jammu, Jammu Tawi - 180006 (India); Jadeja, R. N. [Department of Chemistry, Faculty of Science, The M. S. University of Baroda, Vadodara-390002 (India)



Quantification of mineral matter in the Argonne Premium Coals using interactive Rietveld-based X-ray diffraction  

Science Journals Connector (OSTI)

The mineral matter in the eight reference North American coal samples of the Argonne Premium Coal series has been investigated on a quantitative basis using X-ray diffraction (XRD) techniques. X-ray diffraction data obtained from electronic low-temperature (oxygen–plasma) ash (LTA) residues, from ashes produced by heating the coals in air at 370°C, and also from the raw coals themselves, were evaluated using an interactive data processing system (siroquant™) based on Rietveld interpretation methods. The results from the three types of material (LTA, 370°C ash and raw coal) were compared for each sample. This allowed the components present in the raw coals in crystalline form to be recognised separately from mineral artifacts produced, particularly in the low-rank coals, from interaction of organically associated elements (Ca, S, etc.) during the two ashing processes. After the allowance for the production of any artifacts, the quantitative mineral assemblages identified from XRD of the raw coals were found to be consistent, even for coals having a relatively low ash percentage (around 5%), with the results obtained from the respective mineral concentrates prepared by the ashing methods. The effects of heating the coal to 370°C could also be distinguished, relative to the raw coal or the LTA, through changes in components such as pyrite and the clay minerals. Although some areas of uncertainty exist, particularly with magnesium in the low-rank coals, the calculated chemical compositions of the coal ash derived from the mineral mixtures identified for each coal were also found to be consistent with the results of direct chemical analysis of the respective coal ash materials.

Colin R. Ward; John C. Taylor; C.E. Matulis; L.S. Dale


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


An in situ method for the study of strain broadening using synchrotron X-ray diffraction  

Science Journals Connector (OSTI)

A tensionometer for in situ powder diffraction studies of foils under stress has been constructed and used in a copper foil on beamline 2.3 of the Daresbury SRS. Both peak asymmetry and broadening were observed which was interpreted as being due to a cellular structure with cell walls and cell interiors possessing high and low dislocation densities.

Tang, C.C.



Recent X–ray diffraction studies of muscle contraction and their implications  

Science Journals Connector (OSTI)

...of diffraction studies H. E. Huxley 1881 Phil...yet, that the cross-bridge stroke occurs in more than...78, 134A. Huxley, H. E., Reconditi, M...interferometry to study cross-bridge behavior during rapid mechanical...80, 266A. Huxley, H. E., Reconditi, M...



Water–DNA interactions as studied by X–ray and neutron fibre diffraction  

Science Journals Connector (OSTI)

...over the A form by the pres- ence of excess ions in the fibre. This effect is most...Langridge, R. 1965 Fourier synthesis of lithium DNA part III: Hoogsteen models. J...diffraction study of a crystalline form of the lithium salt. J. Mol. Biol. 2, 1937. Langridge...



An x-ray diffraction study of some mesoionic 2,3-diphenyltetrazoles  

SciTech Connect

An X-my diffraction study is reported for four molecules of mesoionic 2,3-diphenyltetrazoles. The results confirm a dipolar [open quotes]mesoionic[close quotes] structure, aromatic character of the tetrazole ring and no conjugation between the phenyl and tetrazole rings. The geometry of the exocyclic group is discussed in detail. The molecular parameters of the compounds investigated are correlated with [sup 13]C and [sup 15]N nmr data. The results obtained are compared with similar structures which have already been studied.

Luboradzki, R. (Institute of Physical Chemistry, Warsaw (Poland)); Kozminski, W.; Stefaniak, L. (Institute of Organic Chemistry, Warsaw (Poland))



A Model Graphene Diffraction Pattern Frank Rioux  

E-Print Network (OSTI)

A Model Graphene Diffraction Pattern Frank Rioux The purpose of this tutorial is to model graphene d Pj k px j py k 2 i 1 A Graphene Model Diffraction Pattern #12;

Rioux, Frank


Vibrational spectroscopy and x-ray diffraction of Cd,,OH...2 to 28 GPa at 300 K S.-H. Shim* and S. Rekhi  

E-Print Network (OSTI)

and infrared absorption spectroscopy along with x-ray diffraction for brucite-type -Cd OH 2 to 28 GPa at 300 K observed in the brucite-type hydroxides. The Raman spectra of the high-pressure phase of Cd OH 2 is similar I. INTRODUCTION High symmetry prompts considering the brucite-type hy- droxides M OH 2, M


X?ray diffraction study of concentrated chromium (III) chloride solutions. I. Complex formation analysis in equilibrium conditions  

Science Journals Connector (OSTI)

Concentrated chromium (III) chloride solutions both acidic and neutral have been examined by x?ray diffraction in equilibrium conditions; i.e. a long period of time after their preparation. Complex formation between Cr3+ and Cl? ions have been quantitatively analyzed through direct comparison of experimental and calculated structure functions. The average number of chloride ions bonded to chromium in each solution has been determined. The values obtained are consistent with the indications given by the distribution curves and in good agreement with those expected on the grounds of equilibrium constants. The average aggregation numbers were determined by assuming the presence in neutral solutions of the charged species Cr(H2O)3+ 6 Cr(H2O)5Cl2+ and Cr(H2O)4Cl+ 2. In addition experimental evidence of the neutral species Cr(H2O)3Cl3 in the acidic solution has been obtained. Octahedral water coordination for chloride ions has been confirmed. Well defined second coordination shell around Cr3+ ions is strongly supported by the structural parameters obtained for water molecules belonging to two subsequent hydration shells of the cations.

Mauro Magini



Humidity-controlled preparation of frozen-hydrated biological samples for cryogenic coherent x-ray diffraction microscopy  

SciTech Connect

Coherent x-ray diffraction microscopy (CXDM) has the potential to visualize the structures of micro- to sub-micrometer-sized biological particles, such as cells and organelles, at high resolution. Toward advancing structural studies on the functional states of such particles, here, we developed a system for the preparation of frozen-hydrated biological samples for cryogenic CXDM experiments. The system, which comprised a moist air generator, microscope, micro-injector mounted on a micromanipulator, custom-made sample preparation chamber, and flash-cooling device, allowed for the manipulation of sample particles in the relative humidity range of 20%-94%rh at 293 K to maintain their hydrated and functional states. Here, we report the details of the system and the operation procedure, including its application to the preparation of a frozen-hydrated chloroplast sample. Sample quality was evaluated through a cryogenic CXDM experiment conducted at BL29XUL of SPring-8. Taking the performance of the system and the quality of the sample, the system was suitable to prepare frozen-hydrated biological samples for cryogenic CXDM experiments.

Takayama, Yuki; Nakasako, Masayoshi [Department of Physics, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Kanagawa 223-8522 (Japan); RIKEN Harima Institute/SPring-8, 1-1-1 Kouto, Mikaduki, Sayo, Hyogo 679-5148 (Japan)



Time-resolved X-ray diffraction microprobe studies of the conversion of cellulose I to ethylenediamine-cellulose I  

SciTech Connect

Structural changes during the treatment of films of highly crystalline microfibers of Cladophora cellulose with ethylenediamine (EDA) have been studied by time-resolved X-ray microprobe diffraction methods. As EDA penetrates the sample and converts cellulose I to EDA-cellulose I, the measured profile widths of reflections reveal changes in the shapes and average dimensions of cellulose I and EDA-cellulose I crystals. The (200) direction of cellulose I is most resistant to EDA penetration, with EDA penetrating most effectively at the hydrophilic edges of the hydrogen bonded sheets of cellulose chains. Most of the cellulose chains in the initial crystals of cellulose I are incorporated into crystals of EDA-cellulose I. The size of the emerging EDA-cellulose I crystals is limited to about half of their size in cellulose I, most likely due to strains introduced by the penetration of EDA molecules. There is no evidence of any gradual structural transition from cellulose I to EDA-cellulose I involving a continuously changing intermediate phase. Rather, the results point to a rapid transition to EDA-cellulose I in regions of the microfibrils that have been penetrated by EDA.

Nishiyama, Yoshiharu; Wada, Masahisa; Hanson, B. Leif; Langan, Paul (Toledo); (U of Tokyo); (CNRS-CRMD); (LANL)



Experimental determination of bulk modulus of 14 A tobermorite using high pressure synchrotron X-ray diffraction  

SciTech Connect

Using a diamond anvil cell, 14 A tobermorite, a structural analogue of calcium silicate hydrates (C-S-H), was examined by high-pressure synchrotron X-ray diffraction up to 4.8 GPa under hydrostatic conditions. The bulk modulus of 14 A tobermorite was calculated, K{sub o} = 47 GPa. Comparison of the current results with previous high pressure studies on C-S-H(I) indicates that: (1) the compression behavior of the lattice parameters a and b of 14 A tobermorite and C-S-H(I) are very similar, implying that both materials may have very similar Ca-O layers, and also implying that an introduction of structural defects into the Ca-O layers may not substantially change in-plane incompressibility of the ab plane of 14 A tobermorite; and (2) the bulk modulus values of 14 A tobermorite and C-S-H(I) are dominated by the incompressibility of the lattice parameter c, which is directly related to the interlayer spacing composed of dreierketten silicate chains, interlayer Ca, and water molecules.

Oh, Jae Eun [Department of Civil and Environmental Engineering, University of California, Berkeley, 94720, CA USA (United States); School of Urban and Environmental Engineering, Ulsan National Institute of Science and Technology, Ulsan Metropolitan City, 689-798 (Korea, Republic of); Clark, Simon M. [Department of Earth and Planetary Sciences, Maquarie University, Sydney, NSW 2109 (Australia); Advanced Light Source, Lawrence Berkeley National Laboratory, Berkeley, 20015, CA (United States); Wenk, Hans-Rudolf [Department of Earth and Planetary Sciences, Maquarie University, Sydney, NSW 2109 (Australia); Monteiro, Paulo J.M., E-mail: monteiro@berkeley.edu [Department of Civil and Environmental Engineering, University of California, Berkeley, 94720, CA USA (United States)



In-situ x-ray diffraction of layered LiCoO{sub 2}-Type cathode materials  

SciTech Connect

The authors have investigated LiNi{sub 0.8}Co{sub 0.2}O{sub 2} (Sumitomo) and LiNi{sub 5/8}Co{sub 1/4}Mn{sub 1/16}Al{sub 1/16}O{sub 2} (Sandia chemical preparation method) cathode powders via in-situ X-ray Diffraction and Cyclic Voltammetry using a coffee-bag type electrochemical cell. Both cathode materials did not show a monoclinic distortion during de-intercalation but sustained the hexagonal structure up to 4.3 V. The doping of Co into the LiNiO{sub 2} structure appears to stabilize this lattice as the hexagonal structure over the full range of charging (up to 4.3 V). The LiNi{sub 5/8}Co{sub 1/4}Mn{sub 1/16}Al{sub 1/16}O{sub 2} cathode material exhibited a 160 mAh/g capacity (to 4.1 V) on its 1{sup st} cycle, while displaying a much smaller volume change (as compared to LiNi{sub 0.8}Co{sub 0.2}O{sub 2}) during de-intercalation. This reduced overall volume change (2.5 vol%) may have important implications for cycle life of this material.

Rodriguez, M.A.; Ingersoll, D.; Doughty, D.H.



Investigation of metal dusting mechanism in Fe-base alloys using Raman spectroscopy, x-ray diffraction, and electron microscopy.  

SciTech Connect

The metal-dusting phenomenon, which is a metal loss process that occurs in hot reactive gases, was investigated in iron and certain iron-base alloys by Raman scattering, X-ray diffraction (XRD), and scanning-electron microscopy (SEM). Coke from metal dusting exhibits six Raman bands at 1330(D band), 1580(G band), 1617, 2685, 3920, and 3235 cm-1. The bandwidths and the relative intensities of the 1330 and 1580 cm-1 bands are related to the crystallinity and defect structure of the coke. Both Raman and XRD analyses suggest that the metal-dusting process influences the catalytic crystallization of carbon. A new mechanism of metal dusting is, therefore, proposed, based on the premise that coke cannot crystallize well by deposition from carburizing gases at low temperature without catalytic activation because of its strong C-C bonds and high melting temperature. Cementite or iron participates in the coke-crystallizing process in a manner that tends to improve the crystallinity of the coke. At the same time, fine iron or cementite particles are liberated from the pure metal or alloys.

Zeng, Z.; Natesan, K.; Maroni, V. A.



Preferred orientation of n-hexane crystallized in silicon nanochannels: A combined x-ray diffraction and sorption isotherm study  

E-Print Network (OSTI)

We present an x-ray diffraction study on n-hexane in tubular silicon channels of approximately 10 nm diameter both as a function of the filling fraction f of the channels and as a function of temperature. Upon cooling, confined n-hexane crystallizes in a triclinic phase typical of the bulk crystalline state. However, the anisotropic spatial confinement leads to a preferred orientation of the confined crystallites, where the crystallographic direction coincides with the long axis of the channels. The magnitude of this preferred orientation increases with the filling fraction, which corroborates the assumption of a Bridgman-type crystallization process being responsible for the peculiar crystalline texture. This growth process predicts for a channel-like confinement an alignment of the fastest crystallization direction parallel to the long channel axis. It is expected to be increasingly effective with the length of solidifying liquid parcels and thus with increasing f. In fact, the fastest solidification front is expected to sweep over the full silicon nanochannel for f=1, in agreement with our observation of a practically perfect texture for entirely filled nanochannels.

Anke Henschel; Pushpendra Kumar; Tommy Hofmann; Klaus Knorr; Patrick Huber



X-ray Diffraction and Molecular Dynamics Study of Medium-range Order in Ambient and Hot Water  

E-Print Network (OSTI)

We have developed x-ray diffraction measurements with high energy-resolution and accuracy to study water structure at three different temperatures (7, 25 and 66 C) under normal pressure. Using a spherically curved Ge crystal an energy resolution better than 15 eV has been achieved which eliminates influence from Compton scattering. The high quality of the data allows a precise oxygen-oxygen pair correlation function (PCF) to be directly derived from the Fourier transform of the experimental data resolving shell structure out to ~12 {\\AA}, i.e. 5 hydration shells. Large-scale molecular dynamics (MD) simulations using the TIP4P/2005 force-field reproduce excellently the experimental shell-structure in the range 4-12 {\\AA} although less agreement is seen for the first peak in the PCF. The Local Structure Index [J. Chem. Phys. 104, 7671 (1996)] identifies a tetrahedral minority giving the intermediate-range oscillations in the PCF and a disordered majority providing a more featureless background in this range. The current study supports the proposal that the structure of liquid water, even at high temperatures, can be described in terms of a two-state fluctuation model involving local structures related to the high-density and low-density forms of liquid water postulated in the liquid-liquid phase transition hypothesis.

Congcong Huang; K. T. Wikfeldt; D. Nordlund; U. Bergmann; T. McQueen; J. Sellberg; L. G. M. Pettersson; A. Nilsson



Methods development for diffraction and spectroscopy studies of metalloenzymes at X-ray free-electron lasers  

Science Journals Connector (OSTI)

...on electrofocusing, an energy dispersive von Hamos X-ray...spectroscopy data collected by us at the Linac Coherent...deposition of radiation energy by the X-ray pulse was...we review the current status of methods developed in...packages developed by us to process both spectroscopic...



In situ X-ray diffraction study of the lithium excess layered oxide compound Li[Li0.2Ni0.2Mn0.6]O-2 during electrochemical cycling  

SciTech Connect

In situ X-ray diffraction patterns were collected using a laboratory X-ray diffractometer during the first electrochemical charge/discharge cycle of the layered lithium excess compound Li[Li{sub 0.2}Ni{sub 0.2}Mn{sub 0.6}]O{sub 2} in the family of Li[Ni{sub x}Li{sub 1/3 - 2x/3}Mn{sub 2/3 - x/3}]O{sub 2} (x = 1/5). Dynamic changes in peak positions, lattice parameters, and microstrain help to explain the lithium de-intercalation mechanism in this class of materials. Strong anisotropy is observed in the shifts of the lattice parameters during the first cycle. The in situ electrochemical measurement shows dynamically changing strain during the first electrochemical cycle that is explained by known lithium and transition metal (TM) migration mechanisms.

Fell, Christopher [University of Florida, Gainesville; Meng, Ying Shirley [University of California, San Diego; Jones, Jacob [University of Florida



In situ X-ray diffraction study of the lithium excess layered oxide compound Li[Li0.2Ni0.2Mn0.6]O2 during electrochemical cycling  

Science Journals Connector (OSTI)

In situ X-ray diffraction patterns were collected using a laboratory X-ray diffractometer during the first electrochemical charge/discharge cycle of the layered lithium excess compound Li[Li0.2Ni0.2Mn0.6]O2 in the family of Li[NixLi1/3 ? 2x/3Mn2/3 ? x/3]O2 (x = 1/5). Dynamic changes in peak positions, lattice parameters, and microstrain help to explain the lithium de-intercalation mechanism in this class of materials. Strong anisotropy is observed in the shifts of the lattice parameters during the first cycle. The in situ electrochemical measurement shows dynamically changing strain during the first electrochemical cycle that is explained by known lithium and transition metal (TM) migration mechanisms.

Christopher R. Fell; Miaofang Chi; Ying Shirley Meng; Jacob L. Jones



In-situ X-ray diffraction study of phase transformations in the Am-O system  

SciTech Connect

In the frame of minor actinides recycling, americium can be transmuted by adding it in UO{sub 2} or (U, Pu)O{sub 2} fuels. Americium oxides exhibiting a higher oxygen potential than U or Pu oxides, its addition alters the fuel properties. To comprehend its influence, a thorough knowledge of the Am-O phase equilibria diagram and of thermal expansion behavior is of main interest. Due to americium scarcity and high radiotoxicity, few experimental reports on this topic are available. Here we present in-situ high-temperature XRD results on the reduction from AmO{sub 2} to Am{sub 2}O{sub 3}. We show that fluorite (Fm-3m) AmO{sub 2} is reduced to cubic (Ia-3) C Prime -type Am{sub 2}O{sub 3+{delta}}, and then into hexagonal (P6{sub 3}/mmc) A-type Am{sub 2}O{sub 3}, which remains stable up to 1840 K. We also demonstrate the transitional existence of the monoclinic (C2/m) B-type Am{sub 2}O{sub 3}. At last, we describe, for the first time, the thermal expansion behavior of the hexagonal Am{sub 2}O{sub 3} between room temperature and 1840 K. - Graphical abstract: Americium dioxide was in situ studied by high-temperature X-ray diffraction. First, fluorite AmO{sub 2} is reduced to cubic C Prime -type Am{sub 2}O{sub 3+{delta}} and then transforms into hexagonal A-type Am{sub 2}O{sub 3}, which remains stable up to 1840 K. Then, we demonstrate the transitional existence of monoclinic B-type Am{sub 2}O{sub 3}. At last, we describe, for the first time, the thermal expansion of A-type Am{sub 2}O{sub 3} between room temperature and 1840 K. This work may contribute to a better understanding of Am oxide behavior. Highlights: Black-Right-Pointing-Pointer We realize an in-situ high-temperature X-ray diffraction study on an AmO{sub 2} sample. Black-Right-Pointing-Pointer Fluorite AmO{sub 2} transforms to cubic Am{sub 2}O{sub 3+{delta}} and then to hexagonal Am{sub 2}O{sub 3}. Black-Right-Pointing-Pointer Little-known monoclinic Am{sub 2}O{sub 3} is observed during the cubic-to-hexagonal transition. Black-Right-Pointing-Pointer Lattice parameter thermal expansion of hexagonal Am{sub 2}O{sub 3} is given up to 1840 K. Black-Right-Pointing-Pointer We give additional data on AmO{sub 2} lattice parameter expansion under self-irradiation.

Lebreton, Florent, E-mail: florent.lebreton@cea.fr [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France) [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France); GEMH, ENSCI, 87065 Limoges (France); Belin, Renaud C., E-mail: renaud.belin@cea.fr [CEA Cadarache, DEN/DEC/SPUA/LMPC, F-13108 Saint-Paul-Lez-Durance (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France)] [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France); Blanchart, Philippe, E-mail: philippe.blanchart@unilim.fr [GEMH, ENSCI, 87065 Limoges (France)] [GEMH, ENSCI, 87065 Limoges (France)



Resolving Conflicting Crystallographic and NMR Models for Solution-State DNA with Solution X-ray Diffraction  

Science Journals Connector (OSTI)

We report on synchrotron-based high-angle X-ray solution scattering measured to 2 Å resolution for two synthetic DNA sequences for which there are conflicting X-ray crystal and solution NMR models. ... Herein, we report on synchrotron-based high-angle X-ray solution scattering measured to 2 Å resolution for two synthetic DNA sequences for which there are numerous conflicting X-ray crystal and solution NMR models. ... The crystal structure of the synthetic DNA dodecamer d(CpGpCpGpApApTpTpCpGpCpG) was refined to a residual error of R = 17.8% at 1.9-Å resoln. ...

Xiaobing Zuo; David M. Tiede



Vibrational Spectroscopy and X-ray Diffraction of Cd(OH)2 to 28 GPa at 300 K  

E-Print Network (OSTI)

structure parameters of the brucite-type hydroxides. Thederivative (K 0 ) of the brucite-type hydroxides. Materialwith X-ray di?raction for brucite- type ?-Cd(OH) 2 to 28 GPa

Shim, Sang-Heon; Rekhi, Sandeep; Martin, Michael C.; Jeanloz, Raymond


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Crystallization and shear modulus of a forming biopolymer film determined by in situ x-ray diffraction and ultrasound reflection methods  

Science Journals Connector (OSTI)

The structure and the rigidity of a forming biopolymer film were determined using concurrent x-ray diffraction and ultrasonic reflection measurements. Film formation of a xylan solution (de-ionized water 10 g ? l xylan 4 g ? l glycerol) was studied during water evaporation at 24 ( ± 2 ) ° C 37 ( ± 5 ) % RH . X-ray diffraction(XRD) data showed the crystallization and ultrasonic data the increase of the shear modulus ( G ) during water evaporation. Xylan crystallized into small xylan dihydrate crystallites the number of which increased as water evaporated. Crystallization began earlier than the increase in G during film formation. The increase in G also continued after the crystallites were fully formed indicating still ongoing structural changes in the amorphous parts. The maximum value of G was 0.1 – 0.5 GPa . XRD measurements performed ex situ showed a crystallinity of 16%–19% ( ± 5 % ) and a fairly isotropic crystallite orientation in the surface plane of the films.

Marko Peura; Timo Karppinen; Annemai Soovre; Ari Salmi; Maija Tenkanen; Edward Hæggström; Ritva Serimaa



J. Phys.: Condens. Matter 10 (1998) 71337144. Printed in the UK PII: S0953-8984(98)92644-3 X-ray diffraction, magnetization and nuclear magnetic  

E-Print Network (OSTI)

J. Phys.: Condens. Matter 10 (1998) 7133­7144. Printed in the UK PII: S0953-8984(98)92644-3 X-ray diffraction, magnetization and nuclear magnetic resonance study of Y2Fe17-xGax N X Shen, T K Daeubler , J I of the Holy Cross, Worcester, MA 01610, USA § State Key Laboratory of Magnetism, Institute of Physics, Chinese

Yang, De-Ping


Room-temperature serial crystallography using a kinetically optimized microfluidic device for protein crystallization and on-chip X-ray diffraction  

Science Journals Connector (OSTI)

An emulsion-based serial crystallographic technology has been developed, in which single crystals are grown in nanolitre-sized droplets inside an X-ray semi-transparent microfluidic chip exploiting a negative feedback mechanism. Diffraction data are measured, one crystal at a time, from a series of room-temperature crystals stored in the chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different unoriented crystals to solve the structure of glucose isomerase to 2.1 ?.

Heymann, M.



X-ray-diffraction determination of the Ni-dopant site in single-crystal YBa2Cu3O7-?  

Science Journals Connector (OSTI)

Anomalous dispersive x-ray-diffraction measurements have determined the dopant-site distribution in Ni-doped single crystals of the high-temperature superconductor YBa2Cu3O7-?. The data from a YBa2(Cu0.83Ni0.17)3O7-? crystal show that over 95% of the Ni dopants occupy the Cu(2) site in the copper oxide planes, with negligible occupation of the Cu(1) copper oxide chain sites. General guidelines are presented for selecting the most effective hkl diffraction planes for measuring dopant concentration profiles. Direct measurement of the energy dependence of the dopant atomic scattering forces is also demonstrated.

S. A. Hoffman; M. A. Castro; G. C. Follis; S. M. Durbin



X-ray Crystallographic, Scanning Microprobe X-ray Diffraction, and Cross-Polarized/Magic Angle Spinning [superscript 13]C NMR Studies of the Structure of Cellulose III[subscript II  

SciTech Connect

The X-ray crystallographic structure of cellulose III{sub II} is characterized by disorder; the unit cell (space group P2{sub 1}; a = 4.45 {angstrom}, b = 7.64 {angstrom}, c = 10.36 {angstrom}, {alpha} = {beta} = 90{sup o}, {gamma} = 106.96{sup o}) is occupied by one chain that is the average of statistically disordered antiparallel chains. {sup 13}C CP/MAS NMR studies reveal the presence of three distinct molecular conformations that can be interpreted as a mixture of two different crystal forms, one equivalent to cellulose III{sub I}, and another with two independent glucosyl conformations in the asymmetric unit. Both X-ray crystallographic and {sup 13}C NMR spectroscopic results are consistent with an aggregated microdomain structure for cellulose III{sub II}. This structure can be generated from a new crystal form (space group P2{sub 1}; a = 4.45 {angstrom}, b = 14.64 {angstrom}, c = 10.36 {angstrom}, {alpha} = {beta} = 90{sup o}, {gamma} = 90.05{sup o}; two crystallographically independent and antiparallel chains; gt hydroxymethyl groups) by multiple dislocation defects. These defects produce microdomains of the new crystal form and cellulose III{sub I} that scanning microprobe diffraction studies show are distributed consistently through the cellulose III{sub II} fiber.

Wada, Masahisa; Heux, Laurent; Nishiyama, Yoshiharu; Langan, Paul; (U of Tokyo); (CNRS-CRMD); (LANL)



High-temperature X-ray diffraction study of crystallization and phase segregation on spinel-type lithium manganese oxides  

SciTech Connect

To study crystallization process of spinel-type Li{sub 1+x}Mn{sub 2-x}O{sub 4}, in-situ high-temperature X-ray diffraction technique (HT-XRD) was utilized for the mixture consisting of Li{sub 2}CO{sub 3} and Mn{sub 2}O{sub 3} as starting material in the temperature range of 25-700 deg. C. In-situ HT-XRD analysis directly revealed that crystallization process of Li{sub 1+x}Mn{sub 2-x}O{sub 4} was significantly affected by the difference in the Li/Mn molar ratio in the precursor. Single phase of stoichiometric LiMn{sub 2}O{sub 4} formed at 700 deg. C. The formation of single phase of spinel was achieved at the lower temperature than the stoichiometric sample as Li/Mn molar ratio in the precursor increased. Lattice parameter of the stoichiometric LiMn{sub 2}O{sub 4} at 25 deg. C was 8.24 A and expanded to 8.31 A at 700 deg. C, which corresponds to the approximately 3% expansion in the unit cell volume. From the slope of the lattice parameter change as a function of temperatures, linear thermal expansion coefficient of the stoichiometric LiMn{sub 2}O{sub 4} was calculated to be 1.2x10{sup -5} deg. C{sup -1} in this temperature range. When the Li/Mn molar ratio in Li{sub 1+x}Mn{sub 2-x}O{sub 4} increased (x > 0.1), the spinel phase segregated into the Li{sub 1+y}Mn{sub 2-y}O{sub 4} (x > y) and Li{sub 2}MnO{sub 3} during heating, which involved the oxygen loss from the materials. During the cooling process from 700 deg. C, and the segregated phase merged into Li{sub 1+x}Mn{sub 2-x}O{sub 4} with oxygen incorporation. Such trend directly observed by in-situ HT-XRD was supported by thermal gravimetric analysis as reversible weight (oxygen) loss/gain at higher temperature (500-700 deg. C). - Graphical abstract: Non-linear variation of lattice parameters of the Li excess LiMn{sub 2}O{sub 4} spinels was observed during cooling process from 700 to 25 deg. C.

Komaba, Shinichi, E-mail: komaba@rs.kagu.tus.ac.j [Department of Applied Chemistry, Tokyo University of Science, 1-3 Kagurazaka, Shinjuku, Tokyo 162-8601 (Japan); Yabuuchi, Naoaki; Ikemoto, Sachi [Department of Applied Chemistry, Tokyo University of Science, 1-3 Kagurazaka, Shinjuku, Tokyo 162-8601 (Japan)



Center for X-Ray Optics, 1992  

SciTech Connect

This report discusses the following topics: Center for X-Ray Optics; Soft X-Ray Imaging wit Zone Plate Lenses; Biological X-Ray microscopy; Extreme Ultraviolet Lithography for Nanoelectronic Pattern Transfer; Multilayer Reflective Optics; EUV/Soft X-ray Reflectometer; Photoemission Microscopy with Reflective Optics; Spectroscopy with Soft X-Rays; Hard X-Ray Microprobe; Coronary Angiography; and Atomic Scattering Factors.

Not Available



Mirrors for X-ray telescopes: Fresnel diffraction-based computation of Point Spread Functions from metrology  

E-Print Network (OSTI)

The imaging sharpness of an X-ray telescope is chiefly determined by the optical quality of its focusing optics, which in turn mostly depends on the shape accuracy and the surface finishing of the grazing incidence X-ray mirrors that compose the optical modules. In order to ensure the imaging performance during the mirror manufacturing, a fundamental step is represented by the prediction of the mirror Point Spread Function (PSF) from the metrology of its surface. Traditionally, the PSF computation in X-rays is assumed to be different depending on whether the surface defects are classified as figure errors or roughness [...] The aim of this work is to overcome this limit, providing analytical formulae, valid at any light wavelength, to compute the PSF of an X-ray mirror shell from the measured longitudinal profiles and the roughness Power Spectral Density (PSD), without distinguishing spectral ranges with different treatments. The method we adopted is based on the Huygens-Fresnel principle to compute the diffr...

Raimondi, Lorenzo



Methods development for diffraction and spectroscopy studies of metalloenzymes at X-ray free-electron lasers  

Science Journals Connector (OSTI)

...Coherent Light Source, taking...Coherent Light Source (LCLS...radiation energy by the X-ray...developed by us to process...large sample consumption is not sustainable...Coherent Light Source (LCLS...operated for the US Department of Energy Office of...



Combined Neutron and Synchrotron X-ray Diffraction Investigation of the BaCe0.85-xZrxY0.15O3-? (0.1 ? x ? 0.4) Proton Conductors  

Science Journals Connector (OSTI)

Combined Neutron and Synchrotron X-ray Diffraction Investigation of the BaCe0.85-xZrxY0.15O3-? (0.1 ? x ? 0.4) Proton Conductors ... § Laboratory for Neutron Scattering, ETHZ and PSI, CH-5232, Villigen PSI, Switzerland ... Combined neutron and X-ray synchrotron diffraction have been used to unveil the structural properties for the BaCe0.85-xZrxY0.15O3-? ...

Lorenzo Malavasi; Cristina Tealdi; Clemens Ritter; Vladimir Pomjakushin; Fabia Gozzo; Yuri Diaz-Fernandez



X-ray Line Profile Analysis of Nanoparticles in Proton Exchange Membrane Fuel Cell Electrodes  

Science Journals Connector (OSTI)

We present a method to extract X-ray diffraction patterns from a multiphase system and analyze the particle size distribution of each phase. The method is demonstrated for crystalline nanoparticles in the electrodes of proton exchange membrane fuel cells (...

