National Library of Energy BETA

Sample records for wy mt sd

  1. & Scierce Service Feat-? \\WY THE WEATHER ?

    E-Print Network [OSTI]

    No. 39 June 26 & Scierce Service Feat- ? \\WY THE WEATHER ? Dr. Charles F.Brooks, Secretary, American Meteorological Society quotes: TRUTHFUL VEATHEFZ DOGGzEREL Of the hundreds of weather proverbs

  2. File:USDA-CE-Production-GIFmaps-WY.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages RecentTempCampApplicationWorksheet 2011.pdfSD.pdf Jump to: navigation,WY.pdf Jump

  3. Rolling Hills (WY) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-bRenewable Energy|Gas andRofin Sinar TechnologiesWY)

  4. A Science Service Feature 'I ,\\WY THE WEATHER ?

    E-Print Network [OSTI]

    mo. .L73 Dec. 1 A Science Service Feature 'I ,\\WY THE WEATHER ? Dr. Charles F. Bbooks, Secretary temperatures occasionally Occur. me weather Bureau's low record for the month is 50 below zero i n north

  5. RAPID/Roadmap/8-WY-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a <a <8-WY-a <

  6. RAPID/Roadmap/8-WY-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a <a <8-WY-a

  7. Saving Mt. Fuji

    E-Print Network [OSTI]

    Hacker, Randi

    2013-09-12

    Broadcast Transcript: Mt. Fuji, or Fujisan is it is known here in Japan, has just been added to Unesco's World Heritage list as a cultural asset, honoring it for providing thousands of years of inspiration to artists, poets ...

  8. Pipeline MT Instructions Identification Number

    E-Print Network [OSTI]

    Hong, Don

    Pipeline MT Instructions Identification Number For identification purposes, you will be assigned a special identification number. M# You can activate your MT email, login to PipelineMT to register for classes or pay tuition and fees. Activating the MTSU Email and PipelineMT accounts: Visit the website

  9. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Broader source: Energy.gov (indexed) [DOE]

    2 1 Locations of Smart Grid Demonstration and Large-Scale Energy Storage Projects NH 32 Awards Support Projects in 24 States 6 11 MA...

  10. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeedofDepartment ofDeploymentDepartmentService2 1

  11. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeedofDepartment ofDeploymentDepartmentService2 1 2 1

  12. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeedofDepartment ofDeploymentDepartmentService2 1 2 1 7

  13. Basin Play State(s) Production Reserves Williston Bakken ND, MT, SD

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1 Table 1.101 (Million Short6RU Ntight oil plays:

  14. Category:Pierre, SD | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia:GeothermalNEPA EnvironmentalOpenEI policiesPierre, SD

  15. Wireless Stethoscope for Recording Heart and Lung Sound W.Y. Shi, Jeffrey Mays, and J.-C. Chiao

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    Wireless Stethoscope for Recording Heart and Lung Sound W.Y. Shi, Jeffrey Mays, and J.-C. Chiao acoustic properties of the heart and lung sounds using a wearable wireless stethoscope. Cardiac action parameters were extracted from the recorded digitized heart sound and analyzed. The cardiac pulse and lung

  16. Mt. Baker Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt StMt.

  17. BUILDING BETTER CONE JET ALGORITHMS S.D. Ellis,1

    E-Print Network [OSTI]

    Huston, Joey

    BUILDING BETTER CONE JET ALGORITHMS S.D. Ellis,1 J. Huston,2 and M. Tnnesmann3 1 Seattle, WA 98195, such as jet algorithms, to more reliably bridge the gap between theory and experiment. We present recent results on the development of better cone jet algorithms. I. INTRODUCTION A common facet of essentially

  18. 1Department of Wildlife and Fisheries Sciences, South Dakota State University, SNP 138, Brookings, SD 57007. 2Present address: Wyoming Game and Fish Department, Box 850, Pinedale, WY 82941. E-mail: luke.schultz@wyo.gov

    E-Print Network [OSTI]

    . Mountain sucker LTM is intermediate compared to other species in the family Catostomidae. These results

  19. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)MtMt

  20. Preliminary draft industrial siting administration permit application: Socioeconomic factors technical report. Final technical report, November 1980-May 1982. [Proposed WyCoalGas project in Converse County, Wyoming

    SciTech Connect (OSTI)

    Not Available

    1982-01-01

    Under the with-project scenario, WyCoalGas is projected to make a difference in the long-range future of Converse County. Because of the size of the proposed construction and operations work forces, the projected changes in employment, income, labor force, and population will alter Converse County's economic role in the region. Specifically, as growth occurs, Converse County will begin to satisfy a larger portion of its own higher-ordered demands, those that are currently being satisfied by the economy of Casper. Business-serving and household-serving activities, currently absent, will find the larger income and population base forecast to occur with the WyCoalGas project desirable. Converse County's economy will begin to mature, moving away from strict dependence on extractive industries to a more sophisticated structure that could eventually appeal to national, and certainly, regional markets. The technical demand of the WyCoalGas plant will mean a significant influx of varying occupations and skills. The creation of basic manufacturing, advanced trade and service sectors, and concomitant finance and transportation firms will make Converse County more economically autonomous. The county will also begin to serve market center functions for the smaller counties of eastern Wyoming that currently rely on Casper, Cheyenne or other distant market centers. The projected conditions expected to exist in the absence of the WyCoalGas project, the socioeconomic conditions that would accompany the project, and the differences between the two scenarios are considered. The analysis is keyed to the linkages between Converse County and Natrona County.

  1. Supporting Information Geobacter sp. SD-1 with enhanced electrochemical activity in high salt

    E-Print Network [OSTI]

    1 Supporting Information Geobacter sp. SD-1 with enhanced electrochemical activity in high salt title: Geobacter sp. SD-1 in high salt solutions #12;2 Fig. S1. Current generation as a function of time

  2. AA Dor - An Eclipsing sdOB - Brown Dwarf Binary

    E-Print Network [OSTI]

    Thomas Rauch

    2003-11-25

    AA Dor is an eclipsing, close, post common-envelope binary consisting of a sdOB primary star and an unseen secondary with an extraordinary small mass - formally a brown dwarf. The brown dwarf may have been a former planet which survived a common envelope phase and has even gained mass. A recent determination of the components' masses from results of NLTE spectral analysis and subsequent comparison to evolutionary tracks shows a discrepancy to masses derived from radial-velocity and the eclipse curves. Phase-resolved high-resolution and high-SN spectroscopy was carried out in order to investigate on this problem. We present results of a NLTE spectral analysis of the primary, an analysis of its orbital parameters, and discuss possible evolutionary scenarios.

  3. Developing Mt. Hope: The megawatt line

    SciTech Connect (OSTI)

    Rodzianko, P.; Fisher, F.S.

    1992-12-01

    After facing numerous obstacles, including opposition and competition, the Mt. Hope pumped-storage project in New Jersey has been licensed by FERC. That license will allow a former iron ore mine site to be used in producing a new resource-hydroelectricity. In early August 1992, after more than seven years of effort, the 2,000-MW Mt. Hope Waterpower Project was licensed by the Federal Energy Regulatory Commission (FERC). Getting the $1.8 billion pumped-storage project licensed was not an easy task. It involved 54 submittals to FERC, six public meetings, and costs of more than $12 million. Along the way, the project has withstood competing applications, community opposition, and legal battles. Getting a project of this magnitude off the ground is a challenge for even the most experienced developer. The effort was especially challenging for the Halecrest Company, a local family-owned and operated firm with no previous experience in hydroelectric development. When financing became tight, creative ways were found to raise seed capital for the project. When hydroelectric experience was needed, the company developed a world-class corporate team that carried Mt. Hope through the complexities of the licensing process and beyond. With license now in hand, the project developers are ready to move forward with negotiating power sales contracts and securing construction financing. The resulting project will be the second largest pumped-storage facility in the country-second only to the 2,100-MW Bath County project in Virginia. Mt. Hope will take six years to construct and is scheduled to be phased into operation beginning in 1999.

  4. Heavy metals and lead isotopes in sdB stars

    E-Print Network [OSTI]

    S. O'Toole; U. Heber

    2006-12-19

    We present a detailed abundance analysis of high-resolution ultraviolet echelle spectra of five subdwarf B stars obtained with HST-STIS The goal of our observations was to test the hypothesis that pulsations in sdBs are correlated to the surface abundances of iron-group elements. We study two pulsators and three non-pulsators and determined abundances for 25 elements including the iron group and even heavier elements such as tin and lead using LTE spectrum synthesis techniques. We find strong enrichments of heavy elements up to 2.9dex with respect to solar which are probably caused by atomic diffusion processes. No clear-cut correlation between pulsations and metal abundances becomes apparent. Abundances for lead isotopes are derived from very high resolution spectra using an UV line of triply ionised lead. As Pb terminates the s-process sequence Pb isotopic abundance ratios yield important constraints. It is very difficult to measure them in hot stars. For the first time we were able to measure them in two subluminous B stars and conclude that the 207Pb/208Pb is solar.

  5. Wyoming coal-conversion project. Final technical report, November 1980-February 1982. [Proposed WyCoalGas project, Converse County, Wyoming; contains list of appendices with title and identification

    SciTech Connect (OSTI)

    1982-01-01

    This final technical report describes what WyCoalGas, Inc. and its subcontractors accomplished in resolving issues related to the resource, technology, economic, environmental, socioeconomic, and governmental requirements affecting a project located near Douglas, Wyoming for producing 150 Billion Btu per day by gasifying sub-bituminous coal. The report summarizes the results of the work on each task and includes the deliverables that WyCoalGas, Inc. and the subcontractors prepared. The co-venturers withdrew from the project for two reasons: federal financial assistance to the project was seen to be highly uncertain; and funds were being expended at an unacceptably high rate.

  6. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)Mt

  7. Mt Wheeler Power, Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs

  8. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt Geothermal Area Jump to: navigation, search

  9. Mt Signal Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:PosoMt

  10. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson...

    Open Energy Info (EERE)

    Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson & Dellechaie, 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water...

  11. Refraction Survey At Mt Princeton Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et Al., 2012) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Refraction...

  12. 3D Mt Resistivity Imaging For Geothermal Resource Assessment...

    Open Energy Info (EERE)

    3D Mt Resistivity Imaging For Geothermal Resource Assessment And Environmental Mitigation At The Glass Mountain Kgra, California Jump to: navigation, search OpenEI Reference...

  13. Vertical Electrical Sounding Configurations At Mt Princeton Hot...

    Open Energy Info (EERE)

    Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs Geothermal Area (Zohdy, Et Al., 1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home...

  14. Direct-Current Resistivity Survey At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area (Richards, Et Al., 2010) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity:...

  15. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl...

    Open Energy Info (EERE)

    Et Al., 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al., 1976)...

  16. Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression

    E-Print Network [OSTI]

    Gelman, Andrew

    Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression Comparing Andrew Gelman Some Recent Progress in Simple Statistical Methods #12;Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression Comparing the upper third to the lower third

  17. MT3DMS v5.3 Supplemental User's Guide

    E-Print Network [OSTI]

    Zheng, Chunmiao

    published by the U.S. Army Corps of Engineers (Zheng and Wang, 1999; available at http://hydro.geo.ua.edu/mt3d). Readers should refer to Zheng and Wang (1999) for complete information on the theoretical Tonkin, Henning Prommer, Chris Langevin, Ned Banta, Eileen Poeter, and Rui Ma in various aspects of MT3

  18. MOBILE INTERACTIVE VISITOR INFORMATION SERVICE: PUKAHA MT. BRUCE TRIAL RESULTS

    E-Print Network [OSTI]

    Zealand Tourism Research Institute Sept 2005 #12;New Zealand Tourism Research Institute September 2005 www Information Service (MIVIS) mobile phones to access audio information at Pukaha Mt Bruce (PMB) were collected and range of visitors using the MIVIS phones in the Pukaha Mt Bruce setting. #12;New Zealand Tourism

  19. WPA Omnibus Award MT Wind Power Outreach

    SciTech Connect (OSTI)

    Brian Spangler, Manager Energy Planning and Renewables

    2012-01-30

    The objective of this grant was to further the development of Montana??s vast wind resources for small, medium, and large scale benefits to Montana and the nation. This was accomplished through collaborative work with wind industry representatives, state and local governments, the agricultural community, and interested citizens. Through these efforts MT Dept Environmental Quality (DEQ) was able to identify development barriers, educate and inform citizens, as well as to participate in regional and national dialogue that will spur the development of wind resources. The scope of DEQ??s wind outreach effort evolved over the course of this agreement from the development of the Montana Wind Working Group and traditional outreach efforts, to the current focus on working with the state??s university system to deliver a workforce trained to enter the wind industry.

  20. Chi tit mn hc mt bn kia.

    E-Print Network [OSTI]

    California at Davis, University of

    v xã hi, ý n môi trng và sáng to. "Th ô xe p ca Hoa K," Davis là mt cng ng a dng và nng ng chào ón, Phát ?m và Nghe Trong Lãnh Vc Hc Tp, và các lãnh vc khác. Ngoài ra cng có nhiu c hi tham gia các t chc ti trng và phc v cng ng. Mun bit ngày tháng, hc phí và các chi tit khác, hãy n: www

  1. Mineralogic variation in drill holes USW NRG-6, NRG-7/7a, SD-7, SD-9, SD-12, and UZ{number_sign}14: New data from 1996--1997 analyses

    SciTech Connect (OSTI)

    Chipera, S.J.; Vaniman, D.T.; Bish, D.L.; Carey, J.W.

    1997-05-30

    New quantitative X-ray diffraction (QXRD) mineralogic data have been obtained for samples from drill holes NRG-6, NRG-7/7A, SD-7, SD-9, SD- 12, and UZ{number_sign}14. In addition, new QXRD analyses were obtained on samples located in a strategic portion of drill hole USW H-3. These data improve our understanding of the mineral stratigraphy at Yucca Mountain, and they further constrain the 3-D Mineralogic Model of Yucca Mountain. Some of the unexpected findings include the occurrence of the zeolite chabazite in the vitric zone of USW SD-7, broad overlap of vitric and zeolitic horizons (over vertical ranges up to 70 m), and the previously unrecognized importance of the bedded tuft beneath the Calico Hills Formation as a subunit with generally more extensive zeolitization than the Calico Hills Formation in the southern part of the potential repository area. Reassessment of data from drill hole USW H-5 suggests that the zeolitization of this bedded unit occurs in the northwestern part of the repository exploration block as well. Further analyses of the same interval in USW H-3, however, have not permitted the same conclusion to be reached for the southwestern part of the repository block because of the much poorer quality of the cuttings in H-3 compared with those from H-5. X-ray fluorescence (XRF) chemical data for drill holes USW SD-7, 9, and 12 show that the zeolitic horizons provide a >10 million year record of retardation of Sr transport, although the data also show that simplistic models of one-dimensional downward flow in the unsaturated zone (UZ) are inadequate. Complex interstratification of zeolites and glass, with highly variable profiles between drill cores, point to remaining problems in constructing detailed mineral stratigraphies. However, the new data in this report provide important information for constructing bounding models of zeolite stratigraphy for transport calculations.

  2. WY Final EA DRAFT

    Energy Savers [EERE]

    in-water work may be necessary to fix levee breaches. These actions could impact listed fish species through construction activities as well as by isolation of fish behind the...

  3. WY FONSI DRAFT

    Broader source: Energy.gov (indexed) [DOE]

    Act, 16 USC 839b(h)(10)(A), BPA has an obligation to protect, mitigate, and enhance fish and wildlife, and their habitats, affected by the development and operation of the...

  4. WY FONSI DRAFT

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematics And Statistics » USAJobs SearchAMERICA'S FUTURE. regulators02-03 AUDIT REPORT U.S.WWSIS Phase

  5. WY Final EA DRAFT

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'S FUTURE. regulators consumer advocates5-4: QualityMakeup Tank and

  6. Recycling Lingware in a Multilingual MT System Steffen Leo Hansen

    E-Print Network [OSTI]

    Recycling Lingware in a Multilingual MT System Steffen Leo Hansen Manny Rayner David Carter Ivan (Rayner and Carter, 1997). The first is the most obvious: we start with a function- ing grammar

  7. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    lithologic distrubtions Notes Gravity low associated with Mt. Princeton Batholith; density contrast of -0.5 gcm3 of valley-fill sediments relative to batholith References J.E....

  8. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 2 Data Review-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 3

  9. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt St

  10. Canister storage building compliance assessment SNF project NRC equivalency criteria - HNF-SD-SNF-DB-003

    SciTech Connect (OSTI)

    BLACK, D.M.

    1999-08-11

    This document presents the Project's position on compliance with the SNF Project NRC Equivalency Criteria--HNF-SD-SNF-DE-003, Spent Nuclear Fuel Project Path Forward Additional NRC Requirements. No non-compliances are shown The compliance statements have been reviewed and approved by DOE. Open items are scheduled to be closed prior to project completion.

  11. sd2 Graphene: Kagome Band in a Hexagonal Lattice Miao Zhou,1

    E-Print Network [OSTI]

    Simons, Jack

    sd2 Graphene: Kagome Band in a Hexagonal Lattice Miao Zhou,1 Zheng Liu,1 Wenmei Ming,1 Zhengfei 2014; published 2 December 2014) Graphene, made of sp2 hybridized carbon, is characterized with a Dirac band, representative of its underlying 2D hexagonal lattice. The fundamental understanding of graphene

  12. Probing the lexicon in evaluating commercial MT systems Martin Volk

    E-Print Network [OSTI]

    for self evaluation consisted of technical, linguistic and ergonomic issues. As part of the linguisticProbing the lexicon in evaluating commercial MT systems Martin Volk University of Zurich Department Abstract In the past the evaluation of machine trans- lation systems has focused on single sys- tem

  13. (Have we found the Holy Grail?) Panel at MT-Summit 2003

    E-Print Network [OSTI]

    Wu, Dekai

    (Have we found the Holy Grail?) Panel at MT-Summit 2003 #12;The HKUST Leading Question Translation? If not, is the Holy Grail just around the corner? Translation Are we just about done? #12;Dekai Wu, MT

  14. Geothermal energy resource investigations at Mt. Spurr, Alaska

    SciTech Connect (OSTI)

    Turner, D.L.; Wescott, E.M. (eds.)

    1986-12-01

    Spurr volcano is a composite Quaternary cone of largely andesitic composition located on the west side of Cook Inlet about 80 miles west of Anchorage and about 40 miles from the Beluga electrical transmission line. Geologic mapping (Plate 1-1) shows that the present summit depression was produced by a Mt. St. Helens-type sector collapse, rather than by a caldera collapse. Geochronologic and previous tephrachronologic studies show that there has been an active magmatic system at Spurr volcano during the late Pleistocene-to-Holocene time interval that is of critical interest for geothermal energy resource assessment. Major effort was devoted to geochemical and geophysical surveys of the accessible area south of Mt. Spurr, in addition to geologic mapping and geochronologic studies. Many coincident mercury and helium anomalies were found, suggesting the presence of geothermal systems at depth. Extremely large electrical self-potential anomalies were also found, together with extensive zones of low resistivity discovered by our controlled-source audiomagnetotelluric survey. The juxtaposition of all of these different types of anomalies at certain areas on the south slope of Crater Peak indicates the presence of a geothermal system which should be accessible by drilling to about 2000 ft depth. It is also evident that there is a strong volcanic hazard to be evaluated in considering any development on the south side of Mt. Spurr. This hazardous situation may require angle drilling of production wells from safer areas and placement of power generation facilities at a considerable distance from hazardous areas.

