Powered by Deep Web Technologies
Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Category:Cheyenne, WY | Open Energy Information  

Open Energy Info (EERE)

WY WY Jump to: navigation, search Go Back to PV Economics By Location Media in category "Cheyenne, WY" The following 15 files are in this category, out of 15 total. SVFullServiceRestaurant Cheyenne WY Powder River Energy Corporation.png SVFullServiceRestauran... 59 KB SVMidriseApartment Cheyenne WY Powder River Energy Corporation.png SVMidriseApartment Che... 58 KB SVQuickServiceRestaurant Cheyenne WY Powder River Energy Corporation.png SVQuickServiceRestaura... 58 KB SVStandAloneRetail Cheyenne WY Powder River Energy Corporation.png SVStandAloneRetail Che... 58 KB SVHospital Cheyenne WY Powder River Energy Corporation.png SVHospital Cheyenne WY... 57 KB SVLargeHotel Cheyenne WY Powder River Energy Corporation.png SVLargeHotel Cheyenne ... 57 KB SVLargeOffice Cheyenne WY Powder River Energy Corporation.png

2

San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC

3

Rolling Hills (WY) | Open Energy Information  

Open Energy Info (EERE)

WY) WY) Jump to: navigation, search Name Rolling Hills (WY) Facility Rolling Hills (WY) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner EnXco Developer PacifiCorp Location Converse WY Coordinates 43.08080003°, -105.8497953° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.08080003,"lon":-105.8497953,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

4

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

5

Category:Elkins, WV | Open Energy Information  

Open Energy Info (EERE)

Elkins, WV Elkins, WV Jump to: navigation, search Go Back to PV Economics By Location Media in category "Elkins, WV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Elkins WV Harrison Rural Elec Assn Inc.png SVFullServiceRestauran... 59 KB SVQuickServiceRestaurant Elkins WV Harrison Rural Elec Assn Inc.png SVQuickServiceRestaura... 60 KB SVHospital Elkins WV Harrison Rural Elec Assn Inc.png SVHospital Elkins WV H... 57 KB SVLargeHotel Elkins WV Harrison Rural Elec Assn Inc.png SVLargeHotel Elkins WV... 57 KB SVLargeOffice Elkins WV Harrison Rural Elec Assn Inc.png SVLargeOffice Elkins W... 58 KB SVMediumOffice Elkins WV Harrison Rural Elec Assn Inc.png SVMediumOffice Elkins ... 59 KB SVMidriseApartment Elkins WV Harrison Rural Elec Assn Inc.png

6

Category:Charleston, WV | Open Energy Information  

Open Energy Info (EERE)

WV WV Jump to: navigation, search Go Back to PV Economics By Location Media in category "Charleston, WV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Charleston WV Harrison Rural Elec Assn Inc.png SVFullServiceRestauran... 59 KB SVQuickServiceRestaurant Charleston WV Harrison Rural Elec Assn Inc.png SVQuickServiceRestaura... 60 KB SVHospital Charleston WV Harrison Rural Elec Assn Inc.png SVHospital Charleston ... 57 KB SVLargeHotel Charleston WV Harrison Rural Elec Assn Inc.png SVLargeHotel Charlesto... 57 KB SVLargeOffice Charleston WV Harrison Rural Elec Assn Inc.png SVLargeOffice Charlest... 58 KB SVMediumOffice Charleston WV Harrison Rural Elec Assn Inc.png SVMediumOffice Charles... 60 KB SVMidriseApartment Charleston WV Harrison Rural Elec Assn Inc.png

7

File:INL-geothermal-wy.pdf | Open Energy Information  

Open Energy Info (EERE)

wy.pdf Jump to: navigation, search File File history File usage Wyoming Geothermal Resources Size of this preview: 751 600 pixels. Full resolution (4,566 3,647 pixels,...