Matthias Loster; Davor Balzar; K. Andreas Friedrich; Jürgen Garche



Relationship between dislocations and residual stresses in cold-drawn pearlitic steel analyzed by energy-dispersive X-ray diffraction  

SciTech Connect

We analyzed the dislocation distribution of cold-drawn pearlitic-steel wire by using the line-profile analysis based on the energy dispersive X-ray diffraction (EDXD). Although this line-profile analysis requires a high resolution in reciprocal space, the resolution for EDXD is generally poor due to the energy resolution of the detector. Our analysis demonstrated that the resolution in the reciprocal space can be maximized at small scattering angles. Using the line-profile analysis based on the EDXD, the microstructural parameters such as the crystallite size and the dislocation density of the ferrite phase in the pearlitic steel were successfully analyzed. In addition, the distribution of the residual stress of the ferrite phase of a pearlitic steel wire was also analyzed using the EDXD measurement. - Highlights: • Energy dispersive X-ray diffraction is applied to the line-profile analysis. • Distribution of dislocations in ferrite in the pearlitic steel wire is analyzed. • Relationship between dislocations and residual stress is discussed.

Sato, Shigeo, E-mail: s.sato@imr.tohoku.ac.jp [Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan); Wagatsuma, Kazuaki [Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan); Suzuki, Shigeru [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Kumagai, Masayoshi; Imafuku, Muneyuki [Faculty of Engineering, Tokyo City University, Tokyo 158-8557 (Japan); Tashiro, Hitoshi [Gyoda 361-0011 (Japan); Kajiwara, Kentaro [Japan Synchrotron Radiation Research Institute, Sayo 679-5198 (Japan); Shobu, Takahiasa [Japan Atomic Energy Agency, Sayo 679-5184 (Japan)



In situ apparatus for the study of clathrate hydrates relevant to solar system bodies using synchrotron X-ray diffraction and Raman spectroscopy  

E-Print Network (OSTI)

Clathrate hydrates are believed to play a significant role in various solar system environments, e.g. comets, and the surfaces and interiors of icy satellites, however the structural factors governing their formation and dissociation are poorly understood. We demonstrate the use of a high pressure gas cell, combined with variable temperature cooling and time-resolved data collection, to the in situ study of clathrate hydrates under conditions relevant to solar system environments. Clathrates formed and processed within the cell are monitored in situ using synchrotron X-ray powder diffraction and Raman spectroscopy. X-ray diffraction allows the formation of clathrate hydrates to be observed as CO2 gas is applied to ice formed within the cell. Complete conversion is obtained by annealing at temperatures just below the ice melting point. A subsequent rise in the quantity of clathrate is observed as the cell is thermally cycled. Four regions between 100-5000cm-1 are present in the Raman spectra that carry feature...

Day, Sarah J; Evans, Aneurin; Parker, Julia E



Characterization of room temperature recrystallization kinetics in electroplated copper thin films with concurrent x-ray diffraction and electrical resistivity measurements  

SciTech Connect

Concurrent in-situ four-point probe resistivity and high resolution synchrotron x-ray diffraction measurements were used to characterize room temperature recrystallization in electroplated Cu thin films. The x-ray data were used to obtain the variation with time of the integrated intensities and the peak-breadth from the Cu 111 and 200 reflections of the transforming grains. The variation of the integrated intensity and resistivity data with time was analyzed using the Johnson-Mehl-Avrami-Kolmogorov (JMAK) model. For both 111-textured and non-textured electroplated Cu films, four-point probe resistivity measurements yielded shorter transformation times than the values obtained from the integrated intensities of the corresponding Cu 111 reflections. In addition, the JMAK exponents fitted to the resistivity data were significantly smaller. These discrepancies could be explained by considering the different material volumes from which resistivity and diffraction signals originated, and the physical processes which linked these signals to the changes in the evolving microstructure. Based on these issues, calibration of the resistivity analysis with direct structural characterization techniques is recommended.

Treger, Mikhail; Noyan, I. C. [Department of Applied Physics and Applied Mathematics, Columbia University, New York 10027 (United States)] [Department of Applied Physics and Applied Mathematics, Columbia University, New York 10027 (United States); Witt, Christian [GlobalFoundries, T.J. Watson Research Center, Yorktown Heights, New York 10598 (United States)] [GlobalFoundries, T.J. Watson Research Center, Yorktown Heights, New York 10598 (United States); Cabral, Cyril; Murray, Conal; Jordan-Sweet, Jean [IBM, T.J. Watson Research Center, Yorktown Heights, New York 10598 (United States)] [IBM, T.J. Watson Research Center, Yorktown Heights, New York 10598 (United States); Rosenberg, Robert [State University of New York, the University at Albany, Albany, NY 12203 (United States)] [State University of New York, the University at Albany, Albany, NY 12203 (United States); Eisenbraun, Eric [College of Nanoscale Science and Engineering, University at Albany, Albany, NY 12203 (United States)] [College of Nanoscale Science and Engineering, University at Albany, Albany, NY 12203 (United States)



Crystallization and preliminary X-ray diffraction analysis of the catalytic subunit of ADP-glucose pyrophosphorylase from potato tuber  

Science Journals Connector (OSTI)

The catalytic subunit of potato ADP-glucose pyrophosphorylase has been crystallized with one crystal form diffracting to 2.8 Å belonging to a space group P2. Another crystal form obtained in the presence of the substrate analog Cr-ATP, belongs to space group and diffracted to 2.2 Å.

Binderup, K.



Sharper Focusing of Hard X-rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Sharper Focusing of Hard X-rays FROM: Physics News Update Number 773 #1, April 12, 2006, by Phil Schewe and Ben Stein Note: This text has been slightly modified from the original. Sharper focusing of hard x-rays has been achieved with a device developed at Argonne National Lab. Because of their high energy, x-rays are hard to focus: they can be reflected from a surface but only at a glancing angle (less than a tenth of a degree); they can be refracted but the index of refraction is very close to 1, so that making efficient lenses becomes a problem; and they can be diffracted, but the relatively thick, variable pitch grating required for focusing is tricky to achieve. The Argonne device is of the diffraction type, and it consists of a stack of alternating layers of metal and silicon, made by depositing progressively thicker layers. When the x-rays fall on such a structure, nearly edge-on, what they see is a grating (called a linear zone plate) consisting of a sort of bar-code pattern.


Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album  

Science Journals Connector (OSTI)

A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution.

Ohtsuki, T.



Crystal Structure and Hydrogen-Bonding System in Cellulose I? from Synchrotron X-ray and Neutron Fiber Diffraction  

Science Journals Connector (OSTI)

The crystal and molecular structure together with the hydrogen-bonding system in cellulose I? has been determined using synchrotron and neutron diffraction data recorded from oriented fibrous samples prepared by aligning cellulose microcrystals from ...?

Yoshiharu Nishiyama; Paul Langan; Henri Chanzy



X-ray diffraction study of (TlInSe{sub 2}){sub 1-x}(TlGaTe{sub 2}){sub x} crystal system  

SciTech Connect

The crystallographic and dynamic characteristics of TlInSe{sub 2} and TlGaTe{sub 2} crystals have been studied by X-ray diffraction in the temperature range of 85-320 K. The temperature dependences of the unit-cell parameters a of TlInSe{sub 2} and TlGaTe{sub 2} crystals, as well as their coefficients of thermal expansion along the [100] direction, are determined. The concentration dependences of the unit-cell parameters a and c for (TlInSe{sub 2}){sub 1-x}(TlGaTe{sub 2}){sub x} crystals are measured. Anomalies are found in the temperature dependences of the unit-cell parameters a and, correspondingly, the coefficient of thermal expansion, indicating the existence of phase transitions in TlInSe{sub 2} and TlGaTe{sub 2} crystals.

Sheleg, A. U., E-mail: sheleg@ifttp.bas-net.by; Zub, E. M.; Yachkovskii, A. Ya. [National Academy of Sciences of Belarus, State Scientific and Production Association, Scientific and Practical Materials Research Center (Belarus); Mustafaeva, S. N.; Kerimova, E. M. [Azerbaijan National Academy of Sciences, Institute of Physics (Azerbaijan)



Calcium binding in. alpha. -amylases: An X-ray diffraction study at 2. 1- angstrom resolution of two enzymes from Aspergillus  

SciTech Connect

X-ray diffraction analysis (at 2.1-{angstrom} resolution) of an acid alpha-amylase from Aspergillus niger allowed a detailed description of the stereochemistry of the calcium-binding sites. The primary site (which is essential in maintaining proper folding around the active site) contains a tightly bound Ca{sup 2+} with an unusually high number of eight ligands. A secondary binding site was identified at the bottom of the substrate binding cleft; it involves the residues presumed to play a catalytic role (Asp206 and Glu230). This explains the inhibitory effect of calcium observed at higher concentrations. Neutral Aspergillus oryzae (TAKA) {alpha}-amylase was also refined in a new crystal at 2.1-{angstrom} resolution. The structure of this homologous (over 80%) enzyme and addition kinetic studies support all the structural conclusions regarding both calcium-binding sites.

Boel, E.; Jensen, V.J.; Petersen, S.B.; Thim, L. Woldike, H.F. (NOVO-Nordisk Industri AS, Bagsvaerd (Denmark)); Brady, L.; Brzozowski, AM.; Derewenda, Z.; Dodson, G.G.; Swift, H. (Univ. of York (England))


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Agglomeration and sintering in annealed FePt nanoparticle assemblies studied by small angle neutron scattering and x-ray diffraction  

Science Journals Connector (OSTI)

In this work we give a detailed account of complementary small angle neutron scattering and x-ray diffraction studies of polymer mediated, self-assembled FePt nanoparticle arrays as a function of annealing temperature. The combination of these two techniques provides significantly greater physical insight than is available using either individually. Since both methods integrate over a large number of particles statistically meaningful data can be obtained in contrast to imaging techniques where typically only small areas are analyzed. The data show that the median particle size increases with annealing at temperatures of 580°C and above. The data also demonstrate that the distribution of particle diameters is significant and increases with annealing temperature. These results allow a comprehensive structural model of the annealed assemblies to be developed in terms of particle sintering and agglomeration. This enhanced understanding will allow new strategies to be pursued in realizing the potential of nanoparticle assemblies as a monodispersed data storage medium.

T. Thomson; S. L. Lee; M. F. Toney; C. D. Dewhurst; F. Y. Ogrin; C. J. Oates; S. Sun



In-situ x-ray diffraction study of the growth of highly strained epitaxial BaTiO{sub 3} thin films  

SciTech Connect

In-situ synchrotron x-ray diffraction was performed during the growth of BaTiO{sub 3} thin films on SrTiO{sub 3} substrates using both off-axis RF magnetron sputtering and pulsed laser deposition techniques. It was found that the films were ferroelectric during the growth process, and the presence or absence of a bottom SrRuO{sub 3} electrode played an important role in the growth of the films. Pulsed laser deposited films on SrRuO{sub 3} displayed an anomalously high tetragonality and unit volume, which may be connected to the previously predicted negative pressure phase of BaTiO{sub 3}.

Sinsheimer, J.; Callori, S. J.; Ziegler, B.; Bein, B.; Dawber, M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, New York 11794-3800 (United States)] [Department of Physics and Astronomy, Stony Brook University, Stony Brook, New York 11794-3800 (United States); Chinta, P. V.; Ashrafi, A.; Headrick, R. L. [Department of Physics, Cook Physical Science Building, University of Vermont, Burlington, Vermont 05405 (United States)] [Department of Physics, Cook Physical Science Building, University of Vermont, Burlington, Vermont 05405 (United States)



High-Temperature Phase Transitions in CsH2PO4 Under Ambient and High-Pressure Conditions: A Synchrotron X-ray Diffraction Study  

SciTech Connect

To clarify the microscopic origin of the temperature-induced three-order-of-magnitude jump in the proton conductivity of CsH2PO4 (superprotonic behavior), we have investigated its crystal structure modifications within the 25-300 C temperature range under both ambient- and high-pressure conditions using synchrotron x-ray diffraction. Our high-pressure data show no indication of the thermal decomposition/polymerization at the crystal surface recently proposed as the origin of the enhanced proton conductivity. Instead, we found direct evidence that the superprotonic behavior of the title material is associated with a polymorphic structural transition to a high-temperature cubic phase. Our results are in excellent agreement with previous high-pressure ac impedance measurements.

Botez,C.; Hermosillo, J.; Zhang, J.; Qian, J.; Zhao, Y.; Majzlan, J.; Chianelli, R.; Pantea, C.



Crystal Structures of the Trifluoromethyl Sulfonates M(SO3CF3)2 (M = Mg, Ca, Ba, Zn, Cu) from Synchrotron X-ray Powder Diffraction Data  

SciTech Connect

The crystal structures of divalent metal salts of trifluoromethyl sulfonic acid ('trifluoromethyl sulfonates') M(SO{sub 3}CF{sub 3}){sub 2} (M = Mg, Ca, Ba, Zn, Cu) were determined from high-resolution X-ray powder diffraction data. Magnesium, calcium and zinc trifluoromethyl sulfonate crystallize in the rhombohedral space group R{bar 3}. Barium trifluoromethyl sulfonate crystallizes in the monoclinic space group I2/a(C2/c) and copper trifluoromethyl sulfonate crystallizes in the triclinic group P{bar 1}. Within the crystal structures the trifluoromethyl sulfonate anions are arranged in double layers with the apolar CF{sub 3} groups pointing towards each other. The cations are located next to the SO{sub 3} groups. The symmetry relations between the different crystal structures have been analyzed.

Dinnebier,R.; Sofina, N.; Hildebrandt, L.; Jansen, M.



X-ray diffraction study on pressure-induced phase transformations and the equation of state of ZnGa{sub 2}Te{sub 4}  

SciTech Connect

We report on high-pressure x-ray diffraction measurements up to 19.8?GPa in zinc digallium telluride (ZnGa{sub 2}Te{sub 4}) at room temperature. An irreversible structural phase transition takes place at pressures above 12.1?GPa and upon decompression a third polymorph of ZnGa{sub 2}Te{sub 4} was recovered as a metastable phase at pressures below 2.9?GPa. Rietveld refinements were carried out for the three detected polymorphs, being their possible crystal structures reported. The axial compressibilities for the low-pressure phase of ZnGa{sub 2}Te{sub 4} have been determined as well as the equation of state of the low- and high-pressure phases. The reported results are compared with those available in the literature for related compounds. Pressure-induced coordination changes and transition mechanisms are also discussed.

Errandonea, D., E-mail: daniel.errandonea@uv.es [Departamento de Física Aplicada-ICMUV, MALTA Consolider Team, Universidad de Valencia, Edificio de Investigación, C/Dr. Moliner 50, Burjassot, 46100 Valencia (Spain); Kumar, R. S. [High Pressure Science and Engineering Center, Department of Physics and Astronomy, University of Nevada Las Vegas, 4505 Maryland Parkway, Las Vegas, Nevada 89154-4002 (United States); Gomis, O. [Centro de Tecnologías Físicas: Acústica, Materiales y Astrofísica, MALTA Consolider Team, Universitat Politècnica de València, 46022 València (Spain); Manjón, F. J. [Instituto de Diseño para la Fabricación y Producción Automatizada, MALTA Consolider Team, Universitat Politècnica de València, 46022 València (Spain); Ursaki, V. V.; Tiginyanu, I. M. [Institute of Applied Physics, Academy of Sciences of Moldova, 2028 Chisinau (Moldova, Republic of)



Phase transitions in heated Sr{sub 2}MgTeO{sub 6} double perovskite oxide probed by X-ray diffraction and Raman spectroscopy  

SciTech Connect

Double-perovskite oxide Sr{sub 2}MgTeO{sub 6} has been synthetized, and its crystal structure was probed by the technique of X-ray diffraction at room temperature. The structure is monoclinic, space group I2/m. Temperature-induced phase transitions in this compound were investigated by Raman spectroscopy up to 550?°C. Two low-wavenumber modes corresponding to external lattice vibrations merge at temperature of around 100?°C, indicating a phase transition from the monoclinic (I2/m) to the tetragonal (I4/m) structure. At 300?°C, changes in the slopes of temperature dependencies of external and O–Te–O bending modes are detected and interpreted as a second phase transition from the tetragonal (I4/m) to the cubic (Fm-3m) structure.

Manoun, Bouchaib, E-mail: manounb@gmail.com; Tamraoui, Y. [Equipe Ingénierie et environnement, Laboratoire de Chimie Appliquée et Environnement, Université Hassan 1er, Settat 26000 (Morocco)] [Equipe Ingénierie et environnement, Laboratoire de Chimie Appliquée et Environnement, Université Hassan 1er, Settat 26000 (Morocco); Lazor, P. [Department of Earth Sciences, Uppsala University, SE-752 36 Uppsala (Sweden)] [Department of Earth Sciences, Uppsala University, SE-752 36 Uppsala (Sweden); Yang, Wenge [High Pressure Synergetic Consortium, Geophysical Laboratory, Carnegie Institution of Washington, Argonne, Illinois 60439, USA and Center for High Pressure Science and Technology Advanced Research (HPSTAR), Shanghai 201203 (China)] [High Pressure Synergetic Consortium, Geophysical Laboratory, Carnegie Institution of Washington, Argonne, Illinois 60439, USA and Center for High Pressure Science and Technology Advanced Research (HPSTAR), Shanghai 201203 (China)



LJournal of Alloys and Compounds 291 (1999) 94101 The simultaneous powder X-ray and neutron diffraction refinement of two  

E-Print Network (OSTI)

melting of metals in the The intermetallic ternary transition metal nitrides and presence of carbon]. These phases are of interest decomposition of transition metal tris­ethylenediamine to the solid state chemist diffraction refinement of two h-carbide type nitrides, Fe Mo N and Co Mo N, prepared by3 3 3 3 ammonolysis

zur Loye, Hans-Conrad


X-ray Image Bank Open for Business - NERSC Center News, Feb 22, 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

X-ray Image Bank Open X-ray Image Bank Open for Business X-ray Image Bank Open for Business February 22, 2011 Filipe Maia is building a data bank where scientists from around the world can deposit and share images generated by coherent x-ray light sources. A post-doctoral researcher with the National Energy Research Scientific Computing Center (NERSC), Maia hopes the Coherent X-ray Imaging Data Bank, or CXIDB (http://www.cxidb.org) can help researchers make the most of their valuable data. Scientists use light sources to shoot intense x-ray beams into molecules, such as proteins, in order to understand their shapes and structures. The resulting diffraction patterns are painstakingly reconstructed to deduce an image. "It kind of works like a microscope, but it has no lens," Maia says.


Development of heavy mineral and heavy element database of soil sediments in Japan using synchrotron radiation X-ray powder diffraction and high-energy (116 keV) X-ray fluorescence analysis: 1. Case study of Kofu and Chiba region  

Science Journals Connector (OSTI)

We have started the construction of a nationwide forensic soil sediment database for Japan based on the heavy mineral and trace heavy element compositions of stream sediments collected at 3024 points all over Japan obtained by high-resolution synchrotron X-ray powder diffraction (SR-XRD) and high-energy synchrotron X-ray fluorescence analysis (HE-SR-XRF). In this study, the performance of both techniques was demonstrated by analyzing soil sediments from two different geological regions, the Kofu and Chiba regions in Kanto province, to construct database that can be applied in the future to provenance analysis of soil evidence from a crime scene. The sediments from the quaternary volcanic lithology of the Chiba region were found to be dominated by heavy minerals of volcanic origin – orthopyroxene, clinopyroxene, and amphibole, and the \\{REEs\\} (rare earth elements) within the region showed similar geochemical behavior. On the other hand, four distinct heavy mineral groups were identified in the sediments of the Kofu region, where there is a great variety of underlying bedrock, and the geochemical behavior of the \\{REEs\\} in the sediments also varied accordingly to their geological origins. As such, our study shows that high-resolution SR-XRD data can provide information on the spatial distribution patterns of heavy minerals in stream sediments, playing an important role in determining their likely geographical origin. Meanwhile, the highly sensitive HE-SR-XRF data allow us to study the geochemical behavior of trace heavy elements, especially the \\{REEs\\} in the sediments, providing additional support to further constrain the likely geographical origin of the sediments determined by heavy minerals.

Willy Shun Kai Bong; Izumi Nakai; Shunsuke Furuya; Hiroko Suzuki; Yoshinari Abe; Keiichi Osaka; Takuya Matsumoto; Masayoshi Itou; Noboru Imai; Toshio Ninomiya



X-ray photoemission spectromicroscopy of titanium silicide formation in patterned microstructures  

SciTech Connect

Titanium silicide has the lowest resistivity of all the refractory metal silicides and has good thermal stability as well as excellent compatibility with Al metallization. It is used as an intermediate buffer layer between W vias and the Si substrate to provide good electrical contact in ULSI technology, whose submicron patterned features form the basis of the integrated circuits of today and tomorrow, in the self aligned silicide (salicide) formation process. TiSi{sub 2} exists in two phases: a metastable C49 base-centered orthorhombic phase with specific resistivity of 60-90 {mu}{Omega}-cm that is formed at a lower temperature (formation anneal) and the stable 12-15 {mu}{Omega}-cm resistivity face-centered orthorhombic C54 phase into which C49 is transformed with a higher temperature (conversion anneal) step. C54 is clearly the target for low resistivity VLSI interconnects. However, it has been observed that when dimensions shrink below 1/mic (or when the Ti thickness drops below several hundred angstroms), the transformation of C49 into C54 is inhibited and agglomeration often occurs in fine lines at high temperatures. This results in a rise in resistivity due to incomplete transformation to C54 and because of discontinuities in the interconnect line resulting from agglomeration. Spectromicroscopy is an appropriate tool to study the evolution of the TiSi2 formation process because of its high resolution chemical imaging ability which can detect bonding changes even in the absence of changes in the relative amounts of species and because of the capability of studying thick {open_quotes}as is{close_quotes} industrial samples.

Singh, S.; Solak, H.; Cerrina, F. [Univ. of Wisconsin-Madison, Stoughton, WI (United States)] [and others



Crystallization and preliminary X-ray crystallographic study of disproportionating enzyme from potato  

Science Journals Connector (OSTI)

Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction.

Imamura, K.



Evaluation of X-ray Diffraction of Bit Cuttings as a Proxy for Core Data in Determining Bulk Mineralogy and Clay Species, Bakken Formation, Williston Basin.  

E-Print Network (OSTI)

??The principal question addressed in this study concerns the applicability of x-ray diffractometry to determine bulk rock mineralogy and clay species in the absence of… (more)

Barnes, Stuart Lee



X-ray Imaging Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

Imaging and Spectro-microscopy: Imaging and Spectro-microscopy: the Present and the Future Stanford Synchrotron Radiation Laboratory October 8-9, 2002 Organizers: John Miao & Keith Hodgson A workshop on "X-ray Imaging and Spectro-microscopy: the Present and the Future" was held on October 8-9, 2002. This workshop, organized by John Miao (SSRL) and Keith Hodgson (SSRL) provided a forum to discuss the scientific applications of a variety of imaging and spectro-microscopic techniques, including photoemission electron microscopy (PEEM), angle resolved photoemission spectroscopy (ARPES), coherent diffraction imaging, x-ray microscopy, micro-tomography, holographic imaging, and x-ray micro-probe. Twelve invited speakers discussed the important scientific applications of these techniques, and also predicted the future scientific directions with the advance of instrumentation and x-ray sources. The workshop was well attended with over fifty registered attendees.


Hydration and complex formation study on concentrated MCl2 solutions [M=Co(II), Ni(II), Cu(II)] by x?ray diffraction technique  

Science Journals Connector (OSTI)

Concentrated aqueous chloride solutions containing equal amounts of transition metal ions of almost equal ionic radii (Co2+ Ni2+ and Cu2+) have been examined by the x?ray diffraction technique. CoCl2 and Nicl2solutions show distribution curves very similar to each other which leads to the conclusion that the same dominant species should occur in both systems. The analysis of the structure functions can be achieved by considering M(H2O)2+ 6 (M=Co2+ Ni2+) as the dominant species although indication is given in favor of the presence of about 50% of the M(H2O)5Cl+ complex [and the rest M(H2O)2+ 6] in both solutions. The distribution curve of CuCl2solution is markedly different from those of cobalt and nickel. Equatorial positions in the distorted octahedral copper coordination are on the average occupied by about 2.8 water molecules (at 1.95 Å) and about 1.2 chloride ions (at 2.25 Å). Occupancy of the axial copper positions is discussed though no unique conclusion can be obtained with respect to this point from the scattering data.

Mauro Magini



In-situ x-ray diffraction studies of host-guest properties in nanoporous zinc-triazolate-based framework materials.  

SciTech Connect

Two nanoporous metal-organic framework materials incorporating the exotridentate bridging ligand 3-amino-1,2,4-triazolate (AmTAZ) have been synthesized through variation of secondary bridging anions: [Zn{sub 3}(AmTAZ){sub 3}S](NO{sub 3}) {center_dot} (H{sub 2}O) (1 {center_dot} (H{sub 2}O)) and Zn{sub 7}(AmTAZ){sub 8}(CO{sub 3}){sub 2}(OH){sub 2} {center_dot} 2(EtOH) (2 {center_dot} 2(EtOH); EtOH = ethanol). 1 {center_dot} (H{sub 2}O) crystallizes in the cubic space group I23 and is constructed from triangular Zn{sub 3}S units that are bridged through AmTAZ ligands into a cationic three-dimensional (3D) network with nitrate and water molecules residing in the cavities. 2 {center_dot} 2(EtOH) crystallizes in the monoclinic space group C2/c and shows a complex 3D network constructed from seven crystallographically unique zinc centers bridged by AmTAZ, carbonate, and hydroxide anions. The porous nature of both materials has been explored by thermogravimetric analysis, nitrogen sorption, and in situ synchrotron-based powder X-ray diffraction.

Halder, G. J.; Park, H.; Funk, R. J.; Chapman, K. W.; Engerer, L. K.; Geiser, U.; Schlueter, J. A.



Metal-like heat conduction in laser-excited InSb probed by picosecond time-resolved x-ray diffraction  

Science Journals Connector (OSTI)

A semiconductor (InSb) showed transient metal-like heat conduction after excitation of a dense electron-hole plasma via short and intense light pulses. A related ultrafast strain relaxation was detected using picosecond time-resolved x-ray diffraction. The deduced heat conduction was, by a factor of 30, larger than the lattice contribution. The anomalously high heat conduction can be explained once the contribution from the degenerate photocarrier plasma is taken into account. The magnitude of the effect could provide the means for guiding heat in semiconductor nanostructures. In the course of this work, a quantitative model for the carrier dynamics in laser-irradiated semiconductors has been developed, which does not rely on any adjustable parameters or ad hoc assumptions. The model includes various light absorption processes (interband, free carrier, two photon, and dynamical Burstein-Moss shifts), ambipolar diffusion, energy transport (heat and chemical potential), electrothermal effects, Auger recombination, collisional excitation, and scattering (elastic and inelastic). The model accounts for arbitrary degrees of degeneracy.

P. Sondhauss, O. Synnergren, T. N. Hansen, S. E. Canton, H. Enquist, A. Srivastava, and J. Larsson



Growth sequence and interface formation in the Fe/MgO/Fe(001) tunnel junction analyzed by surface x-ray diffraction  

SciTech Connect

We present a surface x-ray diffraction study of the interface geometric structure in the Fe/MgO/Fe(001) magnetic tunnel junction (MTJ). While the lower MgO/Fe(001) interface is characterized by a substoichiometric FeO{sub x} (x=0.6{+-}0.1) layer in agreement with previous studies, growth of Fe on the MgO spacer and the upper Fe/MgO interface structure strongly depends on the preparation method. If 0.4 monolayers of Fe are initially deposited in ambient oxygen atmosphere (p=10{sup -7} mbar) followed by Fe deposition under ultrahigh-vacuum (UHV) conditions, structural coherence across the trilayer junction is observed. In this case, substoichiometric FeO{sub x} layers are present at both Fe/MgO interfaces corresponding to a symmetric MTJ structure. In contrast, lattice registry is not preserved if Fe deposition is carried out solely under UHV conditions. Our results might have important implications for the preparation of magnetic tunnel junctions optimized to achieve giant tunneling-magnetoresistance amplitudes.

Tusche, C.; Meyerheim, H. L.; Kirschner, J. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Germany); Jedrecy, N. [Institut des NanoSciences de Paris, Universites Paris 6 et 7 et CNRS-UMR 7588, 4 place Jussieu, F-75252 Paris Cedex 05 (France); Renaud, G. [CEA-Grenoble, 17 rue des Martyrs, F-38054 Grenoble (France)



Class H Oil Well Cement Hydration at Elevated Temperatures in the Presence of Retarding Agents: An In Situ High-Energy X-ray Diffraction Study  

SciTech Connect

In situ powder X-ray diffraction was used to examine the hydration of API Class H cement slurries, with a water-to-cement ratio of 0.394, at 66, 93, 121, and 177 C under autogenous pressure in the presence of varying amounts of the additives tartaric acid, modified lignosulfonate, and AMPS (2-acrylamido-2-methylpropanesulfonic acid) copolymer. All of these retarding agents inhibited the hydration of crystalline C{sub 3}S (Ca{sub 3}SiO{sub 5}), but other modes of action were also apparent. The formation of ettringite was suppressed when tartaric acid was used by itself or in combination with other additives. Changes in the hydration of C{sub 3}S vs time could not be correlated in a simple way with the observed pumping times for the cement slurries. The largest changes in pumping time as a function of temperature occurred in a temperature interval where ettringite/monosulfate decomposes and crystalline hydrogarnet starts to be formed.

Jupe, Andrew C.; Wilkinson, Angus P.; Luke, Karen; Funkhouser, Gary P. (Halliburton); (GIT)



High energy X-ray diffraction study of a dental ceramics–titanium functional gradient material prepared by field assisted sintering technique  

Science Journals Connector (OSTI)

Abstract A functional gradient material with eleven layers composed of a dental ceramics and titanium was successfully consolidated using field assisted sintering technique in a two-step sintering process. High energy X-ray diffraction studies on the gradient were performed at High Energy Material Science beamline at Desy in Hamburg. Phase composition, crystal unit edges and lattice mismatch along the gradient were determined applying Rietveld refinement procedure. Phase analysis revealed that the main crystalline phase present in the gradient is ?-Ti. Crystallinity increases stepwisely along the gradient with a decreasing increment between every next layer, following rather the weight fraction of titanium. The crystal unit edge a of titanium remains approximately constant with a value of 2.9686(1) Å, while c is reduced with increasing amount of titanium. In the layer with pure titanium the crystal unit edge c is constant with a value of 4.7174(2) Å. The lattice mismatch leading to an internal stress was calculated over the whole gradient. It was found that the maximal internal stress in titanium embedded in the studied gradient is significantly smaller than its yield strength, which implies that the structure of titanium along the whole gradient is mechanically stable.

K. Witte; W. Bodnar; N. Schell; H. Lang; E. Burkel



Maximum Entropy Method and Charge Flipping, a Powerful Combination to Visualize the True Nature of Structural Disorder from in situ X-ray Powder Diffraction Data  

SciTech Connect

In a systematic approach, the ability of the Maximum Entropy Method (MEM) to reconstruct the most probable electron density of highly disordered crystal structures from X-ray powder diffraction data was evaluated. As a case study, the ambient temperature crystal structures of disordered {alpha}-Rb{sub 2}[C{sub 2}O{sub 4}] and {alpha}-Rb{sub 2}[CO{sub 3}] and ordered {delta}-K{sub 2}[C{sub 2}O{sub 4}] were investigated in detail with the aim of revealing the 'true' nature of the apparent disorder. Different combinations of F (based on phased structure factors) and G constraints (based on structure-factor amplitudes) from different sources were applied in MEM calculations. In particular, a new combination of the MEM with the recently developed charge-flipping algorithm with histogram matching for powder diffraction data (pCF) was successfully introduced to avoid the inevitable bias of the phases of the structure-factor amplitudes by the Rietveld model. Completely ab initio electron-density distributions have been obtained with the MEM applied to a combination of structure-factor amplitudes from Le Bail fits with phases derived from pCF. All features of the crystal structures, in particular the disorder of the oxalate and carbonate anions, and the displacements of the cations, are clearly obtained. This approach bears the potential of a fast method of electron-density determination, even for highly disordered materials. All the MEM maps obtained in this work were compared with the MEM map derived from the best Rietveld refined model. In general, the phased observed structure factors obtained from Rietveld refinement (applying F and G constraints) were found to give the closest description of the experimental data and thus lead to the most accurate image of the actual disorder.

