Powered by Deep Web Technologies
Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Method for characterizing mask defects using image reconstruction from X-ray diffraction patterns  

DOE Patents [OSTI]

The invention applies techniques for image reconstruction from X-ray diffraction patterns on the three-dimensional imaging of defects in EUVL multilayer films. The reconstructed image gives information about the out-of-plane position and the diffraction strength of the defect. The positional information can be used to select the correct defect repair technique. This invention enables the fabrication of defect-free (since repaired) X-ray Mo--Si multilayer mirrors. Repairing Mo--Si multilayer-film defects on mask blanks is a key for the commercial success of EUVL. It is known that particles are added to the Mo--Si multilayer film during the fabrication process. There is a large effort to reduce this contamination, but results are not sufficient, and defects continue to be a major mask yield limiter. All suggested repair strategies need to know the out-of-plane position of the defects in the multilayer.

Hau-Riege, Stefan Peter (Fremont, CA)



X-ray Diffraction (XRD) 1.0 What is X-ray Diffraction  

E-Print Network [OSTI]

X-ray Diffraction (XRD) · 1.0 What is X-ray Diffraction · 2.0 Basics of Crystallography · 3.0 Production of X-rays · 4.0 Applications of XRD · 5.0 Instrumental Sources of Error · 6.0 Conclusions #12 why the cleavage faces of crystals appear to reflect X-ray beams at certain angles of incidence (theta

Moeck, Peter


Amyloid Treatment and Research Program key research findings: Definition of the electron microscopic structure and x-ray diffraction pattern of amyloid  

E-Print Network [OSTI]

, which for the first time defined the biochemical nature and source of the amyloid fibril in this form microscopic structure and x-ray diffraction pattern of amyloid fibrils in 1967, providing key insight of amyloidosis. Characterization of the protein deposits in dialysis-associated amyloidosis as 2- microglobulin

Finzi, Adrien


In-situ mechanical testing during X-ray diffraction  

SciTech Connect (OSTI)

Deforming metals during recording X-ray diffraction patterns is a useful tool to get a deeper understanding of the coupling between microstructure and mechanical behaviour. With the advances in flux, detector speed and focussing techniques at synchrotron facilities, in-situ mechanical testing is now possible during powder diffraction and Laue diffraction. The basic principle is explained together with illustrative examples.

Van Swygenhoven, Helena, E-mail: helena.vanswygenhoven@psi.ch; Van Petegem, Steven



X-Ray Diffraction The X-Ray Diffraction facility is equipped with state-of-the-art  

E-Print Network [OSTI]

X-Ray Diffraction The X-Ray Diffraction facility is equipped with state-of-the-art diffractometers offering both single crystal and powder X-Ray diffraction. Powder X-Ray Diffraction High resolution data For more details on powder X-Ray analysis contact Dr J Hriljac on 0121 414 4458 or email: j

Birmingham, University of


J. Mol. Biol. (1984) 177, 201-206 Some X-ray Diffraction Patterns from  

E-Print Network [OSTI]

awaits a molecular model. In vivo and in vitro produced two-dimensional sheets and helices have been methanol (type M) or a mixture of methanol and ethylene glycol (type ME). Sharp, resolvable patterns% (v v methanol at pH 8.7, using a modified version of' the/ ) crystallization method described

Yonath, Ada E.


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Biological Imaging by Soft X-Ray Diffraction Microscopy Print Wednesday, 30 November 2005 00:00 Electron and x-ray...


X-Ray Diffraction on NIF  

SciTech Connect (OSTI)

The National Ignition Facility (NIF) is currently a 192 beam, 1.6 MJ laser. NIF Ramp-Compression Experiments have already made the relevant exo-planet pressure range from 1 to 50 Mbar accessible. We Proposed to Study Carbon Phases by X-Ray Diffraction on NIF. Just a few years ago, ultra-high pressure phase diagrams for materials were very 'simple'. New experiments and theories point out surprising and decidedly complex behavior at the highest pressures considered. High pressures phases of aluminum are also predicted to be complex. Recent metadynamics survey of carbon proposed a dynamic pathway among multiple phases. We need to develop diagnostics and techniques to explore this new regime of highly compressed matter science. X-Ray Diffraction - Understand the phase diagram/EOS/strength/texture of materials to 10's of Mbar. Strategy and physics goals: (1) Powder diffraction; (2) Begin with diamond; (3) Continue with metals etc.; (4) Explore phase diagrams; (5) Develop liquid diffraction; and (6) Reduce background/improve resolution.

Eggert, J H; Wark, J



X-ray Diffraction Laboratory Department of Chemistry  

E-Print Network [OSTI]

X-ray Diffraction Laboratory Department of Chemistry Texas A & M University College Station, Texas Phone : 979-845-9125 www.chem.tamu.edu/xray xray@tamu.edu X-rayDiffractionLaboratory DepartmentofChemistry 3255TAMU CollegeStation,TX77843-3255 Mission The purpose of our laboratory is to provide X-ray

Meagher, Mary


X-ray Diffraction Practicals 1 Graphics Programs  

E-Print Network [OSTI]

X-ray Diffraction Practicals 1 Graphics Programs that will read SHELX or CIF files J. Reibenspies, N. Bhuvanesh ver 1.0.0 #12;X-ray Diffraction Practicals 2 Free software. Gretep : Reads SHELX files shelx files or output thermal ellipsoid plots. http://www.umass.edu/microbio/rasmol/ #12;X-ray

Meagher, Mary


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biological Imaging by Soft X-Ray Diffraction Microscopy Print Electron and x-ray microscopes are a valuable tool for both the life and materials sciences, but they are limited in...


Transient x-ray diffraction and its application to materials science and x-ray optics  

SciTech Connect (OSTI)

Time resolved x-ray diffraction and scattering have been applied to the measurement of a wide variety of physical phenomena from chemical reactions to shock wave physics. Interest in this method has heightened in recent years with the advent of versatile, high power, pulsed x-ray sources utilizing laser plasmas, electron beams and other methods. In this article, we will describe some of the fundamentals involved in time resolved x-ray diffraction, review some of the history of its development, and describe some recent progress in the field. In this article we will emphasize the use of laser-plasmas as the x-ray source for transient diffraction.

Hauer, A.A.; Kopp, R.; Cobble, J.; Kyrala, G.; Springer, R. [and others



Single-particle structure determination by correlations of snapshot X-ray diffraction patterns (CXIDB ID 20)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

This deposition includes the diffraction images generated by the paired polystyrene spheres in random orientations. These images were used to determine and phase the single particle diffraction volume from their autocorrelation functions.

Starodub, D.


In Operando X-ray Diffraction and Transmission X-ray Microscopy of Lithium Sulfur Batteries  

E-Print Network [OSTI]

In Operando X-ray Diffraction and Transmission X-ray Microscopy of Lithium Sulfur Batteries Johanna Information ABSTRACT: Rechargeable lithium-sulfur (Li-S) batteries hold great potential for high of these batteries for commercial use. The two primary obstacles are the solubility of long chain lithium

Cui, Yi


Beyond hard x-ray photoelectron spectroscopy: Simultaneous combination with x-ray diffraction  

SciTech Connect (OSTI)

Hard x-ray photoelectron spectroscopy (HAXPES) is a powerful and novel emerging technique for the nondestructive determination of electronic properties and chemical composition of bulk, buried interfaces and surfaces. It benefits from the exceptionally large escape depth of high kinetic energy photoelectrons, increasing the information depth up to several tens of nanometers. Complementing HAXPES with an atomic structure sensitive technique (such as x-ray diffraction) opens a new research field with major applications for materials science. At SpLine, the Spanish CRG beamline at the European Synchrotron Radiation Facility, we have developed a novel experimental set-up that combines HAXPES and x-ray diffraction (x-ray reflectivity, surface x-ray diffraction, grazing incidence x-ray diffraction, and reciprocal space maps). Both techniques can be operated simultaneously on the same sample and using the same excitation source. The set-up includes a robust 2S + 3D diffractometer hosting a ultrahigh vacuum chamber equipped with a unique photoelectron spectrometer (few eV < electron kinetic energy < 15 keV), x-ray tube (Mg/Ti), 15 keV electron gun, and auxiliary standard surface facilities (molecular beam epitaxy evaporator, ion gun, low energy electron diffraction, sample heating/cooling system, leak valves, load-lock sample transfer, etc.). This end-station offers the unique possibility of performing simultaneous HAXPES + x-ray diffraction studies. In the present work, we describe the experimental set-up together with two experimental examples that emphasize its outstanding capabilities: (i) nondestructive characterization of the Si/Ge and HfO{sub 2}/SiO{sub 2} interfaces on Ge-based CMOS devices, and (ii) strain study on La{sub 0.7}Ca{sub 0.3}MnO{sub 3} ultrathin films grown on SrTiO{sub 3}(001) substrate.

Rubio-Zuazo, Juan; Castro, German R. [SpLine, Spanish CRG beamline at the European Synchrotron Radiation Facility, B.P. 220, F-38043 Grenoble (France) and ICMM-CSIC Cantoblanco, E-28049 Madrid (Spain)



X-Ray Diffraction Microscopy of Magnetic Structures  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search) Citation: J.J. Turner et al., "X-Ray Diffraction Microscopy of Magnetic Structures," Phys. Rev. Lett. 107, 033904 (2011). Web: http:prl.aps.orgpdfPRLv107i3e033904...


Nanofabrication of Diffractive X-ray Optics for Synchrotrons...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanofabrication of Diffractive X-ray Optics for Synchrotrons and XFELs Wednesday, March 11, 2015 - 3:00pm SLAC, Redtail Hawk Conference Room 108A Speaker: Christian David, Paul...


X-Ray Diffraction Studies of Copper Nanopowder  

E-Print Network [OSTI]

Copper nanopowder preparation and its X-Ray diffraction studies are reported in this paper. Electrolytic cathode deposition method is simple and cheapest process for its preparation. Copper nanopowder has been prepared from aqueous copper sulphate solution. Wide range of experimental conditions has been adopted in this process and its X-Ray diffraction characterizations have been studied. The results confirming copper nanopowder with size below 30 nm. Uniformed size Copper nanopowder preparation, in normal room temperature is importance of this study.

T. Theivasanthi; M. Alagar



Anomalous X-ray Diffraction Studies for Photovoltaic Applications  

SciTech Connect (OSTI)

Anomalous X-ray Diffraction (AXRD) has become a useful technique in characterizing bulk and nanomaterials as it provides specific information about the crystal structure of materials. In this project we present the results of AXRD applied to materials for photovoltaic applications: ZnO loaded with Ga and ZnCo{sub 2}O{sub 4} spinel. The X-ray diffraction data collected for various energies were plotted in Origin software. The peaks were fitted using different functions including Pseudo Voigt, Gaussian, and Lorentzian. This fitting provided the integrated intensity data (peaks area values), which when plotted as a function of X-ray energies determined the material structure. For the first analyzed sample, Ga was not incorporated into the ZnO crystal structure. For the ZnCo{sub 2}O{sub 4} spinel Co was found in one or both tetrahedral and octahedral sites. The use of anomalous X-ray diffraction (AXRD) provides element and site specific information for the crystal structure of a material. This technique lets us correlate the structure to the electronic properties of the materials as it allows us to probe precise locations of cations in the spinel structure. What makes it possible is that in AXRD the diffraction pattern is measured at a number of energies near an X-ray absorption edge of an element of interest. The atomic scattering strength of an element varies near its absorption edge and hence the total intensity of the diffraction peak changes by changing the X-ray energy. Thus AXRD provides element specific structural information. This method can be applied to both crystalline and liquid materials. One of the advantages of AXRD in crystallography experiments is its sensitivity to neighboring elements in the periodic tables. This method is also sensitive to specific crystallographic phases and to a specific site in a phase. The main use of AXRD in this study is for transparent conductors (TCs) analysis. TCs are considered to be important materials because of their efficiency and low risk of environmental pollution. These materials are important to solar cells as a result of their remarkable combination of optical and electrical properties, including high electrical conductivity and high optical transparency in the spectrum of visible light. TCs provide a transparent window, which allows sunlight to pass through while also allowing electricity to conduct out of the cell. Spinel materials have the chemical form AB{sub 2}O{sub 4}, and are made of a face-centered cubic (FCC) lattice of oxygen anions and cations in specific interstitial sites. A normal spinel has all A cations on tetrahedral sites and B cations on octahedral sites. In contrast; an inverse spinel has the A and half of the B cations on octahedral sites and the other half of the B cations on tetrahedral sites; a mixed spinel lies between. In the spinel structure, 8 of 64 possible tetrahedral sites and 16 of 32 possible octahedral sites are filled. Normal spinels have particularly high conduction as the linear octahedral chains of B cations likely serve as conduction paths. In this paper we present how the data obtained with AXRD is used to analyze TCs properties as they apply to photovoltaic applications. One of the materials used for this analysis is zinc oxide. It has been loaded with 5% and 10% of Ga, which has an absorption edge of 10367 eV. The peak (100) was measured for the zinc oxide loaded with 10% Ga. In the case of 5% Ga, we measured peaks (100) and (101). With the information provided by the AXRD we can identify if Ga is being incorporated in the ZnO crystal structure. The analysis of 311 plane in the ZnCo{sub 2}O{sub 4} spinel shows if Co is in tetrahedral or octahedral site.

Not Available



X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPUSERFD form that can be accessed by the X-ray diffraction webpage. RESPONSIBILITY: The X-ray Diffraction and suggestions in a timely manner. MATERIALS: · Computer Database · Web interface #12;X-ray Diffraction

Meagher, Mary

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Biological imaging by soft x-ray diffraction microscopy  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

We have used the method of x-ray diffraction microscopy to image the complex-valued exit wave of an intact and unstained yeast cell. The images of the freeze-dried cell, obtained by using 750-eV x-rays from different angular orientations, portray several of the cell's major internal components to 30-nm resolution. The good agreement among the independently recovered structures demonstrates the accuracy of the imaging technique. To obtain the best possible reconstructions, we have implemented procedures for handling noisy and incomplete diffraction data, and we propose a method for determining the reconstructed resolution. This work represents a previously uncharacterized application of x-ray diffraction microscopy to a specimen of this complexity and provides confidence in the feasibility of the ultimate goal of imaging biological specimens at 10-nm resolution in three dimensions.

Shapiro, D.; Thibault, P.; Beetz, T.; Elser, V.; Howells, M.; Jacobsen, C.; Kirz, J.; Lima, E.; Miao, H.; Neiman, A. M.; Sayre, D.



Femtosecond X-ray Diffraction From Two-Dimensional Protein Crystals  

SciTech Connect (OSTI)

Here we present femtosecond x-ray diffraction patterns from two-dimensional (2-D) protein crystals using an x-ray free electron laser (XFEL). To date it has not been possible to acquire x-ray diffraction from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permits a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy methodology at the Linac Coherent Light Source, we observed Bragg diffraction to better than 8.5 resolution for two different 2-D protein crystal samples that were maintained at room temperature. These proof-of-principle results show promise for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.

Frank, Matthias; Carlson, David B.; Hunter, Mark; Williams, Garth J.; Messerschmidt, Marc; Zatsepin, Nadia A.; Barty, Anton; Benner, Henry; Chu, Kaiqin; Graf, Alexander; Hau-Riege, Stefan; Kirian, Rick; Padeste, Celestino; Pardini, Tommaso; Pedrini, Bill; Segelke, Brent; Seibert, M. M.; Spence , John C.; Tsai, Ching-Ju; Lane, Steve M.; Li, Xiao-Dan; Schertler, Gebhard; Boutet, Sebastien; Coleman, Matthew A.; Evans, James E.



X-ray Diffraction / MSE 603 Spring 2002 Qun Shen / CHESS qs11@cornell.edu  

E-Print Network [OSTI]

X-ray Diffraction / MSE 603 Spring 2002 Qun Shen / CHESS qs11@cornell.edu 1. X-ray production & basic properties ­ common sources for diffraction experiments ­ synchrotron radiation ­ response to x-rays by an electron ­ refraction index ­ total external reflection & evanescent wave, TXRF 2. X-ray scattering basics

Shen, Qun


Signal-to-noise and radiation exposure considerations in conventional and diffraction x-ray microscopy  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

Using a signal-to-noise ratio estimation based on correlations between multiple simulated images, we compare the dose efficiency of two soft x-ray imaging systems: incoherent brightfield imaging using zone plate optics in a transmission x-ray microscope (TXM), and x-ray diffraction microscopy (XDM) where an image is reconstructed from the far-field coherent diffraction pattern. In XDM one must computationally phase weak diffraction signals; in TXM one suffers signal losses due to the finite numerical aperture and efficiency of the optics. In simulations with objects representing isolated cells such as yeast, we find that XDM has the potential for delivering equivalent resolution images using fewer photons. This can be an important advantage for studying radiation-sensitive biological and soft matter specimens.

Huang, Xiaojing; Miao, Huijie; Steinbrener, Jan; Nelson, Johanna; Shapiro, David; Stewart, Andrew; Turner, Joshua; Jacobsen, Chris



Borman effect in resonant diffraction of X-rays  

SciTech Connect (OSTI)

A dynamic theory of resonant diffraction (occurring when the energy of incident radiation is close to the energy of the absorption edge of an element in the composition of a given substance) of synchronous X-rays is developed in the two-wave approximation in the coplanar Laue geometry for large grazing angles in perfect crystals. A sharp decrease in the absorption coefficient in the substance with simultaneously satisfied diffraction conditions (Borman effect) is demonstrated, and the theoretical and first experimental results are compared. The calculations reveal the possibility of applying this approach in analyzing the quadrupole-quadrupole contribution to the absorption coefficient.

Oreshko, A. P., E-mail: ap.oreshko@physics.msu.ru [Moscow State University (Russian Federation)



X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPLABSEC that will prevent unwanted access to X-ray diffraction laboratory by unauthorized users. POLICY: All entrance to the X-ray Diffraction Laboratory is controlled by magnetic ID cards issued by Texas A & M University

Meagher, Mary


Portable X-Ray Diffraction (XRD) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:Plug Power Inc Jump to:Venture,149.PopeNewX-Ray Diffraction (XRD)


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series to someone6 M. Babzien,Biological Imaging by Soft X-Ray Diffraction


Femtosecond diffractive imaging with a soft-X-ray free-electron laser  

E-Print Network [OSTI]

LETTERS Femtosecond diffractive imaging with a soft-X-ray free-electron laser HENRY N. CHAPMAN1 of this principle using the FLASH soft-X-ray free-electron laser. An intense 25 fs, 4 ? 1013 W cm-2 pulse by one10 . X-ray free-electron lasers (FELs) are expected to permit diffractive imaging at high

Loss, Daniel


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPDATSMA data collection on the Bruker SMART1000 Single-crystal X-ray Diffractometer. POLICY: Data must. BACKGROUND AND PRECAUTIONS 1. Single-Crystal X-ray diffraction is a method by which investigators can

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPABSSTR for absolute structure determination on the Bruker GADDS Single-crystal X-ray Diffractometer. POLICY: Data must. BACKGROUND AND PRECAUTIONS 1. Single-Crystal X-ray diffraction is a method by which investigators can

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPPOWGAD data collection on the Bruker GADDS Powder X-ray Diffractometer. POLICY: Data must be collected AND PRECAUTIONS 1. Powder X-ray diffraction is a method by which investigators can identify the materials

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPDATSM1 to facilitate data collection on the Bruker APEXii Single-crystal X-ray Diffractometer. POLICY: Data must. BACKGROUND AND PRECAUTIONS 1. Single-Crystal X-ray diffraction is a method by which investigators can

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPDATGAD to facilitate data collection on the Bruker GADDS Single-crystal X-ray Diffractometer. POLICY: Data must. BACKGROUND AND PRECAUTIONS 1. Single-Crystal X-ray diffraction is a method by which investigators can

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPPOWD8 Standard Operating Procedure Title: X-ray Powder Diffraction: D8 Advanced Rev No: Issue date: 1.001 12/29/2008 Page: 1 of 3 SOP: SOPPOWD8 Last date revised: December 23 2009 Date approved: December 29 2009 X-ray

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPDATAP1 data collection on the Bruker APEXii Single-crystal X-ray Diffractometer. POLICY: Data must. BACKGROUND AND PRECAUTIONS 1. Single-Crystal X-ray diffraction is a method by which investigators can

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPDATAP2 to facilitate data collection on the Bruker APEXii Single-crystal X-ray Diffractometer. POLICY: Data must. BACKGROUND AND PRECAUTIONS 1. Single-Crystal X-ray diffraction is a method by which investigators can

Meagher, Mary


Preparation and X-Ray diffraction studies of curium hydrides  

SciTech Connect (OSTI)

Curium hydrides were prepared by reaction of curium-248 metal with hydrogen and characterized by X-ray powder diffraction. Several of the syntheses resulted in a hexagonal compound with average lattice parameters of a/sub 0/ = 0.3769(8) nm and c/sub 0/ = 0.6732(12) nm. These products are considere to be CmH/sub 3//sup -//sub 8/ by analogy with the behavior of lanthanide-hydrogen and lighter actinide-hydrogen systems. Face-centered cubic products with an average lattice parameter of a/sub 0/ = 0.5322(4) nm were obtained from other curium hydride preparations. This parameter is slightly smaller than that reported previously for cubic curium dihydride, CmH /SUB 2-x/ (B.M. Bansal and D. Damien. Inorg. Nucl. Chem. Lett. 6 603, 1970). The present results established a continuation of typical heavy trivalent lanthanidelike behavior of the transuranium actinide-hydrogen systems through curium.

Gibson, J.K.; Maire, R.G.



X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPALIGNA Standard Operating Procedure Title: X-ray Instrument Alignment ­ APEXII Rev No: Issue date: 1.001 6 the alignment of the APEXII single crystal X-ray diffractometer. POLICY: The instrument must be aligned

Meagher, Mary


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPSAXSLA Rev No: Issue date: 1.001 12/26/2008Standard Operating Procedure Title: Small Angle X-ray Scattering approved: December 26 2009 Small Angle X-ray Scattering, Rotating Anode PURPOSE: This Standard Operating

Meagher, Mary

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University  

E-Print Network [OSTI]

X-ray Diffraction Laboratory: Department of Chemistry Texas A & M University Doc. No: SOPALIGNS Standard Operating Procedure Title: X-ray Instrument Alignment ­ SMART1000 Rev No: Issue date: 1.001 6 the alignment of the SMART1000 single crystal X-ray diffractometer. POLICY: The instrument must be aligned

Meagher, Mary


A Curved Image-Plate Detector System for High-Resolution Synchrotron X-ray Diffraction  

SciTech Connect (OSTI)

The developed curved image plate (CIP) is a one-dimensional detector which simultaneously records high-resolution X-ray diffraction (XRD) patterns over a 38.7 2{theta} range. In addition, an on-site reader enables rapid extraction, transfer and storage of X-ray intensity information in {le}30 s, and further qualifies this detector to study kinetic processes in materials science. The CIP detector can detect and store X-ray intensity information linearly proportional to the incident photon flux over a dynamical range of about five orders of magnitude. The linearity and uniformity of the CIP detector response is not compromised in the unsaturated regions of the image plate, regardless of saturation in another region. The speed of XRD data acquisition together with excellent resolution afforded by the CIP detector is unique and opens up wide possibilities in materials research accessible through X-ray diffraction. This article presents details of the basic features, operation and performance of the CIP detector along with some examples of applications, including high-temperature XRD.

Sarin, P.; Haggerty, R; Yoon, W; Knapp, M; Berghaeuser, A; Zschack, P; Karapetrova, E; Yang, N; Kriven, W



Time-resolved x-ray diffraction techniques for bulk polycrystalline materials under dynamic loading  

SciTech Connect (OSTI)

We have developed two techniques for time-resolved x-ray diffraction from bulk polycrystalline materials during dynamic loading. In the first technique, we synchronize a fast detector with loading of samples at strain rates of ?10{sup 3}10{sup 4} s{sup ?1} in a compression Kolsky bar (split Hopkinson pressure bar) apparatus to obtain in situ diffraction patterns with exposures as short as 70 ns. This approach employs moderate x-ray energies (1020 keV) and is well suited to weakly absorbing materials such as magnesium alloys. The second technique is useful for more strongly absorbing materials, and uses high-energy x-rays (86 keV) and a fast shutter synchronized with the Kolsky bar to produce short (?40??s) pulses timed with the arrival of the strain pulse at the specimen, recording the diffraction pattern on a large-format amorphous silicon detector. For both techniques we present sample data demonstrating the ability of these techniques to characterize elastic strains and polycrystalline texture as a function of time during high-rate deformation.

Lambert, P. K.; Hustedt, C. J.; Zhao, M.; Ananiadis, A. G.; Hufnagel, T. C. [Department of Materials Science and Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Vecchio, K. S. [Department of NanoEngineering, University of California San Diego, La Jolla, California 92093 (United States); Huskins, E. L. [Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee 37830 (United States); US Army Research Laboratory, Aberdeen Proving Ground, Aberdeen, Maryland 21005 (United States); Casem, D. T. [US Army Research Laboratory, Aberdeen Proving Ground, Aberdeen, Maryland 21005 (United States); Gruner, S. M. [Department of Physics, Cornell University, Ithaca, New York 14853 (United States); Cornell High Energy Synchrotron Source (CHESS), Cornell University, Ithaca, New York 14853 (United States); Kavli Institute at Cornell for Nanoscale Science, Cornell University, Ithaca, New York 14853 (United States); Tate, M. W.; Philipp, H. T.; Purohit, P.; Weiss, J. T. [Department of Physics, Cornell University, Ithaca, New York 14853 (United States); Woll, A. R. [Cornell High Energy Synchrotron Source (CHESS), Cornell University, Ithaca, New York 14853 (United States); Kannan, V.; Ramesh, K. T. [Department of Mechanical Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Kenesei, P.; Okasinski, J. S.; Almer, J. [X-ray Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States)



Data preparation and evaluation techniques for x-ray diffraction microscopy  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

The post-experiment processing of X-ray Diffraction Microscopy data is often time-consuming and difficult. This is mostly due to the fact that even if a preliminary result has been reconstructed, there is no definitive answer as to whether or not a better result with more consistently retrieved phases can still be obtained. We show here that the first step in data analysis, the assembly of two-dimensional diffraction patterns from a large set of raw diffraction data, is crucial to obtaining reconstructions of highest possible consistency. We have developed software that automates this process and results in consistently accurate diffraction patterns. We have furthermore derived some criteria of validity for a tool commonly used to assess the consistency of reconstructions, the phase retrieval transfer function, and suggest a modified version that has improved utility for judging reconstruction quality.

Steinbrener, Jan; Nelson, Johanna; Huang, Xiaojing; Marchesini, Stefano; Shapiro, David; Turner, Joshua J.; Jacobsen, Chris



Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

We report the first image of an intact, frozen hydrated eukaryotic cell using x-ray diffraction microscopy, or coherent x-ray diffraction imaging. By plunge freezing the specimen in liquid ethane and maintaining it below -170 degrees C, artifacts due to dehydration, ice crystallization, and radiation damage are greatly reduced. In this example, coherent diffraction data using 520 eV x rays were recorded and reconstructed to reveal a budding yeast cell at a resolution better than 25 nm. This demonstration represents an important step towards high resolution imaging of cells in their natural, hydrated state, without limitations imposed by x-ray optics.

Huang, Xiaojing; Nelson, Johanna; Kirz, Janos; Lima, Enju; Marchesini, Stefano; Miao, Huijie; Neiman, Aaron; Shapiro, David; Steinbrener, Jan; Stewart, Andrew; Turner, Joshua; Jacobsen, Chris



Quality experimental and calculated powder x-ray diffraction  

SciTech Connect (OSTI)

For several years, we have submitted quality powder XRD patterns to the International Centre for Diffraction Data for inclusion as reference standards in their Powder Diffraction File. The procedure followed is described; examples used are {beta}-UH{sub 3}, {alpha}- BaT{sub 2}, alpha-lithium disilicate ({alpha}-Li{sub 2}Si{sub 2}O{sub 5}), and 2,2`,4,4`,6,6`hexanitroazobenzene-III (HNAB-III).

Sullenger, D.B.; Cantrell, J.S.; Beiter, T.A.; Tomlin, D.W.



Anti-contamination device for cryogenic soft X-ray diffraction microscopy  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

Cryogenic microscopy allows one to view frozen hydrated biological and soft matter specimens with good structural preservation and a high degree of stability against radiation damage. We describe a liquid nitrogen-cooled anti-contamination device for cryogenic X-ray diffraction microscopy. The anti-contaminator greatly reduces the buildup of ice layers on the specimen due to condensation of residual water vapor in the experimental vacuum chamber. We show by coherent X-ray diffraction measurements that this leads to fivefold reduction of background scattering, which is important for far-field X-ray diffraction microscopy of biological specimens.

Huang, Xiaojing; Miao, Huijie; Nelson, Johanna; Turner, Joshua; Steinbrener, Jan; Shapiro, David; Kirz, Janos; Jacobsen, Chris



Tracking the catalyzed growth process of nanowires by in situ x-ray diffraction  

E-Print Network [OSTI]

capacity.4­7 Silicon nanowires have also found application in solar cells, both as ab- sorber OF NANOSTRUCTURES Gold-catalyzed silicon nanowires were grown in an x-ray furnace so that in situ x-ray diffraction-type furnace attached to a Pana- lytical X'Pert PRO diffractometer. The temperature of the furnace

Wang, Zhong L.


Real-time X-ray Diffraction Measurements of Shocked Polycrystalline Tin and Aluminum  

SciTech Connect (OSTI)

A new, fast, single-pulse x-ray diffraction (XRD) diagnostic for determining phase transitions in shocked polycrystalline materials has been developed. The diagnostic consists of a 37-stage Marx bank high-voltage pulse generator coupled to a needle-and-washer electron beam diode via coaxial cable, producing line and bremsstrahlung x-ray emission in a 35-ns pulse. The characteristic K? lines from the selected anodes of silver and molybdenum are used to produce the diffraction patterns, with thin foil filters employed to remove the characteristic K? line emission. The x-ray beam passes through a pinhole collimator and is incident on the sample with an approximately 3-mm by 6-mm spot and 1 full-width-half-maximum (FWHM) angular divergence in a Bragg-reflecting geometry. For the experiments described in this report, the angle between the incident beam and the sample surface was 8.5. A Debye-Scherrer diffraction image was produced on a phosphor located 76 mm from the polycrystalline sample surface. The phosphor image was coupled to a charge-coupled device (CCD) camera through a coherent fiberoptic bundle. Dynamic single-pulse XRD experiments were conducted with thin foil samples of tin, shock loaded with a 1-mm vitreous carbon back window. Detasheet high explosive with a 2-mm-thick aluminum buffer was used to shock the sample. Analysis of the dynamic shock-loaded tin XRD images revealed a phase transformation of the tin beta phase into an amorphous or liquid state. Identical experiments with shock-loaded aluminum indicated compression of the face-centered-cubic (fcc) aluminum lattice with no phase transformation.

Dane V. Morgan, Don Macy, Gerald Stevens



E-Print Network 3.0 - angle x-ray diffraction Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Materials Science 60 Page 12 CHESS News Magazine 2005 FacilityHighlight Impact of a Future Energy Recovery Linac Summary: -rolled Aluminum SR X-ray diffraction. Map grain...


An atomic layer deposition chamber for in situ x-ray diffraction and scattering analysis  

SciTech Connect (OSTI)

The crystal structure of thin films grown by atomic layer deposition (ALD) will determine important performance properties such as conductivity, breakdown voltage, and catalytic activity. We report the design of an atomic layer deposition chamber for in situ x-ray analysis that can be used to monitor changes to the crystal structural during ALD. The application of the chamber is demonstrated for Pt ALD on amorphous SiO{sub 2} and SrTiO{sub 3} (001) using synchrotron-based high resolution x-ray diffraction, grazing incidence x-ray diffraction, and grazing incidence small angle scattering.

Geyer, Scott M.; Methaapanon, Rungthiwa; Kim, Woo-Hee; Bent, Stacey F., E-mail: sbent@stanford.edu [Department of Chemical Engineering, Stanford University, Stanford, California 94305 (United States); Johnson, Richard W. [Department of Materials Science and Engineering, Stanford University, Stanford, California 94305 (United States); Van Campen, Douglas G.; Metha, Apurva [SLAC National Accelerator Laboratory, Stanford Synchrotron Radiation Lightsource, Menlo Park, California 94025 (United States)



Stratigraphic correlation with X-ray powder patterns  

E-Print Network [OSTI]

of certain metallic trace elements, notably magnesium, iron, aluminum, and strontium, and on this basis were able to pick out sones within a thick limestone section which could not be difi'erentiated by ord1nary methods. As an alternative or ad...STRATIGRAPHIC CORRELATION MITH X-RAY PONDER PATTERNS John B. Singletary A Thesis Submitted to the Graduate School Agricultural and Mechanical College of Texas in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE MA...

Singletary, John B



In-situ X-ray diffraction system using sources and detectors at fixed angular positions  

DOE Patents [OSTI]

An x-ray diffraction technique for measuring a known characteristic of a sample of a material in an in-situ state. The technique includes using an x-ray source for emitting substantially divergent x-ray radiation--with a collimating optic disposed with respect to the fixed source for producing a substantially parallel beam of x-ray radiation by receiving and redirecting the divergent paths of the divergent x-ray radiation. A first x-ray detector collects radiation diffracted from the sample; wherein the source and detector are fixed, during operation thereof, in position relative to each other and in at least one dimension relative to the sample according to a-priori knowledge about the known characteristic of the sample. A second x-ray detector may be fixed relative to the first x-ray detector according to the a-priori knowledge about the known characteristic of the sample, especially in a phase monitoring embodiment of the present invention.

Gibson, David M. (Voorheesville, NY); Gibson, Walter M. (Voorheesville, NY); Huang, Huapeng (Latham, NY)



High-resolution ab initio three-dimensional x-ray diffraction microscopy  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

Coherent x-ray diffraction microscopy is a method of imaging nonperiodic isolated objects at resolutions limited, in principle, by only the wavelength and largest scattering angles recorded. We demonstrate x-ray diffraction imaging with high resolution in all three dimensions, as determined by a quantitative analysis of the reconstructed volume images. These images are retrieved from the three-dimensional diffraction data using no a priori knowledge about the shape or composition of the object, which has never before been demonstrated on a nonperiodic object. We also construct two-dimensional images of thick objects with greatly increased depth of focus (without loss of transverse spatial resolution). These methods can be used to image biological and materials science samples at high resolution with x-ray undulator radiation and establishes the techniques to be used in atomic-resolution ultrafast imaging at x-ray free-electron laser sources.

Chapman, Henry N.; Barty, Anton; Marchesini, Stefano; Noy, Aleksandr; Hau-Riege, Stefan P.; Cui, Congwu; Howells, Malcolm R.; Rosen, Rachel; He, Haifeng; Spence, John C.; Weierstall, Uwe; Beetz, Tobias; Jacobsen, Chris; Shapiro, David



High-resolution x-ray diffraction microscopy of specifically labeled yeast cells  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

X-ray diffraction microscopy complements other x-ray microscopy methods by being free of lens-imposed radiation dose and resolu- tion limits, and it allows for high-resolution imaging of biological specimens too thick to be viewed by electron microscopy. We report here the highest resolution (1113 nm) x-ray diffraction micrograph of biological specimens, and a demonstration of mole- cular-specific gold labeling at different depths within cells via through-focus propagation of the reconstructed wavefield. The lec- tin concanavalin A conjugated to colloidal gold particles was used to label the ?-mannan sugar in the cell wall of the yeast Saccharomyces cerevisiae. Cells were plunge-frozen in liquid ethane and freeze-dried, after which they were imaged whole using x-ray diffraction microscopy at 750 eV photon energy.

Nelson, J.; Huang, X.; Steinbrener, J.; Shapiro, D.; Kirz, J.; Marchesini, S.; Neiman, A. M.; Turner, J. J.; Jacobsen, C.



X-Ray Diffraction Microscopy of Magnetic Structures  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of Energy Worldwide CarbonWrapI 1 0X-Ray


X-Ray Diffraction Microscopy of Magnetic Structures  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of Energy Worldwide CarbonWrapI 1X-Ray


X-ray Diffraction from Membrane Protein Nanocrystals  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL Home SRNL main campusMore thanX-Ray


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series to someone6 M. Babzien,Biological Imaging by Soft X-Ray


X-ray diffraction and EXAFS analysis of materials for lithium-based rechargeable batteries  

SciTech Connect (OSTI)

Lithium iron phosphate LiFePO{sub 4} (triphylite) and lithium titanate Li{sub 4}Ti{sub 5}O{sub 12} are used as components of a number of active materials in modern rechargeable batteries. Samples of these materials are studied by X-ray diffraction and extended X-ray absorption fine structure (EXAFS) spectroscopy. Hypotheses about the phase composition of the analyzed samples are formulated.

Sharkov, M. D., E-mail: mischar@mail.ioffe.ru; Boiko, M. E.; Bobyl, A. V.; Ershenko, E. M.; Terukov, E. I. [Russian Academy of Sciences, Ioffe Physical-Technical Institute (Russian Federation); Zubavichus, Y. V. [National Research Centre Kurchatov Institute (Russian Federation)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Quantitative determination of mineral composition by powder x-ray diffraction  

DOE Patents [OSTI]

An external standard intensity ratio method is used for quantitatively determining mineralogic compositions of samples by x-ray diffraction. The method uses ratios of x-ray intensity peaks from a single run. Constants are previously determined for each mineral which is to be quantitatively measured. Ratios of the highest intensity peak of each mineral to be quantified in the sample and the highest intensity peak of a reference mineral contained in the sample are used to calculate sample composition.

Pawloski, G.A.



Note: Application of a pixel-array area detector to simultaneous single crystal x-ray diffraction and x-ray absorption spectroscopy measurements  

SciTech Connect (OSTI)

X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorption near edge structure for Pr{sub 0.67}Sr{sub 0.33}MnO{sub 3} film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam.

Sun, Cheng-Jun, E-mail: cjsun@aps.anl.gov; Brewe, Dale L.; Heald, Steve M. [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States)] [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Zhang, Bangmin [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States) [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Department of Materials Science and Engineering, National University of Singapore, 117575 Singapore (Singapore); NUSNNI-Nanocore, National University of Singapore, 117411 Singapore (Singapore); Chen, Jing-Sheng; Chow, G. M. [Department of Materials Science and Engineering, National University of Singapore, 117575 Singapore (Singapore)] [Department of Materials Science and Engineering, National University of Singapore, 117575 Singapore (Singapore); Venkatesan, T. [NUSNNI-Nanocore, National University of Singapore, 117411 Singapore (Singapore) [NUSNNI-Nanocore, National University of Singapore, 117411 Singapore (Singapore); Department of Physics, National University of Singapore, 117542 Singapore (Singapore); Department of Electrical and Computer Engineering, National University of Singapore, 117575 Singapore (Singapore)



Neutron and X-ray diffraction and empirical potential structure refinement modelling of magnesium stabilised amorphous calcium  

E-Print Network [OSTI]

Neutron and X-ray diffraction and empirical potential structure refinement modelling of magnesium online xxxx Keywords: Amorphous calcium carbonate; EPSR modelling; Neutron diffraction; X-ray diffraction Amorphous calcium carbonate (ACC) plays a key role in biomineralisation processes in sea organisms. Neutron

Benning, Liane G.


X-ray diffraction experiments with femtosecond time D. VON DER LINDE and K. SOKOLOWSKI-TINTEN  

E-Print Network [OSTI]

X-ray diffraction experiments with femtosecond time resolution D. VON DER LINDE and K. SOKOLOWSKI-essen.de (Received 4 March 2002) Abstract. Intense ultrashort laser pulses enable the generation of subpico- second X-ray pulses in the multi-kilovolt range of photon energies. These X- ray pulses have opened the door

von der Linde, D.


Toward atomic resolution diffractive imaging of isolated molecules with x-ray free-electron lasers  

E-Print Network [OSTI]

We give a detailed account of the theoretical analysis and the experimental results of an x-ray-diffraction experiment on quantum-state selected and strongly laser-aligned gas-phase ensembles of the prototypical large asymmetric rotor molecule 2,5-diiodobenzonitrile, performed at the Linac Coherent Light Source [Phys. Rev. Lett. 112, 083002 (2014)]. This experiment is the first step toward coherent diffractive imaging of structures and structural dynamics of isolated molecules at atomic resolution, i. e., picometers and femtoseconds, using x-ray free-electron lasers.

Stern, Stephan; Filsinger, Frank; Rouze, Arnaud; Rudenko, Artem; Johnsson, Per; Martin, Andrew V; Barty, Anton; Bostedt, Christoph; Bozek, John D; Coffee, Ryan N; Epp, Sascha; Erk, Benjamin; Foucar, Lutz; Hartmann, Robert; Kimmel, Nils; Khnel, Kai-Uwe; Maurer, Jochen; Messerschmidt, Marc; Rudek, Benedikt; Starodub, Dmitri G; Thgersen, Jan; Weidenspointner, Georg; White, Thomas A; Stapelfeldt, Henrik; Rolles, Daniel; Chapman, Henry N; Kpper, Jochen



Diffraction crystals for sagittally focusing x-rays  

DOE Patents [OSTI]

The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

Ice, G.E.; Sparks, C.J. Jr.



Diffraction crystal for sagittally focusing x-rays  

DOE Patents [OSTI]

The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

Ice, Gene E. (Oak Ridge, TN); Sparks, Jr., Cullie J. (Oak Ridge, TN)



X-Ray Diffraction (XRD) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place:ReferenceEditWisconsin: EnergyEdison,WindDiffraction (XRD) Jump


Radial x-ray diffraction of tungsten tetraboride to 86 GPa under nonhydrostatic compression  

E-Print Network [OSTI]

Radial x-ray diffraction of tungsten tetraboride to 86 GPa under nonhydrostatic compression Lun December 2012; published online 16 January 2013) Investigations of the equation of state of tungsten moduli and hardness exceed- ing or closing that of diamond. Tungsten tetraboride (WB4) is a candidate

Lin, Jung-Fu "Afu"


High spatial resolution X-ray and gamma ray imaging system using diffraction crystals  

DOE Patents [OSTI]

A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

Smither, Robert K. (Hinsdale, IL)



Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell Xiaojing Huang,1  

E-Print Network [OSTI]

crystallization, and radiation damage are greatly reduced. In this example, coherent diffraction data using 520 e of biological electron microscopy [1­3]. Radiation damage precludes repeated imaging of live specimens [4 in their natural, hydrated state, without limitations imposed by x-ray optics. DOI: 10.1103/PhysRevLett.103

Mohseni, Hooman


Stereochemistry Determination by Powder X-ray Diffraction Analysis and NMR Spectroscopy Residual Dipolar Couplings  

SciTech Connect (OSTI)

A matter of technique: For a new steroidal lactol, jaborosalactol 24 (1), isolated from Jaborosa parviflora, NMR spectroscopy residual dipolar couplings and powder X-ray diffraction analysis independently gave the same stereochemistry at C23-C26. Conventional NMR spectroscopic techniques, such as NOE and {sup 3}J coupling-constant analysis failed to unambiguously determine this stereochemistry.

Garcia, M.; Pagola, S; Navarro-Vasquez, A; Phillips, D; Gayathri, C; Krakauer, H; Stephens, P; Nicotra, V; Gil, R



Methodology for Optimal In Situ Alignment and Setting of Bendable Optics for Diffraction-Limited Focusing of Soft X-Rays  

E-Print Network [OSTI]

mirrors, x-rays, x-ray optics, synchrotron radiation,beamline, Kirkpatrick-Baez, metrology of x-ray opticsand Setting of Bendable Optics for Diffraction-Limited

Merthe, Daniel



X-ray diffraction study of the static strength of tungsten to 69 GPa Duanwei He* and Thomas S. Duffy  

E-Print Network [OSTI]

X-ray diffraction study of the static strength of tungsten to 69 GPa Duanwei He* and Thomas S of tungsten was determined under static high pressures to 69 GPa using x-ray diffraction techniques strength of tungsten increases with compression, reaching a value of 5.3 GPa at the highest pressure

Duffy, Thomas S.


Apparatus for X-ray diffraction microscopy and tomography of cryo specimens  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

An apparatus for diffraction microscopy of biological and materials science specimens is described. In this system, a coherent soft X-ray beam is selected with a pinhole, and the illuminated specimen is followed by an adjustable beamstop and CCD camera to record diffraction data from non-crystalline specimens. In addition, a Fresnel zone plate can be inserted to allow for direct imaging. The system makes use of a cryogenic specimen holder with cryotransfer capabilities to allow frozen hydrated specimens to be loaded. The specimen can be tilted over a range of +/- 80 degrees for three-dimensional imaging; this is done by computer-controlled motors, enabling automated alignment of the specimen through a tilt series. The system is now in use for experiments in soft X-ray diffraction microscopy.

Beetz, T.; Howells, M.R.; Jacobsen, C.; Kao, C.-C.; Kirz, J.; Lima, E.; Mentes, T.O.; Miao, H.; Sanchez-Hanke, C.; Sayre, D.; Shapiro, D.



Realizing in-plane surface diffraction by x-ray multiple-beam diffraction with large incidence angle  

SciTech Connect (OSTI)

Based on rigorous dynamical-theory calculations, we demonstrate the principle of an x-ray multiple-beam diffraction (MBD) scheme that overcomes the long-lasting difficulties of high-resolution in-plane diffraction from crystal surfaces. This scheme only utilizes symmetric reflection geometry with large incident angles but activates the out-of-plane and in-plane diffraction processes simultaneously and separately in the continuous MBD planes. The in-plane diffraction is realized by detoured MBD, where the intermediate diffracted waves propagate parallel to the surface, which corresponds to an absolute Bragg surface diffraction configuration that is extremely sensitive to surface structures. A series of MBD diffraction and imaging techniques may be developed from this principle to study surface/interface (misfit) strains, lateral nanostructures, and phase transitions of a wide range of (pseudo)cubic crystal structures, including ultrathin epitaxial films and multilayers, quantum dots, strain-engineered semiconductor or (multi)ferroic materials, etc.

Huang, Xian-Rong, E-mail: xiahuang@aps.anl.gov; Gog, Thomas; Assoufid, Lahsen [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Peng, Ru-Wen, E-mail: rwpeng@nju.edu.cn [National Laboratory of Solid State Microstructures and Department of Physics, Nanjing University, Nanjing 210093 (China); Siddons, D. P. [National Synchrotron Light Source, Brookhaven National Laboratory, Upton, New York 11973 (United States)



X-Ray Diffraction Study of Elemental Erbium to 65 GPa  

SciTech Connect (OSTI)

We have investigated phase transitions in elemental erbium in a diamond anvil cell up to 65 GPa using x-ray powder diffraction methods. We present preliminary evidence of a series of phase transitions that appear to follow the expected hcp {yields} Sm-type {yields} dhcp {yields} distorted fcc sequence. In particular, we believe that we have evidence for the predicted dhcp {yields} distorted fcc transition between 43 GPa and 65 GPa.

Pravica, M.G.; Lipinska-Kalita, K.; Quine, Z.; Romano, E.; Nicol, M.F. (UNLV)



Measuring the x-ray resolving power of bent potassium acid phthalate diffraction crystals  

SciTech Connect (OSTI)

This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals that we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories in Albuquerque, New Mexico. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a double crystal diffractometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.

Haugh, M. J., E-mail: haughmj@nv.doe.gov; Jacoby, K. D. [National Security Technologies, LLC, Livermore, California 94550 (United States); Wu, M.; Loisel, G. P. [Sandia National Laboratories, Albuquerque, New Mexico 87123 (United States)



Femtosecond diffractive imaging with a soft-X-ray free-electron laser (CXIDB ID 3)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The diffraction pattern of this entry corresponds to the one shown in **figure 2a** of the corresponding citation.