8

DOE - Office of Legacy Management -- Lost Creek - WY 01  

Office of Legacy Management (LM)

Lost Creek - WY 01 Lost Creek - WY 01 FUSRAP Considered Sites Site: Lost Creek (WY.01 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to

9

PR B_WY_C BM HILIGHT POWELL KIT TY WELL D RAW SC OT T MIKES D  

U.S. Energy Information Administration (EIA) Indexed Site

Gas Reserve Class Gas Reserve Class No 2001 gas reserves 0.1 - 10 MMCF 10.1 - 100 MMCF 100.1 - 1,000 MMCF 1,000.1 - 10,000 MMCF 10,000.1 - 100,000 MMCF > 100,000 MMCF Basin Outline CO Index Map For 2 Powder River Basin Panels WY MT SD NE ND Powder River Basin 1 2 NE Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Powder River 543 193,456 2,398,604 593,223 Basin 2001 Reserve Summary for All Powder River Basin Fields PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas,

10

PR B_WY_C BM HILIGHT POWELL KIT TY WELL D RAW SC OT T MIKES D  

U.S. Energy Information Administration (EIA) Indexed Site

Liquids Reserve Class Liquids Reserve Class No 2001 liquids reserves 0.1 - 10 Mbbl 10.1 - 100 Mbbl 100.1 - 1,000 Mbbl 1,000.1 - 10,000 Mbbl 10,000.1 - 100,000 Mbbl Basin Outline CO Index Map For 2 Powder River Basin Panels WY MT SD NE ND Powder River Basin 1 2 NE Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Powder River 543 193,456 2,398,604 593,223 Basin 2001 Reserve Summary for All Powder River Basin Fields PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by

11

PR B_WY_C BM HILIGHT POWELL KIT TY WELL D RAW SC OT T MIKES D  

U.S. Energy Information Administration (EIA) Indexed Site

BOE Reserve Class BOE Reserve Class No 2001 reserves 0.1 - 10 MBOE 10.1 - 100 MBOE 100.1 - 1,000 MBOE 1,000.1 - 10,000 MBOE 10,000.1 - 100,000 MBOE > 100,000 MBOE Basin Outline CO Index Map For 2 Powder River Basin Panels WY MT SD NE ND Powder River Basin 1 2 NE Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Powder River 543 193,456 2,398,604 593,223 Basin 2001 Reserve Summary for All Powder River Basin Fields PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM PR B_WY_C BM The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas,

12

DOE - Office of Legacy Management -- Reduction Pilot Plant - WV 01  

Office of Legacy Management (LM)

Reduction Pilot Plant - WV 01 Reduction Pilot Plant - WV 01 FUSRAP Considered Sites Site: REDUCTION PILOT PLANT (WV.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: International Nickel Company WV.01-1 Location: Cole Street at Alterizer Ave. , Huntington , West Virginia WV.01-2 Evaluation Year: 1987 WV.01-1 Site Operations: Manufactured powdered Nickel for use at Paducah and Portsmouth gaseous diffusion plants and Nickel plated a small quantity of Uranium slugs. WV.01-2 WV.01-1 Site Disposition: Eliminated - Limited quantities of radioactive material used on the site. Potential for residual radioactive material from AEC operations conducted at the site considered remote - confirmed by radiological survey. WV.01-1 WV.01-3

13

West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

WV DoE-NRCCE-APERC DRAFT February 16, 2009 WV DoE-NRCCE-APERC DRAFT February 16, 2009 1 West Virginia Smart Grid Implementation Plan (WV SGIP) Project APERC Report on Customer Complaints to WV PSC about Electric Power Service Ali Feliachi, Muhammad Choudhry, John Saymansky and Ed Sneckenberger February 16, 2009 Introduction APERC has appreciated that one of the most important sources for data on the consumer perspective of the current electric power grid in West Virginia would be the WV Public Service Commission (WV PSC). Thus, an email request was sent on December 19, 2008 to Byron Harris at the WV PSC to request any advice or approaches to determine customer and regulatory perspectives of the current electric power grid in WV. Customer Complaint Data Bryon Harris was able to provide a spreadsheet of customer complaints in West Virginia for

14

NETL: 2010 WV Science Bowl Information  

NLE Websites -- All DOE Office Websites (Extended Search)

2010 WV Science Bowl 2010 WV Science Bowl The U.S. Department of Energy's National Energy Technology Laboratory (DOE/NETL) invites you to participate in one of the premier scientific events for high school students, the West Virginia High School Science Bowl 2010 on February 6, 2010. This will be NETL's 19th year sponsoring the high school competition. There is a change this year in the registration process from past years, all teams who are registering to complete, must do so through the National Science Bowl website. For those who are not familiar with the West Virginia Science Bowl here are some highlights: The competition is open to high school students (school, scouts, home school) from West Virginia. Complete eligibility requirements are located at the National Science Bowl website.