Samy, A.; Dinnebier, R; van Smaalen, S; Jansen, M


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tokamak x ray diagnostic instrumentation  

SciTech Connect

Three classes of x-ray diagnostic instruments enable measurement of a variety of tokamak physics parameters from different features of the x-ray emission spectrum. (1) The soft x-ray (1 to 50 keV) pulse-height-analysis (PHA) diagnostic measures impurity concentrations from characteristic line intensities and the continuum enhancement, and measures the electron temperature from the continuum slope. (2) The Bragg x-ray crystal spectrometer (XCS) measures the ion temperature and neutral-beam-induced toroidal rotation velocity from the Doppler broadening and wavelength shift, respectively, of spectral lines of medium-Z impurity ions. Impurity charge state distributions, precise wavelengths, and inner-shell excitation and recombination rates can also be studied. X rays are diffracted and focused by a bent crystal onto a position-sensitive detector. The spectral resolving power E/..delta..E is greater than 10/sup 4/ and time resolution is 10 ms. (3) The x-ray imaging system (XIS) measures the spatial structure of rapid fluctuations (0.1 to 100 kHZ) providing information on MHD phenomena, impurity transport rates, toroidal rotation velocity, plasma position, and the electron temperature profile. It uses an array of silicon surface-barrier diodes which view different chords of the plasma through a common slot aperture and operate in current (as opposed to counting) mode. The effectiveness of shields to protect detectors from fusion-neutron radiation effects has been studied both theoretically and experimentally.

Hill, K.W.; Beiersdorfer, P.; Bitter, M.; Fredrickson, E.; Von Goeler, S.; Hsuan, H.; Johnson, L.C.; Liew, S.L.; McGuire, K.; Pare, V.



Reduction of a grid moire pattern by integrating a carbon-interspaced high precision x-ray grid with a digital radiographic detector  

SciTech Connect

The stationary grid commonly used with a digital x-ray detector causes a moire interference pattern due to the inadequate sampling of the grid shadows by the detector pixels. There are limitations with the previous methods used to remove the moire such as imperfect electromagnetic interference shielding and the loss of image information. A new method is proposed for removing the moire pattern by integrating a carbon-interspaced high precision x-ray grid with high grid line uniformity with the detector for frequency matching. The grid was aligned to the detector by translating and rotating the x-ray grid with respect to the detector using microcontrolled alignment mechanism. The gap between the grid and the detector surface was adjusted with micrometer precision to precisely match the projected grid line pitch to the detector pixel pitch. Considering the magnification of the grid shadows on the detector plane, the grids were manufactured such that the grid line frequency was slightly higher than the detector sampling frequency. This study examined the factors that affect the moire pattern, particularly the line frequency and displacement. The frequency of the moire pattern was found to be sensitive to the angular displacement of the grid with respect to the detector while the horizontal translation alters the phase but not the moire frequency. The frequency of the moire pattern also decreased with decreasing difference in frequency between the grid and the detector, and a moire-free image was produced after complete matching for a given source to detector distance. The image quality factors including the contrast, signal-to-noise ratio and uniformity in the images with and without the moire pattern were investigated.

Yoon, Jai-Woong; Park, Young-Guk; Park, Chun-Joo; Kim, Do-Il; Lee, Jin-Ho; Chung, Nag-Kun; Choe, Bo-Young; Suh, Tae-Suk; Lee, Hyoung-Koo [Department of Biomedical Engineering, College of Medicine, The Catholic University of Korea, Seoul 137-701 (Korea, Republic of); Jungwon Precision Ind. Co., Ltd, 425-833, Ansan (Korea, Republic of); Department of Biomedical Engineering, College of Medicine, The Catholic University of Korea, Seoul 137-701 (Korea, Republic of); Jungwon Precision Ind. Co., Ltd, 425-833, Ansan (Korea, Republic of); Department of Biomedical Engineering, College of Medicine, The Catholic University of Korea, Seoul 137-701 (Korea, Republic of)



X-ray and neutron diffraction study of the defect crystal structure of the as-grown nonstoichiometric phase Y{sub 0.715}Ca{sub 0.285}F{sub 2.715}  

SciTech Connect

This work begins a series of papers aimed at studying the defect structure of nonstoichiometric phases R{sub 1-y}Ca{sub y}F{sub 3-y} with a tysonite-type (LaF{sub 3}) structure. In the single-crystal structure of Y{sub 0.715}Ca{sub 0.285}F{sub 2.715} with a tysonite-type small unit cell (sp. gr. P6{sub 3}/mmc, a = 3.9095(2) A, c = 6.9829(2) A; Z = 2; R{sub w} = 2.16%), the displacements of Y{sup 3+} cations and F{sup 2-} anions from 6{sub 3} symmetry axes were observed for the first time. The X-ray diffraction pattern shows weak satellites insufficient for structural calculations. The LaF{sub 3} structure type is stabilized up and down on the temperature scale due to anion vacancies and the symmetrizing effect of Ca{sup 2+} cations lying on 6{sub 3} symmetry axes. At 120 Degree-Sign C the fluoride-ion conductivity in the nonstoichiometric phase Y{sub 0.715}Ca{sub 0.285}F{sub 2.715} is five orders of magnitude higher than that in the stoichiometric phase {beta}-YF{sub 3}. The transition to a superionic state is caused by a deviation from stoichiometry and is not associated with reconstructive phase transformation.

Bolotina, N. B., E-mail: bolotina@ns.crys.ras.ru; Kalyukanov, A. I.; Chernaya, T. S.; Verin, I. A.; Buchinskaya, I. I.; Sorokin, N. I.; Sobolev, B. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)



Single mimivirus particles intercepted and imaged with an X-ray laser (CXIDB ID 1)  

DOE Data Explorer (OSTI)

These are the files used to reconstruct the images in the paper "Single Mimivirus particles intercepted and imaged with an X-ray laser". Besides the diffracted intensities, the Hawk configuration files used for the reconstructions are also provided. The files from CXIDB ID 1 are the pattern and configuration files for the pattern showed in Figure 2a in the paper.

Seibert, M. Marvin; Ekeberg, Tomas; Maia, Filipe R.N.C.


Single mimivirus particles intercepted and imaged with an X-ray laser (CXIDB ID 2)  

DOE Data Explorer (OSTI)

These are the files used to reconstruct the images in the paper "Single Mimivirus particles intercepted and imaged with an X-ray laser". Besides the diffracted intensities, the Hawk configuration files used for the reconstructions are also provided. The files from CXIDB ID 2 are the pattern and configuration files for the pattern showed in Figure 2b in the paper.

Seibert, M. Marvin; Ekeberg, Tomas


Structural characterization of the CeO{sub 2}/Gd{sub 2}O{sub 3} mixed system by synchrotron X-ray diffraction  

SciTech Connect

The structural determination of the CeO{sub 2}/Gd{sub 2}O{sub 3} mixed system is a non-trivial problem because of the close resemblance between the ionic sizes of Ce{sup 4+} and Gd{sup 3+} and between the crystal structures of CeO{sub 2} and Gd{sub 2}O{sub 3}. (Ce{sub 1-x}Gd{sub x})O{sub 2-x/2} powder samples with x ranging between 0 and 1 have been synthesized by coprecipitation of mixed oxalates and subsequent thermal decomposition in air at 1200 Degree-Sign C followed by slow cooling. Synchrotron powder X-ray diffraction data were collected and refined by the Rietveld method. Lattice parameters do not follow Vegard's law and no peak splitting has been observed for any composition, meaning that no biphasic regions exist over the whole compositional range. The same hybrid structural model - a proper mixture of the structures of the two pure oxides - was used for the refinements, allowing to account for the data observed. - graphical abstract: Substituting Ce{sup 4+} by Gd{sup 3+}, a gradual transition from the F structure (typical of CeO{sub 2}) to the C structure (typical of Gd{sub 2}O{sub 3}) takes place. The lattice parameters do not follow Vegard's law. Highlights: Black-Right-Pointing-Pointer A structural study of Ce-Gd mixed oxides has been performed. Black-Right-Pointing-Pointer In (Ce{sub 1-x}Gd{sub x})O{sub 2-x/2} a solid solution forms for 0{<=}x{<=}0.3. Black-Right-Pointing-Pointer For x>0.3 a gradual transition from the C to the F structure is observed. Black-Right-Pointing-Pointer Lattice parameters do not follow Vegard's law.

Artini, Cristina, E-mail: c.artini@ge.ieni.cnr.it [Dipartimento di Chimica e Chimica Industriale, Universita degli Studi di Genova, Via Dodecaneso 31, 16146 Genova (Italy); Costa, Giorgio A., E-mail: costa@chimica.unige.it [Dipartimento di Chimica e Chimica Industriale, Universita degli Studi di Genova, Via Dodecaneso 31, 16146 Genova (Italy); CNR-SPIN Genova, Corso Perrone 24, 16152 Genova (Italy); Pani, Marcella, E-mail: marcella@chimica.unige.it [Dipartimento di Chimica e Chimica Industriale, Universita degli Studi di Genova, Via Dodecaneso 31, 16146 Genova (Italy); Lausi, Andrea, E-mail: andrea.lausi@elettra.trieste.it [Sincrotrone Trieste S.C.p.A., ss 14, km 163, 5, 34149 Basovizza, Trieste (Italy); Plaisier, Jasper, E-mail: jasper.plaisier@elettra.trieste.it [Sincrotrone Trieste S.C.p.A., ss 14, km 163, 5, 34149 Basovizza, Trieste (Italy)



Pressure-induced phase transition of Fe{sub 2}TiO{sub 4}: X-ray diffraction and Moessbauer spectroscopy  

SciTech Connect

X-ray diffraction and Moessbauer spectroscopy were employed to investigate structural stability of Fe{sub 2}TiO{sub 4} under high pressure. Measurements were performed up to about 24 GPa at room temperature using diamond anvil cell. Experimental results demonstrate that Fe{sub 2}TiO{sub 4} undergoes a series of phase transitions from cubic (Fd3-bar m) to tetragonal (I4{sub 1}/amd) at 8.7 GPa, and then to orthorhombic structure (Cmcm) at 16.0 GPa. The high-pressure phase (Cmcm) of Fe{sub 2}TiO{sub 4} is kept on decompression to ambient pressure. In all polymorphs of Fe{sub 2}TiO{sub 4}, iron cations present a high-spin ferrous property without electric charge exchange with titanium cations at high pressure supported by Moessbauer evidences. - Graphical abstract: A series of phase transition of Fe{sub 2}TiO{sub 4} occurs from cubic (a) to tetragonal (b and c) then to orthorhombic phase (d-f) at high pressure. Highlights: Black-Right-Pointing-Pointer High pressure behaviors of Fe{sub 2}TiO{sub 4} were investigated. Black-Right-Pointing-Pointer Phase transitions were observed from cubic to tetragonal and then to orthorhombic. Black-Right-Pointing-Pointer Orthorhombic phase can be kept on decompression. Black-Right-Pointing-Pointer In all polymorphs of Fe{sub 2}TiO{sub 4}, iron ions are ferrous with high-spin state.

Wu Ye [Key Laboratory of Orogenic Belts and Crustal Evolution, MOE, Peking University, Beijing 100871 (China); School of Earth and Space Sciences, Peking University, Beijing 100871 (China); Wu Xiang, E-mail: xiang.wu@pku.edu.cn [Key Laboratory of Orogenic Belts and Crustal Evolution, MOE, Peking University, Beijing 100871 (China); School of Earth and Space Sciences, Peking University, Beijing 100871 (China); Qin Shan [Key Laboratory of Orogenic Belts and Crustal Evolution, MOE, Peking University, Beijing 100871 (China); School of Earth and Space Sciences, Peking University, Beijing 100871 (China)



Brucite [Mg(OH2)] carbonation in wet supercritical CO2: An in situ high pressure X-ray diffraction study  

Science Journals Connector (OSTI)

Understanding mechanisms and kinetics of mineral carbonation reactions relevant to sequestering carbon dioxide as a supercritical fluid (scCO2) in geologic formations is crucial to accurately predicting long-term storage risks. Most attention so far has been focused on reactions occurring between silicate minerals and rocks in the aqueous dominated CO2-bearing fluid. However, water-bearing scCO2 also comprises a reactive fluid, and in this situation mineral carbonation mechanisms are poorly understood. Using in situ high-pressure X-ray diffraction, the carbonation of brucite [Mg(OH)2] in wet scCO2 was examined at pressure (82 bar) as a function of water concentration and temperature (50 and 75 °C). Exposing brucite to anhydrous scCO2 at either temperature resulted in little or no detectable reaction over three days. However, addition of trace amounts of water resulted in partial carbonation of brucite into nesquehonite [MgCO3·3H2O] within a few hours at 50 °C. By increasing water content to well above the saturation level of the scCO2, complete conversion of brucite into nesquehonite was observed. Tests conducted at 75 °C resulted in the conversion of brucite into magnesite [MgCO3] instead, apparently through an intermediate nesquehonite step. Raman spectroscopy applied to brucite reacted with 18O-labeled water in scCO2 show it was incorporated into carbonate at a relatively high concentration. This supports a carbonation mechanism with at least one step involving a direct reaction between the mineral and water molecules without mediation by a condensed aqueous layer.

H.T. Schaef; C.F. Windisch Jr.; B.P. McGrail; P.F. Martin; K.M. Rosso



X-ray Phase Contrast analysis - Digital wavefront development  

SciTech Connect

Optical schemes that enable imaging of the phase shift produced by an object have become popular in the x-ray region, where phase can be the dominant contrast mechanism. The propagation-based technique consists of recording the interference pattern produced by choosing one or several sample-to-detector distances. Pioneering studies, carried out making use of synchrotron radiation, demonstrated that this technique results in a dramatic increase of image contrast and detail visibility, allowing the detection of structures invisible with conventional techniques. An experimental and theoretical study of in-line hard x-ray phase-contrast imaging had been performed. The theoretical description of the technique is based on Fresnel diffraction. As an illustration of the potential of this quantitative imaging technique, high-resolution x-ray phase contrast images of simple objects will be presented.

Idir, Mourad [Metrology Beamline, Synchrotron SOLEIL, Gif-sur-Yvette (France); Potier, Jonathan [Phaseview, Palaiseau (France); Universite Paul Sabatier-Toulouse III, Metrology Beamline, Synchrotron SOLEIL, Gif-sur-Yvette (France); Fricker, Sebastien [Phaseview, Palaiseau (France); Snigirev, Anatoly; Snigireva, Irina [ESRF, Grenoble (France); Modi, M. H. [X-ray Optics Section, Raja Ramanna Centre for Advanced Technology, Indore (India)




SciTech Connect

X-ray crystallography is currently the primary methodology used to determine the 3D structure of materials and macromolecules. However, many nanostructures, disordered materials, biomaterials, hybrid materials and biological specimens are noncrystalline and, hence, their structures are not accessible by X-ray crystallography. Probing these structures therefore requires the employment of different approaches. A very promising technique currently under rapid development is X-ray diffraction microscopy (or lensless imaging), in which the coherent X-ray diffraction pattern of a noncrystalline specimen is measured and then directly phased to obtain a high-resolution image. Through the DOE support over the past three years, we have applied X-ray diffraction microscopy to quantitative imaging of GaN quantum dot particles, and revealed the internal GaN-Ga2O3 core shell structure in three dimensions. By exploiting the abrupt change in the scattering cross-section near electronic resonances, we carried out the first experimental demonstration of resonant X-ray diffraction microscopy for element specific imaging. We performed nondestructive and quantitative imaging of buried Bi structures inside a Si crystal by directly phasing coherent X-ray diffraction patterns acquired below and above the Bi M5 edge. We have also applied X-ray diffraction microscopy to nondestructive imaging of mineral crystals inside biological composite materials - intramuscular fish bone - at the nanometer scale resolution. We identified mineral crystals in collagen fibrils at different stages of mineralization and proposed a dynamic mechanism to account for the nucleation and growth of mineral crystals in the collagen matrix. In addition, we have also discovered a novel 3D imaging modality, denoted ankylography, which allows for complete 3D structure determination without the necessity of sample titling or scanning. We showed that when the diffraction pattern of a finite object is sampled at a sufficiently fine scale on the Ewald sphere, the 3D structure of the object is determined by the 2D spherical pattern. We confirmed the theoretical analysis by performing 3D numerical reconstructions of a sodium silicate glass structure at 2 Ã? resolution from a 2D spherical diffraction pattern alone. As X-ray free electron lasers are under rapid development worldwide, ankylography may open up a new horizon to obtain the 3D structure of a non-crystalline specimen from a single pulse and allow time-resolved 3D structure determination of disordered materials.

Jianwei Miao



Focused X-ray source  

DOE Patents (OSTI)

Disclosed is an intense, relatively inexpensive X-ray source (as compared to a synchrotron emitter) for technological, scientific, and spectroscopic purposes. A conical radiation pattern produced by a single foil or stack of foils is focused by optics to increase the intensity of the radiation at a distance from the conical radiator. 8 figs.

Piestrup, M.A.; Boyers, D.G.; Pincus, C.I.; Maccagno, P.



X-ray micro-diffraction studies on biological samples at the BioCAT Beamline 18-ID at the Advanced Photon Source  

Science Journals Connector (OSTI)

Advances in synchrotron beamlines bring opportunities with accompanying challenges for the study of soft condensed (biological) matter. This article describes improvements to the BioCAT beamline that include micro-focus, scanning and cryo-cooling of soft connective tissues yielding X-ray data from whole rat-tail tendons to better than 4 ?.

Barrea, R.A.



X-ray holography at Lawrence Livermore National Laboratory  

SciTech Connect

The x-ray holography program at the Lawrence Livermore National Laboratory has two principal goals: (1) the development of x-ray diffraction techniques for DNA sequence analysis and (2) the development of x-ray laser holography for structural analysis of intact biological cells and organelles. DNA sequence analysis will be accomplished by applying x-ray diffraction techniques to determine the ensemble average of the sequence of labels along the individual elements of crystalline DNA. X-ray laser holographic imaging will be accomplished by applying three dimensional x-ray holography to elucidate the structure of few hundred angstrom objects such as 300 {Angstrom} chromatin fibers, nuclear pores and nucleic acid replication complexes in living cells. Existing laboratory x-ray lasers will be utilized to produce flash x-ray holograms of the biological structures.

Trebes, J.; Annese, C.; Birdsall, D.; Brase, J.; Gray, J.; Lane, S.; London, R.; Matthews, D.; Peters, D.; Pinkel, D.; Stone, G.; Rapp, D.; Rosen, M.; Weier, U.; Yorkey, T.



E-Print Network 3.0 - alxga1-xas high-energy x-ray Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

All rights reserved. X-ray Diffraction Activity... Background Information The X-ray powder Diffractometer uses different ... Source: Cohen, Itai - Department of Physics, Cornell...


Structural consequences of hen egg-white lysozyme orthorhombic crystal growth in a high magnetic field: validation of X-ray diffraction intensity, conformational energy searching and quantitative analysis of B factors and mosaicity  

Science Journals Connector (OSTI)

It has been shown that a high magnetic field of 10 T improves the quality of lysozyme crystals as quantified by comparison of the X-ray diffraction of crystals grown in the presence and absence of a magnetic field of 10 T, from structure comparisons and from molecular-modelling studies with conformational energy searching, from analysis of the anisotropic B factors and finally from analysis of the mosaicity. It is concluded that magnetic enhancement in protein crystal perfection is an important material engineering tool in the study of protein structure and function.

Saijo, S.



Chest x-Rays  

Energy.gov (U.S. Department of Energy (DOE))

The B-reading is a special reading of a standard chest x-ray film performed by a physician certified by the National Institute for Occupational Safety and Health (NIOSH). The reading looks for changes on the chest x-ray that may indicate exposure and disease caused by agents such as asbestos or silica.


X-ray beamsplitter  

DOE Patents (OSTI)

An x-ray beamsplitter which splits an x-ray beam into two coherent parts by reflecting and transmitting some fraction of an incident beam has applications for x-ray interferometry, x-ray holography, x-ray beam manipulation, and x-ray laser cavity output couplers. The beamsplitter is formed of a wavelength selective multilayer thin film supported by a very thin x-ray transparent membrane. The beamsplitter resonantly transmits and reflects x-rays through thin film interference effects. A thin film is formed of 5--50 pairs of alternate Mo/Si layers with a period of 20--250 A. The support membrane is 10--200 nm of silicon nitride or boron nitride. The multilayer/support membrane structure is formed across a window in a substrate by first forming the structure on a solid substrate and then forming a window in the substrate to leave a free-standing structure over the window. 6 figs.

Ceglio, N.M.; Stearns, D.G.; Hawryluk, A.M.; Barbee, T.W. Jr.



X-ray beamsplitter  

DOE Patents (OSTI)

An x-ray beamsplitter which splits an x-ray beam into two coherent parts by reflecting and transmitting some fraction of an incident beam has applications for x-ray interferometry, x-ray holography, x-ray beam manipulation, and x-ray laser cavity output couplers. The beamsplitter is formed of a wavelength selective multilayer thin film supported by a very thin x-ray transparent membrane. The beamsplitter resonantly transmits and reflects x-rays through thin film interference effects. A thin film is formed of 5-50 pairs of alternate Mo/Si layers with a period of 20-250 A. The support membrane is 10-200 nm of silicon nitride or boron nitride. The multilayer/support membrane structure is formed across a window in a substrate by first forming the structure on a solid substrate and then forming a window in the substrate to leave a free-standing structure over the window.

Ceglio, Natale M. (Livermore, CA); Stearns, Daniel S. (Mountain View, CA); Hawryluk, Andrew M. (Modesto, CA); Barbee, Jr., Troy W. (Palo Alto, CA)



X-ray binaries  

E-Print Network (OSTI)

We review the nuclear astrophysics aspects of accreting neutron stars in X-ray binaries. We summarize open astrophysical questions in light of recent observations and their relation to the underlying nuclear physics. Recent progress in the understanding of the nuclear physics, especially of X-ray bursts, is also discussed.

H. Schatz; K. E. Rehm



X-ray Microscopy and Imaging: 2-BM  

NLE Websites -- All DOE Office Websites (Extended Search)

BM BM Introduction The 2-BM beamline offers measurement capabilities for x-ray microtomography, x-ray topography and x-ray microdiffraction. X-ray microtomography and x-ray diffraction instruments are installed on separate optical tables for independent operation with fast switch over time. Optically-coupled high-resolution CCD system is used for microtomography and topography with up to 1 micron spatial resolution. X-ray microdiffraction setup consists of KB microfocussing mirrors (~3 micron minimum spot), four-circle Huber diffractometer, high-precision translation sample stage, two orthogonally-mounted video cameras for viewing sample, fluorescence detector (Si-drift diode) and diffraction detector (a scintillation detector or a CCD). Three different levels of monochromaticity are available. Conventional monochromatic x-rays from a double-bounced Si (111) crystal monochromator (DCM, D E/E=1E-4), wide band-pass monochromatic x-rays from a double multilayer monochromator (DMM, D E/E=1~4E-2) and pink beam. The available x-ray range is from 5 keV to 30 keV. The lower limit is due to the x-ray windows and the upper limit is due to the critical angle of the x-ray mirror. Two different coatings (Cr and Pt) for the x-ray mirror allow either 20 keV or 30 keV energy cutoff.

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Introduction to Neutron and X-Ray Scattering  

NLE Websites -- All DOE Office Websites (Extended Search)

Scattering Studies of Thin Scattering Studies of Thin Polymer Films Introduction to Neutron and X-Ray Scattering Sunil K. Sinha UCSD/LANL Acknowledgements: Prof. R.Pynn( Indiana U.) Prof. M.Tolan (U. Dortmund) Wilhelm Conrad Röntgen 1845-1923 1895: Discovery of X-Rays 1901 W. C. Röntgen in Physics for the discovery of x-rays. 1914 M. von Laue in Physics for x-ray diffraction from crystals. 1915 W. H. Bragg and W. L. Bragg in Physics for crystal structure determination. 1917 C. G. Barkla in Physics for characteristic radiation of elements. 1924 K. M. G. Siegbahn in Physics for x-ray spectroscopy. 1927 A. H. Compton in Physics for scattering of x-rays by electrons. 1936 P. Debye in Chemistry for diffraction of x-rays and electrons in gases.


X-ray laser  

DOE Patents (OSTI)

An X-ray laser (10) that lases between the K edges of carbon and oxygen, i.e. between 44 and 23 Angstroms, is provided. The laser comprises a silicon (12) and dysprosium (14) foil combination (16) that is driven by two beams (18, 20) of intense line focused (22, 24) optical laser radiation. Ground state nickel-like dysprosium ions (34) are resonantly photo-pumped to their upper X-ray laser state by line emission from hydrogen-like silicon ions (32). The novel X-ray laser should prove especially useful for the microscopy of biological specimens.

Nilsen, Joseph (Livermore, CA)



Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless X-Ray Imaging in Lensless X-Ray Imaging in Reflection Lensless X-Ray Imaging in Reflection Print Wednesday, 26 October 2011 00:00 The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities in the field of lensless imaging. XFELs combine the advantages of sychrotron light sources (high brightness and x-ray wavelengths relevant to atomic and molecular phenomena) with the advantages of visible-light lasers (highly coherent beams). All of these characteristics are important for coherent x-ray diffraction imaging-lensless imaging techniques that are proving to be integral to single-shot, high-resolution imaging of both complex materials and biological samples. Existing techniques are typically designed for transmission geometry, however, and use isolated objects, requiring special sample fabrication and restricting the type of samples under investigation. Recently, researchers from the ALS and the University of Oregon have shown at ALS Beamline 12.0.2 that it is possible to form x-ray holograms in reflection geometry by using the light scattered from a sample, opening the door to lensless imaging of a wealth of new material samples.


X-ray absorption anisotropy for polychromatic illumination--Crystal views from inside  

E-Print Network (OSTI)

X-ray absorption anisotropy for polychromatic illumination--Crystal views from inside P. Korecki a Keywords: X-ray absorption Real-space imaging X-ray holography Electron channeling Electron backscatter of the fine structure in X-ray absorption anisotropy, which results from incident beam diffraction

Korecki, Pawe³


X-ray absorption spectroscopy  

E-Print Network (OSTI)

009-9473-8 REVIEW X-ray absorption spectroscopy Junko Yano Æand application of X-ray absorption spectroscopy, bothX-ray absorption near-edge structure (XANES) and extended X-

Yano, Junko; Yachandra, Vittal K.



X-ray Absorption Spectroscopy  

E-Print Network (OSTI)

type: Review X-ray Absorption Spectroscopy Junko Yano andPhotosystem II; XAS, X-ray absorption spectroscopy; EXAFS,X-ray absorption fine structure; EPR, electron paramagnetic

Yano, Junko



Phase recovery for x-ray crystallography  

Science Journals Connector (OSTI)

For many years people have believed that in conventional x-ray crystallography one can only record the diffraction intensities but not the phases. In order to obtain the atomic arrangements, one usually has to guess a structure and then fit the intensity data by refining its parameters. Here, we show that the phases are in fact hidden in the intensity data, and can be directly recovered from the peak profiles. This method is demonstrated by the normal two-beam x-ray diffraction of a noncentrosymmetric crystal, and nontrivial phases are recovered from the intensity data alone.

G. Xu, G. E. Zhou, and X. Y. Zhang



X-Ray Generators  

Science Journals Connector (OSTI)

There are many types of X-ray generators sold commercially. The following are some of ... that should be considered when selecting a particular generator for a particular purpose. All the companies listed below s...

Reuben Rudman



In situ X-ray diffraction strain-controlled study of Ti–Nb–Zr and Ti–Nb–Ta shape memory alloys: crystal lattice and transformation features  

SciTech Connect

Phase and structure transformations in biomedical Ti–21.8Nb–6.0Zr (TNZ) and Ti–19.7Nb–5.8Ta (TNT) shape memory alloys (at.%) under and without load in the ? 150 to 100 °S temperature range are studied in situ using an original tensile module for a low-temperature chamber of an X-ray diffractometer. Alpha?- and beta-phase lattice parameters, the crystallographic resource of recovery strain, phase and structure transformation sequences, and microstress appearance and disappearance are examined, compared and discussed. For both alloys, the crystallographic resource of recovery strain decreases with temperature increase to become 4.5% for TNZ and 2.5% for TNT alloy (at RT). Loading at low temperatures leads to additional ??-phase formation and reorientation. Heating under load, as compared to strain-free heating, affects the reverse transformation sequence of both alloys in different ways. For TNZ alloy, strain-free heating results in simultaneous ??? and ???? transformations, whereas during heating under stress, they are sequential: ? + ???? precedes ????. For TNT alloy, strain-free heating results in reverse ???? transformation, whereas during heating under stress, ???? transformation is preceded by ??-phase reorientation. - Highlights: • Comparative in situ XRD analysis of Ti–Nb–Zr(Ta) shape memory alloys is realized. • Lattice parameters of ?- and ??-phases are calculated in the ? 150 to + 100 °C range. • The higher the temperature, the lower the ???? transformation strain. • Loading at low temperatures results in ??-phase formation and reorientation. • Transformation sequences upon heating with and without loading are different.

Dubinskiy, S. [École de technologie supérieure, 1100, Notre-Dame Street West, Montreal, Quebec H3C 1K3 (Canada); National University of Science and Technology “MISIS”, 4, Leninskiy prosp., Moscow 119049 (Russian Federation); Prokoshkin, S. [National University of Science and Technology “MISIS”, 4, Leninskiy prosp., Moscow 119049 (Russian Federation); Brailovski, V., E-mail: vladimir.brailovski@etsmtl.ca [École de technologie supérieure, 1100, Notre-Dame Street West, Montreal, Quebec H3C 1K3 (Canada); Inaekyan, K. [École de technologie supérieure, 1100, Notre-Dame Street West, Montreal, Quebec H3C 1K3 (Canada); Korotitskiy, A. [National University of Science and Technology “MISIS”, 4, Leninskiy prosp., Moscow 119049 (Russian Federation)



Measurement by x-ray diffraction methods of the layer compressional elastic constant B in the lyotropic smectic-A (L?) phase of the lecithin-water system  

Science Journals Connector (OSTI)

A high-resolution synchrotron x-ray study of oriented, supported, hydrated dilauryl phosphatidylcholine in the lyotropic L? (smectic-A or ‘‘fluid’’) phase shows that thermal fluctuations give rise to algebraic decay of positional order in stacking of the bimolecular lamellae, the so-called ‘‘Landau-Peierls’’ state. For planar monocrystalline samples of thickness 10–20 ?m, the exponents derived from intensity profiles are in accord with harmonic theory. When combined with previous measurements of the splay elastic constant K in this lyotropic system, the exponents indicate a bulk compressional elastic constant B=(1.9±1.0)×108 erg/cm3, consistent in magnitude with values measured in thermotropic liquid crystals. Samples of thickness ?1–2 ?m show anomalous behavior in the wings of the longitudinal intensity profiles, but are not in accord with harmonic theory, suggesting that surface effects partially quench the thermal fluctuations. Grandjean terraces on sample surfaces produce striking refractive effects at low Bragg angles.

Daniel C. Wack and Watt W. Webb



In-situ synchrotron energy-dispersive x-ray diffraction study of thin Pd foils with Pd:D and Pd:H concentrations up to 1:1  

SciTech Connect

Time resolved, in-situ, energy dispersive x-ray diffraction was performed in an electrolysis cell during electrochemical loading of palladium foil cathodes with hydrogen and deuterium. Concentrations of H:Pd (D:Pd) up to 1:1 in 0.1 M LiOH (LiOD) in H{sub 2}O (D{sub 2}O) electrolyte were obtained, as determined by both the Pd lattice parameter and cathode resistivity. In addition, some indications on the kinetics of loading and deloading of hydrogen from the Pd surface were obtained. The alpha-beta phase transformations were clearly delineated but no new phases at high concentration were determined.