Chapman, H. N.


Absolute x-ray energy calibration over a wide energy range using a diffraction-based iterative method  

E-Print Network [OSTI]

Mineral Physics Institute, Stony Brook University, Stony Brook, New York 11794, USA 2 DepartmentAbsolute x-ray energy calibration over a wide energy range using a diffraction-based iterative;REVIEW OF SCIENTIFIC INSTRUMENTS 83, 063901 (2012) Absolute x-ray energy calibration over a wide energy

Duffy, Thomas S.

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


7 Resolution in Protein 2-Dimentional-Crystal X-Ray Diffraction at Linac Coherent Light Source  

SciTech Connect (OSTI)

Membrane proteins arranged as two-dimensional (2D) crystals in the lipid en- vironment provide close-to-physiological structural information, which is essential for understanding the molecular mechanisms of protein function. X-ray diffraction from individual 2D crystals did not represent a suitable investigation tool because of radiation damage. The recent availability of ultrashort pulses from X-ray Free Electron Lasers (X-FELs) has now provided a mean to outrun the damage. Here we report on measurements performed at the LCLS X-FEL on bacteriorhodopsin 2D crystals mounted on a solid support and kept at room temperature. By merg- ing data from about a dozen of single crystal diffraction images, we unambiguously identified the diffraction peaks to a resolution of 7 A, thus improving the observable resolution with respect to that achievable from a single pattern alone. This indicates that a larger dataset will allow for reliable quantification of peak intensities, and in turn a corresponding increase of resolution. The presented results pave the way to further X-FEL studies on 2D crystals, which may include pump-probe experiments at subpicosecond time resolution.

Pedrini, Bill; Tsai, Ching-Ju; Capitani, Guido; Padeste, Celestino; Hunter, Mark; Zatsepin, Nadia A.; Barty, Anton; Benner, Henry; Boutet, Sebastien; Feld, Geoffrey K.; Hau-Riege, Stefan; Kirian, Rick; Kupitz, Christopher; Messerschmidt, Marc; Ogren, John I.; Pardini, Tommaso; Segelke, Brent; Williams, Garth J.; Spence , John C.; Abela, Rafael; Coleman, Matthew A.; Evans, James E.; Schertler, Gebhard; Frank, Matthias; Li, Xiao-Dan



Automated high pressure cell for pressure jump x-ray diffraction  

SciTech Connect (OSTI)

A high pressure cell for small and wide-angle x-ray diffraction measurements of soft condensed matter samples has been developed, incorporating a fully automated pressure generating network. The system allows both static and pressure jump measurements in the range of 0.1-500 MPa. Pressure jumps can be performed as quickly as 5 ms, both with increasing and decreasing pressures. Pressure is generated by a motorized high pressure pump, and the system is controlled remotely via a graphical user interface to allow operation by a broad user base, many of whom may have little previous experience of high pressure technology. Samples are loaded through a dedicated port allowing the x-ray windows to remain in place throughout an experiment; this facilitates accurate subtraction of background scattering. The system has been designed specifically for use at beamline I22 at the Diamond Light Source, United Kingdom, and has been fully integrated with the I22 beamline control systems.

Brooks, Nicholas J.; Gauthe, Beatrice L. L. E.; Templer, Richard H.; Ces, Oscar; Seddon, John M. [Department of Chemistry, Imperial College London, South Kensington Campus, London SW7 2AZ (United Kingdom); Terrill, Nick J. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, Oxfordshire OX11 0DE (United Kingdom); Rogers, Sarah E. [ISIS, Rutherford Appleton Laboratory, Harwell Science and Innovation Campus, Didcot, Oxfordshire OX11 0QX (United Kingdom)



Time-, frequency-, and wavevector-resolved x-ray diffraction from single molecules  

SciTech Connect (OSTI)

Using a quantum electrodynamic framework, we calculate the off-resonant scattering of a broadband X-ray pulse from a sample initially prepared in an arbitrary superposition of electronic states. The signal consists of single-particle (incoherent) and two-particle (coherent) contributions that carry different particle form factors that involve different material transitions. Single-molecule experiments involving incoherent scattering are more influenced by inelastic processes compared to bulk measurements. The conditions under which the technique directly measures charge densities (and can be considered as diffraction) as opposed to correlation functions of the charge-density are specified. The results are illustrated with time- and wavevector-resolved signals from a single amino acid molecule (cysteine) following an impulsive excitation by a stimulated X-ray Raman process resonant with the sulfur K-edge. Our theory and simulations can guide future experimental studies on the structures of nano-particles and proteins.

Bennett, Kochise, E-mail: kcbennet@uci.edu; Biggs, Jason D.; Zhang, Yu; Dorfman, Konstantin E.; Mukamel, Shaul, E-mail: smukamel@uci.edu [University of California, Irvine, California 92697-2025 (United States)



Fixture for supporting and aligning a sample to be analyzed in an x-ray diffraction apparatus  

DOE Patents [OSTI]

A fixture is provided for supporting and aligning small samples of material on a goniometer for x-ray diffraction analysis. A sample-containing capillary is accurately positioned for rotation in the x-ray beam by selectively adjusting the fixture to position the capillary relative to the x and y axes thereof to prevent wobble and position the sample along the z axis or the axis of rotation. By employing the subject fixture relatively small samples of materials can be analyzed in an x-ray diffraction apparatus previously limited to the analysis of much larger samples.

Green, L.A.; Heck, J.L. Jr.



High resolution x-ray and gamma ray imaging using diffraction lenses with mechanically bent crystals  

DOE Patents [OSTI]

A method for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation is provided. High quality mechanically bent diffracting crystals of 0.1 mm radial width are used for focusing the radiation and directing the radiation to an array of detectors which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for the use of a multi-component high resolution detector array and for narrow source and detector apertures.

Smither, Robert K. (Hinsdale, IL)



Femtosecond diffractive imaging with a soft-X-ray free-electron laser  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsing ZirconiaPolicyFeasibility of SF(STEO) diffractive imaging with a soft-X-ray


Stoichiometry optimization of homoepitaxial oxide thin films using x-ray diffraction  

E-Print Network [OSTI]

a MBE growth window in which the film stoichiometry iswindow, the best fits of the diffraction patterns were obtained with film

Stemmer, Susanne



X-ray Diffraction Laboratory Rev 1.0.3 1/20/2009 Approved by Department of Chemistry and EHSD Texas A & M University (1997)  

E-Print Network [OSTI]

X-ray Diffraction Laboratory Rev 1.0.3 1/20/2009 Approved by Department of Chemistry and EHSD Texas A & M University (1997) Name : ______________________________ UIN _____________________ X-ray Safety Release form for the X-ray Diffraction Laboratory Department of Chemistry, Texas A & M University Answer

Meagher, Mary


High-pressure X-ray diffraction and X-ray emission studies on iron-bearing silicate perovskite under high pressures  

SciTech Connect (OSTI)

Iron-bearing silicate perovskite is believed to be the most abundant mineral of the Earth's lower mantle. Recent studies have shown that Fe{sup 2+} exists predominantly in the intermediate-spin state with a total spin number of 1 in silicate perovskite in the lower part of the lower mantle. Here we have measured the spin states of iron and the pressure-volume relation in silicate perovskite [(Mg{sub 0.6},Fe{sub 0.4})SiO{sub 3}] at pressure conditions relevant to the lowermost mantle using in situ X-ray emission and X-ray diffraction in a diamond cell. Our results showed that the intermediate-spin Fe{sup 2+} is stable in the silicate perovskite up to {approx} 125 GPa but starts to transition to the low-spin state at approximately 135 GPa. Concurrent X-ray diffraction measurements showed a decrease of approximately 1% in the unit cell volume in the silicate perovskite [(Mg{sub 0.6},Fe{sub 0.4})SiO{sub 3}], which is attributed to the intermediate-spin to the low-spin transition. The transition pressure coincides with the pressure conditions of the lowermost mantle, raising the possibility of the existence of the silicate perovskite phase with the low-spin Fe{sup 2+} across the transition from the post-perovskite to the perovskite phases in the bottom of the D{double_prime} layer.

Lin, Jung-Fu; Speciale, Sergio; Prakapenka, Vitali B.; Dera, Przemek; Lavina, Babara; Watson, Heather C. (NIU); (UC); (Texas); (GFZ)



X-ray shearing interferometer  

DOE Patents [OSTI]

An x-ray interferometer for analyzing high density plasmas and optically opaque materials includes a point-like x-ray source for providing a broadband x-ray source. The x-rays are directed through a target material and then are reflected by a high-quality ellipsoidally-bent imaging crystal to a diffraction grating disposed at 1.times. magnification. A spherically-bent imaging crystal is employed when the x-rays that are incident on the crystal surface are normal to that surface. The diffraction grating produces multiple beams which interfere with one another to produce an interference pattern which contains information about the target. A detector is disposed at the position of the image of the target produced by the interfering beams.

Koch, Jeffrey A. (Livermore, CA)



A Diffractive-Optic Telescope for X-Ray Astronomy D. Dewey, T.H. Markert, and M.L. Schattenburg  

E-Print Network [OSTI]

A Diffractive-Optic Telescope for X-Ray Astronomy D. Dewey, T.H. Markert, and M.L. Schattenburg for a light-weight X-ray astronomical telescope that uses a diffractive optical element is described (200-1000 cm2 ) through the use of a blazed diffractive optic. State-of-the-art grating technology

Dewey, Daniel


Reactive sputter magnetron reactor for preparation of thin films and simultaneous in situ structural study by X-ray diffraction  

SciTech Connect (OSTI)

The purpose of the designed reactor is (i) to obtain polycrystalline and/or amorphous thin films by controlled deposition induced by a reactive sputtering magnetron and (ii) to perform a parallel in situ structural study of the deposited thin films by X-ray diffraction, in real time, during the whole growth process. The designed reactor allows for the control and precise variation of the relevant processing parameters, namely, magnetron target-to-sample distance, dc magnetron voltage, and nature of the gas mixture, gas pressure and temperature of the substrate. On the other hand, the chamber can be used in different X-ray diffraction scanning modes, namely, {theta}-2{theta} scanning, fixed {alpha}-2{theta} scanning, and also low angle techniques such as grazing incidence small angle X-ray scattering and X-ray reflectivity. The chamber was mounted on a standard four-circle diffractometer located in a synchrotron beam line and first used for a preliminary X-ray diffraction analysis of AlN thin films during their growth on the surface of a (100) silicon wafer.

Buergi, J.; Molleja, J. Garcia; Feugeas, J. [Instituto de Fisica Rosario (CONICET-UNR), Bv. 27 de Febrero 210 bis, S2000EZP Rosario (Argentina); Neuenschwander, R. [Laboratorio Nacional Luz Sincrotron (LNLS), Caixa Postal 6192, CEP13083-970 Campinas (Brazil); Kellermann, G. [Departamento de Fisica (Universidade Federal do Parana), Caixa Postal 19044, CEP81531-990 Curitiba (Brazil); Craievich, A. F. [Instituto de Fisica (Universidade de Sao Paulo), Rua do Matao Travessa R 187, CEP05508-090 Sao Paulo (Brazil)



X-ray diffraction studies and equation of state of methane at 202 GPa Liling Sun a,*, Wei Yi a  

E-Print Network [OSTI]

X-ray diffraction studies and equation of state of methane at 202 GPa Liling Sun a,*, Wei Yi that at room temperature compressed CH4 remains an insulator with cubic structure to 202 GPa. ? 2009 Elsevier B of planetary interiors and the origin of their magnetic field distribution. CH4 has a very rich phase diagram

Shen, Guoyin


X-ray diffraction study of thermal stress relaxation in ZnO films deposited by magnetron sputtering  

E-Print Network [OSTI]

are in a high compressive stress state. In situ X-ray diffraction measurements inside a furnace revealed a relaxation of the as-grown stresses at temperatures which vary with the atmosphere in the furnace and change in many application domains such as ultraviolet detectors, light-emitting diodes, solar cells. As a II


In-line x-ray phase-contrast tomography and diffraction-contrast tomography study of the ferrite-cementite microstructure in steel  

E-Print Network [OSTI]

In-line x-ray phase-contrast tomography and diffraction-contrast tomography study of the ferrite;In-line X-ray phase-contrast tomography and diffraction-contrast tomography study of the ferrite embedded in a ferrite matrix of medium-carbon steel. The measurements were carried out at the material

van Vliet, Lucas J.


DXRD (Dynamic X-Ray Diffraction) studies of oil shale mineral reactions  

SciTech Connect (OSTI)

With the advent of second generation, above-ground oil shale processes, retorted shale is likely to be combusted at temperatures between 1000{degree}K and 1200{degree}K. At these temperatures the mineral matrix of the shale will undergo a variety of chemical reactions including carbonate decomposition, sulfation and recombination reactions to form silicates. This complex set of reactions can be very important to the optimum design of a retorted shale combustor. For example the net heat of combustion is very dependent on these reactions since the carbonate mineral decomposition reactions are highly endothermic and some of the silication reactions only mildly endothermic. In addition, the combusted shale (ash) will have to be disposed and revegetated and the environmental consequences of this process will be highly dependent on the mineral composition of the ash. The degree to which the mineral reactions influence these considerations will depend on the time-temperature history to which the shale is exposed. Thus it is important to have a knowledge of the kinetics of these reactions. Previous attempts to study these kinetics have been made at Lawrence Livermore Laboratories and in our own laboratory. However, these studies all employed TGA techniques and, since there is usually more than one reaction occurring simultaneously, there is no way to distinguish between competing reactions. What is described here is the application of a new technique - Dynamic X-Ray Diffraction (DXRD), which has been successfully applied to studies of oil shale mineral reactions under typical retorted shale combustion conditions.

Helling, K.A.; Thomson, W.J.



Thermal equation-of-state of TiC: a synchrotron x-ray diffraction study  

SciTech Connect (OSTI)

The pressure (P)-volume (V)-temperature (T) measurements were carried out for titanium carbide at pressures and temperatures up to 8.1 GPa and 1273 K using energy-dispersive synchrotron x-ray diffraction. Thermoelastic parameters were derived for TiC based on a modified high-temperature Birch-Murnaghan equation of state and a thermal-pressure approach. With the pressure derivative of the bulk modulus, K'{sub 0}, fixed at 4.0, we obtain: the ambient bulk modulus K{sub 0} = 268(6) GPa, temperature derivative of bulk modulus at constant pressure ({partial_derivative}K{sub T}/{partial_derivative}T){sub p} = -0.026(9) GPa K{sup -1}, volumetric thermal expansivity a{sub T}(K{sup -1}) = a + bT with a = 1.62(12) x 10{sup -5} K{sup -1} and b = 1.07(17) x 10{sup -8} K{sup -2}, pressure derivative of thermal expansion ({partial_derivative}a/{partial_derivative}P){sub T} = (-3.62 {+-} 1.14) x 10{sup -7} GPa{sup -1} K{sup -1}, and temperature derivative of bulk modulus at constant volume ({partial_derivative}K{sub T}/{partial_derivative}T){sub v} = -0.015 (8) GPa K{sup -1}. These results provide fundamental thermo physical properties for TiC and are important to theoretical and computational modeling of transition metal carbides.

Yu, Xiaohui [Los Alamos National Laboratory; Lin, Zhijun [Los Alamos National Laboratory; Zhang, Jianzhong [Los Alamos National Laboratory; Zhao, Yusheng [Los Alamos National Laboratory; Wang, Liping [STATE UNIV OF NEW YORK; Ding, Zejun [CHINA; Jin, Changqing [CHINA



High-Pressure Synchtron Radiation X-Ray Diffraction Studies of Pentaerythritol Tetranitrate C(CH[subscript 2]ONO[subscript 2 ])[subscript 4  

SciTech Connect (OSTI)

A high-pressure x-ray diffraction study of nanocrystalline pentaerythritol tetranitrate, C(CH{sub 2}ONO{sub 2}){sub 4}, (PETN), has been performed in a diamond-anvil cell at ambient temperature using synchrotron radiation. Pressure-induced alterations in the profiles of the diffraction lines, including their positions, widths and intensities were followed up to 30 GPa in a compressino cycle. The spectral changes in the diffraction patterns at low pressures indicated continuous densification of the tetragonal structure (space group P{bar 4}2{sub 1}c). The diffraction patterns confirmed that PETN compressed from ambient pressure to 7.4 GPa by 17%. At 8.2 GPa and above, several new diffraction lines appeared in the patterns. These lines suggest that the lattice undergoes an incomplete stress-induced structural transformation from the tetragonal to an orthorhombic structure (most probably space group P2{sub 1}22{sub 1}). The mixture of both structures appeared to persist to 30 GPa. The progressive broadening of the diffraction lines as the pressure increased beyond 10 GPa is attributed to the combined diffraction lines of a mixture of two coexisting PETN phases and inhomogeneous pressure distribution within the sample.

Lipinska-Kalita, K.E.; Pravica, M.; Nicol, M. (UNLV)



Calculation of the parameters of the X-ray diffraction station with adaptive segmented optics on the side beam from the wiggler of the Sibir'-2 storage ring  

SciTech Connect (OSTI)

The mounting of an X-ray diffraction station on the side beam of a 19-pole superconducting wiggler makes it possible not only to use the central synchrotron radiation beam with a wavelength of 0.5 Angstrom-Sign , but also to solve problems requiring softer X rays at a synchrotron radiation (SR) intensity exceeding that for the beams from the bending magnet. A numerical simulation of the formation of photon beams from a source and their transmission through the elements of the station (and through the station as a whole) allows one to calculate the parameters of the station, compare it with the existing analogs, determine its potential and actual efficiency of its elements, and estimate the adjustment quality. A numerical simulation of the SR source on the side beam from the wiggler and the focusing channel (segmented condenser mirror, monochromator with sagittal focusing by the segmented second crystal, and segmented focusing mirror) has been performed. The sizes of the focus and the divergence of rays in it are determined with allowance for the finite sizes of segments. The intensity of radiation with a wavelength {lambda} = 1.0 Angstrom-Sign in the focus is determined taking into account the loss in the SR extraction channel and in the focusing channel. The values of the critical wavelength for the side beam from the wiggler and the wavelength resolution are calculated. The intensities in the X-ray diffraction pattern and its angular resolution are found.

Molodenskii, D. S.; Kheiker, D. M., E-mail: kheiker@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Korchuganov, V. N. [National Research Center Kurchatov Institute (Russian Federation); Konoplev, E. E. [NPO Luch (Russian Federation); Dorovatovskii, P. V. [National Research Center Kurchatov Institute (Russian Federation)




SciTech Connect (OSTI)

The F-Area Tank Farm (FTF) Performance Assessment (PA) utilizes waste speciation in the waste release model used in the FTF fate and transport modeling. The waste release modeling associated with the residual plutonium in Tank 18 has been identified as a primary contributor to the Tank 18 dose uncertainty. In order to reduce the uncertainty related to plutonium in Tank 18, a better understanding of the plutonium speciation in the Tank 18 waste (including the oxidation state and stoichiometry) is desired. Savannah River National Laboratory (SRNL) utilized Scanning Electron Microscopy (SEM) and X-ray Diffraction (XRD) to analyze Tank 18 samples to provide information on the speciation of plutonium in the waste material. XRD analysis of the Tank 18 samples did not identify any plutonium mineral phases in the samples. These indicates the crystalline mineral phases of plutonium are below the detection limits of the XRD method or that the plutonium phase(s) lack long range order and are present as amorphous or microcrystalline solids. SEM analysis of the Tank 18 samples did locate particles containing plutonium. The plutonium was found as small particles, usually <1 {micro}m but ranging up to several micrometers in diameter, associated with particles of an iron matrix and at low concentration in other elemental matrices. This suggests the plutonium has an affinity for the iron matrix. Qualitatively, the particles of plutonium found in the SEM analysis do not appear to account for all of the plutonium in the sample based on concentrations determined from the chemical analysis of the Tank 18 samples. This suggests that plutonium is also distributed throughout the solids in low concentrations.

Hay, M.; O'Rourke, P.; Ajo, H.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Thermal Equation of State of TiC: A Synchrotron X-ray Diffraction  

SciTech Connect (OSTI)

The pressure-volume-temperature measurements were carried out for titanium carbide (TiC) at pressures and temperatures up to 8.1 GPa and 1273 K using energy-dispersive synchrotron x-ray diffraction. Thermoelastic parameters were derived for TiC based on a modified high-temperature Birch-Murnaghan equation of state and a thermal pressure approach. With the pressure derivative of the bulk modulus, K{prime}{sub 0}, fixed at 4.0, we obtain: the ambient bulk modulus K{sub 0} = 268(6) GPa, which is comparable to previously reported value; temperature derivative of bulk modulus at constant pressure ({partial_derivative}K{sub T}/{partial_derivative}T){sub P} = -0.026(9) GPa K{sup -1}, volumetric thermal expansivity {alpha}{sub T}(K{sup -1}) = a+b T with a = 1.62(12) x 10{sup -5} K{sup -1} and b = 1.07(17) x 10{sup -8}K{sup -2}, pressure derivative of thermal expansion ({partial_derivative}{sub {alpha}}/{partial_derivative}{sub P}){sub T} = (-3.62 {+-} 1.14) x 10{sup -7} GPa{sup -1} K{sup -1}, and temperature derivative of bulk modulus at constant volume ({partial_derivative}K{sub T}/{partial_derivative}T){sub V} = -0.015(8) GPa K{sup -1}. These results provide fundamental thermophysical properties for TiC for the first time and are important to theoretical and computational modeling of transition metal carbides.

Yu, X.; Lin, Z; Zhang, J; Wang, L; Ding, Z; Jin, C; Zhao, Y



Thermal equation of state of TiC: A synchrotron x-ray diffraction study  

SciTech Connect (OSTI)

The pressure-volume-temperature measurements were carried out for titanium carbide (TiC) at pressures and temperatures up to 8.1 GPa and 1273 K using energy-dispersive synchrotron x-ray diffraction. Thermoelastic parameters were derived for TiC based on a modified high-temperature Birch-Murnaghan equation of state and a thermal pressure approach. With the pressure derivative of the bulk modulus, K{sub 0}{sup '}, fixed at 4.0, we obtain: the ambient bulk modulus K{sub 0}=268(6) GPa, which is comparable to previously reported value; temperature derivative of bulk modulus at constant pressure ({partial_derivative}K{sub T}/{partial_derivative}T){sub P}=-0.026(9) GPa K{sup -1}, volumetric thermal expansivity {alpha}{sub T}(K{sup -1})=a+bT with a=1.62(12)x10{sup -5} K{sup -1} and b=1.07(17)x10{sup -8} K{sup -2}, pressure derivative of thermal expansion ({partial_derivative}{alpha}/{partial_derivative}P){sub T}=(-3.62{+-}1.14)x10{sup -7} GPa{sup -1} K{sup -1}, and temperature derivative of bulk modulus at constant volume ({partial_derivative}K{sub T}/{partial_derivative}T){sub V}=-0.015(8) GPa K{sup -1}. These results provide fundamental thermophysical properties for TiC for the first time and are important to theoretical and computational modeling of transition metal carbides.

Yu Xiaohui [LANSCE Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); National Lab for Condensed Matter Physics, Institute of Physics, CAS, Beijing 100080 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China); Lin Zhijun; Zhang Jianzhong; Zhao Yusheng [LANSCE Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Wang Liping [Mineral Physics Institute, State University of New York, Stony Brook, New York 11794 (United States); Ding Zejun [Department of Physics, University of Science and Technology of China, Hefei 230026 (China); Jin Changqing [National Lab for Condensed Matter Physics, Institute of Physics, CAS, Beijing 100080 (China)



anomalous x-ray diffraction: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

from the soft X-rays emitted by the neutron-star surface. The relation between these heating rates and measured near-infrared fluxes in the K and Ks bands places severe...


Rietveld X-ray diffraction analysis of nanostructured rutile films of titania prepared by pulsed laser deposition  

SciTech Connect (OSTI)

Rietveld powder X-ray diffraction analysis of the rutile films of titanium oxide prepared by pulsed laser deposition was carried out. The crystallite size increased with increase of substrate temperature, while the strain showed a reverse trend. The films synthesized at temperature {>=}573 K showed that the crystal structure was almost close to that of bulk rutile structure. The influence of the substrate temperature on the lattice parameters and oxygen coordinates were also studied in the present work.

Murugesan, S. [Physical Metallurgy Division, Indira Gandhi Centre for Atomic Research, Kalpakkam 603102, Tamil Nadu (India)] [Physical Metallurgy Division, Indira Gandhi Centre for Atomic Research, Kalpakkam 603102, Tamil Nadu (India); Kuppusami, P., E-mail: pk@igcar.gov.in [Physical Metallurgy Division, Indira Gandhi Centre for Atomic Research, Kalpakkam 603102, Tamil Nadu (India); Mohandas, E. [Physical Metallurgy Division, Indira Gandhi Centre for Atomic Research, Kalpakkam 603102, Tamil Nadu (India)] [Physical Metallurgy Division, Indira Gandhi Centre for Atomic Research, Kalpakkam 603102, Tamil Nadu (India)



High brightness--multiple beamlets source for patterned X-ray production  

DOE Patents [OSTI]

Techniques for controllably directing beamlets to a target substrate are disclosed. The beamlets may be either positive ions or electrons. It has been shown that beamlets may be produced with a diameter of 1 .mu.m, with inter-aperture spacings of 12 .mu.m. An array of such beamlets, may be used for maskless lithography. By step-wise movement of the beamlets relative to the target substrate, individual devices may be directly e-beam written. Ion beams may be directly written as well. Due to the high brightness of the beamlets from extraction from a multicusp source, exposure times for lithographic exposure are thought to be minimized. Alternatively, the beamlets may be electrons striking a high Z material for X-ray production, thereafter collimated to provide patterned X-ray exposures such as those used in CAT scans. Such a device may be used for remote detection of explosives.

Leung, Ka-Ngo (Hercules, CA); Ji, Qing (Albany, CA); Barletta, William A. (Oakland, CA); Jiang, Ximan (El Cerrito, CA); Ji, Lili (Albany, CA)



Novel Cell Design for Combined In Situ Acoustic Emission and X-ray Diffraction of Cycling Lithium Ion Batteries  

SciTech Connect (OSTI)

An in situ acoustic emission (AE) and X-ray diffraction (XRD) cell for use in the study of battery electrode materials has been devised and tested. This cell uses commercially available coin cell hardware retrofitted with a metalized polyethylene terephthalate (PET) disk which acts as both an X-ray window and a current collector. In this manner the use of beryllium and its associated cost and hazard is avoided. An AE sensor may be affixed to the cell face opposite the PET window in order to monitor degradation effects, such as particle fracture, during cell cycling. Silicon particles which were previously studied by the AE technique were tested in this cell as a model material. The performance of these cells compared well with unmodified coin cells while providing information about structural changes in the active material as the cell is repeatedly charged and discharged.

Rhodes, Kevin J [ORNL; Kirkham, Melanie J [ORNL; Meisner, Roberta Ann [ORNL; Parish, Chad M [ORNL; Dudney, Nancy J [ORNL; Daniel, Claus [ORNL



Novel cell design for combined in situ acoustic emission and x-ray diffraction study during electrochemical cycling of batteries  

SciTech Connect (OSTI)

An in situ acoustic emission (AE) and x-ray diffraction cell for use in the study of battery electrode materials has been designed and tested. This cell uses commercially available coin cell hardware retrofitted with a metalized polyethylene terephthalate (PET) disk, which acts as both an x-ray window and a current collector. In this manner, the use of beryllium and its associated cost and hazards is avoided. An AE sensor may be affixed to the cell face opposite the PET window in order to monitor degradation effects, such as particle fracture, during cell cycling. Silicon particles, which were previously studied by the AE technique, were tested in this cell as a model material. The performance of these cells compared well with unmodified coin cells, while providing information about structural changes in the active material as the cell is repeatedly charged and discharged.

Rhodes, Kevin; Meisner, Roberta; Daniel, Claus [Materials Science and Technology Division, Oak Ridge National Laboratory, 1 Bethel Valley Rd., MS 6083, Oak Ridge, Tennessee 37931-6083 (United States); Materials Science and Engineering Department, University of Tennessee, 434 Dougherty Hall, Knoxville, Tennessee 37996-2200 (United States); Kirkham, Melanie; Parish, Chad M.; Dudney, Nancy [Materials Science and Technology Division, Oak Ridge National Laboratory, 1 Bethel Valley Rd., MS 6083, Oak Ridge, Tennessee 37931-6083 (United States)



Investigation of the spontaneous lateral modulation in short-period superlattices by grazing-incidence x-ray diffraction.  

SciTech Connect (OSTI)

The process of spontaneous lateral composition modulation in short-period InAs/AlAs superlattices has been investigated by grazing-incidence x-ray diffraction. We have developed a theoretical description of x-ray scattering from laterally modulated structures that makes it possible to determine the lateral composition modulation directly without assuming any structure model. From experimental intensity distributions in reciprocal space we have determined the amplitudes of the modulation and its degree of periodicity and their dependence on the number of superlattice periods. From the data it follows that the modulation process cannot be explained by bunching of monolayer steps and most likely, it is caused by stress-driven morphological instabilities of the growing surface.

Moss, Simon C. (University of Houston, Houston, TX); Holy, Vaclav (Charles University, Prague, Czech Republic); Reno, John Louis; Krause, B. (ESRF, Grenoble, France); Norman, Andrew G. (National Renewable Energy Laboratory, Golden, CO); Mikulik, P. (Masaryk University, Brno, Czech Republic); Caha, O. (Masaryk University, Brno, Czech Republic); Mascarenhas, Angelo (National Renewable Energy Laboratory, Golden, CO)



Formation of delta ferrite in 9 wt.% Cr steel investigated by in-situ X-ray diffraction using synchrotron radiation  

E-Print Network [OSTI]

In-situ X-ray diffraction (XRD) measurements using high energy synchrotron radiation were performed to monitor in real time the formation of delta ferrite in a martensitic 9 wt pct chromium steel under simulated weld thermal ...

Mayr, P.


Ultrafast X-ray Diffraction Theory Jianshu Cao* and Kent R. Wilson  

E-Print Network [OSTI]

notablely using ultrafast optical pump-probe pulses. Unfortunately, except for a few favorable cases of a sample is initiated by an ultrafast optical laser pulse and then probed by an ultrafast X-ray pulse initiated by the optical pump pulse in real time and real space.9-11 From a simple viewpoint, ultrafast X

Cao, Jianshu


Multiferroic CuCrO{sub 2} under high pressure: In situ X-ray diffraction and Raman spectroscopic studies  

SciTech Connect (OSTI)

The compression behavior of delafossite compound CuCrO{sub 2} has been investigated by in situ x-ray diffraction (XRD) and Raman spectroscopic measurements up to 23.2 and 34?GPa, respectively. X-ray diffraction data show the stability of ambient rhombohedral structure up to ?23?GPa. Material shows large anisotropy in axial compression with c-axis compressibility, ?{sub c}?=?1.26??10{sup ?3}(1) GPa{sup ?1} and a-axis compressibility, ?{sub a}?=?8.90??10{sup ?3}(6) GPa{sup ?1}. Our XRD data show an irreversible broadening of diffraction peaks. Pressure volume data when fitted to 3rd order Birch-Murnaghan equation of state give the value of bulk modulus, B{sub 0}?=?156.7(2.8) GPa with its pressure derivative, B{sub 0}{sup ?} as 5.3(0.5). All the observed vibrational modes in Raman measurements show hardening with pressure. Appearance of a new mode at ?24?GPa indicates the structural phase transition in the compound. Our XRD and Raman results indicate that CuCrO{sub 2} may be transforming to an ordered rocksalt type structure under compression.

Garg, Alka B., E-mail: alkagarg@barc.gov.in; Mishra, A. K.; Pandey, K. K.; Sharma, Surinder M. [High Pressure and Synchrotron Radiation Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)



X-ray nano-diffraction study of Sr intermetallic phase during solidification of Al-Si hypoeutectic alloy  

SciTech Connect (OSTI)

The evolution of strontium (Sr) containing intermetallic phase in the eutectic reaction of Sr-modified Al-Si hypoeutectic alloy was studied with high energy synchrotron beam source for nano-diffraction experiments and x-ray fluorescence elemental mapping. Contrary to popular belief, Sr does not seem to interfere with the Twin Plane Re-entrant Edge (TPRE) growth mechanism of eutectic Si, but evolves as the Al{sub 2}Si{sub 2}Sr phase during the eutectic reaction at the boundary between the eutectic Si and Al grains.

Manickaraj, Jeyakumar; Gorny, Anton; Shankar, Sumanth, E-mail: shankar@mcmaster.ca [Light Metal Casting Research Centre (LMCRC), Department of Mechanical Engineering, McMaster University, 1280 Main Street W, Hamilton, Ontario L8S 4L7 (Canada); Cai, Zhonghou [Advanced Photon Source, Argonne National Laboratory, 9700 South Cass Avenue, Argonne, Illinois 60439 (United States)



In-situ stoichiometry determination using x-ray fluorescence generated by reflection-high-energy-electron-diffraction  

SciTech Connect (OSTI)

A major challenge in the stoichiometric growth of complex oxide compounds is the control of the relative compositions of the constituent materials. A potential avenue for compositional analysis during growth is the use of x-ray fluorescence generated during reflection high energy electron diffraction measurements. Using this technique, relative compositions of Y and Mn in molecular beam epitaxy grown YMnO{sub 3} samples were studied. Comparing the results with Rutherford back scattering spectroscopy suggests that the technique has the potential for real-time analysis of elemental fluxes and stoichiometry control during sample growth.

Keenan, Cameron; Chandril, Sandeep; Lederman, David [Department of Physics and Multifunctional Materials Laboratory, West Virginia University, Morgantown, West Virginia 26506 (United States); Myers, T. H. [Department of Physics and Multifunctional Materials Laboratory, West Virginia University, Morgantown, West Virginia 26506 (United States); Materials Science, Engineering, and Commercialization Program, Texas State University-San Marcos, San Marcos, Texas 78666 (United States)



An assessment of the resolution limitation due to radiation-damage in X-ray diffraction microscopy  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

X-ray diffraction microscopy (XDM) is a new form of x-ray imaging that is being practiced at several third-generation synchrotron-radiation x-ray facilities. Nine years have elapsed since the technique was first introduced and it has made rapid progress in demonstrating high-resolution three-dimensional imaging and promises few-nm resolution with much larger samples than can be imaged in the transmission electron microscope. Both life- and materials-science applications of XDM are intended, and it is expected that the principal limitation to resolution will be radiation damage for life science and the coherent power of available x-ray sources for material science. In this paper we address the question of the role of radiation damage. We use a statistical analysis based on the so-called "dose fractionation theorem" of Hegerl and Hoppe to calculate the dose needed to make an image of a single life-science sample by XDM with a given resolution. We find that for simply-shaped objects the needed dose scales with the inverse fourth power of the resolution and present experimental evidence to support this finding. To determine the maximum tolerable dose we have assembled a number of data taken from the literature plus some measurements of our own which cover ranges of resolution that are not well covered otherwise. The conclusion of this study is that, based on the natural contrast between protein and water and "Rose-criterion" image quality, one should be able to image a frozen-hydrated biological sample using XDM at a resolution of about 10 nm.

Howells, M.R.; Beetz, T.; Chapman, H.N.; Cui, C.; Holton, J.M.; Jacobsen, C.J.; Kirz, J.; Lima, E.; Marchesini, S.; Miao, H.; Sayre, D.; Shapiro, D.A.; Spence, J.C.H.; Starodub, D.



The use of X-ray diffraction, microscopy, and magnetic measurements for analysing microstructural features of a duplex stainless steel  

SciTech Connect (OSTI)

X-ray diffraction, light optical microscopy, and magnetization saturation measurements were employed to analyse the microstructural features of a UNS S31803 duplex stainless steel modified by high-temperature treatments. The samples were heated to 1300 deg. C and cooled by different ways to produce five different microstructures. Solution treatments at 1000 deg. C were also employed to produce another five conditions. Three methods were employed to determine the austenite/ferrite proportions. X-ray diffraction gave higher austenite values than the other methods, due to the influence of texture, but can be successfully used to determine the microstrain level in each phase. Magnetic saturation measurement is a very simple and precise method for quantification of austenite and ferrite volume fractions in samples that were fast-cooled and slow-cooled. Light microscopy can give a fast and precise measurement of the phase proportions and reveals important features related to the morphology of the phases, but in the samples where the austenite content is low, quantification becomes difficult and imprecise.

Ribeiro Miranda, M.A. [Instituto de Fisica, Universidade Federal do Ceara, Campus do Pici, Caixa Postal 6030, CEP 60455-760 Fortaleza/CE (Brazil)]. E-mail: marcus@fisica.ufc.br; Sasaki, J.M. [Instituto de Fisica, Universidade Federal do Ceara, Campus do Pici, Caixa Postal 6030, CEP 60455-760 Fortaleza/CE (Brazil); Tavares, S.S.M. [PGMEC/TEM, Universidade Federal Fluminense, Rua Passo da Patria, 156, CEP 24210-240, Niteroi/RJ (Brazil); de Abreu, H.F.G. [Depto. Engenharia Meca-hat nica, Universidade Federal do Ceara (Brazil); Neto, J.M. [Instituto de Fisica, Universidade Federal do Rio de Janeiro (Brazil)



A 31?T split-pair pulsed magnet for single crystal x-ray diffraction at low temperature  

SciTech Connect (OSTI)

We have developed a pulsed magnet system with panoramic access for synchrotron x-ray diffraction in magnetic fields up to 31?T and at low temperature down to 1.5?K. The apparatus consists of a split-pair magnet, a liquid nitrogen bath to cool the pulsed coil, and a helium cryostat allowing sample temperatures from 1.5 up to 250?K. Using a 1.15?MJ mobile generator, magnetic field pulses of 60?ms length were generated in the magnet, with a rise time of 16.5?ms and a repetition rate of 2 pulses/h at 31?T. The setup was validated for single crystal diffraction on the ESRF beamline ID06.

Duc, F.; Frings, P.; Nardone, M.; Billette, J.; Zitouni, A.; Delescluse, P.; Bard, J.; Nicolin, J. P.; Rikken, G. L. J. A. [Laboratoire National des Champs Magntiques Intenses, CNRS-INSA-UJF-UPS, 143, avenue de Rangueil, F-31400 Toulouse (France); Fabrges, X. [Laboratoire National des Champs Magntiques Intenses, CNRS-INSA-UJF-UPS, 143, avenue de Rangueil, F-31400 Toulouse (France); Laboratoire Lon Brillouin, UMR12 CEA-CNRS Bt 563 CEA Saclay, 91191 Gif sur Yvette Cedex (France); Roth, T. [European Synchrotron Radiation Facility, Bote Postale 220, F-38043 Grenoble Cedex (France); European XFEL GmbH, Albert-Einstein-Ring 19, D-22761 Hamburg (Germany); Detlefs, C.; Lesourd, M.; Zhang, L. [European Synchrotron Radiation Facility, Bote Postale 220, F-38043 Grenoble Cedex (France)



Oxygen diffusivity in silicon derived from dynamical X-ray diffraction  

SciTech Connect (OSTI)

Thickness dependent Pendelloesung oscillations are highly sensitive to strain fields from defects in a host crystal. Based on this, we present a novel technique to measure the precipitation kinetics of oxygen in silicon already at its early stage of clustering at high temperatures. At 900 Degree-Sign C, precipitates with a radius smaller than 4 nm and with a density of 1 {+-} 0.5 Multiplication-Sign 10{sup 13} 1/cm{sup 3} were observed. The technique was calibrated by complementary scanning transmission electron microscope and energy dispersive X-ray measurements in the range of normal diffusivity yielding a diffusion constant of 1.7 {+-} 0.1 Multiplication-Sign 10{sup -12}cm{sup 2}/s, which is close to the literature value of 2.074 Multiplication-Sign 10{sup -12}cm{sup 2}/s. The measurements have been made with the characteristic K{sub {alpha}1}-line of a high voltage tungsten X-ray tube at 59.31 keV, which provides the opportunity to illuminate through complex sample environments like high temperature scattering furnaces.

Will, J.; Groeschel, A.; Bergmann, C.; Steinrueck, H.-G.; Magerl, A. [Crystallography and Structural Physics, University of Erlangen-Nuernberg, Staudtstr. 3, 91058 Erlangen (Germany); Kot, D.; Schubert, M. A.; Kissinger, G. [IHP, Im Technologiepark 25, 15236 Frankfurt (Oder) (Germany)



In-situ stress analysis with X-Ray diffraction for yield locus characterization of sheet metals  

SciTech Connect (OSTI)

A main problem in the field of sheet metal characterization is the inhomogeneous plastic deformation in the gauge regions of specimens which causes the analytically calculated stresses to differ from the sought state of stress acting in the middle of the gauge region. To overcome this problem, application of X-Ray diffraction is analyzed. For that purpose a mobile X-ray diffractometer and an optical strain measurement system are mounted on a universal tensile testing machine. This enables the recording of the whole strain and stress history of a material point. The method is applied to uniaxial tension tests, plane strain tension tests and shear tests to characterize the interstitial free steel alloy DC06. The applicability of the concepts of stress factors is verified by uniaxial tension tests. The experimentally obtained values are compared with the theoretical values calculated with crystal elasticity models utilizing the orientation distribution functions (ODF). The relaxation problem is addressed which shows itself as drops in the stress values with the strain kept at a constant level. This drop is analyzed with elasto-viscoplastic material models to correct the measured stresses. Results show that the XRD is applicable to measure the stresses in sheet metals with preferred orientation. The obtained yield locus is expressed with the Yld20002D material model and an industry oriented workpiece is analyzed numerically. The comparison of the strain distribution on the workpiece verifies the identified material parameters.

Gner, A.; Tekkaya, A. E. [Institute of Forming Technology and Lightweight Construction, TU Dortmund University, Baroper Str. 301, 44227 Dortmund (Germany); Zillmann, B.; Lampke, T. [Institute of Materials Science and Engineering, Chemnitz University of Technology, Erfenschlager Strasse 73 D-09125 Chemnitz (Germany)



Tuning of colossal dielectric constant in gold-polypyrrole composite nanotubes using in-situ x-ray diffraction techniques  

SciTech Connect (OSTI)

In-situ x-ray diffraction technique has been used to study the growth process of gold incorporated polypyrrole nanotubes that exhibit colossal dielectric constant due to existence of quasi-one-dimensional charge density wave state. These composite nanotubes were formed within nanopores of a polycarbonate membrane by flowing pyrrole monomer from one side and mixture of ferric chloride and chloroauric acid from other side in a sample cell that allows collection of x-ray data during the reaction. The size of the gold nanoparticle embedded in the walls of the nanotubes was found to be dependent on chloroauric acid concentration for nanowires having diameter more than 100 nm. For lower diameter nanotubes the nanoparticle size become independent of chloroauric acid concentration and depends on the diameter of nanotubes only. The result of this study also shows that for 50 nm gold-polypyrrole composite nanotubes obtained with 5.3 mM chloroauric acid gives colossal dielectric constant of about 10{sup 7}. This value remain almost constant over a frequency range from 1Hz to 10{sup 6} Hz even at 80 K temperature.

Sarma, Abhisakh; Sanyal, Milan K., E-mail: milank.sanyal@saha.ac.in [Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India)



X-ray Diffraction and Multi-Frame Phase Contrast Imaging Diagnostics for IMPULSE at the Advanced Photon Source  

SciTech Connect (OSTI)

The diagnostic needs of any dynamic loading platform present unique technical challenges that must be addressed in order to accurately measure in situ material properties in an extreme environment. The IMPULSE platform (IMPact system for Ultrafast Synchrotron Experiments) at the Advanced Photon Source (APS) is no exception and, in fact, may be more challenging, as the imaging diagnostics must be synchronized to both the experiment and the 60 ps wide x-ray bunches produced at APS. The technical challenges of time-resolved x-ray diffraction imaging and high-resolution multi-frame phase contrast imaging (PCI) are described in this paper. Example data from recent IMPULSE experiments are shown to illustrate the advances and evolution of these diagnostics with a focus on comparing the performance of two intensified CCD cameras and their suitability for multi-frame PCI. The continued development of these diagnostics is fundamentally important to IMPULSE and many other loading platforms and will benefit future facilities such as the Dynamic Compression Sector at APS and MaRIE at Los Alamos National Laboratory.

Iverson, Adam [National Security Technologies, LLC; Carlson, Carl [National Security Technologies, LLC; Young, Jason [National Security Technologies, LLC; Curtis, Alden [National Security Technologies, LLC; Jensen, Brian [Los Alamos National Laboratory; Ramos, Kyle [Los Alamos National Laboratory; Yeager, John [Los Alamos National Laboratory; Montgomery, David [Los Alamos National Laboratory; Fezza, Kamel [Argonne National Laboratory


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Synthesis and single crystal x-ray diffraction study of a Schiff base derived from 4-acylpyrazolone and 2-aminophenol  

SciTech Connect (OSTI)

The title compound, (Z)-1-(3-chlorophenyl)-4[1((2hydroxyphenyl)amino)propylidene] -3-methyl-1H-pyrazol-5(4H)-one was synthesized by refluxing compound 1-(m-chlorophenyl)-3-methyl-4-propionyl-5-pyrazolone, with 2-aminophenol in ethanol. The compound crystallizes in the orthorhombic crystal system with space group Pca2{sub 1} having unit cell parameters: a = 26.2993(8), b = 7.0724(2) and c = 18.7170(5). The structure contains two crystallographically independent molecules, A, and, B, in the asymmetric unit cell. The crystal structure was solved by direct method using single crystal X-ray diffraction data collected at room temperature and refined by full-matrix least-squares procedures to a final R- value of 0.049 for 5207 observed reflections.

Sharma, Naresh; Kant, Rajni, E-mail: vivek-gupta2k2@hotmail.com; Gupta, Vivek K., E-mail: vivek-gupta2k2@hotmail.com [Department of Physics and Electronics, University of Jammu, Jammu Tawi - 180006 (India); Jadeja, R. N. [Department of Chemistry, Faculty of Science, The M. S. University of Baroda, Vadodara-390002 (India)



Observation of localized heating phenomena during microwave heating of mixed powders using in situ x-ray diffraction technique  

SciTech Connect (OSTI)

In materials processing research using microwave heating, there have been several observations of various phenomena occurring known as microwave effects. One significant example of such a phenomenon is increased reaction kinetics. It is believed that there is a possibility that this might be caused by localized heating, were some reactants would attain a higher than apparent temperature. To examine whether such thermal gradients are indeed possible, mixed powders of two microwave non-absorbers, alumina and magnesia, were mixed with graphite, a known absorber, and heated in a microwave furnace. During microwave irradiation, the local temperatures of the respective sample constituents were measured using an in situ x-ray diffraction technique. In the case of the alumina and graphite sample, a temperature difference of around 100?C could be observed.

Sabelstrm, N., E-mail: sabelstrom.n.aa@m.titech.ac.jp; Hayashi, M. [Department of Metallurgy and Ceramics Science, Tokyo Institute of Technology, Tokyo 152-8552 (Japan); Watanabe, T. [Department of Chemistry and Materials Science, Tokyo Institute of Technology, Tokyo 152-8552 (Japan); Nagata, K. [Department of Conservation Science, Tokyo University of the Arts, 12-8 Ueno Park, Taito-ku, Tokyo (Japan)



Thermoelastic study of nanolayered structures using time-resolved X-ray diffraction at high repetition rate  

SciTech Connect (OSTI)

We investigate the thermoelastic response of a nanolayered sample composed of a metallic SrRuO{sub 3} electrode sandwiched between a ferroelectric Pb(Zr{sub 0.2}Ti{sub 0.8})O{sub 3} film with negative thermal expansion and a SrTiO{sub 3} substrate. SrRuO{sub 3} is rapidly heated by fs-laser pulses with 208?kHz repetition rate. Diffraction of X-ray pulses derived from a synchrotron measures the transient out-of-plane lattice constant c of all three materials simultaneously from 120?ps to 5??s with a relative accuracy up to ?c/c?=?10{sup ?6}. The in-plane propagation of sound is essential for understanding the delayed out-of-plane compression of Pb(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}.