15

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

16

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Collins Ferry Road Morgantown, WV 26507-0880 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator, Ultra-Deepwater Resources Portfolio Office of Research and...

17

DOE - Office of Legacy Management -- Riverton Mill Site - WY 0-04  

Office of Legacy Management (LM)

Mill Site - WY 0-04 Mill Site - WY 0-04 FUSRAP Considered Sites Site: Riverton Mill Site (WY.0-04 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Riverton, Wyoming, Processing Site Documents Related to Riverton Mill Site Data Validation Package for the November 2008 Groundwater and Surface Water Sampling at the Riverton, Wyoming, Processing Site. February 2009 U. S. Department of Energy (DOE) Status and Planned Actions at the Riverton, Wyoming, Uranium Mill Tailing Radiation Control Act (UMTRCA) Title I Site April Gil, PhD Environment Team Lead Office of Legacy Management (LM) May 2, 20122 Status and Action Summary 􀂄 Surface

18

DOE - Office of Legacy Management -- Spook Site - WY 0-01  

Office of Legacy Management (LM)

Spook Site - WY 0-01 Spook Site - WY 0-01 FUSRAP Considered Sites Site: Spook Site (WY.0-01) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Documents Related to Spook Site 2012 Annual Site Inspection and Monitoring Report for Uranium Mill Tailings Radiation Control Act Title I Disposal Sites-Spook, Wyoming, Disposal Site. LMS/S09461. February 2013 U.S. Department of Energy 2008 UMTRCA Title I Annual Report January 2009 Spook, Wyoming U.S. Department of Energy 2007 UMTRCA Title I Annual Report December 2007 Spook, Wyoming FACT SHEET - Spook, Wyoming This fact sheet provides information about the Uranium Mill Tailings Radiation Control Act of 1978 Title I

19

DOE - Office of Legacy Management -- The Carborundum Co Inc - WV 02  

Office of Legacy Management (LM)

The Carborundum Co Inc - WV 02 The Carborundum Co Inc - WV 02 FUSRAP Considered Sites Site: THE CARBORUNDUM CO., INC (WV.02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: AMAX Inc WV.02-1 Location: Wood County , West Virginia WV.02-1 Evaluation Year: 1982 WV.02-1 Site Operations: Produced high-grade Zirconium metal for use in construction of nuclear reactors for the Navy circa late-1950s and 1960s; Conducted small scale Zirconium and Uranium testing in the mid-1970s. WV.02-2 Site Disposition: Eliminated - AEC/NRC licensed site. No Authority for cleanup under FUSRAP WV.02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium, Uranium WV.02-2 Radiological Survey(s): Yes WV.02-3 Site Status: Eliminated from further consideration under FUSRAP

20

File:USDA-CE-Production-GIFmaps-WY.pdf | Open Energy Information  

Open Energy Info (EERE)

WY.pdf WY.pdf Jump to: navigation, search File File history File usage Wyoming Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 188 KB, MIME type: application/pdf) Description Wyoming Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Wyoming External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (188 KB) MapBot (Talk | contribs) Automated bot upload

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

DOE - Office of Legacy Management -- Riverton AEC Ore Buying Station - WY  

NLE Websites -- All DOE Office Websites (Extended Search)

Riverton AEC Ore Buying Station - Riverton AEC Ore Buying Station - WY 0-03 FUSRAP Considered Sites Site: Riverton AEC Ore Buying Station (WY.0-03 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The history of domestic uranium procurement under U.S. Atomic Energy Commission (AEC) contracts identifies a number of ore buying stations (sampling and storage sites) that were operated during the period late-1949 through the mid-1960s. During this period the AEC established ore-buying stations in new uranium producing areas where it appeared that ore production would be sufficient to support a uranium milling operation. The

22

EA-1938: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, WY |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, 8: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, WY EA-1938: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, WY SUMMARY The Bureau of Land Management prepared, with DOE's Western Area Power Administration (Western) as a cooperating agency, an EA to analyze the potential environmental impacts of a proposal by Elk Petroleum Incorporated to implement enhanced recovery from the Cretaceous Muddy "Grieve Sand" in the Grieve Unit using a miscible carbon dioxide (CO2) flood with water injection to assist with reservoir repressurization. The proposed action includes drilling ten new wells; installing a CO2 pipeline, an aboveground 230 kV transmission line, an underground 25 kV power distribution line, and two electrical substations; replacing and enlarging an existing infield