Knies, D. L.; Grabowski, K. S.; Dominguez, D. D.; Qadri, S. B.; Hubler, G. K. [U.S. Naval Research Laboratory, Washington, DC 20375 (United States); Violante, V. [ENEA, Frascati (Italy); Hu, J. Z. [NSLS, Brookhaven National Laboratory, Brookhaven, New York 11973 (United States); He, J. H. [Nova Research, Alexandria, Virginia 22308 (United States)



Absence of Structural Impact of Noble Nanoparticles on P3HT: PCBM Blends for Plasmon Enhanced Bulk-Heterojunction Organic Solar Cells Probed by Synchrotron Grazing Incidence X-Ray Diffraction  

E-Print Network (OSTI)

The incorporation of noble metal nanoparticles, displaying localized surface plasmon resonance, in the active area of donor-acceptor bulk-heterojunction organic photovoltaic devices is an industrially compatible light trapping strategy, able to guarantee better absorption of the incident photons and give an efficiency improvement between 12% and 38%. In the present work, we investigate the effect of Au and Ag nanoparticles blended with P3HT: PCBM on the P3HT crystallization dynamics by synchrotron grazing incidence X-ray diffraction. We conclude that the presence of (1) 80nm Au, (2) mix of 5nm, 50nm, 80nm Au, (3) 40nm Ag, and (4) 10nm, 40nm, 60nm Ag colloidal nanoparticles, at different concentrations below 0.3 wt% in P3HT: PCBM blends, does not affect the behaviour of the blends themselves.

Samuele Lilliu; Mejd Alsari; Oier Bikondoa; J. Emyr Macdonald; Marcus S. Dahlem



X-ray Scattering Reveals Unusual Growth of Lead on Silicon  

NLE Websites -- All DOE Office Websites (Extended Search)

X-ray Scattering Reveals Unusual Growth of Lead on Silicon X-ray Scattering Reveals Unusual Growth of Lead on Silicon Most thin films grow on substrates in only three ways: layer by layer, formation of atomic islands, or layers followed by islands. The particular growth mode that a given material will follow crucially depends on the relative magnitudes of the surface energy of the film versus the interfacial energy of the film on the substrate. Recently, a team of researchers from the University of Illinois, Academica Sinica in Taiwan, Georgia Tech, and the City University of Hong Kong has discovered a remarkable anomaly. By means of real-time x-ray scattering measurements, the researchers found that lead films grown on silicon adopt a completely novel pattern of growth. X-ray diffraction images taken with a CCD camera during growth of Pb films on Si(111). The interference fringes yield information about island height and layer thickness. Fig. 1. X-ray diffraction images taken with a CCD camera during growth of Pb films on Si(111). The interference fringes yield information about island height and layer thickness.


Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Imaging in Reflection Print X-Ray Imaging in Reflection Print The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities in the field of lensless imaging. XFELs combine the advantages of sychrotron light sources (high brightness and x-ray wavelengths relevant to atomic and molecular phenomena) with the advantages of visible-light lasers (highly coherent beams). All of these characteristics are important for coherent x-ray diffraction imaging-lensless imaging techniques that are proving to be integral to single-shot, high-resolution imaging of both complex materials and biological samples. Existing techniques are typically designed for transmission geometry, however, and use isolated objects, requiring special sample fabrication and restricting the type of samples under investigation. Recently, researchers from the ALS and the University of Oregon have shown at ALS Beamline 12.0.2 that it is possible to form x-ray holograms in reflection geometry by using the light scattered from a sample, opening the door to lensless imaging of a wealth of new material samples.


Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Imaging in Reflection Print X-Ray Imaging in Reflection Print The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities in the field of lensless imaging. XFELs combine the advantages of sychrotron light sources (high brightness and x-ray wavelengths relevant to atomic and molecular phenomena) with the advantages of visible-light lasers (highly coherent beams). All of these characteristics are important for coherent x-ray diffraction imaging-lensless imaging techniques that are proving to be integral to single-shot, high-resolution imaging of both complex materials and biological samples. Existing techniques are typically designed for transmission geometry, however, and use isolated objects, requiring special sample fabrication and restricting the type of samples under investigation. Recently, researchers from the ALS and the University of Oregon have shown at ALS Beamline 12.0.2 that it is possible to form x-ray holograms in reflection geometry by using the light scattered from a sample, opening the door to lensless imaging of a wealth of new material samples.


Argonne CNM: X-Ray Microscopy Capabilities  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Microscopy Facilities X-Ray Microscopy Facilities The Hard X-Ray Nanoprobe (HXN) facility provides scanning fluorescence, scanning diffraction, and full-field transmission and tomographic imaging capabilities with a spatial resolution of 30 nm over a spectral range of 6-12 keV. Modes of Operation Full-Field Transmission Imaging and Nanotomography X-ray transmission imaging uses both the absorption and phase shift of the X-ray beam by the sample as contrast mechanisms. Absorption contrast is used to map the sample density. Elemental constituents can be located by using differential edge contrast in this mode. Phase contrast can be highly sensitive to edges and interfaces even when the X-ray absorption is weak. These contrast mechanisms are exploited to image samples rapidly in full-field transmission mode under various environmental conditions, or combined with nanotomography methods to study the three-dimensional structure of complex and amorphous nanomaterials with the HXN.


Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless X-Ray Imaging in Reflection Print Lensless X-Ray Imaging in Reflection Print The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities in the field of lensless imaging. XFELs combine the advantages of sychrotron light sources (high brightness and x-ray wavelengths relevant to atomic and molecular phenomena) with the advantages of visible-light lasers (highly coherent beams). All of these characteristics are important for coherent x-ray diffraction imaging-lensless imaging techniques that are proving to be integral to single-shot, high-resolution imaging of both complex materials and biological samples. Existing techniques are typically designed for transmission geometry, however, and use isolated objects, requiring special sample fabrication and restricting the type of samples under investigation. Recently, researchers from the ALS and the University of Oregon have shown at ALS Beamline 12.0.2 that it is possible to form x-ray holograms in reflection geometry by using the light scattered from a sample, opening the door to lensless imaging of a wealth of new material samples.


Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless X-Ray Imaging in Reflection Print Lensless X-Ray Imaging in Reflection Print The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities in the field of lensless imaging. XFELs combine the advantages of sychrotron light sources (high brightness and x-ray wavelengths relevant to atomic and molecular phenomena) with the advantages of visible-light lasers (highly coherent beams). All of these characteristics are important for coherent x-ray diffraction imaging-lensless imaging techniques that are proving to be integral to single-shot, high-resolution imaging of both complex materials and biological samples. Existing techniques are typically designed for transmission geometry, however, and use isolated objects, requiring special sample fabrication and restricting the type of samples under investigation. Recently, researchers from the ALS and the University of Oregon have shown at ALS Beamline 12.0.2 that it is possible to form x-ray holograms in reflection geometry by using the light scattered from a sample, opening the door to lensless imaging of a wealth of new material samples.


Anharmonicity and isomorphic phase transition: a multi-temperature X-ray single-crystal and powder diffraction study of 1-(2'-aminophenyl)-2-methyl-4-nitroimidazole  

Science Journals Connector (OSTI)

Multi-temperature single-crystal and powder diffraction experiments on 1-(2'-aminophenyl)-2-methyl-4-nitroimidazole show that this crystal undergoes an isomorphic phase transition with the coexistence of two phase domains over a wide temperature range. The anharmonic approach was the only way to model the resulting disorder.

Poulain, A.



Crystallization and preliminary X-ray diffraction studies of a terminal oxygenase of carbazole 1,9a-­dioxygenase from Novosphingobium sp. KA1  

Science Journals Connector (OSTI)

The terminal oxygenase component (Oxy) of carbazole 1,9a-dioxygenase (CARDO) catalyzes dihydroxylation of the aromatic ring. The Oxy of CARDO from Novosphingobium sp. KA1 was crystallized and the crystals diffracted to a resolution of 2.1 ?.

Umeda, T.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Crystallization and preliminary X-ray diffraction analysis of the Fab portion of the Alzheimer's disease immunotherapy candidate bapineuzumab complexed with amyloid-  

Science Journals Connector (OSTI)

In order to understand the molecular basis of action of the Alzheimer's disease passive immunotherapy candidate bapineuzumab, the Fab fragment of this antibody was crystallized in complexes with A peptides. The best crystals diffracted to a resolution of 2.0 ? (A residues 1-8) and 2.2 ? (A residues 1-28).

Crespi, G.A.N.



X-ray beam finder  

DOE Patents (OSTI)

An X-ray beam finder for locating a focal spot of an X-ray tube includes a mass of X-ray opaque material having first and second axially-aligned, parallel-opposed faces connected by a plurality of substantially identical parallel holes perpendicular to the faces and a film holder for holding X-ray sensitive film tightly against one face while the other face is placed in contact with the window of an X-ray head.

Gilbert, H.W.



X-ray Spectrometry  

Science Journals Connector (OSTI)

These provide excellent energy resolution for a wide range of X-ray energies, from the optical range up to several kiloelectronvolts. ... The Astro-E2 launched in 2005 was the first mission that contained a low-temperature microcalorimeter-based observatory, and three more low-temperature detector-based observatories are being developed (NeXT, Constellation-X, ZEUS). ...

Imre Szalóki; János Osán; René E. Van Grieken



X-ray imaging crystal spectrometer for extended X-ray sources  

DOE Patents (OSTI)

Spherically or toroidally curved, double focusing crystals are used in a spectrometer for X-ray diagnostics of an extended X-ray source such as a hot plasma produced in a tokomak fusion experiment to provide spatially and temporally resolved data on plasma parameters using the imaging properties for Bragg angles near 45. For a Bragg angle of 45.degree., the spherical crystal focuses a bundle of near parallel X-rays (the cross section of which is determined by the cross section of the crystal) from the plasma to a point on a detector, with parallel rays inclined to the main plain of diffraction focused to different points on the detector. Thus, it is possible to radially image the plasma X-ray emission in different wavelengths simultaneously with a single crystal.

Bitter, Manfred L. (Princeton, NJ); Fraenkel, Ben (Jerusalem, IL); Gorman, James L. (Bordentown, NJ); Hill, Kenneth W. (Lawrenceville, NJ); Roquemore, A. Lane (Cranbury, NJ); Stodiek, Wolfgang (Princeton, NJ); von Goeler, Schweickhard E. (Princeton, NJ)



Imaging single cells in a beam of live cyanobacteria with an X-ray laser  

DOE Data Explorer (OSTI)

This entry contains ten diffraction patterns, and reconstructions images, of individual living Cyanobium gracile cells, imaged using 517 eV X-rays from the LCLS XFEL. The Hawk software package was used for phasing. The Uppsala aerosol injector was used for sample injection, assuring very low noise levels. The cells come from various stages of the cell cycle, and were imaged in random orientations.

Schot, Gijs, vander


APS 7-BM Beamline: X-Ray Resources  

NLE Websites -- All DOE Office Websites (Extended Search)

Useful Websites Useful Websites X-Ray Interactions with Matter from CRXO at LBNL. Intuitive interface for x-ray transmission and reflectivity for a wide range of materials. X-Ray Data Booklet from LBNL. Slightly outdated in places, but many useful tables of edge energies, fluorescence lines, and crystal lattice spacings. NIST XCOM Database. Powerful database of photoelectric absorption, elastic scattering, and Compton scattering cross-sections for a wide range of materials. X-Ray Server. Maintained by Sergey Stepanov at GMCA at the APS, this website has several powerful calculators for simulating x-ray reflection and diffraction. Software X-Ray Oriented Programs (XOP). This program, written by scientists at the ESRF and APS, is widely used in the synchrotron research community.


Copyright The Discussion Group of X-Ray Analysis,  

E-Print Network (OSTI)

-2900. 3 In Situ Spatial and Time-Resolved Studies of Electrochemical Reactions by Scanning Transmission X the Signal-to-Noise Ratio of X-ray Diffraction Profiles by Smoothed Principal Component Analysis Zeng Ping

Jun, Kawai


Tunable X-ray source  

DOE Patents (OSTI)

A method for the production of X-ray bunches tunable in both time and energy level by generating multiple photon, X-ray, beams through the use of Thomson scattering. The method of the present invention simultaneously produces two X-ray pulses that are tunable in energy and/or time.

Boyce, James R. (Williamsburg, VA)



Synthesis and characterization of alkali-metal titanium alkoxide compounds MTi(O-i-Pr) sub 5 (M = Li, Na, K): Single-crystal x-ray diffraction structure of (LiTi(O-i-Pr) sub 5 ) sub 2  

SciTech Connect

The series (MTi(O-iPr){sub 5}), M = Li, Na, or K, has been prepared by the reaction of MO-i-Pr with Ti(O-i-Pr){sub 4}. A single-crystal x-ray diffraction study revealed that (LiTi(O-i-Pr){sub 5}) crystallizes from toluene at {minus}30{degree}C in the monoclinic space group P2{sub 1}/n, with unit cell dimensions a = 11.440 (8) {angstrom}, b = 16.396 (13) {angstrom}, c = 11.838 (8) {angstrom}, {beta} = 92.59 (5){degree}, and Z = 4, as a dimer containing two approximately trigonal-bipyramidal titanium centers linked by lithium bridges. In benzene solution, all three compounds are dimeric, as revealed by cryoscopic molecular weight determination, and all three undergo an alkoxide ligand exchange process that is rapid on the {sup 1}H NMR time scale at room temperature. The positions of {nu}(M-O) are assigned based on the low-energy shifts observed upon deuteriation of the isopropoxide ligands. 23 refs., 3 figs., 3 tabs.

Hampden-Smith, M.J.; Williams, D.S. (Univ. of New Mexico, Albuquerque (USA)); Rheingold, A.L. (Univ. of Delaware, Newark (USA))



Assessment of the optimum degree of Sr{sub 3}Fe{sub 2}MoO{sub 9} electron-doping through oxygen removal: An X-ray powder diffraction and {sup 57}Fe Moessbauer spectroscopy study  

SciTech Connect

We describe the preparation and structural characterization by X-ray powder diffraction (XRPD) and Moessbauer spectroscopy of three electron-doped perovskites Sr{sub 3}Fe{sub 2}MoO{sub 9-{delta}} with Fe/Mo = 2 obtained from Sr{sub 3}Fe{sub 2}MoO{sub 9}. The compounds were synthesized by topotactic reduction with H{sub 2}/N{sub 2} (5/95) at 600, 700 and 800 {sup o}C. Above 800 {sup o}C the Fe/Mo ratio changes from Fe/Mo = 2-1 < Fe/Mo < 2. The structural refinements of the XRPD data for the reduced perovskites were carried out by the Rietveld profile analysis method. The crystal structure of these phases is cubic, space group Fm3-bar m, with cationic disorder at the two different B sites that can be populated in variable proportions by the Fe atoms. The Moessbauer spectra allowed determining the evolution of the different species formed after the treatments at different temperatures and confirm that Fe ions in the samples reduced at 600, 700 and 800 {sup o}C are only in the high-spin Fe{sup 3+} electronic state.

Lopez, Carlos A.; Viola, Maria del C. [Area de Quimica General e Inorganica, Departamento de Quimica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, 5700 San Luis (Argentina)] [Area de Quimica General e Inorganica, Departamento de Quimica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, 5700 San Luis (Argentina); Pedregosa, Jose C., E-mail: jpedreg@unsl.edu.ar [Area de Quimica General e Inorganica, Departamento de Quimica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, 5700 San Luis (Argentina); Mercader, Roberto C., E-mail: mercader@fisica.unlp.edu.ar [Departamento de Fisica, IFLP-CONICET, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, C.C. 67, 1900 La Plata (Argentina)



In situ examination of oxygen non-stoichiometry in La{sub 0.80}Sr{sub 0.20}CoO{sub 3??} thin films at intermediate and low temperatures by x-ray diffraction  

SciTech Connect

Structural evolution of epitaxial La{sub 0.80}Sr{sub 0.20}CoO{sub 3??} thin films under chemical and voltage stimuli was examined in situ using X-ray diffraction. The changes in lattice parameter (chemical expansivity) were used to quantify oxygen reduction reaction processes and vacancy concentration changes in lanthanum strontium cobaltite. At 550?°C, the observed lattice parameter reduction at an applied bias of ?0.6?V was equivalent to that from the reducing condition of a 2% carbon monoxide atmosphere with an oxygen non-stoichiometry ? of 0.24. At lower temperatures (200?°C), the application of bias reduced the sample much more effectively than a carbon monoxide atmosphere and induced an oxygen non-stoichiometry ? of 0.47. Despite these large changes in oxygen concentration, the epitaxial thin film was completely re-oxidized and no signs of crystallinity loss or film amorphization were observed. This work demonstrates that the effects of oxygen evolution and reduction can be examined with applied bias at low temperatures, extending the ability to probe these processes with in-situ analytical techniques.

Biegalski, M. D.; Belianinov, A.; Kalinin, S. V. [Oak Ridge National Laboratory, Center for Nanophase Materials Science, Oak Ridge, Tennessee 37831 (United States); Crumlin, E.; Mutoro, E.; Shao-Horn, Y. [Electrochemical Energy Laboratory, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)



Element-specific structure of materials with intrinsic disorder by high-energy resonant x-ray diffraction and differential atomic pair-distribution functions: A study of PtPd nanosized catalysts  

Science Journals Connector (OSTI)

We demonstrate how high-energy resonant x-ray diffraction (XRD) and differential atomic-pair-distribution function (PDF) analysis can be used to characterize the atomic ordering in materials of limited structural coherence with both excellent spatial resolution and element specificity. First we prove that this experimental approach is feasible by probing the K-absorption edge of Au(?81?keV) atoms in chemically ordered and disordered bulk Cu3Au alloys. The resulting Au-differential PDFs show very clearly the different ways Au atoms are known to occupy the sites of otherwise identical cubic lattices of those materials. Next we apply it to a more complex material: PtPd alloy and core-shell nanosized (?2–4?nm) particles by probing the K-absorption edge of Pt(?78?keV). The resulting Pt-differential atomic PDFs reveal how exactly the atomic ordering of catalytically active Pt atoms is affected by the nanoparticles’ design, thus providing a firm structural basis for understanding their properties. The work is a step forward in expanding the limits of applicability of nontraditional XRD to the rapidly growing field of materials of unusual structural complexity.

V. Petkov and S. D. Shastri



X-Ray Conformational Study of the DNA Duplex in Solution  

E-Print Network (OSTI)

X-Ray Conformational Study of the DNA Duplex in Solution V. GRASSIAN* and G. W. BRADY,f Rensselaer Earlier x-ray studies on dissolved linear DNA molecules were interpreted on the assumption engaged in x-ray diffraction studies of circular su- perhelical DNA. Some of our preliminary results have

Benham, Craig J.


X-Ray Diamond Anvil Cell Facility at NSLS: 2010 Progress Report  

E-Print Network (OSTI)

X-Ray Diamond Anvil Cell Facility at NSLS: 2010 Progress Report Zhiqiang ChenZhiqiang Chen Stony) Powder X-ray Diffraction, Total Scattering Pair-Distributiony , g Function (PDF) under high P and high, yield strength, amorphization, texturing, compressibility Hydrothermal DAC (Bassett) Angle Dispersive X-ray

Duffy, Thomas S.


X-ray Spectrometry  

Science Journals Connector (OSTI)

The segmented STJ operated at total count rates of above 105 counts/s, and the best-achieved energy resolution of their single STJ was found to be 10 eV for X-ray energies below 1 keV. ... The Mo?Au TES, with an operating temperature of 230 mK, was developed for the Constellation-X mission and the energy resolution of the spectrometer is ?28 eV at 3.3 keV. ...

Imre Szalóki; Szabina B. Török; Jasna Injuk; René E. Van Grieken



Spectroscopic ellipsometric modeling of a Bi–Te–Se write layer of an optical data storage device as guided by atomic force microscopy, scanning electron microscopy, and X-ray diffraction  

Science Journals Connector (OSTI)

Abstract Conventional magnetic tape is the most widely used medium for archival data storage. However, data stored on it need to be migrated every ca. 5 years. Recently, optical discs that store information for hundreds, or even more than 1000 years, have been introduced to the market. We recently proposed that technology in these optical discs be used to make an optical tape that would show greater permanence than its magnetic counterpart. Here we provide a detailed optical characterization of a sputtered thin film of bismuth, tellurium, and selenium (BTS) that is a proposed data storage layer for these devices. The methodology described herein should be useful in the future development of related materials. Spectroscopic ellipsometry (SE) data are obtained using interference enhancement, and the modeling of this data is guided by results from atomic force microscopy (AFM), scanning electron microscopy (SEM), X-ray diffraction (XRD), and X-ray reflectivity (XRR). By AFM, ca. 40 nm BTS films show ca. 10 nm roughness. SEM images also suggest considerable roughness in the films and indicate that they are composed of 13.1 ± 5.9 nm grains. XRD confirms that the films are crystalline and predicts a grain size of 17 ± 2 nm. XRD results are consistent with the composition of the films — a mildly oxidized BTS material. Three models of increasing complexity are investigated to explain the SE data. The first model consists of a smooth, homogeneous BTS film. The second model adds a roughness layer to the previous model. The third model also has two layers. The bottom layer is modeled as a mixture of BTS and void using a Bruggeman effective medium approximation. The upper layer is similarly modeled, but with a gradient. The first model was unable to adequately model the SE data. The second model was an improvement — lower MSE (4.4) and good agreement with step height measurements. The third model was even better — very low MSE (2.6) and good agreement with AFM results. The third SE model predicted ca. 90% void at the film surface. XRR modeling of the film agreed well with the predictions from SE. The uniquenesses of the SE models were confirmed.

Hao Wang; Nitesh Madaan; Jacob Bagley; Anubhav Diwan; Yiqun Liu; Robert C. Davis; Barry M. Lunt; Stacey J. Smith; Matthew R. Linford



X-ray lithography using holographic images  

DOE Patents (OSTI)

Methods for forming X-ray images having 0.25 {micro}m minimum line widths on X-ray sensitive material are presented. A holographic image of a desired circuit pattern is projected onto a wafer or other image-receiving substrate to allow recording of the desired image in photoresist material. In one embodiment, the method uses on-axis transmission and provides a high flux X-ray source having modest monochromaticity and coherence requirements. A layer of light-sensitive photoresist material on a wafer with a selected surface is provided to receive the image(s). The hologram has variable optical thickness and variable associated optical phase angle and amplitude attenuation for transmission of the X-rays. A second embodiment uses off-axis holography. The wafer receives the holographic image by grazing incidence reflection from a hologram printed on a flat metal or other highly reflecting surface or substrate. In this second embodiment, an X-ray beam with a high degree of monochromaticity and spatial coherence is required. 15 figs.

Howells, M.S.; Jacobsen, C.



X-ray lithography using holographic images  

DOE Patents (OSTI)

Methods for forming X-ray images having 0.25 .mu.m minimum line widths on X-ray sensitive material are presented. A holgraphic image of a desired circuit pattern is projected onto a wafer or other image-receiving substrate to allow recording of the desired image in photoresist material. In one embodiment, the method uses on-axis transmission and provides a high flux X-ray source having modest monochromaticity and coherence requirements. A layer of light-sensitive photoresist material on a wafer with a selected surface is provided to receive the image(s). The hologram has variable optical thickness and variable associated optical phase angle and amplitude attenuation for transmission of the X-rays. A second embodiment uses off-axis holography. The wafer receives the holographic image by grazing incidence reflection from a hologram printed on a flat metal or other highly reflecting surface or substrate. In this second embodiment, an X-ray beam with a high degree of monochromaticity and spatial coherence is required.

Howells, Malcolm S. (Berkeley, CA); Jacobsen, Chris (Sound Beach, NY)



Frq2 from Drosophila melanogaster: cloning, expression, purification, crystallization and preliminary X-ray analysis  

Science Journals Connector (OSTI)

The calcium-binding protein Frq2 from D. melanogaster has been crystallized and X-ray diffraction data from two different crystal forms have been collected.

Ba?os-Mateos, S.



Synchrotron X-Ray Microdiffraction Studies of Electromigration in Interconnect lines at the Advanced Light Source  

E-Print Network (OSTI)

in Confined Metal Lines”, Journal of Applied Physics, 73 (in passivated metal lines”, Applied Physics Letters, 81 (aluminum interconnect lines with X-ray micro- diffraction”,

Tamura, Nobumichi


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Synchrotron X-Ray Microdiffraction Studies of Electromigration in Interconnect lines at the Advanced Light Source  

E-Print Network (OSTI)

in Confined Metal Lines”, Journal of Applied Physics, 73 (in passivated metal lines”, Applied Physics Letters, 81 (aluminum interconnect lines with X-ray micro- diffraction”,

Tamura, Nobumichi




E-Print Network (OSTI)

Supplemental information I. OPTICAL-LASER AND X-RAY CONFIGURATION The experiment used 70 fs x-ray and x-ray pulses was established by the initial decrease in the 111 diffraction peak in a laser pulses at 10 keV from the LCLS in the high-charge (250 pC) mode at 120 Hz. The x-ray beam was focused

Loss, Daniel


X-rays only when you want them: Report on Pseudo-single-bunch...  

NLE Websites -- All DOE Office Websites (Extended Search)

Room 108A Speaker: David Robin, Lawrence Berkeley National Laboratory Program Description Laser pump - x-ray probe experiments require control over the x-ray pulse pattern and...


Special Application X-ray Diffraction | EMSL  

NLE Websites -- All DOE Office Websites (Extended Search)

on Catalytic Processing of Biomass-Derived Feedstocks . Trace components in biomass feedstocks are potential catalyst poisons when catalytically processing these materials to...


X-ray Absorption Spectroscopy  

SciTech Connect

This review gives a brief description of the theory and application of X-ray absorption spectroscopy, both X-ray absorption near edge structure (XANES) and extended X-ray absorption fine structure (EXAFS), especially, pertaining to photosynthesis. The advantages and limitations of the methods are discussed. Recent advances in extended EXAFS and polarized EXAFS using oriented membranes and single crystals are explained. Developments in theory in understanding the XANES spectra are described. The application of X-ray absorption spectroscopy to the study of the Mn4Ca cluster in Photosystem II is presented.

Yano, Junko; Yachandra, Vittal K.



X-ray fluorescence mapping  

NLE Websites -- All DOE Office Websites (Extended Search)

biololgical cells, over the measurement of impurities in solar cells, to the rare earth content of geological materials. A somewhat 'typical' layout for a X-ray fluorescence...


Fresnel and refractive lenses for X-rays  

Science Journals Connector (OSTI)

We present a Gaussian beam analysis of X-ray refractive and Fresnel lenses. The X-ray refractive lens is featured by an intrinsic soft (Gaussian) aperture due to strong absorption of X-rays by materials. We defined a parameter N0, the critical Fresnel number (CFN), to describe this optical property. The values of N0 for all practical materials are below 1000 for photon energies exceeding 30 eV, still lower for high-Z materials. The maximum effective Fresnel number of a lens is determined by its material to be 2N0 and its maximum enhancement of X-ray intensity is limited to (2?N0)2, independent of its shape. We found that the refractive lens is likely to be useful for manipulating nearly diffraction limited beam in the hard X-ray region and its application is severely restricted by available fabrication capabilities today. X-ray Fresnel lenses, both in cylindrical and linear forms, are proposed as superior focusing elements for hard X-rays. Their high efficiency, up to 100% in optimal construction, will enable us to manipulate beams with multiple lenses and obtain higher performance optics. Their design and fabrication are discussed in reference to those of X-ray Fresnel zone plates and micro Fresnel lenses for optoelectronics.

B.X. Yang



Ris-M-2751 X-Ray Energy Dispersive  

E-Print Network (OSTI)

(PHOT) k«V 50 Risø National Laboratory, DK-4000 Roskilde, Denmark October 1988 #12;Ris*-M-2751 X-ray energy is impinging on the sample (Fig. lb). Its wavelength (photon energy) is in the course of measurements changedm ii. S Risø-M-2751 X-Ray Energy Dispersive Diffraction Lecture Notes Bronislaw Buras BaKo 30 40 E


X-ray studies of the phases and phase transitions of liquid crystals  

Science Journals Connector (OSTI)

Recent X-ray diffraction studies of liquid crystals are reviewed. The topics are twist grain-boundary phases, antiferroelectric phases studied using resonant diffraction and smectic phases within gel structures.

Clegg, P.S.



Real-space calculation of powder diffraction patterns on graphics processing units  

Science Journals Connector (OSTI)

This paper shows how the power of graphics processing units can be exploited to compute the powder diffraction pattern of nano-sized objects.

Gelisio, L.



Structural stability of Fe[subscript 5]Si[subscript 3] and Ni[subscript 2]Si studied by high-pressure x-ray diffraction and ab initio total-energy calculations  

SciTech Connect

We performed high-pressure angle dispersive x-ray diffraction measurements on Fe{sub 5}Si{sub 3} and Ni{sub 2}Si up to 75 GPa. Both materials were synthesized in bulk quantities via a solid-state reaction. In the pressure range covered by the experiments, no evidence of the occurrence of phase transitions was observed. On top of that, Fe{sub 5}Si{sub 3} was found to compress isotopically, whereas an anisotropic compression was observed in Ni{sub 2}Si. The linear incompressibility of Ni{sub 2}Si along the c axis is similar in magnitude to the linear incompressibility of diamond. This fact is related to the higher valence-electron charge density of Ni{sub 2}Si along the c axis. The observed anisotropic compression of Ni{sub 2}Si is also related to the layered structure of Ni{sub 2}Si, where hexagonal layers of Ni{sup 2+} cations alternate with graphite-like layers formed by (NiSi){sup 2-} entities. The experimental results are supported by ab initio total-energy calculations carried out using density functional theory and the pseudopotential method. For Fe{sub 5}Si{sub 3}, the calculations also predicted a phase transition at 283 GPa from the hexagonal P6{sub 3}/mcm phase to the cubic structure adopted by Fe and Si in the garnet Fe{sub 5}Si{sub 3}O{sub 12}. The room-temperature equations of state for Fe{sub 5}Si{sub 3} and Ni{sub 2}Si are also reported and a possible correlation between the bulk modulus of iron silicides and the coordination number of their minority element is discussed. Finally, we report additional descriptions of these structures, in particular, of the predicted high-pressure phase of Fe{sub 5}Si{sub 3} (the cation subarray in the garnet Fe{sub 5}Si{sub 3}O{sub 12}), which can be derived from spinel Fe{sub 2}SiO{sub 4} (Fe{sub 6}Si{sub 3}O{sub 12}).

Errandonea, D.; Santamaria-Perez, D.; Vegas, A.; Nuss, J.; Jansen, M.; Rodriguez-Hernandez, P.; Munoz, A. (MXPL-M); (Valencia); (IQ-FR); (Laguna); (MXPL-F)



The crystal structure of the interrupted framework silicate K{sub 9.6}Ca{sub 1.2}Si{sub 12}O{sub 30} determined from laboratory X-ray diffraction data  

SciTech Connect

The crystal structure of a potassium calcium silicate with composition K{sub 9.6}Ca{sub 1.2}Si{sub 12}O{sub 30} (or K{sub 8}CaSi{sub 10}O{sub 25}) has been solved by direct methods aided by distance least squares optimization from laboratory X-ray powder diffraction data. The trigonal compound adopts the non-centrosymmetric space group R3c with the following basic crystallographic data: a=11.13623(5)A, c=21.9890(2)A, V=2361.63(2)A{sup 3}, Z=3, D{sub calc}=2.617gcm{sup -3}. The crystal structure can be classified as an interrupted framework with exclusively Q{sup 3}-units. It can be thought of as being built from layers parallel to (001) containing isolated six-membered tetrahedral rings in UDUDUD conformation. Corner sharing of tetrahedra belonging to adjacent sheets results in a tetrahedral framework. The framework density of the structure is 15.2 T-atoms/1000A{sup 3}. The coordination sequences are identical for both silicon atoms in the asymmetric unit: 3-6-11-20-32-46-60-80-102-122. The vertex symbols for the two tetrahedral centers are 10{sub 2}.10{sub 2}.6{sub 1}. Topologically, the structure can be described as an Archimedean three-dimensional 3-connected net. It can be derived from the diamond or cristobalite net by removing 20% of the knots. Charge compensation in the structure is achieved by the incorporation of mono- and divalent M-cations (M: K, Ca). These extra-framework ions are coordinated by six to nine oxygen ligands. Ca/K distributions for the five symmetrically independent M-sites were obtained from a combination of bond distance considerations, site occupancy refinements and the bulk chemical composition. The structural characterization is completed by a detailed Raman spectroscopic study. Furthermore, possible implications of the structural chemistry of interrupted framework silicates for the field of silicate glass research are addressed.