  15. File:USDA-CE-Production-GIFmaps-SD.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages RecentTempCampApplicationWorksheet 2011.pdfSD.pdf Jump to: navigation, search File

  16. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St Helens

  17. MT Energie GmbH Co KG | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolar Jump to:Industries Inc JumpMT

  18. RAPID/Roadmap/12-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-aCA-aMT-a <

  19. RAPID/Roadmap/15-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ceWA-eb <MT-a

  20. RAPID/Roadmap/17-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aaMT-c

  1. RAPID/Roadmap/18-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-badMT-b

  2. RAPID/Roadmap/4-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aab <cdMT-a <

  3. RAPID/Roadmap/6-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-d

  4. RAPID/Roadmap/6-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-df

  5. City of Mt Pleasant, Utah (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121City of Mt

  6. Mt Princeton Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs Geothermal

  7. RAPID/Roadmap/14-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b <

  8. RAPID/Roadmap/14-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b

  9. RAPID/Roadmap/14-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-bd

  10. RAPID/Roadmap/17-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad-MT-d < RAPID‎ |

  11. RAPID/Roadmap/20-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a < RAPID‎ |MT-a <

  12. RAPID/Roadmap/8-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a < RAPID‎ID-eMT-a

  13. Micro-Earthquake At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedicalInformation 2-2005)1995) |Information

  14. HERO Ski Trip to Mt. Hood Meadows February

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low WeUpdateScienceForTrip to Mt. Hood Meadows

  15. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Strategies for Rural Communities. National Conference onallocation facing the rural community of Mt. Laguna? (EquityStrategies for Rural Communities. National Conference on

  16. DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot...

    Open Energy Info (EERE)

    1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot Springs Geothermal Area...

  17. Source identification in acoustics and structural mechanics using Sierra/SD.

    SciTech Connect (OSTI)

    Walsh, Timothy Francis; Aquino, Wilkins; Ross, Michael

    2013-03-01

    In this report we derive both time and frequency-domain methods for inverse identification of sources in elastodynamics and acoustics. The inverse/design problem is cast in a PDE-constrained optimization framework with efficient computation of gradients using the adjoint method. The implementation of source inversion in Sierra/SD is described, and results from both time and frequency domain source inversion are compared to actual experimental data for a weapon store used in captive carry on a military aircraft. The inverse methodology is advantageous in that it provides a method for creating ground based acoustic and vibration tests that can reduce the actual number of flight tests, and thus, saving costs and time for the program.

  18. Visual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT Complex

    E-Print Network [OSTI]

    Dumoulin, Serge O.

    of processing in human motion-selective cortex. I N T R O D U C T I O N Neuroimaging experiments localize human by additional experiments. Defining human MT based on stimulus selectivity means that the identificationVisual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT

  19. Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer

    E-Print Network [OSTI]

    Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer ETH Zurich International Publishing Switzerland 2014 #12;314 C. Decker and R. Wattenhofer exchanges its monopoly slowly doubled the withdrawn bitcoins, once from the withdrawal and once on its account on MtGox. In this work we

  20. An assessment of regional climate trends and changes to the Mt. Jaya glaciers of Irian Jaya

    E-Print Network [OSTI]

    Kincaid, Joni L.

    2007-09-17

    on the Mt. Jaya glaciers has been lacking since the early 1970s. Using IKONOS satellite images, the ice extents of the Mt. Jaya glaciers in 2000, 2002, 2003, 2004, and 2005 were mapped. The mapping indicates that the recessional trend which began in the mid...

  1. Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging

    E-Print Network [OSTI]

    Oxford, University of

    Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging.pugnaghi@unimore.it, gabriele.gangale@unimore.it Abstract. A retrieval of tropospheric volcanic ash from Mt Etna has been. In order to derive the ash plume optical thickness, the particle effective radius and the total mass

  2. A MT System from Turkmen to Turkish Employing Finite State and Statistical Methods

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    between close language pairs can be relatively easier and can still benefit from simple(r) paradigms in MT with a disambiguation post-processing stage based on statistical language models. The very productive inflectionalA MT System from Turkmen to Turkish Employing Finite State and Statistical Methods A. Cneyd TANTU

  3. Baltic Astronomy, vol. 14, XXXXXX, 2005. SPECTRAL ANALYSIS OF sdB-He STARS FROM THE SDSS

    E-Print Network [OSTI]

    2005 July 28 Abstract. We present spectral classification and physical parameters of a sam- ple of "helium-rich" sdB-He stars from spectra obtained from the SDSS archive. The spectral classification discovered amongst the many thousand hot subdwarfs in the recent Quasar survey the Sloan Digital Sky Survey

  4. Baltic Astronomy, vol. 14, XXX--XXX, 2005. SPECTRAL ANALYSIS OF sdBHe STARS FROM THE SDSS

    E-Print Network [OSTI]

    Jeffery, Simon

    2005 July 28 Abstract. We present spectral classification and physical parameters of a sam ple of ``heliumrich'' sdBHe stars from spectra obtained from the SDSS archive. The spectral classification discovered amongst the many thousand hot subdwarfs in the recent Quasar survey -- the Sloan Digital Sky

  5. Extending the GHS Weil Descent Attack S.D. Galbraith, F. Hess and N.P. Smart

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Extending the GHS Weil Descent Attack S.D. Galbraith, F. Hess and N.P. Smart Department of Computer Science, University of Bristol, Merchant Venturers Building, Woodland Road, Bristol, BS8 1UB, United due to Gaudry, Hess and Smart (GHS) to a much larger class of elliptic curves. This extended attack

  6. Proposal for the Award of a Contract for the Civil Engineering Work on the Extensions to Buildings SUH and SD at LEP Access point nr. 2

    E-Print Network [OSTI]

    1990-01-01

    Proposal for the Award of a Contract for the Civil Engineering Work on the Extensions to Buildings SUH and SD at LEP Access point nr. 2

  7. MT3D: a 3 dimensional magnetotelluric modeling program (user's guide and documentation for Rev. 1)

    SciTech Connect (OSTI)

    Nutter, C.; Wannamaker, P.E.

    1980-11-01

    MT3D.REV1 is a non-interactive computer program written in FORTRAN to do 3-dimensional magnetotelluric modeling. A 3-D volume integral equation has been adapted to simulate the MT response of a 3D body in the earth. An integro-difference scheme has been incorporated to increase the accuracy. This is a user's guide for MT3D.REV1 on the University of Utah Research Institute's (UURI) PRIME 400 computer operating under PRIMOS IV, Rev. 17.

  8. Improved determination of the atmospheric parameters of the pulsating sdB star Feige 48

    SciTech Connect (OSTI)

    Latour, M.; Fontaine, G.; Brassard, P.; Green, E. M.; Chayer, P.

    2014-06-10

    As part of a multifaceted effort to better exploit the asteroseismological potential of the pulsating sdB star Feige 48, we present an improved spectroscopic analysis of that star based on new grids of NLTE, fully line-blanketed model atmospheres. To that end, we gathered four high signal-to-noise ratio time-averaged optical spectra of varying spectral resolutions from 1.0 to 8.7 , and we made use of the results of four independent studies to fix the abundances of the most important metals in the atmosphere of Feige 48. The mean atmospheric parameters we obtained from our four spectra of Feige 48 are: T {sub eff} = 29,850 60 K, log g = 5.46 0.01, and log N(He)/N(H) = 2.88 0.02. We also modeled, for the first time, the He II line at 1640 from the STIS archive spectrum of the star, and with this line we found an effective temperature and a surface gravity that match well with the values obtained with the optical data. With some fine tuning of the abundances of the metals visible in the optical domain, we were able to achieve a very good agreement between our best available spectrum and our best-fitting synthetic one. Our derived atmospheric parameters for Feige 48 are in rather good agreement with previous estimates based on less sophisticated models. This underlines the relatively small effects of the NLTE approach combined with line blanketing in the atmosphere of this particular star, implying that the current estimates of the atmospheric parameters of Feige 48 are reliable and secure.

  9. NEAFS Y-mtDNA Workshop (Butler and Coble) Markers, Core Loci, and Kits

    E-Print Network [OSTI]

    ) Ann Gross (MN) Jill Smerick (FBI) Sam Baechtel (FBI) Roger Frappier (CFS) Phil Kinsey (OR now MT) Gary Sims (CA DOJ) George Carmody (retired) Mike Adamowicz (CT) Bruce Budowle (FBI

  10. TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL TRANSFORM

    E-Print Network [OSTI]

    Sandsten, Maria

    TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL between all channel pairs. Time-frequency coherence functions are estimated using the multiple window

  11. The Genetic Structure of the Kuwaiti Population: mtDNA Inter- and Intra-population Variation

    E-Print Network [OSTI]

    Theyab, Jasem; Al-Bustan, Suzanne; Crawford, Michael H.

    2012-08-01

    it to their neighboring populations. These subpopulations were tested for genetic homogeneity and shown to be heterogeneous. Restriction fragment length polymorphism (RFLP) and mtDNA sequencing analyses of HVRI were used to reconstruct the genetic structure of Kuwait...

  12. Implied motion activation in cortical area MT can be explained by visual low-level features

    E-Print Network [OSTI]

    Oram, Mike

    ForReview Only Implied motion activation in cortical area MT can be explained by visual low Neuroscience #12;ForReview Only 1 Implied motion activation in cortical area MT can be explained by visual low, The Netherlands Page 1 of 51 Jounal of Cognitive Neuroscience 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

  13. Experiment operations plan for the MT-4 experiment in the NRU reactor. [PWR

    SciTech Connect (OSTI)

    Russcher, G.E.; Wilson, C.L.; Parchen, L.J.; Marshall, R.K.; Hesson, G.M.; Webb, B.J.; Freshley, M.D.

    1983-06-01

    A series of thermal-hydraulic and cladding materials deformation experiments were conducted using light-water reactor fuel bundles as part of the Pacific Northwest Laboratory Loss-of-Coolant Accident (LOCA) Simulation Program. This report is the formal operations plan for MT-4 - the fourth materials deformation experiment conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. A major objective of MT-4 was to simulate a pressurized water reactor LOCA that could induce fuel rod cladding deformation and rupture due to a short-term adiabatic transient and a peak fuel cladding temperature of 1200K (1700/sup 0/F).

  14. Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT 59717

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT M.S. Electrical Engineering University of Utah 1987 B.S. Electrical Engineering University of Alaska Experience: 2008 present Professor Electrical & Computer Engineering (ECE) Department, Montana State

  15. Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT

    E-Print Network [OSTI]

    Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT Yuan formalism specifically designed for syntax-based sta- tistical machine translation. The synchro- nous between lan- guages, which many other synchronous grammars are unable to model. A Depend- ency Insertion

  16. MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS Why mountain bluebirds

    E-Print Network [OSTI]

    Duckworth, Rene

    MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS TURF WAR TWIST Why mountain bluebirds are good for this species in western Montana valleys but don't benefit, in the long run, mountain bluebirds. Although mountain blue- birds also lost nesting sites, they had evolved to also use habitats at higher

  17. Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew LJ

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew in the Python programming language, drawing on Python's builtin library, the RPy extension, ArcGIS geoprocessing and ArcGIS Server. As inputs, it accepts transect shapefiles, transect text files, or point

  18. MT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the

    E-Print Network [OSTI]

    Zheng, Chunmiao

    .M. Cozzarelli, M.H. Lahvis, and B.A. Bekins. 1998. Ground water contamination by crude oil near Bemidji (LNAPL) contaminant through the unsaturated zone and the formation of an oil lens on the water tableMT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the Hydrocarbon

  19. Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units

    E-Print Network [OSTI]

    Way, Andy

    Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units Felipe Sanchez-Martinez Mikel L. Forcada Andy Way Dept. Llenguatges i Sistemes Inform`atics Universitat University Dublin 9, Ireland {mforcada,away}@computing.dcu.ie Abstract This paper describes a hybrid machine

  20. Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy and GPS

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy stress Japan The Earth's stress regime is fundamental to its physical processes, yet few methods can determine absolute stress, and measurements of temporal variations in stress are controversial. The Global

  1. Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts

    E-Print Network [OSTI]

    Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts TIMOTHY W. NEWCOMB and THOMAS. Helens, which was completely decimated with vol- canic ash and mud slides. Heavy sediment loads smolts were exposed to various concentrations ofairborne volcanic ash from the 18 May 1980 eruption

  2. High-latitude vegetation dynamics: 850 years of vegetation development on Mt Hekla, Iceland

    E-Print Network [OSTI]

    Cutler, Nick

    2008-01-01

    on Mt Hekla in south-central Iceland. The chronosequence approach was used to infer 850 years of vegetation development from a suite of 14 lava flows (five of which had been disturbed by the deposition of volcanic tephra). The thesis is organised around...

  3. Geophys. 1. R. astr. Soc. (1987),89,7-18 MT and reflection: an essential combination

    E-Print Network [OSTI]

    Jones, Alan G.

    1987-01-01

    ) studies and seismic reflection profiles conducted. Unfortunately, over many more regions the seismic of the magnetotelluric (MT) technique as having a vertical resolution equivalent to the seismic refraction method, in almost every case, be made wherever a seismic reflection survey is undertaken. Examples are shown from

  4. T-Duality of Green-Schwarz Superstrings on AdS(d) x S(d) x M(10-2d)

    E-Print Network [OSTI]

    Abbott, Michael C; Penati, Silvia; Pittelli, Antonio; Sorokin, Dmitri; Sundin, Per; Tarrant, Justine; Wolf, Martin; Wulff, Linus

    2015-01-01

    We verify the self-duality of Green-Schwarz supercoset sigma models on AdS$_d \\times S^d $ backgrounds (d=2,3,5) under combined bosonic and fermionic T-dualities without gauge fixing kappa symmetry. We also prove this property for superstrings on AdS$_d \\times S^d \\times S^d$ (d=2,3) described by supercoset sigma models with the isometries governed by the exceptional Lie supergroups $D(2,1;\\alpha)$ (d=2) and $D(2,1;\\alpha)\\times D(2,1;\\alpha)$ (d=3), which requires an additional T-dualisation along one of the spheres. Then, by taking into account the contribution of non-supercoset fermionic modes (up to the second order), we provide evidence for the T-self-duality of the complete type IIA and IIB Green-Schwarz superstring theory on AdS$_d\\times S^d \\times T^{10-2d}$ (d=2,3) backgrounds with Ramond-Ramond fluxes. Finally, applying the Buscher-like rules to T-dualising supergravity fields, we prove the T-self-duality of the whole class of the AdS$_d\\times S^d \\times M^{10-2d}$ superbackgrounds with Ramond-Ramon...

  5. T-Duality of Green-Schwarz Superstrings on AdS(d) x S(d) x M(10-2d)

    E-Print Network [OSTI]

    Michael C. Abbott; Jeff Murugan; Silvia Penati; Antonio Pittelli; Dmitri Sorokin; Per Sundin; Justine Tarrant; Martin Wolf; Linus Wulff

    2015-09-25

    We verify the self-duality of Green-Schwarz supercoset sigma models on AdS$_d \\times S^d $ backgrounds (d=2,3,5) under combined bosonic and fermionic T-dualities without gauge fixing kappa symmetry. We also prove this property for superstrings on AdS$_d \\times S^d \\times S^d$ (d=2,3) described by supercoset sigma models with the isometries governed by the exceptional Lie supergroups $D(2,1;\\alpha)$ (d=2) and $D(2,1;\\alpha)\\times D(2,1;\\alpha)$ (d=3), which requires an additional T-dualisation along one of the spheres. Then, by taking into account the contribution of non-supercoset fermionic modes (up to the second order), we provide evidence for the T-self-duality of the complete type IIA and IIB Green-Schwarz superstring theory on AdS$_d\\times S^d \\times T^{10-2d}$ (d=2,3) backgrounds with Ramond-Ramond fluxes. Finally, applying the Buscher-like rules to T-dualising supergravity fields, we prove the T-self-duality of the whole class of the AdS$_d\\times S^d \\times M^{10-2d}$ superbackgrounds with Ramond-Ramond fluxes in the context of supergravity.

  6. Trigonometric Parallaxes for Two Late-Type Subdwarfs: LSR1425+71 (sdM8.0) and the Binary LSR1610-00 (sd?M6pec)

    E-Print Network [OSTI]

    C. C. Dahn; H. C. Harris; S. E. Levine; T. Tilleman; A. K. B. Monet; R. C. Stone; H. H. Guetter; B. Canzian; J. R. Pier; W. I. Hartkopf; J. Liebert; M. Cushing

    2008-06-13

    Trigonometric parallax astrometry and BVI photometry are presented for two late-type subdwarf candidates, LSR1425+71 (sdM8.0) and LSR1610-00 (sd?M6pec). For the former we measure an absolute parallax of 13.37+/-0.51 mas yielding Mv=15.25+/-0.09. The astrometry for LSR1610-00 shows that this object is an astrometric binary with a period of 1.66+/-0.01 yr. The photocentric orbit is derived from the data; it has a moderate eccentricity (e ~ 0.44+/-0.02) and a semi-major axis of 0.28+/-0.01 AU based on our measured absolute parallax of 31.02+/-0.26 mas. Our radial velocity measure of -108.1+/-1.6 km/s for LSR1610-00 at epoch 2006.179, when coupled with the observation of -95+/-1 km/s at epoch 2005.167 by Reiners & Basri, indicates a systemic radial velocity of -101+/-1 km/s for the LSR1610-00AB pair. The galactic velocity components for LSR1425+71 and LSR1610-00AB -- (U,V,W)=(84+/-6, -202+/-13, 66+/-14) km/s and (U,V,W)=(36+/-2, -232+/-2, -61+/-2) km/s, respectively. For both stars, the velocities are characteristic of halo population kinematics. However, modeling shows that both stars have orbits around the galaxy with high eccentricity that pass remarkably close to the galactic center. LSR1425+71 has a luminosity and colors consistent with its metal-poor subdwarf spectral classification, while LSR1610-00 has a luminosity and most colors indicative of being only mildly metal-poor, plus a uniquely red B-V color. The companion to LSR1610-00 must be a low-mass, substellar brown dwarf. We speculate on the paradoxical nature of LSR1610-00 and possible sources of its peculiarities.

  7. Hazard assessment in geothermal exploration: The case of Mt. Parker, Southern Philippines

    SciTech Connect (OSTI)

    Delfin, F.G. Jr.; Salonga, N.D.; Bayon, F.E.B.

    1996-12-31

    Hazard assessment of the Mt. Parker geothermal prospect, conducted in parallel with the surface exploration from 1992 to 1994, was undertaken to determine the long-term suitability of the prospect for development. By comparison with other acidic magmatic-hydrothermal systems in the Philippines, the geochemical data indicated minimal input of acidic magmatic fluids into Mt. Parker`s hydrothermal system. This system was regarded to be a neutral-pH and high-enthalpy chloride reservoir with temperature of at least 200-250{degrees}C. These favorable geochemical indications contrasted sharply with the C-14 and volcanological data indicating a shallow magmatic body with a potential for future eruption. This hazard led PNOC EDC to discontinue the survey and abandon the prospect by late 1994. On September 6, 1995, a flashflood of non-volcanic origin from the caldera lake killed nearly 100 people on the volcano`s northwestern flank.

  8. BiL4i|h@ EtU@ Q b @h3L 2ff L? 4i?L _ SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EtU@ Q b @h3L 2ff L? 4i?L _ SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *@*ic tLTh@ H t sxr u@hi *Ec fc i ~ ' Efc c f n |Ec fc f n rEfc fc E@ AhL@hi ?@ hi||@ o T@tt@?|i Tih *

  9. Rock Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area (Frank, 1995)

  10. EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth W and

    E-Print Network [OSTI]

    Bhashyam, Srikrishna

    EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth a bandpass signal x(t) = m1(t) cos 2fct - m2(t) sin 2fct. (a) Determine the in-phase and quadrature components of this signal when the local os- cillators used have a phase offset of , i.e., they are cos (2fct

  11. Tidally dominated depositional environment for the Mt. Simon Sandstone in central Illinois

    SciTech Connect (OSTI)

    Sargent, M.L.; Lasemi, Z. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    Several hundred feet of core from the upper part of the Mt. Simon in central Illinois have been examined macroscopically. Grain sizes and their systematics, bedding characteristics, sedimentary structures, and relationships among beds show that the upper Mt. Simon Sandstone is composed of a series of fining-upward cycles up to 10 m (30 feet) thick. A typical cycle consists, in ascending order, of a sandy subtidal facies, a mixed sand and mud intertidal-flat facies, and a muddy upper tidal-flat facies upward through the succession, the maximum and average grain size becomes progressively finer and the cycles thinner. The lower sandstone of each cycle contains beds that are massive to cross bedded and cross laminated; some beds show scoured reactivation surfaces. A few cycles contain a middle unit characterized by flaser and lenticular bedding and abundant mudcracks. Mudcracks also are common in the shale beds at the top of each cycle. Sedimentary structures such as reactivation surfaces, flaser and lenticular bedding, and mudcracks suggest that these cycles were deposited in peritidal environments. The presence of Skolithos in some cycles suggests very shallow marine conditions. The within-cycle upward fining is caused by regression or progradation that reflects a progressive decrease in current velocity from subtidal to intertidal parts of the tidal flat. Frequent flooding of the tidal flat resulted in repeated fining-upward cycles within the upper part of the Mt. Simon Sandstone.