Navirian, H. A.; Schick, D., E-mail: daniel.schick@uni-potsdam.de; Leitenberger, W.; Bargheer, M. [Institut fr Physik und Astronomie, Universitt Potsdam, Karl-Liebknecht-Str. 24-25, 14476 Potsdam (Germany); Gaal, P.; Shayduk, R. [Helmholtz-Zentrum Berlin fr Materialien und Energie GmbH, Wilhelm-Conrad-Rntgen Campus, BESSY II, Albert-Einstein-Str. 15, 12489 Berlin (Germany)



Time-resolved X-ray diffraction studies of laser-induced acoustic wave propagation in bilayer metallic thin crystals  

SciTech Connect (OSTI)

Phonon propagation across the interface of a Cu/Ag(111) bilayer and transient lattice disorder, induced by a femtosecond 267?nm pulse, in Ag(111) crystal have been measured by means of time resolved X-ray diffraction. A blast force due to thermal stress induced by suddenly heated electrons is formed within two picoseconds after excitation and its blast wave propagation through the interface and Ag (111) crystal was monitored by the shift and broadening of the rocking curve, I vs. ?, as a function of time after excitation. Lattice disorder, contraction and expansion as well as thermal strain formation and wave propagation have also been measured. The experimental data and mechanism proposed are supported by theoretical simulations.

Er, Ali Oguz [Department of Physics and Astronomy, Western Kentucky University, Bowling Green, Kentucky 42101 (United States); Tang, Jau, E-mail: jautang@gate.sinica.edu.tw, E-mail: prentzepis@ece.tamu.edu [Research Center for Applied Sciences Academia Sinica, Taipei, Taiwan (China); Chen, Jie [Key Laboratory for Laser Plasmas (Ministry of Education) and Department of Physics and Astronomy, Shanghai Jiao Tong University, Shanghai 200240 (China); Rentzepis, Peter M., E-mail: jautang@gate.sinica.edu.tw, E-mail: prentzepis@ece.tamu.edu [Department of Electrical and Computer Engineering, Texas A and M University, College Station, Texas 77843 (United States)



Diffusion-driven precipitate growth and ripening of oxygen precipitates in boron doped silicon by dynamical x-ray diffraction  

SciTech Connect (OSTI)

X-ray Pendellsung fringes from three silicon single crystals measured at 900?C are analyzed with respect to density and size of oxygen precipitates within a diffusion-driven growth model and compared with TEM investigations. It appears that boron doped (p+) material shows a higher precipitate density and a higher strain than moderately (p-) boron crystals. In-situ diffraction reveals a diffusion-driven precipitate growth followed by a second growth regime in both materials. An interpretation of the second growth regime in terms of Ostwald ripening yields surface energy values (around 70?erg/cm{sup 2}) similar to published data. Further, an increased nucleation rate by a factor of ?13 is found in the p+ sample as compared to a p- sample at a nucleation temperature of 450?C.

Will, J., E-mail: will@krist.uni-erlangen.de; Grschel, A.; Bergmann, C.; Magerl, A. [Crystallography and Structural Physics, University of Erlangen-Nrnberg, Staudtstr. 3, 91058 Erlangen (Germany); Spiecker, E. [Center for Nanoanalysis and Electron Microscopy, University of Erlangen-Nrnberg, Cauerstr. 6, 91058 Erlangen (Germany)



Cs-Exchange in Birnessite: Raction Mechanisms Inferred from Time-Resolved X-ray Diffraction and Transmission Electron Microscopy  

SciTech Connect (OSTI)

We have explored the exchange of Cs for interlayer Na in birnessite using several techniques, including transmission electron microscopy (TEM) and time-resolved synchrotron X-ray diffraction (XRD). Our goal was to test which of two possible exchange mechanisms is operative during the reaction: (1) diffusion of cations in and out of the interlayer or (2) dissolution of Na-birnessite and reprecipitation of Cs-birnessite. The appearance of distinct XRD peaks for Na- and Cs-rich phases in partially exchanged samples offered support for a simple diffusion model, but it was inconsistent with the compositional and crystallographic homogeneity of (Na,Cs)-birnessite platelets from core to rim as ascertained by TEM. Time-resolved XRD revealed systematic changes in the structure of the emergent Cs-rich birnessite phase during exchange, in conflict with a dissolution and reprecipitation model. Instead, we propose that exchange occurred by sequential delamination of Mn oxide octahedral sheets. Exfoliation of a given interlayer region allowed for wholesale replacement of Na by Cs and was rapidly followed by reassembly. This model accounts for the rapidity of metal exchange in birnessite, the co-existence of distinct Na- and Cs-birnessite phases during the process of exchange, and the uniformly mixed Na- and Cs-compositions ascertained from point analyses by selected area electron diffraction and energy dispersive spectroscopy of partially exchanged grains.

Lopano, C.; Heaney, P; Post, J



An x-ray diffraction study of some mesoionic 2,3-diphenyltetrazoles  

SciTech Connect (OSTI)

An X-my diffraction study is reported for four molecules of mesoionic 2,3-diphenyltetrazoles. The results confirm a dipolar [open quotes]mesoionic[close quotes] structure, aromatic character of the tetrazole ring and no conjugation between the phenyl and tetrazole rings. The geometry of the exocyclic group is discussed in detail. The molecular parameters of the compounds investigated are correlated with [sup 13]C and [sup 15]N nmr data. The results obtained are compared with similar structures which have already been studied.

Luboradzki, R. (Institute of Physical Chemistry, Warsaw (Poland)); Kozminski, W.; Stefaniak, L. (Institute of Organic Chemistry, Warsaw (Poland))



Growth and nucleation regimes in boron doped silicon by dynamical x-ray diffraction  

SciTech Connect (OSTI)

The oxygen precipitation of highly (17.5 m? cm) and moderately (4.5 ? cm) boron (B) doped silicon (Si) crystals at 780?C is investigated by following in-situ the evolution of diffraction Pendellsung oscillations. All samples show an initial diffusion-driven growth process which may change over into Ostwald ripening. For the highly doped sample and involving a nucleation step at 450?C for 30?h, the precipitate density ? is enhanced by a factor of 8 as compared to the moderately doped sample. The influence of a high B concentration on ? is dramatically higher for the samples directly heated to 780?C, where an enhancement factor of 80 is found. Considering Ostwald ripening as a second growth regime reveals consistent ripening rates and surface energies ? with those found at 900?C in a previous publication.

Will, J., E-mail: johannes.will@fau.de; Grschel, A.; Bergmann, C.; Weier, M.; Magerl, A. [Crystallography and Structural Physics, University of Erlangen-Nrnberg, Staudtstr. 3, 91058 Erlangen (Germany)



A Model Graphene Diffraction Pattern Frank Rioux  

E-Print Network [OSTI]

A Model Graphene Diffraction Pattern Frank Rioux The purpose of this tutorial is to model graphene d Pj k px j py k 2 i 1 A Graphene Model Diffraction Pattern #12;

Rioux, Frank


Reconstruction of a yeast cell from X-ray diffraction data  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

Details are provided of the algorithm used for the reconstruction of yeast cell images in the recent demonstration of diffraction microscopy by Shapiro, Thibault, Beetz, Elser, Howells, Jacobsen, Kirz, Lima, Miao, Nieman & Sayre [Proc. Natl Acad. Sci. USA (2005), 102, 15343-15346]. Two refinements of the iterative constraint-based scheme are developed to address the current experimental realities of this imaging technique, which include missing central data and noise. A constrained power operator is defined whose eigenmodes allow the identification of a small number of degrees of freedom in the reconstruction that are negligibly constrained as a result of the missing data. To achieve reproducibility in the algorithm's output, a special intervention is required for these modes. Weak incompatibility of the constraints caused by noise in both direct and Fourier space leads to residual phase fluctuations. This problem is addressed by supplementing the algorithm with an averaging method. The effect of averaging may be interpreted in terms of an effective modulation transfer function, as used in optics, to quantify the resolution. The reconstruction details are prefaced with simulations of wave propagation through a model yeast cell. These show that the yeast cell is a strong-phase-contrast object for the conditions in the experiment.

Thibault, Pierre; Elser, Veit; Jacobsen, Chris; Shapiro, David; Sayre, David



Structure of a zeolite ZSM-5-Bithiophene complex as determined by high-resolution synchrotron X-ray powder diffraction  

SciTech Connect (OSTI)

The structure of a zeolite ZSM-5 complex with ca. 4 molecules/unit cell of bithiophene was determined by high-resolution synchrotron X-ray powder diffraction. In adopts monoclinic symmetry in space group P2{sub 1}/n ({alpha} unique) between room temperature and 25 K, with refined lattice parameters at 25 K of a = 20.0614(4), b = 19.8251(4), c = 13.3623(4) {Angstrom}, and a = 90.848(2){degrees}. Structural modeling and Rietveld refinements showed that there are two crystallographically unique bithiophene molecules, each with an occupancy factor of ca. 0.5. One bithiophene is localized at the center of the straight channels with one of the rings residing at the intersection with the sinusoidal channels. The other molecule lies in the sinusoidal channels and projects partially into the straight channels. The relationship between polythiophene chain length and the formation of conducting polythiophene molecular wires in the ZSM-5 framework is discussed. 32 refs., 4 figs., 3 tabs.

Eylem, C.; Hriljac, J.A. [Brookhaven National Laboratory, Upton, NY (United States)] [Brookhaven National Laboratory, Upton, NY (United States); Ramamurthy, V.; Corbin, D.R. [Du Pont Co., Wilmington, DE (United States)] [Du Pont Co., Wilmington, DE (United States); Parise, J.B. [State Univ. of New York, Stony Brook, NY (United States)] [State Univ. of New York, Stony Brook, NY (United States)



Purification, crystallization and preliminary X-ray diffraction analysis of the human mismatch repair protein MutS[beta  

SciTech Connect (OSTI)

MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification of recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.

Tseng, Quincy; Orans, Jillian; Hast, Michael A.; Iyer, Ravi R.; Changela, Anita; Modrich, Paul L.; Beese, Lorena S. (Duke)



X-ray Diffraction and Molecular Dynamics Study of Medium-range Order in Ambient and Hot Water  

E-Print Network [OSTI]

We have developed x-ray diffraction measurements with high energy-resolution and accuracy to study water structure at three different temperatures (7, 25 and 66 C) under normal pressure. Using a spherically curved Ge crystal an energy resolution better than 15 eV has been achieved which eliminates influence from Compton scattering. The high quality of the data allows a precise oxygen-oxygen pair correlation function (PCF) to be directly derived from the Fourier transform of the experimental data resolving shell structure out to ~12 {\\AA}, i.e. 5 hydration shells. Large-scale molecular dynamics (MD) simulations using the TIP4P/2005 force-field reproduce excellently the experimental shell-structure in the range 4-12 {\\AA} although less agreement is seen for the first peak in the PCF. The Local Structure Index [J. Chem. Phys. 104, 7671 (1996)] identifies a tetrahedral minority giving the intermediate-range oscillations in the PCF and a disordered majority providing a more featureless background in this range. The current study supports the proposal that the structure of liquid water, even at high temperatures, can be described in terms of a two-state fluctuation model involving local structures related to the high-density and low-density forms of liquid water postulated in the liquid-liquid phase transition hypothesis.

Congcong Huang; K. T. Wikfeldt; D. Nordlund; U. Bergmann; T. McQueen; J. Sellberg; L. G. M. Pettersson; A. Nilsson



Soft x-ray reduction camera for submicron lithography  

DOE Patents [OSTI]

Soft x-ray projection lithography can be performed using x-ray optical components and spherical imaging lenses (mirrors), which form an x-ray reduction camera. The x-ray reduction is capable of projecting a 5x demagnified image of a mask onto a resist coated wafer using 4.5 nm radiation. The diffraction limited resolution of this design is about 135 nm with a depth of field of about 2.8 microns and a field of view of 0.2 cm.sup.2. X-ray reflecting masks (patterned x-ray multilayer mirrors) which are fabricated on thick substrates and can be made relatively distortion free are used, with a laser produced plasma for the source. Higher resolution and/or larger areas are possible by varying the optic figures of the components and source characteristics.

Hawryluk, Andrew M. (2708 Rembrandt Pl., Modesto, CA 95356); Seppala, Lynn G. (7911 Mines Rd., Livermore, CA 94550)



Soft x-ray reduction camera for submicron lithography  

DOE Patents [OSTI]

Soft x-ray projection lithography can be performed using x-ray optical components and spherical imaging lenses (mirrors), which form an x-ray reduction camera. The x-ray reduction is capable of projecting a 5x demagnified image of a mask onto a resist coated wafer using 4.5 nm radiation. The diffraction limited resolution of this design is about 135 nm with a depth of field of about 2.8 microns and a field of view of 0.2 cm[sup 2]. X-ray reflecting masks (patterned x-ray multilayer mirrors) which are fabricated on thick substrates and can be made relatively distortion free are used, with a laser produced plasma for the source. Higher resolution and/or larger areas are possible by varying the optic figures of the components and source characteristics. 9 figures.

Hawryluk, A.M.; Seppala, L.G.



In-situ X-ray diffraction study of phase transformations in the Am-O system  

SciTech Connect (OSTI)

In the frame of minor actinides recycling, americium can be transmuted by adding it in UO{sub 2} or (U, Pu)O{sub 2} fuels. Americium oxides exhibiting a higher oxygen potential than U or Pu oxides, its addition alters the fuel properties. To comprehend its influence, a thorough knowledge of the Am-O phase equilibria diagram and of thermal expansion behavior is of main interest. Due to americium scarcity and high radiotoxicity, few experimental reports on this topic are available. Here we present in-situ high-temperature XRD results on the reduction from AmO{sub 2} to Am{sub 2}O{sub 3}. We show that fluorite (Fm-3m) AmO{sub 2} is reduced to cubic (Ia-3) C Prime -type Am{sub 2}O{sub 3+{delta}}, and then into hexagonal (P6{sub 3}/mmc) A-type Am{sub 2}O{sub 3}, which remains stable up to 1840 K. We also demonstrate the transitional existence of the monoclinic (C2/m) B-type Am{sub 2}O{sub 3}. At last, we describe, for the first time, the thermal expansion behavior of the hexagonal Am{sub 2}O{sub 3} between room temperature and 1840 K. - Graphical abstract: Americium dioxide was in situ studied by high-temperature X-ray diffraction. First, fluorite AmO{sub 2} is reduced to cubic C Prime -type Am{sub 2}O{sub 3+{delta}} and then transforms into hexagonal A-type Am{sub 2}O{sub 3}, which remains stable up to 1840 K. Then, we demonstrate the transitional existence of monoclinic B-type Am{sub 2}O{sub 3}. At last, we describe, for the first time, the thermal expansion of A-type Am{sub 2}O{sub 3} between room temperature and 1840 K. This work may contribute to a better understanding of Am oxide behavior. Highlights: Black-Right-Pointing-Pointer We realize an in-situ high-temperature X-ray diffraction study on an AmO{sub 2} sample. Black-Right-Pointing-Pointer Fluorite AmO{sub 2} transforms to cubic Am{sub 2}O{sub 3+{delta}} and then to hexagonal Am{sub 2}O{sub 3}. Black-Right-Pointing-Pointer Little-known monoclinic Am{sub 2}O{sub 3} is observed during the cubic-to-hexagonal transition. Black-Right-Pointing-Pointer Lattice parameter thermal expansion of hexagonal Am{sub 2}O{sub 3} is given up to 1840 K. Black-Right-Pointing-Pointer We give additional data on AmO{sub 2} lattice parameter expansion under self-irradiation.

Lebreton, Florent, E-mail: florent.lebreton@cea.fr [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France) [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France); GEMH, ENSCI, 87065 Limoges (France); Belin, Renaud C., E-mail: renaud.belin@cea.fr [CEA Cadarache, DEN/DEC/SPUA/LMPC, F-13108 Saint-Paul-Lez-Durance (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France)] [CEA Marcoule, DEN/DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Ceze cedex (France); Blanchart, Philippe, E-mail: philippe.blanchart@unilim.fr [GEMH, ENSCI, 87065 Limoges (France)] [GEMH, ENSCI, 87065 Limoges (France)



High-pressure single-crystal X-ray diffraction of Tl{sub 2}SeO{sub 4}  

SciTech Connect (OSTI)

The effect of pressure on the crystal structure of thallium selenate (Tl{sub 2}SeO{sub 4}) (Pmcn, Z=4), containing the Tl{sup +} cations with electron lone pairs, has been studied with single-crystal X-ray diffraction in a diamond anvil cell up to 3.64 GPa at room temperature. No phase transition has been observed. The compressibility data are fitted by a Murnaghan equation of state with the zero-pressure bulk modulus B{sub 0}=29(1) GPa and the unit-cell volume at ambient pressure V{sub 0}=529.6(8) A{sup 3} (B'=4.00). Tl{sub 2}SeO{sub 4} is the least compressible in the c direction, while the pressure-induced changes of the a and b lattice parameters are quite similar. These observations can be explained by different pressure effects on the nine- and 11-fold coordination polyhedra around the two non-equivalent Tl atoms. The SeO{sub 4}{sup 2-} tetrahedra are not rigid units and become more distorted. Their contribution to the compressibility is small. The effect of pressure on the isotypical oxide materials A{sub 2}TO{sub 4} with the {beta}-K{sub 2}SO{sub 4} structure is discussed. It appears that the presence of electron lone pairs on the Tl{sup +} cation does not seem to influence the compressibility of Tl{sub 2}SeO{sub 4}. - Graphical abstract: Pressure dependence of normalized lattice parameters and unit-cell volumes in Tl{sub 2}SeO{sub 4} (Pmcn, Z=4). The solid line is the Murnaghan equation of state.

Grzechnik, Andrzej [Departamento de Fisica de la Materia Condensada, Universidad del Pais Vasco, E-48080 Bilbao (Spain)], E-mail: andrzej.grzechnik@ehu.es; Breczewski, Tomasz; Friese, Karen [Departamento de Fisica de la Materia Condensada, Universidad del Pais Vasco, E-48080 Bilbao (Spain)



Phases of underpotentially deposited Hg on Au(111): An in situ surface X-ray diffraction study  

SciTech Connect (OSTI)

We report on an in situ surface X-ray diffraction study of the underpotential deposition (UPD) of mercury on Au(111). We have observed three UPD phases present at potentials prior to bulk mercury deposition. These phases consist of two well-ordered intermediate states and what appears to be either a fully discharged two-dimensional liquid Hg layer or a monolayer of an amorphous Hg-Au alloy. Both ordered intermediate phases have hexagonal structures with lattice vectors that are rotated 30{degree} from those of the Au(111) substrate. The first phase (phase I), present at a potential of +0.68 V, was only observed on fresh flame-annealed Au(111) electrodes and appears to be an open incommensurate structure with a lattice constant of 3.86 {+-} 0.03 A. This phase appears to be metastable since it changes to a second ordered phase (phase II) after a certain time. The second phase has a more compact lattice with a = 3.34 {+-} 0.01 A and appears to be a commensurate 2x2 structure with 2/3 of the Hg atoms at threefold hollow sites and 1/3 on atop sites. Similar to the first one, this phase is also metastable and can be transformed to a final, fully discharged, state of a two-dimensional liquid Hg layer or an amorphous Hg-Au alloy. The entire Hg UPD process, from Hg{sup 2+} to the fully discharged metallic Hg layer, agrees well with a multistep mechanism based on previous electrochemical kinetic studies on polycrystalline Au electrodes. 31 refs., 10 figs., 2 tabs.

Li, J.; Abruna, H.D. [Cornell Univ., Ithaca, NY (United States)] [Cornell Univ., Ithaca, NY (United States)



High-pressure behavior and thermoelastic properties of niobium studied by in situ x-ray diffraction  

SciTech Connect (OSTI)

In situ synchrotron energy dispersive x-ray diffraction (XRD) experiments on Nb have been conducted at pressures up to 6.4?GPa and temperatures up to 1073?K. From the pressure-volume-temperature measurements, thermoelastic parameters were derived for the first time for Nb based on the thermal pressure (?P{sub th}) equation of state (EOS), modified high-T Birch-Murnaghan EOS, and Mie-Grneisen-Debye EOS. With the pressure derivative of the bulk modulus K{sub T}{sup ?} fixed at 4.0, we obtained the ambient isothermal bulk modulus K{sub T0}?=?174(5) GPa, the temperature derivative of bulk modulus at constant pressure (?K{sub T}/?T){sub P}=?0.060(8) GPa K{sup ?1} and at constant volume (?K{sub T}/?T){sub V}=?0.046(8)?GPa K{sup ?1}, the volumetric thermal expansivity ?{sub T}(T)=2.3(3)10{sup ?5}+0.3(2)10{sup ?8}T (K{sup ?1}), as well as the pressure dependence of thermal expansion (??/?P){sub T}=(?2.00.4)10{sup ?6} K{sup ?1?}GPa{sup ?1}. Fitting the present data to the Mie-Grneisen-Debye EOS with Debye temperature ?{sub 0}?=?276.6?K gives ?{sub 0}?=?1.27(8) and K{sub T0}?=?171(3) GPa at a fixed value of q?=?3.0. The ambient isothermal bulk modulus and Grneisen parameter derived from this work are comparable to previously reported values from both experimental and theoretical studies. An in situ high-resolution, angle dispersive XRD study on Nb did not indicate any anomalous behavior related to pressure-induced electronic topological transitions at ?5?GPa as has been reported previously.

Zou, Yongtao, E-mail: yongtao.zou@stonybrook.edu, E-mail: yongtaozou6@gmail.com; Li, Baosheng [Mineral Physics Institute, State University of New York, Stony Brook, New York 11794 (United States); Qi, Xintong [Department of Materials Science and Engineering, State University of New York, Stony Brook, New York 11794 (United States); Wang, Xuebing; Chen, Ting [Department of Geosciences, State University of New York, Stony Brook, New York 11794 (United States); Li, Xuefei [Mineral Physics Institute, State University of New York, Stony Brook, New York 11794 (United States); Key Laboratory of Functional Materials Physics and Chemistry of the Ministry of Education, Jilin Normal University, Siping 136000 (China); Welch, David [Department of Materials Science and Engineering, State University of New York, Stony Brook, New York 11794 (United States); Condensed Matter Physics and Materials Science Department, Brookhaven National Laboratory, Upton, New York 11973 (United States)



Observations of Ferrite/Austenite Transformations in the Heat Affected Zone of 2205 Duplex Stainless Steel Spot Welds Using Time Resolved X-Ray Diffraction  

SciTech Connect (OSTI)

Time Resolved X-Ray Diffraction (TRXRD) measurements are made in the Heat Affected Zone (HAZ) of 2205 Duplex Stainless Steel (DSS) spot welds. Both the {gamma} {yields} {delta} and {delta} {yields} {gamma} transformations are monitored as a function of time during the rapid spot weld heating and cooling cycles. These observations are then correlated with calculated thermal cycles. Where the peak temperatures are highest ({approx}1342 C), the {gamma} {yields} {delta} transformation proceeds to completion, leaving a ferritic microstructure at the end of heating. With lower peak temperatures, the {gamma} {yields} {delta} transformation proceeds to only partial completion, resulting in a microstructure containing both transformed and untransformed austenite. Further analyses of the individual diffraction patterns show shifts in the peak positions and peak widths as a function of both time and temperature. In addition, these changes in the peak characteristics are correlated with measured changes in the ferrite volume fraction. Such changes in the peak positions and widths during the {gamma} {yields} {delta} transformation provide an indication of changes occurring in each phase. These changes in peak properties can be correlated with the diffusion of nitrogen and other substitutional alloying elements, which are recognized as the primary mechanisms for this transformation. Upon cooling, the {delta} {yields} {gamma} transformation is observed to proceed from both the completely and partially transformed microstructural regions in the TRXRD data. An examination of the resulting microstructures confirms the TRXRD observation as the evidence shows that austenite both nucleates and grows from the ferritic microstructure at locations closest to the fusion zone boundary and grows from untransformed austenite grains at locations further from this boundary.

Palmer, T; Elmer, J; Babu, S


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray diffraction and extended X-ray absorption fine structure study of epitaxial mixed ternary bixbyite Pr{sub x}Y{sub 2-x}O{sub 3} (x = 0-2) films on Si (111)  

SciTech Connect (OSTI)

Ternary single crystalline bixbyite Pr{sub x}Y{sub 2-x}O{sub 3} films over the full stoichiometry range (x = 0-2) have been epitaxially grown on Si (111) with tailored electronic and crystallographic structure. In this work, we present a detailed study of their local atomic environment by extended X-ray absorption fine structure at both Y K and Pr L{sub III} edges, in combination with complementary high resolution x-ray diffraction measurements. The local structure exhibits systematic variations as a function of the film composition. The cation coordination in the second and third coordination shells changes with composition and is equal to the average concentration, implying that the Pr{sub x}Y{sub 2-x}O{sub 3} films are indeed fully mixed and have a local bixbyite structure with random atomic-scale ordering. A clear deviation from the virtual crystal approximation for the cation-oxygen bond lengths is detected. This demonstrates that the observed Vegard's law for the lattice variation as a function of composition is based microscopically on a more complex scheme related to local structural distortions which accommodate the different cation-oxygen bond lengths.

Niu, G.; Zoellner, M. H.; Zaumseil, P. [IHP, Im Technologiepark 25, 15236 Frankfurt (Oder) (Germany); Pouliopoulos, A. [Department of Physics and Astronomy, University of Bologna, viale C. BertiPichat 6/2, 40127 Bologna (Italy); D'Acapito, F. [Consiglio Nazionale delle Ricerche, Istituto Officina dei Materiali, Operative Group in Grenoble, c/o European Synchrotron Radiation Facility, B.P. 220, 38043 Grenoble (France); Schroeder, T. [IHP, Im Technologiepark 25, 15236 Frankfurt (Oder) (Germany); BTU Cottbus, Konrad-Zuse-Str. 1, 03046 Cottbus (Germany); Boscherini, F. [Department of Physics and Astronomy, University of Bologna, viale C. BertiPichat 6/2, 40127 Bologna (Italy); Consiglio Nazionale delle Ricerche, Istituto Officina dei Materiali, Operative Group in Grenoble, c/o European Synchrotron Radiation Facility, B.P. 220, 38043 Grenoble (France)



X-ray Line Profile Analysis of Nanoparticles in Proton Exchange Membrane Fuel Cell Matthias Loster,*, Davor Balzar, K. Andreas Friedrich, and Ju1rgen Garche  

E-Print Network [OSTI]

X-ray Line Profile Analysis of Nanoparticles in Proton Exchange Membrane Fuel Cell Electrodes to extract X-ray diffraction patterns from a multiphase system and analyze the particle size distribution to the durability of the cell. Since the membrane electrode assembly (MEA) contains multiple and partially X-ray

Balzar, Davor


Study of strain propagation in laser irradiated silicon crystal by time-resolved diffraction of K-{alpha} x-ray probe of different photon energies  

SciTech Connect (OSTI)

An experimental study on the time resolved x-ray diffraction from laser shocked silicon crystal, carried out using a 10 TW Ti:sapphire laser system, is presented. The characteristic K{sub {alpha}} x-ray line radiation generated by 45 fs laser produced plasmas of two different target materials (iron and copper) is used as the probe, whereas the stretched pulse of sub-nanosecond duration (pump), derived from the same laser, is used to compress the sample. The use of x-ray probe of different photon energies yields information about the strain over a greater crystal depth. The dynamics of the strain propagation is inferred by monitoring the evolution of rocking curve width of the shocked sample at different time delays between the pump and the probe pulse. The shock velocity deduced from these measurements is {approx}10{sup 6} cm/s, consistent with the sound velocity in bulk silicon. The maximum elastic compression observed is 0.4%, indicating a pressure of 0.8 GPa.

Arora, V.; Bagchi, S.; Chakera, J. A.; Naik, P. A.; Gupta, P. D. [Laser Plasma Division, Raja Ramanna Centre for Advanced Technology, Indore 452 013 (India); Gupta, M.; Gupta, A.; Chaddah, P. [UGC-DAE Consortium for Scientific Research, University Campus, Indore 452 001 (India)



Relationship between dislocations and residual stresses in cold-drawn pearlitic steel analyzed by energy-dispersive X-ray diffraction  

SciTech Connect (OSTI)

We analyzed the dislocation distribution of cold-drawn pearlitic-steel wire by using the line-profile analysis based on the energy dispersive X-ray diffraction (EDXD). Although this line-profile analysis requires a high resolution in reciprocal space, the resolution for EDXD is generally poor due to the energy resolution of the detector. Our analysis demonstrated that the resolution in the reciprocal space can be maximized at small scattering angles. Using the line-profile analysis based on the EDXD, the microstructural parameters such as the crystallite size and the dislocation density of the ferrite phase in the pearlitic steel were successfully analyzed. In addition, the distribution of the residual stress of the ferrite phase of a pearlitic steel wire was also analyzed using the EDXD measurement. - Highlights: Energy dispersive X-ray diffraction is applied to the line-profile analysis. Distribution of dislocations in ferrite in the pearlitic steel wire is analyzed. Relationship between dislocations and residual stress is discussed.

Sato, Shigeo, E-mail: s.sato@imr.tohoku.ac.jp [Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan); Wagatsuma, Kazuaki [Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan); Suzuki, Shigeru [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Kumagai, Masayoshi; Imafuku, Muneyuki [Faculty of Engineering, Tokyo City University, Tokyo 158-8557 (Japan); Tashiro, Hitoshi [Gyoda 361-0011 (Japan); Kajiwara, Kentaro [Japan Synchrotron Radiation Research Institute, Sayo 679-5198 (Japan); Shobu, Takahiasa [Japan Atomic Energy Agency, Sayo 679-5184 (Japan)



In situ apparatus for the study of clathrate hydrates relevant to solar system bodies using synchrotron X-ray diffraction and Raman spectroscopy  

E-Print Network [OSTI]

Clathrate hydrates are believed to play a significant role in various solar system environments, e.g. comets, and the surfaces and interiors of icy satellites, however the structural factors governing their formation and dissociation are poorly understood. We demonstrate the use of a high pressure gas cell, combined with variable temperature cooling and time-resolved data collection, to the in situ study of clathrate hydrates under conditions relevant to solar system environments. Clathrates formed and processed within the cell are monitored in situ using synchrotron X-ray powder diffraction and Raman spectroscopy. X-ray diffraction allows the formation of clathrate hydrates to be observed as CO2 gas is applied to ice formed within the cell. Complete conversion is obtained by annealing at temperatures just below the ice melting point. A subsequent rise in the quantity of clathrate is observed as the cell is thermally cycled. Four regions between 100-5000cm-1 are present in the Raman spectra that carry feature...

Day, Sarah J; Evans, Aneurin; Parker, Julia E



Coadsorption of sulfate/bisulfate anions with Hg cations during Hg underpotential deposition on Au(111): An in situ x-ray diffraction study  

SciTech Connect (OSTI)

The first stage of mercury underpotential deposition on Au(111) electrodes in 0.10 M H{sub 2}SO{sub 4} containing 1.0 mM Hg{sup 2+} has been studied by synchrotron X-ray scattering techniques including grazing incidence X-ray diffraction and specular crystal truncation rod measurements. An ordered coadsorbed structure of sulfate/bisulfate anions and Hg cations was found at potentials between the first and second Hg UPD peaks (+0.80 V > E > +0.88 V vs Ag/AgCl(3 M KCl)). The coadsorption structure was found to consist of a compressed Hg honeycomb lattice with the honeycomb centers occupied by sulfate or bisulfate anions. The compression of the lattice is likely due to the formation of mercurous (Hg{sub 2}{sup 2+}) ions which have a much shorter Hg-Hg distance than that in frozen bulk Hg crystals. The net charge transferred under the first Hg UPD peak suggests that the chemical state of the species in the coadsorbed structure is likely Hg{sub 2}SO{sub 4}. Our results indicate that both the chemical state of the mercury cations and the nature of the anions are important in the resulting electrodeposited structures. 38 refs., 8 figs., 1 tab.

Li, J.; Abruna, H.D. [Cornell Univ., Ithaca, NY (United States)] [Cornell Univ., Ithaca, NY (United States)



X-ray ?-Laue diffraction analysis of Cu through-silicon vias: A two-dimensional and three-dimensional study  

SciTech Connect (OSTI)

Here, white X-ray ?-beam Laue diffraction is developed and applied to investigate elastic strain distributions in three-dimensional (3D) materials, more specifically, for the study of strain in Cu 10??m diameter80??m deep through-silicon vias (TSVs). Two different approaches have been applied: (i) two-dimensional ?-Laue scanning and (ii) ?-beam Laue tomography. 2D ?-Laue scans provided the maps of the deviatoric strain tensor integrated along the via length over an array of TSVs in a 100??m thick sample prepared by Focused Ion Beam. The ?-beam Laue tomography analysis enabled to obtain the 3D grain and elemental distribution of both Cu and Si. The position, size (about 3??m), shape, and orientation of Cu grains were obtained. Radial profiles of the equivalent deviatoric strain around the TSVs have been derived through both approaches. The results from both methods are compared and discussed.

Sanchez, Dario Ferreira; Weleguela, Monica Larissa Djomeni; Audoit, Guillaume; Grenier, Adeline; Gergaud, Patrice; Bleuet, Pierre [Univ. Grenoble Alpes, F-38000 Grenoble (France); CEA/LETI, MINATEC Campus, F-38054 Grenoble (France); Laloum, David [Univ. Grenoble Alpes, F-38000 Grenoble (France); CEA/LETI, MINATEC Campus, F-38054 Grenoble (France); ST Microelectronics, 850 Rue Jean Monnet, F-38920 Crolles (France); Ulrich, Olivier; Micha, Jean-Sbastien; Robach, Odile [Univ. Grenoble Alpes, F-38000 Grenoble (France); CEA/INAC and CNRS, SPrAM, 17 rue des Martyrs, F-38054 Grenoble (France); Lorut, Frdric [ST Microelectronics, 850 Rue Jean Monnet, F-38920 Crolles (France)



X-ray diffraction study of (TlInSe{sub 2}){sub 1-x}(TlGaTe{sub 2}){sub x} crystal system  

SciTech Connect (OSTI)

The crystallographic and dynamic characteristics of TlInSe{sub 2} and TlGaTe{sub 2} crystals have been studied by X-ray diffraction in the temperature range of 85-320 K. The temperature dependences of the unit-cell parameters a of TlInSe{sub 2} and TlGaTe{sub 2} crystals, as well as their coefficients of thermal expansion along the [100] direction, are determined. The concentration dependences of the unit-cell parameters a and c for (TlInSe{sub 2}){sub 1-x}(TlGaTe{sub 2}){sub x} crystals are measured. Anomalies are found in the temperature dependences of the unit-cell parameters a and, correspondingly, the coefficient of thermal expansion, indicating the existence of phase transitions in TlInSe{sub 2} and TlGaTe{sub 2} crystals.

Sheleg, A. U., E-mail: sheleg@ifttp.bas-net.by; Zub, E. M.; Yachkovskii, A. Ya. [National Academy of Sciences of Belarus, State Scientific and Production Association, Scientific and Practical Materials Research Center (Belarus); Mustafaeva, S. N.; Kerimova, E. M. [Azerbaijan National Academy of Sciences, Institute of Physics (Azerbaijan)



Identification of an incommensurate FeAl{sub 2} overlayer on FeAl(110) using x-ray diffraction and reflectivity  

SciTech Connect (OSTI)

FeAl, like NiAl, crystallizes in the CsCl structure. Consequently the (110) planes contain equal amounts of Fe and Al distributed as interlocking rectangles. Unlike the NiAI(110) surface, which retains the (1{times}l) in-plane symmetry of the bulk, FeAl(l10) reconstructs to form an ordered, incommensurate overlayer. The reconstructed layer introduces x-ray diffraction rods at half-order positions along the [1{bar 1}0] direction, and displaced {plus_minus}0.2905 from integer positions along the [001] direction. Peak widths reveal excellent long range order. Specular reflectivity measurements above and below the Fe K{alpha} edge can be reproduced using a model containing a single reconstructed overlayer with an Fe:Al ratio of 1:2, consistent with FeA{sub I}2.

Baddorf, A.P. [Oak Ridge National Lab., TN (United States); Chandavarkar, S.S. [Tennessee Univ., Knoxville, TN (United States). Dept. of Physics and Astronomy



X-ray imaging and diffraction from surface phonons on GaAs W. Sauer,a)  

E-Print Network [OSTI]

, the driver frequency of the synchrotron was multiplied 102 times by a phase-locked loop PLL , ampli- fied are excited on the GaAs 001 surface by using interdigital transducers, designed for frequencies of up to 900 to measured diffraction profiles at different excitation voltages, the SAW amplitudes were calculated

Ludwig-Maximilians-Universitt, Mnchen


LJournal of Alloys and Compounds 291 (1999) 94101 The simultaneous powder X-ray and neutron diffraction refinement of two  

E-Print Network [OSTI]

melting of metals in the The intermetallic ternary transition metal nitrides and presence of carbon]. These phases are of interest decomposition of transition metal tris­ethylenediamine to the solid state chemist diffraction refinement of two h-carbide type nitrides, Fe Mo N and Co Mo N, prepared by3 3 3 3 ammonolysis

zur Loye, Hans-Conrad


X-ray photoemission spectromicroscopy of titanium silicide formation in patterned microstructures  

SciTech Connect (OSTI)

Titanium silicide has the lowest resistivity of all the refractory metal silicides and has good thermal stability as well as excellent compatibility with Al metallization. It is used as an intermediate buffer layer between W vias and the Si substrate to provide good electrical contact in ULSI technology, whose submicron patterned features form the basis of the integrated circuits of today and tomorrow, in the self aligned silicide (salicide) formation process. TiSi{sub 2} exists in two phases: a metastable C49 base-centered orthorhombic phase with specific resistivity of 60-90 {mu}{Omega}-cm that is formed at a lower temperature (formation anneal) and the stable 12-15 {mu}{Omega}-cm resistivity face-centered orthorhombic C54 phase into which C49 is transformed with a higher temperature (conversion anneal) step. C54 is clearly the target for low resistivity VLSI interconnects. However, it has been observed that when dimensions shrink below 1/mic (or when the Ti thickness drops below several hundred angstroms), the transformation of C49 into C54 is inhibited and agglomeration often occurs in fine lines at high temperatures. This results in a rise in resistivity due to incomplete transformation to C54 and because of discontinuities in the interconnect line resulting from agglomeration. Spectromicroscopy is an appropriate tool to study the evolution of the TiSi2 formation process because of its high resolution chemical imaging ability which can detect bonding changes even in the absence of changes in the relative amounts of species and because of the capability of studying thick {open_quotes}as is{close_quotes} industrial samples.

Singh, S.; Solak, H.; Cerrina, F. [Univ. of Wisconsin-Madison, Stoughton, WI (United States)] [and others



Structural phase transition and magnetism in hexagonal SrMnO{sub 3} by magnetization measurements and by electron, x-ray, and neutron diffraction studies  

SciTech Connect (OSTI)

The structural and magnetic properties of the hexagonal four-layer form of SrMnO{sub 3} have been investigated by combining magnetization measurements, electron diffraction, and high-resolution synchrotron x-ray and neutron powder diffraction. Below 350 K, there is subtle structural phase transition from hexagonal symmetry (space group P6{sub 3}/mmc) to orthorhombic symmetry (space group C222{sub 1}) where the hexagonal metric is preserved. The second-order phase transition involves a slight tilting of the corner-sharing Mn{sub 2}O{sub 9} units composed of two face-sharing MnO{sub 6} octahedra and the associated displacement of Sr{sup 2+} cations. The phase transition is described in terms of symmetry-adapted displacement modes of the high symmetry phase. Upon further cooling, long range magnetic order with propagation vector k=(0,0,0) sets in below 300 K. The antiferromagnetic structure, analyzed using representation theory, shows a considerably reduced magnetic moment indicating the crucial role played by direct exchange between Mn centers of the Mn{sub 2}O{sub 9} units.

Daoud-Aladine, A.; Chapon, L. C.; Knight, K. S. [ISIS facility, Rutherford Appleton Laboratory-CCLRC, Chilton, Didcot, Oxfordshire, OX11 0QX (United Kingdom); Martin, C. [Laboratoire CRISMAT-UMR, 6508 ENSI CAEN, 6, Marechal Juin, 14050 Caen (France); ISIS facility, Rutherford Appleton Laboratory-CCLRC, Chilton, Didcot, Oxfordshire, OX11 0QX (United Kingdom); Hervieu, M. [Laboratoire CRISMAT-UMR, 6508 ENSI CAEN, 6, Marechal Juin, 14050 Caen (France); Brunelli, M. [European Synchrotron Radiation Facility, BP220, F-38043 Grenoble Cedex (France); Radaelli, P. G. [ISIS facility, Rutherford Appleton Laboratory-CCLRC, Chilton, Didcot, Oxfordshire, OX11 0QX (United Kingdom); Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)



Spatial resolution of synchrotron x-ray microtomography in high energy range: Effect of x-ray energy and sample-to-detector distance  

SciTech Connect (OSTI)

Spatial resolution of three-dimensional images obtained by synchrotron X-ray microtomography technique is evaluated using cyclic bar patterns machined on a steel wire. Influences of X-ray energy and the sample-to-detector distance on spatial resolution were investigated. High X-ray energies of 33-78 keV are applied due to the high X-ray absorption of transition metals. Best spatial resolution of about 1.2 {mu}m pitch was observed at the sample-to-detector distance range of 20-110 mm and at the energy range of 68-78 keV. Several factors such as X-ray scattering and diffraction phenomena affecting the degradation of spatial resolution are also discussed.

Seo, D.; Tomizato, F.; Toda, H.; Kobayashi, M. [Department of Mechanical Engineering, Toyohashi University of Technology, Toyohashi, Aichi 441-8580 (Japan); Uesugi, K.; Takeuchi, A.; Suzuki, Y. [Japan Synchrotron Radiation Research Institute, Mikazuki, Sayo, Hyogo 679-5198 (Japan)



Percolative superconductivity in La{sub 2}CuO{sub 4.06} by lattice granularity patterns with scanning micro x-ray absorption near edge structure  

SciTech Connect (OSTI)

The simplest cuprate superconductor La{sub 2}CuO{sub 4+y} with mobile oxygen interstitials exhibits a clear phase separation. It is known that oxygen interstitials enter into the rocksalt La{sub 2}O{sub 2+y} spacer layers forming oxygen interstitials rich puddles and poor puddles but only recently a bulk multiscale structural phase separation has been observed by using scanning micro X-ray diffraction. Here we get further information on their spatial distribution, using scanning La L{sub 3}-edge micro X-ray absorption near edge structure. Percolating networks of oxygen rich puddles are observed in different micrometer size portions of the crystals. Moreover, the complex surface resistivity shows two jumps associated to the onset of intra-puddle and inter-puddles percolative superconductivity. The similarity of oxygen doped La{sub 2}CuO{sub 4+y}, with the well established phase separation in iron selenide superconductors is also discussed.

Poccia, Nicola [MESA Institute for Nanotechnology, University of Twente, P. O. Box 217, 7500AE Enschede (Netherlands); RICMASS Rome International Center for Materials Science Superstripes, via dei Sabelli 119A, 00185 Roma (Italy); Chorro, Matthieu [Synchrotron SOLEIL L'Orme des Merisiers, 91190 Paris S.Aubin (France); Ricci, Alessandro [Deutsches Elektronen-Synchrotron DESY, Notkestrae 85, D-22607 Hamburg (Germany); RICMASS Rome International Center for Materials Science Superstripes, via dei Sabelli 119A, 00185 Roma (Italy); Xu, Wei [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China); Marcelli, Augusto [Istituto Nazionale di Fisica Nucleare - Laboratori Nazionali di Frascati, 00044 Frascati, Rome (Italy); NSRL, University of Science and Technology of China, Hefei 230026 (China); RICMASS Rome International Center for Materials Science Superstripes, via dei Sabelli 119A, 00185 Roma (Italy); Campi, Gaetano [Institute of Crystallography, CNR, via Salaria Km 29.300, Monterotondo, 00015 Rome (Italy); RICMASS Rome International Center for Materials Science Superstripes, via dei Sabelli 119A, 00185 Roma (Italy); Bianconi, Antonio [RICMASS Rome International Center for Materials Science Superstripes, via dei Sabelli 119A, 00185 Roma (Italy); Institute of Crystallography, CNR, via Salaria Km 29.300, Monterotondo, 00015 Rome (Italy)



Direct Observations of Sigma Phase Formation in Duplex Stainless Steels using In Situ Synchrotron X-Ray Diffraction  

SciTech Connect (OSTI)

The formation and growth of sigma phase in 2205 duplex stainless steel was observed and measured in real time using synchrotron radiation during 10 hr isothermal heat treatments at temperatures between 700 C and 850 C. Sigma formed in near-equilibrium quantities during the isothermal holds, starting from a microstructure which contained a balanced mixture of metastable ferrite and austenite. In situ synchrotron diffraction continuously monitored the transformation, and these results were compared to those predicted by thermodynamic calculations. Differences between the calculated and measured amounts of sigma, ferrite and austenite suggest that the thermodynamic calculations underpredict the sigma dissolution temperature by approximately 50 C. The data were further analyzed using a modified Johnson-Mehl-Avrami (JMA) approach to determine kinetic parameters for sigma formation over this temperature range. The initial JMA exponent, n, at low fractions of sigma was found to be approximately 7.0, however, towards the end of the transformation, n decreased to values of approximately 0.75. The change in the JMA exponent was attributed to a change in the transformation mechanism from discontinuous precipitation with increasing nucleation rate, to growth of the existing sigma phase after nucleation site saturation occurred. Because of this change in mechanism, it was not possible to determine reliable values for the activation energy and pre-exponential terms for the JMA equation. While cooling back to room temperature, the partial transformation of austenite resulted in a substantial increase in the ferrite content, but sigma retained its high temperature value to room temperature.

Elmer, J W; Palmer, T A; Specht, E D



Direct Observations of Sigma Phase Formation in Duplex Stainless Steels Using In Situ Synchrotron X-Ray Diffraction  

SciTech Connect (OSTI)

The formation and growth of sigma ( ) phase in 2205 duplex stainless steel (DSS) was observed and measured in real time using synchrotron radiation during 10 hour isothermal heat treatments at temperatures between 700 C and 850 C. Sigma formed in near-equilibrium quantities during the isothermal holds, starting from a microstructure which contained a balanced mixture of metastable ferrite and austenite. In-situ synchrotron diffraction continuously monitored the transformation, and these results were compared to those predicted by thermodynamic calculations. The data were further analyzed using a modified Johnson-Mehl-Avrami-Kolmogrov (JMAK) approach to determine kinetic parameters for sigma formation over this temperature range. The initial JMAK exponent, n, at low fractions of sigma was found to be approximately 7.0; however, toward the end of the transformation, n decreased to values of approximately 0.75. The change in the JMAK exponent was attributed to a change in the transformation mechanism from discontinuous precipitation with increasing nucleation rate, to growth of the existing sigma phase after nucleation site saturation occurred. Because of this change in mechanism, it was not possible to determine reliable values for the activation energy and pre-exponential terms for the JMAK equation. While cooling back to room temperature, the partial transformation of austenite resulted in a substantial increase in the ferrite content, but sigma retained its high-temperature value to room temperature.