23

DOE - Office of Legacy Management -- Crooks Gap AEC Ore Buying Station - WY  

NLE Websites -- All DOE Office Websites (Extended Search)

Crooks Gap AEC Ore Buying Station - Crooks Gap AEC Ore Buying Station - WY 0-02 FUSRAP Considered Sites Site: Crooks Gap AEC Ore Buying Station (WY.0-02 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The history of domestic uranium procurement under U.S. Atomic Energy Commission (AEC) contracts identifies a number of ore buying stations (sampling and storage sites) that were operated during the period late-1949 through the mid-1960s. During this period the AEC established ore-buying stations in new uranium producing areas where it appeared that ore production would be sufficient to support a uranium milling operation. The

24

EA-1938: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, WY |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, 8: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, WY EA-1938: Grieve Unit CO2 Enhanced Recovery Project, Natrona County, WY SUMMARY The Bureau of Land Management prepared, with DOE's Western Area Power Administration (Western) as a cooperating agency, an EA to analyze the potential environmental impacts of a proposal by Elk Petroleum Incorporated to implement enhanced recovery from the Cretaceous Muddy "Grieve Sand" in the Grieve Unit using a miscible carbon dioxide (CO2) flood with water injection to assist with reservoir repressurization. The proposed action includes drilling ten new wells; installing a CO2 pipeline, an aboveground 230 kV transmission line, an underground 25 kV power distribution line, and two electrical substations; replacing and enlarging an existing infield

25

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

26

Verification Checklist Home Address: City: State: Zip:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

27

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

28

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

29

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

30

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

31

West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

West Virginia Smart Grid Implementation Plan (WV SGIP) Project West Virginia Smart Grid Implementation Plan (WV SGIP) Project APERC Report on Assessment of As-Is Grid by Non-Utility Stakeholders Introduction One goal of this grid modernization project is to assess the current status of the electric power grid in West Virginia in order to define the potential to implement smart grid technologies. Thus, an initial task of this project was to define the current state or "As-Is" grid in West Virginia. Financial and time constraints prohibited the development and execution of formal surveys to solicit input from the various stakeholders. However attempts were made to obtain their input through informal questionnaires and meeting with focus groups. list of stakeholders which

32

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network (OSTI)

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

33

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

34

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network (OSTI)

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

35

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network (OSTI)

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

36

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

37

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

38

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network (OSTI)

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

39

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network (OSTI)

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

40

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network (OSTI)

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

42

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

43

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

44

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

45

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network (OSTI)

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

46

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Joshua Hull Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-0906 joshua.hull@netl.doe.gov Erik Westman Principal Investigator Virginia Polytechnic Institute and State University 100 Holden Hall Blacksburg, VA 24061 540-0231-7510 Fax: 540-231-4070 ewestman@vt.edu PROJECT DURATION Start Date End Date 12/01/2009 12/31/2012 COST Total Project Value $257,818 DOE/Non-DOE Share $248,441 / $9,377 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. P R OJ E C T FAC T

47

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Program Technology Program Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Dawn Deel Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4133 dawn.deel@netl.doe.gov Sherry Mediati Business Contact California Energy Commission 1516 9th Street, MS 1 Sacramento, CA 95814 916-654-4204 smediati@energy.state.ca.us Mike Gravely Principal Investigator California Energy Commission 1516 Ninth Street, MS 43 Sacramento, CA 95814 916-327-1370 mgravely@energy.state.ca.us Elizabeth Burton Technical Director Lawrence Berkeley National Laboratory 1 Cyclotron Road, MS 90-1116 Berkeley, CA 94720 925-899-6397 eburton@lbl.gov West Coast Regional Carbon

48

File:EIA-Appalach6-WV-VA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-BOE.pdf Appalach6-WV-VA-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.02 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