  12. Application of Remote Sensing Technology and Ecological Modeling of Forest Carbon Stocks in Mt. Apo Natural Park, Philippines

    E-Print Network [OSTI]

    Leal, Ligaya Rubas

    2015-01-23

    This dissertation work explored the application of remote sensing technology for the assessment of forest carbon storage in Mt. Apo Natural Park. Biomass estimation is traditionally conducted using destructive sampling with high levels...

  13. Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson Quartzite, British Columbia, Canada

    E-Print Network [OSTI]

    Hutto, Andrew Paul

    2012-07-16

    STRATIGRAPHY AND DETRITAL ZIRCON GEOCHRONOLOGY OF MIDDLE-LATE ORDOVICIAN MT. WILSON QUARTZITE, BRITISH COLUMBIA CANADA A Thesis by ANDREW PAUL HUTTO Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 2012 Major Subject: Geology Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson...

  14. SD 13130019: ANOTHER SECOND-GENERATION STAR WITH [Fe/H] = ?5.0, OBSERVED WITH THE MAGELLAN TELESCOPE

    E-Print Network [OSTI]

    Chiti, Anirudh

    We present a Magellan/MIKE high-resolution (R ~ 35,000) spectrum of the ancient star SD 1313?0019, which has an iron abundance of [Fe/H] = -5.0, paired with a carbon enhancement of [C/Fe] ~ 3.0. The star was initially ...

  15. 50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links

    E-Print Network [OSTI]

    Allen, Gale

    that broadcast with a power of 50,000 Watts day and night. Some of these stations are what was once known50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links 50,000-Watt AM stations This list includes AM stations in the United States and Canada

  16. BANDO PER IL RECLUTAMENTO DI UN RICERCATORE CON RAPPORTO DI LAVORO A TEMPO DETERMINATO CO FINANZIATO DALLA REGIONE LAZIO PER IL SETTORE S/D

    E-Print Network [OSTI]

    Di Pillo, Gianni

    FINANZIATO DALLA REGIONE LAZIO PER IL SETTORE S/D BIO/09 PRESSO IL DIPARTIMENTO DI FISIOLOGIA E FARMACOLOGIA "VITTORIO ERSPAMER" Il Direttore del Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" Visto il Regione Lazio Viste le Delibere del Consiglio del Dipartimento di Fisiologia e Farmacologia "Vittorio

  17. Wireless Internet Access To Real-Time Transit Information S.D. Maclean, University of Washington, Dept. of Electrical Engineering, Box 352500, Seattle,

    E-Print Network [OSTI]

    TRB 02-3863 Wireless Internet Access To Real-Time Transit Information S.D. Maclean, University departure times for buses at user-selectable geographic locations to Internet-enabled mobile devices.e., wired) Internet connectivity is not available. Wireless access to real-time transit information

  18. Top-Down Intelligent Reservoir Modeling (TDIRM) Y.Gomez, Y. Khazaeni, S.D. Mohaghegh, SPE, West Virginia University, R. Gaskari, Intelligent Solutions, Inc.

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    aspects of an oil reservoir. The models include different reservoir saturation conditions (saturated or under-saturated), different number of wells and different distributions of reservoir characteristicsSPE 124204 Top-Down Intelligent Reservoir Modeling (TDIRM) Y.Gomez, Y. Khazaeni, S.D. Mohaghegh

  19. Havre, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969CentralWellsMillion Cubic Feet) Havre, MT Natural Gas Pipeline

  20. Weak Interaction Rates Of sd-Shell Nuclei In Stellar Environment Calculated in the Proton-Neutron Quasiparticle Random Phase Approximation

    E-Print Network [OSTI]

    J. -U. Nabi; H. V. Klapdor-Kleingrothaus

    1999-07-27

    Allowed weak interaction rates for sd-shell nuclei in stellar environment are calculated using a generalized form of proton-neutron quasiparticle RPA model with separable Gamow-Teller forces. Twelve different weak rates are calculated for each nucleus as a function of temperature and density. This project consists of calculation of weak rates for a total of 709 nuclei with masses ranging from A = 18 to 100. This paper contains calculated weak rates for sd-shell nuclei. The calculated capture and decay rates take into consideration the latest experimental energy levels and ft value compilations. The results are also compared with earlier works. Particle emission processes from excited states, previously ignored, are taken into account, and are found to significantly affect some beta decay rates.

  1. BiL4i|h@ EW?uLh4@|U@ Q 2 ti||i4Mhi 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q 2 ti||i4Mhi 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *hi _@ U#12; @ AhL@hi ?@ M@ti _i* ?U*iL i ?@ M@ti _i**hi sff E i s!E _Li ' e 2e2 n e#12

  2. BiL4i|h@ EW?uLh4@|U@ Q D B}?L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q D B}?L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *? % n + n 5 ' f i 2% + ' f E@ #4Lt|h@hi Ui *@ *LhL ?|ihti3L?i i ?@ hi||@ , i |hL@h?i *i i^@3L? E2 T

  3. BiL4i|h@ EW?uLh4@|U@ Q 2 6iMMh@L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q 2 6iMMh@L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *hi _@|L _@**i i^@3L? E|%n2+|5 ' | c %|+n25 ' UL? | T@h@4i|hL hi@*i E@ AhL@hi ? @*Lhi _ | Tih U * tt|i4@ ?L? @ tL*3L

  4. BiL4i|h@ EW?uLh4@|U@ Q b }i??@L 2ff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q b }i??@L 2ff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *?i % + n 5 ' f i * T?|L @ ' Ec c @ tUhihi *hi||@ T@tt@?|i Tih @ i Lh|L}L?@*i @ Z ?| #12; M

  5. BiL4i|h@ EW?uLh4@|U@ Q S w}*L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q S w}*L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi * 5 hULh_ Ui rR@? ij i * tL||LtT@3L }i?ih@|L _@ i||Lh UL?|i?| ?i**@ T@hi?|it E@ @*UL*@hi *i _4i

  6. SD 1313-0019 -- Another second-generation star with [Fe/H] = -5.0, observed with the Magellan Telescope

    E-Print Network [OSTI]

    Frebel, Anna; Ji, Alexander P; Jacobson, Heather R; Placco, Vinicius M

    2015-01-01

    We present a Magellan/MIKE high-resolution (R ~ 35,000) spectrum of the ancient star SD 1313-0019 which has an iron abundance of [Fe/H] = -5.0, paired with a carbon enhancement of [C/Fe] ~ 3.0. The star was initially identified by Allende Prieto et al. in the BOSS survey. Its medium-resolution spectrum suggested a higher metallicity of [Fe/H] = -4.3 due to the CaII K line blending with a CH feature which is a common issue related to the search for the most iron-poor stars. This star joins several other, similar stars with [Fe/H] < -5.0 that all display a combination of low iron and high carbon abundances. Other elemental abundances of SD 1313-0019 follow that of more metal-rich halo stars. From fitting the abundance pattern with yields of Population III supernova, we conclude that SD 1313-0019 had only one massive progenitor star with 20 - 30 M_sun that must have undergone a mixing and fallback episode. Overall, there are now five stars known with [Fe/H] < -5.0 (1D LTE abundances). This population of se...

  7. Other Participants 2001 | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    High School , Huron, SD Ignacio High School, Ignacio, CO Iolani High School , Honolulu , HI J. I. Case High School , Racine , WI Kelly Walsh High School , Casper , WY Lake Brantley...

  8. MT1-MMP promotes cell growth and ERK activation through c-Src and paxillin in three-dimensional collagen matrix

    SciTech Connect (OSTI)

    Takino, Takahisa; Tsuge, Hisashi; Ozawa, Terumasa [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan); Sato, Hiroshi, E-mail: vhsato@kenroku.kanazawa-u.ac.jp [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)

    2010-06-11

    Membrane-type 1 matrix metalloproteinase (MT1-MMP) is essential for tumor invasion and growth. We show here that MT1-MMP induces extracellular signal-regulated kinase (ERK) activation in cancer cells cultured in collagen gel, which is indispensable for their proliferation. Inhibition of MT1-MMP by MMP inhibitor or small interfering RNA suppressed activation of focal adhesion kinase (FAK) and ERK in MT1-MMP-expressing cancer cells, which resulted in up-regulation of p21{sup WAF1} and suppression of cell growth in collagen gel. Cell proliferation was also abrogated by the inhibitor against ERK pathway without affecting FAK phosphorylation. MT1-MMP and integrin {alpha}{sub v}{beta}{sub 3} were shown to be involved in c-Src activation, which induced FAK and ERK activation in collagen gel. These MT1-MMP-mediated signal transductions were paxillin dependent, as knockdown of paxillin reduced cell growth and ERK activation, and co-expression of MT1-MMP with paxillin induced ERK activation. The results suggest that MT1-MMP contributes to proliferation of cancer cells in the extracellular matrix by activating ERK through c-Src and paxillin.

  9. Uranium hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Not Available

    1981-05-01

    Results of a hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes quadrangle, Alaska, are presented. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. In this data release are location data, field analyses, and Laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume. These data are, however, available on the magnetic tape. Appendices A to D describe the sample media and summarize the analytical results for each medium. The data were subsetted by one of the Los Alamos National Laboratory (LANL) sorting programs into groups of stream sediment, lake sediment, stream water, lake water, and ground water samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1000000 scale maps of pertinent elements have been included in this report.

  10. EIS-0092: Conversion to Coal, Holyoke Water Power Company, Mt. Tom Generating Station Unit 1 Holyoke, Hampden County, Massachusetts

    Broader source: Energy.gov [DOE]

    The Economic Regulatory Administration prepared this statement to assess the environmental impacts of prohibiting Unit 1 of the Mt. Tom Generation Station Unit 1 from using either natural gas or petroleum products as a primary energy source, which would result in the utility burning low-sulfur coal.

  11. The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1)

    E-Print Network [OSTI]

    Craik, Charles S.

    The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1, 600 16th St. Genentech Hall, San Francisco, CA 94143, USA The mechanisms of inhibition of two novel sc-SP1 at low pH, and is a standard mechanism inhibitor of the protease. The mechanisms of inhibition

  12. PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets16 (next20,System - PatchBOE Reserve Class

  13. PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets16 (next20,System - PatchBOE Reserve

  14. PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets16 (next20,System - PatchBOE ReserveLiquids

  15. Applications of stable isotopes in hydrological studies of Mt. Apo geothermal field, Philippines

    SciTech Connect (OSTI)

    Salonga, N.D.; Aragon, G.M.; Nogara, J.B.; Sambrano, B.G.

    1996-12-31

    The local precipitation in Mt. Apo is depleted of heavy isotopes owing to high elevation and landward location of the field. Rainwaters infiltrate the shallow grounds, circulate in short distances with almost no interaction with the host bed rocks, and effuse in the surface as cold springs. Lakes and rivers are affected by surface evaporation while the acid SO{sub 4} springs are affected by both evaporation and steam-heating. Only the neutral-pH Cl springs have the signature of the deep thermal fluids. The parent fluids of the deep thermal brine contain Cl of 4,800 to 5,000 mg/kg, {delta}{sup 18}O of -4.62 to -4.13 {per_thousand} and {delta}{sup 2}H of -60.0 to -57.8 {per_thousand}. Inside the Sandawa Collapse, boiling of the parent fluids resulted in a two-phase reservoir with lighter isotope contents. The thermal fluids laterally flow towards the west where they are affected by cooling and mixing of cold waters. Deep water recharge has {delta}{sup 18}O of -10.00 {per_thousand} and {delta}{sup 2}H = -61.20 {per_thousand} which come from the upper slopes of Sandawa Collapse (1580-1700 mASL).

  16. Four-year prospective study of the respiratory effects of volcanic ash from Mt. St. Helens

    SciTech Connect (OSTI)

    Buist, A.S.; Vollmer, W.M.; Johnson, L.R.; Bernstein, R.S.; McCamant, L.E.

    1986-04-01

    This report describes the 4-yr follow-up of 712 loggers exposed over an extended period to varying levels of fresh volcanic ash from the 1980 eruptions of Mt. St. Helens. Concerns related to the irritant effect the ash might have on the airways and also to its fibrogenic potential if exposures were intense and continued over many years. Our subjects were divided into 3 groups: high, low, and no exposure. Baseline testing was begun in June 1980, 1 month after the major eruption, and follow-up testing continued on an annual basis through 1984; 88% of the loggers have been tested at least 3 times. Analysis of lung function data showed that a significant, exposure-related decline in FEV1 occurred during the first year after the eruption. The decline was short-lived, however, and by 1984 the differences between exposure groups were no longer significant. Self-reported symptoms of cough, phlegm, and wheeze showed a similar pattern. No ash-related changes were seen in chest roentgenograms taken in 1980 and in 1984. Our findings are consistent with the hypothesis that the inhaled ash caused mucus hypersecretion and/or airway inflammation that reversed when the exposure levels decreased. The ash levels to which the loggers were exposed were low compared with permissible occupational levels for nuisance dusts, but generally higher than the total suspended particulate levels permissible in ambient air.

  17. CO2 flood tests on whole core samples of the Mt. Simon sandstone, Illinois Basin

    SciTech Connect (OSTI)

    O'Connor, William K.; Rush, Gilbert E.

    2005-09-01

    Geological sequestration of CO2, whether by enhanced oil recovery (EOR), coal-bed methane (CBM) recovery, or saline aquifer injection is a promising near-term sequestration methodology. While tremendous experience exists for EOR, and CBM recovery has been demonstrated in existing fields, saline aquifer injection studies have only recently been initiated. Studies evaluating the availability of saline aquifers suitable for CO2 injection show great potential, however, the long-term fate of the CO2 injected into these ancient aqueous systems is still uncertain. For the subject study, a series of laboratory-scale CO2 flood tests were conducted on whole core samples of the Mt. Simon sandstone from the Illinois Basin. By conducting these tests on whole core samples rather than crushed core, an evaluation of the impact of the CO2 flood on the rock mechanics properties as well as the geochemistry of the core and brine solution has been possible. This empirical data could provide a valuable resource for the validation of reservoir models under development for these engineered CO2 systems.

  18. Assignment 4 BS4a Actuarial Science Oxford MT 2011 IX A.4 Inflation, taxation and project appraisal

    E-Print Network [OSTI]

    Winkel, Matthias

    Assignment 4 ­ BS4a Actuarial Science ­ Oxford MT 2011 IX A.4 Inflation, taxation and project are indexed by reference to the value of a retail price index with a time lag of 8 months. The retail price index value in September 1996 was Q(-8/12) = 200 and in March 1997 was Q(-2/12) = 206. The issue price

  19. Electron capture and beta-decay rates for sd-shell nuclei in stellar environments relevant to high density O-Ne-Mg cores

    E-Print Network [OSTI]

    Toshio Suzuki; Hiroshi Toki; Ken'ichi Nomoto

    2015-12-01

    Electron capture and beta-decay rates for nuclear pairs in sd-shell are evaluated at high densities and high temperatures relevant to the final evolution of electron-degenerate O-Ne-Mg cores of stars with the initial masses of 8-10 solar mass. Electron capture induces a rapid contraction of the electron-degenerate O-Ne-Mg core. The outcome of rapid contraction depends on the evolutionary changes in the central density and temperature, which are determined by the competing processes of contraction, cooling, and heating. The fate of the stars are determined by these competitions, whether they end up with electron-capture supernovae or Fe core-collapse supernovae. Since the competing processes are induced by electron capture and beta-decay, the accurate weak rates are crucially important. The rates are obtained for pairs with A=20, 23, 24, 25 and 27 by shell-model calculations in sd-shell with the USDB Hamiltonian. Effects of Coulomb corrections on the rates are evaluated. The rates for pairs with A=23 and 25 are important for nuclear URCA processes that determine the cooling rate of O-Ne-Mg core, while those for pairs with A=20 and 24 are important for the core-contraction and heat generation rates in the core. We provide these nuclear rates at stellar environments in tables with fine enough meshes at various densities and temperatures for the studies of astrophysical processes sensitive to the rates. In particular, the accurate rate tables are crucially important for the final fates of not only O-Ne-Mg cores but also a wider range of stars such as C-O cores of lower mass stars.

  20. Dark Matter Particle Spectroscopy at the LHC: Generalizing M(T2) to Asymmetric Event Topologies

    SciTech Connect (OSTI)

    Konar, Partha; Kong, Kyoungchul; Matchev, Konstantin T.; Park, Myeonghun; /Florida U.

    2012-04-03

    We consider SUSY-like missing energy events at hadron colliders and critically examine the common assumption that the missing energy is the result of two identical missing particles. In order to experimentally test this hypothesis, we generalize the subsystem M{sub T2} variable to the case of asymmetric event topologies, where the two SUSY decay chains terminate in different 'children' particles. In this more general approach, the endpoint M{sub T2(max)} of the M{sub T2} distribution now gives the mass {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}) of the parent particles as a function of two input children masses {tilde M}{sub c}{sup (a)} and {tilde M}{sub c}{sup (b)}. We propose two methods for an independent determination of the individual children masses M{sub c}{sup (a)} and M{sub c}{sup (b)}. First, in the presence of upstream transverse momentum PUTM the corresponding function {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}, P{sub UTM}) is independent of P{sub UTM} at precisely the right values of the children masses. Second, the previously discussed MT2 'kink' is now generalized to a 'ridge' on the 2-dimensional surface {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}). As we show in several examples, quite often there is a special point along that ridge which marks the true values of the children masses. Our results allow collider experiments to probe a multi-component dark matter sector directly and without any theoretical prejudice.

  1. Uranium hydrogeochemical and stream-sediment reconnaissance of the Mt. Michelson NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Zinkl, R.J.; Shettel, D.L. Jr.; Langfeldt, S.L.; Hardy, L.C.; D'Andrea, R.F. Jr.

    1982-04-01

    This report presents results of a Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the Mt. Michelson NTMS quadrangle, Alaska. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. These machine-readable data, as well as quarterly or semiannual program progress reports containing further information on the HSSR program in general, or on the Los Alamos National Laboratory (LANL) portion of the program in particular, are available from DOE's Technical Library at its Grand Junction Area Office. Presented in this data release are location data, field analyses, and laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume; these data are, however, available on the magnetic tape. Appendices A and B describe the sample media and summarize the analytical results for each medium. The data have been subdivided by one of the Los Alamos National Laboratory sorting programs of Zinkl and others (1981a) into groups of stream-sediment and lake-sediment samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1,000,000 scale maps of pertinent elements have been included in this report. Also included are maps showing results of multivariate statistical analyses. Information on the field and analytical procedures used by the Los Alamos National Laboratory during sample collection and analysis may be found in any HSSR data release prepared by the Laboratory and will not be included in this report.

  2. International Best Practices for Pre-Processing and Co-Processing Municipal Solid Waste and Sewage Sludge in the Cement Industry

    E-Print Network [OSTI]

    Hasanbeigi, Ali

    2013-01-01

    centrifuges, anaerobic digesters, and sludge dryers. In+Sludge Drier (SD) MS+MT+Anaerobic digester (AD) MS+MT+AD+DC

  3. Construction integrity assessment report (ETN-98-0005) S-Farm overground transfer (OGT) system valve pit 241-S-B to valve pit 241-S-D

    SciTech Connect (OSTI)

    HICKS, D.F.