Elmer, J. W. [Lawrence Livermore National Laboratory (LLNL); Palmer, T. A. [Lawrence Livermore National Laboratory (LLNL); Specht, Eliot D [ORNL



Evaluation of X-ray Diffraction of Bit Cuttings as a Proxy for Core Data in Determining Bulk Mineralogy and Clay Species, Bakken Formation, Williston Basin.  

E-Print Network [OSTI]

??The principal question addressed in this study concerns the applicability of x-ray diffractometry to determine bulk rock mineralogy and clay species in the absence of (more)

Barnes, Stuart Lee



High energy X-ray diffraction measurement of residual stresses in a monolithic aluminum clad uranium10 wt% molybdenum fuel plate assembly  

SciTech Connect (OSTI)

Residual stresses are expected in monolithic, aluminum clad uranium 10 wt% molybdenum (U10Mo) nuclear fuel plates because of the large mismatch in thermal expansion between the two bonded materials. The full residual stress tensor of the U10Mo foil in a fuel plate assembly was mapped with 0.1 mm resolution using high-energy (86 keV) X-ray diffraction. The in-plane stresses in the U10Mo foil are strongly compressive, roughly -250 MPa in the longitudinal direction and -140 MPa in the transverse direction near the center of the fuel foil. The normal component of the stress is weakly compressive near the center of the foil and tensile near the corner. The disparity in the residual stress between the two in-plane directions far from the edges and the tensile normal stress suggest that plastic deformation in the aluminum cladding during fabrication by hot isostatic pressing also contributes to the residual stress field. A tensile in-plane residual stress is presumed to be present in the aluminum cladding to balance the large in-plane compressive stresses in the U10Mo fuel foil, but cannot be directly measured with the current technique due to large grain size.

D. W. Brown; M. A. Okuniewski; J. D. Almer; L. Balogh; B. Clausen; J. S. Okasinski; B. H. Rabin



Thermal equation of state of solid naphthalene to 13 GPa and 773 K: In situ X-ray diffraction study and first principles calculations  

SciTech Connect (OSTI)

In a wide range of P-T conditions, such fundamental characteristics as compressibility and thermoelastic properties remain unknown for most classes of organic compounds. Here we attempt to clarify this issue by the example of naphthalene as a model representative of polycyclic aromatic hydrocarbons (PAHs). The elastic behavior of solid naphthalene was studied by in situ synchrotron powder X-ray diffraction up to 13 GPa and 773 K and first principles computations to 20 GPa and 773 K. Fitting of the P-V experimental data to Vinet equation of state yielded T 0 = 8.4(3) GPa and T' = 7.2 (3) at V0 = 361 (3), whereas the thermal expansion coefficient was found to be extremely low at P > 3 GPa (about 10(-5) K(-1)), in agreement with theoretical estimation. Such a diminishing of thermal effects with the pressure increase clearly demonstrates a specific feature of the high-pressure behavior of molecular crystals like PAHs, associated with a low energy of intermolecular interactions.

Likhacheva, Anna Y., E-mail: alih@igm.nsc.ru [Sobolev Institute of Geology and Mineralogy, SB RAS, Novosibirsk 630090 (Russian Federation); Rashchenko, Sergey V.; Chanyshev, Artem D.; Litasov, Konstantin D. [Sobolev Institute of Geology and Mineralogy, SB RAS, Novosibirsk 630090 (Russian Federation) [Sobolev Institute of Geology and Mineralogy, SB RAS, Novosibirsk 630090 (Russian Federation); Department of Geology and Geophysics, Novosibirsk State University, Novosibirsk 630090 (Russian Federation); Inerbaev, Talgat M. [Department of Physics and Technical Science, Gumilyov Eurasian National University, Astana (Kazakhstan)] [Department of Physics and Technical Science, Gumilyov Eurasian National University, Astana (Kazakhstan); Kilin, Dmitry S. [Department of Chemistry, University of South Dakota, Vermillion, South Dakota 57069 (United States)] [Department of Chemistry, University of South Dakota, Vermillion, South Dakota 57069 (United States)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray and neutron powder diffraction studies of Ba(Nd{sub x}Y{sub 2-x})CuO{sub 5}  

SciTech Connect (OSTI)

Ba(R,R'){sub 2}CuO{sub 5} (R,R'=lanthanides and Y) plays an important role as a flux-pinning agent in enhancing the superconducting properties of the Ba{sub 2}(R,R')Cu{sub 3}O{sub 6+x} (R,R'=lanthanides and Y) coated conductors. Using X-ray diffraction and neutron diffraction, we found that the Ba(Nd{sub x}Y{sub 2-x})CuO{sub 5} solid solution adopts two structure types. In the Nd-rich region (1.8{<=}x{<=}2.0), the materials are of brown color (commonly referred to as the 'brown phase'), and the structure is tetragonal with space group I4/mbm (no. 127). In the Y-rich region (0.0{<=}x{<=}1.4), the materials are green (commonly referred to as the 'green phase') and the structure is orthorhombic with space group Pnma (no. 62). A two-phase region (1.4

Liu, G. [Ceramics Division, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899 (United States); Huang, Q. [NIST Center for Neutron Research, Naperville, IL 60563 (United States); Kaduk, J.A. [INEOS Technologies, Naperville, IL 60563 (United States); Yang, Z. [Yunnan Normal University, Kunming 650092 (China); Lucas, C. [Chemistry and Biochemistry Department, University of Maryland, College Park, MD 20742 (United States); Wong-Ng, W. [Ceramics Division, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899 (United States)], E-mail: Winnie.wong-ng@nist.gov



Maximum Entropy Method and Charge Flipping, a Powerful Combination to Visualize the True Nature of Structural Disorder from in situ X-ray Powder Diffraction Data  

SciTech Connect (OSTI)

In a systematic approach, the ability of the Maximum Entropy Method (MEM) to reconstruct the most probable electron density of highly disordered crystal structures from X-ray powder diffraction data was evaluated. As a case study, the ambient temperature crystal structures of disordered {alpha}-Rb{sub 2}[C{sub 2}O{sub 4}] and {alpha}-Rb{sub 2}[CO{sub 3}] and ordered {delta}-K{sub 2}[C{sub 2}O{sub 4}] were investigated in detail with the aim of revealing the 'true' nature of the apparent disorder. Different combinations of F (based on phased structure factors) and G constraints (based on structure-factor amplitudes) from different sources were applied in MEM calculations. In particular, a new combination of the MEM with the recently developed charge-flipping algorithm with histogram matching for powder diffraction data (pCF) was successfully introduced to avoid the inevitable bias of the phases of the structure-factor amplitudes by the Rietveld model. Completely ab initio electron-density distributions have been obtained with the MEM applied to a combination of structure-factor amplitudes from Le Bail fits with phases derived from pCF. All features of the crystal structures, in particular the disorder of the oxalate and carbonate anions, and the displacements of the cations, are clearly obtained. This approach bears the potential of a fast method of electron-density determination, even for highly disordered materials. All the MEM maps obtained in this work were compared with the MEM map derived from the best Rietveld refined model. In general, the phased observed structure factors obtained from Rietveld refinement (applying F and G constraints) were found to give the closest description of the experimental data and thus lead to the most accurate image of the actual disorder.

Samy, A.; Dinnebier, R; van Smaalen, S; Jansen, M



Reduction of a grid moire pattern by integrating a carbon-interspaced high precision x-ray grid with a digital radiographic detector  

SciTech Connect (OSTI)

The stationary grid commonly used with a digital x-ray detector causes a moire interference pattern due to the inadequate sampling of the grid shadows by the detector pixels. There are limitations with the previous methods used to remove the moire such as imperfect electromagnetic interference shielding and the loss of image information. A new method is proposed for removing the moire pattern by integrating a carbon-interspaced high precision x-ray grid with high grid line uniformity with the detector for frequency matching. The grid was aligned to the detector by translating and rotating the x-ray grid with respect to the detector using microcontrolled alignment mechanism. The gap between the grid and the detector surface was adjusted with micrometer precision to precisely match the projected grid line pitch to the detector pixel pitch. Considering the magnification of the grid shadows on the detector plane, the grids were manufactured such that the grid line frequency was slightly higher than the detector sampling frequency. This study examined the factors that affect the moire pattern, particularly the line frequency and displacement. The frequency of the moire pattern was found to be sensitive to the angular displacement of the grid with respect to the detector while the horizontal translation alters the phase but not the moire frequency. The frequency of the moire pattern also decreased with decreasing difference in frequency between the grid and the detector, and a moire-free image was produced after complete matching for a given source to detector distance. The image quality factors including the contrast, signal-to-noise ratio and uniformity in the images with and without the moire pattern were investigated.

Yoon, Jai-Woong; Park, Young-Guk; Park, Chun-Joo; Kim, Do-Il; Lee, Jin-Ho; Chung, Nag-Kun; Choe, Bo-Young; Suh, Tae-Suk; Lee, Hyoung-Koo [Department of Biomedical Engineering, College of Medicine, The Catholic University of Korea, Seoul 137-701 (Korea, Republic of); Jungwon Precision Ind. Co., Ltd, 425-833, Ansan (Korea, Republic of); Department of Biomedical Engineering, College of Medicine, The Catholic University of Korea, Seoul 137-701 (Korea, Republic of); Jungwon Precision Ind. Co., Ltd, 425-833, Ansan (Korea, Republic of); Department of Biomedical Engineering, College of Medicine, The Catholic University of Korea, Seoul 137-701 (Korea, Republic of)



Single mimivirus particles intercepted and imaged with an X-ray laser (CXIDB ID 1)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

These are the files used to reconstruct the images in the paper "Single Mimivirus particles intercepted and imaged with an X-ray laser". Besides the diffracted intensities, the Hawk configuration files used for the reconstructions are also provided. The files from CXIDB ID 1 are the pattern and configuration files for the pattern showed in Figure 2a in the paper.

Seibert, M. Marvin; Ekeberg, Tomas; Maia, Filipe R.N.C.


Single mimivirus particles intercepted and imaged with an X-ray laser (CXIDB ID 2)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

These are the files used to reconstruct the images in the paper "Single Mimivirus particles intercepted and imaged with an X-ray laser". Besides the diffracted intensities, the Hawk configuration files used for the reconstructions are also provided. The files from CXIDB ID 2 are the pattern and configuration files for the pattern showed in Figure 2b in the paper.

Seibert, M. Marvin; Ekeberg, Tomas



SciTech Connect (OSTI)

X-ray crystallography is currently the primary methodology used to determine the 3D structure of materials and macromolecules. However, many nanostructures, disordered materials, biomaterials, hybrid materials and biological specimens are noncrystalline and, hence, their structures are not accessible by X-ray crystallography. Probing these structures therefore requires the employment of different approaches. A very promising technique currently under rapid development is X-ray diffraction microscopy (or lensless imaging), in which the coherent X-ray diffraction pattern of a noncrystalline specimen is measured and then directly phased to obtain a high-resolution image. Through the DOE support over the past three years, we have applied X-ray diffraction microscopy to quantitative imaging of GaN quantum dot particles, and revealed the internal GaN-Ga2O3 core shell structure in three dimensions. By exploiting the abrupt change in the scattering cross-section near electronic resonances, we carried out the first experimental demonstration of resonant X-ray diffraction microscopy for element specific imaging. We performed nondestructive and quantitative imaging of buried Bi structures inside a Si crystal by directly phasing coherent X-ray diffraction patterns acquired below and above the Bi M5 edge. We have also applied X-ray diffraction microscopy to nondestructive imaging of mineral crystals inside biological composite materials - intramuscular fish bone - at the nanometer scale resolution. We identified mineral crystals in collagen fibrils at different stages of mineralization and proposed a dynamic mechanism to account for the nucleation and growth of mineral crystals in the collagen matrix. In addition, we have also discovered a novel 3D imaging modality, denoted ankylography, which allows for complete 3D structure determination without the necessity of sample titling or scanning. We showed that when the diffraction pattern of a finite object is sampled at a sufficiently fine scale on the Ewald sphere, the 3D structure of the object is determined by the 2D spherical pattern. We confirmed the theoretical analysis by performing 3D numerical reconstructions of a sodium silicate glass structure at 2 ? resolution from a 2D spherical diffraction pattern alone. As X-ray free electron lasers are under rapid development worldwide, ankylography may open up a new horizon to obtain the 3D structure of a non-crystalline specimen from a single pulse and allow time-resolved 3D structure determination of disordered materials.

Jianwei Miao



X-ray diffraction analysis and scanning micro-Raman spectroscopy of structural irregularities and strains deep inside the multilayered InGaN/GaN heterostructure  

SciTech Connect (OSTI)

High-resolution X-ray diffraction analysis and scanning confocal Raman spectroscopy are used to study the spatial distribution of strains in the In{sub x}Ga{sub 1-x}N/GaN layers and structural quality of these layers in a multilayered light-emitting diode structure produced by metal-organic chemical vapor deposition onto (0001)-oriented sapphire substrates. It is shown that elastic strains almost completely relax at the heterointerface between the thick GaN buffer layer and In{sub x}Ga{sub 1-x}N/GaN buffer superlattice. It is established that the GaN layers in the superlattice are in a stretched state, whereas the alloy layers are in a compressed state. In magnitude, the stretching strains in the GaN layers are lower than the compressive strains in the InGaN layers. It is shown that, as compared to the buffer layers, the layers of the superlattice contain a smaller number of dislocations and the distribution of dislocations is more randomly disordered. In micro-Raman studies on scanning through the thickness of the multilayered structure, direct evidence is obtained for the asymmetric gradient distributions of strains and crystal imperfections of the epitaxial nitride layers along the direction of growth. It is shown that the emission intensity of the In{sub x}Ga{sub 1-x}N quantum well is considerably (more than 30 times) higher than the emission intensity of the GaN barrier layers, suggesting the high efficiency of trapping of charge carriers by the quantum well.

Strelchuk, V. V., E-mail: Strelch@isp.kiev.ua; Kladko, V. P.; Avramenko, E. A.; Kolomys, O. F.; Safryuk, N. V.; Konakova, R. V. [National Academy of Sciences of Ukraine, Lashkaryov Institute of Semiconductor Physics (Ukraine); Yavich, B. S., E-mail: byavich@soptel.ru [ZAO Svetlana-Optoelectronics (Russian Federation); Valakh, M. Ya.; Machulin, V. F.; Belyaev, A. E. [National Academy of Sciences of Ukraine, Lashkaryov Institute of Semiconductor Physics (Ukraine)



Structural characterization of the CeO{sub 2}/Gd{sub 2}O{sub 3} mixed system by synchrotron X-ray diffraction  

SciTech Connect (OSTI)

The structural determination of the CeO{sub 2}/Gd{sub 2}O{sub 3} mixed system is a non-trivial problem because of the close resemblance between the ionic sizes of Ce{sup 4+} and Gd{sup 3+} and between the crystal structures of CeO{sub 2} and Gd{sub 2}O{sub 3}. (Ce{sub 1-x}Gd{sub x})O{sub 2-x/2} powder samples with x ranging between 0 and 1 have been synthesized by coprecipitation of mixed oxalates and subsequent thermal decomposition in air at 1200 Degree-Sign C followed by slow cooling. Synchrotron powder X-ray diffraction data were collected and refined by the Rietveld method. Lattice parameters do not follow Vegard's law and no peak splitting has been observed for any composition, meaning that no biphasic regions exist over the whole compositional range. The same hybrid structural model - a proper mixture of the structures of the two pure oxides - was used for the refinements, allowing to account for the data observed. - graphical abstract: Substituting Ce{sup 4+} by Gd{sup 3+}, a gradual transition from the F structure (typical of CeO{sub 2}) to the C structure (typical of Gd{sub 2}O{sub 3}) takes place. The lattice parameters do not follow Vegard's law. Highlights: Black-Right-Pointing-Pointer A structural study of Ce-Gd mixed oxides has been performed. Black-Right-Pointing-Pointer In (Ce{sub 1-x}Gd{sub x})O{sub 2-x/2} a solid solution forms for 0{<=}x{<=}0.3. Black-Right-Pointing-Pointer For x>0.3 a gradual transition from the C to the F structure is observed. Black-Right-Pointing-Pointer Lattice parameters do not follow Vegard's law.

Artini, Cristina, E-mail: c.artini@ge.ieni.cnr.it [Dipartimento di Chimica e Chimica Industriale, Universita degli Studi di Genova, Via Dodecaneso 31, 16146 Genova (Italy); Costa, Giorgio A., E-mail: costa@chimica.unige.it [Dipartimento di Chimica e Chimica Industriale, Universita degli Studi di Genova, Via Dodecaneso 31, 16146 Genova (Italy); CNR-SPIN Genova, Corso Perrone 24, 16152 Genova (Italy); Pani, Marcella, E-mail: marcella@chimica.unige.it [Dipartimento di Chimica e Chimica Industriale, Universita degli Studi di Genova, Via Dodecaneso 31, 16146 Genova (Italy); Lausi, Andrea, E-mail: andrea.lausi@elettra.trieste.it [Sincrotrone Trieste S.C.p.A., ss 14, km 163, 5, 34149 Basovizza, Trieste (Italy); Plaisier, Jasper, E-mail: jasper.plaisier@elettra.trieste.it [Sincrotrone Trieste S.C.p.A., ss 14, km 163, 5, 34149 Basovizza, Trieste (Italy)



Hidden Superlattice in Tl2(SC6H4S) and Tl2(SeC6H4Se) Solved from Powder X-ray Diffraction  

SciTech Connect (OSTI)

The crystal structures of the isostructural title compounds poly[({mu}-benzene-1,4-dithiolato)dithallium], Tl{sub 2}(SC{sub 6}H{sub 4}S), and poly[({mu}-benzene-1,4-diselenolato)dithallium], Tl{sub 2}(SeC{sub 6}H{sub 4}Se), were solved by simulated annealing from high-resolution synchrotron X-ray powder diffraction. Rietveld refinements of an initial structure with one formula unit per triclinic cell gave satisfactory agreement with the data, but led to a structure with impossibly close non-bonded contacts. A disordered model was proposed to alleviate this problem, but an alternative supercell structure leads to slightly improved agreement with the data. The isostructural superlattice structures were confirmed for both compounds through additional data collection, with substantially better counting statistics, which revealed the presence of very weak superlattice peaks not previously seen. Overall, each structure contains Tl-S or Tl-Se two-dimensional networks, connected by phenylene bridges. The sulfur (or selenium) coordination sphere around each thallium is a highly distorted square pyramid or a 'see-saw' shape, depending upon how many Tl-S or Tl-Se interactions are considered to be bonds. In addition, the two compounds contain pairs of Tl{sup I} ions that interact through a closed-shell 'thallophilic' interaction: in the sulfur compound there are two inequivalent pairs of Tl atoms with Tl-Tl distances of 3.49 and 3.58 {angstrom}, while in the selenium compound those Tl-Tl interactions are at 3.54 and 3.63 {angstrom}.

K Stone; D Turner; M Singh; T Vaid; P Stephens



Focused X-ray source  

DOE Patents [OSTI]

Disclosed is an intense, relatively inexpensive X-ray source (as compared to a synchrotron emitter) for technological, scientific, and spectroscopic purposes. A conical radiation pattern produced by a single foil or stack of foils is focused by optics to increase the intensity of the radiation at a distance from the conical radiator. 8 figs.

Piestrup, M.A.; Boyers, D.G.; Pincus, C.I.; Maccagno, P.



X-Ray Data Booklet X-RAY DATA BOOKLET  

E-Print Network [OSTI]

X-Ray Data Booklet X-RAY DATA BOOKLET Center for X-ray Optics and Advanced Light Source Lawrence Berkeley National Laboratory Introduction X-Ray Properties of Elements Electron Binding Energies X-Ray Levels of Few Electron Ions Now Available Order X-Ray Data Booklet http://xdb.lbl.gov/ (1 of 3) [2

Meagher, Mary


E-Print Network 3.0 - alxga1-xas high-energy x-ray Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

All rights reserved. X-ray Diffraction Activity... Background Information The X-ray powder Diffractometer uses different ... Source: Cohen, Itai - Department of Physics, Cornell...


X-ray diffraction on the X-cut of a Ca{sub 3}TaGa{sub 3}Si{sub 2}O{sub 14} single crystal modulated by a surface acoustic wave  

SciTech Connect (OSTI)

The result of X-ray diffraction study on a single crystal of the calcium-gallogermanate family Ca{sub 3}TaGa{sub 3}Si{sub 2}O{sub 14} (CTGS) modulated by a surface acoustic wave (SAW) is presented. The power flow angle for SAW propagating along the X{sub 2} axis of the X-cut in CTGS was measured. The rocking curves for the CTGS crystal were recorded at different amplitudes of an input high frequency electric signal on interdigital transducer used to excite a SAW. Based on the data obtained, intensity dependence of diffraction satellites on the amplitude of electric signal exciting a SAW was built. Numerical simulation of the crystal rocking curves and dependence of diffraction satellite intensities on the SAW amplitude enabled the selection of a set of material constants at which the most complete coincidence of experimental and calculated results is observed.

Irzhak, D., E-mail: irzhak@iptm.ru; Roshchupkin, D., E-mail: rochtch@iptm.ru [Institute of Microelectronics Technology and High-Purity Materials Russian Academy of Sciences, Chernogolovka 142432 (Russian Federation)



E-Print Network 3.0 - aspect ratio x-ray Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0953-89841825S17 Summary: the power ratio of beam splitting. With centralized remote control, heating and x-ray diffraction... for in situ x-ray diffraction at high...


Present Situation of Diffracted X-ray Radiation and Resonance (Coherent) Transition Radiation Induced by High Energy Charged Particles in Frequencies Region Exiding Atomic one  

E-Print Network [OSTI]

The review is devoted to the modern investigations of electromagnetic radiation by relativistic charged particles propagating with constant velocity through the periodic media. Two examples of radiation are considered in this review, the first corresponds to the Bragg scattering of charged particles pseudophotons in crystals, the second one to the Fresnel scattering of pseudophotons in periodic medium. Both examples play essential role in construction new compact tunable sources in X-ray region.

Ter-Mikaelian, M L



Present Situation of Diffracted X-ray Radiation and Resonance (Coherent) Transition Radiation Induced by High Energy Charged Particles in Frequencies Region Exiding Atomic one  

E-Print Network [OSTI]

The review is devoted to the modern investigations of electromagnetic radiation by relativistic charged particles propagating with constant velocity through the periodic media. Two examples of radiation are considered in this review, the first corresponds to the Bragg scattering of charged particles pseudophotons in crystals, the second one to the Fresnel scattering of pseudophotons in periodic medium. Both examples play essential role in construction new compact tunable sources in X-ray region.

M. L. Ter-Mikayelyan



X-ray beamsplitter  

DOE Patents [OSTI]

An x-ray beamsplitter which splits an x-ray beam into two coherent parts by reflecting and transmitting some fraction of an incident beam has applications for x-ray interferometry, x-ray holography, x-ray beam manipulation, and x-ray laser cavity output couplers. The beamsplitter is formed of a wavelength selective multilayer thin film supported by a very thin x-ray transparent membrane. The beamsplitter resonantly transmits and reflects x-rays through thin film interference effects. A thin film is formed of 5--50 pairs of alternate Mo/Si layers with a period of 20--250 A. The support membrane is 10--200 nm of silicon nitride or boron nitride. The multilayer/support membrane structure is formed across a window in a substrate by first forming the structure on a solid substrate and then forming a window in the substrate to leave a free-standing structure over the window. 6 figs.

Ceglio, N.M.; Stearns, D.G.; Hawryluk, A.M.; Barbee, T.W. Jr.



X-ray beamsplitter  

DOE Patents [OSTI]

An x-ray beamsplitter which splits an x-ray beam into two coherent parts by reflecting and transmitting some fraction of an incident beam has applications for x-ray interferometry, x-ray holography, x-ray beam manipulation, and x-ray laser cavity output couplers. The beamsplitter is formed of a wavelength selective multilayer thin film supported by a very thin x-ray transparent membrane. The beamsplitter resonantly transmits and reflects x-rays through thin film interference effects. A thin film is formed of 5-50 pairs of alternate Mo/Si layers with a period of 20-250 A. The support membrane is 10-200 nm of silicon nitride or boron nitride. The multilayer/support membrane structure is formed across a window in a substrate by first forming the structure on a solid substrate and then forming a window in the substrate to leave a free-standing structure over the window.

Ceglio, Natale M. (Livermore, CA); Stearns, Daniel S. (Mountain View, CA); Hawryluk, Andrew M. (Modesto, CA); Barbee, Jr., Troy W. (Palo Alto, CA)



Chest x-Rays  

Broader source: Energy.gov [DOE]

The B-reading is a special reading of a standard chest x-ray film performed by a physician certified by the National Institute for Occupational Safety and Health (NIOSH). The reading looks for changes on the chest x-ray that may indicate exposure and disease caused by agents such as asbestos or silica.


X-ray binaries  

E-Print Network [OSTI]

We review the nuclear astrophysics aspects of accreting neutron stars in X-ray binaries. We summarize open astrophysical questions in light of recent observations and their relation to the underlying nuclear physics. Recent progress in the understanding of the nuclear physics, especially of X-ray bursts, is also discussed.

H. Schatz; K. E. Rehm


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Proceedings of the workshop on X-ray computed microtomography  

SciTech Connect (OSTI)

This report consists of vugraphs from the nine presentations at the conference. Titles of the presentations are: CMT: Applications and Techniques; Computer Microtomography Using X-rays from Third Generation Synchrotron X-ray; Approaches to Soft-X-ray Nanotomography; Diffraction Enhanced Tomography; X-ray Computed Microtomography Applications at the NSLS; XCMT Applications in Forestry and Forest Products; 3DMA: Investigating Three Dimensional Pore Geometry from High Resolution Images; X-ray Computed Microtomography Studies of Volcanic Rock; and 3-D Visualization of Tomographic Volumes.




X-ray absorption anisotropy for polychromatic illumination--Crystal views from inside  

E-Print Network [OSTI]

X-ray absorption anisotropy for polychromatic illumination--Crystal views from inside P. Korecki a Keywords: X-ray absorption Real-space imaging X-ray holography Electron channeling Electron backscatter of the fine structure in X-ray absorption anisotropy, which results from incident beam diffraction

Korecki, Pawe³


X-ray laser  

DOE Patents [OSTI]

An X-ray laser (10) that lases between the K edges of carbon and oxygen, i.e. between 44 and 23 Angstroms, is provided. The laser comprises a silicon (12) and dysprosium (14) foil combination (16) that is driven by two beams (18, 20) of intense line focused (22, 24) optical laser radiation. Ground state nickel-like dysprosium ions (34) are resonantly photo-pumped to their upper X-ray laser state by line emission from hydrogen-like silicon ions (32). The novel X-ray laser should prove especially useful for the microscopy of biological specimens.

Nilsen, Joseph (Livermore, CA)



X-ray absorption spectroscopy  

E-Print Network [OSTI]

009-9473-8 REVIEW X-ray absorption spectroscopy Junko Yano and application of X-ray absorption spectroscopy, bothX-ray absorption near-edge structure (XANES) and extended X-

Yano, Junko; Yachandra, Vittal K.



X-ray Absorption Spectroscopy  

E-Print Network [OSTI]

type: Review X-ray Absorption Spectroscopy Junko Yano andPhotosystem II; XAS, X-ray absorption spectroscopy; EXAFS,X-ray absorption fine structure; EPR, electron paramagnetic

Yano, Junko



Theoretical standards in x-ray spectroscopies  

SciTech Connect (OSTI)

We propose to extend our state-of-the-art, ab initio XAFS (X-ray absorption fine structure) codes, FEFF. Our current work has been highly successful in achieving accurate, user-friendly XAFS standards, exceeding the performance of both tabulated standards and other codes by a considerable margin. We now propose to add the capability to treat more complex materials. This includes multiple-scattering, polarization dependence, an approximate treatment of XANES (x-ray absorption near edge structure), and other improvements. We also plan to adapt FEFF to other spectroscopies, e.g. photoelectron diffraction (PD) and diffraction anomalous fine structure (DAFS).

Not Available



Ray tracing flux calculation for the small and wide angle x-ray scattering diffraction station at the SESAME synchrotron radiation facility  

SciTech Connect (OSTI)

The calculation for the optics of the synchrotron radiation small and wide angle x-ray scattering beamline, currently under construction at SESAME is described. This beamline is based on a cylindrically bent germanium (111) single crystal with an asymmetric cut of 10.5 deg., followed by a 1.2 m long rhodium coated plane mirror bent into a cylindrical form. The focusing properties of bent asymmetrically cut crystals have not yet been studied in depth. The present paper is devoted to study of a particular application of a bent asymmetrically cut crystal using ray tracing simulations with the SHADOW code. These simulations show that photon fluxes of order of 1.09x10{sup 11} photons/s will be available at the experimental focus at 8.79 keV. The focused beam dimensions will be 2.2 mm horizontal full width at half maximum (FWHM) by 0.12 mm vertical (FWHM).

Salah, Wa'el [Synchrotron-light for Experimental Science and Application in the Middle East (SESAME), P.O. Box 7, Allan 19252 (Jordan); Department of Physics, The Hashemite University, Zarqa 13115 (Jordan); Sanchez del Rio, M. [European Synchrotron Radiation Facility, Bp 220, 38043 Grenoble Cedex (France); Hoorani, H. [Synchrotron-light for Experimental Science and Application in the Middle East (SESAME), P.O. Box 7, Allan 19252 (Jordan)



X-Ray diffraction and vibrational spectroscopic study of 2-chloro-N-{l_brace}4-[3-(2,5-dimethylphenyl)-3-methylcyclobutyl] -thiazol-2-yl{r_brace}-acetamide  

SciTech Connect (OSTI)

The title compound C{sub 18}H{sub 21}ClN{sub 2}SO crystallizes with Z = 4 in space group P2{sub 1}/c. The structure of the title compound was characterized by {sup 1}H-NMR, {sup 13}C-NMR, IR and single crystal diffraction. There are an intermolecular N-H-O hydrogen bond and a C-H-{pi} interactions in crystal packing. In addition to the molecular geometry and packing obtained from X-ray experiment, the molecular geometry and vibrational frequencies of the title compound in ground state have been calculated using density functional theory method DFT (B3LYP) with 6-31G (d, p) basis set. Calculated frequencies, bond lengths, angles and dihedral angles are in good agreement with the corresponding experimental data.

Caliskan, Nezihe, E-mail: nezihec@omu.edu.tr; Guentepe, Feyizan [Ondokuz Mayis University, Department of Physics, Faculty of Arts and Sciences (Turkey); Yueksektepe, Cigdem [Cankiri Karatekin University, Department of Physics, Faculty of Science (Turkey); Cukurovali, Alaaddin [Firat University, Department of Chemistry, Faculty of Science (Turkey); Bueyuekguengoer, Orhan [Ondokuz Mayis University, Department of Physics, Faculty of Arts and Sciences (Turkey)



Absence of Structural Impact of Noble Nanoparticles on P3HT: PCBM Blends for Plasmon Enhanced Bulk-Heterojunction Organic Solar Cells Probed by Synchrotron Grazing Incidence X-Ray Diffraction  

E-Print Network [OSTI]

The incorporation of noble metal nanoparticles, displaying localized surface plasmon resonance, in the active area of donor-acceptor bulk-heterojunction organic photovoltaic devices is an industrially compatible light trapping strategy, able to guarantee better absorption of the incident photons and give an efficiency improvement between 12% and 38%. In the present work, we investigate the effect of Au and Ag nanoparticles blended with P3HT: PCBM on the P3HT crystallization dynamics by synchrotron grazing incidence X-ray diffraction. We conclude that the presence of (1) 80nm Au, (2) mix of 5nm, 50nm, 80nm Au, (3) 40nm Ag, and (4) 10nm, 40nm, 60nm Ag colloidal nanoparticles, at different concentrations below 0.3 wt% in P3HT: PCBM blends, does not affect the behaviour of the blends themselves.

Samuele Lilliu; Mejd Alsari; Oier Bikondoa; J. Emyr Macdonald; Marcus S. Dahlem



Direct evidence of a zigzag spin-chain structure in the honeycomb lattice: A neutron and x-ray diffraction investigation of single-crystal Na2IrO3  

SciTech Connect (OSTI)

We have combined single crystal neutron and x-ray diffractions to investigate the magnetic and crystal structures of the honeycomb lattice $\\rm Na_2IrO_3$. The system orders magnetically below $18.1(2)$~K with Ir$^{4+}$ ions forming zigzag spin chains within the layered honeycomb network with ordered moment of $\\rm 0.22(1)~\\mu_B$/Ir site. Such a configuration sharply contrasts the N{\\'{e}}el or stripe states proposed in the Kitaev-Heisenberg model. The structure refinement reveals that the Ir atoms form nearly ideal 2D honeycomb lattice while the $\\rm IrO_6$ octahedra experience a trigonal distortion that is critical to the ground state. The results of this study provide much-needed experimental insights into the magnetic and crystal structure crucial to the understanding of the exotic magnetic order and possible topological characteristics in the 5$d$-electron based honeycomb lattice.

Ye, Feng [ORNL; Chi, Songxue [ORNL; Cao, Huibo [ORNL; Chakoumakos, Bryan C [ORNL; Fernandez-Baca, Jaime A [ORNL; Custelcean, Radu [ORNL; Qi, Tongfei [University of Kentucky; Korneta, O. B. [University of Kentucky, Lexington; Cao, Gang [University of Kentucky



In situ X-ray diffraction strain-controlled study of TiNbZr and TiNbTa shape memory alloys: crystal lattice and transformation features  

SciTech Connect (OSTI)

Phase and structure transformations in biomedical Ti21.8Nb6.0Zr (TNZ) and Ti19.7Nb5.8Ta (TNT) shape memory alloys (at.%) under and without load in the ? 150 to 100 S temperature range are studied in situ using an original tensile module for a low-temperature chamber of an X-ray diffractometer. Alpha?- and beta-phase lattice parameters, the crystallographic resource of recovery strain, phase and structure transformation sequences, and microstress appearance and disappearance are examined, compared and discussed. For both alloys, the crystallographic resource of recovery strain decreases with temperature increase to become 4.5% for TNZ and 2.5% for TNT alloy (at RT). Loading at low temperatures leads to additional ??-phase formation and reorientation. Heating under load, as compared to strain-free heating, affects the reverse transformation sequence of both alloys in different ways. For TNZ alloy, strain-free heating results in simultaneous ??? and ???? transformations, whereas during heating under stress, they are sequential: ? + ???? precedes ????. For TNT alloy, strain-free heating results in reverse ???? transformation, whereas during heating under stress, ???? transformation is preceded by ??-phase reorientation. - Highlights: Comparative in situ XRD analysis of TiNbZr(Ta) shape memory alloys is realized. Lattice parameters of ?- and ??-phases are calculated in the ? 150 to + 100 C range. The higher the temperature, the lower the ???? transformation strain. Loading at low temperatures results in ??-phase formation and reorientation. Transformation sequences upon heating with and without loading are different.

Dubinskiy, S. [cole de technologie suprieure, 1100, Notre-Dame Street West, Montreal, Quebec H3C 1K3 (Canada); National University of Science and Technology MISIS, 4, Leninskiy prosp., Moscow 119049 (Russian Federation); Prokoshkin, S. [National University of Science and Technology MISIS, 4, Leninskiy prosp., Moscow 119049 (Russian Federation); Brailovski, V., E-mail: vladimir.brailovski@etsmtl.ca [cole de technologie suprieure, 1100, Notre-Dame Street West, Montreal, Quebec H3C 1K3 (Canada); Inaekyan, K. [cole de technologie suprieure, 1100, Notre-Dame Street West, Montreal, Quebec H3C 1K3 (Canada); Korotitskiy, A. [National University of Science and Technology MISIS, 4, Leninskiy prosp., Moscow 119049 (Russian Federation)



Development of at-wavelength metrology for x-ray optics at the ALS  

E-Print Network [OSTI]

alignment of bendable x-ray optics to realize diffraction-Bass (Ed. ), Handbook of Optics, third ed. , vol. V, ch. 46,wavelength metrology for x-ray optics at the ALS* Valeriy V.

Yashchuk, Valeriy V.



E-Print Network 3.0 - atomic multipole x-ray Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

radial functions, has been generated with single-crystal X-ray... of a limited data set, a relatively large set of single-crystal X-ray diffraction data was collected......


Development of procedures for refurbishing x-ray optics at the Advanced Light Source  

E-Print Network [OSTI]

and Setting of Bendable Optics for Diffraction- Limitedof Soft X-Rays, Abstract to SPIE Optics and Photonics 2012,Metrology for X-Ray and EUV Optics IV (San Diego, August 12-

Yashchuk, Valeriy V.



X-ray beam finder  

DOE Patents [OSTI]

An X-ray beam finder for locating a focal spot of an X-ray tube includes a mass of X-ray opaque material having first and second axially-aligned, parallel-opposed faces connected by a plurality of substantially identical parallel holes perpendicular to the faces and a film holder for holding X-ray sensitive film tightly against one face while the other face is placed in contact with the window of an X-ray head.

Gilbert, H.W.



X-ray imaging crystal spectrometer for extended X-ray sources  

DOE Patents [OSTI]

Spherically or toroidally curved, double focusing crystals are used in a spectrometer for X-ray diagnostics of an extended X-ray source such as a hot plasma produced in a tokomak fusion experiment to provide spatially and temporally resolved data on plasma parameters using the imaging properties for Bragg angles near 45. For a Bragg angle of 45.degree., the spherical crystal focuses a bundle of near parallel X-rays (the cross section of which is determined by the cross section of the crystal) from the plasma to a point on a detector, with parallel rays inclined to the main plain of diffraction focused to different points on the detector. Thus, it is possible to radially image the plasma X-ray emission in different wavelengths simultaneously with a single crystal.

Bitter, Manfred L. (Princeton, NJ); Fraenkel, Ben (Jerusalem, IL); Gorman, James L. (Bordentown, NJ); Hill, Kenneth W. (Lawrenceville, NJ); Roquemore, A. Lane (Cranbury, NJ); Stodiek, Wolfgang (Princeton, NJ); von Goeler, Schweickhard E. (Princeton, NJ)



Hydrogen in polar intermetallics: Syntheses and structures of the ternary Ca5Bi3D0.93, Yb5Bi3Hx, and Sm5Bi3H~1 by powder neutron or single crystal X-ray diffraction  

SciTech Connect (OSTI)

The syntheses of the title compounds are described in detail. Structural characterizations from refinements of single crystal X-ray diffraction data for Yb{sub 5}Bi{sub 3}H{sub x} and Sm{sub 5}Bi{sub 3}H{sub 1} and of powder neutron diffraction data for Ca{sub 5}Bi{sub 3}D{sub 0.93(3)} are reported. These confirm that all three crystallize with the heavy atom structure type of {beta}-Yb{sub 5}Sb{sub 3}, and the third gives the first proof that the deuterium lies in the center of nominal calcium tetrahedra, isostructural with the Ca{sub 5}Sb{sub 3}F-type structure. These Ca and Yb phases are particularly stable with respect to dissociation to Mn{sub 5}Si{sub 3}-type product plus H{sub 2}. Some contradictions in the literature regarding Yb{sub 5}Sb{sub 3} and Yb{sub 5}Sb{sub 3}H{sub x} phases are considered in terms of adventitious hydrogen impurities that are generated during reactions in fused silica containers at elevated temperatures.

Leon-Escamilla, E. Alejandro; Dervenagas, Panagiotis; Stasis, Constantine; Corbett, John D.



Imaging single cells in a beam of live cyanobacteria with an X-ray laser  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

This entry contains ten diffraction patterns, and reconstructions images, of individual living Cyanobium gracile cells, imaged using 517 eV X-rays from the LCLS XFEL. The Hawk software package was used for phasing. The Uppsala aerosol injector was used for sample injection, assuring very low noise levels. The cells come from various stages of the cell cycle, and were imaged in random orientations.

Schot, Gijs, vander


Principles of X-ray Navigation  

SciTech Connect (OSTI)

X-ray navigation is a new concept in satellite navigation in which orientation, position and time are measured by observing stellar emissions in x-ray wavelengths. X-ray navigation offers the opportunity for a single instrument to be used to measure these parameters autonomously. Furthermore, this concept is not limited to missions in close proximity to the earth. X-ray navigation can be used on a variety of missions from satellites in low earth orbit to spacecraft on interplanetary missions. In 1997 the Unconventional Stellar Aspect Experiment (USA) will be launched as part of the Advanced Research and Global Observation Satellite (ARGOS). USA will provide the first platform for real-time experimentation in the field of x-ray navigation and also serves as an excellent case study for the design and manufacturing of space qualified systems in small, autonomous groups. Current techniques for determining the orientation of a satellite rely on observations of the earth, sun and stars in infrared, visible or ultraviolet wavelengths. It is possible to use x-ray imaging devices to provide arcsecond level measurement of attitude based on star patterns in the x-ray sky. This technique is explored with a simple simulation. Collimated x-ray detectors can be used on spinning satellites to provide a cheap and reliable measure of orientation. This is demonstrated using observations of the Crab Pulsar taken by the high Energy Astronomy Observatory (HEAO-1) in 1977. A single instrument concept is shown to be effective, but dependent on an a priori estimate of the guide star intensity and thus susceptible to errors in that estimate. A star scanner based on a differential measurement from two x-ray detectors eliminates the need for an a priori estimate of the guide star intensity. A first order model and a second order model of the two star scanner concepts are considered. Many of the stars that emit in the x-ray regime are also x-ray pulsars with frequency stability approaching a part in 10{sup 9}. By observing these pulsations, a satellite can keep accurate time autonomously. They have demonstrated the acquisition and tracking of the Crab nebula pulsar by simulating the operation of a phase-locked loop.

Hanson, John Eric; /SLAC



Fluctuation X-Ray Scattering  

SciTech Connect (OSTI)

The work supported by the grant was aimed at developing novel methods of finding the structures of biomolecules using x-rays from novel sources such as the x-ray free electron laser and modern synchrotrons

Saldin, PI: D. K.; Co-I's: J. C. H. Spence and P. Fromme


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tunable X-ray source  

DOE Patents [OSTI]

A method for the production of X-ray bunches tunable in both time and energy level by generating multiple photon, X-ray, beams through the use of Thomson scattering. The method of the present invention simultaneously produces two X-ray pulses that are tunable in energy and/or time.

Boyce, James R. (Williamsburg, VA)



Phase transition upon K{sup +} ion exchange into Na-low silica X: Combined NMR and synchrotron X-ray powder diffraction study  

SciTech Connect (OSTI)

The mechanism by which K{sup +} ions exchange into zeolite Na-low silica X (LSX) (Na{sub 96}Al{sub 96}Si{sub 96}O{sub 384}{center_dot}nH{sub 2}O) has ben determined by studying structures of the Na-LSX and K-LSX end members in the Na-K LSX solid solution series as well as samples exchanged at the 20%, 42% and 80% K{sup +} levels. A preliminary investigation using {sup 29}Si MAS NMR spectroscopy revealed a two-phase region in the solid solution near 80% K{sup +} exchange. Rietveld analysis of the powder diffraction data collected from hydrated samples showed that, up to 42% of K{sup +} exchange, K{sup +} ions were located preferentially at site I{prime}, just outside the double 6-ring (D6R) in the sodalite age, and at site II, above the single 6-ring (S6R) in the supercage. Introduction of K{sup +} ions into site I{prime} repositioned Na{sup +} ions into site I, at the center of the D6R. An abrupt change in the cubic lattice parameter from 25.0389(5) to 25.2086(5) {angstrom} marked the formation of a second phase at the 80% K{sup +}-exchange level as K{sup +} ions began to occupy site I. No coexistence of phases was observed for the fully K{sup +}-exchanged sample (a = 25.2486(2) {angstrom}), where sites I and II were fully occupied by K{sup +} ions.

Lee, Y.; Parise, J.B. [State Univ. of New York, Stony Brook, NY (United States)] [State Univ. of New York, Stony Brook, NY (United States); Carr, S.W. [ANSTO, Menai (Australia)] [ANSTO, Menai (Australia)



X-Ray Conformational Study of the DNA Duplex in Solution  

E-Print Network [OSTI]

X-Ray Conformational Study of the DNA Duplex in Solution V. GRASSIAN* and G. W. BRADY,f Rensselaer Earlier x-ray studies on dissolved linear DNA molecules were interpreted on the assumption engaged in x-ray diffraction studies of circular su- perhelical DNA. Some of our preliminary results have

Benham, Craig J.


X-Ray Diamond Anvil Cell Facility at NSLS: 2010 Progress Report  

E-Print Network [OSTI]

X-Ray Diamond Anvil Cell Facility at NSLS: 2010 Progress Report Zhiqiang ChenZhiqiang Chen Stony) Powder X-ray Diffraction, Total Scattering Pair-Distributiony , g Function (PDF) under high P and high, yield strength, amorphization, texturing, compressibility Hydrothermal DAC (Bassett) Angle Dispersive X-ray

Duffy, Thomas S.


In situ examination of oxygen non-stoichiometry in La{sub 0.80}Sr{sub 0.20}CoO{sub 3??} thin films at intermediate and low temperatures by x-ray diffraction  

SciTech Connect (OSTI)

Structural evolution of epitaxial La{sub 0.80}Sr{sub 0.20}CoO{sub 3??} thin films under chemical and voltage stimuli was examined in situ using X-ray diffraction. The changes in lattice parameter (chemical expansivity) were used to quantify oxygen reduction reaction processes and vacancy concentration changes in lanthanum strontium cobaltite. At 550?C, the observed lattice parameter reduction at an applied bias of ?0.6?V was equivalent to that from the reducing condition of a 2% carbon monoxide atmosphere with an oxygen non-stoichiometry ? of 0.24. At lower temperatures (200?C), the application of bias reduced the sample much more effectively than a carbon monoxide atmosphere and induced an oxygen non-stoichiometry ? of 0.47. Despite these large changes in oxygen concentration, the epitaxial thin film was completely re-oxidized and no signs of crystallinity loss or film amorphization were observed. This work demonstrates that the effects of oxygen evolution and reduction can be examined with applied bias at low temperatures, extending the ability to probe these processes with in-situ analytical techniques.

Biegalski, M. D.; Belianinov, A.; Kalinin, S. V. [Oak Ridge National Laboratory, Center for Nanophase Materials Science, Oak Ridge, Tennessee 37831 (United States); Crumlin, E.; Mutoro, E.; Shao-Horn, Y. [Electrochemical Energy Laboratory, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)



Synthesis and characterization of alkali-metal titanium alkoxide compounds MTi(O-i-Pr) sub 5 (M = Li, Na, K): Single-crystal x-ray diffraction structure of (LiTi(O-i-Pr) sub 5 ) sub 2  

SciTech Connect (OSTI)

The series (MTi(O-iPr){sub 5}), M = Li, Na, or K, has been prepared by the reaction of MO-i-Pr with Ti(O-i-Pr){sub 4}. A single-crystal x-ray diffraction study revealed that (LiTi(O-i-Pr){sub 5}) crystallizes from toluene at {minus}30{degree}C in the monoclinic space group P2{sub 1}/n, with unit cell dimensions a = 11.440 (8) {angstrom}, b = 16.396 (13) {angstrom}, c = 11.838 (8) {angstrom}, {beta} = 92.59 (5){degree}, and Z = 4, as a dimer containing two approximately trigonal-bipyramidal titanium centers linked by lithium bridges. In benzene solution, all three compounds are dimeric, as revealed by cryoscopic molecular weight determination, and all three undergo an alkoxide ligand exchange process that is rapid on the {sup 1}H NMR time scale at room temperature. The positions of {nu}(M-O) are assigned based on the low-energy shifts observed upon deuteriation of the isopropoxide ligands. 23 refs., 3 figs., 3 tabs.