Kahlenberg, V. [Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria)]. E-mail: volker.kahlenberg@uibk.ac.at; Kaindl, R. [Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria); Christian-Doppler-Laboratory for Advanced Hard Coatings at the Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria); Toebbens, D.M. [Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria)



Neutron Diffraction  

Science Journals Connector (OSTI)

22 February 1949 research-article Neutron Diffraction G. E. Bacon J. Thewlis The problem of neutron diffraction by crystals is treated by analogy...deals with a comparison between X-ray and neutron diffraction and it is shown that quantitatively...



Optics for X-Ray Laser and Laser Plasma Soft X-Ray Radiation  

Science Journals Connector (OSTI)

Focusing X-ray grazing incidence optics for X-ray laser and laser plasma soft X-ray radiation has been studied. ... computer code. Parabolic axisymmetric mirror for focusing Princeton X-ray laser beam and ellipso...

L. Pina; A. Inneman; R. Hudec



SMB, X-Ray Spectroscopy & Imaging  

NLE Websites -- All DOE Office Websites (Extended Search)

Home X-Ray Spectroscopy & Imaging X-Ray Spectroscopy & Imaging SSRL has five hard X-ray Spectroscopy beamlines and three Microfocus Imaging beamlines dedicated to Biological and...


Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless X-Ray Imaging in Reflection Lensless X-Ray Imaging in Reflection Print Wednesday, 26 October 2011 00:00 The advent of x-ray free-electron laser (XFEL) light sources has...


X-ray Raman scattering study of aligned polyfluorene  

E-Print Network (OSTI)

We present a non-resonant inelastic x-ray scattering study at the carbon K-edge on aligned poly[9,9-bis(2-ethylhexyl)-fluorene-2,7-diyl] and show that the x-ray Raman scattering technique can be used as a practical alternative to x-ray absorption measurements. We demonstrate that this novel method can be applied to studies on aligned $\\pi$-conjugated polymers complementing diffraction and optical studies. Combining the experimental data and a very recently proposed theoretical scheme we demonstrate a unique property of x-ray Raman scattering by performing the symmetry decomposition on the density of unoccupied electronic states into $s$- and $p$-type symmetry contributions.

S. Galambosi; M. Knaapila; J. A. Soininen; K. Nyg\\aard; S. Huotari; F. Galbrecht; U. Scherf; A. P. Monkman; K. Hämäläinen



Miniature x-ray source  

DOE Patents (OSTI)

A miniature x-ray source utilizing a hot filament cathode. The source has a millimeter scale size and is capable of producing broad spectrum x-ray emission over a wide range of x-ray energies. The miniature source consists of a compact vacuum tube assembly containing the hot filament cathode, an anode, a high voltage feedthru for delivering high voltage to the cathode, a getter for maintaining high vacuum, a connector for initial vacuum pump down and crimp-off, and a high voltage connection for attaching a compact high voltage cable to the high voltage feedthru. At least a portion of the vacuum tube wall is fabricated from highly x-ray transparent materials, such as sapphire, diamond, or boron nitride.

Trebes, James E. (Livermore, CA); Bell, Perry M. (Tracy, CA); Robinson, Ronald B. (Modesto, CA)



X-ray Stacking 2008-Apr-22 Astrostats X-ray Stacking  

E-Print Network (OSTI)

X-ray Stacking 2008-Apr-22 Astrostats X-ray Stacking Tom Aldcroft SAO/CXC #12;X-ray Stacking 2008 analysis for a sample Stacking ­ mean properties of sample Chandra X-ray data (faint point sources) are photon-limited with low background => stacking in X-rays is very effective #12;X-ray Stacking 2008-Apr-22

Wolfe, Patrick J.


Center for X-Ray Optics, 1991  

SciTech Connect

This report discusses: Soft-X-Ray imaging with zone-plate lenses; multilayer reflective optics; and spectroscopy with x-rays.

Not Available


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


SMB, X-ray Absorption Spectroscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Absorption Spectroscopy X-ray Absorption Spectroscopy X-ray absorption spectroscopy (XAS) is a well-established technique for simultaneous local geometric and electronic structure...


X-Ray Crystallography What do you need? A crystal. But not just any crystal a well ordered crystal  

E-Print Network (OSTI)

X-Ray Crystallography What do you need? A crystal. But not just any crystal­ a well ordered crystal that will diffract x-rays strongly. A crystal handedness. This reduces number to 6- 12. #12;#12;Generally X-ray beam

Cavanagh, John


Structural and dynamical studies of superacids and superacidic solutions using neutron and high energy X-ray scattering.  

E-Print Network (OSTI)

?? The diffusive motions of the Brønsted superacid, hydrogen fluoride, have been studied using quasielastic neutron scattering. Neutron and high energy X-ray diffraction measurements on… (more)

Molaison, Jamie John



X-ray Emission from Massive Stars  

E-Print Network (OSTI)

X-ray Emission from Massive Stars David Cohen Department of Physics and Astronomy Swarthmore be related to the production of X-rays on massive stars. If so, massive stars' X-rays are much different than those found our own Sun and other cooler stars like the Sun that produce X-rays via magnetic activity

Cohen, David


X-ray Emission from Massive Stars  

E-Print Network (OSTI)

X-ray Emission from Massive Stars David Cohen Department of Physics and Astronomy Swarthmore #12;What is the mechanism by which massive stars produce x-rays? New results from the Chandra X-ray Observatory ­ high-resolution x-ray spectroscopy: measuring Doppler broadening in emission lines Testing

Cohen, David


Vitreous carbon mask substrate for X-ray lithography  

DOE Patents (OSTI)

The present invention is directed to the use of vitreous carbon as a substrate material for providing masks for X-ray lithography. The new substrate also enables a small thickness of the mask absorber used to pattern the resist, and this enables improved mask accuracy. An alternative embodiment comprised the use of vitreous carbon as a LIGA substrate wherein the VC wafer blank is etched in a reactive ion plasma after which an X-ray resist is bonded. This surface treatment provides a surface enabling good adhesion of the X-ray photoresist and subsequent nucleation and adhesion of the electrodeposited metal for LIGA mold-making while the VC substrate practically eliminates secondary radiation effects that lead to delamination of the X-ray resist form the substrate, the loss of isolated resist features, and the formation of a resist layer adjacent to the substrate that is insoluble in the developer.

Aigeldinger, Georg (Livermore, CA); Skala, Dawn M. (Fremont, CA); Griffiths, Stewart K. (Livermore, CA); Talin, Albert Alec (Livermore, CA); Losey, Matthew W. (Livermore, CA); Yang, Chu-Yeu Peter (Dublin, CA)



Synchrotron-Radiation Induced X-Ray Emission (SRIXE)  

SciTech Connect

Elemental analysis using emission of characteristic x rays is a well-established scientific method. The success of this analytical method is highly dependent on the properties of the source used to produce the x rays. X-ray tubes have long existed as a principal excitation source, but electron and proton beams have also been employed extensively. The development of the synchrotron radiation x-ray source that has taken place during the past 40 years has had a major impact on the general field of x-ray analysis. Even tier 40 years, science of x-ray analysis with synchrotron x-ray beams is by no means mature. Improvements being made to existing synchrotron facilities and the design and construction of new facilities promise to accelerate the development of the general scientific use of synchrotron x-ray sources for at least the next ten years. The effective use of the synchrotron source technology depends heavily on the use of high-performance computers for analysis and theoretical interpretation of the experimental data. Fortunately, computer technology has advanced at least as rapidly as the x-ray technology during the past 40 years and should continue to do so during the next decade. The combination of these technologies should bring about dramatic advances in many fields where synchrotron x-ray science is applied. It is interesting also to compare the growth and rate of acceptance of this particular research endeavor to the rates for other technological endeavors. Griibler [1997] cataloged the time required for introduction, diffusion,and acceptance of technological, economic, and social change and found mean values of 40 to 50 years. The introduction of the synchrotron source depends on both technical and non-technical factors, and the time scale at which this seems to be occurring is quite compatible with what is seen for other major innovations such as the railroad or the telegraph. It will be interesting to see how long the present rate of technological change and increase in scientific use can be maintained for the synchrotron x-ray source. A short summary of the present state of the synchrotron radiation-induced x-ray emission (SRIXE) method is presented here. Basically, SRIXE experiments can include any that depend on the detection. of characteristic x-rays produced by the incident x-ray beam born the synchrotron source as they interact with a sample. Thus, experiments done to measure elemental composition, chemical state, crystal, structure, and other sample parameters can be considered in a discussion of SRIXE. It is also clear that the experimentalist may well wish to use a variety of complementary techniques for study of a given sample. For this reason, discussion of computed microtomography (CMT) and x-ray diffraction is included here. It is hoped that this present discussion will serve as a succinct introduction to the basic ideas of SRIXE for those not working in the field and possibly help to stimulate new types of work by those starting in the field as well as by experienced practitioners of the art. The topics covered include short descriptions of (1) the properties of synchrotron radiation, (2) a description of facilities used for its production, (3) collimated microprobe, (4) focused microprobes, (5) continuum and monoenergetic excitation, (6) detection limits, (7) quantitation, (8) applications of SRIXE, (9) computed microtomography (CMT), and (10)chemical speciation using x-ray absorption near-edge structure (XANES) and extended x-ray absorption fine structure (EXAFS). An effort has been made to cite a wide variety of work from different laboratories to show the vital nature of the field.

Jones, Keith W.



Compact x-ray source and panel  

DOE Patents (OSTI)

A compact, self-contained x-ray source, and a compact x-ray source panel having a plurality of such x-ray sources arranged in a preferably broad-area pixelized array. Each x-ray source includes an electron source for producing an electron beam, an x-ray conversion target, and a multilayer insulator separating the electron source and the x-ray conversion target from each other. The multi-layer insulator preferably has a cylindrical configuration with a plurality of alternating insulator and conductor layers surrounding an acceleration channel leading from the electron source to the x-ray conversion target. A power source is connected to each x-ray source of the array to produce an accelerating gradient between the electron source and x-ray conversion target in any one or more of the x-ray sources independent of other x-ray sources in the array, so as to accelerate an electron beam towards the x-ray conversion target. The multilayer insulator enables relatively short separation distances between the electron source and the x-ray conversion target so that a thin panel is possible for compactness. This is due to the ability of the plurality of alternating insulator and conductor layers of the multilayer insulators to resist surface flashover when sufficiently high acceleration energies necessary for x-ray generation are supplied by the power source to the x-ray sources.

Sampayon, Stephen E. (Manteca, CA)



Ultrafast X-ray Absorption Spectroscopy using Laser-Driven Electron X-ray Sources (LEXS)  

E-Print Network (OSTI)

: ultrafast x-rays, x-ray absorption spectroscopy, terawatt lasers, ultrafast reaction dynamics, atomic motion atomic motion by scrutinizing the changes in x- ray absorption spectra during reactions. FirstUltrafast X-ray Absorption Spectroscopy using Laser-Driven Electron X-ray Sources (LEXS) Guangjun

Guo, Ting


Reduction imaging with soft x rays for projection lithography A. A. MacDowell  

E-Print Network (OSTI)

experiments with a 20X reduction Schwarzschild optic produced features as small as 50 nm. It is considered multilayer coated mirrors to image soft x rays at/or near the diffraction limit on to resist coated wafers with projection x-ray lithography. This paper will describe our experimental work using a Schwarzschild camera

Bokor, Jeffrey


X-ray instrumentation for the photon factory  

SciTech Connect

The Photon Factory is one of the world's largest synchroton radiation light sources, the beam lines of which supply intense sources of vacuum UV, soft and hard X-rays. About 30 measuring instruments have been purpose-built, and this book describes the development and construction of the X-ray instrumentation. Given the multifunctional nature of the Photon Factory, it may be expected that the instrumentation serving it fulfills a variety of purposes including: reflection imaging systems; diffraction grating fabrication; monochromators; polarizers; analyzers; detectors; data collection systems; cameras; and goniometers.

Hosoya, S.; Iitaka, Y.; Hashizume, H.



X-ray microscopy: An emerging technique for semiconductor microstructure characterization  

SciTech Connect

The advent of third generation synchrotron radiation x-ray sources, such as the Advanced Light Source (ALS) at Berkeley have enabled the practical realization of a wide range of new techniques in which mature chemical or structural probes such as x-ray photoelectron spectroscopy (XPS) and x-ray diffraction are used in conjunction with microfocused x-ray beams. In this paper the characteristics of some of these new microscopes are described, particularly in reference to their applicability to the characterization of semiconductor microstructures.

Padmore, H.A.



13 - X-ray and Neutron Scattering  

Science Journals Connector (OSTI)

Abstract This chapter describes the use of neutrons and X-rays as probes in the study of structural and dynamic properties of metallic materials. Crystalline materials are characterized by their diffraction peaks related to their average crystallographic structure. In real crystals, locally displaced atoms and chemically (or isotopically for neutrons) different species may lead not only to changes of peak shapes and positions, but also to additional (diffuse) scattering between Bragg peak, including scattering around the primary beam (small-angle scattering). All these features can be used to extract information about the state of a sample, its compositional and structural variations on a scale depending on the scattering, in static and time-resolved kinetic studies. Energy-resolved scattering also offers an insight into solid-state dynamics on a microscopic scale. Some of the most important methods will be described and illustrated by instructive examples. The presentation offers a combined view of neutron and X-ray scattering, with the necessary simplifications dictated by space limitations. The special properties of thermal neutrons and of hard X-rays (now widely available at synchrotron radiation sources), their mutual combination, and combinations with other methods, in particular electron microscopy, offer ample opportunity to better understand and control materials properties. After a brief introduction to scattering from real crystals and some general ideas about long-range strains and Bragg peaks, the vicinity of Bragg peaks (displacement scattering at large scattering angles), the scattering far away from Bragg peaks (chemical heterogeneities, short-range order), and, in greater detail, small-angle scattering (which is not sensitive to the extent of crystallinity, but to nanoscale variations of chemical composition and of magnetization, precipitation) will be described, along with classical and more recent applications related to short-range ordering and precipitation in bulk and nanostructured alloys. Some other fields are only briefly addressed (grazing-incidence studies of surfaces, radiography, absorption spectroscopies, coherent X-rays). The final section offers some information on the influence of defects on lattice dynamics and on (slow) diffusive motion in materials.

Gernot Kostorz




NLE Websites -- All DOE Office Websites (Extended Search)

RAY FLUORESCENCE MICROPROBE (XFM) RAY FLUORESCENCE MICROPROBE (XFM) TECHNIQUES AND CAPABILITIES APPLICATIONS WORLD-LEADING MICROFOCUSED EXAFS SPECTROSCOPY * XFM is an optimized three-pole wiggler beamline for the characterization of materials in an "as-is" state that are chemically heterogeneous at the micrometer scale via synchrotron induced X-ray fluorescence. * XFM includes instrumentation for microbeam X-ray fluorescence (µXRF), diffraction (µXRD) and fluorescence computed microtomography (FCMT) . However, it is optimized to provide users state-of-the-art microfocused Extended X-ray Absorption Fine Structure (µEXAFS) spectroscopy between 4 to 20 keV. * XFM will trade-off beam size and flux for sample configuration flexibility. This includes more readily achievable stability


Fabrication and performance of blazed transmission gratings for x-ray astronomy  

E-Print Network (OSTI)

We have developed a new type of soft x-ray diffraction grating. This critical-angle transmission (CAT) grating combines the advantages of traditional transmission gratings (low mass, extremely relaxed alignment and flatness ...

Schattenburg, Mark Lee


X-ray and Neutron Scattering Studies of Methyl Iodide and Hydrogen Confined in Porous Media.  

E-Print Network (OSTI)

??X-ray diffraction was used to study the liquid - solid phase transition and structure of methyl iodide confined in porous GelTech© glass, with 25, 50… (more)

Glanville, Yvonne



Expression, purification, crystallization and preliminary X-ray crystallographic analysis of Enpp6  

Science Journals Connector (OSTI)

The extracellular catalytic domain of mouse Enpp6 was expressed in mammalian cells, purified and crystallized. An X-ray diffraction data set was collected to 1.8 ? resolution.

Morita, J.



Single molecule imaging with longer x-ray laser pulses  

E-Print Network (OSTI)

In serial femtosecond crystallography, x-ray laser pulses do not need to outrun all radiation damage processes because Bragg diffraction exceeds the damage-induced background scattering for longer pulses ($\\sim$ 50--100 fs). This is due to a "self-gating pulse" effect whereby damage terminates Bragg diffraction prior to the pulse completing its passage through the sample, as if that diffraction were produced by a shorter pulse of equal fluence. We show here that a similar gating effect applies to single molecule diffraction with respect to spatially uncorrelated damage processes like ionization and ion diffusion. The effect is clearly seen in calculations of the diffraction contrast, by calculating the diffraction of average structure separately to the diffraction from statistical fluctuations of the structure due to damage ("damage noise"). Our results suggest that sub-nanometer single molecule imaging with longer pulses, like those produced at currently operating facilities, should not yet be ruled out. The...

Martin, Andrew V; Caleman, Carl; Quiney, Harry M



X-Ray Tomographic Imaging of Crystal Structure at the Atomic Level P. Korecki,1,* M. Tolkiehn,2  

E-Print Network (OSTI)

X-Ray Tomographic Imaging of Crystal Structure at the Atomic Level P. Korecki,1,* M. Tolkiehn,2 D of the crystal structure from real-space projections obtained by illuminating the sample with white x rays. This approach was applied to the pattern of the directional fine structure in absorption of white x rays

Korecki, Pawe³


Microgap x-ray detector  

DOE Patents (OSTI)

An x-ray detector which provides for the conversion of x-ray photons into photoelectrons and subsequent amplification of these photoelectrons through the generation of electron avalanches in a thin gas-filled region subject to a high electric potential. The detector comprises a cathode (photocathode) and an anode separated by the thin, gas-filled region. The cathode may comprise a substrate, such a beryllium, coated with a layer of high atomic number material, such as gold, while the anode can be a single conducting plane of material, such as gold, or a plane of resistive material, such as chromium/silicon monoxide, or multiple areas of conductive or resistive material, mounted on a substrate composed of glass, plastic or ceramic. The charge collected from each electron avalanche by the anode is passed through processing electronics to a point of use, such as an oscilloscope.

Wuest, Craig R. (Danville, CA); Bionta, Richard M. (Livermore, CA); Ables, Elden (Livermore, CA)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Chest x-Rays | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chest x-Rays Chest x-Rays Chest x-Rays Chest X-ray B-Reading The B-reading is a special reading of a standard chest x-ray film performed by a physician certified by the National Institute for Occupational Safety and Health (NIOSH). The reading looks for changes on the chest x-ray that may indicate exposure and disease caused by agents such as asbestos or silica. The B-reading is considered a special reading because doctors who are certified by NIOSH to perform B-readings use a specific protocol to read and record the findings as developed by the International Labour Organization (ILO). The ILO's protocol provides rules for systematically examining the x-ray in a step-by-step method and recording certain abnormalities or changes on the chest x-ray that can be attributable to


Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Imaging in Reflection Print The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities in the field of lensless imaging. XFELs...


Lensless X-Ray Imaging in Reflection  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Imaging in Reflection Print Wednesday, 26 October 2011 00:00 The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities...


Producing X-rays at the APS  

ScienceCinema (OSTI)

An introduction and overview of the Advanced Photon Source at Argonne National Laboratory, the technology that produces the brightest X-ray beams in the Western Hemisphere, and the research carried out by scientists using those X-rays.




SMB, X-ray Fluorescence Imaging  

NLE Websites -- All DOE Office Websites (Extended Search)

Fluorescence Imaging X-ray Fluorescence Imaging X-ray fluorescence imaging utilizes the high brightness of SPEAR3 and focused beam generated by the uses of K-B optics, capillaries...


High-pressure single-crystal X-ray diffraction facilities on station 9.8 at the SRS Daresbury Laboratory - hydrogen location in the high-pressure structure of ethanol  

Science Journals Connector (OSTI)

A new high-pressure single-crystal diffraction facility constructed on station 9.8 at the Synchrotron Radiation Source, Daresbury Laboratory, is described. Initial results on the low-melting-point compound ethanol are presented; diffraction data were of sufficient quality to enable H-atoms to be located.

Allan, D.R.



Chandra X-ray Observatory Center  

E-Print Network (OSTI)

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St in hot gas about 250 million light years from Earth. (Credit: X-ray: NASA/CXC/SAO/E.Bulbul, et al-Newton has revealed a mysterious X-ray signal in the data. This signal is represented in the circled data


X-Ray Absorption Spectroscopy of Metallobiomolecules  

E-Print Network (OSTI)

2/9/07 1 X-Ray Absorption Spectroscopy of Metallobiomolecules The Outskirts of Structural Biology 9, 07] This is a tutorial about the use of X-ray Absorption Spectroscopy (XAS) in biology, RG; Eisenberger, P; Kincaid, BM "X-ray Absorption Spectroscopy of Biological Molecules" Annu. Rev

Scott, Robert A.


Chandra X-ray Observatory Center  

E-Print Network (OSTI)

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St million light years from Earth. (Credit: X-ray: NASA/CXC/Wesleyan Univ./R.Kilgard, et al; Optical: NASA with optical data from the Hubble Space Telescope (red, green, and blue). The X-ray data reveal hundreds


X-ray Spectroscopy of Cool Stars  

E-Print Network (OSTI)

High-resolution X-ray spectroscopy has addressed not only various topics in coronal physics of stars, but has also uncovered important features relevant for our understanding of stellar evolution and the stellar environment. I summarize recent progress in coronal X-ray spectroscopy and in particular also discuss new results from studies of X-rays from pre-main sequence stars.

M. Guedel



X-Ray Physics Evan Berkowitz  

E-Print Network (OSTI)

X-Ray Physics Evan Berkowitz Junior, MIT Department of Physics (Dated: October 25, 2006) We measure a variety of phenomena related to X-Ray absorption and production. We present data which conforms within, as are 22 Na electron-positron annhilation lines. The importance of understanding x-rays is demonstrated


Chandra X-ray Observatory Center  

E-Print Network (OSTI)

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St 200 million light years from Earth. (Credit: X-ray: NASA/CXC/UAH/M.Sun et al; Optical: NASA, ESA, & the Hubble Heritage Team (STScI/AURA) Caption: This composite image from the Chandra X-ray Observatory (blue


X-Ray Absorption Spectroscopy of Metallobiomolecules  

E-Print Network (OSTI)

9/6/09 1 X-Ray Absorption Spectroscopy of Metallobiomolecules The Outskirts of Structural Biology 6, 09] This is a tutorial about the use of X-ray Absorption Spectroscopy (XAS) in biology, RG; Eisenberger, P; Kincaid, BM "X-ray Absorption Spectroscopy of Biological Molecules" Annu. Rev

Scott, Robert A.


Chandra X-ray Observatory Center  

E-Print Network (OSTI)

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St. Cambridge, MA 02138 USA http://chandra.harvard.edu Four Supernova Remnants: NASA's Chandra X-ray Observatory's Chandra X-ray Observatory, four newly processed images of supernova remnants dramatically illustrate


Using Light to Control How X Rays Interact with Matter  

NLE Websites -- All DOE Office Websites (Extended Search)

ultrafast x-ray spectroscopy. ALS femtosecond spectroscopy beamline layout. Femtosecond x-ray and laser pulses derive from a single 800-nm laser oscillator. Femtosecond x rays...


X-RAY SPECTROMETRY X-Ray Spectrom. 2007; 36: 336342  

E-Print Network (OSTI)

X-RAY SPECTROMETRY X-Ray Spectrom. 2007; 36: 336­342 Published online in Wiley InterScience (www.interscience.wiley.com) DOI: 10.1002/xrs.980 Fish otolith trace element maps: new approaches with synchrotron microbeam x-ray of elements as they accrete through a fish's life. We apply synchrotron microbeam x-ray fluorescence methods

Limburg, Karin E.


X-ray Pulsations in the Supersoft X-ray Binary CAL 83  

E-Print Network (OSTI)

X-ray data reveal that the supersoft X-ray binary CAL 83 exhibits 38.4 minute pulsations at some epochs. These X-ray variations are similar to those found in some novae and are likely to be caused by nonradial pulsations the white dwarf. This is the first detection of pulsations in a classical supersoft X-ray binary.

P. C. Schmidtke; A. P. Cowley



X-ray Spectroscopy of Cooling Cluster  

SciTech Connect

We review the X-ray spectra of the cores of clusters of galaxies. Recent high resolution X-ray spectroscopic observations have demonstrated a severe deficit of emission at the lowest X-ray temperatures as compared to that expected from simple radiative cooling models. The same observations have provided compelling evidence that the gas in the cores is cooling below half the maximum temperature. We review these results, discuss physical models of cooling clusters, and describe the X-ray instrumentation and analysis techniques used to make these observations. We discuss several viable mechanisms designed to cancel or distort the expected process of X-ray cluster cooling.

Peterson, J.R.; /SLAC; Fabian, A.C.; /Cambridge U., Inst. of Astron.



X-ray transmissive debris shield  

DOE Patents (OSTI)

An X-ray debris shield for use in X-ray lithography that is comprised of an X-ray window having a layer of low density foam exhibits increased longevity without a substantial increase in exposure time. The low density foam layer serves to absorb the debris emitted from the X-ray source and attenuate the shock to the window so as to reduce the chance of breakage. Because the foam is low density, the X-rays are hardly attenuated by the foam and thus the exposure time is not substantially increased.

Spielman, R.B.



X-ray Spectroscopy of Cooling Clusters  

E-Print Network (OSTI)

We review the X-ray spectra of the cores of clusters of galaxies. Recent high resolution X-ray spectroscopic observations have demonstrated a severe deficit of emission at the lowest X-ray temperatures as compared to that expected from simple radiative cooling models. The same observations have provided compelling evidence that the gas in the cores is cooling below half the maximum temperature. We review these results, discuss physical models of cooling clusters, and describe the X-ray instrumentation and analysis techniques used to make these observations. We discuss several viable mechanisms designed to cancel or distort the expected process of X-ray cluster cooling.

J. R. Peterson; A. C. Fabian


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray transmissive debris shield  

DOE Patents (OSTI)

An X-ray debris shield for use in X-ray lithography that is comprised of an X-ray window having a layer of low density foam exhibits increased longevity without a substantial increase in exposure time. The low density foam layer serves to absorb the debris emitted from the X-ray source and attenuate the shock to the window so as to reduce the chance of breakage. Because the foam is low density, the X-rays are hardly attenuated by the foam and thus the exposure time is not substantially increased.

Spielman, Rick B. (Albuquerque, NM)



X-ray lithography using holographic images  

DOE Patents (OSTI)

A non-contact X-ray projection lithography method for producing a desired X-ray image on a selected surface of an X-ray-sensitive material, such as photoresist material on a wafer, the desired X-ray image having image minimum linewidths as small as 0.063 .mu.m, or even smaller. A hologram and its position are determined that will produce the desired image on the selected surface when the hologram is irradiated with X-rays from a suitably monochromatic X-ray source of a selected wavelength .lambda.. On-axis X-ray transmission through, or off-axis X-ray reflection from, a hologram may be used here, with very different requirements for monochromaticity, flux and brightness of the X-ray source. For reasonable penetration of photoresist materials by X-rays produced by the X-ray source, the wavelength X, is preferably chosen to be no more than 13.5 nm in one embodiment and more preferably is chosen in the range 1-5 nm in the other embodiment. A lower limit on linewidth is set by the linewidth of available microstructure writing devices, such as an electron beam.

Howells, Malcolm R. (Berkeley, CA); Jacobsen, Chris (Sound Beach, NY)



Uncovering a Pressure-Tuned Electronic Transition in Bi[subscript 1.98]Sr[subscript 2.06]Y[subscript0.68]Cu[subscript 2]O[subscipt 8+delta] using Raman Scattering and X-Ray Diffraction  

SciTech Connect

We report pressure-tuned Raman and x-ray diffraction data of Bi{sub 1.98}Sr{sub 2.06}Y{sub 0.68}Cu{sub 2}O{sub 8+{delta}} revealing a critical pressure at 21 GPa with anomalies in electronic Raman background, electron-phonon coupling {lambda}, spectral weight transfer, density dependent behavior of phonons and magnons, and a compressibility change in the c axis. For the first time in a cuprate, mobile charge carriers, lattice, and magnetism all show anomalies at a distinct critical pressure in the same experimental setting. Furthermore, the spectral changes suggest that the critical pressure at 21 GPa is related to the critical point at optimal doping.

Cuk, T.; Struzhkin, V.V.; Devereaux, T.P.; Goncharov, A.F.; Kendziora, C.A.; Eisaki, H.; Mao, H.-K.; Shen, Z.-X. (Stanford); (Waterloo); (NIAIST); (CIW); (NRL)



Neutron and X-ray diffraction studies on the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2}, the new isostructural compound NaMn{sub 4}(VO{sub 4}){sub 3} and their mixed crystals Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3} (0{<=}x{<=}1)  

SciTech Connect

This paper presents a detailed structure analysis (combined Rietveld analysis of X-ray and neutron powder diffraction data as well as quantum mechanical calculations) of the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2} (space group I4 Macron 2d). Special attention is directed to the analysis of the local coordination around Mn{sup 2+} ions or vacancies within a stella quadrangula configuration of anions. Furthermore, the new compound NaMn{sub 4}(VO{sub 4}){sub 3} is described as well as a range of mixed crystals between NaMn{sub 4}(VO{sub 4}){sub 3} and Mn{sub 3}(VO{sub 4}){sub 2} (described by the formula Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3}, 0{<=}x{<=}1) which were synthesized by a solid state route. All compounds were shown to be isostructural to the high temperature phase Mn{sub 3}(VO{sub 4}){sub 2}. - Graphical abstract: The crystal structure of the new compound NaMn{sub 4}(VO{sub 4}){sub 3}. Highlights: Black-Right-Pointing-Pointer We present neutron and X-ray diffraction studies on high temperature-Mn{sub 3}(VO{sub 4}){sub 2}. Black-Right-Pointing-Pointer Structural details of partly filled stellae quadrangulae positions are discussed. Black-Right-Pointing-Pointer Refined structural parameters and theoretical calculations are compared. Black-Right-Pointing-Pointer We investigate the mixed crystal system Mn{sub 3}(VO{sub 4}){sub 2}-NaMn{sub 4}(VO{sub 4}){sub 3}.

Clemens, Oliver [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany); Haberkorn, Robert [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany); Springborg, Michael [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany)] [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany); Beck, Horst Philipp, E-mail: hp.beck@mx.uni-saarland.de [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)



Gray scale x-ray mask  

DOE Patents (OSTI)

The present invention describes a method for fabricating an embossing tool or an x-ray mask tool, providing microstructures that smoothly vary in height from point-to-point in etched substrates, i.e., structure which can vary in all three dimensions. The process uses a lithographic technique to transfer an image pattern in the surface of a silicon wafer by exposing and developing the resist and then etching the silicon substrate. Importantly, the photoresist is variably exposed so that when developed some of the resist layer remains. The remaining undeveloped resist acts as an etchant barrier to the reactive plasma used to etch the silicon substrate and therefore provides the ability etch structures of variable depths.

Morales, Alfredo M. (Livermore, CA); Gonzales, Marcela (Seattle, WA)



Plasma focus x?ray source for lithography  

Science Journals Connector (OSTI)

A bright and reliable x?ray source for lithography has been developed using plasma focus.Discharge with constant pressure gas one of the features of plasma focus makes the x?ray source system simple and lengthens lifetime. A fine ceramicinsulator made of alumina in place of a conventional Pyrex glass insulator improves system reliability. The system operates for more than 105discharges without maintenance. The lifetime of the system is ten times longer than that of a conventional plasma focusdevice. The resolution of a pattern printed by multishot exposure depends not only on the diameter of pinched plasma but also on the variation of source position. A new spherical electrode surrounding the plasma?focusing space is added to stabilize the location of the spot on the axis by eddy currents which exert the Lorentz force on the plasma. The spot position deviation has become negligibly small as compared with the pinched plasma diameter. The x?ray source size for neon is 1 mm in diameter and 10 mm in length. Consequently 0.4??m fine pattern has been printed with this source. Neon radiates intense x rays in opposite voltage polarity to that of a conventional plasma focus. Polarity inversion enables a very thin beryllium window to be located on the axis with the assistance of magnetic deflector and plasma stop. An x?ray intensity of 5 mJ/cm2/shot 25 cm from the source with an irradiance of 10 mW/cm2 at the 2?Hz repetition rate has been obtained. The plasma focus is a promising x?ray source for lithography from the viewpoint of intensity resolution and lifetime.