    1999-08-12

    The S-Farm overground transfer (OGT) line will bypass the existing line(s), between valve pits 241-S-B and 241-S-D that no longer meet system requirements. The new OGT line will provide a waste transfer pipeline between these valve pits in support of saltwell pumping activities. The length of the OGT line is approximately 180 ft from pit to pit. The primary pipe is nominal 1-in. diameter stainless steel (SST) braided Ethylene-propylene Diene Monomer (EPDM) hose. The encasement pipe is a nominal 3-in., flanged, SST pipe made up of several different length pipe spool pieces (drawing H-2-829564, sh. 1 and sh. 2). The OGT line slopes from valve pit 241-S-B toward valve pit 241-S-D. At each end, the primary and encasement pipe connect to a pit entry spool piece. The pit entry spool pieces are constructed of prefabricated SST materials. These spool pieces allow for the separation of the primary and encasement pipelines after the pipes have entered the valve pits (drawing H-2-818280, sh. 2). The pit entry spool pieces also allow for leak detection of the encasement pipe at each end (drawing H-2-829564, sh. 2). The OGT encasement pipeline is supported above ground by adjustable height unistrut brackets and precast concrete bases (drawing H-2-829654, sh. 1). The pipeline is heat-traced and insulated. The heat tracing and insulation supply and retain latent heat that prevents waste solidification during transfers and provides freeze protection. The total length of the pipeline is above ground, thereby negating the need for cathodic corrosion protection. This Construction Integrity Assessment Report (CIAR) is prepared by Fluor Daniel Northwest for Numatec Hanford Corporation/Lockheed Martin Hanford Corporation, the operations contractor, and the U. S. Department of Energy, the system owner. The CIAR is intended to verify that construction was performed in accordance with the provisions of Washington Administrative Code, WAC-173-303-640 (3) (c), (e), (f) and (h).

  4. Portable SD Recorder Product Overview

    E-Print Network [OSTI]

    storage is matched by six hours recording time from four AA Alkaline / Ni-MH batteries. Drag and drop file file transfer 4 x AA Batteries, providing six hours recording (w/Alkaline 1450mAh batteries Speaker Standard level 450 mW/8 ohms General Power consumption Recording/Playback 4.2 W (DC) Battery life

  5. NA SD 452.2

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLEDStatements |Mo-99N

  6. MRI of the lung using hyperpolarized He-3 at very low magnetic field (3 mT)

    E-Print Network [OSTI]

    Bidinosti, C P; Tastevin, G; Vignaud, A; Nacher, P J

    2004-01-01

    Optical pumping of He-3 produces large (hyper) nuclear-spin polarizations independent of the magnetic resonance imaging (MRI) field strength. This allows lung MRI to be performed at reduced fields with many associated benefits, such as lower tissue susceptibility gradients and decreased power absorption rates. Here we present results of 2D imaging as well as accurate 1D gas diffusion mapping of the human lung using He-3 at very low field (3 mT). Furthermore, measurements of transverse relaxation in zero applied gradient are shown to accurately track pulmonary oxygen partial pressure, opening the way for novel imaging sequences.

  7. A polymorphism in metallothionein 1A (MT1A) is associated with cadmium-related excretion of urinary beta 2?microglobulin

    SciTech Connect (OSTI)

    Lei, Lijian; Department of Epidemiology, School of Public Health, Shanxi Medical University, Shanxi ; Chang, Xiuli; Rentschler, Gerda; Tian, Liting; Zhu, Guoying; Chen, Xiao; Jin, Taiyi; Broberg, Karin

    2012-12-15

    Objectives: Cadmium (Cd) toxicity of the kidney varies between individuals despite similar exposure levels. In humans Cd is mainly bound to metallothioneins (MT), which scavenge its toxic effects. Here we analyzed whether polymorphisms in MT genes MT1A and MT2A influence Cd-related kidney damage. Methods: In a cross-sectional study N = 512 volunteers were selected from three areas in South-Eastern China, which to varying degree were Cd-polluted from a smelter (control area [median Cd in urine U-Cd = 2.67 ?g/L], moderately [U-Cd = 4.23 ?g/L] and highly [U-Cd = 9.13 ?g/L] polluted areas). U-Cd and blood Cd (B-Cd) concentrations were measured by graphite-furnace atomic absorption spectrometry. MT1A rs11076161 (G/A), MT2A rs10636 (G/C) and MT2A rs28366003 (A/G) were determined by Taqman assays; urinary N-Acetyl-beta-(D)-Glucosaminidase (UNAG) by spectrometry, and urinary ?2-microglobulin (UB2M) by ELISA. Results: Higher B-Cd (natural log-transformed) with increasing number of MT1A rs11076161 A-alleles was found in the highly polluted group (p-value trend = 0.033; all p-values adjusted for age, sex, and smoking). In a linear model a significant interaction between rs11076161 genotype and B-Cd was found for UNAG (p = 0.001) and UB2M concentrations (p = 0.001). Carriers of the rs11076161 AA genotype showed steeper slopes for the associations between Cd in blood and natural log-transformed UB2M (? = 1.2, 95% CI 0.721.6) compared to GG carriers (? = 0.30, 95% CI 0.150.45). Also for UNAG (natural log-transformed) carriers of the AA genotype had steeper slopes (? = 0.55, 95% CI 0.270.84) compared to GG carriers (? = 0.018, 95% CI ? 0.790.11). Conclusions: MT1A rs11076161 was associated with B-Cd concentrations and Cd-induced kidney toxicity at high exposure levels. -- Highlights: ? Cadmium is toxic to the kidney but the susceptibility differs between individuals. ? The toxic effect of cadmium is scavenged by metallothioneins. ? A common variant of metallothionein 1A was genotyped in 512 cadmium exposed humans. ? Variant carriers of this polymorphism showed more kidney damage from cadmium. ? The frequency of these variants needs to be taken into account in risk assessment.

  8. LOCA simulation in the national research universal reactor program: postirradiation examination results for the third materials experiment (MT-3)

    SciTech Connect (OSTI)

    Rausch, W.N.

    1984-04-01

    A series of in-reactor experiments were conducted using full-length 32-rod pressurized water reactor (PWR) fuel bundles as part of the Loss-of-Coolant Accident (LOCA) Simulation Program. The third materials experiment (MT-3) was the sixth in the series of thermal-hydraulic and materials deformation/rutpure experiments conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. The main objective of the experiment was to evaluate ballooning and rupture during active two-phase cooling in the temperature range from 1400 to 1500/sup 0/F (1030 to 1090 K). The 12 test rods in the center of the 32-rod bundle were initially pressurized to 550 psi (3.8 MPa) to insure rupture in the correct temperature range. All 12 of the rods ruptured, with an average peak bundle strain of approx. 55%. The UKAEA also funded destructive postirradiation examination (PIE) of several of the ruptured rods from the MT-3 experiment. This report describes the work performed and presents the PIE results. Information obtained during the PIE included cladding thickness measurements metallography, and particle size analysis of the cracked and broken fuel pellets.

  9. Searches for supersymmetry using the MT2 variable in hadronic events produced in pp collisions at 8 TeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Khachatryan, V.

    2015-05-15

    Searches for supersymmetry (SUSY) are performed using a sample of hadronic events produced in 8 TeV pp collisions at the CERN LHC. The searches are based on the MT2 variable, which is a measure of the transverse momentum imbalance in an event. The data were collected with the CMS detector and correspond to an integrated luminosity of 19.5 fb?. Two related searches are performed. The first is an inclusive search based on signal regions defined by the value of the MT2 variable, the hadronic energy in the event, the jet multiplicity, and the number of jets identified as originating frommorebottom quarks. The second is a search for a mass peak corresponding to a Higgs boson decaying to a bottom quark-antiquark pair, where the Higgs boson is produced as a decay product of a SUSY particle. For both searches, the principal backgrounds are evaluated with data control samples. No significant excess over the expected number of background events is observed, and exclusion limits on various SUSY models are derived.less

  10. Soil Science Society of America Journal This work was presented at the 12th North American Forest Soils Conference, Whitefish, MT, 1620

    E-Print Network [OSTI]

    Martin, Timothy

    Soils Conference, Whitefish, MT, 1620 June 2013, in the Production Systems for Biomass and Bioenergy silvicultural practices used, and when combined with suitable site preparation techniques and the deployment fourfold higher aboveground pine biomass than the C treatment (7.7 Mg ha-1); the untreated CF (17.9 Mg ha-1

  11. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 1

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech textbook (now in its 2nd Edition) STRBase website: http://www.cstl.nist.gov/biotech/strbase/ Family: wife Terilynne and 6 children Hobbies: reading and writing http://www.cstl.nist.gov/biotech

  12. Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun

    E-Print Network [OSTI]

    Williams, Paul

    Commentary Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun Paul D. Williams Department of Meteorology, University of Reading, UK a r t i c l e i n f integration of the shallow-water equa- tions using the leapfrog time-stepping scheme [Sun Wen-Yih, Sun Oliver

  13. Table 2 -Lime use and practices on Corn, major producing states, 2001 CO GA IL IN IA KS KY MI MN MO NE NY NC ND OH PA SD TX WI Area

    E-Print Network [OSTI]

    Kammen, Daniel M.

    MO NE NY NC ND OH PA SD TX WI Area Lime applied NR 85 81 85 67 16 72 55 27 65 10 57 53 NR 70 95 3 1 50 51 Lime (tons treated acre) NR 1.0 2.1 1.9 2.5 2.1 2.4 2.0 2.6 2.8 1.5 1.9 1.1 NR 1.9 1.7 NR 0.5 2 NC ND OH PA SD TX WI Area Lime applied NR 95 90 69 18 69 71 14 77 16 76 99 NR 82 80 NR 5 58 54 Lime

  14. A_ Scior!,ce Servi-$5 Feittura. ? WY THE FEATHER? ?

    E-Print Network [OSTI]

    autumn $8 not disputed' Occur at lrequent i n t e r v a l s over tho North A t l a n t i c throughout the cold montha~from September t o March, and occasionally euch n disturbance coincides with the equinox

  15. Study 59 - Fed 70WY Surplus Deficit.xls

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1049 -305 -225 322 1995 Federal SurplusDeficit 260 -205 -53 142 1931 3119 1491 3318 3012 2668 519 347 1375 1996 Federal SurplusDeficit 1081 2864 3933 4477 3832 4732 4138 5391...

  16. DOE - Office of Legacy Management -- Lost Creek - WY 01

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont,Manufacturing - OH 40Loma Mill - CO 03NMLost

  17. Quadrennial Energy Review Stakeholder Meeting #11: Cheyenne, WY

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAandSummary From: Julia Hammand Distribution |Public MeetingMeetingPublic:

  18. File:INL-geothermal-wy.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages Recent Changes AllApschem.pdfgasp 03.pdf JumpGerak.pdf Jump5.pdf Jumpwy.pdf Jump to:

  19. Study 59 - Fed 70WY Surplus Deficit.xls

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect PhotovoltaicsStructure andChallenge | Department, 2015Studies

  20. QER Public Meeting in Cheyenne, WY: Infrastructure Siting | Department of

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuildingBudget || DepartmentPutting Solar PanelsEnergy 1

  1. San Juan Montana Thrust Belt WY Thrust Belt Black Warrior

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979 1.988 1.996 2.003 1990-2016November 2000 Overview OilSan

  2. Improvements in the M-T relation and mass function and the measured Omega_m through clusters evolution

    E-Print Network [OSTI]

    A. Del Popolo

    2003-09-05

    In this paper, I revisit the constraints obtained by several authors (Reichart et al. 1999; Eke et al. 1998; Henry 2000) on the estimated values of Omega_m, n and sigma_8 in the light of recent theoretical developments: 1) new theoretical mass functions (Sheth & Tormen 1999, Sheth, Mo & Tormen 1999, Del Popolo 2002b); 2) a more accurate mass-temperature relation, also determined for arbitrary Omega_m and Omega_{\\Lambda} (Voit 2000, Pierpaoli et al. 2001, Del Popolo 2002a). Firstly, using the quoted improvements, I re-derive an expression for the X-ray Luminosity Function (XLF), similarly to Reichart et al. (1999), and then I get some constraints to \\Omega_m and n, by using the ROSAT BCS and EMSS samples and maximum-likelihood analysis. Then I re-derive the X-ray Temperature Function (XTF), similarly to Henry (2000) and Eke et al. (1999), re-obtaining the constraints on Omega_m, n, sigma_8. Both in the case of the XLF and XTF, the changes in the mass function and M-T relation produces an increase in Omega_m of \\simeq 20% and similar results in sigma_8 and n.

  3. A Complete Solution Classification and Unified Algorithmic Treatment for the One- and Two-Step Asymmetric S-Transverse Mass (MT2) Event Scale Statistic

    E-Print Network [OSTI]

    Joel W. Walker

    2014-08-29

    The MT2 or "s-transverse mass" statistic was developed to associate a parent mass scale to a missing transverse energy signature, given that escaping particles are generally expected in pairs, while collider experiments are sensitive to just a single transverse momentum vector sum. This document focuses on the generalized extension of that statistic to asymmetric one- and two-step decay chains, with arbitrary child particle masses and upstream missing transverse momentum. It provides a unified theoretical formulation, complete solution classification, taxonomy of critical points, and technical algorithmic prescription for treatment of the MT2 event scale. An implementation of the described algorithm is available for download, and is also a deployable component of the author's selection cut software package AEACuS (Algorithmic Event Arbiter and Cut Selector). Appendices address combinatoric event assembly, algorithm validation, and a complete pseudocode.

  4. Probing the Mechanism of the Mycobacterium tuberculosis [beta]-Ketoacyl-Acyl Carrier Protein Synthase III mtFabH: Factors Influencing Catalysis and Substrate Specificity

    SciTech Connect (OSTI)

    Brown, Alistair K.; Sridharan, Sudharsan; Kremer, Laurent; Lindenberg, Sandra; Dover, Lynn G.; Sacchettini, James C.; Besra, Gurdyal S.

    2010-11-30

    Mycolic acids are the dominant feature of the Mycobacterium tuberculosis cell wall. These {alpha}-alkyl, {beta}-hydroxy fatty acids are formed by the condensation of two fatty acids, a long meromycolic acid and a shorter C{sub 24}-C{sub 26} fatty acid. The component fatty acids are produced via a combination of type I and II fatty acid synthases (FAS) with FAS-I products being elongated by FAS-II toward meromycolic acids. The {beta}-ketoacyl-acyl carrier protein (ACP) synthase III encoded by mtfabH (mtFabH) links FAS-I and FAS-II, catalyzing the condensation of FAS-I-derived acyl-CoAs with malonyl-acyl carrier protein (ACP). The acyl-CoA chain length specificity of mtFabH was assessed in vitro; the enzyme extended longer, physiologically relevant acyl-CoA primers when paired with AcpM, its natural partner, than with Escherichia coli ACP. The ability of the enzyme to use E. coli ACP suggests that a similar mode of binding is likely with both ACPs, yet it is clear that unique factors inherent to AcpM modulate the substrate specificity of mtFabH. Mutation of proposed key mtFabH residues was used to define their catalytic roles. Substitution of supposed acyl-CoA binding residues reduced transacylation, with double substitutions totally abrogating activity. Mutation of Arg{sup 46} revealed its more critical role in malonyl-AcpM decarboxylation than in the acyl-CoA binding role. Interestingly, this effect was suppressed intragenically by Arg{sup 161} {yields} Ala substitution. Our structural studies suggested that His{sup 258}, previously implicated in malonyl-ACP decarboxylation, also acts as an anchor point for a network of water molecules that we propose promotes deprotonation and transacylation of Cys{sup 122}.

  5. Structural and tectonic implications of pre-Mt. Simon strata -- or a lack of such -- in the western part of the Illinois basin

    SciTech Connect (OSTI)

    Sargent, M.L. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    The discovery of a pre-Mt. Simon lithic arenite (arkose) in southwestern Ohio has lead to reevaluation of many basement tests in the region. Several boreholes in adjacent states have been reexamined by others and are now believed to bottom in the Middle Run Formation. Seismic-reflection sections in western Ohio and Indiana have indicated pre-Mt. Simon basins filled with layered rocks that are interpreted to be Middle Run, however, the pre-Mt. Simon basins and east of Illinois. Samples from Illinois basement tests were reexamined to determine whether they had encountered similar strata. All reported crystalline-basement tests in Illinois show diagnostic igneous textures and mineralogical associations. Coarsely crystalline samples in cores show intergrown subhedral grains of quartz, microcline, and sodic plagioclase. Medium-crystalline rocks in cuttings samples show numerous examples of micrographic intergrowths of quartz and K-feldspar. This texture cannot be authigenically grown in a sediment and probably could not have survived a single cycle of erosion and deposition. Aphanitic rocks show porphyritic and spherulitic textures that are distinctly igneous and would be destroyed by weathering. Substantial relief on the Precambrian crystalline surface in Illinois is postulated for major structural features like the LaSalle Anticlinorium, the Sparta Shelf, the Ste. Genevieve Fault zone, etc. Paleotopographic relief up to 300 m (1,000 feet) is documented from drilling on the western flank of the basin.

  6. Littleton Mt. Washington

    E-Print Network [OSTI]

    Pringle, James "Jamie"

    Across New Hampshire IN TRAVELING NEW HAMPSHIRE HIGHWAYS AND BACK ROADS, you'll discover New Hampshire, Keene Nashua Community College, Nashua BAE Systems of N.A., Nashua University of New Hampshire, Durham Great Bay Community College, Portsmouth New Hampshire Space grant Consortium 1 23 4 56 7 8 9 10 11 12 13

  7. versity (MT Assistant o

    E-Print Network [OSTI]

    discipline um vitae, s and contac electronica cmsearch@ 2011, an trategic Fac nitiative ates are en rsities

  8. F.E. S.D. Gender

    Office of Environmental Management (EM)

    80+ 1.000 COMPARISON 0 0 UGESP Q-21 EXCEPTION WFR Impact Analysis SELECTION RATE % OF POOL SELECTED POOL FLAG STANDARD DEVIATION FISHER'S EXACT 80% RULE EXPECTED OF PERSONS...

  9. F.E. S.D. Gender

    Energy Savers [EERE]

    OF PERSONS AFFECTED UGESP Q-21 EXCEPTION WFR Impact Analysis SELECTION RATE % OF POOL SELECTED POOL FLAG STANDARD DEVIATION FISHER'S EXACT 80% RULE EXPECTED OF PERSONS...

  10. OPTIONAL I-""... ..o SD

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TAC GJO-PIN~$ ., .,. ' e' , Ucl

  11. Microsoft Word - SD452.3 FINAL

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLED DOCUMENT OFFICE

  12. F.E. S.D. Gender

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015Executive Order 13514 FederalEnergy Extraction UtilityReduction in792

  13. F.E. S.D. Gender

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015Executive Order 13514 FederalEnergy Extraction UtilityReduction

  14. Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O.M. Knio2 and R.G. Ghanem2

    E-Print Network [OSTI]

    Frey, Pascal

    Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O The Johns Hopkins University, Baltimore, MD 21218, USA Abstract. This study compares two techniques of Chemical Kinetics 1. Introduction Chemical kinetics computations require the specification of a number

  15. A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings of nearly $130,000 with the installation of an integrated microturbine power system

    E-Print Network [OSTI]

    Pennycook, Steve

    Background A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings, heating and power solutions, was installed in 2005 in the 57,000- square-foot facility. The New York supermarket was the first U.S. customer to take delivery of the new system. The PureComfort system is designed

  16. Visualizing the Surface Infrastructure Used to Move 2 MtCO2/year from the Dakota Gasification Company to the Weyburn CO2 Enhanced Oil Recovery Project: Version of July 1, 2009

    SciTech Connect (OSTI)

    Dooley, James J.

    2009-07-09

    Google Earth Pro has been employed to create an interactive flyover of the worlds largest operational carbon dioxide capture and storage project. The visualization focuses on the transport and storage of 2 MtCO2/year which is captured from the Dakota Gasification Facility (Beula, North Dakota) and transported 205 miles and injected into the Weyburn oil field in Southeastern Saskatchewan.