49

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Turbines Hydrogen Turbines CONTACTS Richard A. Dennis Technology Manager, Turbines National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4515 richard.dennis@netl.doe.gov Travis Shultz Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507-0880 304-285-1370 travis.shultz@netl.doe.gov Jacob A. Mills Principal Investigator Florida Turbine Technologies, Inc 1701 Military Trail Suite 110 Jupiter, FL 33458-7887 561-427-6349 jmills@fttinc.com PARTNERS None PROJECT DURATION Start Date End Date 06/28/2012 08/13/2015 COST Total Project Value $1,149,847 DOE/Non-DOE Share $1,149,847 / $0 AWARD NUMBER SC0008218 Air-Riding Seal Technology for Advanced Gas Turbine Engines-Florida Turbine

50

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rodosta Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Darin Damiani Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4398 darin.damiani@netl.doe.gov Vivak Malhotra Principal Investigator Southern Illinois University Neckers 483A Mailcode: 4401 Carbondale, IL 62901 618-453-2643 Fax: 618-453-1056 vmalhotra@physics.siu.edu PARTNERS None Risk Assessment and Monitoring of Stored CO2 in Organic Rock under Non-Equilibrium Conditions Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)

51

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PO Box 880 PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea McNemar Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-2024 andrea.mcnemar@netl.doe.gov Charles D. Gorecki Technical Contact Senior Research Manager Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5355 cgorecki@undeerc.org Edward N. Steadman Deputy Associate Director for Research Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5279 esteadman@undeerc.org John A. Harju Associate Director for Research Energy & Environmental Research Center University of North Dakota

52

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACTS Joseph Stoffa Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-0285 joseph.stoffa@netl.doe.gov Xingbo Liu Principal Investigator Dept. MechanaWest Virginia University P.O. Box 6106 Morgantown, WV 26506-6106 304-293-3339 xingbo.liu@mail.wvu.edu Shailesh D. Vora Technology Manager, Fuel Cells National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7515 shailesh.vora@netl.doe.gov PARTNERS None PROJECT DURATION Start Date End Date 08/31/2012 09/30/2015 COST Total Project Value $634,839 DOE/Non-DOE Share $499,953 / $134,886 AWARD NUMBER FE0009675 Fundamental Understanding of Oxygen Reduction and Reaction Behavior and Developing High Performance and Stable

53

File:EIA-Appalach6-WV-VA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-GAS.pdf Appalach6-WV-VA-GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.09 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

54

File:EIA-Appalach5-eastWV-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach5-eastWV-BOE.pdf Appalach5-eastWV-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.26 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Maryland File history Click on a date/time to view the file as it appeared at that time.

55

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Romanosky Romanosky Crosscutting Research Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-4721 robert.romanosky@netl.doe.gov Richard Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Shizhong Yang Principal Investigator Southern University

56

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

57

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network (OSTI)

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

58

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

59

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network (OSTI)

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

60

SBOT WEST VIRGINIA NATIONAL ENERGY TECHNOLOGY LAB -WV POC Larry Sullivan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WEST VIRGINIA WEST VIRGINIA NATIONAL ENERGY TECHNOLOGY LAB -WV POC Larry Sullivan Telephone (412) 386-6115 Email larry.sullivan@netl.doe.gov ADMINISTATIVE / WASTE / REMEDIATION Facilities Support Services 561210 Employment Placement Agencies 561311 Temporary Help Services 561320 Professional Employer Organizations 561330 Document Preparation Services 561410 Security Guards and Patrol Services 561612 Security Systems Services (except Locksmiths) 561621 Janitorial Services 561720 Landscaping Services 561730 Hazardous Waste Treatment and Disposal 562211 Remediation Services 562910 Materials Recovery Facilities 562920 All Other Miscellaneous Waste Management Services 562998 CONSTRUCTION Industrial Building Construction 236210 Commercial and Institutional Building Construction 236220 Power and Communication Line and Related Structures Construction

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R R &D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV

62

Microsoft Word - 2014 WVSB - WV HS letter (generic for PDF).docx  

NLE Websites -- All DOE Office Websites (Extended Search)