Yasuo Kato; Isao Ochiai; Yoshio Watanabe; Seiichi Murayama



An experimental measurement of metal multilayer x-ray reflectivity degradation due to intense x-ray flux  

SciTech Connect

The degradation of the x-ray reflection characteristics of metal multilayer Bragg diffractors due to intense x-ray flux was investigated. The Z-pinch plasma produced by PROTO II of Sandia National Laboratories, Albuquerque, New Mexico, was used as the source. The plasma generated total x-ray yields of as much as 40 kJ with up to 15 kJ in the neon hydrogen- and helium-like resonance lines in nominal 20-ns pulses. Molybdenum-carbon, palladium-carbon, and tungsten-carbon metal multilayers were placed at 15 and 150 cm from the plasma center. The multilayers were at nominal angles of 5/sup 0/ and 10/sup 0/ to diffract the neon resonance lines. The time-integrated x-ray reflection of the metal multilayers was monitored by x-ray film. A fluorescer-fiber optic-visible streak camera detector system was then used to monitor the time-resolved x-ray reflection characteristics of 135 A- 2d tungsten-carbon multilayers. A large specular component in the reflectivity prevented determination of the rocking curve of the multilayer. For a neon implosion onto a vanadium-doped polyacrylic acid foam target shot, detailed modeling was attempted. The spectral flux was determined with data from 5 XRD channels and deconvolved using the code SHAZAM. The observed decay in reflectivity was assumed to correspond to the melting of the first tungsten layer. A ''conduction factor'' of 82 was required to manipulate the heat loading of the first tungsten layer such that the time of melting corresponded to the observed decay. The power at destruction was 141 MW/cm/sup 2/ and the integrated energy at destruction was 2.0 J/cm/sup 2/. 82 refs., 66 figs., 10 tabs.

Hockaday, M.Y.P.



X-ray Observations of Mrk 231  

E-Print Network (OSTI)

This paper presents new X-ray observations of Mrk 231, an active galaxy of particular interest due to its large infrared luminosity and the presence of several blueshifted broad absorption line (BAL) systems, a phenomenon observed in a small fraction of QSOs. A ROSAT HRI image of Mrk 231 is presented, this shows an extended region of soft X-ray emission, covering several tens of kpc, consistent with the extent of the host galaxy. An ASCA observation of Mrk 231 is also presented. Hard X-rays are detected but the data show no significant variability in X-ray flux. The hard X-ray continuum is heavily attenuated and X-ray column estimates range from ~ 2 x 10^{22} - 10^{23} cm^{-2} depending on whether the material is assumed to be neutral or ionized, and on the model assumed for the extended X-ray component. These ASCA data provide only the second hard X-ray spectrum of a BAL AGN presented to date. The broad-band spectral-energy-distribution of the source is discussed. While Mrk 231 is X-ray weak compared to Seyfert 1 galaxies, it has an optical-to-X-ray spectrum typical of a QSO.

T. J. Turner



Low Dose Radiation Research Program: A Variable-Energy Soft X-Ray  

NLE Websites -- All DOE Office Websites (Extended Search)

A Variable-Energy Soft X-Ray Microprobe to Investigate Mechanisms of A Variable-Energy Soft X-Ray Microprobe to Investigate Mechanisms of the Radiation -Induced Bystander Effect. Authors: Melvyn Folkard, Borivoj Vojnovic, Giuseppe Schettino, Kirk Atkinson, Kevin M Prise, Barry D Michael Institutes: Gray Cancer Institute, PO Box 100, Mount Vernon Hospital, Northwood, HA6 2JR, UK For over a decade, the Gray Cancer Institute (GCI) has been actively engaged in the development and use of micro-irradiation techniques applied to radiobiological research. Our initial investigations made use of a charged-particle microbeam capable of irradiating individual cells with collimated energetic protons or 3He ions. By the end of the 1990's, a second facility had been constructed, which uses diffractive X-ray optics to focus ultrasoft X-rays to a sub-micron spot. The X-ray microprobe was


Inferring planar disorder in close-packed structures via -machine spectral reconstruction theory: examples from simulated diffraction patterns  

Science Journals Connector (OSTI)

-Machine spectral reconstruction theory, a method for finding planar disorder in close-packed structures, is applied to four simulated diffraction patterns.

Varn, D.P.



Hard x-ray imaging from explorer  

SciTech Connect

Coded aperture X-ray detectors were applied to obtain large increases in sensitivity as well as angular resolution. A hard X-ray coded aperture detector concept is described which enables very high sensitivity studies persistent hard X-ray sources and gamma ray bursts. Coded aperture imaging is employed so that approx. 2 min source locations can be derived within a 3 deg field of view. Gamma bursts were located initially to within approx. 2 deg and X-ray/hard X-ray spectra and timing, as well as precise locations, derived for possible burst afterglow emission. It is suggested that hard X-ray imaging should be conducted from an Explorer mission where long exposure times are possible.

Grindlay, J.E.; Murray, S.S.



Development of x-ray photoelectron microscope with an x-ray laser source  

Science Journals Connector (OSTI)

We have constructed an x-ray photoelectron microscopic system with an x-ray laser as an x-ray source. The lasing line is the Li-like Al 3d-4f transition at 15.47 nm where the recombining Al plasma is used as the x-ray laser medium. The beam from the x-ray laser cavity was then focused by using a Schwarzschild mirror coated with Mo/Si multilayers. The x-ray beam size with a diameter less than 0.5 ?m and the estimated photon number of about 2×10 6 ? photons/shot into the spot were achieved.

Tadayuki Ohchi; Naohiro Yamaguchi; Chiemi Fujikawa; Tamio Hara; Katsumi Watanabe; Ibuki Tanaka; Masami Taguchi



Applications of soft x-ray lasers  

SciTech Connect

The high brightness and short pulse duration of soft x-ray lasers provide unique advantages for novel applications. Imaging of biological specimens using x-ray lasers has been demonstrated by several groups. Other applications to fields such as chemistry, material science, plasma diagnostics, and lithography are beginning to emerge. We review the current status of soft x-ray lasers from the perspective of applications, and present an overview of the applications currently being developed.

Skinner, C.H.



High speed x-ray beam chopper  

DOE Patents (OSTI)

A fast, economical, and compact x-ray beam chopper with a small mass and a small moment of inertia whose rotation can be synchronized and phase locked to an electronic signal from an x-ray source and be monitored by a light beam is disclosed. X-ray bursts shorter than 2.5 microseconds have been produced with a jitter time of less than 3 ns.

McPherson, Armon (Oswego, IL); Mills, Dennis M. (Naperville, IL)



X-ray laser frequency near-doubling and generation of tunable coherent x rays in plasma  

E-Print Network (OSTI)

X-ray laser frequency near-doubling and generation of tunable coherent x rays in plasma P. L plasmas in which efficient x-ray laser frequency near-doubling is expected for a number of available x-ray of coherent x rays and tunable optical radiation may result in tunable coherent x-ray radiation powerful

Kaplan, Alexander


Colloid Coalescence with Focused X Rays  

SciTech Connect

We show direct evidence that focused x rays enable us to merge polymer colloidal particles at room temperature. This phenomenon is ascribed to the photochemical scission of colloids with x rays, reducing the molecular weight, glass transition temperature, surface tension, and viscosity of colloids. The observation of the neck bridge growth with time shows that the x-ray-induced colloid coalescence is analogous to viscoelastic coalescence. This finding suggests a feasible protocol of photonic nanofabrication by sintering or welding of polymers, without thermal damage, using x-ray photonics.

Weon, B. M.; Kim, J. T.; Je, J. H. [X-ray Imaging Center, Department of Materials Science and Engineering, Pohang University of Science and Technology, Pohang, 790-784 (Korea, Republic of); Yi, J. M. [Samsung Advanced Institute of Technology, Yongin, Gyeonggi, 446-712 (Korea, Republic of); Wang, S.; Lee, W.-K. [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States)




E-Print Network (OSTI)

X-RAY MICROBEAM SPEECH PRODUCTION DATABASE USER'S HANDBOOK Version 1.0 (June 1994) prepared by John . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Chapter Two: XRMB History


X-ray laser microscope apparatus  

DOE Patents (OSTI)

A microscope consisting of an x-ray contact microscope and an optical microscope. The optical, phase contrast, microscope is used to align a target with respect to a source of soft x-rays. The source of soft x-rays preferably comprises an x-ray laser but could comprise a synchrotron or other pulse source of x-rays. Transparent resist material is used to support the target. The optical microscope is located on the opposite side of the transparent resist material from the target and is employed to align the target with respect to the anticipated soft x-ray laser beam. After alignment with the use of the optical microscope, the target is exposed to the soft x-ray laser beam. The x-ray sensitive transparent resist material whose chemical bonds are altered by the x-ray beam passing through the target mater GOVERNMENT LICENSE RIGHTS This invention was made with government support under Contract No. De-FG02-86ER13609 awarded by the Department of Energy. The Government has certain rights in this invention.

Suckewer, Szymon (Princeton, NJ); DiCicco, Darrell S. (Plainsboro, NJ); Hirschberg, Joseph G. (Coral Gables, FL); Meixler, Lewis D. (East Windsor, NJ); Sathre, Robert (Princeton, NJ); Skinner, Charles H. (Lawrenceville, NJ)



Automation in X-Ray Crystallography  

Science Journals Connector (OSTI)

Automation in X-Ray Crystallography ... But in the past few years, automation procedures have been applied to intrinsically superior experimental methods. ...




X-Ray Laser Sources for Microscopy  

Science Journals Connector (OSTI)

Progress and prospects in soft X-ray laser development at Princeton are presented. A comparison to plasma and synchrotron sources is made with a...

C. H. Skinner; D. E. Kim; A. Wouters; D. Voorhees; S. Suckewer


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Compound refractive X-ray lens  

DOE Patents (OSTI)

An apparatus and method for focusing X-rays. In one embodiment, his invention is a commercial-grade compound refractive X-ray lens. The commercial-grade compound refractive X-ray lens includes a volume of low-Z material. The volume of low-Z material has a first surface which is adapted to receive X-rays of commercially-applicable power emitted from a commercial-grade X-ray source. The volume of low-Z material also has a second surface from which emerge the X-rays of commercially-applicable power which were received at the first surface. Additionally, the commercial-grade compound refractive X-ray lens includes a plurality of openings which are disposed between the first surface and the second surface. The plurality of openings are oriented such that the X-rays of commercially-applicable power which are received at the first surface, pass through the volume of low-Z material and through the plurality openings. In so doing, the X-rays which emerge from the second surface are refracted to a focal point.

Nygren, David R. (Berkeley, CA); Cahn, Robert (Walnut Creek, CA); Cederstrom, Bjorn (Traellborg, SE); Danielsson, Mats (Stocksund, SE); Vestlund, Jonas (Stockholm, SE)



X-Ray Science Division (XSD)  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Science Division (XSD) Search Button About Welcome Overview Visiting the APS Mission & Goals Find People Organization Charts Committees Job Openings User Information...


X-ray mask and method for providing same  

DOE Patents (OSTI)

The present invention describes a method for fabricating an x-ray mask tool which can achieve pattern features having lateral dimension of less than 1 micron. The process uses a thin photoresist and a standard lithographic mask to transfer an trace image pattern in the surface of a silicon wafer by exposing and developing the resist. The exposed portion of the silicon substrate is then anisotropically etched to provide an etched image of the trace image pattern consisting of a series of channels in the silicon having a high depth-to-width aspect ratio. These channels are then filled by depositing a metal such as gold to provide an inverse image of the trace image and thereby providing a robust x-ray mask tool.

Morales, Alfredo M. (Pleasanton, CA); Skala, Dawn M. (Fremont, CA)



The influence of pressure on the phase stability of nanocomposite Fe{sub 89}Zr{sub 7}B{sub 4} during heating from energy dispersive x-ray diffraction  

SciTech Connect

Nanocomposite materials consisting of small crystalline grains embedded within an amorphous matrix show promise for many soft magnetic applications. The influence of pressure is investigated by in situ diffraction of hammer milled Fe{sub 89}Zr{sub 7}B{sub 4} during heating through the {alpha}{yields}{gamma} Fe transition at 0.5, 2.2, and 4.9 GPa. The changes in primary and secondary crystallization onset are described by diffusion and the energy to form a critical nucleus within the framework of classical nucleation theory.

Leary, A. M.; Kernion, S. J.; McHenry, M. E. [Materials Science and Engineering Department, Carnegie Mellon University, 5000 Forbes Ave., Pittsburgh, Pennsylvania 15213 (United States); Lucas, M. S. [Air Force Research Laboratory, Wright-Patterson AFB, Ohio 45433 (United States); Ohodnicki, P. R. [Division of Chemistry and Surface Science, National Energy Technology Laboratory (NETL), 626 Cochrans Mill Road, Pittsburgh, Pennsylvania 15236 (United States); Mauger, L. [California Institute of Technology, W. M. Keck Laboratory 138-78, Pasadena, California 91125 (United States); Park, C.; Kenney-Benson, C. [High Pressure Collaborative Access Team (HPCAT), Geophysical Laboratory, Carnegie Institution of Washington, 9700 S. Cass Ave., Argonne, Illinois 60439 (United States)



Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)



X-ray spectroscopy of neutron star low-mass X-ray binaries  

E-Print Network (OSTI)

In this thesis, I present work spanning a variety of topics relating to neutron star lowmass X-ray binaries (LMXBs) and utilize spectral information from X-ray observations to further our understanding of these sources. ...

Krauss, Miriam Ilana



X-ray absorption spectroscopy on solid krypton up to 20 GPa  

Science Journals Connector (OSTI)

High-pressure properties of krypton were investigated by energy-dispersive extended x-ray absorption fine-structure spectroscopy in a diamond anvil cell at room temperature. The equation of state agrees very well with x-ray diffraction data. The pressure dependence of the Debye-Waller factor was determined and compared with calculations using pair potentials. The analysis of the x-ray absorption near-edge structure part of the spectrum shows the possibility of measuring the pressure in bubbles of krypton implanted in metallic matrices.

A. Polian; J. P. Itie; E. Dartyge; A. Fontaine; G. Tourillon



Acemetacin cocrystals and salts: structure solution from powder X-ray data and form selection of the piperazine salt  

Science Journals Connector (OSTI)

Multi-component crystals of the anti-inflammatory drug acemetacin were prepared by melt crystallization and their X-ray crystal structures solved using single-crystal and high-resolution powder X-ray diffraction (PXRD) data. The acemetacin-para-aminobenzoic acid adduct and the acemetacin piperazine salt are stable to hydration in the aqueous medium (up to 24 h).

Sanphui, P.



Acoustically Mounted Microcrystals Yield High-Resolution X-ray Structures  

SciTech Connect

We demonstrate a general strategy for determining structures from showers of microcrystals. It uses acoustic droplet ejection to transfer 2.5 nL droplets from the surface of microcrystal slurries, through the air, onto mounting micromesh pins. Individual microcrystals are located by raster-scanning a several-micrometer X-ray beam across the cryocooled micromeshes. X-ray diffraction data sets merged from several micrometer-sized crystals are used to determine 1.8 {angstrom} resolution crystal structures.

Soares, Alexei S.; Engel, Matthew A.; Stearns, Richard; Datwani, Sammy; Olechno, Joe; Ellson, Richard; Skinner, John M.; Allaire, Marc; Orville, Allen M. (Labcyte); (BNL)



Ultraluminous X-ray Sources: The most extreme X-ray binaries  

E-Print Network (OSTI)

1 Ultraluminous X-ray Sources: The most extreme X-ray binaries Luca Zampieri INAF ULXs ­ Lubiana ­ May 11, 2012- LZ #12;6 · X-ray observations of nearby galaxies show a population of pointlike, off-nuclear sources with L >> Ledd for 1 Msun (L>1.0e39 erg/s) UltraLuminous X-ray Sources (e

Â?umer, Slobodan


Water Window Ptychographic Imaging with Characterized Coherent X-rays  

E-Print Network (OSTI)

We report on a ptychographical coherent diffractive imaging experiment in the water window with focused soft X-rays at $500~\\mathrm{eV}$. An X-ray beam with high degree of coherence was selected for ptychography at the P04 beamline of the PETRA III synchrotron radiation source. We measured the beam coherence with the newly developed non-redundant array method. A pinhole $2.6~\\mathrm{\\mu m}$ in size selected the coherent part of the beam and was used for ptychographic measurements of a lithographically manufactured test sample and fossil diatom. The achieved resolution was $53~\\mathrm{nm}$ for the test sample and only limited by the size of the detector. The diatom was imaged at a resolution better than $90~\\mathrm{nm}$.

Rose, Max; Dzhigaev, Dmitry; Gorobtsov, Oleg; Senkbeil, Tobias; von Gundlach, Andreas; Gorniak, Thomas; Shabalin, Anatoly; Viefhaus, Jens; Rosenhahn, Axel; Vartanyants, Ivan



New Developments in Femtosecond Soft X-ray Spectroscopy  

SciTech Connect

Recent instrumentation developments in X-ray spectroscopy for ultra-fast time-resolved measurements with soft X-rays done in HZB Berlin during the last years are described. The significant performance improvements achieved this way are based on Fresnel diffraction from structures being fabricated on a surface of a total externally reflecting mirror. The first type of this spectrometer, an off-axis reflection zone plate, has been implemented at the BESSY Femtoslicing setup and shows on the order of 20 times higher flux in the focal plane compared to the classical grating monochromator beamline. It has proven to serve very precise experiments with a time resolution down to 100 fs on magnetic materials after optical laser pulse excitation.

Erko, A.; Firsov, A.; Holldack, K. [Helmholtz-Zentrum Berlin fuer Materialien und Energie GmbH, Elektronenspeicherring BESSY II, Albert Einstein str.15, Berlin (Germany)



Aneta Siemiginowska Chandra X-ray Center  

E-Print Network (OSTI)

-ray and gamma-ray · High Energy Sky · Chandra X-ray Observatory · examples of typical X-ray data, · an example of a data analysis process · statistical challenges · what do we learn from the data? #12;What is Astronomy and phenomena do we study and how? Solar System: Sun and sollar wind, planets, moons, asteroids, comets Our

Wolfe, Patrick J.


Watershed in X-ray Astronomy  

Science Journals Connector (OSTI)

... extent the article on page 96 of this issue of Nature from the X-ray astronomy group at the Massachusetts Institute of Technology is a record of disappointments. That is ... near the galactic centre. Now that the first satellite to be devoted to X-ray astronomy has been launched, and is apparently working successfully, the MIT article and another from ...



X-Ray Identification of Element 104  

Science Journals Connector (OSTI)

The daughter x-ray identification technique has been applied to the identification of element 104. The characteristic K-series x rays from the ?-decay daughter isotope, nobelium (Z=102), have been observed in coincidence with ? particles from the decay of 4.5-sec 104257, thus providing an unequivocal determination of the parent atomic number, Z=104.

C. E. Bemis; Jr.; R. J. Silva; D. C. Hensley; O. L. Keller; Jr.; J. R. Tarrant; L. D. Hunt; P. F. Dittner; R. L. Hahn; C. D. Goodman



Quantitative Measurements of X-ray Intensity  

SciTech Connect

This chapter describes the characterization of several X-ray sources and their use in calibrating different types of X-ray cameras at National Security Technologies, LLC (NSTec). The cameras are employed in experimental plasma studies at Lawrence Livermore National Laboratory (LLNL), including the National Ignition Facility (NIF). The sources provide X-rays in the energy range from several hundred eV to 110 keV. The key to this effort is measuring the X-ray beam intensity accurately and traceable to international standards. This is accomplished using photodiodes of several types that are calibrated using radioactive sources and a synchrotron source using methods and materials that are traceable to the U.S. National Institute of Standards and Technology (NIST). The accreditation procedures are described. The chapter begins with an introduction to the fundamental concepts of X-ray physics. The types of X-ray sources that are used for device calibration are described. The next section describes the photodiode types that are used for measuring X-ray intensity: power measuring photodiodes, energy dispersive photodiodes, and cameras comprising photodiodes as pixel elements. Following their description, the methods used to calibrate the primary detectors, the power measuring photodiodes and the energy dispersive photodiodes, as well as the method used to get traceability to international standards are described. The X-ray source beams can then be measured using the primary detectors. The final section then describes the use of the calibrated X-ray beams to calibrate X-ray cameras. Many of the references are web sites that provide databases, explanations of the data and how it was generated, and data calculations for specific cases. Several general reference books related to the major topics are included. Papers expanding some subjects are cited.

Haugh, M. J., Schneider, M.



BaZn{sub 2}Si{sub 2}O{sub 7} and the solid solution series BaZn{sub 2?x}Co{sub x}Si{sub 2}O{sub 7} (0X-ray diffraction and dilatometry  

SciTech Connect

For sealing of solid oxide fuel cells, glasses from which crystalline phases with high coefficient of thermal expansion (CTE) can be crystallized are required. In this paper, a new solid solution series BaZn{sub 2?x}Co{sub x}Si{sub 2}O{sub 7} (0X-ray diffraction and high-temperature X-ray diffraction (BaZn{sub 2}Si{sub 2}O{sub 7}). Sintered specimens were characterized by dilatometry. The introduction of Co{sup 2+} does not lead to a change in the space group. All compounds show a transition of a low to a high temperature modification. The attributed temperature increases from 300 °C for BaZn{sub 2}Si{sub 2}O{sub 7} to 850 °C for BaCo{sub 2}Si{sub 2}O{sub 7}. The volume expansion which runs parallel to the phase transition decreases with increasing cobalt concentration. The phase BaZn{sub 2}Si{sub 2}O{sub 7} shows the largest CTE and a steep volume effect during phase transition. For the compound BaZn{sub 0.25}Co{sub 1.75}Si{sub 2}O{sub 7} the CTE is minimum (8.6×10{sup ?6} K{sup ?1} (50–900 °C)) and increases again until for the compound BaCo{sub 2}Si{sub 2}O{sub 7} a CTE of 16.6×10{sup ?6} K{sup ?1} (50–900 °C) is reached. In the cobalt rich composition range, the CTEs are in the right range for high temperature fuel cells and can be adjusted by the composition. - Graphical abstract: The composition of the solid solution BaZn{sub 2?x}Co{sub x}Si{sub 2}O{sub 7} strongly affects the thermal expansion. Display Omitted - Highlights: • We examined the thermal expansion of solid solutions BaZn{sub 2?x}Co{sub x}Si{sub 2}O{sub 7} (0

Kerstan, Marita; Thieme, Christian; Grosch, Matthias; Müller, Matthias; Rüssel, Christian, E-mail: ccr@rz.uni-jena.de



Projections of local atomic structure revealed by wavelet analysis of x-ray absorption anisotropy P. Korecki,1,* D. V. Novikov,2 and M. Tolkiehn2  

E-Print Network (OSTI)

Projections of local atomic structure revealed by wavelet analysis of x-ray absorption anisotropy P x-ray field amplitude at the sites of absorbing atoms and effectively changes the atomic absorption in an experiment a wavelet transform approach for analysis of x-ray absorption anisotropy XAA patterns recorded

Korecki, Pawe³


X-ray Practicals Series 1 Advanced Data Reduction  

E-Print Network (OSTI)

X-ray Practicals Series 1 Advanced Data Reduction Instructor J. Reibenspies, Ph. D. Nattamai Bhuvanesh, Ph.D. Version 1.0.0 #12;X-ray Practicals Series 2 #12;X-ray Practicals Series 3 #12;X-ray is good. The y direction is shifting the most, but the shift is ok #12;X-ray Practicals Series 5 Other

Meagher, Mary


X-ray sources in globular clusters  

E-Print Network (OSTI)

The twelve bright (Lx>10(36) erg/s) X-ray sources in the globular clusters have lower luminosities than the brightest sources in the bulge of our galaxy. The dim (Lx<10(35) erg/s) X-ray sources in globular clusters reach higher luminosities than the cataclysmic variables in the disk of our galaxy. The first difference is a statistical fluke, as comparison with M31 indicates. The second difference is explained because the brightest of the dim sources are not cataclysmic variables, but soft X-ray transients in quiescence. This article describes the BeppoSAX, ROSAT and first Chandra observations leading to these conclusions.

Frank Verbunt


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

with the occurrence of solar X-ray flare, when light travel time delay is accounted, suggesting that X-rays fromX-RAY EMISSION FROM PLANETS AND COMETS: RELATIONSHIP WITH SOLAR X-RAYS AND SOLAR WIND ANIL BHARDWAJ Flight center, Greenbelt, MD 20771, USA Scattering of solar X-ray radiation mainly produces the non

Ã?stgaard, Nikolai


Novel X-Ray Imaging Opportunities for the RPI Linear Accelerator's Tunable, Quasi-monochromatic X-ray Source  

E-Print Network (OSTI)

Novel X-Ray Imaging Opportunities for the RPI Linear Accelerator's Tunable, Quasi-monochromatic X-ray of an intense, tunable, polarized, and quasi-monochromatic X-ray source has been ongoing at Rensselaer Polytechnic Institute since 2001 [1, 2, 3, 4, 5, 6]. This X-ray source, known as Parametric X-rays (PXR

Danon, Yaron


The Kinetic Effect on Structural Behavior of Mixed LiMn2O4–LiNi1/3Co1/3Mn1/3O2 Cathode Materials Studied by In Situ Time-resolved X-ray Diffraction Technique  

SciTech Connect

How the structural changes of each active material in mixed cathode systems take place at different charge-discharge rates is quite important in the application of the system in which the mixed cathode materials with different rate capabilities are formed into one composite electrode. Here we report the results of the real time structural change studies of mixed LiMn{sub 2}O{sub 4}-LiNi{sub 1/3}Co{sub 1/3}Mn{sub 1/3}O{sub 2} composite cathode in a Li-ion cell by using in situ synchrotron-based time resolved x-ray diffraction (TR-XRD) technique. The layer structured component in the mixed composite cathode system shows less utilization at fast discharge rate (high power mode) whereas the spinel structured component is fully utilized. This clearly demonstrates that the reduced capacity at fast discharge rate for this system is caused by the less utilization of the layer structured component. The real time monitoring of the structural behavior at various discharge rates is a great tool to design the best ratios of active materials with different rate capabilities in the mixed cathode systems for different applications.

Yoon W. S.; Nam K.; Jang, D.; Chung, K.Y.; Cho, Y.-H.; Choi, S.; Hanson, J.C.; Yang, X.-Q.



X-ray Absorption Spectroscopy of Biologically Relevant Systems  

E-Print Network (OSTI)

308, Messer, B. M. X-ray Absorption Spectroscopy of AqueousSarcosine via X-ray Absorption Spectroscopy 5.1 Introductionwith Carboxylate by X-Ray Absorption Spectroscopy of Liquid

Uejio, Janel Sunayo



Compact X-Ray Light Source Workshop | EMSL  

NLE Websites -- All DOE Office Websites (Extended Search)

Compact X-Ray Light Source Workshop Compact X-Ray Light Source Workshop Teller R, Terminello L, Thevuthasan T, Moncton D. 2012. "Compact X-Ray Light Source Workshop Report."...


The Center for X-ray Optics - Now hiring engineers. Apply Today.  

NLE Websites -- All DOE Office Websites (Extended Search)

Database Nanomagnetism X-Ray Microscopy EUV Lithography EUV Mask Database Nanomagnetism X-Ray Microscopy EUV Lithography EUV Mask Imaging Reflectometry Zoneplate Lenses Coherent Optics Nanofabrication Optical Coatings Engineering Education Careers Publications Contact LBNL-Logo The Center for X-Ray Optics is a multi-disciplined research group within Lawrence Berkeley National Laboratory's (LBNL) Materials Sciences Division (MSD). Notice to users. Precision Engineering Building the tools that make nanoscience possible. A high-precision stage fabricated by CXRO's Instrument Fabrication Facility Zone plates Diffractive lenses for a new generation of x-ray beamlines. SEM image of a zoneplate fabricated by CXRO Interferometry Wavefront control with sub-angstrom sensitivity Null interferogram, in preparation for EUV metrology of the SEMATECH Berkeley Microfield Exposure Tool (MET)


The Road to Ultrahigh-Resolution X-ray Spectrometers | Advanced Photon  

NLE Websites -- All DOE Office Websites (Extended Search)

How Atoms Behave: Characteristics of Microstructural Avalanches How Atoms Behave: Characteristics of Microstructural Avalanches Iodate Refuses to Intimidate Creating the Heart of a Planet in the Heart of a Gem How a Powerful Antibody Neutralizes HIV Taking a Page from Nature to Build Better Nanomaterials Science Highlights Archives: 2013 | 2012 | 2011 | 2010 2009 | 2008 | 2007 | 2006 2005 | 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed The Road to Ultrahigh-Resolution X-ray Spectrometers NOVEMBER 22, 2011 Bookmark and Share Basic phenomena underlying the AD&AT x-ray optics. In x-ray Bragg diffraction from atomic planes composing nonzero angle η to the crystal entrance face, the crystal acts (a) like an optical prism dispersing the photons into a divergent x-ray fan with photons of different energies E


APS Bending Magnet X-rays and  

NLE Websites -- All DOE Office Websites (Extended Search)

Irradiation of Nd-Fe-B Permanent Magnets with Irradiation of Nd-Fe-B Permanent Magnets with APS Bending Magnet X-rays and 60 Co γ-rays J. Alderman and P.K. Job APS Operations Division Advanced Photon Source J. Puhl Ionizing Radiation Division National Institute of Standards and Technology June 2000 Table of Contents Introduction Radiation-Induced Demagnetization of Permanent Magnets Resources Required γ-ray Irradiation Results and Analysis of γ-ray Irradiation X-ray Irradiation Results and Analysis of X-ray Irradiation Summary and Conclusions Acknowledgements References Tables and Figures Introduction The Advanced Photon Source (APS), as well as other third-generation synchrotron light sources, uses permanent magnets in the insertion devices to produce x-rays for scientific


X-ray source for mammography  

DOE Patents (OSTI)

An x-ray source utilizing anode material which shifts the output spectrum to higher energy and thereby obtains higher penetrating ability for screening mammography application, than the currently utilized anode material. The currently used anode material (molybdenum) produces an energy x-ray spectrum of 17.5/19.6 keV, which using the anode material of this invention (e.g. silver, rhodium, and tungsten) the x-ray spectrum would be in the 20-35 keV region. Thus, the anode material of this invention provides for imaging of breasts with higher than average x-ray opacity without increase of the radiation dose, and thus reduces the risk of induced breast cancer due to the radiation dose administered for mammograms.

Logan, Clinton M. (Pleasanton, CA)



Ultrafast X-Ray Sources and Science  

Science Journals Connector (OSTI)

X-ray science is entering the ultrafast and ultraintense era - spurred by developments in coherent, short-wavelength sources that range from tabletop to accelerator-based. These...

Young, Linda


X-ray induced optical reflectivity  

The change in optical reflectivity induced by intense x-ray pulses can now be used to study ultrafast many body responses in solids in the femtosecond time domain. X-ray absorption creates photoelectrons and core level holes subsequently filled by Auger or fluorescence processes, and these excitations ultimately add conduction and valence band carriers that perturb optical reflectivity.Optical absorption associated with band filling and band gap narrowing is shown to explain the basic features found in recent measurements on an insulator (silicon nitride, Si3N4), a semiconductor(gallium arsenide,GaAs), and a metal (gold,Au), obtained with ?100 fs x-ray pulses at 500-2000 eV and probed with 800 nm laser pulses. In particular GaAs exhibits an abrupt drop in reflectivity, persisting only for a time comparable to the x-ray excitation pulse duration, consistent with prompt band gap narrowing.

Durbin, Stephen M.



SMB, X-ray Emission Spectroscopy  

NLE Websites -- All DOE Office Websites (Extended Search)

Emission Spectroscopy Beam Line 6-2b X-ray Emission Spectroscopy Beam Line 6-2b is an advanced spectroscopy experimental station on the multidisciplinary general user wiggler Beam...