  17. Notices 20 Miles Northwest of Rapid City SD Rapid City SD 57702

    Office of Environmental Management (EM)

    Availability of the Proposed Southline Transmission Line Project Draft Environmental Impact Statement and Draft Resource Management Plan Amendment, New Mexico and Arizona AGENCY:...

  18. Study on the reduction of atmospheric mercury emissions from mine waste enriched soils through native grass cover in the Mt. Amiata region of Italy

    SciTech Connect (OSTI)

    Fantozzi, L., E-mail: l.fantozzi@iia.cnr.it [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy); Ferrara, R., E-mail: romano.ferrara@pi.ibf.cnr.it [CNR-Institute of Biophysics, San Cataldo Research Area, Via G. Moruzzi 1, 56124 Pisa (Italy); Dini, F., E-mail: fdiniprotisti@gmail.com [University of Pisa, Department of Biology, Via A. Volta 4, 56126 Pisa (Italy); Tamburello, L., E-mail: ltamburello@biologia.unipi.it [University of Pisa, Department of Biology, Via Derna 1, I-56126 Pisa (Italy); Pirrone, N.; Sprovieri, F. [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)] [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)

    2013-08-15

    Atmospheric mercury emissions from mine-waste enriched soils were measured in order to compare the mercury fluxes of bare soils with those from other soils covered by native grasses. Our research was conducted near Mt. Amiata in central Italy, an area that was one of the largest and most productive mining centers in Europe up into the 1980s. To determine in situ mercury emissions, we used a Plexiglas flux chamber connected to a portable mercury analyzer (Lumex RA-915+). This allowed us to detect, in real time, the mercury vapor in the air, and to correlate this with the meteorological parameters that we examined (solar radiation, soil temperature, and humidity). The highest mercury flux values (8000 ng m{sup ?2} h{sup ?1}) were observed on bare soils during the hours of maximum insulation, while lower values (250 ng m{sup ?2} h{sup ?1}) were observed on soils covered by native grasses. Our results indicate that two main environmental variables affect mercury emission: solar radiation intensity and soil temperature. The presence of native vegetation, which can shield soil surfaces from incident light, reduced mercury emissions, a result that we attribute to a drop in the efficiency of mercury photoreduction processes rather than to decreases in soil temperature. This finding is consistent with decreases in mercury flux values down to 3500 ng m{sup ?2} h{sup ?1}, which occurred under cloudy conditions despite high soil temperatures. Moreover, when the soil temperature was 28 C and the vegetation was removed from the experimental site, mercury emissions increased almost four-fold. This increase occurred almost immediately after the grasses were cut, and was approximately eight-fold after 20 h. Thus, this study demonstrates that enhancing wild vegetation cover could be an inexpensive and effective approach in fostering a natural, self-renewing reduction of mercury emissions from mercury-contaminated soils. -- Highlights: ? Mercury air/surface exchange from grass covered soil is different from bare soil. ? Light enhances mercury emissions and is the main parameter driving the process. ? The presence of wild vegetation covering the soil reduces mercury emission. ? Vegetative covers could be a solution to reduce atmospheric mercury pollution.

  19. Microsoft Word - WY_Draft EA_2014_12_16.docx

    Broader source: Energy.gov (indexed) [DOE]

    manmade impassable barriers from the Columbia River and its tributaries upstream of the Wind and Hood rivers (exclusive) to and including the Yakima River, excluding fish...

  20. EA-1236: Preparation for Transfer of Ownership of Naval Petroleum Reserve No. 3, Natrona County, WY

    Broader source: Energy.gov [DOE]

    Final Sitewide Environmental Assessment (EA) This Sitewide EA evaluates activities that DOE would conduct in anticipation of possible transfer of Naval Petroleum Reserve No. 3 (NPR-3) out of Federal operation.

  1. DOE - Office of Legacy Management -- Crooks Gap AEC Ore Buying Station - WY

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont, SouthLaboratory -CheneyColumbusCotter

  2. DOE - Office of Legacy Management -- Riverton AEC Ore Buying Station - WY

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont,Manufacturing0-19RulisonReynoldsRio0-03

  3. DOE - Office of Legacy Management -- Riverton Mill Site - WY 0-04

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota

  4. DOE - Office of Legacy Management -- Spook Site - WY 0-01

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co - OH 51SavannahMillKS 0-01WyomingSpook

  5. An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia.

    E-Print Network [OSTI]

    Brown, Rafe M.

    2010-01-01

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  6. An Ancient Origin for the Enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the Islands of Southeast Asia

    E-Print Network [OSTI]

    Blackburn, David C.; Bickford, David P.; Diesmos, Arvin C.; Iskandar, Djoko T; Brown, Rafe M.

    2010-08-09

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  7. 2000-Liter-Gesellschaft --Entwicklungschance fr Nord und Sd

    E-Print Network [OSTI]

    Wehrli, Bernhard

    2000-Liter-Gesellschaft -- Entwicklungschance fr Nord und Sd Die Schweizerische Umweltstiftung initiiert die Real-Vision der 2000-Liter- Gesellschaft um den Wasserverbrauch von weltweit rund 4'000 Litern pro Person und Tag auf 2'000 Liter zu reduzieren. Die 2000-Liter-Gesellschaft ist das

  8. The COSI Framework -Carbon Offsets with SD Impacts (COSI)

    E-Print Network [OSTI]

    Cape Town, South Africa Karen Holm Olsen, PhD UNEP Ris Centre #12;Outline of Presentation Policy and a high quantity of CERs (trade-offs) A common conclusion across different assessment methodologies

  9. Oblique slamming, planing and skimming S.D. Howison

    E-Print Network [OSTI]

    Howison, Sam

    , inviscid hydrodynamics, ship slamming, water entry, planing. 1 Introduction The phenomenon of violent impacts where there is the possibility of either cavitation on the "downstream" segment of the contact

  10. Microsoft Word - SD243-1_Clean_20140429

    National Nuclear Security Administration (NNSA)

    Acknowledgement Form RMP appointment forms are located on the NNSA Records Management internet site or by submitting a request to the RPO group email NNSARecordsManagement@nnsa.doe...

  11. Tutorial Fator de Impacto BIBLIOTECA DE CINCIAS DA SADE SD

    E-Print Network [OSTI]

    Paraná, Universidade Federal do

    calculo realizado nas demais colunas Total Cites ­ número de citações que a revista teve nos últimos dois Half-life ­ Idade mediana ­ Calculo do número de citações ano a contar pelo 1º. Número da revista #12;

  12. DOE - Office of Legacy Management -- Edgemont Mill Site - SD 01

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont, SouthLaboratoryDiv - NYCorp - NJ

  13. Microsoft Word - SD 351-1 FINAL.doc

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12

  14. Microsoft Word - SD243-1_Clean_20140429

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLED DOCUMENT OFFICE OF

  15. HNF-SD-WM-TI-740, Rev. OA

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low34 Revision 0 Approved for69 Revision71748884045.

  16. HNF-SD-WM-TI-740, Rev. OC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low34 Revision 0 Approved for69

  17. Pukaha Mt Bruce Capability Building Project

    E-Print Network [OSTI]

    : _________________________________________________ ISO ID: ____________________________ Department: ___________________________________________ Office Reports Applicant Certification Access privileges are issued to staff members with the understanding

  18. Why Mt Etna? C. Doglioni,1

    E-Print Network [OSTI]

    between these two approaches: (i) evo- lution and dip of the foreland mono- cline are used in Doglioni et

  19. Mt Ranier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open

  20. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,InformationIllinois:Martin, Michigan:

  1. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease

  2. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122 1996-2014

  3. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO

  4. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO2,504

  5. Controlled Source Audio MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans, EtInformation Control of Well KS-8 inSource

  6. Mt Peak Utility | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:

  7. Mt Poso Cogeneration | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:Poso

  8. Category:Billings, MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia: Energy014771°,North Dakota:Bonn |NJ

  9. "Block" "Spot Column" "Spot Row" ORF ID Gene Block Column Row Name ID X Y Dia. F635 Median F635 Mean F635 SD B635 Median B635 Mean B635 SD % > B635+1SD % > B635+2SD F635 % Sat. F532 Median F532 Mean F532 SD B532 Median B532 Mean B532 SD % > B532+1SD % > B

    E-Print Network [OSTI]

    Winston, Fred

    622 100 100 0 2580 2796 1174 63 89 234 100 100 0 5.257 5.315 5.223 5.619 2.874 5.004 0.873 2.394 13231

  10. Complexity induced anisotropic bimodal intermittent turbulence in space plasmas Tom Chang and Sunny W.Y. Tam

    E-Print Network [OSTI]

    , California 90095 USA Abstract The "physics of complexity" in space plasmas is the central theme and dissipative effects, and all notations are standard. Equations (1) admit the well-known Alfvn waves

  11. Microsoft Word - USDOE QER, Cheyenne WY 08-21-14, Prepared Statement of Brian Jeffries, Wyoming Pipeline Authority.docx

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE SafetyofDepartment. " 21 ranDay:OCIO AuditUto: A Dispersionto:

  12. WH ITNEY CAN YON-CART ER CR K YELLOW CR EEK_WY_D PIN EVIEW AN

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSalesa.E. GreatCSVLiquids

  13. WH ITNEY CAN YON-CART ER CR K YELLOW CR EEK_WY_D PIN EVIEW AN

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSalesa.E. GreatCSVLiquidsGas

  14. WH ITNEY CAN YON-CART ER CR K YELLOW CR EEK_WY_D PIN EVIEW AN

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSalesa.E.

  15. PR B_WY_C BM HILIGHT POWELL KIT TY WELL D RAW SC OT T MIKES D

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets16 (next20,System - Patch ArchiveBOE

  16. PR B_WY_C BM HILIGHT POWELL KIT TY WELL D RAW SC OT T MIKES D

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets16 (next20,System - Patch ArchiveBOEGas

  17. PR B_WY_C BM HILIGHT POWELL KIT TY WELL D RAW SC OT T MIKES D

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets16 (next20,System - Patch

  18. State 2007 2008 2009 2010 2011 2012 Alabama 16 13 6 9 7 7 -56%

    E-Print Network [OSTI]

    Fernandez, Eduardo

    3 CA 50 OR 5 WA 13 WY 0 ND 5 SD 0 NE 9 KS 5 OK 7 MN 14 WI 12 MI 43 IA 7 MO 19 IL 55 AR 4 AL 7 AK 2 5 6 200% Vermont 5 6 6 5 6 9 80% Virginia 38 40 41 45 49 52 37% Washington 8 8 6 12 13 13 63% West Virginia 6 7 4 2 6 7 17% Wisconsin 10 13 17 18 19 12 20% Wyoming 0 0 0 1 0 0 0% Total States 26,166 26

  19. File:USFWSList.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages RecentTempCampApplicationWorksheet 2011.pdfSD.pdf Jump to: navigation,WY.pdf

  20. 2.8 Mt5.6 Mt Turning over a New Leaf

    E-Print Network [OSTI]

    to local communities and other stewards of our natural resources. Forest Trends analyzes strategic market natural ecosystems, which provide life-sustaining processes, by promoting incentives stemming from a broad 19th Street, NW 4th floor Washington, DC 20036 info@ecosystemmarketplace.com www

  1. Application of natural analogues in the Yucca Mountain project - overview

    E-Print Network [OSTI]

    Simmons, Ardyth M.

    2003-01-01

    Processes Yellowstone and other geothermal systems in weldedat Yellowstone (WY) and Wairakei (NZ) geothermal fields;Yellowstone (WY), Otake (Japan), and various New Zealand geothermal

  2. Present address: South Dakota Department of Game, Fish and Parks, 20641 SD HWY 1806, Ft Pierre, SD 57532, USA. Corresponding author email address: chris.longhenry@state.sd.us

    E-Print Network [OSTI]

    ) aquacultural harvest data to model climate effects on variability of juvenile yellow perch year class strength-permanent wetlands. KEY WORDS Climatic effects, Perca flavescens, recruitment, wetlands, yellow perch Climate factors) and increased water levels (Henderson 1985) have also been positively related to abundance of larval yellow

  3. Source:http://webarchive.nationalarchives.gov.uk/20090224120513/teachernet.gov.uk/sustainabl A manual for all students taking SD modules or the SD

    E-Print Network [OSTI]

    Brierley, Andrew

    of BREEAM Excellent for the new Medical Building. The Sustainable Development Undergraduate Programme

  4. Shell plans $2. 2-billion renovation of Dutch refinery

    SciTech Connect (OSTI)

    Ladeur, P. (Shell Internationale Petroleum Maatschappij B.V., Hague (Netherlands)); Bijwaard, H.

    1993-04-26

    Royal Dutch/Shell Group recently approved a $2.2 billion rejuvenation of its Pernis refinery, near Rotterdam. This upgrade will enable the refinery to meet product volume and quality demands well into the next century, while reducing environmental emissions. Cornerstones of the $1.7-billion main revamp project are a single-train, 8,000 metric tons/sd (mt/sd), or about 56,000 b/sd, hydrocracking unit and a three-train 1,650 mt/sd residue-gasification unit for production of hydrogen and sulfur-free fuel gas. Fuel gas will be used in a new 115-mw electricity cogeneration plant. In addition, new amine treating, sulfur recovery, and tail gas units will be installed. The paper describes the process selection; hydrocracking unit; gasification unit; utilities; construction; and environmental aspects.

  5. Comment on ``Specific Heat and Shape Transitions in Light sd Nuclei''

    E-Print Network [OSTI]

    B. J. Cole; H. G. Miller; R. M. Quick

    1994-09-02

    This comment re-examines the origin of structure seen in the computed specific heat of finite nuclei. In a recent paper, Civitarese and Schvellinger suggest that such structure is due to model-space truncation in the calculations. We reaffirm our conclusion that the structure is caused by a collective-to-non-collective phase transformation at low temperatures, signaled by a change in the nuclear level density below 10 MeV excitation energy.

  6. ADMINISTRATIVE CHANGE TO NNSA SD G-1027, "GUIDANCE ON USING RELEASE...

    National Nuclear Security Administration (NNSA)

    needed based on consideration of the physical and chemical form and available dispersive energy sources. For Hazard Category 2 thresholds, the adjustment is performed by...

  7. UNIVERSIDADE FEDERAL DO PARAN -SETOR DE CINCIAS DA SADE SIBI -BIBLIOTECA DE CINCIAS DA SADE -SD

    E-Print Network [OSTI]

    Paran, Universidade Federal do

    - RADIOLOGIA1 ARTIGOS INDEXADOS (Revistas no localizadas em bases de dados bibliogrficas esto com espao em. Hemangioendotelioma Heptico: aspectos radiolgicos e evoluo clnica de um caso. Radiologia Brasileira, v.36, n.1, p

  8. UNIVERSIDADE FEDERAL DO PARAN -SETOR DE CINCIAS DA SADE SIBI -BIBLIOTECA DE CINCIAS DA SADE -SD

    E-Print Network [OSTI]

    Paran, Universidade Federal do

    crnicas atravs de ressonncia magntica de 3 Tesla. Mestrado em Medicina (Radiologia). Universidade

  9. perturbation Peyser, T.A.; Murray, S.D.; Farley, D.R.; Logory...

    Office of Scientific and Technical Information (OSTI)

    These experiments were performed using the Nova laser. Measurements of the time-evolution of the mixing region were reported previously. We compared the experimental...

  10. Microsoft Word - RedSeal_Smart Grid Policy Logistics RFI-sd.docx

    Energy Savers [EERE]

    smart grid technologies that will significantly increase the number and availability of digital access points for hackers to cause harm through smart meters, automated control...

  11. Hard Drive Camcorder Elegant and slim HDD/microSD Hybrid camcorder with KONICA MINOLTA

    E-Print Network [OSTI]

    Backlight Control Auto Illumi. Light Data Battery Picture Titles Quick Restart Direct DVD Button: 680k Effective Pixels for Capture (Moving images - 340k-pixel) (Still images - 340k-pixel) KONICA.0 F Stop - F1.8 - F4.0 Filter Diameter (mm) - 30.5 Video Image Stabilization Full Range AF

  12. Geobacter sp. SD-1 with enhanced electrochemical activity in high-salt concentration solutions

    E-Print Network [OSTI]

    , was obtained from a biofilm dominated by Geobacter sulfur- reducens in a microbial fuel cell fuel cells (MFCs), microbial electrolysis cells (MECs) as well as other systems, are technologies are exoelectrogenic, and there are different characteris- tics needed for optimal growth on dissolving minerals

  13. IPNO DR-01-010 PAO/SD/PMT/Bases/Design

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    variation of the particle density with the primary energy and the distance between the shower core.3 and -3.3 V regulated supplies. The total power budget for one PMT base is limited to 500 mW i.e. 1.5 m by cosmic rays with energies of up to 1021 eV. The surface array is composed of 1,600 Cerenkov water tanks

  14. PROC. S.D. ACAD. SCI., VOL. 74 (1995) 77 RELATIONSIllP BETWEEN DIETARY

    E-Print Network [OSTI]

    1995-01-01

    -TAILED DEER IN THE NORTHERN BLACK HILLS OF SOUTH DAKOTA Robert G. Osborn and Jonathan A. Jenks Department Black Hills ofSouth Dakota. Fecal samples werecollectedattwo week intervals from Januarythrough March (Howery and Pfister, 1990), elk (Cervlls elaplrlls; Leslie and Starkey. 1985), bighorn sheep (Ovis

  15. An updated anthropogenic CO2 inventory in the Atlantic Ocean S.-D. Choi,1

    E-Print Network [OSTI]

    to the industrial revolution to the current level of more than 370 ppm [Neftel et al., 1985; Keeling and Whorf, 2000 accumulated in the world oceans during the industrial era. This global oceanic uptake accounts

  16. Session Name: Data Transfer (session D2SD) Co-Chairs: Andrew Cherry, Eli Dart

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541 Unlimited Release4: "Short-Term Energy Prices -

  17. ADMINISTRATIVE CHANGE TO NNSA SD G-1027, "GUIDANCE ON USING RELEASE FRACTION AND MODERN

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr |oft I s s u e450.2G 1027

  18. ADMINISTRATIVE CHANGE TO SD 251.1, Policy Letters: NNSA Policies, Supplemental Directives, and Business Operating

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr |oft I s s u e450.2G 1027NA

  19. Microsoft Word - RedSeal_Smart Grid Policy Logistics RFI-sd.docx

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy May2.docTechnicalBARACK ofAcquisition Smart Grid RFI

  20. NNSA Supplemental Guidance: NA-1 SD G 1027 | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -Department of EnergyNEW1for Acquisition and ProjectNNSA SitesNNSA

  1. Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:Standards Jump to:VernonWisconsin:Labs LLP

  2. Integrated Dense Array and Transect MT Surveying at Dixie Valley...

    Open Energy Info (EERE)

    Dixie Valley Geothermal Area, Nevada- Structural Controls, Hydrothermal Alteration and Deep Fluid Sources Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  3. Improving Machine Tool Interoperability Using Standardized Interface Protocols: MT Connect

    E-Print Network [OSTI]

    Vijayaraghavan, Athulan; Sobel, Will; Fox, Armando; Dornfeld, David; Warndorf, Paul

    2008-01-01

    23-26, 2008 IMPROVING MACHINE TOOL INTEROPERABILITY USINGMTConnect TM data from a machine tool for process planningpotential of improved machine-tool interoperability through

  4. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    Date Usefulness not indicated DOE-funding Unknown References L. Shevenell, F. Goff (2000) Temporal Geochemical Variations In Volatile Emissions From Mount St Helens, Usa,...

  5. Northwest Distributed/Community Wind Workgroup Meeting- MT

    Broader source: Energy.gov [DOE]

    The Northwest Wind Resource and Action Center, which is partially funded by the U.S. Department of Energy, will facilitate a workgroup meeting for stakeholders involved in the distributed and...

  6. Thermal Gradient Holes At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    the area References J. Held, F. Henderson (2012) New developments in Colorado geothermal energy projects Additional References Retrieved from "http:en.openei.orgw...