Hampden-Smith, M.J.; Williams, D.S. (Univ. of New Mexico, Albuquerque (USA)); Rheingold, A.L. (Univ. of Delaware, Newark (USA))



Synthesis and single-crystal X-ray diffraction studies of new framework substituted type II clathrates, Cs{sub 8}Na{sub 16}Ag{sub x}Ge{sub 136-x} (x<7)  

SciTech Connect (OSTI)

New inorganic type II clathrates with Ag atoms substituting for framework Ge atoms, Cs{sub 8}Na{sub 16}Ag{sub x}Ge{sub 136-x} (x=0, 5.9, and 6.7), have been synthesized by reaction of the pure elements at high temperature. Structural refinements have been performed using single crystal X-ray diffraction. The materials crystallize with the cubic type II clathrate crystal structure (space group Fd3-barm) with a=15.49262(9)A, 15.51605(6)A, and 15.51618(9) for x=0, 5.9, and 6.7, respectively, and Z=1. The structure is formed by a covalently bonded Ag-Ge framework, in which the Cs and Na atoms are found inside two types of polyhedral cages. Ag substitutes for Ge in the tetrahedrally bonded framework positions, and was found to preferentially occupy the most asymmetric 96g site. The proven ability to substitute atoms for the germanium framework should offer a route to the synthesis of new compositions of type II clathrates, materials that are of interest for potential thermoelectrics applications.

Beekman, M. [Department of Physics, University of South Florida, 4202 East Fowler Ave., PHY 114, Tampa, FL 33620 (United States); Wong-Ng, W. [Materials Science and Engineering Laboratory, National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Kaduk, J.A. [INEOS Technologies, Naperville, IL 60566 (United States); Shapiro, A. [Materials Science and Engineering Laboratory, National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Nolas, G.S. [Department of Physics, University of South Florida, 4202 East Fowler Ave., PHY 114, Tampa, FL 33620 (United States)], E-mail: gnolas@cas.usf.edu



Structurally-driven metal-insulator transition in Ca{sub 2}Ru{sub 1-x}Cr{sub x}O{sub 4} (0{<=}x<0.14): A single crystal X-ray diffraction study  

SciTech Connect (OSTI)

Correlation between structure and transport properties are investigated in high-quality single-crystals of Ca{sub 2}Ru{sub 1-x}Cr{sub x}O{sub 4} with 0X-ray diffraction and by electronic studies. The parent compound was known to exhibit an intriguing first-order structurally driven metal-insulator (MI) transition at 357 K. Upon chromium doping on the ruthenium site, the metal-insulator transition temperature (T{sub MI}) was drastically reduced, and is related to the competition between structural changes that occur upon Cr doping and with decreasing temperature. A strong suppression of structural distortions with increasing Cr substitution was identified. No clear T{sub MI} can be observed when x>13.5% and the system behaves as an insulator. Such a large, sharp metal-insulator transition and tuneable transition temperature may have potential applications in electronic devices. -- Graphical abstract: The metal-insulator transition temperature (T{sub MI}) was drastically reduced by Cr doping, and is closely related to the distortion of structure. Display Omitted Research highlights: {yields} The metal-insulator transition temperature (T{sub MI}) was drastically reduced by doping Cr into Ca{sub 2}RuO{sub 4} single crystal. {yields} Detailed single crystal structural analysis provided important insight into this structurally-driven metal-insulator transition. {yields} Negative Volume Thermal Expansion (NVTE) was observed with increasing temperature.

Qi, T.F., E-mail: tqi2@uky.ed [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States); Ge, M. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); High Magnetic Field Laboratory, University of Science and Technology of China, Hefei, Anhui 230026 (China); Korneta, O.B. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States); Parkin, S. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Chemistry, University of Kentucky, Lexington, KY 40506 (United States); De Long, L.E.; Cao, G. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)



In situ examination of oxygen non-stoichiometry in La0.80Sr0.20CoO3 thin films at intermediate and low temperatures by X-ray diffraction  

SciTech Connect (OSTI)

Structural evolution of epitaxial La0.80Sr0.20CoO3 thin films under chemical and voltage stimuli were examined in situ using X-ray diffraction. The changes in lattice parameter (chemical expansivity) were used to quantify oxygen reduction reaction processes and vacancy concentration changes in LSCO. At 550 C the observed lattice parameter reduction at an applied bias of 0.6 V was equivalent to that from the reducing condition of a two percent carbon monoxide atmosphere with an oxygen non-stoichiometry of 0.24. At lower temperatures (200 C) the application of bias reduced the sample much more effectively than a carbon monoxide atmosphere and induced an oxygen non-stoichiometry of 0.47. Despite these large changes in oxygen concentration, the epitaxial thin film was completely re-oxidized and no signs of crystallinity loss or film amorphization were observed. This work demonstrates that the effects of oxygen evolution and reduction can be examined with applied bias at low temperatures, extending the ability to probe these processes with in-situ analytical techniques.

Biegalski, Michael D [ORNL] [ORNL; Crumlin, Ethan [Massachusetts Institute of Technology (MIT)] [Massachusetts Institute of Technology (MIT); Belianinov, Alex [ORNL] [ORNL; Mutoro, Eva [Massachusetts Institute of Technology (MIT)] [Massachusetts Institute of Technology (MIT); Shao-Horn, Yang [Massachusetts Institute of Technology (MIT)] [Massachusetts Institute of Technology (MIT); Kalinin, Sergei [Oak Ridge National Laboratory (ORNL)] [Oak Ridge National Laboratory (ORNL)



X-ray lithography source  

DOE Patents [OSTI]

A high-intensity, inexpensive X-ray source for X-ray lithography for the production of integrated circuits is disclosed. Foil stacks are bombarded with a high-energy electron beam of 25 to 250 MeV to produce a flux of soft X-rays of 500 eV to 3 keV. Methods of increasing the total X-ray power and making the cross section of the X-ray beam uniform are described. Methods of obtaining the desired X-ray-beam field size, optimum frequency spectrum and eliminating the neutron flux are all described. A method of obtaining a plurality of station operation is also described which makes the process more efficient and economical. The satisfying of these issues makes transition radiation an excellent moderate-priced X-ray source for lithography. 26 figures.

Piestrup, M.A.; Boyers, D.G.; Pincus, C.



X-ray lithography source  

DOE Patents [OSTI]

A high-intensity, inexpensive X-ray source for X-ray lithography for the production of integrated circuits. Foil stacks are bombarded with a high-energy electron beam of 25 to 250 MeV to produce a flux of soft X-rays of 500 eV to 3 keV. Methods of increasing the total X-ray power and making the cross section of the X-ray beam uniform are described. Methods of obtaining the desired X-ray-beam field size, optimum frequency spectrum and elminating the neutron flux are all described. A method of obtaining a plurality of station operation is also described which makes the process more efficient and economical. The satisfying of these issues makes transition radiation an exellent moderate-priced X-ray source for lithography.

Piestrup, Melvin A. (Woodside, CA); Boyers, David G. (Mountain View, CA); Pincus, Cary (Sunnyvale, CA)



X-Ray Diagnostics  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL Home SRNL main campusMore than 20X-Ray Diagnostics


X-ray lithography using holographic images  

DOE Patents [OSTI]

Methods for forming X-ray images having 0.25 .mu.m minimum line widths on X-ray sensitive material are presented. A holgraphic image of a desired circuit pattern is projected onto a wafer or other image-receiving substrate to allow recording of the desired image in photoresist material. In one embodiment, the method uses on-axis transmission and provides a high flux X-ray source having modest monochromaticity and coherence requirements. A layer of light-sensitive photoresist material on a wafer with a selected surface is provided to receive the image(s). The hologram has variable optical thickness and variable associated optical phase angle and amplitude attenuation for transmission of the X-rays. A second embodiment uses off-axis holography. The wafer receives the holographic image by grazing incidence reflection from a hologram printed on a flat metal or other highly reflecting surface or substrate. In this second embodiment, an X-ray beam with a high degree of monochromaticity and spatial coherence is required.

Howells, Malcolm S. (Berkeley, CA); Jacobsen, Chris (Sound Beach, NY)



X-ray atlas of rheumatic diseases  

SciTech Connect (OSTI)

This atlas comprises instructive X-rays of the various inflammatory rheumatic joint diseases in all stages at the extremities and the spinal column. In addition, the complex pattern of the wide range of arthroses, also known as degenerative rheumatic disease is included. Besides the instructive pointers to X-ray diagnosis, the book is also a guide to differential diagnosis. Hence, this book is actually an X-ray atlas of joint diseases in general. Selected Contents: Introduction: What Does ''Rheumatism'' Actually Mean./Radiographic Methodology in Rheumatic Diseases of the Locomotor System/The Mosaic of Arthritis/Adult Rheumatoid Arthritis/Seronegative Spondylarthritis/Classic Collagen Diseases/Enthesiopathies/Gout-Pseudogout

Dihlmann, W.




E-Print Network [OSTI]

Supplemental information I. OPTICAL-LASER AND X-RAY CONFIGURATION The experiment used 70 fs x-ray and x-ray pulses was established by the initial decrease in the 111 diffraction peak in a laser pulses at 10 keV from the LCLS in the high-charge (250 pC) mode at 120 Hz. The x-ray beam was focused

Loss, Daniel


X-rays only when you want them: Report on Pseudo-single-bunch...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Room 108A Speaker: David Robin, Lawrence Berkeley National Laboratory Program Description Laser pump - x-ray probe experiments require control over the x-ray pulse pattern and...


Miniature x-ray source  

DOE Patents [OSTI]

A miniature x-ray source capable of producing broad spectrum x-ray emission over a wide range of x-ray energies. The miniature x-ray source comprises a compact vacuum tube assembly containing a cathode, an anode, a high voltage feedthru for delivering high voltage to the anode, a getter for maintaining high vacuum, a connection for an initial vacuum pump down and crimp-off, and a high voltage connection for attaching a compact high voltage cable to the high voltage feedthru. At least a portion of the vacuum tube wall is highly x-ray transparent and made, for example, from boron nitride. The compact size and potential for remote operation allows the x-ray source, for example, to be placed adjacent to a material sample undergoing analysis or in proximity to the region to be treated for medical applications.

Trebes, James E. (Livermore, CA); Stone, Gary F. (Livermore, CA); Bell, Perry M. (Tracy, CA); Robinson, Ronald B. (Modesto, CA); Chornenky, Victor I. (Minnetonka, MN)



Special Application X-ray Diffraction | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on Catalytic Processing of Biomass-Derived Feedstocks . Trace components in biomass feedstocks are potential catalyst poisons when catalytically processing these materials to...


Hadron Optics: Diffraction Patterns in Deeply Virtual Compton Scattering  

E-Print Network [OSTI]

We show that the Fourier transform of the Deeply Virtual Compton Scattering (DVCS) amplitude with respect to the skewness variable $\\zeta$ at fixed invariant momentum transfer squared $t$ provides a unique way to visualize the structure of the target hadron in the boost-invariant longitudinal coordinate space. The results are analogous to the diffractive scattering of a wave in optics. As a specific example, we utilize the quantum fluctuations of a fermion state at one loop in QED to obtain the behavior of the DVCS amplitude for electron-photon scattering. We then simulate the wavefunctions for a hadron by differentiating the above LFWFs with respect to $M^2$ and study the corresponding DVCS amplitudes in light-front longitudinal space. In both cases we observe that the diffractive patterns in the longitudinal variable conjugate to $\\zeta$ sharpen and the positions of the first minima move in with increasing momentum transfer. For fixed $t$, higher minima appear at positions which are integral multiples of the lowest minimum. Both these observations strongly support the analogy with diffraction in optics.

S. J. Brodsky; D. Chakrabarti; A. Harindranath; A. Mukherjee; J. P. Vary



Refractive Optics for Hard X-ray Transmission Microscopy  

SciTech Connect (OSTI)

For hard x-ray transmission microscopy at photon energies higher than 15 keV we design refractive condenser and imaging elements to be used with synchrotron light sources as well as with x-ray tube sources. The condenser lenses are optimized for low x-ray attenuation--resulting in apertures greater than 1 mm--and homogeneous intensity distribution on the detector plane, whereas the imaging enables high-resolution (<100 nm) full-field imaging. To obtain high image quality at reasonable exposure times, custom-tailored matched pairs of condenser and imaging lenses are being developed. The imaging lenses (compound refractive lenses, CRLs) are made of SU-8 negative resist by deep x-ray lithography. SU-8 shows high radiation stability. The fabrication technique enables high-quality lens structures regarding surface roughness and arrangement precision with arbitrary 2D geometry. To provide point foci, crossed pairs of lenses are used. Condenser lenses have been made utilizing deep x-ray lithographic patterning of thick SU-8 layers, too, whereas in this case, the aperture is limited due to process restrictions. Thus, in terms of large apertures, condenser lenses made of structured and rolled polyimide film are more attractive. Both condenser types, x-ray mosaic lenses and rolled x-ray prism lenses (RXPLs), are considered to be implemented into a microscope setup. The x-ray optical elements mentioned above are characterized with synchrotron radiation and x-ray laboratory sources, respectively.

Simon, M.; Last, A.; Mohr, J.; Nazmov, V.; Reznikova, E. [Institute for Microstructure Technology, Karlsruhe Institute of Technology Kaiserstrasse 12, 76131 Karlsruhe (Germany); Ahrens, G.; Voigt, A. [Microresist Technology, Koepenikerstrasse 325, 12555 Berlin (Germany)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray fluorescence mapping  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

biololgical cells, over the measurement of impurities in solar cells, to the rare earth content of geological materials. A somewhat 'typical' layout for a X-ray fluorescence...


Ris-M-2751 X-Ray Energy Dispersive  

E-Print Network [OSTI]

(PHOT) k«V 50 Risø National Laboratory, DK-4000 Roskilde, Denmark October 1988 #12;Ris*-M-2751 X-ray energy is impinging on the sample (Fig. lb). Its wavelength (photon energy) is in the course of measurements changedm ii. S Risø-M-2751 X-Ray Energy Dispersive Diffraction Lecture Notes Bronislaw Buras BaKo 30 40 E


Note: A novel normalization scheme for laser-based plasma x-ray sources  

SciTech Connect (OSTI)

A kHz repetition rate laser pump-X-ray probe system for ultrafast X-ray diffraction is set up based on a laser-driven plasma X-ray source. A simple and reliable normalization approach has been developed to minimize the impact of large X-ray pulse intensity fluctuation on data quality. It utilizes one single X-ray area detector to record both sample and reference signals simultaneously. Performance of this novel normalization method is demonstrated in reflectivity oscillation measurement of a superlattice sample at sub-ps resolution.

Zhang, B. B.; Sun, D. R.; Tao, Y., E-mail: taoy@ihep.ac.cn [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China); Sun, S. S. [Institute of Physics, Chinese Academy of Sciences, Beijing 100090 (China)



The crystal structure of the interrupted framework silicate K{sub 9.6}Ca{sub 1.2}Si{sub 12}O{sub 30} determined from laboratory X-ray diffraction data  

SciTech Connect (OSTI)

The crystal structure of a potassium calcium silicate with composition K{sub 9.6}Ca{sub 1.2}Si{sub 12}O{sub 30} (or K{sub 8}CaSi{sub 10}O{sub 25}) has been solved by direct methods aided by distance least squares optimization from laboratory X-ray powder diffraction data. The trigonal compound adopts the non-centrosymmetric space group R3c with the following basic crystallographic data: a=11.13623(5)A, c=21.9890(2)A, V=2361.63(2)A{sup 3}, Z=3, D{sub calc}=2.617gcm{sup -3}. The crystal structure can be classified as an interrupted framework with exclusively Q{sup 3}-units. It can be thought of as being built from layers parallel to (001) containing isolated six-membered tetrahedral rings in UDUDUD conformation. Corner sharing of tetrahedra belonging to adjacent sheets results in a tetrahedral framework. The framework density of the structure is 15.2 T-atoms/1000A{sup 3}. The coordination sequences are identical for both silicon atoms in the asymmetric unit: 3-6-11-20-32-46-60-80-102-122. The vertex symbols for the two tetrahedral centers are 10{sub 2}.10{sub 2}.6{sub 1}. Topologically, the structure can be described as an Archimedean three-dimensional 3-connected net. It can be derived from the diamond or cristobalite net by removing 20% of the knots. Charge compensation in the structure is achieved by the incorporation of mono- and divalent M-cations (M: K, Ca). These extra-framework ions are coordinated by six to nine oxygen ligands. Ca/K distributions for the five symmetrically independent M-sites were obtained from a combination of bond distance considerations, site occupancy refinements and the bulk chemical composition. The structural characterization is completed by a detailed Raman spectroscopic study. Furthermore, possible implications of the structural chemistry of interrupted framework silicates for the field of silicate glass research are addressed.

Kahlenberg, V. [Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria)]. E-mail: volker.kahlenberg@uibk.ac.at; Kaindl, R. [Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria); Christian-Doppler-Laboratory for Advanced Hard Coatings at the Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria); Toebbens, D.M. [Institute of Mineralogy and Petrography, University of Innsbruck, Innrain 52, A-6020 Innsbruck (Austria)



Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lensless X-Ray Imaging in Reflection Lensless X-Ray Imaging in Reflection Print Wednesday, 26 October 2011 00:00 The advent of x-ray free-electron laser (XFEL) light sources has...


X-ray Raman scattering study of aligned polyfluorene  

E-Print Network [OSTI]

We present a non-resonant inelastic x-ray scattering study at the carbon K-edge on aligned poly[9,9-bis(2-ethylhexyl)-fluorene-2,7-diyl] and show that the x-ray Raman scattering technique can be used as a practical alternative to x-ray absorption measurements. We demonstrate that this novel method can be applied to studies on aligned $\\pi$-conjugated polymers complementing diffraction and optical studies. Combining the experimental data and a very recently proposed theoretical scheme we demonstrate a unique property of x-ray Raman scattering by performing the symmetry decomposition on the density of unoccupied electronic states into $s$- and $p$-type symmetry contributions.

S. Galambosi; M. Knaapila; J. A. Soininen; K. Nyg\\aard; S. Huotari; F. Galbrecht; U. Scherf; A. P. Monkman; K. Hmlinen



X-ray Stacking 2008-Apr-22 Astrostats X-ray Stacking  

E-Print Network [OSTI]

X-ray Stacking 2008-Apr-22 Astrostats X-ray Stacking Tom Aldcroft SAO/CXC #12;X-ray Stacking 2008 analysis for a sample Stacking ­ mean properties of sample Chandra X-ray data (faint point sources) are photon-limited with low background => stacking in X-rays is very effective #12;X-ray Stacking 2008-Apr-22

Wolfe, Patrick J.


Miniature x-ray source  

DOE Patents [OSTI]

A miniature x-ray source utilizing a hot filament cathode. The source has a millimeter scale size and is capable of producing broad spectrum x-ray emission over a wide range of x-ray energies. The miniature source consists of a compact vacuum tube assembly containing the hot filament cathode, an anode, a high voltage feedthru for delivering high voltage to the cathode, a getter for maintaining high vacuum, a connector for initial vacuum pump down and crimp-off, and a high voltage connection for attaching a compact high voltage cable to the high voltage feedthru. At least a portion of the vacuum tube wall is fabricated from highly x-ray transparent materials, such as sapphire, diamond, or boron nitride.

Trebes, James E. (Livermore, CA); Bell, Perry M. (Tracy, CA); Robinson, Ronald B. (Modesto, CA)



X-Ray Crystallography What do you need? A crystal. But not just any crystal a well ordered crystal  

E-Print Network [OSTI]

X-Ray Crystallography What do you need? A crystal. But not just any crystal­ a well ordered crystal that will diffract x-rays strongly. A crystal handedness. This reduces number to 6- 12. #12;#12;Generally X-ray beam

Cavanagh, John


An electrochemical cell for in operando studies of lithium/sodium batteries using a conventional x-ray powder diffractometer  

SciTech Connect (OSTI)

An electrochemical cell has been designed for powder X-ray diffraction studies of lithium ion batteries (LIB) and sodium ion batteries (SIB) in operando with high time resolution using a conventional powder X-ray diffractometer. The cell allows for studies of both anode and cathode electrode materials in reflection mode. The cell design closely mimics that of standard battery testing coin cells and allows obtaining powder X-ray diffraction patterns under representative electrochemical conditions. In addition, the cell uses graphite as the X-ray window instead of beryllium, and it is easy to operate and maintain. Test examples on lithium insertion/extraction in two spinel-type LIB electrode materials (Li{sub 4}Ti{sub 5}O{sub 12} anode and LiMn{sub 2}O{sub 4} cathode) are presented as well as first results on sodium extraction from a layered SIB cathode material (Na{sub 0.84}Fe{sub 0.56}Mn{sub 0.44}O{sub 2})

Shen, Yanbin; Pedersen, Erik E.; Christensen, Mogens; Iversen, Bo B., E-mail: bo@chem.au.dk [Center for Materials Crystallography, Department of Chemistry and iNANO, Aarhus University, Aarhus (Denmark)



X-ray Emission from Massive Stars  

E-Print Network [OSTI]

X-ray Emission from Massive Stars David Cohen Department of Physics and Astronomy Swarthmore be related to the production of X-rays on massive stars. If so, massive stars' X-rays are much different than those found our own Sun and other cooler stars like the Sun that produce X-rays via magnetic activity

Cohen, David


X-ray Emission from Massive Stars  

E-Print Network [OSTI]

X-ray Emission from Massive Stars David Cohen Department of Physics and Astronomy Swarthmore #12;What is the mechanism by which massive stars produce x-rays? New results from the Chandra X-ray Observatory ­ high-resolution x-ray spectroscopy: measuring Doppler broadening in emission lines Testing

Cohen, David


Lensless imaging of nanoporous glass with soft X-rays  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

Coherent soft X-ray diffraction has been used to image nanoporous glass structure in two dimensions using different methods. The merit of the reconstructions was judged using a new method of Fourier phase correlation with a final, refined image. The porous structure was found to have a much larger average size then previously believed.

Turner, Joshua J.; Nelson, Johanna; Huang, Xiaojing; Steinbrener, Jan; Jacobsen, Chris



Synchrotron-Radiation Induced X-Ray Emission (SRIXE)  

SciTech Connect (OSTI)

Elemental analysis using emission of characteristic x rays is a well-established scientific method. The success of this analytical method is highly dependent on the properties of the source used to produce the x rays. X-ray tubes have long existed as a principal excitation source, but electron and proton beams have also been employed extensively. The development of the synchrotron radiation x-ray source that has taken place during the past 40 years has had a major impact on the general field of x-ray analysis. Even tier 40 years, science of x-ray analysis with synchrotron x-ray beams is by no means mature. Improvements being made to existing synchrotron facilities and the design and construction of new facilities promise to accelerate the development of the general scientific use of synchrotron x-ray sources for at least the next ten years. The effective use of the synchrotron source technology depends heavily on the use of high-performance computers for analysis and theoretical interpretation of the experimental data. Fortunately, computer technology has advanced at least as rapidly as the x-ray technology during the past 40 years and should continue to do so during the next decade. The combination of these technologies should bring about dramatic advances in many fields where synchrotron x-ray science is applied. It is interesting also to compare the growth and rate of acceptance of this particular research endeavor to the rates for other technological endeavors. Griibler [1997] cataloged the time required for introduction, diffusion,and acceptance of technological, economic, and social change and found mean values of 40 to 50 years. The introduction of the synchrotron source depends on both technical and non-technical factors, and the time scale at which this seems to be occurring is quite compatible with what is seen for other major innovations such as the railroad or the telegraph. It will be interesting to see how long the present rate of technological change and increase in scientific use can be maintained for the synchrotron x-ray source. A short summary of the present state of the synchrotron radiation-induced x-ray emission (SRIXE) method is presented here. Basically, SRIXE experiments can include any that depend on the detection. of characteristic x-rays produced by the incident x-ray beam born the synchrotron source as they interact with a sample. Thus, experiments done to measure elemental composition, chemical state, crystal, structure, and other sample parameters can be considered in a discussion of SRIXE. It is also clear that the experimentalist may well wish to use a variety of complementary techniques for study of a given sample. For this reason, discussion of computed microtomography (CMT) and x-ray diffraction is included here. It is hoped that this present discussion will serve as a succinct introduction to the basic ideas of SRIXE for those not working in the field and possibly help to stimulate new types of work by those starting in the field as well as by experienced practitioners of the art. The topics covered include short descriptions of (1) the properties of synchrotron radiation, (2) a description of facilities used for its production, (3) collimated microprobe, (4) focused microprobes, (5) continuum and monoenergetic excitation, (6) detection limits, (7) quantitation, (8) applications of SRIXE, (9) computed microtomography (CMT), and (10)chemical speciation using x-ray absorption near-edge structure (XANES) and extended x-ray absorption fine structure (EXAFS). An effort has been made to cite a wide variety of work from different laboratories to show the vital nature of the field.

Jones, Keith W.



Vitreous carbon mask substrate for X-ray lithography  

DOE Patents [OSTI]

The present invention is directed to the use of vitreous carbon as a substrate material for providing masks for X-ray lithography. The new substrate also enables a small thickness of the mask absorber used to pattern the resist, and this enables improved mask accuracy. An alternative embodiment comprised the use of vitreous carbon as a LIGA substrate wherein the VC wafer blank is etched in a reactive ion plasma after which an X-ray resist is bonded. This surface treatment provides a surface enabling good adhesion of the X-ray photoresist and subsequent nucleation and adhesion of the electrodeposited metal for LIGA mold-making while the VC substrate practically eliminates secondary radiation effects that lead to delamination of the X-ray resist form the substrate, the loss of isolated resist features, and the formation of a resist layer adjacent to the substrate that is insoluble in the developer.

Aigeldinger, Georg (Livermore, CA); Skala, Dawn M. (Fremont, CA); Griffiths, Stewart K. (Livermore, CA); Talin, Albert Alec (Livermore, CA); Losey, Matthew W. (Livermore, CA); Yang, Chu-Yeu Peter (Dublin, CA)



Compact x-ray source and panel  

DOE Patents [OSTI]

A compact, self-contained x-ray source, and a compact x-ray source panel having a plurality of such x-ray sources arranged in a preferably broad-area pixelized array. Each x-ray source includes an electron source for producing an electron beam, an x-ray conversion target, and a multilayer insulator separating the electron source and the x-ray conversion target from each other. The multi-layer insulator preferably has a cylindrical configuration with a plurality of alternating insulator and conductor layers surrounding an acceleration channel leading from the electron source to the x-ray conversion target. A power source is connected to each x-ray source of the array to produce an accelerating gradient between the electron source and x-ray conversion target in any one or more of the x-ray sources independent of other x-ray sources in the array, so as to accelerate an electron beam towards the x-ray conversion target. The multilayer insulator enables relatively short separation distances between the electron source and the x-ray conversion target so that a thin panel is possible for compactness. This is due to the ability of the plurality of alternating insulator and conductor layers of the multilayer insulators to resist surface flashover when sufficiently high acceleration energies necessary for x-ray generation are supplied by the power source to the x-ray sources.

Sampayon, Stephen E. (Manteca, CA)



Ultrafast X-ray Absorption Spectroscopy using Laser-Driven Electron X-ray Sources (LEXS)  

E-Print Network [OSTI]

: ultrafast x-rays, x-ray absorption spectroscopy, terawatt lasers, ultrafast reaction dynamics, atomic motion atomic motion by scrutinizing the changes in x- ray absorption spectra during reactions. FirstUltrafast X-ray Absorption Spectroscopy using Laser-Driven Electron X-ray Sources (LEXS) Guangjun

Guo, Ting


X-ray effects in charge-ordered manganites: A magnetic mechanism of persistent photoconductivity  

SciTech Connect (OSTI)

Charge-ordered manganites of composite Pr{sub 1{minus}x}(Ca{sub 1{minus}y}Sr{sub y}){sub x}MnO{sub 3} exhibit persistent photoconductivity when illuminated by x-rays. The authors review transport and x-ray diffraction data as functions of x-ray exposure, magnetic field, and temperature which shed light on the origin of this unusual behavior. The experimental evidence suggests that the mechanism primarily involves a ferromagnetic polarization of local spins by hot electrons generated by the x-rays.

Keimer, B.; Casa, D.; Kiryukhin, V.; Saleh, O.A. [Princeton Univ., NJ (United States). Dept. of Physics; Hill, J.P. [Brookhaven National Lab., Upton, NY (United States). Dept. of Physics; Tomioka, Y. [Joint Research Center for Atom Technology, Tsukuba, Ibaraki (Japan); Tokura, Y. [Joint Research Center for Atom Technology, Tsukuba, Ibaraki (Japan)]|[Univ. of Tokyo (Japan). Dept. of Applied Physics



Cryo diffraction microscopy: Ice conditions and finite supports  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

Using a signal-to-noise ratio estimation based on correlations between multiple simulated images, we compare the dose efficiency of two soft x-ray imaging systems: incoherent brightfield imaging using zone plate optics in a transmission x-ray microscope (TXM), and x-ray diffraction microscopy (XDM) where an image is reconstructed from the far-field coherent diffraction pattern. In XDM one must computationally phase weak diffraction signals; in TXM one suffers signal losses due to the finite numerical aperture and efficiency of the optics. In simulations with objects representing isolated cells such as yeast, we find that XDM has the potential for delivering equivalent resolution images using fewer photons. This can be an important advantage for studying radiation-sensitive biological and soft matter specimens.

Miao, H; Downing, K; Huang, X; Kirz, J; Marchesini, S; Nelson, J; Shapiro, D; Steinbrener, J; Stewart, A; Jacobsen, C



Imaging X-ray Thomson Scattering Spectrometer Design and Demonstration  

SciTech Connect (OSTI)

In many laboratory astrophysics experiments, intense laser irradiation creates novel material conditions with large, one-dimensional gradients in the temperature, density, and ionization state. X-ray Thomson scattering is a powerful technique for measuring these plasma parameters. However, the scattered signal has previously been measured with little or no spatial resolution, which limits the ability to diagnose inhomogeneous plasmas. We report on the development of a new imaging x-ray Thomson spectrometer (IXTS) for the Omega laser facility. The diffraction of x-rays from a toroidally-curved crystal creates high-resolution images that are spatially resolved along a one-dimensional profile while spectrally dispersing the radiation. This focusing geometry allows for high brightness while localizing noise sources and improving the linearity of the dispersion. Preliminary results are presented from a scattering experiment that used the IXTS to measure the temperature profile of a shocked carbon foam.

Gamboa, E.J. [University of Michigan; Huntington, C.M. [University of Michigan; Trantham, M.R. [University of Michigan; Keiter, P.A [University of Michigan; Drake, R.P. [University of Michigan; Montgomery, David [Los Alamos National Laboratory; Benage, John F. [Los Alamos National Laboratory; Letzring, Samuel A. [Los Alamos National Laboratory


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fabrication and performance of blazed transmission gratings for x-ray astronomy  

E-Print Network [OSTI]

We have developed a new type of soft x-ray diffraction grating. This critical-angle transmission (CAT) grating combines the advantages of traditional transmission gratings (low mass, extremely relaxed alignment and flatness ...

Schattenburg, Mark Lee


No Evidence for Coherent Diffractive Radiation Patterns in the Millisecond Pulsar PSR J0437-4715  

E-Print Network [OSTI]

An independent analysis of the 326.5 MHz data obtained by Ooty Radio Telescope reveals no evidence for coherent diffractive radiation patterns in the millisecond pulsar PSR J0437-4715.

M. Vivekanand



Single molecule imaging with longer x-ray laser pulses  

E-Print Network [OSTI]

In serial femtosecond crystallography, x-ray laser pulses do not need to outrun all radiation damage processes because Bragg diffraction exceeds the damage-induced background scattering for longer pulses ($\\sim$ 50--100 fs). This is due to a "self-gating pulse" effect whereby damage terminates Bragg diffraction prior to the pulse completing its passage through the sample, as if that diffraction were produced by a shorter pulse of equal fluence. We show here that a similar gating effect applies to single molecule diffraction with respect to spatially uncorrelated damage processes like ionization and ion diffusion. The effect is clearly seen in calculations of the diffraction contrast, by calculating the diffraction of average structure separately to the diffraction from statistical fluctuations of the structure due to damage ("damage noise"). Our results suggest that sub-nanometer single molecule imaging with longer pulses, like those produced at currently operating facilities, should not yet be ruled out. The...

Martin, Andrew V; Caleman, Carl; Quiney, Harry M



X-Ray Tomographic Imaging of Crystal Structure at the Atomic Level P. Korecki,1,* M. Tolkiehn,2  

E-Print Network [OSTI]

X-Ray Tomographic Imaging of Crystal Structure at the Atomic Level P. Korecki,1,* M. Tolkiehn,2 D of the crystal structure from real-space projections obtained by illuminating the sample with white x rays. This approach was applied to the pattern of the directional fine structure in absorption of white x rays

Korecki, Pawe³


Microgap x-ray detector  

DOE Patents [OSTI]

An x-ray detector is disclosed which provides for the conversion of x-ray photons into photoelectrons and subsequent amplification of these photoelectrons through the generation of electron avalanches in a thin gas-filled region subject to a high electric potential. The detector comprises a cathode (photocathode) and an anode separated by the thin, gas-filled region. The cathode may comprise a substrate, such a beryllium, coated with a layer of high atomic number material, such as gold, while the anode can be a single conducting plane of material, such as gold, or a plane of resistive material, such as chromium/silicon monoxide, or multiple areas of conductive or resistive material, mounted on a substrate composed of glass, plastic or ceramic. The charge collected from each electron avalanche by the anode is passed through processing electronics to a point of use, such as an oscilloscope. 3 figures.

Wuest, C.R.; Bionta, R.M.; Ables, E.



Microgap x-ray detector  

DOE Patents [OSTI]

An x-ray detector which provides for the conversion of x-ray photons into photoelectrons and subsequent amplification of these photoelectrons through the generation of electron avalanches in a thin gas-filled region subject to a high electric potential. The detector comprises a cathode (photocathode) and an anode separated by the thin, gas-filled region. The cathode may comprise a substrate, such a beryllium, coated with a layer of high atomic number material, such as gold, while the anode can be a single conducting plane of material, such as gold, or a plane of resistive material, such as chromium/silicon monoxide, or multiple areas of conductive or resistive material, mounted on a substrate composed of glass, plastic or ceramic. The charge collected from each electron avalanche by the anode is passed through processing electronics to a point of use, such as an oscilloscope.

Wuest, Craig R. (Danville, CA); Bionta, Richard M. (Livermore, CA); Ables, Elden (Livermore, CA)



Spectral analysis of X-ray binaries  

E-Print Network [OSTI]

In this thesis, I present work from three separate research projects associated with observations of X-ray binaries. Two of those revolve around spectral characteristics of neutron star low-mass X-ray binaries (NS-LMXBs), ...

Fridriksson, Joel Karl



Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

X-Ray Imaging in Reflection Print The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities in the field of lensless imaging. XFELs...


Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

X-Ray Imaging in Reflection Print Wednesday, 26 October 2011 00:00 The advent of x-ray free-electron laser (XFEL) light sources has led to an outburst of research activities...


Producing X-rays at the APS  

ScienceCinema (OSTI)

An introduction and overview of the Advanced Photon Source at Argonne National Laboratory, the technology that produces the brightest X-ray beams in the Western Hemisphere, and the research carried out by scientists using those X-rays.




Phase-sensitive X-ray imager  

DOE Patents [OSTI]

X-ray phase sensitive wave-front sensor techniques are detailed that are capable of measuring the entire two-dimensional x-ray electric field, both the amplitude and phase, with a single measurement. These Hartmann sensing and 2-D Shear interferometry wave-front sensors do not require a temporally coherent source and are therefore compatible with x-ray tubes and also with laser-produced or x-pinch x-ray sources.

Baker, Kevin Louis



Chandra X-ray Observatory Center  

E-Print Network [OSTI]

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St in hot gas about 250 million light years from Earth. (Credit: X-ray: NASA/CXC/SAO/E.Bulbul, et al-Newton has revealed a mysterious X-ray signal in the data. This signal is represented in the circled data


X-Ray Absorption Spectroscopy of Metallobiomolecules  

E-Print Network [OSTI]

2/9/07 1 X-Ray Absorption Spectroscopy of Metallobiomolecules The Outskirts of Structural Biology 9, 07] This is a tutorial about the use of X-ray Absorption Spectroscopy (XAS) in biology, RG; Eisenberger, P; Kincaid, BM "X-ray Absorption Spectroscopy of Biological Molecules" Annu. Rev

Scott, Robert A.


Chandra X-ray Observatory Center  

E-Print Network [OSTI]

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St million light years from Earth. (Credit: X-ray: NASA/CXC/Wesleyan Univ./R.Kilgard, et al; Optical: NASA with optical data from the Hubble Space Telescope (red, green, and blue). The X-ray data reveal hundreds


Cryotomography x-ray microscopy state  

DOE Patents [OSTI]

An x-ray microscope stage enables alignment of a sample about a rotation axis to enable three dimensional tomographic imaging of the sample using an x-ray microscope. A heat exchanger assembly provides cooled gas to a sample during x-ray microscopic imaging.

Le Gros, Mark (Berkeley, CA); Larabell, Carolyn A. (Berkeley, CA)



X-ray Spectroscopy of Cool Stars  

E-Print Network [OSTI]

High-resolution X-ray spectroscopy has addressed not only various topics in coronal physics of stars, but has also uncovered important features relevant for our understanding of stellar evolution and the stellar environment. I summarize recent progress in coronal X-ray spectroscopy and in particular also discuss new results from studies of X-rays from pre-main sequence stars.

M. Guedel



X-Ray Physics Evan Berkowitz  

E-Print Network [OSTI]

X-Ray Physics Evan Berkowitz Junior, MIT Department of Physics (Dated: October 25, 2006) We measure a variety of phenomena related to X-Ray absorption and production. We present data which conforms within, as are 22 Na electron-positron annhilation lines. The importance of understanding x-rays is demonstrated


Chandra X-ray Observatory Center  

E-Print Network [OSTI]

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St 200 million light years from Earth. (Credit: X-ray: NASA/CXC/UAH/M.Sun et al; Optical: NASA, ESA, & the Hubble Heritage Team (STScI/AURA) Caption: This composite image from the Chandra X-ray Observatory (blue


X-Ray Absorption Spectroscopy of Metallobiomolecules  

E-Print Network [OSTI]

9/6/09 1 X-Ray Absorption Spectroscopy of Metallobiomolecules The Outskirts of Structural Biology 6, 09] This is a tutorial about the use of X-ray Absorption Spectroscopy (XAS) in biology, RG; Eisenberger, P; Kincaid, BM "X-ray Absorption Spectroscopy of Biological Molecules" Annu. Rev

Scott, Robert A.


Chandra X-ray Observatory Center  

E-Print Network [OSTI]

Chandra X-ray Observatory Center Harvard-Smithsonian Center for Astrophysics 60 Garden St. Cambridge, MA 02138 USA http://chandra.harvard.edu Four Supernova Remnants: NASA's Chandra X-ray Observatory's Chandra X-ray Observatory, four newly processed images of supernova remnants dramatically illustrate

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray spectroscopy of low-mass X-ray binaries  

E-Print Network [OSTI]

I present high-resolution X-ray grating spectroscopy of neutron stars in low-mass X-ray binaries (LMXBs) using instruments onboard the Chandra X-ray Observatory and the X-ray Multi-Mirror Mission (XMM-Newton). The first ...

Juett, Adrienne Marie, 1976-



Extending The Methodology Of X-ray Crystallography To Allow X-ray  

E-Print Network [OSTI]

, the radiation damage. While the radiation damage problem can be mitigated somewhat by using cryogenic techniques resolution without serious radiation damage to the specimens. Although X-ray crystallography becomesExtending The Methodology Of X-ray Crystallography To Allow X-ray Microscopy Without X-ray Optics

Miao, Jianwei "John"


X-ray Pulsations in the Supersoft X-ray Binary CAL 83  

E-Print Network [OSTI]

X-ray data reveal that the supersoft X-ray binary CAL 83 exhibits 38.4 minute pulsations at some epochs. These X-ray variations are similar to those found in some novae and are likely to be caused by nonradial pulsations the white dwarf. This is the first detection of pulsations in a classical supersoft X-ray binary.

P. C. Schmidtke; A. P. Cowley



X-ray Spectroscopy of Cooling Clusters  

E-Print Network [OSTI]

We review the X-ray spectra of the cores of clusters of galaxies. Recent high resolution X-ray spectroscopic observations have demonstrated a severe deficit of emission at the lowest X-ray temperatures as compared to that expected from simple radiative cooling models. The same observations have provided compelling evidence that the gas in the cores is cooling below half the maximum temperature. We review these results, discuss physical models of cooling clusters, and describe the X-ray instrumentation and analysis techniques used to make these observations. We discuss several viable mechanisms designed to cancel or distort the expected process of X-ray cluster cooling.

J. R. Peterson; A. C. Fabian



X-ray transmissive debris shield  

DOE Patents [OSTI]

An X-ray debris shield for use in X-ray lithography that is comprised of an X-ray window having a layer of low density foam exhibits increased longevity without a substantial increase in exposure time. The low density foam layer serves to absorb the debris emitted from the X-ray source and attenuate the shock to the window so as to reduce the chance of breakage. Because the foam is low density, the X-rays are hardly attenuated by the foam and thus the exposure time is not substantially increased.

Spielman, Rick B. (Albuquerque, NM)



Synchronization of x-ray pulses to the pump laser in an ultrafast x-ray facility  

E-Print Network [OSTI]

Accurate timing of ultrafast x-ray probe pulses emitted fromOF X-RAY PULSES TO THE PUMP LASER IN AN ULTRAFAST X-RAY

Corlett, J.N.; Barry, W.; Byrd, J.M.; Schoenlein, R.; Zholents, A.



X-ray lithography using holographic images  

DOE Patents [OSTI]

A non-contact X-ray projection lithography method for producing a desired X-ray image on a selected surface of an X-ray-sensitive material, such as photoresist material on a wafer, the desired X-ray image having image minimum linewidths as small as 0.063 .mu.m, or even smaller. A hologram and its position are determined that will produce the desired image on the selected surface when the hologram is irradiated with X-rays from a suitably monochromatic X-ray source of a selected wavelength .lambda.. On-axis X-ray transmission through, or off-axis X-ray reflection from, a hologram may be used here, with very different requirements for monochromaticity, flux and brightness of the X-ray source. For reasonable penetration of photoresist materials by X-rays produced by the X-ray source, the wavelength X, is preferably chosen to be no more than 13.5 nm in one embodiment and more preferably is chosen in the range 1-5 nm in the other embodiment. A lower limit on linewidth is set by the linewidth of available microstructure writing devices, such as an electron beam.

Howells, Malcolm R. (Berkeley, CA); Jacobsen, Chris (Sound Beach, NY)



X-ray Imaging Workshop  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of EnergyX-ray Computed TomographyImaging


X-ray fluorescence mapping  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of EnergyX-rayNew Materialsray


X-Ray Science Education  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL Home SRNL main campusMore thanX-Ray Imagingfeed


Uncovering a Pressure-Tuned Electronic Transition in Bi[subscript 1.98]Sr[subscript 2.06]Y[subscript0.68]Cu[subscript 2]O[subscipt 8+delta] using Raman Scattering and X-Ray Diffraction  

SciTech Connect (OSTI)

We report pressure-tuned Raman and x-ray diffraction data of Bi{sub 1.98}Sr{sub 2.06}Y{sub 0.68}Cu{sub 2}O{sub 8+{delta}} revealing a critical pressure at 21 GPa with anomalies in electronic Raman background, electron-phonon coupling {lambda}, spectral weight transfer, density dependent behavior of phonons and magnons, and a compressibility change in the c axis. For the first time in a cuprate, mobile charge carriers, lattice, and magnetism all show anomalies at a distinct critical pressure in the same experimental setting. Furthermore, the spectral changes suggest that the critical pressure at 21 GPa is related to the critical point at optimal doping.

Cuk, T.; Struzhkin, V.V.; Devereaux, T.P.; Goncharov, A.F.; Kendziora, C.A.; Eisaki, H.; Mao, H.-K.; Shen, Z.-X. (Stanford); (Waterloo); (NIAIST); (CIW); (NRL)



Gray scale x-ray mask  

DOE Patents [OSTI]

The present invention describes a method for fabricating an embossing tool or an x-ray mask tool, providing microstructures that smoothly vary in height from point-to-point in etched substrates, i.e., structure which can vary in all three dimensions. The process uses a lithographic technique to transfer an image pattern in the surface of a silicon wafer by exposing and developing the resist and then etching the silicon substrate. Importantly, the photoresist is variably exposed so that when developed some of the resist layer remains. The remaining undeveloped resist acts as an etchant barrier to the reactive plasma used to etch the silicon substrate and therefore provides the ability etch structures of variable depths.

Morales, Alfredo M. (Livermore, CA); Gonzales, Marcela (Seattle, WA)



Controlling X-rays With Light  

SciTech Connect (OSTI)

Ultrafast x-ray science is an exciting frontier that promises the visualization of electronic, atomic and molecular dynamics on atomic time and length scales. A largelyunexplored area of ultrafast x-ray science is the use of light to control how x-rays interact with matter. In order to extend control concepts established for long wavelengthprobes to the x-ray regime, the optical control field must drive a coherent electronic response on a timescale comparable to femtosecond core-hole lifetimes. An intense field is required to achieve this rapid response. Here an intense optical control pulse isobserved to efficiently modulate photoelectric absorption for x-rays and to create an ultrafast transparency window. We demonstrate an application of x-ray transparencyrelevant to ultrafast x-ray sources: an all-photonic temporal cross-correlation measurement of a femtosecond x-ray pulse. The ability to control x-ray/matterinteractions with light will create new opportunities at current and next-generation x-ray light sources.

Glover, Ernie; Hertlein, Marcus; Southworth, Steve; Allison, Tom; van Tilborg, Jeroen; Kanter, Elliot; Krassig, B.; Varma, H.; Rude, Bruce; Santra, Robin; Belkacem, Ali; Young, Linda



X-ray Observations of Mrk 231  

E-Print Network [OSTI]

This paper presents new X-ray observations of Mrk 231, an active galaxy of particular interest due to its large infrared luminosity and the presence of several blueshifted broad absorption line (BAL) systems, a phenomenon observed in a small fraction of QSOs. A ROSAT HRI image of Mrk 231 is presented, this shows an extended region of soft X-ray emission, covering several tens of kpc, consistent with the extent of the host galaxy. An ASCA observation of Mrk 231 is also presented. Hard X-rays are detected but the data show no significant variability in X-ray flux. The hard X-ray continuum is heavily attenuated and X-ray column estimates range from ~ 2 x 10^{22} - 10^{23} cm^{-2} depending on whether the material is assumed to be neutral or ionized, and on the model assumed for the extended X-ray component. These ASCA data provide only the second hard X-ray spectrum of a BAL AGN presented to date. The broad-band spectral-energy-distribution of the source is discussed. While Mrk 231 is X-ray weak compared to Seyfert 1 galaxies, it has an optical-to-X-ray spectrum typical of a QSO.

T. J. Turner



Techniques for synchronization of X-Ray pulses to the pump laser in an ultrafast X-Ray facility  

E-Print Network [OSTI]

synchronization of ultrafast x-ray pulses produced in theAccurate timing of ultrafast x-ray probe pulses emitted fromOF X-RAY PULSES TO THE PUMP LASER IN AN ULTRAFAST X-RAY

Corlett, J.N.; Doolittle, L.; Schoenlein, R.; Staples, J.; Wilcox, R.; Zholents, A.