X-raying galaxies: A Chandra legacy  

Science Journals Connector (OSTI)

...Astronomy, University of Massachusetts, Amherst, MA 01003 This presentation...stellar x-ray sources in the solar neighborhood (8). The...elements—Meteoritic and solar . Geochim Cosmochim Acta 53...Astronomy, University of Massachusetts, Amherst, MA 01003, USA...

Q. Daniel Wang



Small Angle X-Ray Scattering Detector  

DOE Patents (OSTI)

A detector for time-resolved small-angle x-ray scattering includes a nearly constant diameter, evacuated linear tube having an end plate detector with a first fluorescent screen and concentric rings of first fiber optic bundles for low angle scattering detection and an annular detector having a second fluorescent screen and second fiber optic bundles concentrically disposed about the tube for higher angle scattering detection. With the scattering source, i.e., the specimen under investigation, located outside of the evacuated tube on the tube's longitudinal axis, scattered x-rays are detected by the fiber optic bundles, to each of which is coupled a respective photodetector, to provide a measurement resolution, i.e., dq/q, where q is the momentum transferred from an incident x-ray to an x-ray scattering specimen, of 2% over two (2) orders of magnitude in reciprocal space, i.e., qmax/qmin approx=lO0.

Hessler, Jan P.



X-Ray Nanoimaging: Instruments and Methods  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Nanoimaging: Instruments and Methods To be held as part of SPIE. http:spie.orgOP318 August 28-29, 2013; San Diego, California, USA...


Femtosecond X-ray protein nanocrystallography  

NLE Websites -- All DOE Office Websites (Extended Search)

Femtosecond X-ray protein nanocrystallography Authors: Chapman, H.N., Fromme, P., Barty, A., White, T.A., Kirian, R.A., Aquila, A., Hunter, M.S., Schulz, J., DePonte, D.P.,...


X-ray source for mammography  

DOE Patents (OSTI)

An x-ray source is described utilizing anode material which shifts the output spectrum to higher energy and thereby obtains higher penetrating ability for screening mammography application, than the currently utilized anode material. The currently used anode material (molybdenum) produces an energy x-ray spectrum of 17.5/19.6 keV, which using the anode material of this invention (e.g. silver, rhodium, and tungsten) the x-ray spectrum would be in the 20-35 keV region. Thus, the anode material of this invention provides for imaging of breasts with higher than average x-ray opacity without increase of the radiation dose, and thus reduces the risk of induced breast cancer due to the radiation dose administered for mammograms. 6 figures.

Logan, C.M.



Strains in Thermally Growing Alumina Films Measured in-situ usingSynchrotron X-rays  

SciTech Connect

Strains in thermally grown oxides have been measured in-situ, as the oxides develop and evolve. Extensive data have been acquired from oxides grown in air at elevated temperatures on different model alloys that form Al{sub 2}O{sub 3}. Using synchrotron x-rays at the Advanced Photon Source (Beamline 12BM, Argonne National Laboratory), Debye-Scherrer diffraction patterns from the oxidizing specimen were recorded every 5 minutes during oxidation and subsequent cooling. The diffraction patterns were analyzed to determine strains in the oxides, as well as phase changes and the degree of texture. To study a specimen's response to stress perturbation, the oxidizing temperature was quickly cooled from 1100 to 950 C to impose a compressive thermal stress in the scale. This paper describes this new experimental approach and gives examples from oxidized {beta}-NiAl, Fe-20Cr-10Al, Fe-28Al-5Cr and H{sub 2}-annealed Fe-28Al-5Cr (all at. %) alloys to illustrate some current understanding of the development and relaxation of growth stresses in Al{sub 2}O{sub 3}.

Hou, P.Y.; Paulikas, A.P.; Veal, B.W.



Using X-Ray Computed Tomography in Pore Structure Characterization...  

NLE Websites -- All DOE Office Websites (Extended Search)

Using X-Ray Computed Tomography in Pore Structure Characterization for a Berea Sandstone: Resolution Effect. Using X-Ray Computed Tomography in Pore Structure Characterization for...


The Constellation X-ray mission  

Science Journals Connector (OSTI)

The Constellation-X mission is a large collecting area X-ray facility, emphasizing observations at high spectral resolution (E/?E?300–3000) while covering a broad energy band (0.25–40 keV). By increasing the telescope aperture and utilizing efficient spectrometers the mission will achieve a factor of 100 increased sensitivity over current high-resolution X-ray spectroscopy missions. The use of focussing optics across the 10–40 keV band will provide a similar factor of 100 increased sensitivity in this band. Key technologies under development for the mission include lightweight high throughput X-ray optics, multilayer coatings to enhance the hard X-ray performance of X-ray optics, micro-calorimeter spectrometer arrays with 2 eV resolution, low-power and low-weight CCD arrays, lightweight gratings and hard X-ray detectors. When observations commence towards the end of the next decade, Constellation-X will address many pressing questions concerning the extremes of gravity and the evolution of the Universe.

N.E White; H Tananbaum


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-Ray Observations of Radio Galaxies  

E-Print Network (OSTI)

We review some of the ways that X-ray observations provide unique information on radio galaxies. Thermal bremsstrahlung X-ray emission provides detailed data on ambient densities and temperatures. These parameters in turn can be used for pressure balance calculations and can demonstrate how the ambient gas affects radio source structure. Additionally, many signatures of the interaction of radio jets and lobes with the hot gas are found in high resolution X-ray maps. Non-thermal X-ray emission from knots and hotspots of radio jets can give us constraints on the relativistic electron population for energies greater that that normally sampled in the radio (in the case of synchrotron emission) or can give us an independent estimate of the average magnetic field strength (if inverse Compton emission is the origin of the X-rays). From recent ROSAT HRI observations of 3C 390.3 and 3C 120, we show evidence that X-ray emission from knots and hotspots appears to be associated with regions of large gradients in the radio surface brightness; i.e. at the location of powerful shocks.

D. E. Harris



Compton backscattered collimated x-ray source  

DOE Patents (OSTI)

A high-intensity, inexpensive and collimated x-ray source is disclosed for applications such as x-ray lithography is disclosed. An intense pulse from a high power laser, stored in a high-finesse resonator, repetitively collides nearly head-on with and Compton backscatters off a bunched electron beam, having relatively low energy and circulating in a compact storage ring. Both the laser and the electron beams are tightly focused and matched at the interaction region inside the optical resonator. The laser-electron interaction not only gives rise to x-rays at the desired wavelength, but also cools and stabilizes the electrons against intrabeam scattering and Coulomb repulsion with each other in the storage ring. This cooling provides a compact, intense bunch of electrons suitable for many applications. In particular, a sufficient amount of x-rays can be generated by this device to make it an excellent and flexible Compton backscattered x-ray (CBX) source for high throughput x-ray lithography and many other applications. 4 figs.

Ruth, R.D.; Huang, Z.



Compton backscattered collmated X-ray source  

DOE Patents (OSTI)

A high-intensity, inexpensive and collimated x-ray source for applications such as x-ray lithography is disclosed. An intense pulse from a high power laser, stored in a high-finesse resonator, repetitively collides nearly head-on with and Compton backscatters off a bunched electron beam, having relatively low energy and circulating in a compact storage ring. Both the laser and the electron beams are tightly focused and matched at the interaction region inside the optical resonator. The laser-electron interaction not only gives rise to x-rays at the desired wavelength, but also cools and stabilizes the electrons against intrabeam scattering and Coulomb repulsion with each other in the storage ring. This cooling provides a compact, intense bunch of electrons suitable for many applications. In particular, a sufficient amount of x-rays can be generated by this device to make it an excellent and flexible Compton backscattered x-ray (CBX) source for high throughput x-ray lithography and many other applications.

Ruth, Ronald D. (Woodside, CA); Huang, Zhirong (Stanford, CA)



Compton backscattered collimated x-ray source  

DOE Patents (OSTI)

A high-intensity, inexpensive and collimated x-ray source for applications such as x-ray lithography is disclosed. An intense pulse from a high power laser, stored in a high-finesse resonator, repetitively collides nearly head-on with and Compton backscatters off a bunched electron beam, having relatively low energy and circulating in a compact storage ring. Both the laser and the electron beams are tightly focused and matched at the interaction region inside the optical resonator. The laser-electron interaction not only gives rise to x-rays at the desired wavelength, but also cools and stabilizes the electrons against intrabeam scattering and Coulomb repulsion with each other in the storage ring. This cooling provides a compact, intense bunch of electrons suitable for many applications. In particular, a sufficient amount of x-rays can be generated by this device to make it an excellent and flexible Compton backscattered x-ray (CBX) source for high throughput x-ray lithography and many other applications.

Ruth, Ronald D. (Woodside, CA); Huang, Zhirong (Stanford, CA)



X-ray Holograms Expose Secret Magnetism | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

How Dissolved Metal Ions Interact in Solution How Dissolved Metal Ions Interact in Solution One Giant Leap for Radiation Biology? What's in the Cage Matters in Iron Antimonide Thermoelectric Materials Novel Experiments on Cement Yield Concrete Results Watching a Glycine Riboswitch "Switch" Science Highlights Archives: 2013 | 2012 | 2011 | 2010 2009 | 2008 | 2007 | 2006 2005 | 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed X-ray Holograms Expose Secret Magnetism MAY 11, 2007 Bookmark and Share By observing changes in coherent x-ray speckle pattern, such as the one shown above, researchers are able for the first time to investigate nanoscale dynamics of antiferromagnetic domain walls, and observe a cross over from classical to quantum behavior. (Credit: O. Shpyrko)


Fiber fed x-ray/gamma ray imaging apparatus  

DOE Patents (OSTI)

X-ray/gamma ray imaging apparatus is disclosed for detecting the position, energy, and intensity of x-ray/gamma ray radiation comprising scintillation means disposed in the path of such radiation and capable of generating photons in response to such radiation; first photodetection means optically bonded to the scintillation means and capable of generating an electrical signal indicative of the intensity, and energy of the radiation detected by the scintillation means; second photodetection means capable of generating an electrical signal indicative of the position of the radiation in the radiation pattern; and means for optically coupling the scintillation means to the second photodetection means. The photodetection means are electrically connected to control and storage means which may also be used to screen out noise by rejecting a signal from one photodetection means not synchronized to a signal from the other photodetection means; and also to screen out signals from scattered radiation.

Hailey, Charles J. (San Francisco, CA); Ziock, Klaus-Peter (Livermore, CA)



Development of x-ray laminography under an x-ray microscopic condition  

SciTech Connect

An x-ray laminography system under an x-ray microscopic condition was developed to obtain a three-dimensional structure of laterally-extended planar objects which were difficult to observe by x-ray tomography. An x-ray laminography technique was introduced to an x-ray transmission microscope with zone plate optics. Three prototype sample holders were evaluated for x-ray imaging laminography. Layered copper grid sheets were imaged as a laminated sample. Diatomite powder on a silicon nitride membrane was measured to confirm the applicability of this method to non-planar micro-specimens placed on the membrane. The three-dimensional information of diatom shells on the membrane was obtained at a spatial resolution of sub-micron. Images of biological cells on the membrane were also obtained by using a Zernike phase contrast technique.

Hoshino, Masato; Uesugi, Kentaro; Takeuchi, Akihisa; Suzuki, Yoshio; Yagi, Naoto [Japan Synchrotron Radiation Research Institute JASRI/SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan)



X-ray views of neutron star low-mass X-ray binaries  

E-Print Network (OSTI)

A neutron star low-mass X-ray binary is a binary stellar system with a neutron star and a low-mass companion star rotating around each other. In this system the neutron star accretes mass from the companion, and as this matter falls into the deep potential well of the neutron star, the gravitational potential energy is released primarily in the X-ray wavelengths. Such a source was first discovered in X-rays in 1962, and this discovery formally gave birth to the "X-ray astronomy". In the subsequent decades, our knowledge of these sources has increased enormously by the observations with several X-ray space missions. Here we give a brief overview of our current understanding of the X-ray observational aspects of these systems.

Sudip Bhattacharyya



Cryptotomography: reconstructing 3D Fourier intensities from randomly oriented single-shot diffraction patterns (CXIDB ID 9)  

DOE Data Explorer (OSTI)

These 2000 single-shot diffraction patterns include were either background-scattering only or hits (background-scattering plus diffraction signal from sub-micron ellipsoidal particles at random, undetermined orientations). Candidate hits were identified by eye, and the remainder were presumed as background. 54 usable, background-subtracted hits in this set (procedure in referenced article) were used to reconstruct the 3D diffraction intensities of the average ellipsoidal particle.

Loh, Ne-Te Duane


Kinetics of alloy formation at the interfaces in a Ni-Ti multilayer: X-ray and neutron reflectometry study  

Science Journals Connector (OSTI)

Vacuum-deposited Ni/Ti multilayers on annealing at different temperatures exhibit formation of ordered alloy layers at interfaces. We have studied in detail the formation of alloy at interfaces of a Ni/Ti multilayer on annealing at 300?°C and 400?°C using powder x-ray diffraction, x-ray reflectometry, polarized neutron reflectometry, and off-specular x-ray reflectometry techniques. Correlation among structural, magnetic, and morphological properties in as-deposited Ni/Ti multilayer as well as in a sample annealed at 300?°C and 400?°C has been studied. X-ray diffraction technique was used to obtain crystal structure of the sample. Specular x-ray reflectometry and neutron reflectometry were used to determine the growth of alloy layers from density profile, as a function of depth in the sample. From off-specular x-ray reflectivity we found that the in-plane correlation lengths at the interfaces grew with annealing. This is associated with alloy crystallite growth obtained from x-ray reflectometry. Detailed magnetic-moment density profile of as-deposited as well as annealed multilayer sample has been determined by polarized neutron reflectometry measurements, which was used to determine the magnetic nature of the alloy layers. The results show formation of nonmagnetic alloy layers at the interfaces on annealing. From the Bragg-peak intensities of x-ray reflectivity and polarized neutron reflectivity measurements, we have estimated the diffusion lengths after annealing at 300?°C and 400?°C.

Surendra Singh; Saibal Basu; Pramod Bhatt; A. K. Poswal



Correlated single-crystal electronic absorption spectroscopy and X-ray crystallography at NSLS beamline X26-C  

SciTech Connect

The research philosophy and new capabilities installed at NSLS beamline X26-C to support electronic absorption and Raman spectroscopies coupled with X-ray diffraction are reviewed. This beamline is dedicated full time to multidisciplinary studies with goals that include revealing the relationship between the electronic and atomic structures in macromolecules. The beamline instrumentation has been fully integrated such that optical absorption spectra and X-ray diffraction images are interlaced. Therefore, optical changes induced by X-ray exposure can be correlated with X-ray diffraction data collection. The installation of Raman spectroscopy into the beamline is also briefly reviewed. Data are now routinely generated almost simultaneously from three complementary types of experiments from the same sample. The beamline is available now to the NSLS general user population.

Orville, A.M.; Buono, R.; Cowan, M.; Heroux, A.; Shea-McCarthy, G.; Schneider, D. K.; Skinner, J. M.; Skinner, M. J.; Stoner-Ma, D.; Sweet, R. M.



Correlated Single-Crystal Electronic Absorption Spectroscopy and X-ray Crystallography at NSLS Beamline X26-C  

SciTech Connect

The research philosophy and new capabilities installed at NSLS beamline X26-C to support electronic absorption and Raman spectroscopies coupled with X-ray diffraction are reviewed. This beamline is dedicated full time to multidisciplinary studies with goals that include revealing the relationship between the electronic and atomic structures in macromolecules. The beamline instrumentation has been fully integrated such that optical absorption spectra and X-ray diffraction images are interlaced. Therefore, optical changes induced by X-ray exposure can be correlated with X-ray diffraction data collection. The installation of Raman spectroscopy into the beamline is also briefly reviewed. Data are now routinely generated almost simultaneously from three complementary types of experiments from the same sample. The beamline is available now to the NSLS general user population.

A Orville; R Buono; M Cowan; A Heroux; G Shea-McCarthy; D Schneider; J Skinner; M Skinner; D Stoner-Ma; R Sweet



Is linear response to x-rays suitable for digital dental x-ray imaging systems? —Theoretical and experimental considerations  

Science Journals Connector (OSTI)

The purpose of this study was to consider theoretically and experimentally the suitability of linear response to x-rays for digital dental x-ray imaging systems.

Keiichi Nishikawa PhD; Mamoru Wakoh DDS; PhD; Kinya Kuroyanagi DDS; PhD



Oxides: neutron and synchrotron X-ray diffraction studies  

Science Journals Connector (OSTI)

......the opal silica-water system. Keywords...oxides, opal silica-water system Received 11...order to perform advanced structure studies...oxides containing water (superionic non-stoichiometric...presence of very heavy atoms and to distin...using the IBR pulsed reactor in structure analysis......

Izabela M. Sosnowska; Makoto Shiojiri



High Pressure X-Ray Diffraction Study of V. Siruguria,*  

E-Print Network (OSTI)

Place Jussieu, 75252 Paris Cedex 05, France Abstract Uranium manganese germanide, UMn2Ge2, crystallizes intermetallic UT2X2 compounds, where T is a 3d transition metal and X is either Ge or Si. The crystal structure


Apparatus for generating x-ray holograms  

DOE Patents (OSTI)

Apparatus for x-ray microholography of living biological materials. A Fourier transform holographic configuration is described as being most suitable for the 3-dimensional recording of the physical characteristics of biological specimens. The use of a spherical scatterer as a reference and a charge-coupled device two-dimensional detector array placed in the forward direction relative to the incident x-radiation for viewing electromagnetic radiation simultaneously scattered from both the specimen and the reference scatterer permits the ready reconstruction of the details of the specimen from the fringe pattern detected by the charge-coupled device. For example, by using a nickel reference scatter at 4.5 nm, sufficient reference illumination is provided over a wide enough angle to allow similar resolution in both transverse and longitudinal directions. Both laser and synchrotron radiation sources are feasible for generating microholographs. Operation in the water window (2.4 to 4.5 nm) should provide maximum contrast for features of the specimen and spatial resolution on the order of the wavelength of x-radiation should be possible in all three dimensions, which is sufficient for the visualization of many biological features. It is anticipated that the present apparatus will find utility in other areas as well where microscopic physical details of a specimen are important. A computational procedure which enables the holographic data collected by the detector to be used to correct for misalignments introduced by inexact knowledge of the relative positions of the spherical reference scatterer and the sample under investigation has been developed. If the correction is performed prior to reconstruction, full compensation can be achieved and a faithfully reconstructed image produced.

Rhodes, Charles K. (Chicago, IL); Boyer, Keith (Los Alamos, NM); Solem, Johndale C. (Los Alamos, NM); Haddad, Waleed S. (Chicago, IL)



Apparatus for generating x-ray holograms  

DOE Patents (OSTI)

Apparatus for x-ray microholography of living biological materials. A Fourier transform holographic configuration is described as being most suitable for the 3-dimensional recording of the physical characteristics of biological specimens. The use of a spherical scatterer as a reference and a charge-coupled device two-dimensional detector array placed in the forward direction relative to the incident x-radiation for viewing electromagnetic radiation simultaneously scattered from both the specimen and the reference scatterer permits the ready reconstruction of the details of the specimen from the fringe pattern detected by the charge-coupled device. For example, by using a nickel reference scatter at 4.5 nm, sufficient reference illumination is provided over a wide enough angle to allow similar resolution in both transverse and longitudinal directions. Both laser and synchrotron radiation sources are feasible for generating microholographs. Operation in the water window (2.4 to 4.5 nm) should provide maximum contrast for features of the specimen and spatial resolution on the order of the wavelength of x-radiation should be possible in all three dimensions, which is sufficient for the visualization of many biological features. It is anticipated that the present apparatus will find utility in other areas as well where microscopic physical details of a specimen are important. A computational procedure which enables the holographic data collected by the detector to be used to correct for misalignments introduced by inexact knowledge of the relative positions of the spherical reference scatterer and the sample under investigation has been developed. If the correction is performed prior to reconstruction, full compensation can be achieved and a faithfully reconstructed image produced. 7 figs.

Rhodes, C.K.; Boyer, K.; Solem, J.C.; Haddad, W.S.



X-ray Pinhole Camera Measurements  

SciTech Connect

The development of the rod pinch diode [1] has led to high-resolution radiography for dynamic events such as explosive tests. Rod pinch diodes use a small diameter anode rod, which extends through the aperture of a cathode plate. Electrons borne off the aperture surface can self-insulate and pinch onto the tip of the rod, creating an intense, small x-ray source (Primary Pinch). This source has been utilized as the main diagnostic on numerous experiments that include high-value, single-shot events. In such applications there is an emphasis on machine reliability, x-ray reproducibility, and x-ray quality [2]. In tests with the baseline rod pinch diode, we have observed that an additional pinch (Secondary Pinch) occurs at the interface near the anode rod and the rod holder. This suggests that stray electrons exist that are not associated with the Primary Pinch. In this paper we present measurements on both pinches using an x-ray pinhole camera. The camera is placed downstream of the Primary Pinch at an angle of 60° with respect to the diode centerline. This diagnostic will be employed to diagnose x-ray reproducibility and quality. In addition, we will investigate the performance of hybrid diodes relating to the formation of the Primary and Secondary Pinches.

Nelson, D. S. [NSTec; Berninger, M. J. [NSTec; Flores, P. A. [NSTec; Good, D. E. [NSTec; Henderson, D. J. [NSTec; Hogge, K. W. [NSTec; Huber, S. R. [NSTec; Lutz, S. S. [NSTec; Mitchell, S. E. [NSTec; Howe, R. A. [NSTec; Mitton, C. V. [NSTec; Molina, I. [NSTec; Bozman, D. R. [SNL; Cordova, S. R. [SNL; Mitchell, D. R. [SNL; Oliver, B. V. [SNL; Ormond, E. C. [SNL



Nonlinear X-ray Compton Scattering  

E-Print Network (OSTI)

X-ray scattering is a weak linear probe of matter. It is primarily sensitive to the position of electrons and their momentum distribution. Elastic X-ray scattering forms the basis of atomic structural determination while inelastic Compton scattering is often used as a spectroscopic probe of both single-particle excitations and collective modes. X-ray free-electron lasers (XFELs) are unique tools for studying matter on its natural time and length scales due to their bright and coherent ultrashort pulses. However, in the focus of an XFEL the assumption of a weak linear probe breaks down, and nonlinear light-matter interactions can become ubiquitous. The field can be sufficiently high that even non-resonant multiphoton interactions at hard X-rays wavelengths become relevant. Here we report the observation of one of the most fundamental nonlinear X-ray-matter interactions, the simultaneous Compton scattering of two identical photons producing a single photon at nearly twice the photon energy. We measure scattered...

Fuchs, Matthias; Chen, Jian; Ghimire, Shambhu; Shwartz, Sharon; Kozina, Michael; Jiang, Mason; Henighan, Thomas; Bray, Crystal; Ndabashimiye, Georges; Bucksbaum, P H; Feng, Yiping; Herrmann, Sven; Carini, Gabriella; Pines, Jack; Hart, Philip; Kenney, Christopher; Guillet, Serge; Boutet, Sebastien; Williams, Garth; Messerschmidt, Marc; Seibert, Marvin; Moeller, Stefan; Hastings, Jerome B; Reis, David A



Oscillations During Thermonuclear X-ray Bursts  

E-Print Network (OSTI)

High amplitude, nearly coherent X-ray brightness oscillations during thermonuclear X-ray bursts were discovered with the Rossi X-ray Timing Explorer (RXTE) in early 1996. Spectral and timing evidence strongly supports the conclusion that these oscillations are caused by rotational modulation of the burst emission and that they reveal the spin frequency of neutron stars in low mass X-ray binaries, a long sought goal of X-ray astronomy. Studies carried out over the past year have led to the discovery of burst oscillations in four new sources, bringing to ten the number with confirmed burst oscillations. I review the status of our knowledge of these oscillations and indicate how they can be used to probe the physics of neutron stars. For a few burst oscillation sources it has been proposed that the strongest and most ubiquitous frequency is actually the first overtone of the spin frequency and hence that two nearly antipodal hot spots are present on the neutron star. This inference has important implications for both the physics of thermonuclear burning as well as the mass - radius relation for neutron stars, so its confirmation is crucial. I discuss recent attempts to confirm this hypothesis for 4U 1636-53, the source for which a signal at the putative fundamental (290 Hz) has been claimed.

Tod E. Strohmayer


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Neutron and X-Ray Studies of Advanced Materials V: CENTENNIAL  

SciTech Connect

In 2012 the diffraction community will celebrate 100 years since the prediction of X-ray diffraction by M. Laue, and following his suggestion the first beautiful diffraction experiment by W. Friedrich and P. Knipping. The significance of techniques based on the analysis of the diffraction of X-rays, neutrons, electrons and Mossbauer photons discovered later, has continued to increase in the past 100 years. The aim of this symposium is to provide a forum for discussion of using state-of-the-art neutron and X-ray scattering techniques for probing advanced materials. These techniques have been widely used to characterize materials structures across all length scales, from atomic to nano, meso, and macroscopic scales. With the development of sample environments, in-situ experiments, e.g., at temperatures and applied mechanical load, are becoming routine. The development of ultra-brilliant third-generation synchrotron X-ray sources, together with advances in X-ray optics, has created intense X-ray microbeams, which provide the best opportunities for in-depth understanding of mechanical behavior in a broad spectrum of materials. Important applications include ultra-sensitive elemental detection by X-ray fluorescence/absorption and microdiffraction to identify phase and strain with submicrometer spatial resolution. X-ray microdiffraction is a particularly exciting application compared with alternative probes of crystalline structure, orientation and strain. X-ray microdiffraction is non-destructive with good strain resolution, competitive or superior spatial resolution in thick samples, and with the ability to probe below the sample surface. Advances in neutron sources and instrumentation also bring new opportunities in neutron scattering research. In addition to characterizing the structures, neutrons are also a great tool for elucidating the dynamics of materials. Because neutrons are highly penetrating, neutrons have been used to map stress in engineering systems. Neutrons have also played a vital role in our understanding of the magnetism and magnetic properties. Specialized instruments have been built to gain physical insights of the fundamental mechanisms governing phase transformation and mechanical behaviors of materials. The application of those techniques, in combination with theoretical simulations and numerical modeling, will lead to major breakthroughs in materials science in the foreseeable future that will contribute to the development of materials technology and industrial innovation.

Spanos, George



Predicted X-ray backgrounds for the International X-ray Observatory  

E-Print Network (OSTI)

The background that will be observed by IXO's X-ray detectors naturally separates into two components: (1) a Cosmic X-ray Background (CXB), primarily due to unresolved point sources at high energies (E>2 keV), along with ...

Bautz, Marshall W.


Reflection soft X-ray microscope and method  

DOE Patents (OSTI)

A reflection soft X-ray microscope is provided by generating soft X-ray beams, condensing the X-ray beams to strike a surface of an object at a predetermined angle, and focusing the X-ray beams reflected from the surface onto a detector, for recording an image of the surface or near surface features of the object under observation.

Suckewer, Szymon (Princeton, NJ); Skinner, Charles H. (Lawrenceville, NJ); Rosser, Roy (Princeton, NJ)



Differential phase contrast X-ray imaging system and components  

DOE Patents (OSTI)

A differential phase contrast X-ray imaging system includes an X-ray illumination system, a beam splitter arranged in an optical path of the X-ray illumination system, and a detection system arranged in an optical path to detect X-rays after passing through the beam splitter.

Stutman, Daniel; Finkenthal, Michael



X-ray variability in M87  

E-Print Network (OSTI)

We present the evidence for X-ray variability from the core and from knot A in the M87 jet based on data from two observations with the Einstein Observatory High Resolution Imager (HRI) and three observations with the ROSAT HRI. The core intensity showed a 16% increase in 17 months ('79-'80); a 12% increase in the 3 years '92 to '95; and a 17% drop in the last half of 1995. The intensity of knot A appears to have decreased by 16% between 92Jun and 95Dec. Although the core variability is consistent with general expectations for AGN nuclei, the changes in knot A provide constraints on the x-ray emission process and geometry. Thus we predict that the x-ray morphology of knot A will differ significantly from the radio and optical structure.

D. E. Harris; J. A. Biretta; W. Junor



Displaced Vertices from X-ray Lines  

E-Print Network (OSTI)

We present a simple model of weak-scale thermal dark matter that gives rise to X-ray lines. Dark matter consists of two nearly degenerate states near the weak scale, which are populated thermally in the early universe via co-annihilation with slightly heavier states that are charged under the Standard Model. The X-ray line arises from the decay of the heavier dark matter component into the lighter one via a radiative dipole transition, at a rate that is slow compared to the age of the universe. The model predicts observable signatures at the LHC in the form of exotic events with missing energy and displaced leptons and jets. As an application, we show how this model can explain the recently observed 3.55 keV X-ray line.

Adam Falkowski; Yonit Hochberg; Joshua T. Ruderman



Optimizing and characterizing grating efficiency for a soft X-ray emission spectrometer  

Science Journals Connector (OSTI)

The efficiency of soft X-ray diffraction gratings is examined using theoretical calculations with new open-source software, and insights to design a high-performance emission spectrometer are applied. The calculated and measured efficiencies of real-world gratings are compared, and discrepancies are explained by incorporating real-world effects into the calculations.

Boots, M.



X-ray focal spot locating apparatus and method  

DOE Patents (OSTI)

An X-ray beam finder for locating a focal spot of an X-ray tube includes a mass of X-ray opaque material having first and second axially-aligned, parallel-opposed faces connected by a plurality of substantially identical parallel holes perpendicular to the faces and a film holder for holding X-ray sensitive film tightly against one face while the other face is placed in contact with the window of an X-ray head.

Gilbert, Hubert W. (Cedar Crest, NM)



X-ray Science Division: Groups  

NLE Websites -- All DOE Office Websites (Extended Search)

Division: Groups Division: Groups Atomic, Molecular and Optical Physics (AMO) Primary Contact: Stephen Southworth Work focuses on understanding how strong optical and x-ray fields interact with matter, with an emphasis on photonic control of electronic, atomic and molecular motion. Chemical and Materials Science (CMS) Primary Contact: Randy Winans Research Disciplines: Chemistry, Materials Science Detectors (DET) Primary Contact: Antonino Miceli GMCA Structural Biology Facility (MX) Primary Contact: Robert Fischetti Research Disciplines: Biology, Life Sciences Imaging (IMG) Primary Contact: Francesco DeCarlo Research Disciplines: Materials Science, Biology, Physics, Life Sciences Inelastic X-ray & Nuclear Resonant Scattering (IXN) Primary Contact: Thomas Gog Research Disciplines: Condensed Matter Physics, Geophysics, Materials


Cosmology with X-ray Cluster Baryons  

SciTech Connect

X-ray cluster measurements interpreted with a universal baryon/gas mass fraction can theoretically serve as a cosmological distance probe. We examine issues of cosmological sensitivity for current (e.g., Chandra X-ray Observatory, XMM-Newton) and next generation (e.g., Con-X, XEUS) observations, along with systematic uncertainties and biases. To give competitive next generation constraints on dark energy, we find that systematics will need to be controlled to better than 1percent and any evolution in f_gas (and other cluster gas properties) must be calibrated so the residual uncertainty is weaker than (1+z)0.03.

Linder, Eric V.



Time-resolved x-ray diagnostics  

SciTech Connect

Techniques for time-resolved x-ray diagnostics will be reviewed with emphasis on systems utilizing x-ray diodes or scintillators. System design concerns for high-bandwidth (> 1 GHz) diagnostics will be emphasized. The limitations of a coaxial cable system and a technique for equalizing to improve bandwidth of such a system will be reviewed. Characteristics of new multi-GHz amplifiers will be presented. An example of a complete operational system on the Los Alamos Helios laser will be presented which has a bandwidth near 3 GHz over 38 m of coax. The system includes the cable, an amplifier, an oscilloscope, and a digital camera readout.

Lyons, P.B.



High resolution biomedical imaging system with direct detection of x-rays via a charge coupled device  

DOE Patents (OSTI)

An imaging system is provided for direct detection of x-rays from an irradiated biological tissue. The imaging system includes an energy source for emitting x-rays toward the biological tissue and a charge coupled device (CCD) located immediately adjacent the biological tissue and arranged transverse to the direction of irradiation along which the x-rays travel. The CCD directly receives and detects the x-rays after passing through the biological tissue. The CCD is divided into a matrix of cells, each of which individually stores a count of x-rays directly detected by the cell. The imaging system further includes a pattern generator electrically coupled to the CCD for reading a count from each cell. A display device is provided for displaying an image representative of the count read by the pattern generator from the cells of the CCD. 13 figs.