  7. Deriving Semantic Knowledge from Descriptive Texts using an MT System

    E-Print Network [OSTI]

    Spirtes, Peter

    , instantiating concepts in an upper model for the electric power domain. In an extension of the basic system, we statements for entry into the Ontology Works electrical power factbase [9]. The system was extended to allow and textual description for a model of the North west electric power grid [10]. A set of texts were written

  8. Improving Machine Tool Interoperability Using Standardized Interface Protocols: MT Connect

    E-Print Network [OSTI]

    Vijayaraghavan, Athulan; Sobel, Will; Fox, Armando; Dornfeld, David; Warndorf, Paul

    2008-01-01

    interoperability enabled by MTConnect TM can provide the mechanism for process and system monitoring and optimization with respect to energy and

  9. Analysis of borehole temperature data from the Mt. Princeton...

    Open Energy Info (EERE)

    Colorado (abstract only) Author P. Morgan Conference AAPG Rocky Mountain Meeting; Salt Lake County, Utah; 10811 Published AAPG Rocky Mountain Meeting, 2013 DOI Not Provided...

  10. Urdu Localization Project: Lexicon, MT and TTS (ULP) Sarmad HUSSAIN

    E-Print Network [OSTI]

    , Pakistan sarmad.hussain@nu.edu.pk Abstract Pakistan has a population of 140 million speaking more than 56, also the national language of Pakistan. Being a developing population, Pakistani people need access-10% of these people are familiar with English. Therefore, Government of Pakistan has embarked on a project which

  11. School of Mathematics and Statistics MT5824 Topics in Groups

    E-Print Network [OSTI]

    St Andrews, University of

    .] Deduce that GpG (G). Use the previous question to show that (G) = GpG. Show that G can be generated

  12. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    not indicated DOE-funding Unknown References Lisa Shevenell, Fraser Goff (1995) Evolution Of Hydrothermal Waters At Mount St Helens, Washington, Usa Additional References...

  13. Todd J. Kaiser Montana State University, Bozeman, MT

    E-Print Network [OSTI]

    Kaiser, Todd J.

    and Actuators Workshop, pp 85-88, June 2000. E. Selected Invited Presentations "Solar Cell Basics for Teachers Square Cambridge, MA 02139 C. Selected Journal Publications "A Wireless Sensor Interrogation Design for Passive Resonant Frequency Sensors using Frequency Modulation Spectroscopy," Brian Peterson, Andrew Olson

  14. DLT -AN INDUSTRIAL R & D PROJECT FOR MULTILINGUAL MT

    E-Print Network [OSTI]

    by an ophthalmo-logist towards the end of the nineteenth century) is not usually considered a respectable object-term development and maintenance of a complex translation and world knowledge system is a task that can only

  15. *MT 4S1SGOO ^ Ris-M-2672

    E-Print Network [OSTI]

    . APPLICATIONS OF NEUTRON RADIOGRAPHY 14 7.1. Nuclear industry 16 Nuclear fuel 16 General 23 7.2. Industrial of application of neutron radiography in industry and the nuclear field. October 1987 Ris National Laboratory 26 Real-time 26 Engine fluids 26 7.3. Non-industrial applications 27 Biology, medicine and dentistry

  16. Extrinsic Evaluation of Patent MT: Review and Commentary

    E-Print Network [OSTI]

    Oard, Doug

    ." The National Institute of Informatics (NII) Testbeds and Community for Information Access Research (NTCIR these tasks into three broad categories (expressed here using specific examples of languages and sources College Park, MD 20742 USA oard@umd.edu Noriko Kando National Institute of Informatics Tokyo, Japan kando

  17. Seismicity induced by seasonal groundwater recharge at Mt. Hood, Oregon

    E-Print Network [OSTI]

    Manga, Michael

    and narrow-width pore-fluid pressure signal. Time delays between this seasonal groundwater recharge-fluid pressure fraction, PP/P0W0.1, of the applied near-surface pore-fluid pressure perturbation, P0W0.1 MPa Elsevier B.V. All rights reserved. Keywords: hydroseismicity; groundwater; pore-uid pressure; permeability

  18. Statistical Theory MT 2009 Problems 1: Solution sketches

    E-Print Network [OSTI]

    Reinert, Gesine

    =1 Xi and put T = X 1 n-1 n i=1(Xi - X)2 . Show that T is an ancillary statistic. What does this say the distribution of T does not depend on neither; it is an ancillary statistic. Thus a t-test based on exponential of A is independent of (so A is an ancillary statistic). c) Show that any value in the interval x(n) - 1 2 , x(1) + 1

  19. Self Potential At Mt Princeton Hot Springs Geothermal Area (Richards...

    Open Energy Info (EERE)

    2008 - 2010 Usefulness useful DOE-funding Unknown Exploration Basis Determination of groundwater flux patterns Notes Researchers collected 2700 SP measurements. Equilibrium...

  20. DC Resistivity Survey (Wenner Array) At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    2008 - 2010 Usefulness useful DOE-funding Unknown Exploration Basis Determination of groundwater flux patterns Notes Researchers measured DC resistivity and produced 12 resistivity...

  1. Graduate Student Handbook The Graduate Group in Molecular Toxicology (MT)

    E-Print Network [OSTI]

    (Stat 2, 20) 1 Semester Mathematics Differential and Integral Calculus (Math 1A) 1 Semester Chemistry and Microbial Biology, Chemistry, Public Health, Environmental Science and Policy Management, Integrative in the core courses. Research units (NST 299) are not calculated into this GPA requirement. To receive

  2. 2323 University Way, Suite 239 Bozeman, MT 59717

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    is accomplished through exposure and penetration of the contaminated material by superheated steam for an adequate through autoclaving. After sterilization in a steam autoclave, these materials are considered non amount of time. Because steam will not penetrate a sealed plastic autoclave bag, bags containing dry

  3. MSc Programme In the programme, MT engineers acquire a thorough

    E-Print Network [OSTI]

    Langendoen, Koen

    . Research within the Marine Technology group focuses on ship hydromechanics, shipbuilding and design, safety of new ones. Ship Production is concerned in particular with the management of shipbuilding projects

  4. Ground Gravity Survey At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar Jump to:ResourcesGriggsOpen| OpenAl., 1979)Al., 2003)

  5. Ground Magnetics At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar JumpInformation Crump's Hot Springs Area (DOE

  6. File:INL-geothermal-mt.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages Recent Changes AllApschem.pdfgasp 03.pdf JumpGerak.pdf Jump to:hi.pdf Jump

  7. Data Acquisition-Manipulation At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstruments Inc JumpIowa: EnergyDarkEnergy InformationEnergy

  8. Mt Carmel Public Utility Co | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)

  9. RAPID/Roadmap/1-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasource History

  10. RAPID/Roadmap/11-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-a <aa <

  11. RAPID/Roadmap/11-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-a <aa <b <

  12. RAPID/Roadmap/13-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | Roadmap Jumpf <ID-a

  13. RAPID/Roadmap/14-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-c

  14. RAPID/Roadmap/14-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ce < RAPID‎

  15. RAPID/Roadmap/17-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aa

  16. RAPID/Roadmap/18-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-bad

  17. RAPID/Roadmap/19-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f < RAPID‎ |

  18. RAPID/Roadmap/3-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aa <dFD-pca <

  19. RAPID/Roadmap/3-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aa <dFD-pca <b

  20. RAPID/Roadmap/6-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac <a

  1. RAPID/Roadmap/6-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac <ab

  2. RAPID/Roadmap/6-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac

  3. RAPID/Roadmap/7-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa <NV-b < RAPID‎ |ahn

  4. Whitlash, MT Natural Gas Imports by Pipeline from Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3Additions (Million CubicYearSeparation9,195 7,707 7,062 6,571

  5. 2007-mt-elbert | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-Decay EvaluatedThe6 Feature2007 News7

  6. Port of Morgan, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265 257485,026

  7. Port of Morgan, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265

  8. Sweetgrass, MT Liquefied Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3 November 2013Additions (Million CubicYearCubic(Million,109 932

  9. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3 November 2013Additions (MillionThousand Cubic Feet) Year

  10. Babb, MT Liquefied Natural Gas Exports (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease Separation A4.98

  11. City of Mt Pleasant, Iowa (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121 Website:

  12. City of Mt Pleasant, Tennessee (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121

  13. Village of Mt Horeb, Wisconsin (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company)Idaho) Jump to:NewVermont (Utility Company) Jump

  14. RAPID/Roadmap/11-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report Url

  15. RAPID/Roadmap/17-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad

  16. RAPID/Roadmap/3-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <

  17. RAPID/Roadmap/3-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <d

  18. RAPID/Roadmap/3-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <de

  19. RAPID/Roadmap/3-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <def

  20. RAPID/Roadmap/5-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-ae

  1. RAPID/Roadmap/6-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-ab < RAPID‎ |c <dee

  2. RAPID/Roadmap/9-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a <aAK-a

  3. Mt. Wachusett Community College Makes Huge Investment in Wind Power |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOEDepartment of Energy Motion to Mr. Daniel CohenJUN 1 1 20133

  4. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.

  5. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I .

  6. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I

  7. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I

  8. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I II

  9. BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, V

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I IIV

  10. Field Mapping At Marysville Mt Area (Blackwell) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdisto ElectricMonaster And Coolbaugh, 2007)

  11. Magnetotelluric Techniques At Mt Princeton Hot Springs Geothermal Area

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios Towards 2050EnermarGeneration Jump to:New(Held & Henderson,

  12. Mt Wheeler Power, Inc (Utah) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump

  13. Mt. Edgecumbe High School Wind Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility JumpEdgecumbe

  14. 3D Mt Resistivity Imaging For Geothermal Resource Assessment And

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (UtilityMichigan)data bookresult9) Jump to:13:28-07:00

  15. Sweetgrass, MT Liquefied Natural Gas Exports (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(Million Cubic

  16. Sweetgrass, MT Liquefied Natural Gas Exports Price (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(Million

  17. Sweetgrass, MT Liquefied Natural Gas Exports Price (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(MillionCubic

  18. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page

  19. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic Feet) Year

  20. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic Feet)

  1. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic

  2. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand CubicThousand Cubic

  3. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand CubicThousand

  4. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand

  5. Data Driven Analytics in Powder River Basin, WY Mohammad Maysami, Razi Gaskari, Intelligent Solutions, Inc., Shahab D. Mohaghegh, Intelligent Solutions, Inc.

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    that adapt themselves to specific needs of individual users. There are many mobile and web-based services

  6. IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE

    E-Print Network [OSTI]

    IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE SURVEYS By Michael J. Moran, Rick M. Clawges, and John S. Zogorski U.S. Geological Survey 1608 Mt. View Rapid City, SD 57702 Methyl tert-butyl ether (MTBE) is commonly added to gasoline

  7. EIS-0432: Medicine Bow Fuel & Power Coal-to-Liquid Facility in...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2: Medicine Bow Fuel & Power Coal-to-Liquid Facility in Carbon County, WY EIS-0432: Medicine Bow Fuel & Power Coal-to-Liquid Facility in Carbon County, WY Documents Available for...

  8. Brain-targeted proanthocyanidin metabolites for Alzheimer's disease treatment

    E-Print Network [OSTI]

    2012-01-01

    WY (2006) Metabolism of green tea catechins: an overview.Town T, Tan J (2005) Green tea epigallocatechin-3-gallate (

  9. SD-VBS: The San Diego Vision Benchmark Suite Sravanthi Kota Venkata, Ikkjin Ahn, Donghwan Jeon, Anshuman Gupta,

    E-Print Network [OSTI]

    Cortes, Corinna

    platforms. The C code minimizes pointer usage and employs clean constructs to make them easier across a diverse and rich set of fields including medicine, automotive robotics, web search, guidance platforms in real-time. Recently, motivated by the power crisis brought on by tran- sistor scaling

  10. Microsoft Word - HQ-#465026-v1-NNSA_SD_350_2_-_FINAL_9-6-CLEAN

    National Nuclear Security Administration (NNSA)

    and Project Management NNSA SUPPLEMENTAL DIRECTIVE Approved: 10-18-12 USE OF MANAGEMENT AND OPERATING CONTRACTOR EMPLOYEES FOR SERVICES TO THE NATIONAL NUCLEAR SECURITY...

  11. Is Tritium over-regulated by DOE? Should the TFG support NA-1 SD G 1027 tritium values?

    Office of Energy Efficiency and Renewable Energy (EERE)

    Presentation from the 32nd Tritium Focus Group Meeting held in Germantown, Maryland on April 23-25, 2013.

  12. Reservoir characterization of the Ordovician Red River Formation in southwest Williston Basin Bowman County, ND and Harding County, SD

    SciTech Connect (OSTI)

    Sippel, M.A.; Luff, K.D.; Hendricks, M.L.; Eby, D.E.

    1998-07-01

    This topical report is a compilation of characterizations by different disciplines of the Red River Formation in the southwest portion of the Williston Basin and the oil reservoirs which it contains in an area which straddles the state line between North Dakota and South Dakota. Goals of the report are to increase understanding of the reservoir rocks, oil-in-place, heterogeneity, and methods for improved recovery. The report is divided by discipline into five major sections: (1) geology, (2) petrography-petrophysical, (3) engineering, (4) case studies and (5) geophysical. Interwoven in these sections are results from demonstration wells which were drilled or selected for special testing to evaluate important concepts for field development and enhanced recovery. The Red River study area has been successfully explored with two-dimensional (2D) seismic. Improved reservoir characterization utilizing 3-dimensional (3D) and has been investigated for identification of structural and stratigraphic reservoir compartments. These seismic characterization tools are integrated with geological and engineering studies. Targeted drilling from predictions using 3D seismic for porosity development were successful in developing significant reserves at close distances to old wells. Short-lateral and horizontal drilling technologies were tested for improved completion efficiency. Lateral completions should improve economics for both primary and secondary recovery where low permeability is a problem and higher density drilling is limited by drilling cost. Low water injectivity and widely spaced wells have restricted the application of waterflooding in the past. Water injection tests were performed in both a vertical and a horizontal well. Data from these tests were used to predict long-term injection and oil recovery.

  13. OO84O4c6sP HNF-SD-WM-II-740, Rev. OB

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolarNewsusceptometer under pressureNavyNumericalO K30 SeeOO84O4c6sP

  14. Microsoft Word - HQ-#465026-v1-NNSA_SD_350_2_-_FINAL_9-6-CLEAN

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12 |SanApproved:

  15. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    kerosene, diesel oil, fuel oil, LPG, refinery gas and otherMt Diesel Oil Mt Fuel Oil Mt LPG Mt Refinery Gas Mt Other

  16. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    kerosene, diesel oil, fuel oil, LPG, refinery gas and otherMt Diesel Oil Mt Fuel Oil Mt LPG Mt Refinery Gas Mt Other

  17. Report on surface geology and groundwater investigations of Mortons and Green Valley Well Fields. Final technical report, November 1980-May 1982. [Proposed WyCoalGas Project, Converse County, Wyoming; site evaluation

    SciTech Connect (OSTI)

    None

    1982-01-01

    The general region of investigation of this report is in the southern part of the Powder River Basin near the Town of Douglas, Wyoming. Two specific areas within this region were investigated to determine the groundwater potential with drilling and testing programs during the years 1973 to 1975. One area of investigation is located approximately 12 miles west of Douglas in T32 and 33N, R73 and 74W, and is known as the Green Valley Well Field. This area is situated in the foothills of the north end of the Laramie Range and encompasses approximately 25 square miles. In this area the Madison Formation limestone and the Flathead Formation sandstone are the aquifers of interest for groundwater production. The second area is located approximately 13 miles north of Douglas in T34 and 35N, R70 and 71W, and is known as the Mortons Well Field. This area encompasses about 30 square miles. In this area, the Lance Formation and Fox Hills Formation sandstones are the aquifers of interest. Contained within the body of this report are two geologic studies prepared by consulting geologists, Dr. Peter Huntoon and Henry Richter. These studies define the pertinent structural and groundwater geologic features in and in the vicinities of the Mortons and Green Valley Well Fields. A relatively complex structural geology was encountered in the Green Valley area. The study of the Mortons area suggests that the geology of this area is relatively uniform. Inventories of the water users in the vicinities of the two study areas are included at the back of this report in Appendix B. These inventories are comprised of water appropriations as recognized by the Wyoming State Engineer's Office. Both groundwater and surface water appropriations are inventoried within the Green Valley study area. Only groundwater appropriations are inventoried within the Mortons study area.

  18. C;\\u U ,RAI Y Mt. PI OJ 1, Mich.

    E-Print Network [OSTI]

    /3 cup salad dressing 2 ta blespoons chopped onion 1 tea poon salt Pepper to season Salad greens Dram he Oll off he tuna Brea. the tuna in 0 large pieces. ix every- thing together except he salad greens. Pu the una-po a 0 salad in the refrigera or until cold Serve he una-potato salad on the so ad greens #12

  19. Www.deq.mt.gov/MFS/LawRules/Circular2 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEtGeorgia:Illinois:Wizard Power

  20. Thermal And-Or Near Infrared At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open EnergyEnergy

  1. Thermal And-Or Near Infrared At Mt Ranier Area (Frank, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open

  2. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    incentivizing unbridled water extraction, this situation ledhow much individual water extraction practices impact theexcessive groundwater extraction Water Scarcity and Ac- cess

  3. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    103113 18 Freeman, Strategic Management: A StakeholderFreeman, R. Edward. Strategic Management: A StakeholderCommander. 39,40 Freeman Strategic Management: A Stakeholder

  4. In-situ aircraft observations of the 2000 Mt. Hekla volcanic cloud: Composition and chemical

    E-Print Network [OSTI]

    Lee, Shan-Hu

    to sulfuric acid was broadly consistent with changing OH concentrations at the time of the vernal equinox

  5. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    of Fire and Invasive Alien Plant Management Practices inof Fire and Invasive Alien Plant Management Practices inof Fire and Invasive Alien Plant Management Practices in

  6. mtDNA Variation in Caste Populations of Andhra Pradesh, India.

    E-Print Network [OSTI]

    Bamshad, Michael; Fraley, Alexander E.; Crawford, Michael H.; Cann, Rebecca L.; Busi, Baskara R.; Naidu, J. M.; Jorde, Lynn B.

    1996-01-01

    Various anthropological analyses have documented extensive regional variation among populations on the subcontinent of India using morphological, protein, blood group, and nuclear DNA polymorphisms. These patterns are the product of complex...

  7. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    11 California State Water Resources Control Board, The WaterSan Diego Regional Water Quality Control Board, Watershed73 California State Water Resources Control Board, The Water

  8. Montana Weed Control Association Annual Meeting. January 11th 2011, Great Falls, MT.

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Seed movement by vehicles: how many, how far, and under what conditions? Movement of seeds by vehicles is generally thought to increase the spread of invasive plant species, but few studies have vehicles when driven a range of distances on different surfaces (asphalt, unpaved and offroad) under wet

  9. LETTERS TO THE EDITOR Two years ago at the MT Summit held in Hakone, Japan,

    E-Print Network [OSTI]

    is based on the Arthur D. Little (ADL) study of the production experience with the Georgetown Russian). Finally, it was suggested that there were better ways for the federal government to spend these R & D

  10. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Libecap, Gary D. Rescuing Water Markets: Lessons from OwensWest and Its Disappearing Water, Revised Edition. Revised. (Thomas. Estimating Water Requirements for Firefighting

  11. A Demonstration Project for Capturing Geothermal Energy from Mine Waters beneath Butte, MT

    Broader source: Energy.gov [DOE]

    Project objectives. Demonstrate performance of heat pumps in a large HVAC system in a heating-dominated climate.

  12. Istituzioni di Matematiche I (CH-CI-MT) ________________________________V_IIIo_foglio_di_esercizi______________________*

    E-Print Network [OSTI]

    Candilera, Maurizio

    flesso e B quello a tangente parallela all'asse delle ordinate, si determini il* * volume del solido ottenuto dalla rotazione della regione finita di piano compresa tra l'arco AB, la retta OA e l* *'asse delle ascisse, di un intero giro attorno alla asse medesimo. ESERCIZIO 4. Si disegni nel piano

  13. The CAFE experiment : a joint seismic and MT investigation of the Cascadia subduction system

    E-Print Network [OSTI]

    McGary, R. Shane

    2013-01-01

    In this thesis we present results from inversion of data using dense arrays of collocated seismic and magnetotelluric stations located in the Cascadia subduction zone region of central Washington. In the migrated seismic ...