Hard x-ray imaging from explorer  

SciTech Connect (OSTI)

Coded aperture X-ray detectors were applied to obtain large increases in sensitivity as well as angular resolution. A hard X-ray coded aperture detector concept is described which enables very high sensitivity studies persistent hard X-ray sources and gamma ray bursts. Coded aperture imaging is employed so that approx. 2 min source locations can be derived within a 3 deg field of view. Gamma bursts were located initially to within approx. 2 deg and X-ray/hard X-ray spectra and timing, as well as precise locations, derived for possible burst afterglow emission. It is suggested that hard X-ray imaging should be conducted from an Explorer mission where long exposure times are possible.

Grindlay, J.E.; Murray, S.S.



X-ray laser frequency near-doubling and generation of tunable coherent x rays in plasma  

E-Print Network [OSTI]

X-ray laser frequency near-doubling and generation of tunable coherent x rays in plasma P. L plasmas in which efficient x-ray laser frequency near-doubling is expected for a number of available x-ray of coherent x rays and tunable optical radiation may result in tunable coherent x-ray radiation powerful

Kaplan, Alexander


High speed x-ray beam chopper  

DOE Patents [OSTI]

A fast, economical, and compact x-ray beam chopper with a small mass and a small moment of inertia whose rotation can be synchronized and phase locked to an electronic signal from an x-ray source and be monitored by a light beam is disclosed. X-ray bursts shorter than 2.5 microseconds have been produced with a jitter time of less than 3 ns.

McPherson, Armon (Oswego, IL); Mills, Dennis M. (Naperville, IL)



X-ray populations in galaxies  

E-Print Network [OSTI]

Today's sensistive, high resolution Chandra X-ray observations allow the study of many populations of X-ray sources. The traditional astronomical tools of photometric diagrams and luminosity functions are now applied to these populations, and provide the means for classifying the X-ray sources and probing their evolution. While overall stellar mass drives the amount of X-ray binaries in old stellar population, the amount of sources in star-forming galaxies is related to the star formation rate. Shart-lived, luminous, high mass binaries (HNXBs) dominate these young populations.

G. Fabbiano




E-Print Network [OSTI]

X-RAY MICROBEAM SPEECH PRODUCTION DATABASE USER'S HANDBOOK Version 1.0 (June 1994) prepared by John . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Chapter Two: XRMB History

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray laser microscope apparatus  

DOE Patents [OSTI]

A microscope consisting of an x-ray contact microscope and an optical microscope. The optical, phase contrast, microscope is used to align a target with respect to a source of soft x-rays. The source of soft x-rays preferably comprises an x-ray laser but could comprise a synchrotron or other pulse source of x-rays. Transparent resist material is used to support the target. The optical microscope is located on the opposite side of the transparent resist material from the target and is employed to align the target with respect to the anticipated soft x-ray laser beam. After alignment with the use of the optical microscope, the target is exposed to the soft x-ray laser beam. The x-ray sensitive transparent resist material whose chemical bonds are altered by the x-ray beam passing through the target mater GOVERNMENT LICENSE RIGHTS This invention was made with government support under Contract No. De-FG02-86ER13609 awarded by the Department of Energy. The Government has certain rights in this invention.

Suckewer, Szymon (Princeton, NJ); DiCicco, Darrell S. (Plainsboro, NJ); Hirschberg, Joseph G. (Coral Gables, FL); Meixler, Lewis D. (East Windsor, NJ); Sathre, Robert (Princeton, NJ); Skinner, Charles H. (Lawrenceville, NJ)



Compound refractive X-ray lens  

DOE Patents [OSTI]

An apparatus and method for focusing X-rays. In one embodiment, his invention is a commercial-grade compound refractive X-ray lens. The commercial-grade compound refractive X-ray lens includes a volume of low-Z material. The volume of low-Z material has a first surface which is adapted to receive X-rays of commercially-applicable power emitted from a commercial-grade X-ray source. The volume of low-Z material also has a second surface from which emerge the X-rays of commercially-applicable power which were received at the first surface. Additionally, the commercial-grade compound refractive X-ray lens includes a plurality of openings which are disposed between the first surface and the second surface. The plurality of openings are oriented such that the X-rays of commercially-applicable power which are received at the first surface, pass through the volume of low-Z material and through the plurality openings. In so doing, the X-rays which emerge from the second surface are refracted to a focal point.

Nygren, David R. (Berkeley, CA); Cahn, Robert (Walnut Creek, CA); Cederstrom, Bjorn (Traellborg, SE); Danielsson, Mats (Stocksund, SE); Vestlund, Jonas (Stockholm, SE)



X-Ray Science Division (XSD)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

X-Ray Science Division (XSD) Search Button About Welcome Overview Visiting the APS Mission & Goals Find People Organization Charts Committees Job Openings User Information...


X-ray mask and method for providing same  

DOE Patents [OSTI]

The present invention describes a method for fabricating an x-ray mask tool which can achieve pattern features having lateral dimension of less than 1 micron. The process uses a thin photoresist and a standard lithographic mask to transfer an trace image pattern in the surface of a silicon wafer by exposing and developing the resist. The exposed portion of the silicon substrate is then anisotropically etched to provide an etched image of the trace image pattern consisting of a series of channels in the silicon having a high depth-to-width aspect ratio. These channels are then filled by depositing a metal such as gold to provide an inverse image of the trace image and thereby providing a robust x-ray mask tool.

Morales, Alfredo M. (Pleasanton, CA); Skala, Dawn M. (Fremont, CA)



X-ray mask and method for providing same  

DOE Patents [OSTI]

The present invention describes a method for fabricating an x-ray mask tool which can achieve pattern features having lateral dimension of less than 1 micron. The process uses a thin photoresist and a standard lithographic mask to transfer an trace image pattern in the surface of a silicon wafer by exposing and developing the resist. The exposed portion of the silicon substrate is then anisotropically etched to provide an etched image of the trace image pattern consisting of a series of channels in the silicon having a high depth-to-width aspect ratio. These channels are then filled by depositing a metal such as gold to provide an inverse image of the trace image and thereby providing a robust x-ray mask tool.

Morales, Alfredo M. (Pleasanton, CA); Skala, Dawn M. (Fremont, CA)



Entangled valence electron-hole dynamics revealed by stimulated attosecond x-ray Raman scattering  

SciTech Connect (OSTI)

We show that broadband x-ray pulses can create wavepackets of valence electrons and holes localized in the vicinity of a selected atom (nitrogen, oxygen or sulfur in cysteine) by resonant stimulated Raman scattering. The subsequent dynamics reveals highly correlated motions of entangled electrons and hole quasiparticles. This information goes beyond the time-dependent total charge density derived from x-ray diffraction.

Healion, Daniel; Zhang, Yu; Biggs, Jason D.; Govind, Niranjan; Mukamel, Shaul



Acoustically Mounted Microcrystals Yield High-Resolution X-ray Structures  

SciTech Connect (OSTI)

We demonstrate a general strategy for determining structures from showers of microcrystals. It uses acoustic droplet ejection to transfer 2.5 nL droplets from the surface of microcrystal slurries, through the air, onto mounting micromesh pins. Individual microcrystals are located by raster-scanning a several-micrometer X-ray beam across the cryocooled micromeshes. X-ray diffraction data sets merged from several micrometer-sized crystals are used to determine 1.8 {angstrom} resolution crystal structures.

Soares, Alexei S.; Engel, Matthew A.; Stearns, Richard; Datwani, Sammy; Olechno, Joe; Ellson, Richard; Skinner, John M.; Allaire, Marc; Orville, Allen M. (Labcyte); (BNL)



X-ray spectroscopy of neutron star low-mass X-ray binaries  

E-Print Network [OSTI]

In this thesis, I present work spanning a variety of topics relating to neutron star lowmass X-ray binaries (LMXBs) and utilize spectral information from X-ray observations to further our understanding of these sources. ...

Krauss, Miriam Ilana



The influence of pressure on the phase stability of nanocomposite Fe{sub 89}Zr{sub 7}B{sub 4} during heating from energy dispersive x-ray diffraction  

SciTech Connect (OSTI)

Nanocomposite materials consisting of small crystalline grains embedded within an amorphous matrix show promise for many soft magnetic applications. The influence of pressure is investigated by in situ diffraction of hammer milled Fe{sub 89}Zr{sub 7}B{sub 4} during heating through the {alpha}{yields}{gamma} Fe transition at 0.5, 2.2, and 4.9 GPa. The changes in primary and secondary crystallization onset are described by diffusion and the energy to form a critical nucleus within the framework of classical nucleation theory.

Leary, A. M.; Kernion, S. J.; McHenry, M. E. [Materials Science and Engineering Department, Carnegie Mellon University, 5000 Forbes Ave., Pittsburgh, Pennsylvania 15213 (United States); Lucas, M. S. [Air Force Research Laboratory, Wright-Patterson AFB, Ohio 45433 (United States); Ohodnicki, P. R. [Division of Chemistry and Surface Science, National Energy Technology Laboratory (NETL), 626 Cochrans Mill Road, Pittsburgh, Pennsylvania 15236 (United States); Mauger, L. [California Institute of Technology, W. M. Keck Laboratory 138-78, Pasadena, California 91125 (United States); Park, C.; Kenney-Benson, C. [High Pressure Collaborative Access Team (HPCAT), Geophysical Laboratory, Carnegie Institution of Washington, 9700 S. Cass Ave., Argonne, Illinois 60439 (United States)



Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect (OSTI)

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)



Ultraluminous X-ray Sources: The most extreme X-ray binaries  

E-Print Network [OSTI]

1 Ultraluminous X-ray Sources: The most extreme X-ray binaries Luca Zampieri INAF ULXs ­ Lubiana ­ May 11, 2012- LZ #12;6 · X-ray observations of nearby galaxies show a population of pointlike, off-nuclear sources with L >> Ledd for 1 Msun (L>1.0e39 erg/s) UltraLuminous X-ray Sources (e

?umer, Slobodan


Water Window Ptychographic Imaging with Characterized Coherent X-rays  

E-Print Network [OSTI]

We report on a ptychographical coherent diffractive imaging experiment in the water window with focused soft X-rays at $500~\\mathrm{eV}$. An X-ray beam with high degree of coherence was selected for ptychography at the P04 beamline of the PETRA III synchrotron radiation source. We measured the beam coherence with the newly developed non-redundant array method. A pinhole $2.6~\\mathrm{\\mu m}$ in size selected the coherent part of the beam and was used for ptychographic measurements of a lithographically manufactured test sample and fossil diatom. The achieved resolution was $53~\\mathrm{nm}$ for the test sample and only limited by the size of the detector. The diatom was imaged at a resolution better than $90~\\mathrm{nm}$.

Rose, Max; Dzhigaev, Dmitry; Gorobtsov, Oleg; Senkbeil, Tobias; von Gundlach, Andreas; Gorniak, Thomas; Shabalin, Anatoly; Viefhaus, Jens; Rosenhahn, Axel; Vartanyants, Ivan



X-ray source populations in galaxies  

E-Print Network [OSTI]

Today's sensitive, high-resolution X-ray observations allow the study of populations of X-ray sources, in the luminosity range of Galactic X-ray binaries, in galaxies as distant as 20-30 Mpc. The traditional astronomical tools of photometric diagrams and luminosity functions are now applied to these populations, providing a direct probe of the evolved binary component of different stellar populations. The study of the X-ray populations of E and S0 galaxies has revamped the debate on the formation and evolution of low-mass X-ray binaries (LMXBs) and on the role of globular clusters in these processes. While overall stellar mass drives the amount of X-ray binaries in old stellar populations, the amount of sources in star forming galaxies is related to the star formation rate. Short-lived, luminous, high-mass binaries (HMXBs) dominate these young populations. The most luminous sources in these systems are the debated ULXs, which have been suggested to be ~100-1000 Msol black holes, but could alternatively include a number of binaries with stellar mass black holes. Very soft sources have also been discovered in many galaxies and their nature is currently being debated. Observations of the deep X-ray sky, and comparison with deep optical surveys, are providing the first evidence of the X-ray evolution of galaxies.

G. Fabbiano



Aneta Siemiginowska Chandra X-ray Center  

E-Print Network [OSTI]

-ray and gamma-ray · High Energy Sky · Chandra X-ray Observatory · examples of typical X-ray data, · an example of a data analysis process · statistical challenges · what do we learn from the data? #12;What is Astronomy and phenomena do we study and how? Solar System: Sun and sollar wind, planets, moons, asteroids, comets Our

Wolfe, Patrick J.


Phased Contrast X-Ray Imaging  

ScienceCinema (OSTI)

The Pacific Northwest National Laboratory is developing a range of technologies to broaden the field of explosives detection. Phased contrast X-ray imaging, which uses silicon gratings to detect distortions in the X-ray wave front, may be applicable to mail or luggage scanning for explosives; it can also be used in detecting other contraband, small-parts inspection, or materials characterization.

Erin Miller



Quantitative Measurements of X-ray Intensity  

SciTech Connect (OSTI)

This chapter describes the characterization of several X-ray sources and their use in calibrating different types of X-ray cameras at National Security Technologies, LLC (NSTec). The cameras are employed in experimental plasma studies at Lawrence Livermore National Laboratory (LLNL), including the National Ignition Facility (NIF). The sources provide X-rays in the energy range from several hundred eV to 110 keV. The key to this effort is measuring the X-ray beam intensity accurately and traceable to international standards. This is accomplished using photodiodes of several types that are calibrated using radioactive sources and a synchrotron source using methods and materials that are traceable to the U.S. National Institute of Standards and Technology (NIST). The accreditation procedures are described. The chapter begins with an introduction to the fundamental concepts of X-ray physics. The types of X-ray sources that are used for device calibration are described. The next section describes the photodiode types that are used for measuring X-ray intensity: power measuring photodiodes, energy dispersive photodiodes, and cameras comprising photodiodes as pixel elements. Following their description, the methods used to calibrate the primary detectors, the power measuring photodiodes and the energy dispersive photodiodes, as well as the method used to get traceability to international standards are described. The X-ray source beams can then be measured using the primary detectors. The final section then describes the use of the calibrated X-ray beams to calibrate X-ray cameras. Many of the references are web sites that provide databases, explanations of the data and how it was generated, and data calculations for specific cases. Several general reference books related to the major topics are included. Papers expanding some subjects are cited.

Haugh, M. J., Schneider, M.



Projections of local atomic structure revealed by wavelet analysis of x-ray absorption anisotropy P. Korecki,1,* D. V. Novikov,2 and M. Tolkiehn2  

E-Print Network [OSTI]

Projections of local atomic structure revealed by wavelet analysis of x-ray absorption anisotropy P x-ray field amplitude at the sites of absorbing atoms and effectively changes the atomic absorption in an experiment a wavelet transform approach for analysis of x-ray absorption anisotropy XAA patterns recorded

Korecki, Pawe³


X-ray Practicals Series 1 Advanced Data Reduction  

E-Print Network [OSTI]

X-ray Practicals Series 1 Advanced Data Reduction Instructor J. Reibenspies, Ph. D. Nattamai Bhuvanesh, Ph.D. Version 1.0.0 #12;X-ray Practicals Series 2 #12;X-ray Practicals Series 3 #12;X-ray is good. The y direction is shifting the most, but the shift is ok #12;X-ray Practicals Series 5 Other

Meagher, Mary



E-Print Network [OSTI]

with the occurrence of solar X-ray flare, when light travel time delay is accounted, suggesting that X-rays fromX-RAY EMISSION FROM PLANETS AND COMETS: RELATIONSHIP WITH SOLAR X-RAYS AND SOLAR WIND ANIL BHARDWAJ Flight center, Greenbelt, MD 20771, USA Scattering of solar X-ray radiation mainly produces the non

?stgaard, Nikolai


Novel X-Ray Imaging Opportunities for the RPI Linear Accelerator's Tunable, Quasi-monochromatic X-ray Source  

E-Print Network [OSTI]

Novel X-Ray Imaging Opportunities for the RPI Linear Accelerator's Tunable, Quasi-monochromatic X-ray of an intense, tunable, polarized, and quasi-monochromatic X-ray source has been ongoing at Rensselaer Polytechnic Institute since 2001 [1, 2, 3, 4, 5, 6]. This X-ray source, known as Parametric X-rays (PXR

Danon, Yaron

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-Ray Physics in Confinement  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of Energy WorldwideX-RayX-RayX-Ray


X-ray Absorption Spectroscopy of Biologically Relevant Systems  

E-Print Network [OSTI]

308, Messer, B. M. X-ray Absorption Spectroscopy of AqueousSarcosine via X-ray Absorption Spectroscopy 5.1 Introductionwith Carboxylate by X-Ray Absorption Spectroscopy of Liquid

Uejio, Janel Sunayo



Theoretical standards in x-ray spectroscopies. Annual progress report, 1991--1992  

SciTech Connect (OSTI)

We propose to extend our state-of-the-art, ab initio XAFS (X-ray absorption fine structure) codes, FEFF. Our current work has been highly successful in achieving accurate, user-friendly XAFS standards, exceeding the performance of both tabulated standards and other codes by a considerable margin. We now propose to add the capability to treat more complex materials. This includes multiple-scattering, polarization dependence, an approximate treatment of XANES (x-ray absorption near edge structure), and other improvements. We also plan to adapt FEFF to other spectroscopies, e.g. photoelectron diffraction (PD) and diffraction anomalous fine structure (DAFS).

Not Available



Photosynthesis and structure of electroless Ni-P films by synchrotron x-ray irradiation  

SciTech Connect (OSTI)

The authors describe an electroless deposition method for thin films, based on the irradiation by an x-ray beam emitted by a synchrotron source. Specifically, Ni-P films were deposited at room temperature. This synthesis is a unique combination of photochemical and electrochemical processes. The influence of the pH value on the formation and structural properties of the films was examined by various characterization tools including scanning electron microscopy, x-ray diffraction, and x-ray absorption spectroscopy. Real time monitoring of the deposition process by coherent x-ray microscopy reveals that the formation of hydrogen bubbles leads to a self-catalysis effect without a preexisting catalyst. The mechanisms underlying the deposition process are discussed in details.

Hsu, P.-C.; Wang, C.-H.; Yang, T.-Y.; Hwu, Y.-K.; Lin, C.-S.; Chen, C.-H.; Chang, L.-W.; Seol, S.-K.; Je, J.-H.; Margaritondo, G. [Institute of Physics, Academia Sinica, NanKang, Taipei 115, Taiwan and Department of Materials Science and Engineering, National Taiwan University, Taipei 106, Taiwan (China); Institute of Physics, Academia Sinica, NanKang, Taipei 115, Taiwan (China); Institute of Physics, Academia Sinica, NanKang, Taipei 115, Taiwan (China); Department of Engineering and System Science, National Tsing Hua University, Hsinchu, 300, Taiwan (China) and Institute of Optoelectronic Sciences, National Taiwan Ocean University, Keelung 202, Taiwan (China); Department of Materials Science and Engineering, National Taiwan University, Taipei 106, Taiwan (China); Kinsus Interconnect Technology Co., Taoyuang 327, Taiwan (China); Department of Materials Science and Optoelectronic Engineering, National Sun Yat-Sen University, Kaoshung 804, Taiwan (China); X-ray Imaging Center, Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of) and Department of Materials Science and Engineering, Pohang University of Science and Technology, Pohang 790-784 (Korea); Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)



Time-domain sampling of x-ray pulses using an ultrafast sample response  

SciTech Connect (OSTI)

We employ the ultrafast response of a 15.4 nm thin SrRuO{sub 3} layer grown epitaxially on a SrTiO{sub 3} substrate to perform time-domain sampling of an x-ray pulse emitted from a synchrotron storage ring. Excitation of the sample with an ultrashort laser pulse triggers coherent expansion and compression waves in the thin layer, which turn the diffraction efficiency on and off at a fixed Bragg angle during 5 ps. This is significantly shorter than the duration of the synchrotron x-ray pulse of 100 ps. Cross-correlation measurements of the ultrafast sample response and the synchrotron x-ray pulse allow to reconstruct the x-ray pulse shape.

Gaal, P.; Shayduk, R. [Helmholtz-Zentrum Berlin fuer Materialien und Energie GmbH, Wilhelm-Conrad-Roentgen Campus, BESSY II, Albert-Einstein-Str. 15, 12489 Berlin (Germany); Schick, D.; Herzog, M.; Bojahr, A.; Goldshteyn, J.; Navirian, H. A.; Leitenberger, W. [Institut fuer Physik und Astronomie, Universitaet Potsdam, Karl-Liebknecht-Str. 24-25, 14476 Potsdam (Germany); Vrejoiu, I. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, 06120 Halle (Germany); Khakhulin, D.; Wulff, M. [European Synchrotron Radiation Facility (ESRF), 6 rue Jules Horowitz, 38000 Grenoble (France); Bargheer, M. [Helmholtz-Zentrum Berlin fuer Materialien und Energie GmbH, Wilhelm-Conrad-Roentgen Campus, BESSY II, Albert-Einstein-Str. 15, 12489 Berlin (Germany); Institut fuer Physik und Astronomie, Universitaet Potsdam, Karl-Liebknecht-Str. 24-25, 14476 Potsdam (Germany)



Small Angle X-Ray Scattering Detector  

DOE Patents [OSTI]

A detector for time-resolved small-angle x-ray scattering includes a nearly constant diameter, evacuated linear tube having an end plate detector with a first fluorescent screen and concentric rings of first fiber optic bundles for low angle scattering detection and an annular detector having a second fluorescent screen and second fiber optic bundles concentrically disposed about the tube for higher angle scattering detection. With the scattering source, i.e., the specimen under investigation, located outside of the evacuated tube on the tube's longitudinal axis, scattered x-rays are detected by the fiber optic bundles, to each of which is coupled a respective photodetector, to provide a measurement resolution, i.e., dq/q, where q is the momentum transferred from an incident x-ray to an x-ray scattering specimen, of 2% over two (2) orders of magnitude in reciprocal space, i.e., qmax/qmin approx=lO0.

Hessler, Jan P.



X-ray grid-detector apparatus  

DOE Patents [OSTI]

A hybrid grid-detector apparatus for x-ray systems wherein a microchannel plate structure has an air-interspaced grid portion and a phosphor/optical fluid-filled grid portion. The grids are defined by multiple adjacent channels separated by lead-glass septa. X-rays entering the air-interspaced grid portion at an angle of impingement upon the septa are attenuated, while non-impinging x-rays pass through to the phosphor/fluid filled portion. X-ray energy is converted to luminescent energy in the phosphor/fluid filled portion and the resultant beams of light are directed out of the phosphor/optical fluid filled portion to an imaging device.

Boone, John M. (Folsom, CA); Lane, Stephen M. (Oakland, CA)



X-ray source for mammography  

DOE Patents [OSTI]

An x-ray source utilizing anode material which shifts the output spectrum to higher energy and thereby obtains higher penetrating ability for screening mammography application, than the currently utilized anode material. The currently used anode material (molybdenum) produces an energy x-ray spectrum of 17.5/19.6 keV, which using the anode material of this invention (e.g. silver, rhodium, and tungsten) the x-ray spectrum would be in the 20-35 keV region. Thus, the anode material of this invention provides for imaging of breasts with higher than average x-ray opacity without increase of the radiation dose, and thus reduces the risk of induced breast cancer due to the radiation dose administered for mammograms.

Logan, Clinton M. (Pleasanton, CA)



X-ray induced optical reflectivity  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

The change in optical reflectivity induced by intense x-ray pulses can now be used to study ultrafast many body responses in solids in the femtosecond time domain. X-ray absorption creates photoelectrons and core level holes subsequently filled by Auger or fluorescence processes, and these excitations ultimately add conduction and valence band carriers that perturb optical reflectivity.Optical absorption associated with band filling and band gap narrowing is shown to explain the basic features found in recent measurements on an insulator (silicon nitride, Si3N4), a semiconductor(gallium arsenide,GaAs), and a metal (gold,Au), obtained with ?100 fs x-ray pulses at 500-2000 eV and probed with 800 nm laser pulses. In particular GaAs exhibits an abrupt drop in reflectivity, persisting only for a time comparable to the x-ray excitation pulse duration, consistent with prompt band gap narrowing.

Durbin, Stephen M.



Columbia University X-Ray Measurements  

E-Print Network [OSTI]

Columbia University X-Ray Measurements of the Levitated Dipole Experiment J. L. Ellsworth, J. Kesner MIT Plasma Science and Fusion Center D.T. Garnier, A.K. Hansen, M.E. Mauel Columbia University


X-Ray Nanoimaging: Instruments and Methods  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

X-Ray Nanoimaging: Instruments and Methods To be held as part of SPIE. http:spie.orgOP318 August 28-29, 2013; San Diego, California, USA...


X-ray source for mammography  

DOE Patents [OSTI]

An x-ray source is described utilizing anode material which shifts the output spectrum to higher energy and thereby obtains higher penetrating ability for screening mammography application, than the currently utilized anode material. The currently used anode material (molybdenum) produces an energy x-ray spectrum of 17.5/19.6 keV, which using the anode material of this invention (e.g. silver, rhodium, and tungsten) the x-ray spectrum would be in the 20-35 keV region. Thus, the anode material of this invention provides for imaging of breasts with higher than average x-ray opacity without increase of the radiation dose, and thus reduces the risk of induced breast cancer due to the radiation dose administered for mammograms. 6 figures.

Logan, C.M.



Hard X-ray Fluorescence Measurements of Heteroepitaxial Solid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hard X-ray Fluorescence Measurements of Heteroepitaxial Solid Oxide Fuel Cell Cathode Materials. Hard X-ray Fluorescence Measurements of Heteroepitaxial Solid Oxide Fuel Cell...


Using X-Ray Computed Tomography in Pore Structure Characterization...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Using X-Ray Computed Tomography in Pore Structure Characterization for a Berea Sandstone: Resolution Effect. Using X-Ray Computed Tomography in Pore Structure Characterization for...


Strains in Thermally Growing Alumina Films Measured in-situ usingSynchrotron X-rays  

SciTech Connect (OSTI)

Strains in thermally grown oxides have been measured in-situ, as the oxides develop and evolve. Extensive data have been acquired from oxides grown in air at elevated temperatures on different model alloys that form Al{sub 2}O{sub 3}. Using synchrotron x-rays at the Advanced Photon Source (Beamline 12BM, Argonne National Laboratory), Debye-Scherrer diffraction patterns from the oxidizing specimen were recorded every 5 minutes during oxidation and subsequent cooling. The diffraction patterns were analyzed to determine strains in the oxides, as well as phase changes and the degree of texture. To study a specimen's response to stress perturbation, the oxidizing temperature was quickly cooled from 1100 to 950 C to impose a compressive thermal stress in the scale. This paper describes this new experimental approach and gives examples from oxidized {beta}-NiAl, Fe-20Cr-10Al, Fe-28Al-5Cr and H{sub 2}-annealed Fe-28Al-5Cr (all at. %) alloys to illustrate some current understanding of the development and relaxation of growth stresses in Al{sub 2}O{sub 3}.

Hou, P.Y.; Paulikas, A.P.; Veal, B.W.



Correlated single-crystal electronic absorption spectroscopy and X-ray crystallography at NSLS beamline X26-C  

SciTech Connect (OSTI)

The research philosophy and new capabilities installed at NSLS beamline X26-C to support electronic absorption and Raman spectroscopies coupled with X-ray diffraction are reviewed. This beamline is dedicated full time to multidisciplinary studies with goals that include revealing the relationship between the electronic and atomic structures in macromolecules. The beamline instrumentation has been fully integrated such that optical absorption spectra and X-ray diffraction images are interlaced. Therefore, optical changes induced by X-ray exposure can be correlated with X-ray diffraction data collection. The installation of Raman spectroscopy into the beamline is also briefly reviewed. Data are now routinely generated almost simultaneously from three complementary types of experiments from the same sample. The beamline is available now to the NSLS general user population.

Orville, A.M.; Buono, R.; Cowan, M.; Heroux, A.; Shea-McCarthy, G.; Schneider, D. K.; Skinner, J. M.; Skinner, M. J.; Stoner-Ma, D.; Sweet, R. M.



Correlated Single-Crystal Electronic Absorption Spectroscopy and X-ray Crystallography at NSLS Beamline X26-C  

SciTech Connect (OSTI)

The research philosophy and new capabilities installed at NSLS beamline X26-C to support electronic absorption and Raman spectroscopies coupled with X-ray diffraction are reviewed. This beamline is dedicated full time to multidisciplinary studies with goals that include revealing the relationship between the electronic and atomic structures in macromolecules. The beamline instrumentation has been fully integrated such that optical absorption spectra and X-ray diffraction images are interlaced. Therefore, optical changes induced by X-ray exposure can be correlated with X-ray diffraction data collection. The installation of Raman spectroscopy into the beamline is also briefly reviewed. Data are now routinely generated almost simultaneously from three complementary types of experiments from the same sample. The beamline is available now to the NSLS general user population.

A Orville; R Buono; M Cowan; A Heroux; G Shea-McCarthy; D Schneider; J Skinner; M Skinner; D Stoner-Ma; R Sweet



Indus-2 X-ray lithography beamline for X-ray optics and material science applications  

SciTech Connect (OSTI)

X-ray lithography is an ideal technique by which high aspect ratio and high spatial resolution micro/nano structures are fabricated using X-rays from synchrotron radiation source. The technique has been used for fabricating optics (X-ray, visible and infrared), sensors and actuators, fluidics and photonics. A beamline for X-ray lithography is operational on Indus-2. The beamline offers wide lithographic window from 1-40keV photon energy and wide beam for producing microstructures in polymers upto size ?100mm 100mm. X-ray exposures are possible in air, vacuum and He gas environment. The air based exposures enables the X-ray irradiation of resist for lithography and also irradiation of biological and liquid samples.

Dhamgaye, V. P., E-mail: vishal@rrcat.gov.in; Lodha, G. S., E-mail: vishal@rrcat.gov.in [Indus Synchrotrons Utilisation Division, Raja Ramanna Centre for Advanced Technology, Indore-452013 (India)



X-ray views of neutron star low-mass X-ray binaries  

E-Print Network [OSTI]

A neutron star low-mass X-ray binary is a binary stellar system with a neutron star and a low-mass companion star rotating around each other. In this system the neutron star accretes mass from the companion, and as this matter falls into the deep potential well of the neutron star, the gravitational potential energy is released primarily in the X-ray wavelengths. Such a source was first discovered in X-rays in 1962, and this discovery formally gave birth to the "X-ray astronomy". In the subsequent decades, our knowledge of these sources has increased enormously by the observations with several X-ray space missions. Here we give a brief overview of our current understanding of the X-ray observational aspects of these systems.

Sudip Bhattacharyya



Fiber fed x-ray/gamma ray imaging apparatus  

DOE Patents [OSTI]

X-ray/gamma ray imaging apparatus is disclosed for detecting the position, energy, and intensity of x-ray/gamma ray radiation comprising scintillation means disposed in the path of such radiation and capable of generating photons in response to such radiation; first photodetection means optically bonded to the scintillation means and capable of generating an electrical signal indicative of the intensity, and energy of the radiation detected by the scintillation means; second photodetection means capable of generating an electrical signal indicative of the position of the radiation in the radiation pattern; and means for optically coupling the scintillation means to the second photodetection means. The photodetection means are electrically connected to control and storage means which may also be used to screen out noise by rejecting a signal from one photodetection means not synchronized to a signal from the other photodetection means; and also to screen out signals from scattered radiation. 6 figs.

Hailey, C.J.; Ziock, K.P.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fiber fed x-ray/gamma ray imaging apparatus  

DOE Patents [OSTI]

X-ray/gamma ray imaging apparatus is disclosed for detecting the position, energy, and intensity of x-ray/gamma ray radiation comprising scintillation means disposed in the path of such radiation and capable of generating photons in response to such radiation; first photodetection means optically bonded to the scintillation means and capable of generating an electrical signal indicative of the intensity, and energy of the radiation detected by the scintillation means; second photodetection means capable of generating an electrical signal indicative of the position of the radiation in the radiation pattern; and means for optically coupling the scintillation means to the second photodetection means. The photodetection means are electrically connected to control and storage means which may also be used to screen out noise by rejecting a signal from one photodetection means not synchronized to a signal from the other photodetection means; and also to screen out signals from scattered radiation.

Hailey, Charles J. (San Francisco, CA); Ziock, Klaus-Peter (Livermore, CA)



X-Ray Observations of Radio Galaxies  

E-Print Network [OSTI]

We review some of the ways that X-ray observations provide unique information on radio galaxies. Thermal bremsstrahlung X-ray emission provides detailed data on ambient densities and temperatures. These parameters in turn can be used for pressure balance calculations and can demonstrate how the ambient gas affects radio source structure. Additionally, many signatures of the interaction of radio jets and lobes with the hot gas are found in high resolution X-ray maps. Non-thermal X-ray emission from knots and hotspots of radio jets can give us constraints on the relativistic electron population for energies greater that that normally sampled in the radio (in the case of synchrotron emission) or can give us an independent estimate of the average magnetic field strength (if inverse Compton emission is the origin of the X-rays). From recent ROSAT HRI observations of 3C 390.3 and 3C 120, we show evidence that X-ray emission from knots and hotspots appears to be associated with regions of large gradients in the radio surface brightness; i.e. at the location of powerful shocks.

D. E. Harris



Compton backscattered collimated x-ray source  

DOE Patents [OSTI]

A high-intensity, inexpensive and collimated x-ray source is disclosed for applications such as x-ray lithography is disclosed. An intense pulse from a high power laser, stored in a high-finesse resonator, repetitively collides nearly head-on with and Compton backscatters off a bunched electron beam, having relatively low energy and circulating in a compact storage ring. Both the laser and the electron beams are tightly focused and matched at the interaction region inside the optical resonator. The laser-electron interaction not only gives rise to x-rays at the desired wavelength, but also cools and stabilizes the electrons against intrabeam scattering and Coulomb repulsion with each other in the storage ring. This cooling provides a compact, intense bunch of electrons suitable for many applications. In particular, a sufficient amount of x-rays can be generated by this device to make it an excellent and flexible Compton backscattered x-ray (CBX) source for high throughput x-ray lithography and many other applications. 4 figs.

Ruth, R.D.; Huang, Z.



Compton backscattered collmated X-ray source  

DOE Patents [OSTI]

A high-intensity, inexpensive and collimated x-ray source for applications such as x-ray lithography is disclosed. An intense pulse from a high power laser, stored in a high-finesse resonator, repetitively collides nearly head-on with and Compton backscatters off a bunched electron beam, having relatively low energy and circulating in a compact storage ring. Both the laser and the electron beams are tightly focused and matched at the interaction region inside the optical resonator. The laser-electron interaction not only gives rise to x-rays at the desired wavelength, but also cools and stabilizes the electrons against intrabeam scattering and Coulomb repulsion with each other in the storage ring. This cooling provides a compact, intense bunch of electrons suitable for many applications. In particular, a sufficient amount of x-rays can be generated by this device to make it an excellent and flexible Compton backscattered x-ray (CBX) source for high throughput x-ray lithography and many other applications.

Ruth, Ronald D. (Woodside, CA); Huang, Zhirong (Stanford, CA)



Compton backscattered collimated x-ray source  

DOE Patents [OSTI]

A high-intensity, inexpensive and collimated x-ray source for applications such as x-ray lithography is disclosed. An intense pulse from a high power laser, stored in a high-finesse resonator, repetitively collides nearly head-on with and Compton backscatters off a bunched electron beam, having relatively low energy and circulating in a compact storage ring. Both the laser and the electron beams are tightly focused and matched at the interaction region inside the optical resonator. The laser-electron interaction not only gives rise to x-rays at the desired wavelength, but also cools and stabilizes the electrons against intrabeam scattering and Coulomb repulsion with each other in the storage ring. This cooling provides a compact, intense bunch of electrons suitable for many applications. In particular, a sufficient amount of x-rays can be generated by this device to make it an excellent and flexible Compton backscattered x-ray (CBX) source for high throughput x-ray lithography and many other applications.

Ruth, Ronald D. (Woodside, CA); Huang, Zhirong (Stanford, CA)



Cryptotomography: reconstructing 3D Fourier intensities from randomly oriented single-shot diffraction patterns (CXIDB ID 9)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

These 2000 single-shot diffraction patterns include were either background-scattering only or hits (background-scattering plus diffraction signal from sub-micron ellipsoidal particles at random, undetermined orientations). Candidate hits were identified by eye, and the remainder were presumed as background. 54 usable, background-subtracted hits in this set (procedure in referenced article) were used to reconstruct the 3D diffraction intensities of the average ellipsoidal particle.

Loh, Ne-Te Duane


Neutron and X-Ray Studies of Advanced Materials V: CENTENNIAL  

SciTech Connect (OSTI)

In 2012 the diffraction community will celebrate 100 years since the prediction of X-ray diffraction by M. Laue, and following his suggestion the first beautiful diffraction experiment by W. Friedrich and P. Knipping. The significance of techniques based on the analysis of the diffraction of X-rays, neutrons, electrons and Mossbauer photons discovered later, has continued to increase in the past 100 years. The aim of this symposium is to provide a forum for discussion of using state-of-the-art neutron and X-ray scattering techniques for probing advanced materials. These techniques have been widely used to characterize materials structures across all length scales, from atomic to nano, meso, and macroscopic scales. With the development of sample environments, in-situ experiments, e.g., at temperatures and applied mechanical load, are becoming routine. The development of ultra-brilliant third-generation synchrotron X-ray sources, together with advances in X-ray optics, has created intense X-ray microbeams, which provide the best opportunities for in-depth understanding of mechanical behavior in a broad spectrum of materials. Important applications include ultra-sensitive elemental detection by X-ray fluorescence/absorption and microdiffraction to identify phase and strain with submicrometer spatial resolution. X-ray microdiffraction is a particularly exciting application compared with alternative probes of crystalline structure, orientation and strain. X-ray microdiffraction is non-destructive with good strain resolution, competitive or superior spatial resolution in thick samples, and with the ability to probe below the sample surface. Advances in neutron sources and instrumentation also bring new opportunities in neutron scattering research. In addition to characterizing the structures, neutrons are also a great tool for elucidating the dynamics of materials. Because neutrons are highly penetrating, neutrons have been used to map stress in engineering systems. Neutrons have also played a vital role in our understanding of the magnetism and magnetic properties. Specialized instruments have been built to gain physical insights of the fundamental mechanisms governing phase transformation and mechanical behaviors of materials. The application of those techniques, in combination with theoretical simulations and numerical modeling, will lead to major breakthroughs in materials science in the foreseeable future that will contribute to the development of materials technology and industrial innovation.

Spanos, George



X-ray Powder Diffraction (XPD) Scientific scope  

E-Print Network [OSTI]

elaborate/complex setups: large pressure cells, non-routine reaction chambers, combined spectrometry, gas Pressure cells Scintillation counters Si strip detector 120 2 range 0


Residual stress measurement using X-ray diffraction  

E-Print Network [OSTI]

difference can be measured. Magnetoacoustic emission is the generation of elastic waves caused by changes in magnetostrictive strain during the movement of magnetic domain walls and is generally detected from the material bulk. Barkhausen emission... when a material is subjected to a stress, the changes providing a measure of the stress averaged along the wave path. The acoustoelastic coefficients necessary for the analysis are usually calculated using calibration tests. Different types of wave...

Anderoglu, Osman



High Pressure X-Ray Diffraction Study of V. Siruguria,*  

E-Print Network [OSTI]

Place Jussieu, 75252 Paris Cedex 05, France Abstract Uranium manganese germanide, UMn2Ge2, crystallizes intermetallic UT2X2 compounds, where T is a 3d transition metal and X is either Ge or Si. The crystal structure



E-Print Network [OSTI]

expandability. The new technique broadens the computer simulation method eveloped by R. C. Reynolds and J. Hower

unknown authors


Diffraction-Limited Soft X-Ray Workshop  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesData FilesShape,Physics DiagnosticsMicrochips. |


X-Ray Diffraction Microscopy of Magnetic Structures  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of Energy Worldwide CarbonWrapI 1 0


X-Ray Diffraction Microscopy of Magnetic Structures  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of Energy Worldwide CarbonWrapI 1


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuelHelp Table of Welcome to


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuelHelp Table of Welcome


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuelHelp Table of WelcomeBiological


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuelHelp Table of


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuelHelp Table ofBiological Imaging


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuelHelp Table ofBiological

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Biological Imaging by Soft X-Ray Diffraction Microscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuelHelp Table


Self-terminating diffraction gates femtosecond X-ray nanocrystallography  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLas ConchasPassiveSubmitted forHighlights NuclearSelf-Supplied-Balancing-Reserves


Oscillations During Thermonuclear X-ray Bursts  

E-Print Network [OSTI]

High amplitude, nearly coherent X-ray brightness oscillations during thermonuclear X-ray bursts were discovered with the Rossi X-ray Timing Explorer (RXTE) in early 1996. Spectral and timing evidence strongly supports the conclusion that these oscillations are caused by rotational modulation of the burst emission and that they reveal the spin frequency of neutron stars in low mass X-ray binaries, a long sought goal of X-ray astronomy. Studies carried out over the past year have led to the discovery of burst oscillations in four new sources, bringing to ten the number with confirmed burst oscillations. I review the status of our knowledge of these oscillations and indicate how they can be used to probe the physics of neutron stars. For a few burst oscillation sources it has been proposed that the strongest and most ubiquitous frequency is actually the first overtone of the spin frequency and hence that two nearly antipodal hot spots are present on the neutron star. This inference has important implications for both the physics of thermonuclear burning as well as the mass- radius relation for neutron stars, so its confirmation is crucial. I discuss recent attempts to confirm this hypothesis for 4U 1636-53, the source for which a signal at the putative fundamental (290 Hz) has been claimed.

Tod E. Strohmayer



X-ray Pinhole Camera Measurements  

SciTech Connect (OSTI)

The development of the rod pinch diode [1] has led to high-resolution radiography for dynamic events such as explosive tests. Rod pinch diodes use a small diameter anode rod, which extends through the aperture of a cathode plate. Electrons borne off the aperture surface can self-insulate and pinch onto the tip of the rod, creating an intense, small x-ray source (Primary Pinch). This source has been utilized as the main diagnostic on numerous experiments that include high-value, single-shot events. In such applications there is an emphasis on machine reliability, x-ray reproducibility, and x-ray quality [2]. In tests with the baseline rod pinch diode, we have observed that an additional pinch (Secondary Pinch) occurs at the interface near the anode rod and the rod holder. This suggests that stray electrons exist that are not associated with the Primary Pinch. In this paper we present measurements on both pinches using an x-ray pinhole camera. The camera is placed downstream of the Primary Pinch at an angle of 60 with respect to the diode centerline. This diagnostic will be employed to diagnose x-ray reproducibility and quality. In addition, we will investigate the performance of hybrid diodes relating to the formation of the Primary and Secondary Pinches.

Nelson, D. S. [NSTec; Berninger, M. J. [NSTec; Flores, P. A. [NSTec; Good, D. E. [NSTec; Henderson, D. J. [NSTec; Hogge, K. W. [NSTec; Huber, S. R. [NSTec; Lutz, S. S. [NSTec; Mitchell, S. E. [NSTec; Howe, R. A. [NSTec; Mitton, C. V. [NSTec; Molina, I. [NSTec; Bozman, D. R. [SNL; Cordova, S. R. [SNL; Mitchell, D. R. [SNL; Oliver, B. V. [SNL; Ormond, E. C. [SNL



Nonlinear X-ray Compton Scattering  

E-Print Network [OSTI]

X-ray scattering is a weak linear probe of matter. It is primarily sensitive to the position of electrons and their momentum distribution. Elastic X-ray scattering forms the basis of atomic structural determination while inelastic Compton scattering is often used as a spectroscopic probe of both single-particle excitations and collective modes. X-ray free-electron lasers (XFELs) are unique tools for studying matter on its natural time and length scales due to their bright and coherent ultrashort pulses. However, in the focus of an XFEL the assumption of a weak linear probe breaks down, and nonlinear light-matter interactions can become ubiquitous. The field can be sufficiently high that even non-resonant multiphoton interactions at hard X-rays wavelengths become relevant. Here we report the observation of one of the most fundamental nonlinear X-ray-matter interactions, the simultaneous Compton scattering of two identical photons producing a single photon at nearly twice the photon energy. We measure scattered...

Fuchs, Matthias; Chen, Jian; Ghimire, Shambhu; Shwartz, Sharon; Kozina, Michael; Jiang, Mason; Henighan, Thomas; Bray, Crystal; Ndabashimiye, Georges; Bucksbaum, P H; Feng, Yiping; Herrmann, Sven; Carini, Gabriella; Pines, Jack; Hart, Philip; Kenney, Christopher; Guillet, Serge; Boutet, Sebastien; Williams, Garth; Messerschmidt, Marc; Seibert, Marvin; Moeller, Stefan; Hastings, Jerome B; Reis, David A



Ultrafast X-Ray Coherent Control  

SciTech Connect (OSTI)

This main purpose of this grant was to develop the nascent #12;eld of ultrafast x-ray science using accelerator-based sources, and originally developed from an idea that a laser could modulate the di#11;racting properties of a x-ray di#11;racting crystal on a fast enough time scale to switch out in time a shorter slice from the already short x-ray pulses from a synchrotron. The research was carried out primarily at the Advanced Photon Source (APS) sector 7 at Argonne National Laboratory and the Sub-Picosecond Pulse Source (SPPS) at SLAC; in anticipation of the Linac Coherent Light Source (LCLS) x-ray free electron laser that became operational in 2009 at SLAC (all National User Facilities operated by BES). The research centered on the generation, control and measurement of atomic-scale dynamics in atomic, molecular optical and condensed matter systems with temporal and spatial resolution . It helped develop the ultrafast physics, techniques and scienti#12;c case for using the unprecedented characteristics of the LCLS. The project has been very successful with results have been disseminated widely and in top journals, have been well cited in the #12;eld, and have laid the foundation for many experiments being performed on the LCLS, the world's #12;rst hard x-ray free electron laser.

Reis, David



Oscillations During Thermonuclear X-ray Bursts  

E-Print Network [OSTI]

High amplitude, nearly coherent X-ray brightness oscillations during thermonuclear X-ray bursts were discovered with the Rossi X-ray Timing Explorer (RXTE) in early 1996. Spectral and timing evidence strongly supports the conclusion that these oscillations are caused by rotational modulation of the burst emission and that they reveal the spin frequency of neutron stars in low mass X-ray binaries, a long sought goal of X-ray astronomy. Studies carried out over the past year have led to the discovery of burst oscillations in four new sources, bringing to ten the number with confirmed burst oscillations. I review the status of our knowledge of these oscillations and indicate how they can be used to probe the physics of neutron stars. For a few burst oscillation sources it has been proposed that the strongest and most ubiquitous frequency is actually the first overtone of the spin frequency and hence that two nearly antipodal hot spots are present on the neutron star. This inference has important implications for both the physics of thermonuclear burning as well as the mass - radius relation for neutron stars, so its confirmation is crucial. I discuss recent attempts to confirm this hypothesis for 4U 1636-53, the source for which a signal at the putative fundamental (290 Hz) has been claimed.

Tod E. Strohmayer



X-ray standing waves and surface EXAFS studies of electrochemical interfaces  

SciTech Connect (OSTI)

Because of their penetrative power, X-rays are ideally suited for in-situ studies of interfaces in general and solid/liquid interfaces in particular. The recent advent of powerful X-ray synchrotron sources has made experiments of this type feasible. Synchrotron sources offer a broad spectral range of polarized, highly collimated X-rays with intensities that are 10{sup 3}-10{sup 6} higher than those of conventional sources. Moreover, third-generation synchrotron sources, with their projected increase in brightness on the order of 10{sup 4}, will allow for new types of experiments, including the study of dynamic processes in real time. There are a number of X-ray-based surface-sensitive techniques that can be employed in the study of solid/liquid interfaces, including surface EXAFS, X-ray standing waves (XSW), grazing incidence X-ray diffraction (GIXD), and others. In this Account the authors focus on the use of XSW and surface EXAFS. The authors begin with a brief theoretical description followed by experimental aspects of these techniques. The authors then discuss specific examples with emphasis on the underpotential deposition of copper on platinum in the presence and absence of coadsorbates, the potential dependent distribution of interfacial species, and potential dependent structural changes of a redox-active self-assembling monolayer. 33 refs., 7 figs.