Atac, M.; McKay, T.A.



High resolution biomedical imaging system with direct detection of x-rays via a charge coupled device  

DOE Patents (OSTI)

An imaging system is provided for direct detection of x-rays from an irradiated biological tissue. The imaging system includes an energy source for emitting x-rays toward the biological tissue and a charge coupled device (CCD) located immediately adjacent the biological tissue and arranged transverse to the direction of irradiation along which the x-rays travel. The CCD directly receives and detects the x-rays after passing through the biological tissue. The CCD is divided into a matrix of cells, each of which individually stores a count of x-rays directly detected by the cell. The imaging system further includes a pattern generator electrically coupled to the CCD for reading a count from each cell. A display device is provided for displaying an image representative of the count read by the pattern generator from the cells of the CCD.

Atac, Muzaffer (Wheaton, IL); McKay, Timothy A. (Ann Arbor, MI)



A new procedure for static RAM evaluation under x-ray pulses  

SciTech Connect

An original method, to identify the initial patterns that are the most favorable to obtain upsets under X-ray pulses, has been developed on Static RAMs in the standby mode. The results obtained with these initial patterns are interesting in order to analyze the radiation induced failures.

Marec, R.; Gaillard, R. (Nucletudes S.A., Les Ulis (France)); Mary, P.; Fairbank, X. (LRBA, Vernon (France)); Ferrant, R. (Thomson-CSF Semiconducteurs Specifiques, Saint Egreve (France)); Palau, J.M.; Gasiot, J. (Univ. Montpellier (France). Centre Electronique de Montpellier)



Source-wave angular-momentum effects on electron-diffraction patterns  

Science Journals Connector (OSTI)

We use a simple model to predict when electron-emission diffraction patterns from surfaces will have peaks or dips along internuclear axes. A high angular-momentum electron wave emitted from an atom acts like an s wave (l=0) in an extra centrifugal potential. This extra potential changes the electron’s effective wave number and phase shift, altering the conditions for constructive interference when this wave scatters from nearby atoms. We demonstrate that the difference in source-wave angular momentum between Cu M2,3M4,5M4,5 Auger and Cu 3p photoelectrons explains the difference between their emission angular distributions from surfaces: the Auger-electron emission has a predominantly f-like source wave (l=3) and destructive interference in the forward electron-scattering direction (‘‘silhouette’’) while the photoelectron has lower angular momentum and constructive interference (‘‘peak’’). As long as this effect is considered, Auger-electron emission patterns can be used to determine surface structures. The unusual Auger-electron emission patterns observed by Frank et al. [Science 247, 182 (1990)] can be explained as due to high source-wave angular momentum and low electron energy.

John J. Barton and Louis J. Terminello



Radioactive Thulium for X-Rays  

Science Journals Connector (OSTI)

Radioactive power from thulium makes Argonne x-ray unit a potential for medical and industrial use ... Active component of the instrument is a tiny particle (one-fifth gram) of thulium-170 which has been made radioactive in a heavy water nuclear reactor at Arco, Idaho. ...



X-ray spectroscopy of manganese clusters  

SciTech Connect

Much of this thesis represents the groundwork necessary in order to probe Mn clusters more productively than with conventional Mn K-edge XAS and is presented in Part 1. Part 2 contains the application of x-ray techniques to Mn metalloproteins and includes a prognosis at the end of each chapter. Individual Mn oxidation states are more readily distinguishable in Mn L-edge spectra. An empirical mixed valence simulation routine for determining the average Mn oxidation state has been developed. The first Mn L-edge spectra of a metalloprotein were measured and interpreted. The energy of Mn K{beta} emission is strongly correlated with average Mn oxidation state. K{beta} results support oxidation states of Mn(III){sub 2}(IV){sub 2} for the S{sub 1} state of Photosystem II chemical chemically reduced preparations contain predominantly Mn(II). A strength and limitation of XAS is that it probes all of the species of a particular element in a sample. It would often be advantageous to selectively probe different forms of the same element. The first demonstration that chemical shifts in x-ray fluorescence energies can be used to obtain oxidation state-selective x-ray absorption spectra is presented. Spin-dependent spectra can also be used to obtain a more simplified picture of local structure. The first spin-polarized extended x-ray absorption fine structure using Mn K{beta} fluorescence detection is shown.

Grush, M.M. [Univ. of California, Davis, CA (United States). Dept. of Applied Science; [Lawrence Berkeley National Lab., CA (United States). Energy and Environment Div.



Multiple wavelength X-ray monochromators  

DOE Patents (OSTI)

An improved apparatus and method is provided for separating input x-ray radiation containing first and second x-ray wavelengths into spatially separate first and second output radiation which contain the first and second x-ray wavelengths, respectively. The apparatus includes a crystalline diffractor which includes a first set of parallel crystal planes, where each of the planes is spaced a predetermined first distance from one another. The crystalline diffractor also includes a second set of parallel crystal planes inclined at an angle with respect to the first set of crystal planes where each of the planes of the second set of parallel crystal planes is spaced a predetermined second distance from one another. In one embodiment, the crystalline diffractor is comprised of a single crystal. In a second embodiment, the crystalline diffractor is comprised of a stack of two crystals. In a third embodiment, the crystalline diffractor includes a single crystal that is bent for focusing the separate first and second output x-ray radiation wavelengths into separate focal points. 3 figs.

Steinmeyer, P.A.



Soft x-ray laser microscope  

SciTech Connect

The program consisted of two phases (Phase I and Phase II). The goal of the Phase I (first year program) was to design and construct the Soft X-ray Laser Contact Microscope. Such microscope was constructed and adapted to PPL's 18.2nm soft X-ray Laser (SXL), which in turn was modified and prepared for microscopy experiments. Investigation of the photoresist response to 18.2nm laser radiation and transmissivity of 0.1m thick silicion-nitride (Si[sub 3]N[sub 4]) windows were important initial works. The goal of the first year of Phase II was to construct X-ray contact microscope in combination with existing optical phase microscope, already used by biologists. In the second year of Phase II study of dehydrated Horeseshoe Crab and Hela cancer cells were performed with COXRALM. Also during Phase II, the Imaging X-Ray Laser Microscope (IXRALM) was designed and constructed. This paper describes the development of each of the microscopes and their application for research.

Suckewer, P.I.



Small Angle X-Ray Scattering Detector  

DOE Patents (OSTI)

A detector for time-resolved small-angle x-ray scattering includes a nearly constant diameter, evacuated linear tube having an end plate detector with a first fluorescent screen and concentric rings of first fiber optic bundles for low angle scattering detection and an annular detector having a second fluorescent screen and second fiber optic bundles concentrically disposed about the tube for higher angle scattering detection. With the scattering source, i.e., the specimen under investigation, located outside of the evacuated tube on the tube's longitudinal axis, scattered x-rays are detected by the fiber optic bundles, to each of which is coupled a respective photodetector, to provide a measurement resolution, i.e., dq/q, where q is the momentum transferred from an incident x-ray to an x-ray scattering specimen, of 2% over two (2) orders of magnitude in reciprocal space, i.e., q.sub.max /q.sub.min.congruent.100.

Hessler, Jan P. (Downers Grove, IL)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


SLAC All Access: X-ray Microscope  

ScienceCinema (OSTI)

SLAC physicists Johanna Nelson and Yijin Liu give a brief overview of the X-ray microscope at the Stanford Synchrotron Radiation Lightsource (SSRL) that is helping improve rechargeable-battery technology by letting researchers peek into the inner workings of batteries as they operate.

Nelson, Johanna; Liu, Yijin



Source effects in analyzer-based X-ray phase contrast imaging with conventional sources  

SciTech Connect

Several recent papers have shown the implementation of analyzer based X-ray phase contrast imaging (ABI) with conventional X-ray sources. The high flux is always a requirement to make the technique useful for bio-medical applications. Here, we present and discuss three important parameters, which need to be taken into account, when searching for the high flux ABI: anisotropic magnification, double image, and source size spread due to intrinsic dispersive diffraction by asymmetrically cut crystals. These parameters, if not well optimized, may cause important features in the acquired images which can mislead the interpretation. A few ways to minimize these effects are implemented and discussed, including some experimental results.

Hoennicke, M. G. [Universidade Federal da Integracao Latino-Americana, 85867-970 Foz do Iguacu, PR (Brazil); Manica, J. [Universidade Estadual do Oeste do Parana, 85867-970 Foz do Iguacu, PR (Brazil); Mazzaro, I.; Cusatis, C. [LORXI, Departamento de Fisica, Universidade Federal do Parana, Caixa Postal 19091, 81531-990 Curitiba, PR (Brazil); Huang, X.-R. [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States)



High-energy x-ray diffractometer for nondestructive strain depth profile measurement  

SciTech Connect

We describe a lab-based high-energy x-ray diffraction system and a new approach to nondestructively measuring strain profiles in polycrystalline samples. This technique utilizes the tungsten K{sub ?1} characteristic radiation from a standard industrial x-ray tube. We introduce a simulation model that is used to determine strain values from data collected with this system. Examples of depth profiling are shown for shot peened aluminum and titanium samples. Profiles to 1 mm depth in aluminum and 300 ?m depth in titanium with a depth resolution of 20 ?m are presented.

Al-Shorman, M. Y. [Department of Physics, Yarmouk University, 21163 Irbid (Jordan)] [Department of Physics, Yarmouk University, 21163 Irbid (Jordan); Jensen, T. C.; Gray, J. N. [Center for Nondestructive Evaluation, Iowa State University, Ames, Iowa 50011 (United States)] [Center for Nondestructive Evaluation, Iowa State University, Ames, Iowa 50011 (United States)



HipGISAXS: a high-performance computing code for simulating grazing-incidence X-ray scattering data  

Science Journals Connector (OSTI)

A new massively parallel code for simulation of a grazing-incidence X-ray scattering experiment has been developed. The sample modeling flexibility enables users to simulate scattering patterns for a wide variety of nanostructures and morphologies.

Chourou, S.T.



Synchrotron x-ray fluorescence and extended x-ray absorption fine structure analysis  

SciTech Connect

The advent of dedicated synchrotron radiation sources has led to a significant increase in activity in many areas of science dealing with the interaction of x-rays with matter. Synchrotron radiation provides intense, linearly polarized, naturally collimated, continuously tunable photon beams, which are used to determine not only the elemental composition of a complex, polyatomic, dilute material but also the chemical form of the elements with improved accuracy. Examples of the application of synchrotron radiation include experiments in synchrotron x-ray fluorescence (SXRF) analysis and extended x-ray absorption fine structure (EXAFS) analysis. New synchrotron radiation x-ray microprobes for elemental analysis in the parts per billion range are under construction at several laboratories. 76 references, 24 figures.

Chen, J.R.; Gordon, B.M.; Hanson, A.L.; Jones, K.W.; Kraner, H.W.; Chao, E.C.T.; Minkin, J.A.



Rise Time Measurement for Ultrafast X-Ray Pulses  

DOE Patents (OSTI)

A pump-probe scheme measures the rise time of ultrafast x-ray pulses. Conventional high speed x-ray diagnostics (x-ray streak cameras, PIN diodes, diamond PCD devices) do not provide sufficient time resolution to resolve rise times of x-ray pulses on the order of 50 fs or less as they are being produced by modern fast x-ray sources. Here, we are describing a pump-probe technique that can be employed to measure events where detector resolution is insufficient to resolve the event. The scheme utilizes a diamond plate as an x-ray transducer and a p-polarized probe beam.

Celliers, Peter M.; Weber, Franz A.; Moon, Stephen J.



X-ray microscopy using grazing-incidence reflection optics  

SciTech Connect

The Kirkpatrick-Baez microscopes are described along with their role as the workhorse of the x-ray imaging devices. This role is being extended with the development of a 22X magnification Kirkpatrick-Baez x-ray microscope with multilayer x-ray mirrors. These mirrors can operate at large angles, high x-ray energies, and have a narrow, well defined x-ray energy bandpass. This will make them useful for numerous experiments. However, where a large solid angle is needed, the Woelter microscope will still be necessary and the technology needed to build them will be useful for many other types of x-ray optics.

Price, R.H.




SciTech Connect

Apparently diffuse X-ray emission has been known to exist along the central quarter of the Galactic Plane since the beginning of X-ray astronomy; this is referred to as the Galactic Ridge X-ray emission (GRXE). Recent deep X-ray observations have shown that numerous X-ray point sources account for a large fraction of the GRXE in the hard band (2-8 keV). However, the nature of these sources is poorly understood. Using the deepest X-ray observations made in the Chandra bulge field, we present the result of a coherent photometric and spectroscopic analysis of individual X-ray point sources for the purpose of constraining their nature and deriving their fractional contributions to the hard-band continuum and Fe K line emission of the GRXE. Based on the X-ray color-color diagram, we divided the point sources into three groups: A (hard), B (soft and broad spectrum), and C (soft and peaked spectrum). The group A sources are further decomposed spectrally into thermal and non-thermal sources with different fractions in different flux ranges. From their X-ray properties, we speculate that the group A non-thermal sources are mostly active galactic nuclei and the thermal sources are mostly white dwarf (WD) binaries such as magnetic and non-magnetic cataclysmic variables (CVs), pre-CVs, and symbiotic stars, whereas the group B and C sources are X-ray active stars in flares and quiescence, respectively. In the log N-log S curve of the 2-8 keV band, the group A non-thermal sources are dominant above Almost-Equal-To 10{sup -14} erg cm{sup -2} s{sup -1}, which is gradually taken over by Galactic sources in the fainter flux ranges. The Fe K{alpha} emission is mostly from the group A thermal (WD binaries) and the group B (X-ray active stars) sources.

Morihana, Kumiko [Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)] [Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Tsujimoto, Masahiro; Ebisawa, Ken [Japan Aerospace Exploration Agency, Institute of Space and Astronautical Science, 3-1-1 Yoshino-dai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan)] [Japan Aerospace Exploration Agency, Institute of Space and Astronautical Science, 3-1-1 Yoshino-dai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Yoshida, Tessei, E-mail: morihana@crab.riken.jp [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan)] [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan)



Transverse Coherence of the LCLS X-Ray Beam  

SciTech Connect

Self-amplifying spontaneous radiation free-electron lasers, such as the LCLS or the European X-FEL, rely on the incoherent, spontaneous radiation as the seed for the amplifying process. Though this method overcomes the need for an external seed source one drawback is the incoherence of the effective seed signal. The FEL process allows for a natural growth of the coherence because the radiation phase information is spread out within the bunch due to slippage and diffraction of the radiation field. However, at short wavelengths this spreading is not sufficient to achieve complete coherence. In this presentation we report on the results of numerical simulations of the LCLS X-ray FEL. From the obtained radiation field distribution the coherence properties are extracted to help to characterize the FEL as a light source.

Not Available



X-rays Illuminate Ancient Archimedes Text  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links: Related Links: May 2005 Headlines TIP Article Press Release Walters Art Museum SSRL Home Page SLAC Home Page Stanford Home Page Tuesday, 31 May 2005 X-rays Illuminate Ancient Archimedes Text (contact: Uwe Bergmann, bergmann@slac.stanford.edu) Archimedes Figure Image provided by Will Noel, The Walters Art Museum An early transcription of Archimedes' mathematical theories has been brought to light through the probing of high-intensity x-rays at SSRL's BL6-2. The text contains part of the Method of Mechanical Theorems, one of Archimedes' most important works, which was probably copied out by a scribe in the tenth century. The parchment on which it was written was later scraped down and reused as pages in a twelfth century prayer book, producing a document known as a palimpsest (which comes from the Greek,



NLE Websites -- All DOE Office Websites (Extended Search)

BRILLIANCE X-RAY SCATTERING FOR BRILLIANCE X-RAY SCATTERING FOR LIFE SCIENCES (LIX) Group Leader: Lin Yang Proposal Team: O. Bilsel 1 , B. Hsiao 2 , H. Huang 3 , T. Irving 4 , A. Menzel 5 , L. Pollack 6 , C. Riekel 7 , J. Rubert 8 , H. Tsuruta 9 , L. Yang 10 1 University of Massachusetts, 2 Stony Brook University, 3 Rice University, 4 IIT, 5SLS, 6 Cornell University, 7 European Synchrotron Radiation Facility, 8 NEU, 9 Stanford Synchrotron Radiation Lightsource, 10 Brookhaven National Laboratory TECHNIQUES AND CAPABILITIES APPLICATIONS ADDITIONAL INFORMATION * Energy range 2-20keV using undulator source. Simultaneous SAXS/WAXS to cover 0.003-3Å -1 at 12keV with 1 micron spot size * Time-resolved solution scattering with resolution of (1) microseconds to milliseconds using continuous-flow mixing (5µm x 10µm spot size) and (2) milliseconds using stopped-


Element 104 identified by characteristic x rays  

Science Journals Connector (OSTI)

A research team at the Oak Ridge National Laboratory has recently announced that they have conclusively identified the 257 isotope of element 104. This new work shows promise of shedding light on the controversy between Albert Ghiorso and Georgi N. Flerov the leaders respectively of the groups at Lawrence Berkeley Laboratory and the Joint Institute for Nuclear Research Dubna. The isotope 104 X 257 decays by alpha emission to 102 No 253 with a half?life of 4.3 seconds. The Oak Ridge group observed the K?series x rays from nobelium in coincidence with the alpha particles from 104 X 257 ; the observation of x?ray spectra has never been reported previously by the Berkeley or Dubna workers according to Curtis E. Bemis Jr spokesman for the group.

Ronald J. Cohn



X-ray radiography for container inspection  

DOE Patents (OSTI)

Arrangements of X-ray inspection systems are described for inspecting high-z materials in voluminous objects such as containers. Inspection methods may involve generating a radiographic image based on detected attenuation corresponding to a pulsed beams of radiation transmitted through a voluminous object. The pulsed beams of radiation are generated by a high-energy source and transmitted substantially downward along an incident angle, of approximately 1.degree. to 30.degree., to a vertical axis extending through the voluminous object. The generated radiographic image may be analyzed to detect on localized high attenuation representative of high-z materials and to discriminate high-z materials from lower and intermediate-z materials on the basis of the high density and greater attenuation of high-z material for higher energy (3-10 MeV) X-rays, and the compact nature of threatening masses of fissionable materials.

Katz, Jonathan I. (Clayton, MO); Morris, Christopher L. (Los Alamos, NM)



Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


X-Ray Absorption Spectroscopy of Transition Metal-Magnesium Hydride Thin  

NLE Websites -- All DOE Office Websites (Extended Search)

X-Ray Absorption Spectroscopy of Transition Metal-Magnesium Hydride Thin X-Ray Absorption Spectroscopy of Transition Metal-Magnesium Hydride Thin Films Title X-Ray Absorption Spectroscopy of Transition Metal-Magnesium Hydride Thin Films Publication Type Journal Article LBNL Report Number LBNL-50574 Year of Publication 2002 Authors Richardson, Thomas J., Baker Farangis, Jonathan L. Slack, Ponnusamy Nachimuthu, Rupert C. C. Perera, Nobumichi Tamura, and Michael D. Rubin Journal Journal of Alloys and Compounds Volume 356-357 Start Page 204 Pagination 204-207 Date Published 08/2003 Keywords A. hydrogen storage materials, NEXAFS, thin film s; C. EXAFS, x-ray diffraction Abstract Mixed metal thin films containing magnesium and a first-row transition element exhibit very large changes in both reflectance and transmittance on exposure to hydrogen gas. Changes in electronic structure and coordination of the magnesium and transition metal atoms during hydrogen absorption were studied using dynamic in situ transmission mode X-ray absorption spectroscopy. Mg K-edge and Ni, Co, and Ti L-edge spectra reflect both reversible and irreversible changes in the metal environments. A significant shift in the nickel L absorption edge shows it to be an active participant in hydride formation. The effect on cobalt and titanium is much less dramatic, suggesting that these metals act primarily as catalysts for formation of magnesium hydride.


Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Lensless Imaging of Whole Biological Cells with Soft X-Rays Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Wednesday, 26 May 2010 00:00 A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

SciTech Connect

The application of high-resolution X-ray spectroscopy methods to study the photosynthetic water oxidizing complex, which contains a unique hetero-nuclear catalytic Mn4Ca cluster, are described. Issues of X-ray damage especially at the metal sites in the Mn4Ca cluster are discussed. The structure of the Mn4Ca catalyst at high-resolution which has so far eluded attempts of determination by X-ray diffraction, EXAFS and other spectroscopic techniques has been addressed using polarized EXAFS techniques applied to oriented PS II membrane preparations and PS II single crystals. A review of how the resolution of traditional EXAFS techniques can be improved, using methods such as range-extended EXAFS is presented, and the changes that occur in the structure of the cluster as it advances through the catalytic cycle are described. X-ray absorption and emission techniques (XANES and K? emission) have been used earlier to determine the oxidation states of the Mn4Ca cluster, and in this report we review the use of X-ray resonant Raman spectroscopy to understand the electronic structure of the Mn4Ca cluster as it cycles through the intermediate S-states.

Yachandra, Vittal; Yano, Junko; Kern, Jan; Pushkar, Yulia; Sauer, Kenneth; Glatzel, Pieter; Bergmann, Uwe; Messinger, Johannes; Zouni, Athina; Yachandra, Vittal K.



High Quality Image of Biomedical Object by X-ray Refraction Based Contrast Computed Tomography  

SciTech Connect

Recently we have developed a new Computed Tomography (CT) algorithm for refraction contrast that uses the optics of diffraction-enhanced imaging. We applied this new method to visualize soft tissue which is not visualized by the current absorption based contrast. The meaning of the contrast that appears in refraction-contrast X-ray CT images must be clarified from a biologic or anatomic point of view. It has been reported that the contrast is made with the specific gravity map with a range of approximately 10 {mu}arc sec. However, the relationship between the contrast and biologic or anatomic findings has not been investigated, to our knowledge. We compared refraction-contrast X-ray CT images with microscopic X-ray images, and we evaluated refractive indexes of pathologic lesions on phase-contrast X-ray CT images. We focused our attenuation of breast cancer and lung cancer as samples. X-ray refraction based Computed Tomography was appeared to be a pathological ability to depict the boundary between cancer nest and normal tissue, and inner structure of the disease.

Hashimoto, E. [Department of Photon-Science, School of Advanced Studies, Graduate University for Advanced Studies (GUAS), Shonan Village, Hayama, Kanagawa 240-0193 (Japan); Maksimenko, A.; Hirano, K.; Hyodo, K. [Photon Factory, Institute of Materials Structure Science, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Sugiyama, H. [Department of Photon-Science, School of Advanced Studies, Graduate University for Advanced Studies (GUAS), Shonan Village, Hayama, Kanagawa 240-0193 (Japan); Photon Factory, Institute of Materials Structure Science, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Shimao, D. [Department of Health Sciences, Ibaraki prefectural University of Health Sciences, 4669-2Ami, Ami, Inashiki, Ibaraki, 300-0394 (Japan); Nishino, Y.; Ishikawa, T. [RIKEN Harima Institute, 1-1-1 Kouto, Mikazuki, Sayo, Hyogo, 679-5148 (Japan); Yuasa, T. [Department of Bio-system Engineering, Faculty of Engineering Yamagata University, 4-3-16 Jonan, Yonezawa, Yamagata 992-8510 (Japan); Ichihara, S. [Dept. of Path., Nagoya Med. Center, Nat. Hospital Organization, Naka-ku, Nagoya 460-0001 (Japan); Arai, Y. [Matsumoto Dental University, 1980 Hirooka, Shiojiri, Nagano (Japan); Ando, M. [Department of Photon-Science, School of Advanced Studies, Graduate University for Advanced Studies (GUAS), Shonan Village, Hayama, Kanagawa 240-0193 (Japan); Photon Factory, Institute of Materials Structure Science, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Inst. of Sci. and Tech., Tokyo Univ. of Science, Yamasaki 2641, Noda, Chiba 278-8510 (Japan)



Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


Lensless Imaging of Whole Biological Cells with Soft X-Rays  

NLE Websites -- All DOE Office Websites (Extended Search)

Lensless Imaging of Whole Biological Cells with Soft X-Rays Print Lensless Imaging of Whole Biological Cells with Soft X-Rays Print A team of scientists has used x-ray diffraction microscopy at ALS Beamline 9.0.1 to make images of whole yeast cells, achieving the highest resolution-11 to 13 nanometers (billionths of a meter)-ever obtained with this method for biological specimens. Their success indicates that full 3-D tomography of whole cells at equivalent resolution should soon be possible. The National Center for X-Ray Tomography at ALS Beamline 2.1 images whole, frozen hydrated cells in 3-D (see highlight "Imaging Antifungal Drug Molecules in Action using Soft X-Ray Tomography"). Large numbers of cells can currently be processed in a short time at resolutions of 40 to 60 nanometers, but the ability to increase resolution to the 10-nanometer range would enhance research capabilities in both biology and materials sciences.


Patterned Block-Copolymer-Silica Mesostructures as Host Media for the Laser Dye Rhodamine 6G  

E-Print Network (OSTI)

-gel route using poly-b-poly(propylene oxide)-b-poly(ethylene oxide) (EOx-POy-EOx) block copolymer with soft lithography to produce high- quality waveguides. This enables efficient waveguiding in the line123) and (EO)106(PO)70- (EO)106 (F127), X-ray diffraction patterns and transmission electron

Yang, Peidong


Sample holder for X-ray diffractometry  

DOE Patents (OSTI)

A sample holder for use with X-ray diffractometers with the capability to rotate the sample, as well as to adjust the position of the sample in the x, y, and z directions. Adjustment in the x direction is accomplished through loosening set screws, moving a platform, and retightening the set screws. Motion translators are used for adjustment in the y and z directions. An electric motor rotates the sample, and receives power from the diffractometer.

Hesch, Victor L. (Los Alamos, NM)



Columbia University X-Ray Measurements  

E-Print Network (OSTI)

V-720 keV · NaI 2x2x2" detector views an energy range of 1 keV-3 MeV Store signal in the tree. computer configuration. Plasmas were created using multi-frequency ECRH, and we find that most of the plasma energy is stored in the fast electrons. The energy spectrum of the x-ray emission below 740 keV is measured


Silicon Absolute X-Ray Detectors  

SciTech Connect

The responsivity of silicon photodiodes having no loss in the entrance window, measured using synchrotron radiation in the 1.75 to 60 keV range, was compared to the responsivity calculated using the silicon thickness measured using near-infrared light. The measured and calculated responsivities agree with an average difference of 1.3%. This enables their use as absolute x-ray detectors.

Seely, John F. [Naval Research Laboratory, Washington, D.C. 20375 (United States); Korde, Raj; Sprunck, Jacob [International Radiation Detectors, Inc., Torrance, CA 90505-5243 (United States); Medjoubi, Kadda; Hustache, Stephanie [Synchrotron SOLEIL, L'Orme des Merisiers, Saint-Aubin, BP 48, 91192 Gif-sur-Yvette CEDEX (France)



Ultrashort x-ray backlighters and applications  

SciTech Connect

Previously, using ultrashort laser pulses focused onto solid targets, we have experimentally studied a controllable ultrafast broadband radiation source in the extreme ultraviolet for time-resolved dynamical studies in ultrafast science [J. Workman, A. Maksimchuk, X. Llu, U. Ellenberger, J. S. Coe, C.-Y. Chien, and D. Umstadter, ``Control of Bright Picosecond X-Ray Emission from Intense Sub- Picosecond Laser-Plasma Interactions,`` Phys. Rev. Lett. 75, 2324 (1995)]. Once armed with a bright ultrafast broadband continuum x-ray source and appropriate detectors, we used the source as a backlighter to study a remotely produced plasma. The application of the source to a problem relevant to high-density matter completes the triad: creating and controlling, efficiently detecting, and applying the source. This work represented the first use of an ultrafast laser- produced x-ray source as a time-resolving probe in an application relevant to atomic, plasma and high-energy-density matter physics. Using the x-ray source as a backlighter, we adopted a pump-probe geometry to investigate the dynamic changes in electronic structure of a thin metallic film as it is perturbed by an ultrashort laser pulse. Because the laser deposits its energy in a skin depth of about 100 {Angstrom} before expansion occurs, up to gigabar pressure shock waves lasting picosecond in duration have been predicted to form in these novel plasmas. This raises the possibility of studying high- energy-density matter relevant to inertial confinement fusion (ICF) and astrophysics in small-scale laboratory experiments. In the past, time-resolved measurements of K-edge shifts in plasmas driven by nanosecond pulses have been used to infer conditions in highly compressed materials. In this study, we used 100-fs laser pulses to impulsively drive shocks into a sample (an untamped 1000 {Angstrom} aluminum film on 2000 {Angstrom} of parylene-n), measuring L-edge shifts.

Umstadter, D., University of Michigan



Development of a Schwarzschild-type x-ray microscope  

Science Journals Connector (OSTI)

A Schwarzschild-type x-ray microscope has been designed, constructed, and tested. Ni/C multilayers were used as the x-ray mirrors, with a thickness (2d) of 7 nm and 30 layer pairs. The...

Kado, M; Yamashita, K; Ohtani, M; Tanaka, K A; Kodama, R; Kitamoto, S; Yamanaka, T; Nakai, S



A Record Run for the APS X-ray Source  

NLE Websites -- All DOE Office Websites (Extended Search)

2004 | 2003 | 2002 | 2001 2000 Subscribe to APS News rss feed A Record Run for the APS X-ray Source FEBRUARY 23, 2012 Bookmark and Share The APS storage ring. X-ray beams and...


Resonant Soft X-Ray Scattering - Combining Structural with Spectroscop...  

NLE Websites -- All DOE Office Websites (Extended Search)

Resonant Soft X-Ray Scattering - Combining Structural with Spectroscopic Refinement Friday, September 28, 2012 - 10:00am SLAC, Bldg. 137, Room 322 SSRL Presents Kevin Stone X-ray...



NLE Websites -- All DOE Office Websites (Extended Search)

TENDER ENERGY X-RAY ABSORPTION TENDER ENERGY X-RAY ABSORPTION SPECTROSCOPY (TES) Project Team: S. Bare 1,2 , J. Brandes 3 , T. Buonassisi 4 , J. Chen 5,2 , M. Croft 6 , E. DiMasi 7 , A. Frenkel 8,2 , D. Hesterberg 9 , S. Hulbert 7,2 , S. Khalid 7 , S. Myneni 10 , P. Northrup 7,11 , E.T. Rasbury 11 , B. Ravel 12 , R. Reeder 11 , J. Rodriguez 7,2 , D. Sparks 5,13 , V. Stojanoff 7 , G. Waychunas 14 1 UOP LLC, 2 Synchrotron Catalysis Consortium, 3 Skidaway Inst. of Oceanography, 4 MIT Laboratory for Photovoltaics Research, 5 Univ. of Delaware, 6 Rutgers Univ., 7 Brookhaven National Lab, 8 Yeshiva Univ., 9 North Carolina State Univ., 10 Princeton Univ., 11 Stony Brook Univ., 12 NIST, 13 Delaware Environmental Inst., 14 Lawrence Berkeley National Lab TECHNIQUES: High performance and in-situ X-ray absorption spectroscopy and spatially-resolved XAS of


The X-ray Telescope of CAST  

E-Print Network (OSTI)

The Cern Axion Solar Telescope (CAST) is in operation and taking data since 2003. The main objective of the CAST experiment is to search for a hypothetical pseudoscalar boson, the axion, which might be produced in the core of the sun. The basic physics process CAST is based on is the time inverted Primakoff effect, by which an axion can be converted into a detectable photon in an external electromagnetic field. The resulting X-ray photons are expected to be thermally distributed between 1 and 7 keV. The most sensitive detector system of CAST is a pn-CCD detector combined with a Wolter I type X-ray mirror system. With the X-ray telescope of CAST a background reduction of more than 2 orders off magnitude is achieved, such that for the first time the axion photon coupling constant g_agg can be probed beyond the best astrophysical constraints g_agg < 1 x 10^-10 GeV^-1.

M. Kuster; H. Bräuninge