  14. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    1: Climate Change and the Energy Crisis. (2008). Getting Our1: Climate Change and the Energy Crisis. (2008). http://

  15. IDBA-MT: De novo Assembler for Metatranscriptomic Data generated from Next-Generating Sequencing Technology

    E-Print Network [OSTI]

    Chin, Francis Y.L.

    Parkinson Biochemistry & Molecular and Medical Genetics University of Toronto, 27 King's College Circle, Toronto, Ontario, Canada M5S 1A1 Email: john.parkinson@utoronto.ca Telephone: 416-813-5746 Francis Y of microbes in human gut was found to be related to common diseases such as Inflammatory Bowel Disease (IBD

  16. Hawaiian Hot-spot Swell Structure from Seafloor MT Sounding Steven Constable

    E-Print Network [OSTI]

    Key, Kerry

    on the hotspot (Cough, 1979; Detrick and Crough, 1978); (ii) compositional underplating of depleted mantle

  17. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    Human Genome The Human Genome Nuclear DNA 3 billion bp High Power Of Discrimination Mitochondrial DNA 16 11 12 13 14 15 16 17 18 19 20 21 22 X Y Sex- chromosomes Autosomes 3.2 billion bp Nuclear DNA), and use a genetic code for amino acids different that the nuclear DNA. New mitochondria are formed

  18. The Investigation on Fibrous Veins and Their Host from Mt. Ida, Ouachita Mountains, Arkansas

    E-Print Network [OSTI]

    Chung, Jae Won

    2004-09-30

    , the ?13C and ?18O compositions of the host lithologies range from 1.5 to -3.0 per mil and 7.5 to -14.0 per mil (VPDB), respectively. By contrast, the ?18O composition of the veins is remarkably constant (-13.5 per mil) among veins of starkly different...

  19. Compound Nouns in a Unification-Based MT System Pierrette Bouillon Katharina Boesefeldt

    E-Print Network [OSTI]

    of the texts involved in order to translate compounds efficientlyand correctly. We first give a brief overview

  20. MT3522 Knot Theory Solutions 4 1. (i) The closure of 2

    E-Print Network [OSTI]

    Walker, Grant

    molecule. O 1 :unknot O 2 :split unlink or opposite matched M 1 :pos trefoil M 2 :pos Hopf link or 3 #12; or opposite O 1 O 2 :pos trefoil :pos Hopf link :unknot or matched M 2 :split unlink M 1 opposite 2 or O 1 O

  1. m)T7(T^/f^\\ \\ / Riso-R-430 The Geochemistry

    E-Print Network [OSTI]

    -LEVEL HASTE 22 Uranium 31 Neptunium 35 Plutonium 38 Americium 41 CHEMISTRY OF TECHNETIUM 44 ADSORPTION, stability-diagrams for the transuranium elements from uranium to americium under diverse conditions have GROUNDWATER COMPOSITIONS 7 COMPLEX CHEMISTRY 12 CRITICAL ANION CONCENTRATION IN GROUND WATERS 17 THE CHEMISTRY

  2. mtAndroid Aplicao Mvel Android de Apoio a Percursos Pedestres Outdoor

    E-Print Network [OSTI]

    da Silva, Alberto Rodrigues

    às capacidades de um Smartphone e das tecnologias disponíveis no meio envolvente. Além das principais técnicas e tecnologias de localização existentes

  3. On the stability of the Earth's radiative energy balance: Response to the Mt. Pinatubo eruption

    E-Print Network [OSTI]

    short wave energy into the outgoing long wave energy stream, it is of interest to understand how and why

  4. Building America Case Study: Lancaster County Career and Technology Center Green Home 3, Mt Joy, Pennsylvania

    SciTech Connect (OSTI)

    Not Available

    2014-12-01

    Transitioning from standard light frame to a thermal mass wall system in a high performance home will require a higher level of design integration with the mechanical systems. The much higher mass in the ICF wall influences heat transfer through the wall and affects how the heating and cooling system responds to changing outdoor conditions. This is even more important for efficient, low-load homes with efficient heat pump systems in colder climates where the heating and cooling peak loads are significantly different from standard construction.This report analyzes a range of design features and component performance estimates in an effort to select practical, cost-effective solutions for high performance homes in a cold climate. Of primary interest is the influence of the ICF walls on developing an effective air sealing strategy and selecting an appropriate heating and cooling equipment type and capacity. The domestic water heating system is analyzed for costs and savings to investigate options for higher efficiency electric water heating. A method to ensure mechanical ventilation air flows is examined. The final solution package includes high-R mass walls, very low infiltration rates, multi-stage heat pump heating, solar thermal domestic hot water system, and energy recovery ventilation. This solution package can be used for homes to exceed 2012 International Energy Conservation Code requirements throughout all climate zones and achieves the DOE Challenge Home certification.

  5. J. Geomag. Geoelectr., 49, 727-737, 1997 Introduction to MT.,.DIW2 Special Issue

    E-Print Network [OSTI]

    Jones, Alan G.

    line, with 300 m dipoles. In-line electric fields only were recorded on this line. The four full 5, Downing Street, Cambridge, England, CB2 9EQ 1. Introduction The second Magnetotelluric Data Interpretation

  6. ATH 1300/1600 M-MT MAGLEV HYBRID TURBOMOLECULAR PUMPS

    E-Print Network [OSTI]

    Wager, John F.

    ). In Europe, AVTF-France headquarters and three of its subsidiaries, Alcatel Hochvakuumtechnik (Germany, Research and development, High energy physics, Space simulation, Accelerators. ADVANTAGES: High throughput of experience in the field of turbomolecular pump design. In order to ensure the best possible performance

  7. AMTA 2006 Overview of Statistical MT 1 An Overview of Statistical

    E-Print Network [OSTI]

    Smith, David A.

    , govt documents (~30M words) ... Serbian KhmerChechen {... ... { Bible/Koran/ Book of Mormon/ Dianetics

  8. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    of R: A Language and Environment for Statistical ComputingR Development Core Team. R: A language and environment for statistical

  9. Manual for Development of a Transient MODFLOW/MT3DMS/SEAWAT Simulation

    E-Print Network [OSTI]

    Barrash, Warren

    . The results of this model run are compared to the observed data in an effort to correctly identify...................................................................................... 19 Creating River Coverage........................................................................................... 20 Creating the River Arcs

  10. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    rain gardens, soil amendments, permeable pavements, and infiltration devices could offer potential solutions to problems of water

  11. Bern, 28. Januar 2015 / MT Weisung: Wechselkurs fr das Budgetieren neuer EU Grants

    E-Print Network [OSTI]

    Sola, Rolf Haenni

    Forschung Prof. Dr. Christian Leumann Vizerektor Hochschulstrasse 4 CH-3012 Bern Tel. +41 031 631 43 55 Christian.leumann@rektorat.unibe.ch www.rektorat.unibe.ch Vizerektorat, Hochschulstrasse 4, CH-3012 Bern #12;

  12. Bern, 28 January 2015 / MT Directive: Exchange rate for budgeting new EU grants

    E-Print Network [OSTI]

    Richner, Heinz

    -Rectorate Research Prof. Dr. Christian Leumann Vizerektor Hochschulstrasse 4 CH-3012 Bern Tel. +41 031 631 43 55 Christian.leumann@rektorat.unibe.ch www.rektorat.unibe.ch Vice-Rectorate, Hochschulstrasse 4, CH-3012 Bern

  13. Altered Mitochondrial Retrograde Signaling in Response to mtDNA Depletion or a Ketogenic Diet

    E-Print Network [OSTI]

    Selfridge, Jennifer Eva

    2012-12-31

    pathways and general neuronal dependence on anaerobic metabolism. Specifically, the electron transport chain function is reduced both systemically and in brains of individuals affected by Alzheimer's disease, amyotrophic lateral sclerosis, and Parkinson...

  14. Testing neural mechanisms that may underlie spatiotopic processing in area MT

    E-Print Network [OSTI]

    Ong, Wei Song

    2012-01-01

    Hence if motion processing occurs in retinal coordinates, wethat show motion processing do so in retinal coordinates, wein retinal coordinates, can have spatiotopic processing. In

  15. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    various small-scale water suppliers, the San Diego CountyDepartment, major water suppliers for the region (e.g. Mounttries to work with suppliers Acknowledges that infrastruc-

  16. NAT'L INST. OF STAND & TECH \\lllDb 2527MT

    E-Print Network [OSTI]

    standards used in science, engineering, manufacturing, commerce, industry, and education with the standards of Standards and Technology Technology Administration U.S. Department of Commerce PUBLICATIONS jri5A CENTENNIAL #12;rhe National Institute of Standards and Technology was established in 1988 by Congress

  17. Overview of physical oceanographic measurements taken during the Mt. Mitchell Cruise to the ROPME Sea Area

    SciTech Connect (OSTI)

    Reynolds, R.M.

    1993-03-31

    The ROPME Sea Area (RSA) is one of the most important commercial waterways in the world. However, the number of direct oceanographic observations is small. An international program to study the effect of the Iraqi oil spill on the environment was sponsored by the ROPME, the Intergovernmental Oceanographic Commission, and the National Oceanic and Atmospheric Administration (NOAA).

  18. Geothermal Literature Review At Mt Ranier Area (Frank, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky:Bore Technologies IncEnergy2002) | Open1957)

  19. Geothermometry At Mt St Helens Area (Shevenell & Goff, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky:Bore TechnologiesAssessmentOpenFishOpen Energy1976)

  20. Direct-Current Resistivity Survey At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOE GTP) JumpDillard(Kauahikaua &

  1. Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOE GTP) JumpDillard(Kauahikaua &1986) |

  2. Self Potential At Mt St Helens Area (Bedrosian, Et Al., 2007) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk,SageScheucoSedco Hills,Information HualalaiInformation St

  3. Isotopic Analysis At Mt St Helens Area (Shevenell & Goff, 1995) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13RenewableIremInformation Goff, Et Al.,2002) |

  4. Isotopic Analysis At Mt St Helens Area (Shevenell & Goff, 2000) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13RenewableIremInformation Goff, Et Al.,2002)

  5. Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/WaterEnergyRedfield1989) Jump to:| Open1979) |Al., 2012) |

  6. Whitlash, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3Additions (Million CubicYearSeparation9,195 7,707

  7. Babb, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"OmahaEnergy Sources and End Uses Topics: Energy Sources and End Uses End-UseA 6 JWithdrawalsYear JanYear Jan Feb Mar

  8. Babb, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"OmahaEnergy Sources and End Uses Topics: Energy Sources and End Uses End-UseA 6 JWithdrawalsYear JanYear JanYear Jan

  9. Havre, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear, ElectricRhodeFeet)Cubic Feet)Cubic Feet) Year JanYear

  10. Port of Del Bonita, MT Natural Gas Imports by Pipeline from Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265 257 241 200

  11. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Million

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265 257

  12. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424

  13. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424ThousandFeet)

  14. Havre, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969CentralWells

  15. Babb, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal4 Arizona - NaturalYear JanProfile

  16. Babb, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal4 Arizona - NaturalYear JanProfileDecade Year-0 Year-1

  17. Babb, MT Liquefied Natural Gas Exports Price (Dollars per Thousand Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease Separation

  18. Babb, MT Liquefied Natural Gas Exports to Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease SeparationCubic

  19. Babb, MT Liquefied Natural Gas Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease SeparationCubicMillion

  20. Babb, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122

  1. Babb, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122Feet) Year

  2. Babb, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122Feet)

  3. Babb, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122Feet)Cubic

  4. Babb, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0

  5. Babb, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0Year Jan Feb Mar

  6. Havre, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW

  7. Havre, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOWCubic

  8. Havre, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOWCubicYear

  9. Havre, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456

  10. Self Potential At Mt Princeton Hot Springs Geothermal Area (Richards, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-bRenewableSMUDSectional Modelof the

  11. Thermal Gradient Holes At Mt Princeton Hot Springs Geothermal Area (Held &

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJ AutomationTexas/WindEnergyOpen EnergyInformation Mcgee

  12. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson &

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) | Open Energy

  13. Water Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) | Open

  14. Water Sampling At Mt St Helens Area (Shevenell & Goff, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) |

  15. 3-D Density Model Of Mt Etna Volcano (Southern Italy) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand Dalton Jump to:Wylie,Information Skord, Et15: Leases7

  16. A Large Self-Potential Anomaly And Its Changes On The Quiet Mt Fuji, Japan

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand Dalton JumpProgram | OpenEnergyEvaluation | Open

  17. A Portable Elf-Mt System For Shallow Resistivity Sounding | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand Dalton JumpProgram | OpenEnergyEvaluation |Island,ApproachSteam|

  18. Analysis of borehole temperature data from the Mt. Princeton Hot Springs

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A S Jump to: navigation,Inof Ground Source Heat Pumparea,

  19. Aeromagnetic Survey At Mt Princeton Hot Springs Geothermal Area (Case, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolar EnergyAerodyn Energiesysteme GmbHOpenAl., 1984) | Open

  20. Aeromagnetic Survey At Mt St Helens Area (Towle, 1983) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolar EnergyAerodyn Energiesysteme GmbHOpenAl., 1984) |

  1. Controlled Source Audio MT At Mccoy Geothermal Area (DOE GTP) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans, EtInformation Control of Well KS-8 in

  2. DC Resistivity Survey (Wenner Array) At Mt Princeton Hot Springs Geothermal

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstruments Inc Jump to: navigation,(RECP) in Jump to: navigation,Area

  3. ASC_RdMap7.7.55.10_MT.indd

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr |oft5 DecemberACADEMICon

  4. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al.,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New Pages RecentPlant < Geothermal(Redirected

  5. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal Area (Case, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New PagesInformationEnergy Information 2)EnergyAl., 1984) |

  6. Integrated Dense Array and Transect MT Surveying at Dixie Valley Geothermal

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View NewGuam:on OpeneiAlbanian Centre for EnergyTorcuato Di TellaIntech

  7. Compound and Elemental Analysis At Mt St Helens Area (Shevenell & Goff,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercial Jump(Thompson, 1985) | Open1995) | Open Energy

  8. Compound and Elemental Analysis At Mt St Helens Area (Shevenell & Goff,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercial Jump(Thompson, 1985) | Open1995) | Open

  9. Controlled Source Audio MT At Cove Fort Area - Liquid (Combs 2006) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to: navigation,Energy

  10. Controlled Source Audio MT At Pilgrim Hot Springs Area (DOE GTP) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to:

  11. Controlled Source Audio MT At Roosevelt Hot Springs Area (Combs 2006) |

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to:Open Energy

  12. DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot Springs

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower VenturesInformation9) Wind Farm JumpAlum|Cyclone PowerD1

  13. Building America Case Study: Lancaster County Career and Technology Center Green Home 3, Mt Joy, Pennsylvania

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s i s t a n t S e c r e t a r y J uF EERE

  14. EM SSAB NATIONAL CHAIRS MEETING Deer Creek State Park, Mt. Sterling, Ohio

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based|DepartmentStatementof EnergyQuality AssuranceTop Line8,26,SeptemberEM

  15. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper Thousand Cubic

  16. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper Thousand Cubicper

  17. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper Thousand

  18. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper ThousandCubic

  19. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper

  20. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year JanperThousand Cubic

  1. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year JanperThousand

  2. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year JanperThousandFeet)

  3. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year

  4. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) YearThousand Cubic Feet)

  5. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) YearThousand Cubic

  6. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) YearThousand CubicFeet)

  7. Whitlash, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0 1 1Cubic

  8. Whitlash, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0 1

  9. Whitlash, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0 1Decade

  10. Whitlash, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0

  11. SciTech Connect:

    Office of Scientific and Technical Information (OSTI)

    CO (United States) Rocky Flats Field Office, Golden, CO (United States) Rocky Mountain Oilfield Testing Center, Casper, WY (United States) S. M. Stoller (United States) SLAC...

  12. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    (United States); Western Research Institute, Laramie, WY (United States)","USDOE","01 COAL, LIGNITE, AND PEAT",,"Under the cooperative agreement program of DOE and funding from...

  13. SciTech Connect:

    Office of Scientific and Technical Information (OSTI)

    Golden, CO (United States) Rocky Flats Field Office, Golden, CO (United States) Rocky Mountain Oilfield Testing Center, Casper, WY (United States) S. M. Stoller (United States)...

  14. U.S. Energy Information Administration | State Energy Data 2013...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    (GE) * conventional hydroelectric power (HY) * solar thermal direct use energy and photovoltaic electricity net generation (SO) * electricity produced by wind (WY) * wood and...

  15. Initial Hydrologic Feasibility Analysis of the Proposed Ship Channel Bypass (lower Sacramento River, California

    E-Print Network [OSTI]

    Church, Tami C.

    2012-01-01

    R = 0.9875 DISCHARGE (cfs) FIGURE 6: Correlation betweeninterpolated DISCHARGE (cfs) mean daily flow (IST) YEARYEAR (WY1991) DISCHARGE (cfs) SEP AUG JUL JUN MAY APR MAR

  16. Chemoprevention of human skin cancers.

    E-Print Network [OSTI]

    Loescher, L J; Meyskens, F L Jr

    1991-01-01

    chemopreventive activity of resveratrol, a natural productJM, Dannenberg AJ. Resveratrol inhibits cyclooxygenase-2C, Ma WY, Goranson A, Dong Z. Resveratrol sup- presses cell

  17. Assessment of China's Energy-Saving and Emission-Reduction Accomplishments and Opportunities During the 11th Five Year Plan

    E-Print Network [OSTI]

    Levine, Mark D.

    2010-01-01

    calcium carbide, coking, cement, coal, plate glass, pulp andcarbide 2 Mt Coking 80 Mt Cement 250 Mt Coal mining (

  18. 978-1-61284-469-5/11/$26.00 2011 IEEE October 12 -15, 2011, Rapid City, SD ASEE/IEEE Frontiers in Education Conference

    E-Print Network [OSTI]

    illustrate principles of the; solar pathfinder, flywheel, hydroelectricity, wind turbine, thermoelectricity, flywheel, wind turbine, hydroelectric, thermoelectric and hydrogen fuel cell car. All laboratory

  19. Fast Track Analysis of Shale Numerical Models A. Kalantari-Dahaghi ,SPE, S. Esmaili, SPE, West Virginia University, S.D. Mohaghegh, SPE, Intelligent Solution

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    SPE 162699 Fast Track Analysis of Shale Numerical Models A. Kalantari-Dahaghi ,SPE, S. Esmaili, SPE of SPE copyright. Abstract Latest advances in shale gas reservoir simulation and modeling have made it possible to optimize and enhance the production from organic rich shale gas reservoirs. Reservoir simulator

  20. Retrofit and Testing of a Pre-Turbo, Diesel Oxidation Catalyst on a Tier 0, SD60M Freight Locomotive Achieving Over 50% PM Reduction

    Broader source: Energy.gov [DOE]

    Poster presentation at the 2007 Diesel Engine-Efficiency & Emissions Research Conference (DEER 2007). 13-16 August, 2007, Detroit, Michigan. Sponsored by the U.S. Department of Energy's (DOE) Office of FreedomCAR and Vehicle Technologies (OFCVT).

  1. Session T2F 978-1-61284-469-5/11/$26.00 2011 IEEE October 12 -15, 2011, Rapid City, SD

    E-Print Network [OSTI]

    Bailey, Reynold J.

    . These experiences include guiding undergraduate Honors projects and independent studies at our institution supervised around twenty-five students, over two summers, on a project funded by an NSF-funded REU program of these student projects have led to research publications. The paper briefly motivates the need for research

  2. Appendix. Variable descriptions, code, unit of measure, and descriptive statistics, which include the mean, standard deviation (SD), and range of values in the data set.