Abruna, H.D.; Bommarito, G.M.; Yee, H.S. [Cornell Univ., Ithaca, NY (United States)



Reflection soft X-ray microscope and method  

DOE Patents [OSTI]

A reflection soft X-ray microscope is provided by generating soft X-ray beams, condensing the X-ray beams to strike a surface of an object at a predetermined angle, and focusing the X-ray beams reflected from the surface onto a detector, for recording an image of the surface or near surface features of the object under observation.

Suckewer, Szymon (Princeton, NJ); Skinner, Charles H. (Lawrenceville, NJ); Rosser, Roy (Princeton, NJ)



Differential phase contrast X-ray imaging system and components  

DOE Patents [OSTI]

A differential phase contrast X-ray imaging system includes an X-ray illumination system, a beam splitter arranged in an optical path of the X-ray illumination system, and a detection system arranged in an optical path to detect X-rays after passing through the beam splitter.

Stutman, Daniel; Finkenthal, Michael



Apparatus for generating x-ray holograms  

DOE Patents [OSTI]

Apparatus for x-ray microholography of living biological materials. A Fourier transform holographic configuration is described as being most suitable for the 3-dimensional recording of the physical characteristics of biological specimens. The use of a spherical scatterer as a reference and a charge-coupled device two-dimensional detector array placed in the forward direction relative to the incident x-radiation for viewing electromagnetic radiation simultaneously scattered from both the specimen and the reference scatterer permits the ready reconstruction of the details of the specimen from the fringe pattern detected by the charge-coupled device. For example, by using a nickel reference scatter at 4.5 nm, sufficient reference illumination is provided over a wide enough angle to allow similar resolution in both transverse and longitudinal directions. Both laser and synchrotron radiation sources are feasible for generating microholographs. Operation in the water window (2.4 to 4.5 nm) should provide maximum contrast for features of the specimen and spatial resolution on the order of the wavelength of x-radiation should be possible in all three dimensions, which is sufficient for the visualization of many biological features. It is anticipated that the present apparatus will find utility in other areas as well where microscopic physical details of a specimen are important. A computational procedure which enables the holographic data collected by the detector to be used to correct for misalignments introduced by inexact knowledge of the relative positions of the spherical reference scatterer and the sample under investigation has been developed. If the correction is performed prior to reconstruction, full compensation can be achieved and a faithfully reconstructed image produced.

Rhodes, Charles K. (Chicago, IL); Boyer, Keith (Los Alamos, NM); Solem, Johndale C. (Los Alamos, NM); Haddad, Waleed S. (Chicago, IL)



Apparatus for generating x-ray holograms  

DOE Patents [OSTI]

Apparatus for x-ray microholography of living biological materials. A Fourier transform holographic configuration is described as being most suitable for the 3-dimensional recording of the physical characteristics of biological specimens. The use of a spherical scatterer as a reference and a charge-coupled device two-dimensional detector array placed in the forward direction relative to the incident x-radiation for viewing electromagnetic radiation simultaneously scattered from both the specimen and the reference scatterer permits the ready reconstruction of the details of the specimen from the fringe pattern detected by the charge-coupled device. For example, by using a nickel reference scatter at 4.5 nm, sufficient reference illumination is provided over a wide enough angle to allow similar resolution in both transverse and longitudinal directions. Both laser and synchrotron radiation sources are feasible for generating microholographs. Operation in the water window (2.4 to 4.5 nm) should provide maximum contrast for features of the specimen and spatial resolution on the order of the wavelength of x-radiation should be possible in all three dimensions, which is sufficient for the visualization of many biological features. It is anticipated that the present apparatus will find utility in other areas as well where microscopic physical details of a specimen are important. A computational procedure which enables the holographic data collected by the detector to be used to correct for misalignments introduced by inexact knowledge of the relative positions of the spherical reference scatterer and the sample under investigation has been developed. If the correction is performed prior to reconstruction, full compensation can be achieved and a faithfully reconstructed image produced. 7 figs.

Rhodes, C.K.; Boyer, K.; Solem, J.C.; Haddad, W.S.



X-RAY SPECTROMETRY X-Ray Spectrom. 2007; 36: 336342  

E-Print Network [OSTI]

, Chicago, IL 60637, USA 3 Cornell High Energy Synchrotron Source and School of Applied and EngineeringX-RAY SPECTROMETRY X-Ray Spectrom. 2007; 36: 336­342 Published online in Wiley InterScience (www to establish a breakthrough in high-resolution, simultaneous area mapping of multiple trace elements

Limburg, Karin E.


X-Ray Data from the X-Ray Data Booklet Online  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The original X-Ray Data Booklet, published in 1985, became a classic reference source. The online version has been significantly revised and updated to reflect today's science. Hundreds of pages of authoritative data provide the x-ray properties of elements, information on synchrotron radiation, scattering processes, optics and detectors, and other related calculations, formulas, and data tables.

Thompson, Albert C.; Attwood, David T.; Gullikson, Eric M.; Howells, Malcolm R.; Kortright, Jeffrey B.; Robinson, Arthur L.; Underwood, James H.; Kim, Kwang-Je; Kirz, Janos; Lindau, Ingolf; Pianetta, Piero; Winick, Herman; Williams, Gwyn P.; Scofield, James H.


Predicted X-ray backgrounds for the International X-ray Observatory  

E-Print Network [OSTI]

The background that will be observed by IXO's X-ray detectors naturally separates into two components: (1) a Cosmic X-ray Background (CXB), primarily due to unresolved point sources at high energies (E>2 keV), along with ...

Bautz, Marshall W.


X-ray reflectivity and surface roughness  

SciTech Connect (OSTI)

Since the advent of high brightness synchrotron radiation sources there has been a phenomenal growth in the use of x-rays as a probe of surface structure. The technique of x-ray reflectivity is particularly relevant to electrochemists since it is capable of probing the structure normal to an electrode surface in situ. In this paper the theoretical framework for x-ray reflectivity is reviewed and the results from previous non-electrochemistry measurements are summarized. These measurements are from the liquid/air interface (CCl/sub 4/), the metal crystal vacuum interface (Au(100)), and from the liquid/solid interface(liquid crystal/silicon). 34 refs., 5 figs.

Ocko, B.M.



X-ray variability in M87  

E-Print Network [OSTI]

We present the evidence for X-ray variability from the core and from knot A in the M87 jet based on data from two observations with the Einstein Observatory High Resolution Imager (HRI) and three observations with the ROSAT HRI. The core intensity showed a 16% increase in 17 months ('79-'80); a 12% increase in the 3 years '92 to '95; and a 17% drop in the last half of 1995. The intensity of knot A appears to have decreased by 16% between 92Jun and 95Dec. Although the core variability is consistent with general expectations for AGN nuclei, the changes in knot A provide constraints on the x-ray emission process and geometry. Thus we predict that the x-ray morphology of knot A will differ significantly from the radio and optical structure.

D. E. Harris; J. A. Biretta; W. Junor



Combined microstructure x-ray optics  

SciTech Connect (OSTI)

Multilayers are man-made microstructures which vary in depth and are now of sufficient quality to be used as x-ray, soft x-ray and extreme ultraviolet optics. Gratings are man-made in plane microstructures which have been used as optic elements for most of this century. Joining of these two optical microstructures to form combined microstructure optical microstructures to form combined microstructure optical elements has the potential for greatly enhancing both the throughput and the resolution attainable in these spectral ranges. The characteristics of these new optic elements will be presented and compared to experiment with emphasis on the unique properties of these combined microstructures. These results reported are general in nature and not limited to the soft x-ray or extreme ultraviolet spectral domains and also apply to neutrons. 19 refs., 7 figs., 4 tabs.

Barbee, T.W. Jr.



The X-ray/submillimetre link  

E-Print Network [OSTI]

It is widely believed that most of the cosmic X-ray background (XRB) is produced by a vast, hitherto undetected population of obscured AGN. Deep X-ray surveys with Chandra and XMM will soon test this hypothesis. Similarly, recent sub-mm surveys with SCUBA have revealed an analogous population of exceptionally luminous, dust-enshrouded {\\em star-forming} galaxies at high redshift. There is now growing evidence for an intimate link between these obscured populations. There are currently large uncertainties in the models, but several independent arguments lead to the conclusion that a significant fraction of the SCUBA sources ($10-30% $) will contain quasars. Recent observational studies of SCUBA survey sources appear to confirm these predictions, although the relative roles of AGN and star-forming activity in heating the dust are unclear. Forthcoming surveys combining X-ray and sub-mm observations will provide a very powerful tool for disentangling these processes.

O. Almaini



X-ray focal spot locating apparatus and method  

DOE Patents [OSTI]

An X-ray beam finder for locating a focal spot of an X-ray tube includes a mass of X-ray opaque material having first and second axially-aligned, parallel-opposed faces connected by a plurality of substantially identical parallel holes perpendicular to the faces and a film holder for holding X-ray sensitive film tightly against one face while the other face is placed in contact with the window of an X-ray head.

Gilbert, Hubert W. (Cedar Crest, NM)


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


High resolution biomedical imaging system with direct detection of x-rays via a charge coupled device  

DOE Patents [OSTI]

An imaging system is provided for direct detection of x-rays from an irradiated biological tissue. The imaging system includes an energy source for emitting x-rays toward the biological tissue and a charge coupled device (CCD) located immediately adjacent the biological tissue and arranged transverse to the direction of irradiation along which the x-rays travel. The CCD directly receives and detects the x-rays after passing through the biological tissue. The CCD is divided into a matrix of cells, each of which individually stores a count of x-rays directly detected by the cell. The imaging system further includes a pattern generator electrically coupled to the CCD for reading a count from each cell. A display device is provided for displaying an image representative of the count read by the pattern generator from the cells of the CCD. 13 figs.

Atac, M.; McKay, T.A.



High resolution biomedical imaging system with direct detection of x-rays via a charge coupled device  

DOE Patents [OSTI]

An imaging system is provided for direct detection of x-rays from an irradiated biological tissue. The imaging system includes an energy source for emitting x-rays toward the biological tissue and a charge coupled device (CCD) located immediately adjacent the biological tissue and arranged transverse to the direction of irradiation along which the x-rays travel. The CCD directly receives and detects the x-rays after passing through the biological tissue. The CCD is divided into a matrix of cells, each of which individually stores a count of x-rays directly detected by the cell. The imaging system further includes a pattern generator electrically coupled to the CCD for reading a count from each cell. A display device is provided for displaying an image representative of the count read by the pattern generator from the cells of the CCD.

Atac, Muzaffer (Wheaton, IL); McKay, Timothy A. (Ann Arbor, MI)



Energy resolved X-ray grating interferometry  

SciTech Connect (OSTI)

Although compatible with polychromatic radiation, the sensitivity in X-ray phase contrast imaging with a grating interferometer is strongly dependent on the X-ray spectrum. We used an energy resolving detector to quantitatively investigate the dependency of the noise from the spectral bandwidth and to consequently optimize the system-by selecting the best energy band matching the experimental conditions-with respect to sensitivity maximization and, eventually, dose. Further, since theoretical calculations of the spectrum are usually limited due to non-ideal conditions, an energy resolving detector accurately quantifies the spectral changes induced by the interferometer including flux reduction and beam hardening.

Thuering, T.; Stampanoni, M. [Swiss Light Source, Paul Scherrer Institut, Villigen PSI (Switzerland) [Swiss Light Source, Paul Scherrer Institut, Villigen PSI (Switzerland); Institute for Biomedical Engineering, Swiss Federal Institute of Technology, Zurich (Switzerland); Barber, W. C.; Iwanczyk, J. S. [DxRay, Inc., Northridge, California 91324 (United States)] [DxRay, Inc., Northridge, California 91324 (United States); Seo, Y.; Alhassen, F. [UCSF Physics Research Laboratory, Department of Radiology and Biomedical Imaging, University of California, San Francisco, California 94143 (United States)] [UCSF Physics Research Laboratory, Department of Radiology and Biomedical Imaging, University of California, San Francisco, California 94143 (United States)



Radiobiological studies using gamma and x rays.  

SciTech Connect (OSTI)

There are approximately 500 self-shielded research irradiators used in various facilities throughout the U.S. These facilities use radioactive sources containing either 137Cs or 60Co for a variety of biological investigations. A report from the National Academy of Sciences[1] described the issues with security of particular radiation sources and the desire for their replacement. The participants in this effort prepared two peer-reviewed publications to document the results of radiobiological studies performed using photons from 320-kV x rays and 137Cs on cell cultures and mice. The effectiveness of X rays was shown to vary with cell type.

Potter, Charles Augustus; Longley, Susan W.; Scott, Bobby R. [Lovelace Respiratory Research Institute, Albuquerque, NM; Lin, Yong [Lovelace Respiratory Research Institute, Albuquerque, NM; Wilder, Julie [Lovelace Respiratory Research Institute, Albuquerque, NM; Hutt, Julie A. [Lovelace Respiratory Research Institute, Albuquerque, NM; Padilla, Mabel T. [Lovelace Respiratory Research Institute, Albuquerque, NM; Gott, Katherine M. [Lovelace Respiratory Research Institute, Albuquerque, NM



Time-resolved x-ray diagnostics  

SciTech Connect (OSTI)

Techniques for time-resolved x-ray diagnostics will be reviewed with emphasis on systems utilizing x-ray diodes or scintillators. System design concerns for high-bandwidth (> 1 GHz) diagnostics will be emphasized. The limitations of a coaxial cable system and a technique for equalizing to improve bandwidth of such a system will be reviewed. Characteristics of new multi-GHz amplifiers will be presented. An example of a complete operational system on the Los Alamos Helios laser will be presented which has a bandwidth near 3 GHz over 38 m of coax. The system includes the cable, an amplifier, an oscilloscope, and a digital camera readout.

Lyons, P.B.



Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces and Interfaces Sample6, 2011 LawrenceE C H NLensless X-RayLensless X-Ray


X-Ray Nanoimaging: Instruments and Methods  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL Home SRNL main campusMore thanX-Ray Imaging ofX-Ray


X-ray Computed Tomography | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL Home SRNL main campusMore thanX-Ray ImagingfeedX-ray


Hexakis(4-phormylphenoxy)cyclotriphosphazene: X-ray and DFT-calculated structures  

SciTech Connect (OSTI)

The crystal structure of hexakis(4-phormylphenoxy)cyclotriphosphazene is determined by using X-ray diffraction and then the molecular structure is investigated with density functional theory (DFT). X-Ray study shows that the title compound has C-H-{pi} interaction with phosphazene ring. The molecules in the unit cell are packed with Van der Waals and dipole-dipole interactions and the molecules are packed in zigzag shaped. Optimized molecular geometry is calculated with DFT at B3LYP/6-311G(d,p) level. The results from both experimental and theoretical calculations are compared in this study.

Albayrak, Cigdem, E-mail: calbayrak@sinop.edu.tr; Kosar, Basak [Sinop University, Faculty of Education (Turkey); Odabasoglu, Mustafa [Pamukkale University, Chemical Technology Program (Turkey); Bueyuekguengoer, Orhan [Ondokuz Mayis University, Faculty of Arts and Sciences (Turkey)



High-energy x-ray diffractometer for nondestructive strain depth profile measurement  

SciTech Connect (OSTI)

We describe a lab-based high-energy x-ray diffraction system and a new approach to nondestructively measuring strain profiles in polycrystalline samples. This technique utilizes the tungsten K{sub ?1} characteristic radiation from a standard industrial x-ray tube. We introduce a simulation model that is used to determine strain values from data collected with this system. Examples of depth profiling are shown for shot peened aluminum and titanium samples. Profiles to 1 mm depth in aluminum and 300 ?m depth in titanium with a depth resolution of 20 ?m are presented.

Al-Shorman, M. Y. [Department of Physics, Yarmouk University, 21163 Irbid (Jordan)] [Department of Physics, Yarmouk University, 21163 Irbid (Jordan); Jensen, T. C.; Gray, J. N. [Center for Nondestructive Evaluation, Iowa State University, Ames, Iowa 50011 (United States)] [Center for Nondestructive Evaluation, Iowa State University, Ames, Iowa 50011 (United States)



A new procedure for static RAM evaluation under x-ray pulses  

SciTech Connect (OSTI)

An original method, to identify the initial patterns that are the most favorable to obtain upsets under X-ray pulses, has been developed on Static RAMs in the standby mode. The results obtained with these initial patterns are interesting in order to analyze the radiation induced failures.

Marec, R.; Gaillard, R. (Nucletudes S.A., Les Ulis (France)); Mary, P.; Fairbank, X. (LRBA, Vernon (France)); Ferrant, R. (Thomson-CSF Semiconducteurs Specifiques, Saint Egreve (France)); Palau, J.M.; Gasiot, J. (Univ. Montpellier (France). Centre Electronique de Montpellier)



Atomic Resolution Coherent Diffractive Imaging and Ultrafast Science  

SciTech Connect (OSTI)

A major scientific challenge is determining the 3-D atomic structure of small nanostructures, including single molecules. Coherent diffractive imaging (CDI) is a promising approach. Recent progress has demonstrated coherent diffraction patterns can be recorded from individual nanostructures and phased to reconstruct their structure. However, overcoming the dose limit imposed by radiation damage is a major obstacle toward the full potential of CDI. One approach is to use ultrafast x-ray or electron pulses. In electron diffraction, amplitudes recorded in a diffraction pattern are unperturbed by lens aberrations, defocus, and other microscope resolution-limiting factors. Sub-A signals are available beyond the information limit of direct imaging. Significant contrast improvement is obtained compared to high-resolution electron micrographs. progress has also been made in developing time-resolved electron diffraction and imaging for the study of ultrafast dynamic processes in materials. This talk will cover these crosscutting issues and the convergence of electron and x-ray diffraction techniques toward structure determination of single molecules.

Zuo, Jian-min (University of Illinois) [University of Illinois



Small Angle X-Ray Scattering Detector  

DOE Patents [OSTI]

A detector for time-resolved small-angle x-ray scattering includes a nearly constant diameter, evacuated linear tube having an end plate detector with a first fluorescent screen and concentric rings of first fiber optic bundles for low angle scattering detection and an annular detector having a second fluorescent screen and second fiber optic bundles concentrically disposed about the tube for higher angle scattering detection. With the scattering source, i.e., the specimen under investigation, located outside of the evacuated tube on the tube's longitudinal axis, scattered x-rays are detected by the fiber optic bundles, to each of which is coupled a respective photodetector, to provide a measurement resolution, i.e., dq/q, where q is the momentum transferred from an incident x-ray to an x-ray scattering specimen, of 2% over two (2) orders of magnitude in reciprocal space, i.e., q.sub.max /q.sub.min.congruent.100.

Hessler, Jan P. (Downers Grove, IL)



SLAC All Access: X-ray Microscope  

ScienceCinema (OSTI)

SLAC physicists Johanna Nelson and Yijin Liu give a brief overview of the X-ray microscope at the Stanford Synchrotron Radiation Lightsource (SSRL) that is helping improve rechargeable-battery technology by letting researchers peek into the inner workings of batteries as they operate.

Nelson, Johanna; Liu, Yijin



X-ray spectroscopy of manganese clusters  

SciTech Connect (OSTI)

Much of this thesis represents the groundwork necessary in order to probe Mn clusters more productively than with conventional Mn K-edge XAS and is presented in Part 1. Part 2 contains the application of x-ray techniques to Mn metalloproteins and includes a prognosis at the end of each chapter. Individual Mn oxidation states are more readily distinguishable in Mn L-edge spectra. An empirical mixed valence simulation routine for determining the average Mn oxidation state has been developed. The first Mn L-edge spectra of a metalloprotein were measured and interpreted. The energy of Mn K{beta} emission is strongly correlated with average Mn oxidation state. K{beta} results support oxidation states of Mn(III){sub 2}(IV){sub 2} for the S{sub 1} state of Photosystem II chemical chemically reduced preparations contain predominantly Mn(II). A strength and limitation of XAS is that it probes all of the species of a particular element in a sample. It would often be advantageous to selectively probe different forms of the same element. The first demonstration that chemical shifts in x-ray fluorescence energies can be used to obtain oxidation state-selective x-ray absorption spectra is presented. Spin-dependent spectra can also be used to obtain a more simplified picture of local structure. The first spin-polarized extended x-ray absorption fine structure using Mn K{beta} fluorescence detection is shown.

Grush, M.M. [Univ. of California, Davis, CA (United States). Dept. of Applied Science; [Lawrence Berkeley National Lab., CA (United States). Energy and Environment Div.



Multiple wavelength X-ray monochromators  

DOE Patents [OSTI]

An improved apparatus and method is provided for separating input x-ray radiation containing first and second x-ray wavelengths into spatially separate first and second output radiation which contain the first and second x-ray wavelengths, respectively. The apparatus includes a crystalline diffractor which includes a first set of parallel crystal planes, where each of the planes is spaced a predetermined first distance from one another. The crystalline diffractor also includes a second set of parallel crystal planes inclined at an angle with respect to the first set of crystal planes where each of the planes of the second set of parallel crystal planes is spaced a predetermined second distance from one another. In one embodiment, the crystalline diffractor is comprised of a single crystal. In a second embodiment, the crystalline diffractor is comprised of a stack of two crystals. In a third embodiment, the crystalline diffractor includes a single crystal that is bent for focusing the separate first and second output x-ray radiation wavelengths into separate focal points. 3 figs.

Steinmeyer, P.A.



Catalog of supersoft X-ray sources  

E-Print Network [OSTI]

This catalog comprises an up-to-date (December 1999) list of luminous (>10^36 erg/s), binary supersoft X-ray sources. This electronic version (including the accompannying Web-pages) supersedes the printed version of Greiner (1996).

J. Greiner



Workshops on Science Enabled by a Coherent, CW, Synchrotron X-ray Source, June 2011  

SciTech Connect (OSTI)

In June of 2011 we held six two-day workshops called "XDL-2011: Science at the Hard X-ray Diffraction Limit". The six workshops covered (1) Diffraction-based imaging techniques, (2) Biomolecular structure from non-crystalline materials, (3) Ultra-fast science, (4) High-pressure science, (5) Materials research with nano-beams and (6) X-ray photon correlation spectroscopy (XPCS), In each workshop, invited speaker from around the world presented examples of novel experiments that require a CW, diffraction-limited source. During the workshop, each invited speaker provided a one-page description of the experiment and an illustrative graphic. The experiments identified by the workshops demonstrate the broad and deep scientific case for a CW coherent synchrotron x-ray source. The next step is to perform detailed simulations of the best of these ideas to test them quantitatively and to guide detailed x-ray beam-line designs. These designs are the first step toward developing detailed facility designs and cost estimates.

Brock, Joel



X-ray and synchrotron studies of porous silicon  

SciTech Connect (OSTI)

The results of comprehensive studies of layers of porous silicon of different conductivity types, grown by anodizing standard Si(111) substrates in an electrolyte based on fluoric acid and ethanol with the addition of 5% of iodine and kept in air for a long time, are discussed. Measurements are performed by scanning electron microscopy, high-resolution X-ray diffraction, and ultrasoft X-ray spectroscopy using synchrotron radiation. The structural parameters of the layers (thickness, strain, and porosity) and atomic and chemical composition of the porous-silicon surface are determined. It is found that an oxide layer 1.5-2.3-nm thick is formed on the surface of the silicon skeleton. The near-edge fine structure of the Si 2p absorption spectrum of this layer corresponds to the fine structure of the 2p spectrum of well coordinated SiO{sub 2}. In this case, the fine structure in the Si 2p-edge absorption region of the silicon skeleton is identical to that of the 2p absorption spectrum of crystalline silicon.

Sivkov, V. N., E-mail: svn@dm.komisc.ru [Russian Academy of Sciences, Komi Scientific Center, Ural Branch (Russian Federation); Lomov, A. A. [Russian Academy of Sciences, Physical-Technological Institute (Russian Federation)] [Russian Academy of Sciences, Physical-Technological Institute (Russian Federation); Vasil'ev, A. L. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)] [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Nekipelov, S. V. [Komi State Pedagogical Institute (Russian Federation)] [Komi State Pedagogical Institute (Russian Federation); Petrova, O. V. [Russian Academy of Sciences, Komi Scientific Center, Ural Branch (Russian Federation)] [Russian Academy of Sciences, Komi Scientific Center, Ural Branch (Russian Federation)



X-ray microscopy using grazing-incidence reflections optics  

SciTech Connect (OSTI)

The role of Kirkpatrick-Baez microscopes as the workhorse of the x-ray imaging devices is discussed. This role is being extended with the development of a 22X magnification Kirkpatrick-Baez x-ray microscope with multilayer x-ray mirrors. These mirrors can operate at large angles, high x-ray energies, and have a narrow, well defined x-ray energy bandpass. This will make them useful for numerous experiments. However, where a large solid angle is needed, the Woelter microscope will still be necessary and the technology needed to build them will be useful for many other types of x-ray optics.

Price, R.H.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


X-ray microscopy using grazing-incidence reflection optics  

SciTech Connect (OSTI)

The Kirkpatrick-Baez microscopes are described along with their role as the workhorse of the x-ray imaging devices. This role is being extended with the development of a 22X magnification Kirkpatrick-Baez x-ray microscope with multilayer x-ray mirrors. These mirrors can operate at large angles, high x-ray energies, and have a narrow, well defined x-ray energy bandpass. This will make them useful for numerous experiments. However, where a large solid angle is needed, the Woelter microscope will still be necessary and the technology needed to build them will be useful for many other types of x-ray optics.

Price, R.H.



Rise Time Measurement for Ultrafast X-Ray Pulses  

DOE Patents [OSTI]

A pump-probe scheme measures the rise time of ultrafast x-ray pulses. Conventional high speed x-ray diagnostics (x-ray streak cameras, PIN diodes, diamond PCD devices) do not provide sufficient time resolution to resolve rise times of x-ray pulses on the order of 50 fs or less as they are being produced by modern fast x-ray sources. Here, we are describing a pump-probe technique that can be employed to measure events where detector resolution is insufficient to resolve the event. The scheme utilizes a diamond plate as an x-ray transducer and a p-polarized probe beam.

Celliers, Peter M.; Weber, Franz A.; Moon, Stephen J.



Rise time measurement for ultrafast X-ray pulses  

DOE Patents [OSTI]

A pump-probe scheme measures the rise time of ultrafast x-ray pulses. Conventional high speed x-ray diagnostics (x-ray streak cameras, PIN diodes, diamond PCD devices) do not provide sufficient time resolution to resolve rise times of x-ray pulses on the order of 50 fs or less as they are being produced by modern fast x-ray sources. Here, we are describing a pump-probe technique that can be employed to measure events where detector resolution is insufficient to resolve the event. The scheme utilizes a diamond plate as an x-ray transducer and a p-polarized probe beam.

Celliers, Peter M. (Berkeley, CA); Weber, Franz A. (Oakland, CA); Moon, Stephen J. (Tracy, CA)



Possibility of corrector plate tuning of x-ray focusing  

SciTech Connect (OSTI)

Schemes for focusing a hard x-ray beam to a small spot are described. The theoretical minimum spot size, assuming perfect mirror shape, is shown to be 4 nm FWHM, independent of x-ray wavelength. This is less than the 10 nm previously said to be the minimum achievable diffraction-limited x-ray spot size. While providing the penetrating power only possible with x rays, this approaches the resolution needed to image individual atoms or atomic layers. However, the perfect mirror assumption is physically unrealistic. This paper discusses the compensation of mirror shape errors by a corrector plate and shows that the tolerances for corrector plate shape are far looser than are tolerances for mirror shape. The full eventual success of achieving theoretical minimum resolution will require mirror shape precision considerably better than has been achieved at this time, though far looser than would be required for simpleminded paraboloidal focusing. Two variants of the scheme, subject to the same mathematical treatment, are described. (i) The ''corrector plate'' name is copied from the similarly functioning element of the same name in a Schmidt camera. The focusing is achieved using glancing, yet coherent, reflection from a high-Z paraboloidal mirror. The strategy is to obtain dominant focusing from reflection and to compensate with weak refractive focusing. The reflective focusing is strong and achromatic but insufficiently accurate. The refractive focusing is weak and chromatic but highly accurate. The corrector plate improves resolution the way eyeglasses help a person to see. It can, for example, be ''fitted'' the same trial-and-error way an optometrist establishes a prescription for glasses. Dimensional tolerances for the compensator are far looser than would be needed for a mirror to achieve the same resolution. Unlike compound refractive lenses, attenuation will be small, at least for wavelengths longer than 1 A, because the compensation layer is thin. (ii) For this variant, the corrector plate is a washer-shaped refractive or Fresnel lens, and the mirror is (theoretically) a perfect cone. All focusing is provided by the lens. Even though the cone provides no focusing, it improves the resolution by increasing the numerical aperture of the device. Compared to a paraboloidal shape, it is assumed that the conical shape can be more accurately fabricated. Of the two variants, only the first variant is, in principle, capable of achieving the theoretical minimum resolution. Configurations are suggested, in both case (i) and case (ii), that use currently possible construction precisions to produce resolutions better than have been achieved to date. However, both results will remain well above the theoretical minimum until fabrication techniques have been developed that provide greater precision than is possible at this time.

Talman, Richard




SciTech Connect (OSTI)

Apparently diffuse X-ray emission has been known to exist along the central quarter of the Galactic Plane since the beginning of X-ray astronomy; this is referred to as the Galactic Ridge X-ray emission (GRXE). Recent deep X-ray observations have shown that numerous X-ray point sources account for a large fraction of the GRXE in the hard band (2-8 keV). However, the nature of these sources is poorly understood. Using the deepest X-ray observations made in the Chandra bulge field, we present the result of a coherent photometric and spectroscopic analysis of individual X-ray point sources for the purpose of constraining their nature and deriving their fractional contributions to the hard-band continuum and Fe K line emission of the GRXE. Based on the X-ray color-color diagram, we divided the point sources into three groups: A (hard), B (soft and broad spectrum), and C (soft and peaked spectrum). The group A sources are further decomposed spectrally into thermal and non-thermal sources with different fractions in different flux ranges. From their X-ray properties, we speculate that the group A non-thermal sources are mostly active galactic nuclei and the thermal sources are mostly white dwarf (WD) binaries such as magnetic and non-magnetic cataclysmic variables (CVs), pre-CVs, and symbiotic stars, whereas the group B and C sources are X-ray active stars in flares and quiescence, respectively. In the log N-log S curve of the 2-8 keV band, the group A non-thermal sources are dominant above Almost-Equal-To 10{sup -14} erg cm{sup -2} s{sup -1}, which is gradually taken over by Galactic sources in the fainter flux ranges. The Fe K{alpha} emission is mostly from the group A thermal (WD binaries) and the group B (X-ray active stars) sources.

Morihana, Kumiko [Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)] [Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Tsujimoto, Masahiro; Ebisawa, Ken [Japan Aerospace Exploration Agency, Institute of Space and Astronautical Science, 3-1-1 Yoshino-dai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan)] [Japan Aerospace Exploration Agency, Institute of Space and Astronautical Science, 3-1-1 Yoshino-dai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Yoshida, Tessei, E-mail: morihana@crab.riken.jp [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan)] [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan)



Brighter Screens for Nondestructive Digital X-ray Radiography  

SciTech Connect (OSTI)

Fine resolution, bright X-ray screens are needed for digital radiography and material characterization at the Y-12 National Security Complex (Y-12). Current technology is simply not adequate for transferring high-energy X-ray images to visible light for demanding digital applications. Low energy radiography and especially emerging tomographic technologies are severely hampered for Y-12 nondestructive evaluation (NDE) applications by dim screens with poor resolution. Also, the development of more advanced materials characterization techniques, such as electron backscatter diffraction (EBSD), is driven by a design agency desire for tighter specifications and more uniform materials. Brighter screens would allow us to probe materials on a finer scale, leading to a better understanding of material behavior. A number of X-ray screen materials were studied that would be suitable for direct replacement in existing digital imaging systems. Spectroscopic evaluations were first made for a several candidates and indicated that lutetium orthosilicate (LSO) would be a promising candidate for MeV images. A relative comparison of brightness at various energies was then completed which showed that cesium iodide (CsI) could increase brightness by over an order of magnitude. Since image quality is also important for better screens, the resolving capabilities of candidate materials were measured. Resolution measurements were completed at X-ray peak energies up to 420KeV with magnified optical imaging systems, and indicated that LSO and Industrial Quality Incorporated glass (IQI) exhibited higher resolution than the CsI screen. The results give a choice of materials that can be tailored to the particular test under consideration. If high-speed images are necessary and some resolution can be sacrificed, the CsI screen will be a good choice. The screen can be replaced by an IQI or LSO unit if higher resolution is needed later, for instance to focus in on a region of interest. A number of significant findings were obtained from this study. Most important of the findings was that materials are commercially available that are much brighter than screens currently in use. This finding meets the original objective of the project. Two objectives of the study; however, were not met. We hoped to evaluate a 'quantum dot' (nanometer-sized particles of semiconductor material) wavelength conversion screen, but the manufacturer ceased production of the screen shortly before the project was started. The dot screen could be efficient in converting ultraviolet light to visible light which would have proved important for utilizing a Cherenkov screen. Since this was a very new, cutting-edge technology, an alternative supplier was not found during the study. Also, high-energy testing of a Cherenkov light screen was not performed due to difficulties in obtaining appropriate approvals for locating test equipment in the high-energy X-ray vault at Y-12. The test is still important, and is being pursued through follow-on funding sources. Although many film shots will be eliminated by the availability of high quality digital images, the largest potential gains result from the availability of clearer images that show fine detail in the parts under analysis. Digital radiographic data also offers the possibility of easily sharing data with other sites. This could prove invaluable when critical material, placement, assembly, or quality issues are pressing. Also, increased throughput in the NDE facility allows statistically significant numbers of units to be analyzed. Digital technologies may in fact be needed just to meet minimum requirements of future demands. Increased brightness screens allow for such innovations as 3-D tomographic images to be acquired in a reasonable time. Much of the skill required to interpret 'flattened' X-ray images is not needed to maneuver around the reconstructed tomogram. This study showed that several commercially available materials are much brighter than screens currently in use. The study also showed that materials othe

Miller, Jr., A. C.; Bell, Z. W.; Carpenter, D. A.



High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

SciTech Connect (OSTI)

The application of high-resolution X-ray spectroscopy methods to study the photosynthetic water oxidizing complex, which contains a unique hetero-nuclear catalytic Mn4Ca cluster, are described. Issues of X-ray damage especially at the metal sites in the Mn4Ca cluster are discussed. The structure of the Mn4Ca catalyst at high-resolution which has so far eluded attempts of determination by X-ray diffraction, EXAFS and other spectroscopic techniques has been addressed using polarized EXAFS techniques applied to oriented PS II membrane preparations and PS II single crystals. A review of how the resolution of traditional EXAFS techniques can be improved, using methods such as range-extended EXAFS is presented, and the changes that occur in the structure of the cluster as it advances through the catalytic cycle are described. X-ray absorption and emission techniques (XANES and K? emission) have been used earlier to determine the oxidation states of the Mn4Ca cluster, and in this report we review the use of X-ray resonant Raman spectroscopy to understand the electronic structure of the Mn4Ca cluster as it cycles through the intermediate S-states.

Yachandra, Vittal; Yano, Junko; Kern, Jan; Pushkar, Yulia; Sauer, Kenneth; Glatzel, Pieter; Bergmann, Uwe; Messinger, Johannes; Zouni, Athina; Yachandra, Vittal K.



High resolution x-ray microscope  

SciTech Connect (OSTI)

The authors present x-ray images of grid meshes and biological material obtained using a microspot x-ray tube with a multilayer optic and a 92-element parabolic compound refractive lens (CRL) made of a plastic containing only hydrogen and carbon. Images obtained using this apparatus are compared with those using an area source with a spherical lens and a spherical lens with multilayer condenser. The authors found the best image quality using the multilayer condenser with a parabolic lens, compared to images with a spherical lens and without the multilayer optics. The resolution was measured using a 155-element parabolic CRL and a multilayer condenser with the microspot tube. The experiment demonstrates about 1.1 {mu}m resolution.

Gary, C. K.; Park, H.; Lombardo, L. W.; Piestrup, M. A.; Cremer, J. T.; Pantell, R. H.; Dudchik, Y. I. [Adelphi Technology, Inc. 981-B Industrial Road, San Carlos, California 94070 (United States); Department of Electrical Engineering, Stanford University, Stanford, California 94305 (United States); Institute of Applied Physics Problems, Kurchatova 7, Minsk 220064 (Belarus)



X-ray radiography for container inspection  

DOE Patents [OSTI]

Arrangements of X-ray inspection systems are described for inspecting high-z materials in voluminous objects such as containers. Inspection methods may involve generating a radiographic image based on detected attenuation corresponding to a pulsed beams of radiation transmitted through a voluminous object. The pulsed beams of radiation are generated by a high-energy source and transmitted substantially downward along an incident angle, of approximately 1.degree. to 30.degree., to a vertical axis extending through the voluminous object. The generated radiographic image may be analyzed to detect on localized high attenuation representative of high-z materials and to discriminate high-z materials from lower and intermediate-z materials on the basis of the high density and greater attenuation of high-z material for higher energy (3-10 MeV) X-rays, and the compact nature of threatening masses of fissionable materials.

Katz, Jonathan I. (Clayton, MO); Morris, Christopher L. (Los Alamos, NM)



The X-ray Microcalorimeter Spectrometer onboard of IXO  

E-Print Network [OSTI]

One of the instruments on the International X-ray Observatory (IXO), under study with NASA, ESA and JAXA, is the X-ray Microcalorimeter Spectrometer (XMS). This instrument, which will provide high spectral resolution images, ...

Figueroa-Feliciano, Enectali


Resonant Soft X-Ray Scattering - Combining Structural with Spectroscop...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Resonant Soft X-Ray Scattering - Combining Structural with Spectroscopic Refinement Friday, September 28, 2012 - 10:00am SLAC, Bldg. 137, Room 322 SSRL Presents Kevin Stone X-ray...


Sample holder for X-ray diffractometry  

DOE Patents [OSTI]

A sample holder for use with X-ray diffractometers with the capability to rotate the sample, as well as to adjust the position of the sample in the x, y, and z directions. Adjustment in the x direction is accomplished through loosening set screws, moving a platform, and retightening the set screws. Motion translators are used for adjustment in the y and z directions. An electric motor rotates the sample, and receives power from the diffractometer.

Hesch, Victor L. (Los Alamos, NM)



Columbia University X-Ray Measurements  

E-Print Network [OSTI]

V-720 keV · NaI 2x2x2" detector views an energy range of 1 keV-3 MeV Store signal in the tree. computer configuration. Plasmas were created using multi-frequency ECRH, and we find that most of the plasma energy is stored in the fast electrons. The energy spectrum of the x-ray emission below 740 keV is measured


X-rays from Supernova Remnants  

E-Print Network [OSTI]

A summary of X-ray observations of supernova remnants is presented including the explosion fragment A of the Vela SNR, Tycho, N132D, RX J0852-4622, the Crab Nebula and the 'bulls eye', and SN 1987A, high-lighting the progress made with Chandra and XMM-Newton and touching upon the questions which arise from these observations and which might inspire future research.

B. Aschenbach



X-ray Free-electron Lasers  

SciTech Connect (OSTI)

In a free-electron laser (FEL) the lasing medium is a high-energy beam of electrons flying with relativistic speed through a periodic magnetic field. The interaction between the synchrotron radiation that is produced and the electrons in the beam induces a periodic bunching of the electrons, greatly increasing the intensity of radiation produced at a particular wavelength. Depending only on a phase match between the electron energy and the magnetic period, the wavelength of the FEL radiation can be continuously tuned within a wide spectral range. The FEL concept can be adapted to produce radiation wavelengths from millimeters to Angstroms, and can in principle produce hard x-ray beams with unprecedented peak brightness, exceeding that of the brightest synchrotron source by ten orders of magnitude or more. This paper focuses on short-wavelength FELs. It reviews the physics and characteristic properties of single-pass FELs, as well as current technical developments aiming for fully coherent x-ray radiation pulses with pulse durations in the 100 fs to 100 as range. First experimental results at wavelengths around 100 nm and examples of scientific applications planned on the new, emerging x-ray FEL facilities are presented.

Feldhaus, J.; /DESY; Arthur, J.; Hastings, J.B.; /SLAC



The X-ray Telescope of CAST  

E-Print Network [OSTI]

The Cern Axion Solar Telescope (CAST) is in operation and taking data since 2003. The main objective of the CAST experiment is to search for a hypothetical pseudoscalar boson, the axion, which might be produced in the core of the sun. The basic physics process CAST is based on is the time inverted Primakoff effect, by which an axion can be converted into a detectable photon in an external electromagnetic field. The resulting X-ray photons are expected to be thermally distributed between 1 and 7 keV. The most sensitive detector system of CAST is a pn-CCD detector combined with a Wolter I type X-ray mirror system. With the X-ray telescope of CAST a background reduction of more than 2 orders off magnitude is achieved, such that for the first time the axion photon coupling constant g_agg can be probed beyond the best astrophysical constraints g_agg < 1 x 10^-10 GeV^-1.

M. Kuster; H. Bruninger; S. Cbrian; M. Davenport; C. Elefteriadis; J. Englhauser; H. Fischer; J. Franz; P. Friedrich; R. Hartmann; F. H. Heinsius; D. H. H. Hoffmann; G. Hoffmeister; J. N. Joux; D. Kang; K. Knigsmann; R. Kotthaus; T. Papaevangelou; C. Lasseur; A. Lippitsch; G. Lutz; J. Morales; A. Rodrguez; L. Strder; J. Vogel; K. Zioutas



X-Ray Searches for Solar Axions  

E-Print Network [OSTI]

Axions generated thermally in the solar core can convert nearly directly to X-rays as they pass through the solar atmosphere via interaction with the magnetic field. The result of this conversion process would be a diffuse centrally-concentrated source of few-keV X-rays at disk center; it would have a known dimension, of order 10% of the solar diameter, and a spectral distribution resembling the blackbody spectrum of the solar core. Its spatial structure in detail would depend on the distribution of mass and field in the solar atmosphere. The brightness of the source depends upon these factors as well as the unknown coupling constant and the unknown mass of the axion; this particle is hypothetical and no firm evidence for its existence has been found yet. We describe the solar magnetic environment as an axion/photon converter and discuss the upper limits obtained by existing and dedicated observations from three solar X-ray observatories: Yohkoh, RHESSI, and Hinode

Hugh S. Hudson; L. W. Acton; E. DeLuca; I. G. Hannah; K. Reardon; K. Van Bibber



Applications of holography to x-ray imaging  

SciTech Connect (OSTI)

In this paper we consider various applications of holographic techniques to the problem of soft x-ray imaging. We give special attention to imaging biological material using x-rays in the wavelength range 24 to 45A. We describe some experiments on formation and reconstruction of x-ray holograms and propose some ways in which holographic techniques might contribute to the difficult problem of fabricating optical elements for use in the soft x-ray region.

Howells, M.; Iarocci, M.; Kenney, J.; Rarback, H.; Rosser, R.; Yun, W.



Applications of holography to X-ray imaging  

SciTech Connect (OSTI)

In this paper the authors consider various applications of holographic techniques to the problem of soft x-ray imaging. Special attention is given to imaging biological material using x-rays in the wavelength range 24-45A. The authors describe some experiments on formation and reconstruction of x-ray holograms and propose some ways in which holographic techniques might contribute to the difficult problem of fabricating optical elements for use in the soft x-ray region.

Howells, M.; Iarocci, M.; Kenney, J.; Rarback, H.; Rosser, R.; Yun, W.



X-ray MicroCT Training Presentation  

E-Print Network [OSTI]

X-ray MicroCT Training Presentation T. Fettah Kosar, PhD Center for Nanoscale Systems Harvard) Model: HMXST225 (max. 225 kV) #12;Overview 3 Introduction to X-ray imaging and Computed Tomography (CT) · What are X-rays and how do we generate and image them? · How do we magnify X-ray images and keep them

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Simulation of the electron diffraction patterns from needle/rod-like precipitates in Al-Mg-Si alloys  

SciTech Connect (OSTI)

The origin of the selected area electron diffraction (SAED) patterns from needle/rod-like metastable precipitates embedded in {alpha}-Al matrix in Al-Mg-Si alloys have been studied via an example of {beta}'' phase. In addition, the SAED pattern from {beta}'' phase has been simulated with significant improvement in comparison with the previous simulations. Three important factors, i.e. the 12 crystallographically equivalent variants of {beta}'' phase in the {alpha}-Al matrix due to the highly symmetric f.c.c. structure of {alpha}-Al, the coherence between {beta}'' phase and the {alpha}-Al matrix, and the double diffractions from the {alpha}-Al matrix and {beta}'' phase, are proved to contribute to the special square-shaped features in the SAED patterns from {beta}'' phase and thus fully taken into account in the simulation. An improved but simplified method for simulating the SAED patterns from needle/rod-like metastable precipitates has been developed. This method is further verified by simulating the SAED pattern from Q phase. The simulated SAED patterns from both {beta}'' and Q phases fit the experimentally determined patterns very well. - Highlights: {yields}An improved method has been developed to simulate the SADPs of Al alloys. {yields}The formation mechanism of SADPs of Al alloys has been systemically studied. {yields}Double diffraction contributes to the formation of the SADPs of Al alloys.

Li Kai [State Key Laboratory of Powder Metallurgy, Central South University, Changsha 410083 (China); Song Min, E-mail: Min.Song.Th05@Alum.Dartmouth.ORG [State Key Laboratory of Powder Metallurgy, Central South University, Changsha 410083 (China); Du Yong [State Key Laboratory of Powder Metallurgy, Central South University, Changsha 410083 (China); Zhang Hong [School of Materials Science and Engineering, Central South University, Changsha 410083 (China)



Femtosecond laser-electron x-ray source  

DOE Patents [OSTI]

A femtosecond laser-electron X-ray source. A high-brightness relativistic electron injector produces an electron beam pulse train. A system accelerates the electron beam pulse train. The femtosecond laser-electron X-ray source includes a high intra-cavity power, mode-locked laser and an x-ray optics system.