    E-Print Network [OSTI]

    Poff, N. LeRoy

    .37246.26 Median annual coefficient of variation of daily flows C.H.CV Unitless 1.66 0.7 0.774.63 Proportion0.77 Proportion of fast-water habitat (riffles, runs, etc) within the reach R.H.Fast Proportion 0.51 0.28 01 Riparian (nonclimatic) Proportion of all vegetation types along of riparian zone of reach R

  3. Maura Daly Iversen, PT, DPT, SD, MPH, FNAP Dr. Iversen is a Professor and Chair, Department of Physical Therapy, Movement and Rehabilitation

    E-Print Network [OSTI]

    Saskatchewan, University of

    of Physical Therapy, Movement and Rehabilitation Sciences, Northeastern University, and Senior Behavioral foundations. Dr. Iversen research focuses primarily on the design and evaluation of rehabilitation

  4. eyeROBOT -Heterogeneous Robotic Platform for Real-time Computer Vision Mohit Modi (mm2675), Sravya Chinthalapati (sc2655), Shang Dang (sd687), Yunong Liu (yl2494)

    E-Print Network [OSTI]

    Afshari, Ehsan

    is a mobile robotic platform which can be driven based on the input commands provided over serial interface-software co-design including FPGA prototyping, High-Level Digital Synthesis (HLS), Embedded System Development Window FPGA Video Accelerator TX RX OpCode Velocity (MSB) Velocity (LSB) Radius (MSB) Radius (LSB) 1 Byte

  5. s-d Electronic interactions induced H2 dissociation on the \\gamma-U(100) surface and influences of niobium doping

    E-Print Network [OSTI]

    Yang, Yu; Shi, Peng; Wang, Xiaolin

    2011-01-01

    The dissociation of hydrogen molecules on the \\gamma-U(100) surface is systematically studied with the density functional theory method. Through potential energy surface calculations, we find that hydrogen molecules can dissociate without any barriers on the clean \\gamma-U(100) surface. After careful electronic analysis, it is found that charge transfer between the hydrogen s and uranium d electronic states causes the dissociation, which is quite different from the dissociation of hydrogen molecules on other actinide metal surfaces. Considering that doping of 3d transition metal atoms can stabilize the \\alpha phase of U, we also study the influences of Nb-doping on the hydrogen dissociation process. We find that the 3d electronic states of Nb also take part in the hybridization with hydrogen s electronic states, which leads to the result that hydrogen molecules also dissociate without any energy barriers on the doped U surface. In addition, the free electronic energy lowers down more quickly for a hydrogen mo...

  6. Pulse-height distributions of neutron and gamma rays from plutonium-oxide S.A. Pozzi a,, S.D. Clarke a

    E-Print Network [OSTI]

    Eustice, Ryan

    Pulse-height distributions of neutron and gamma rays from plutonium-oxide samples S.A. Pozzi a,, S Digital data processing Plutonium oxide 252 Cf a b s t r a c t We present new results on neutron and gamma-ray pulse-height distributions (PHDs) measured with liquid scintillators from five plutonium-oxide samples

  7. Top-Down Intelligent Reservoir Modeling of New Albany Shale A. Kalantari-Dahaghi, SPE, S.D. Mohaghegh, SPE, West Virginia University

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    on individual wells in a multi-well New Albany Shale gas reservoir in Western Kentucky that has a reasonable Albany Shale Gas -The New Albany Shale is predominantly an organic-rich brownish-black and grayish-black shale that is present in the subsurface throughout the Illinois Basin. The total gas content of the New

  8. Follow-up observations of X-ray emitting hot subdwarf star: the He-rich sdO BD +37{\\deg} 1977

    E-Print Network [OSTI]

    La Palombara, N; Mereghetti, S; Novara, G; Tiengo, A

    2015-01-01

    We report on the results of the first XMM-Newton satellite observation of the luminous and helium-rich O-type subdwarf BD +37{\\deg} 1977 carried out in April 2014. X-ray emission is detected with a flux of about 4*10^(-14) erg/cm2/s (0.2-1.5 keV), corresponding to a f_X/f_bol ratio about 10^(-7); the source spectrum is very soft, and is well fit by the sum of two plasma components at different temperatures. Both characteristics are in agreement with what is observed in the main-sequence early-type stars, where the observed X-ray emission is due to turbulence and shocks in the stellar wind. A smaller but still significant stellar wind has been observed also in BD +37{\\deg} 1977; therefore, we suggest that also in this case the detected X-ray flux has the same origin.

  9. IftheShoeFits . . . I V I D E N D SdA Publication of the College of Business Fall 2002

    E-Print Network [OSTI]

    Salvaggio, Carl

    than that. Infantino says he really came to enjoy working for this family-owned company, and he credits. recruited Infantino as president of its North American operations. Five years later, CCNA was named "Company of brands into a powerful mix." Since then, the company has continued to experience record-setting growth

  10. A note on oblique water entry M.R. Moore, S.D. Howison, J.R. Ockendon and J.M. Oliver

    E-Print Network [OSTI]

    Howison, Sam

    ranging from the shipbuilding industry to ink-jet printing. The simplest model for the entry of a solid

  11. Uranium Mill Tailings Remedial Action Project Annual Environmental Monitoring Report calendar year 1992: Volume 2

    SciTech Connect (OSTI)

    none,

    1993-12-31

    This report contains environmental monitoring information for the following UMTRA sites for the 1992 Calendar Year: Lakeview, OR; Lowman, ID; Mexican Hat, UT; Monument Valley, AZ; Rifle, CO; Riverton, WY; Shiprock, NM; Spook, WY; Tuba City, AZ. Each site report contains a site description, compliance summary, environmental program information, environmental radiological and non-radiological program information, water resources protection, and quality assurance information.

  12. NetFPGA SUME: Toward Research Commodity 100Gb/s

    E-Print Network [OSTI]

    Zilberman, Noa; Audzevich, Yury; Covington, G. Adam; Moore, Andrew W.

    2014-07-15

    and media-access controls has been used to encode a side-channel into Ethernet pauses [9] and to provide a prototyping environment for energy-efficient physical-layer systems [10]. III. THE NETFPGA PROJECT The context of our solution is the NetFPGA project... memory is composed of two 64-bit DDR3 memory modules running at 933MHz (1866MT/s). Storage subsystems of the design permit both a MicroSD card and external disks through two SATA interfaces. Finally, the FPGA configuration subsystem is con- cerned...

  13. Lateral Drilling and Completion Technologies for Shallow-Shelf Carbonates of the Red River and Ratcliffe Formations, Williston Basin

    SciTech Connect (OSTI)

    David Gibbons; Larry A. Carrell; Richard D. George

    1997-07-31

    Luff Exploration Company (LEC) focused on involvement in technologies being developed utilizing horizontal drilling concepts to enhance oil- well productivity starting in 1992. Initial efforts were directed toward high-pressure lateral jetting techniques to be applied in existing vertical wells. After involvement in several failed field attempts with jetting technologies, emphasis shifted to application of emerging technologies for drilling short-radius laterals in existing wellbores and medium-radius technologies in new wells. These lateral drilling technologies were applied in the Mississippi Ratcliffe and Ordovician Red River formations at depths of 2590 to 2890 m (8500 to 9500 ft) in Richland Co., MT; Bowman Co., ND; and Harding Co., SD.

  14. BiL4i|h@ EtU@c4@|i4@|U@ i ?uLh4@|U@ L? 4i?L _ SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *

    E-Print Network [OSTI]

    Catenacci, Roberto

    i H t ghyh u@hi *hi *|hUi ` ' |Ec c n rEc fc i *@ hi||@ E@h@M*i TihU i _Ti?_i _@* ?4ihL hi@*i & oE& ' Ec fc f n Ec &c f E@ AhL@hi @*Lh _ & Tih U * T@?L i *@ hi||@ ?L? t ?|ihtiU@?L Ee T?| EM AhL@hi * T?|L _ ?|ihti3L?i |h@ * T@?L ` i

  15. Montana/Geothermal | Open Energy Information

    Open Energy Info (EERE)

    14-MT-b: MPDES Permit 14-MT-c: Underground Injection Control Permit 14-MT-d: 401 Water Quality Certification 14-MT-e: Groundwater Pollution Control System 15-MT-a: Air...

  16. Universite d'Orleans Premier semestre, annee 2006/2007 Departement de Mathematiques Licence Physique-Chimie MT21

    E-Print Network [OSTI]

    d'Orlans, Universit

    , = bvm0 , = cw forment une base orthonormee de R3. (d) On donne A = (1, 3, 4). Determiner les coordonn

  17. A new deep branch of eurasian mtDNA macrohaplogroup M reveals additional complexity regarding the settlement of Madagascar

    E-Print Network [OSTI]

    Ricaut, Francois-X.; Razafindrazaka, Harilanto; Cox, Murray P.; Dugoujon, Jean-M.; Guitard, Evelyne; Sambo, Clement; Mormina, Maru; Mirazon-Lahr, Marta; Ludes, Bertrand; Crubezy, Eric

    2009-12-14

    highlanders (n = 266). Complete mitochondrial DNA genome sequences reveal several unresolved lineages, and a new, deep branch of the out-of-Africa founder clade M has been identified. This new haplogroup, M23, has a limited global distribution...

  18. Structural Studies and Evaluation of Inhibitors of Mycobacterium tuberculosis H37Rv Shikimate Dehydrogenase (MtSDH)

    E-Print Network [OSTI]

    Lalgondar, Mallikarjun

    2014-03-21

    - (trifluoromethyl)phenyl)- 2H-tetrazol-2- yl)butanenitrile 8 EN:T5232146 1-(1H-benzo[d]imidazol-2- yl)-3-(3,4- dichlorophenyl)urea 11 EN:T5690368 2-(1,1-dioxido-2H- naphtho[1,8-cd]isothiazol- 2-yl)-N-(5-methylthiazol-2- yl)acetamide 6 2...

  19. Reply to the discussion of: "Carbonatites in a subduction system: The Pleistocene alvikites from Mt. Vulture (Southern Italy)" by

    E-Print Network [OSTI]

    Pisa, Via S.Maria 53, I-56126 Pisa, Italy b Istituto di Geoscienze e Georisorse, C.N.R., Via Moruzzi 1, I-56124 Pisa, Italy c Dipartimento di Scienze della Terra, Universit "La Sapienza", P.le A. Moro 5 Georisorse, C.N.R., Via Moruzzi 1, I-56124 Pisa, Italy. Tel.: +39 50 2215700; fax: +39 50 2215800. E

  20. Sources and photochemistry of volatile organic compounds in the remote atmosphere of western China: results from the Mt. Waliguan Observatory

    E-Print Network [OSTI]

    2013-01-01

    sites a . Waliguan b Species Ethane Propane n-butanei-butane n-pentane i-pentane Ethene Propene Isoprene EthyneNorth b CO Ethane Propane n-butane i-butane Ethyne Benzene

  1. Learning of Linear Ordering Problems and its Application to J-E Patent Translation in NTCIR-9 PatentMT

    E-Print Network [OSTI]

    Duh, Kevin

    PROBLEM BASED REORDERING Tromble and Eisner (2009) [16] proposed a word-level re- ordering model based

  2. A Trans-Amazonian Screening of mtDNA Reveals Deep Intraspecific Divergence in Forest Birds and Suggests a

    E-Print Network [OSTI]

    Karubian, Jordan

    and prioritizing taxa for species discovery. Citation: Mila B, Tavares ES, Mun~oz Saldan~a A, Karubian J, Smith TB

  3. Peptide aptamers as new tools to modulate clathrin-mediated internalisation - inhibition of MT1-MMP internalisation

    E-Print Network [OSTI]

    Wickramasinghe, Rochana D; Ko Ferrigno, Paul; Roghi, Christian

    2010-07-23

    . Oncogene 1999, 18:4357-4363. 12. Bottger A, Bottger V, Sparks A, Liu WL, Howard SF, Lane DP: Design of a synthetic Mdm2-binding mini protein that activates the p53 response in vivo. Curr Biol 1997, 7:860-869. 13. Nouvion AL, Thibaut J, Lohez OD, Venet S...

  4. Hillebrand 1 A comparison of tectonics of the eastern Sierra Nevada, CA in the vicinity of Mt. Whitney and

    E-Print Network [OSTI]

    Shuster, David L.

    thought to show a low Cenozoic geothermal gradient of ~6 C/km, but (U-T)/He data from House et al. (1997) shows that a moderate geotherm of ~25 C/km is required for their age-elevation profile. Brady et al

  5. 4 p-p.S.DEPARTI\\.IE:MT OF AGRICULTURE '%CY!P. 0,EOX 245.BERKELEY. CALIFORNIA 94701

    E-Print Network [OSTI]

    -pine, rosegum eucalypbs, and Amm- manit eucalyptus. Sevexd other species have good reforestatio.7 Callitvis end- Iicheri (calcauata) + 176.1 Eucalyptus deglupl-a -+ 176.1 Eucalyptus p n d i s + 176-pine Callitvis endkicheri (calcarataj rosegum eucalyptus ficalyptus gandis fill ex Majiden Ammmanit eucdyptus

  6. This article was downloaded by:[Mt Sinai School of Medicine, Levy Library] On: 21 March 2008

    E-Print Network [OSTI]

    Shelley, Michael

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form ) Liquid crystal drops dispersed in a continuous phase of silicone oil are generated with a narrow

  7. LIZARD CHEMICAL SIGNALS Around Mt Isa. A Guide to the Flora and Fauna, Pair-bonding in chameleons. Naturwissenschaften

    E-Print Network [OSTI]

    Macedonia, Joseph

    and Coloration in the JamaicanRadiation of Anolis Lizards JOSEPH M. MACEDONIA,~,~SARAHJAMES,' W. WITTLE

  8. Predicting and validating the tracking of a Volcanic Ash Cloud during the 2006 Eruption of Mt. Augustine Volcano

    SciTech Connect (OSTI)

    Webley, Peter W.; Atkinson, D.; Collins, Richard L.; Dean, K.; Fochesatto, J.; Sassen, Kenneth; Cahill, Catherine F.; Prata, A.; Flynn, Connor J.; Mizutani, K.

    2008-11-01

    On 11 January 2006, Mount Augustine volcano in southern Alaska began erupting after 20-year repose. The Anchorage Forecast Office of the National Weather Service (NWS) issued an advisory on 28 January for Kodiak City. On 31 January, Alaska Airlines cancelled all flights to and from Anchorage after multiple advisories from the NWS for Anchorage and the surrounding region. The Alaska Volcano Observatory (AVO) had reported the onset of the continuous eruption. AVO monitors the approximately 100 active volcanoes in the Northern Pacific. Ash clouds from these volcanoes can cause serious damage to an aircraft and pose a serious threat to the local communities, and to transcontinental air traffic throughout the Arctic and sub-Arctic region. Within AVO, a dispersion model has been developed to track the dispersion of volcanic ash clouds. The model, Puff, was used operational by AVO during the Augustine eruptive period. Here, we examine the dispersion of a volcanic ash cloud from Mount Augustine across Alaska from 29 January through the 2 February 2006. We present the synoptic meteorology, the Puff predictions, and measurements from aerosol samplers, laser radar (or lidar) systems, and satellites. UAF aerosol samplers revealed the presence of volcanic aerosols at the surface at sites where Puff predicted the ash clouds movement. Remote sensing satellite data showed the development of the ash cloud in close proximity to the volcano and a sulfur-dioxide cloud further from the volcano consistent with the Puff predictions. Lidars showed the presence of volcanic aerosol with consistent characteristics aloft over Alaska and were capable of detecting the aerosol, even in the presence of scattered clouds and where the cloud is too thin/disperse to be detected by remote sensing satellite data. The lidar measurements revealed the different trajectories of ash consistent with the Puff predictions. Dispersion models provide a forecast of volcanic ash cloud movement that might be undetectable by any other means but are still a significant hazard. Validation is the key to assessing the accuracy of any future predictions. The study highlights the use of multiple and complementary observations used in detecting the trajectory ash cloud, both at the surface and aloft within the atmosphere.

  9. Department of Energy Announces Quadrennial Energy Review Public...

    Broader source: Energy.gov (indexed) [DOE]

    News Media Contact 202-586-4940 WASHINGTON, DC - The Energy Department's Office of Energy Policy and Systems Analysis will host a public meeting in Cheyenne, WY, on Thursday,...

  10. A political theory of the firm : why ownership matters

    E-Print Network [OSTI]

    Clark Muntean, Susan

    2009-01-01

    JOHN MR JACKSON WY 83001 WALMART WALTON, JOHN T BENTONVILLEfrom individuals at WalMart. I searched on theoccupation or employer as WalMart or These are the limits

  11. The Pipe vs. The Shed: Waste Water compared with Natural Hydrology in an Urban Setting

    E-Print Network [OSTI]

    Lather, Alaska; Wozniak, Monika

    2011-01-01

    stream flow was 0.472 cfs. Precipitation: Only partialThe highest peak in January occurred at 47 cfs, followedby 15 cfs in October (beginning of WY1993), 15 cfs in

  12. Analysis of the LagrangeSQPNewton Method for the Control of a Phase Field Equation

    E-Print Network [OSTI]

    Tröltzsch, Fredi

    .2) with boundary conditions E E(v )w`aB E E7v Y)x`aB on E !wWy$¨`Beb'B (1.3) and initial conditions q)x73BY

  13. Coalbed Methane Produced Water Screening Tool for Treatment Technology and Beneficial Use 2013 Supporting Information

    E-Print Network [OSTI]

    Coalbed Methane Produced Water Screening Tool for Treatment Technology and Beneficial Use 2013 1 Supporting Information 1.0 Produced Water Regulatory Framework for WY and NM.................................................................................................................... 4 2.0 Background on Interstate Water Marketing Using Produced Water

  14. inSightstheEarthScope newsletter Participants in the EarthScope San Andreas interpretive

    E-Print Network [OSTI]

    Smith-Konter, Bridget

    River Plain-Teton region September 9-12 in Jackson, WY. Information and an online application form.earthscope.org/workshops/ fault_slip10). Attend the EarthScope workshop for interpretive professionals in theYellowstone-Snake

  15. PRODUCT ENERGY AND ANGULAR DISTIBUTIONS FROM THE REACTION OP N2+ WITH ISOTOPIC HYDROGEN MOLECULES

    E-Print Network [OSTI]

    Gentry, W.R.; Gislason, E.A.; Lee, Yuan-tseh; Mahan, B.H.; Tsao, Chi-wing.

    2008-01-01

    No. w-y405-eng-4.8 PRODUCT ENERGY AND ANGULAR DISTRJBUTIONSauspices of the U. S. Atomic Energy Commission. Eepartmentthis text. Short Title: Energy and Angular Distri'outions.

  16. Conversion of Low-Rank Wyoming Coals into Gasoline by Direct...

    Office of Scientific and Technical Information (OSTI)

    Number(s): DOENT-43293--; WRI--14-R002r DOE Contract Number: FC26-08NT43293 Resource Type: Technical Report Research Org: University Of Wyoming Research Corporation, WY...

  17. PowerProjections2003(FPavgusing8-03water)(avgalloc)II.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2:49 PM Average Hydro Forecast - Depletions capped in 2009 Customer allocations set to average generation forecast WY Net Gen Total Firm Project Use Total Load Purch @ Load AHP...

  18. PowerProjections2003(FPavgusing8-03water)(avgalloc-5yearstepup...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    01 AM Average Hydro Forecast - Depletions capped in 2009 Customer allocations set to step up from FY2004 allocation to the average generation forecast WY Net Gen (GWh) Total Firm...

  19. PowerProjections2003(avgusing5-03water,BrokerPrices)(amended...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    jections2003(avgusing5-03water,BrokerPrices)(amended).xls SLIP Energy WY Gross Gen from Hydro LP Dolores Gen. Total SLIP Gross Gen Avg. Plant Use SLIP Net Gen @ Plant Losses SLIP...

  20. PowerProjections2003(FPavgusing8-03water)(medalloc-10yearstepup...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    19 AM Average Hydro Forecast - Depletions capped in 2009 Customer allocations set to step up from FY2004 allocation to the Median generation forecast WY Net Gen (GWh) Total Firm...