Hartemann, Frederic V.; Baldis, Hector A.; Barty, Chris P.; Gibson, David J.; Rupp, Bernhard



X-ray Emission from Massive Stars David Cohen  

E-Print Network [OSTI]

X-ray Emission from Massive Stars David Cohen Department of Physics and Astronomy Swarthmore University, Oct. 13, 2005 astro.swarthmore.edu/~cohen/ #12;Outline 1. What you need to know: a. X-rays from the Sun - magnetic activity, x-ray spectra b. Hot stars c. Radiation-driven winds and the Doppler shift d

Cohen, David


X-Ray Photoelectron Spectroscopy XPS Mark Engelhard  

E-Print Network [OSTI]

X-Ray Photoelectron Spectroscopy XPS Mark Engelhard 1 #12;EMSL XPS Instrumentation 2 Physical Electronics Quantera XPS High Energy Resolution Focused X-ray Beam Capability Catalysis reaction and processing chamber with inert atmosphere glove box connected to a PHI Quantera Scanning X-ray Microprobe


Quantitative x-ray imager (abstract)  

SciTech Connect (OSTI)

We report on development of a quantitative x-ray imager (QXI) for the national Inertial Confinement Fusion Program. Included in this development is a study of photocathode response as a function of photon energy, 2--17.5 keV, which is related to diagnostic development on the National Ignition Facility (NIF). The QXI is defined as being a quantative imager due to the repeated characterization. This instrument is systematically checked out, electronically as well as its photocathode x-ray response, both on a direct current and pulsed x-ray sources, before and after its use on a shot campaign. The QXI is a gated x-ray imager1 used for a variety of experiments conducted in the Inertial Confinement Fusion and Radiation Physics Program. The camera was assembled in Los Alamos and has been under development since 1997 and has now become the workhorse framing camera by the program. The electronics were built by Grant Applied Physics of San Fransisco, CA.2 The QXI has been used at the LANL Trident, LLNL Nova, and University of Rochester Laboratory OMEGA laser facilities. The camera consists of a grated microchannel plate (MCP), a phosphor coated fiberoptic faceplate coupled to film for data readout, along with high speed electronic pulsers to drive the x-ray detector. The QXI has both a two-strip and a four-strip detection head and has the ability to individually bias the gain of each of the strips. The timing of the QXI was done at the Trident short pulse laboratory, using 211 nm light. Single strip jitter was looked at as well and determined to be <25 ps. Flatfielding of the photocathode across the MCP was done with the Trident main laser with 150 J on a gold disk with a 1 ns. Spatial resolution was determined to be <5 {mu}m by using the same laser conditions as before and a backlit 1000 lp/in. grid. The QXI has been used on cylindrical implosion work at the Nova Laser Facility, and on direct-drive cylinder mix and indirect-drive high convergence implosion experiments at OMEGA. Its two-strip module has provided the capability to look at point backlighters, as part of technique development for experiments on the NIF. Its next use will be in March 2000 with its off axis viewer nose at Omega, providing a perpendicular view of Rayleigh--Taylor spike dissipation.

Evans, Scott C.; Archuleta, Tom N.; Oertel, John A.; Walsh, Peter J.



TEM and x-ray investigation of single crystal-like zirconia films fabricated by dual ion beam deposition  

SciTech Connect (OSTI)

Single crystal-like yttria-stabilized zirconia (YSZ) thin films have been deposited on amorphous quartz, polycrystalline zirconia, single crystal Si, and Hastelloy substrates using dual ion beam deposition (IBAD). These films are highly crystallographically aligned both normal to and within the film plane. The films are deposited at low substrate temperatures (< 200 C), and the film orientation is substrate independent. 0--20 X-ray diffraction, X-ray rocking curves, X-ray pole figures and X-ray phi scans are used to evaluate the film structure. High resolution cross-sectional TEM is used to examine the evolution of crystallographic film alignment on an amorphous quartz substrate. The data suggest that the evolution of biaxial alignment is nucleation controlled under these conditions.

Ressler, K.G.; Sonnenberg, N.; Cima, M.J. [Massachusetts Inst. of Tech., Cambridge, MA (United States). Ceramics Processing Research Lab.



X-Ray Interactions with Matter from the Center for X-Ray Optics (CXRO)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The primary interactions of low-energy x-rays within condensed matter, viz. photoabsorption and coherent scattering, are described for photon energies outside the absorption threshold regions by using atomic scattering factors. The atomic scattering factors may be accurately determined from the atomic photoabsorption cross sections using modified Kramers-Kronig dispersion relations. From a synthesis of the currently available experimental data and recent theoretical calculations for photoabsorption, the angle-independent, forward-scattering components of the atomic scattering factors have been thus semiempirically determined and tabulated here for 92 elements and for the region 50-30,000 eV. Atomic scattering factors for all angles of coherent scattering and at the higher photon energies are obtained from these tabulated forward-scattering values by adding a simple angle-dependent form-factor correction. The incoherent scattering contributions that become significant for the light elements at the higher photon energies are similarly determined. The basic x-ray interaction relations that are used in applied x-ray physics are presented here in terms of the atomic scattering factors. The bulk optical constants are also related to the atomic scattering factors. These atomic and optical relations are applied to the detailed calculation of the reflectivity characteristics of a series of practical x-ray mirror, multilayer, and crystal monochromators. Comparisons of the results of this semiempirical,"atom-like", description of x-ray interactions for the low-energy region with those of experiment and ab initio theory are presented.

Henke, B.L.; Gullikson, E.M.; Davis, J.C.


Calibrating X-ray Imaging Devices for Accurate Intensity Measurement  

SciTech Connect (OSTI)

The purpose of the project presented is to develop methods to accurately calibrate X-ray imaging devices. The approach was to develop X-ray source systems suitable for this endeavor and to develop methods to calibrate solid state detectors to measure source intensity. NSTec X-ray sources used for the absolute calibration of cameras are described, as well as the method of calibrating the source by calibrating the detectors. The work resulted in calibration measurements for several types of X-ray cameras. X-ray camera calibration measured efficiency and efficiency variation over the CCD. Camera types calibrated include: CCD, CID, back thinned (back illuminated), front illuminated.

Haugh, M. J.



X-Ray Source Based on the Parametric X-Rays  

E-Print Network [OSTI]

Prospects of parametric x-rays (PXR) application for the development of a tuneable quasi-monochromatic x-ray source for medical imaging are discussed. Analysis of basic requirements for electron accelerator shows that it must be relatively low-energy and high-current linac. In comparison with known ultra-relativistic cases, at low energies PXR properties will be modified to a great extent by multiple scattering of the electrons. PXR intensity dependence on target thickness and beam energy are calculated taking multiple scattering into account. It is concluded that PXR source based on real medical accelerators is feasible and can provide x-ray flux needful for obtaining high quality medical images.

Alexander Lobko; Olga Lugovskaya



Apparatus for monitoring X-ray beam alignment  

DOE Patents [OSTI]

A self-contained, hand-held apparatus is provided for monitoring alignment of an X-ray beam in an instrument employing an X-ray source. The apparatus includes a transducer assembly containing a photoresistor for providing a range of electrical signals responsive to a range of X-ray beam intensities from the X-ray beam being aligned. A circuit, powered by a 7.5 VDC power supply and containing an audio frequency pulse generator whose frequency varies with the resistance of the photoresistor, is provided for generating a range of audible sounds. A portion of the audible range corresponds to low X-ray beam intensity. Another portion of the audible range corresponds to high X-ray beam intensity. The transducer assembly may include an a photoresistor, a thin layer of X-ray fluorescent material, and a filter layer transparent to X-rays but opaque to visible light. X-rays from the beam undergoing alignment penetrate the filter layer and excite the layer of fluorescent material. The light emitted from the fluorescent material alters the resistance of the photoresistor which is in the electrical circuit including the audio pulse generator and a speaker. In employing the apparatus, the X-ray beam is aligned to a complete alignment by adjusting the X-ray beam to produce an audible sound of the maximum frequency. 2 figures.

Steinmeyer, P.A.



Apparatus for monitoring X-ray beam alignment  

DOE Patents [OSTI]

A self-contained, hand-held apparatus is provided for minitoring alignment of an X-ray beam in an instrument employing an X-ray source. The apparatus includes a transducer assembly containing a photoresistor for providing a range of electrical signals responsive to a range of X-ray beam intensities from the X-ray beam being aligned. A circuit, powered by a 7.5 VDC power supply and containing an audio frequency pulse generator whose frequency varies with the resistance of the photoresistor, is provided for generating a range of audible sounds. A portion of the audible range corresponds to low X-ray beam intensity. Another portion of the audible range corresponds to high X-ray beam intensity. The transducer assembly may include an a photoresistor, a thin layer of X-ray fluorescent material, and a filter layer transparent to X-rays but opaque to visible light. X-rays from the beam undergoing alignment penetrate the filter layer and excite the layer of fluorescent material. The light emitted from the fluorescent material alters the resistance of the photoresistor which is in the electrical circuit including the audio pulse generator and a speaker. In employing the apparatus, the X-ray beam is aligned to a complete alignment by adjusting the X-ray beam to produce an audible sound of the maximum frequency.

Steinmeyer, Peter A. (Arvada, CO)



An In-vacuum Diffractometer for Resonant elastic Soft X-ray Scattering  

SciTech Connect (OSTI)

We describe the design, construction, and performance of a 4-circle in-vacuum diffractometer for resonant elastic soft x-ray scattering. The diffractometer, installed on the resonant elastic and inelastic x-ray scattering beamline at the Canadian Light Source, includes 9 in-vacuum motions driven by in-vacuum stepper motors and operates in ultra-high vacuum at base pressure of 2 x 10{sup -10} Torr. Cooling to a base temperature of 18 K is provided with a closed-cycle cryostat. The diffractometer includes a choice of 3 photon detectors: a photodiode, a channeltron, and a 2D sensitive channelplate detector. Along with variable slit and filter options, these detectors are suitable for studying a wide range of phenomena having both weak and strong diffraction signals. Example measurements of diffraction and reflectivity in Nd-doped (La,Sr){sub 2}CuO{sub 4} and thin film (Ga,Mn)As are shown.

D Hawthorn; F He; L Venema; H Davis; A Achkar; J Zhang; R Sutarto; H Wadati; A Radi; et al.



Demonstration of 12 nm resolution Fresnel zone plate lens based soft x-ray microscopy  

SciTech Connect (OSTI)

To extend soft x-ray microscopy to a resolution of order 10 nm or better, we developed a new nanofabrication process for Fresnel zone plate lenses. The new process, based on the double patterning technique, has enabled us to fabricate high quality gold zone plates with 12 nm outer zones. Testing of the zone plate with the full-field transmission x-ray microscope, XM-1, in Berkeley, showed that the lens clearly resolved 12 nm lines and spaces. This result represents a significant step towards 10 nm resolution and beyond.

Chao, W.; Kim, J.; Rekawa, S.; Fischer, P.; Anderson, E. H.



X-ray emission properties of galaxies in Abell 3128  

E-Print Network [OSTI]

We use archival Chandra X-ray Observatory data to investigate X-ray emission from early-type galaxies in the rich z=0.06 cluster Abell 3128. By combining the X-ray count-rates from an input list of optically-selected galaxies, we obtain a statistical detection of X-ray flux, unbiased by X-ray selection limits. Using 87 galaxies with reliable Chandra data, X-ray emission is detected for galaxies down to M_B ~ -19.0, with only an upper limit determined for galaxies at M_B ~ -18.3. The ratio of X-ray to optical luminosities is consistent with recent determinations of the low-mass X-ray binary content of nearby elliptical galaxies. Taken individually, in contrast, we detect significant (3sigma) flux for only six galaxies. Of these, one is a foreground galaxy, while two are optically-faint galaxies with X-ray hardness ratios characteristic of active galactic nuclei. The remaining three detected galaxies are amongst the optically-brightest cluster members, and have softer X-ray spectra. Their X-ray flux is higher than that expected from X-ray binaries, by a factor 2-10; the excess suggests these galaxies have retained their hot gaseous haloes. The source with the highest L_X / L_B ratio is of unusual optical morphology with prominent sharp-edged shells. Notwithstanding these few exceptions, the cluster population overall exhibits X-ray properties consistent with their emission being dominated by X-ray binaries. We conclude that in rich cluster environments, interaction with the ambient intra-cluster medium acts to strip most galaxies of their hot halo gas.

Russell J. Smith



X-ray generation using carbon nanotubes  

E-Print Network [OSTI]

of these sys- tems are illustrated in Figure 2(b) also outlines the principle mode of operation. Here, sealed in an inexpensive and eas- ily fabricated evacuated glass or ceramic envelope, the elec- trons are liberated from a metallic filament, often made... - ment of CNT-based FE sources is provided in [152]. Here we provide a condensed review of the progress, as it pertains to X-ray sources, since then. CNTs have some of the highest attainable aspect ratios, high thermal conductivity, low chemical...

Parmee, Richard J.; Collins, Clare M.; Milne, William I.; Cole, Matthew T.



Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces and Interfaces Sample6, 2011 LawrenceE C H NLensless X-Ray Imaging in


Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces and Interfaces Sample6, 2011 LawrenceE C H NLensless X-Ray Imaging


Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces and Interfaces Sample6, 2011 LawrenceE C H NLensless X-Ray ImagingLensless


Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces and Interfaces Sample6, 2011 LawrenceE C H NLensless X-Ray


SMB, Small Angle X-Ray Scattering  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the1 -the Mid-Infrared0 ResourceAwards SAGE Awards ,#2446Small Angle X-Ray Scattering

Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


SMB, X-ray Absorption Spectroscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the1 -the Mid-Infrared0 ResourceAwards SAGE Awards ,#2446Small Angle X-Ray


SMB, X-ray Emission Spectroscopy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the1 -the Mid-Infrared0 ResourceAwards SAGE Awards ,#2446Small Angle X-RayEmission


X-ray Microscopy and Imaging: FAQs  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of EnergyX-ray ComputedOverFrequently


X-rays Illuminate Ancient Archimedes Text  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1of EnergyX-rayNew MaterialsrayRelated


X-Ray Nanoimaging: Instruments and Methods  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL Home SRNL main campusMore thanX-Ray Imaging of


X-Ray Science Division (XSD)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL Home SRNL main campusMore thanX-Ray Imaging


Gamma Radiation & X-Rays  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFun with Big Sky Learning Fun with Big SkyDIII-DRMRGamma Radiation and X-Rays 1.


Femtosecond X-ray protein nanocrystallography  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series toESnet4:Epitaxial ThinFORFALL NEWSFemtosecond X-ray protein


Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickrinformationPostdocs spaceLaser The SRSSPECIALLenslessX-Ray Imaging in


Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickrinformationPostdocs spaceLaser The SRSSPECIALLenslessX-Ray Imaging


Lensless X-Ray Imaging in Reflection  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickrinformationPostdocs spaceLaser The SRSSPECIALLenslessX-Ray


The BMW X-ray Cluster Survey  

E-Print Network [OSTI]

We describe the main features of the BMW survey of serendipitous X-ray clusters, based on the still unexploited ROSAT-HRI archival observations. The sky coverage, surface density and first deep optical CCD images of the candidates indicate that this sample can represent an excellent complement to the existing PSPC deep cluster surveys and will provide us with a fully independent probe of the evolution of the cluster abundance, in addition to significantly increasing the number of clusters known at z>0.6.

Alberto Moretti; Luigi Guzzo; Sergio Campana; Stefano Covino; Davide Lazzati; Marcella Longhetti; Emilio Molinari; Maria Rosa Panzera; Gianpiero Tagliaferri; Ian Dell'Antonio



The BMW X-ray Cluster Survey  

E-Print Network [OSTI]

We describe the main features of the BMW survey of serendipitous X-ray clusters, based on the still unexploited ROSAT-HRI archival observations. The sky coverage, surface density and first deep optical CCD images of the candidates indicate that this sample can represent an excellent complement to the existing PSPC deep cluster surveys and will provide us with a fully independent probe of the evolution of the cluster abundance, in addition to significantly increasing the number of clusters known at z>0.6.

Moretti, A; Campana, S; Covino, S; Lazzati, D; Longhetti, M; Molinari, E; Panzera, M R; Tagliaferri, G; Dell'Antonio, I P; Moretti, Alberto; Guzzo, Luigi; Campana, Sergio; Covino, Stefano; Lazzati, Davide; Longhetti, Marcella; Molinari, Emilio; Panzera, Maria Rosa; Tagliaferri, Gianpiero; Antonio, Ian Dell'



Structure and dynamics of cadmium telluride studied by x-ray and inelastic neutron scattering  

SciTech Connect (OSTI)

We present a combined study of density functional theory, x-ray diffraction, and inelastic neutron scattering examining the temperature dependent structure and lattice dynamics of commercially available cadmium telluride. A subtle change in the structure is evinced near 80?K, which manifests also in the measured phonon density of states. There is no change to the long-range ordered structure. The implications of the change in relation to structural defects are discussed.

Niedziela, J. L., E-mail: niedzielajl@ornl.gov [Instrument and Source Division, Neutron Sciences Directorate, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Stone, M. B., E-mail: stonemb@ornl.gov [Quantum Condensed Matter Division, Neutron Sciences Directorate, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)



Structure and dynamics of cadmium telluride studied by x-ray and inelastic neutron scattering  

SciTech Connect (OSTI)

We present a combined study of density functional theory, x-ray diffraction, and inelastic neutron scattering examining the temperature dependent structure and lattice dynamics of commercially available cadmium telluride. A subtle change in the structure is evinced near 80~K, which manifests also in the measured phonon density of states. There is no change to the long-range ordered structure. The implications of the change in relation to structural defects are discussed.

Niedziela, Jennifer L [ORNL; Stone, Matthew B [ORNL



Analysis of Off-Nuclear X-Ray Sources in Galaxy NGC 4945  

SciTech Connect (OSTI)

Recently, X-ray astronomy has been used to investigate objects such as galaxies, clusters of galaxies, Active Galactic Nuclei (AGN), quasars, starburst superbubbles of hot gas, X-ray binary systems, stars, supernova remnants, and interstellar and intergalactic material. By studying the x-ray emission patterns of these objects, we can gain a greater understanding of their structure and evolution. We analyze X-ray emission from the galaxy NGC 4945 using data taken by the Chandra X-ray Observatory. The Chandra Interactive Analysis of Observations (CIAO) software package was used to extract and fit energy spectra and to extract light curves for the brightest off-nuclear sources in two different observations of NGC 4945 (January, 2000 and May, 2004). A majority of sources were closely fit by both absorbed power law and absorbed bremsstrahlung models, with a significantly poorer {chi}{sup 2}/dof for the absorbed blackbody model, and most sources had little variability. This indicates that the sources are accreting binary systems with either a neutron star or black hole as the compact object. The calculated luminosities were about 10{sup 38} erg/s, which implies that the mass of the accreting object is close to 10 solar masses and must be a black hole.

Harrison, Sarah M.; /MIT /SLAC



Air-core grid for scattered x-ray rejection  

DOE Patents [OSTI]

The invention is directed to a grid used in x-ray imaging applications to block scattered radiation while allowing the desired imaging radiation to pass through, and to process for making the grid. The grid is composed of glass containing lead oxide, and eliminates the spacer material used in prior known grids, and is therefore, an air-core grid. The glass is arranged in a pattern so that a large fraction of the area is open allowing the imaging radiation to pass through. A small pore size is used and the grid has a thickness chosen to provide high scatter rejection. For example, the grid may be produced with a 200 .mu.m pore size, 80% open area, and 4 mm thickness.

Logan, Clinton M. (Pleasanton, CA); Lane, Stephen M. (Oakland, CA)



Air-core grid for scattered x-ray rejection  

DOE Patents [OSTI]

The invention is directed to a grid used in x-ray imaging applications to block scattered radiation while allowing the desired imaging radiation to pass through, and to process for making the grid. The grid is composed of glass containing lead oxide, and eliminates the spacer material used in prior known grids, and is therefore, an air-core grid. The glass is arranged in a pattern so that a large fraction of the area is open allowing the imaging radiation to pass through. A small pore size is used and the grid has a thickness chosen to provide high scatter rejection. For example, the grid may be produced with a 200 {micro}m pore size, 80% open area, and 4 mm thickness. 2 figs.

Logan, C.M.; Lane, S.M.



RYLLA. [X-ray transport code  

SciTech Connect (OSTI)

This paper describes a computer code, RYLLA, which models the deposition of x-rays into thin metal slabs, and transports the resulting photoelectrons, finding the distribution of electrons leaving the slab from both the front and back surfaces. The slab must be homogeneous, but can contain a mixture of up to 5 different elements. Due to the short electron mean free path at low electron energies, RYLLA should be used only for studying thin slabs, roughly < 100 mg/cm/sup 2/ for low Z metals, and < 10 mg/cm/sup 2/ for high Z metals. X-ray energies should be in the range of 1 to 150 keV, as they are deposited only via photoionization and Compton scattering processes. Following photoionization, a hole exists in the electron cloud of the absorbing atom. This fills either by Auger or fluoresence, resulting in lower energy holes which are also filled. Fluoresence photons are transported and absorbed in the same manner as the primary photons, except that they are isotropically produced. Once all photons have been transported and absorbed, and all holes have been filled, a space- and energy-dependent electron source spectrum has been obtained. This is used in a discrete ordinate expansion solution of the 1-D transport equation, which gives the output electron spectra at the two slab surfaces. This paper discusses both the physics and coding of RYLLA. Examples of user input are given, as are some comparisons with other codes.

Hyde, R.A.



Development of procedures for refurbishing x-ray optics at the Advanced Light Source  

E-Print Network [OSTI]

Development of procedures for refurbishing x-ray optics atpractical and robust procedures for refurbishing x-ray

Yashchuk, Valeriy V.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The variability properties of X-ray steep and X-ray flat quasars  

E-Print Network [OSTI]

We have studied the variability of 6 low redshift, radio quiet `PG' quasars on three timescales (days, weeks, and months) using the ROSAT HRI. The quasars were chosen to lie at the two extreme ends of the ROSAT PSPC spectral index distribution and hence of the H$\\beta$ FWHM distribution. The observation strategy has been carefully designed to provide even sampling on these three basic timescales and to provide a uniform sampling among the quasars We have found clear evidence that the X-ray steep, narrow H_beta, quasars systematically show larger amplitude variations than the X-ray flat broad H_beta quasars on timescales from 2 days to 20 days. On longer timescales we do not find significant differences between steep and flat quasars, although the statistics are poorer. We suggest that the above correlation between variability properties and spectral steepness can be explained in a scenario in which the X-ray steep, narrow line objects are in a higher L/L_Edd state with respect to the X-ray flat, broad line objects. We evaluated the power spectrum of PG1440+356 (the brigthest quasar in our sample) between 2E-7 and 1E-3 Hz, where it goes into the noise. The power spectrum is roughly consistent with a 1/f law between 1E-3 and 2E-6 Hz. Below this frequency it flattens significantly.

Fabrizio Fiore; Ari Laor; Martin Elvis; Fabrizio Nicastro; Emanuele Giallongo



X-ray driven channeling acceleration in crystals and carbon nanotubes  

SciTech Connect (OSTI)

Acceleration of particles channeling in a crystal by means of diffracted x-rays via Bormann anomalous transmission was conceived for heavy ions and muons by Tajima and Cavenago [Phys. Rev. Lett. 59, 1440 (1987)], which potentially offers an appreciably high field gradient on the order of GV/cm. The theoretical model of the high gradient acceleration has been studied in two kinds of atomic structure, crystals and carbon nanotubes (CNTs), with analytic calculations and electromagnetic eigenmode simulations. A range of acceleration gradients and cutoffs of the x-ray power (the lowest power limit to overcome the Bremsstrahlung radiation losses) are characterized in terms of the lattice constants, unit cell sizes, and photon energies. The parametric analysis indicates that the required x-ray power can be reduced to an order of megawatt by replacing crystals with CNTs. Eventually, the equivalent dielectric approximation of a multi-wall nanotube shows that 250810 MeV muons can be synchronously coupled with x-rays of 0.651.32 keV in the accelerating structure.

Shin, Young-Min [Department of Physics, Northern Illinois Center for Accelerator and Detector Development (NICADD), Northern Illinois University, Dekalb, Illinois 60115 (United States) [Department of Physics, Northern Illinois Center for Accelerator and Detector Development (NICADD), Northern Illinois University, Dekalb, Illinois 60115 (United States); Fermi National Accelerator Laboratory, Batavia, Illinois 60510 (United States); Still, Dean A.; Shiltsev, Vladimir [Fermi National Accelerator Laboratory, Batavia, Illinois 60510 (United States)] [Fermi National Accelerator Laboratory, Batavia, Illinois 60510 (United States)



High-pressure X-ray absorption fine structure in the diamond anvil cell and its applications in geological materials  

E-Print Network [OSTI]

nano- polycrystalline diamond instead of single crystal anvils, the influence of diamond diffractionHigh-pressure X-ray absorption fine structure in the diamond anvil cell and its applications fine structure in the diamond anvil cell and its applications in geological materials Xinguo Hong1

Duffy, Thomas S.


Method and apparatus for enhanced sensitivity filmless medical x-ray imaging, including three-dimensional imaging  

DOE Patents [OSTI]

A filmless X-ray imaging system includes at least one X-ray source, upper and lower collimators, and a solid-state detector array, and can provide three-dimensional imaging capability. The X-ray source plane is distance z.sub.1 above upper collimator plane, distance z.sub.2 above the lower collimator plane, and distance z.sub.3 above the plane of the detector array. The object to be X-rayed is located between the upper and lower collimator planes. The upper and lower collimators and the detector array are moved horizontally with scanning velocities v.sub.1, v.sub.2, v.sub.3 proportional to z.sub.1, z.sub.2 and z.sub.3, respectively. The pattern and size of openings in the collimators, and between detector positions is proportional such that similar triangles are always defined relative to the location of the X-ray source. X-rays that pass through openings in the upper collimator will always pass through corresponding and similar openings in the lower collimator, and thence to a corresponding detector in the underlying detector array. Substantially 100% of the X-rays irradiating the object (and neither absorbed nor scattered) pass through the lower collimator openings and are detected, which promotes enhanced sensitivity. A computer system coordinates repositioning of the collimators and detector array, and X-ray source locations. The computer system can store detector array output, and can associate a known X-ray source location with detector array output data, to provide three-dimensional imaging. Detector output may be viewed instantly, stored digitally, and/or transmitted electronically for image viewing at a remote site.

Parker, Sherwood (Berkeley, CA)



Method and apparatus for enhanced sensitivity filmless medical x-ray imaging, including three-dimensional imaging  

DOE Patents [OSTI]

A filmless X-ray imaging system includes at least one X-ray source, upper and lower collimators, and a solid-state detector array, and can provide three-dimensional imaging capability. The X-ray source plane is distance z{sub 1} above upper collimator plane, distance z{sub 2} above the lower collimator plane, and distance z{sub 3} above the plane of the detector array. The object to be X-rayed is located between the upper and lower collimator planes. The upper and lower collimators and the detector array are moved horizontally with scanning velocities v{sub 1}, v{sub 2}, v{sub 3} proportional to z{sub 1}, z{sub 2} and z{sub 3}, respectively. The pattern and size of openings in the collimators, and between detector positions is proportional such that similar triangles are always defined relative to the location of the X-ray source. X-rays that pass through openings in the upper collimator will always pass through corresponding and similar openings in the lower collimator, and thence to a corresponding detector in the underlying detector array. Substantially 100% of the X-rays irradiating the object (and neither absorbed nor scattered) pass through the lower collimator openings and are detected, which promotes enhanced sensitivity. A computer system coordinates repositioning of the collimators and detector array, and X-ray source locations. The computer system can store detector array output, and can associate a known X-ray source location with detector array output data, to provide three-dimensional imaging. Detector output may be viewed instantly, stored digitally, and/or transmitted electronically for image viewing at a remote site. 5 figs.

Parker, S.



Fabrication process for a gradient index x-ray lens  

DOE Patents [OSTI]

A process for fabricating high efficiency x-ray lenses that operate in the 0.5-4.0 keV region suitable for use in biological imaging, surface science, and x-ray lithography of integrated circuits. The gradient index x-ray optics fabrication process broadly involves co-sputtering multi-layers of film on a wire, followed by slicing and mounting on block, and then ion beam thinning to a thickness determined by periodic testing for efficiency. The process enables the fabrication of transmissive gradient index x-ray optics for the 0.5-4.0 keV energy range. This process allows the fabrication of optical elements for the next generation of imaging and x-ray lithography instruments m the soft x-ray region.

Bionta, Richard M. (Livermore, CA); Makowiecki, Daniel M. (Livermore, CA); Skulina, Kenneth M. (Livermore, CA)



Density gradient free electron collisionally excited X-ray laser  

DOE Patents [OSTI]

An operational X-ray laser (30) is provided that amplifies 3p-3s transition X-ray radiation along an approximately linear path. The X-ray laser (30) is driven by a high power optical laser. The driving line focused optical laser beam (32) illuminates a free-standing thin foil (34) that may be associated with a substrate (36) for improved structural integrity. This illumination produces a generally cylindrically shaped plasma having an essentially uniform electron density and temperature, that exists over a long period of time, and provides the X-ray laser gain medium. The X-ray laser (30) may be driven by more than one optical laser beam (32, 44). The X-ray laser (30) has been successfully demonstrated to function in a series of experimental tests.

Campbell, Edward M. (Pleasanton, CA); Rosen, Mordecai D. (Berkeley, CA)



Density gradient free electron collisionally excited x-ray laser  

DOE Patents [OSTI]

An operational x-ray laser is provided that amplifies 3p-3s transition x-ray radiation along an approximately linear path. The x-ray laser is driven by a high power optical laser. The driving line focused optical laser beam illuminates a free-standing thin foil that may be associated with a substrate for improved structural integrity. This illumination produces a generally cylindrically shaped plasma having an essentially uniform electron density and temperature, that exists over a long period of time, and provides the x-ray laser gain medium. The x-ray laser may be driven by more than one optical laser beam. The x-ray laser has been successfully demonstrated to function in a series of experimental tests.

Campbell, E.M.; Rosen, M.D.



Legacy of the X-Ray Laser Program  

SciTech Connect (OSTI)

The X-Ray Laser Program has evolved from a design effort focusing on developing a Strategic Defense Initiative weapon that protects against Soviet ICBMs to a scientific project that is producing new technologies for industrial and medical research. While the great technical successes and failures of the X-ray laser itself cannot be discussed, this article presents the many significant achievements made as part of the X-ray laser effort that are now being used for other applications at LLNL.

Nilsen, J.



On X-Ray Waveguiding in Nanochannels: Channeling Formalism  

E-Print Network [OSTI]

The question on X-ray extreme focusing (smallest reachable spot size) brings us to the idea for using the wave features of X-ray propagation in media. As known, wave features are revealed at propagation in ultra-narrow collimators as well as at glancing reflection from smooth flat and/or strongly curved surfaces. All these phenomena can be described within the general formalism of X-ray channeling.

S. B. Dabagov



New rhenium(I) compounds containing the donor-acceptor diphosphine ligands 2-(ferrocenylidene)-4,5-bis(diphenylphosphino)4-cyclopenten-1,3-dione (fbpcd) and 2-(3-ferrocenylprop-2-ynylidene)-4,5-bis(diphenylphosphino)4-cyclopenten-1,3-dione (fpbpcd): Electrochemical behavior, MO properties, and X-ray diffraction structure of fac-BrRe(CO)(3)(fpbpcd)  

SciTech Connect (OSTI)

Displacement of the labile THF molecules in BrRe(CO){sub 3}(THF){sub 2} (1) by the diphosphine ligands 2-(ferrocenylidene)-4,5-bis(diphenylphosphino)4-cyclopenten-1,3-dione (fbpcd) and 2-(3-ferrocenylprop-2-ynylidene)-4,5-bis(diphenylphosphino)4-cyclopenten- 1,3-dione (fpbpcd) yields the mononuclear compounds fac-BrRe(CO){sub 3}(fbpcd) (2) and fac-BrRe(CO){sub 3}(fpbpcd) (3), respectively. The new ligand fpbpcd ligand has been synthesized from 3-ferrocenylpropynal and the parent diphosphine ligand 4,5-bis(diphenylphosphino)-4-cyclopenten-1,3-dione (bpcd) through a Knoevenagel condensation. 2 and 3 have been isolated and fully characterized by IR and NMR spectroscopies ({sup 1}H and {sup 31}P), ESI mass spectrometry, and X-ray diffraction analysis in the case of 3. The electrochemical properties of compounds 2 and 3 have been examined by cyclic voltammetry, and the nature of the HOMO and LUMO levels in these systems has been confirmed by MO calculations at the extended Hueckel level. The redox and MO data are discussed relative to the redox and orbital properties of related functionalized diphosphines based on the bpcd platform.

Poola, Bhaskar [University of North Texas; Richmond, Michael G. [University of North Texas



Domain wall motion and electromechanical strain in lead-free piezoelectrics: Insight from the model system (1 ? x)Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}x(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3} using in situ high-energy X-ray diffraction during application of electric fields  

SciTech Connect (OSTI)

The piezoelectric compositions (1 ? x)Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}x(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3} (BZT-xBCT) span a model lead-free morphotropic phase boundary (MPB) between room temperature rhombohedral and tetragonal phases at approximately x?=?0.5. In the present work, in situ X-ray diffraction measurements during electric field application are used to elucidate the origin of electromechanical strain in several compositions spanning the tetragonal compositional range 0.6???x???0.9. As BCT concentration decreases towards the MPB, the tetragonal distortion (given by c/a-1) decreases concomitantly with an increase in 90 domain wall motion. The increase in observed macroscopic strain is predominantly attributed to the increased contribution from 90 domain wall motion. The results demonstrate that domain wall motion is a significant factor in achieving high strain and piezoelectric coefficients in lead-free polycrystalline piezoelectrics.

Tutuncu, Goknur [Department of Materials Science and Engineering, University of Florida, Gainesville, Florida 32611 (United States); Li, Binzhi [Department of Chemical Engineering and Materials Science, University of California, Davis, Davis, California 95616 (United States); Bowman, Keith [Illinois Institute of Technology, Armour College of Engineering, Chicago, Illinois 60616 (United States); School of Materials Engineering, Purdue University, West Lafayette, Indiana 47907 (United States); Jones, Jacob L., E-mail: JacobJones@ncsu.edu [Department of Materials Science and Engineering, North Carolina State University, Raleigh, North Carolina 27695 (United States)




E-Print Network [OSTI]

. A microdensitometer (Optronics photoscan P-1000) wa: used for complete recording of the diffraction patterns

Yonath, Ada E.


X-ray Pinhole Camera Measurements  

SciTech Connect (OSTI)

The rod pinch diode is made up of a cathode plate and a small diameter anode rod that extends through the cathode hole. The anode is charged positively. The rod tip is made of a high-z material which is chosen for its bremsstrahlung efficiency. When the diode is pulsed it produces an intense x-ray source used for pulsed radiography. The baseline or reference diode consists of a 0.75 mm diameter Tungsten (W) tapered anode rod which extends 10 mm through a 9 mm diameter 3 mm thick aluminum (Al) aperture. The majority of the current in the electron beam is created on the edges of the cathode aperture and when properly configured, the electrons will self insulate, travel down the extension of the rod, and pinch onto the tip of the rod. In this presentation, performance of hybrid diodes will be compared with the baseline diode.

Nelson, D. S. [NSTec; Berninger, M. J. [NSTec; Flores, P. A. [NSTec; Good, D. E. [NSTec; Henderson, D. J. [NSTec; Hogge, K. W. [NSTec; Huber, S. R. [NSTec; Lutz, S. S. [NSTec; Mitchell, S. E. [NSTec; Howe, R. A. [NSTec; Mitton, C. V. [NSTec; Molina, I. [NSTec; Bozman, D. R. [SNL; Cordova, S. R. [SNL; Mitchell, D. R. [SNL; Oliver, B. V. [SNL; Ormond, E. C. [SNL




SciTech Connect (OSTI)

The soft X-ray photoelectric absorption of high-z quasars has been known for two decades, but has no unambiguous astrophysical context. We construct the largest sample to date of 58 high-redshift quasars (z > 0.45) selected from the XMM-Newton archive based on a high photon count criterion (>1800). We measure the optical depth {tau} at 0.5 keV and find that 43% of the quasars show significant absorption. We aim to find which physical parameters of the quasars, e.g., redshift, radio luminosity, radio loudness, or X-ray luminosity, drive their observed absorption. We compare the absorption behavior with redshift with the pattern expected if the diffuse intergalactic medium (IGM) is responsible for the observed absorption. We also compare the absorption with a comparison sample of gamma-ray burst (GRB) X-ray afterglows. Although the z > 2 quasar opacity is consistent with diffuse IGM absorption, many intermediate-z (0.45 < z < 2) quasars are not sufficiently absorbed for this scenario, and are appreciably less absorbed than GRBs. Only 10/37 quasars at z < 2 are absorbed, and only 5/30 radio-quiet quasars are absorbed. We find a weak correlation between {tau} and z, and an even weaker correlation between {tau} and radio luminosity. These findings lead to the conclusion that although a diffuse IGM origin for the quasar absorption is unlikely, the optical depth does seem to increase with redshift, roughly as (1 + z){sup 2.2{+-}0.6}, tending to {tau} Almost-Equal-To 0.4 at high redshifts, similar to the high-z GRBs. This result can be explained by an ionized and clumpy IGM at z < 2, and a cold, diffuse IGM at higher redshift. If, conversely, the absorption occurs at the quasar, and owing to the steep L{sub x} {proportional_to}(1 + z){sup 7.1{+-}0.5} correlation in the present sample, the host column density scales as N{sub H}{proportional_to}L{sub x}{sup 0.7{+-}0.1}.

Eitan, Assaf; Behar, Ehud, E-mail: sassafe@tx.technion.ac.il, E-mail: behar@physics.technion.ac.il [Physics Department, Technion, Haifa 32000 (Israel)



A laser triggered vacuum spark x-ray lithography source  

E-Print Network [OSTI]

ionized state or the physical processes occurring 15 in a high temperature plasma. There are many advantages to the use of the vacuum spark as an x-ray source; the simplicity of the machine is one. The x-ray output is within the range usable for x-ray... spark apparatus ha- been studied here to determine its applicability to x-ray lithography. A capacitor which stored approximately 3 KJ supplied most of the energy for the plasma. A Nd-YAG laser was used to supply electrons and metallic atoms...

Keating, Richard Allen



Unexpected Angular Dependence of X-Ray Magnetic Linear Dichroism  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

axes must be taken into account for accurate interpretation of XMLD data. Magnetism and X Rays The ancient Greeks and also the Chinese knew about strange and rare...


X-ray compass for determining device orientation  

DOE Patents [OSTI]

An apparatus and method for determining the orientation of a device with respect to an x-ray source. In one embodiment, the present invention is coupled to a medical device in order to determine the rotational orientation of the medical device with respect to the x-ray source. In such an embodiment, the present invention is comprised of a scintillator portion which is adapted to emit photons upon the absorption of x-rays emitted from the x-ray source. An x-ray blocking portion is coupled to the scintillator portion. The x-ray blocking portion is disposed so as to vary the quantity of x-rays which penetrate the scintillator portion based upon the particular rotational orientation of the medical device with respect to the x-ray source. A photon transport mechanism is also coupled to the scintillator portion. The photon transport mechanism is adapted to pass the photons emitted from the scintillator portion to an electronics portion. By analyzing the quantity of the photons, the electronics portion determines the rotational orientation of the medical device with respect to the x-ray source.

Da Silva, Luiz B. (Danville, CA); Matthews, Dennis L. (Moss Beach, CA); Fitch, Joseph P. (Livermore, CA); Everett, Matthew J. (Pleasanton, CA); Colston, Billy W. (Livermore, CA); Stone, Gary F. (Livermore, CA)



X-ray compass for determining device orientation  

DOE Patents [OSTI]

An apparatus and method for determining the orientation of a device with respect to an x-ray source are disclosed. In one embodiment, the present invention is coupled to a medical device in order to determine the rotational orientation of the medical device with respect to the x-ray source. In such an embodiment, the present invention is comprised of a scintillator portion which is adapted to emit photons upon the absorption of x-rays emitted from the x-ray source. An x-ray blocking portion is coupled to the scintillator portion. The x-ray blocking portion is disposed so as to vary the quantity of x-rays which penetrate the scintillator portion based upon the particular rotational orientation of the medical device with respect to the x-ray source. A photon transport mechanism is also coupled to the scintillator portion. The photon transport mechanism is adapted to pass the photons emitted from the scintillator portion to an electronics portion. By analyzing the quantity of the photons, the electronics portion determines the rotational orientation of the medical device with respect to the x-ray source. 25 figs.

Da Silva, L.B.; Matthews, D.L.; Fitch, J.P.; Everett, M.J.; Colston, B.W.; Stone, G.F.



Normal incidence x-ray mirror for chemical microanalysis  

DOE Patents [OSTI]

An x-ray mirror for both electron column instruments and micro x-ray fluorescence instruments for making chemical, microanalysis comprises a non-planar mirror having, for example, a spherical reflecting surface for x-rays comprised of a predetermined number of alternating layers of high atomic number material and low atomic number material contiguously formed on a substrate and whose layers have a thickness which is a multiple of the wavelength being reflected. For electron column instruments, the wavelengths of interest lie above 1.5nm, while for x-ray fluorescence instruments, the range of interest is below 0.2nm. 4 figs.

Carr, M.J.; Romig, A.D. Jr.


Note: This page contains sample records for the topic "x-ray diffraction pattern" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fuel Injection and Spray Research Using X-Ray Diagnostics  

Broader source: Energy.gov (indexed) [DOE]

collaborations - Explore new capabilities, applications Upgraded x-ray optics in FY2011 - Allows us to resolve finer structures in spray * Old beamline: 150 m x...


Using Light to Control How X Rays Interact with Matter  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

pulse, a heretofore difficult challenge. This capability should help to further develop ultrafast x-ray spectroscopy. ALS femtosecond spectroscopy beamline layout. Femtosecond...


First principles calculations, neutron, and x-ray diffraction investigation of Y{sub 3}Ni{sub 13}B{sub 2}, Y{sub 3}Co{sub 13}B{sub 2}, and Y{sub 3}Ni{sub 10}Co{sub 3}B{sub 2}  

SciTech Connect (OSTI)

Fully relativistic calculations within the local spin density approximation and the generalized gradient approximation were performed to determine the local spin and orbital magnetic moments, as well as the magnetocrystalline anisotropy energy of Y{sub 3}Ni{sub 13}B{sub 2}, Y{sub 3}Co{sub 13}B{sub 2}, and Y{sub 3}Ni{sub 10}Co{sub 3}B{sub 2} compounds. A weak in-plane magnetic anisotropy is determined for Y{sub 3}Ni{sub 13}B{sub 2}, under the assumption of a crystallographic-like magnetic unit cell and collinear magnetic moments. The calculations predict considerable c-axis anisotropy for Y{sub 3}Co{sub 13}B{sub 2} and Y{sub 3}Ni{sub 10}Co{sub 3}B{sub 2}, but smaller than that of YCo{sub 5}. The values of the magnetocrystalline anisotropy energy correlate well with both the magnitude of the orbital magnetic moment and the orbital magnetic moment anisotropy. The mixing between Co or Ni 3d states and B 2p states, observable at the bottom of the valence band of the 3d metal having a boron atom nearest neighbor, decreases the 3d spin and especially, the 3d orbital magnetic moments. Y{sub 3}Ni{sub 13}B{sub 2} and Y{sub 3}Ni{sub 10}Co{sub 3}B{sub 2} were also investigated by powder neutron diffraction experiments, at temperatures between 1.8 and 249?K. The Co and Ni site averaged magnetic moments calculated in the mixed compound are in fair agreement with the values obtained by the refinement of the magnetic contribution to the diffraction pattern.

Plugaru, N.; Valeanu, M. [National Institute of Materials Physics, Atomistilor Str. 105bis, Magurele-Bucharest 077125, P.O. Box MG-07, Ilfov (Romania); Plugaru, R., E-mail: rodica.plugaru@imt.ro [National Institute for R and D in Microtechnologies, Erou Iancu Nicolae Str. 126A, Bucharest 077190, P.O. Box 38-160 (Romania); Campo, J. [Material Science Institute of Aragon, University of Zaragoza, C.S.I.C., E-50009 Zaragoza (Spain)



Reciprocal space mapping of epitaxial materials using position-sensitive x-ray detection  

SciTech Connect (OSTI)

Reciprocal space mapping can be efficiently carried out using a position-sensitive x-ray detector (PSD) coupled to a traditional double-axis diffractometer. The PSD offers parallel measurement of the total scattering angle of all diffracted x-rays during a single rocking-curve scan. As a result, a two-dimensional reciprocal space map can be made in a very short time similar to that of a one-dimensional rocking-curve scan. Fast, efficient reciprocal space mapping offers numerous routine advantages to the x-ray diffraction analyst. Some of these advantages are the explicit differentiation of lattice strain from crystal orientation effects in strain-relaxed heteroepitaxial layers; the nondestructive characterization of the size, shape and orientation of nanocrystalline domains in ordered-alloy epilayers; and the ability to measure the average size and shape of voids in porous epilayers. Here, the PSD-based diffractometer is described, and specific examples clearly illustrating the advantages of complete reciprocal space analysis are presented.

Lee, S.R.; Doyle, B.L.; Drummond, T.J.; Medernach, J.W.; Schneider, R.P. Jr.



X-ray laser system, x-ray laser and method  

DOE Patents [OSTI]

Disclosed is an x-ray laser system comprising a laser containing generating means for emitting short wave length radiation, and means external to said laser for energizing said generating means, wherein when the laser is in an operative mode emitting radiation, the radiation has a transverse coherence length to width ratio of from about 0.05 to 1. Also disclosed is a method of adjusting the parameters of the laser to achieve the desired coherence length to laser width ratio.

London, Richard A. (Oakland, CA); Rosen, Mordecai D. (Berkeley, CA); Strauss, Moshe (Omer, IL)



2011 U.S. National School on Neutron and X-ray Scattering  

SciTech Connect (OSTI)

The 13th annual U.S. National School on Neutron and X-ray Scattering was held June 11 to 25, 2011, at both Oak Ridge and Argonne National Laboratories. This school brought together 65 early career graduate students from 56 different universities in the US and provided them with a broad introduction to the techniques available at the major large-scale neutron and synchrotron x-ray facilities. This school is focused primarily on techniques relevant to the physical sciences, but also touches on cross-disciplinary bio-related scattering measurements. During the school, students received lectures by over 30 researchers from academia, industry, and national laboratories and participated in a number of short demonstration experiments at Argonne's Advanced Photon Source (APS) and Oak Ridge's Spallation neutron Source (SNS) and High Flux Isotope Reactor (HFIR) facilities to get hands-on experience in using neutron and synchrotron sources. The first week of this year's school was held at Oak Ridge National Lab, where Lab director Thom Mason welcomed the students and provided a shitorical perspective of the neutron and x-ray facilities both at Oak Ridge and Argonne. The first few days of the school were dedicated to lectures laying out the basics of scattering theory and the differences and complementarity between the neutron and x-ray probes given by Sunil Sinha. Jack Carpenter provided an introduction into how neutrons are generated and detected. After this basic introduction, the students received lectures each morning on specific techniques and conducted demonstration experiments each afternoon on one of 15 different instruments at either the SNS or HFIR. Some of the topics covered during this week of the school included inelastic neutron scattering by Bruce Gaulin, x-ray and neutron reflectivity by Chuck Majkrazak, small-angle scattering by Volker Urban, powder diffraction by Ashfia Huq and diffuse scattering by Gene Ice.

Lang, Jonathan [Argonne National Laboratory (ANL); te Vethuis, Suzanne [Argonne National Laboratory (ANL); Ekkebus, Allen E [ORNL; Chakoumakos, Bryan C [ORNL; Budai, John D [ORNL



Constraints on jet X-ray emission in low/hard state X-ray binaries  

E-Print Network [OSTI]

We show that the combination of the similarities between the X-ray properties of low luminosity accreting black holes and accreting neutron stars, combined with the differences in their radio properties argues that the X-rays from these systems are unlikely to be formed in the relativistic jets. Specifically, the spectra of extreme island state neutron stars and low/hard state black holes are known to be indistinguishable, while the power spectra from these systems are known to show only minor differences beyond what would be expected from scaling the characteristic variability frequencies by the mass of the compact object. The spectral and temporal similarities thus imply a common emission mechanism that has only minor deviations from having all key parameters scaling linearly with the mass of the compact object, while we show that this is inconsistent with the observations that the radio powers of neutron stars are typically about 30 times lower than those of black holes at the same X-ray luminosity. We also show that an abrupt luminosity change would be expected when a system makes a spectral state transition from a radiatively inefficient jet dominated accretion flow to a thin disk dominated flow, but that such a change is not seen.

Thomas J. Maccarone