610 Collins Ferry Road, P.O. Box 880, Morgantown, WV 26507-0880 626 Cochrans Mill Road, P.O. Box 10940, Pittsburgh, PA 15236-0940 610 Collins Ferry Road, P.O. Box 880, Morgantown, WV 26507-0880 626 Cochrans Mill Road, P.O. Box 10940, Pittsburgh, PA 15236-0940 REPLY TO: Morgantown Office  steven.woodruff@netl.doe.gov  Voice (304) 285-4175  Fax (304) 285-0903  www.netl.doe.gov September 23, 2013 Dear Science Chair or Principal: On behalf of the Secretary of Energy, I am pleased to announce the opening of the 2014 National Science Bowl, a tournament-style academic competition challenging students in the fields of science and mathematics. In support of the National Science Bowl, the U.S. Dept of Energy's National Energy Technology Laboratory is once again proud to host the West Virginia Regional Science Bowl. The WVSB is one of many regional competitions held for high school teams across

63

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

64

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

65

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

66

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maira Reidpath Maira Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Steven S.C. Chuang Principal Investigator The University of Akron Department of Chemical and Biomolecular Engineering 230 E. Buchtel Commons Akron, OH 44325 330-972-6993 schuang@uakron.edu PARTNERS None PROJECT DURATION Start Date End Date 09/01/2009 08/31/2013 COST Total Project Value $1,713,961 DOE/Non-DOE Share $1,370,977/$342,984 AWARD NUMBER Techno-Economic Analysis of Scalable Coal-Based Fuel Cells-University of Akron Background In this congressionally directed project, the University of Akron (UA) will develop a scalable coal fuel cell manufacturing process to a megawatt scale. UA has demonstrated the

67

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maria Reidpath Maria Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Bogdan Gurau Principal Investigator NuVant Systems, Inc. 130 N West Street Crown Point, IN 46307 219-644-3232 b.gurau@nuvant.com PARTNERS None PROJECT DURATION Start Date End Date 08/01/2009 05/31/2013 COST Total Project Value $1,142,481 DOE/Non-DOE Share $913,985 / $228,496 AWARD NUMBER Improved Flow-field Structures for Direct Methanol Fuel Cells-NuVant Systems, Inc. Background In this congressionally directed project, NuVant Systems, Inc. (NuVant) will improve the performance of direct methanol fuel cells (DMFCs) by designing anode flow-fields specifically for the delivery of liquid methanol. The goal is to deliver concentrated

68

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

FACTS FACTS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Joseph Labuz Principal Investigator University of Minnesota 500 Pillsbury Drive SE Room 122 CivE 0851 Minneapolis, MN 55455 612-625-9060 jlabuz@umn.edu PARTNERS None PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,568 DOE/Non-DOE Share $299,568 / $0 PROJECT NUMBER DE-FE0002020 Government funding for this project is provided in whole or in part through the

69

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV

70

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PROJEC PROJEC T FAC TS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Gordon Bierwagen Principal Investigator North Dakota State University P.O. Box 6050 Department 2760 Fargo, ND 58108-6050 701-231-8294 gordon.bierwagen@ndsu.edu PARTNERS None PROJECT DURATION Start Date 12/01/2009 End Date 11/30/2011 COST Total Project Value $298,949 DOE/Non-DOE Share $298,949 / $0 PROJECT NUMBER DE-FE0002054 Government funding for this project is provided in whole or in part through the

71

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Jose Castillo Principal Investigator San Diego State University 5500 Campanile Drive San Diego, CA 92122 619-594-7205 castillo@myth.sdsu.edu PARTNERS Sienna Geodynamics and Consulting, Inc. PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,993 DOE/Non-DOE Share $299,993 / $0 PROJECT NUMBER DE-FE0002069 Government funding for this project is provided in whole or in part through the

72

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Briggs White Briggs White Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-5437 briggs.white@netl.doe.gov Jeff Stevenson Principal Investigator Pacific Northwest National Laboratory P.O. Box 999, MS K2-44 Richland, WA 99352 509-372-4697 jeff.stevenson@pnl.com PARTNERS Oak Ridge National Laboratory University of Connecticut PROJECT DURATION Start Date End Date 10/01/1999 09/30/2013 (annual continuations) COST Total Project Value $52,889,667 DOE/Non-DOE Share $52,889,667 / $0 AWARD NUMBER FWP40552 PR OJ E C T FAC T S Fuel Cells Low Cost Modular SOFC Development- Pacific Northwest National Laboratory Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) has a mission to advance energy options to fuel our economy, strengthen our security,

73

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Karen Kluger Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6667 karen.kluger@netl.doe.gov Gary Mavko Principal Investigator Stanford University 397 Panama Mall Stanford, CA 94305-2215 650-723-9438 Fax: 650-723-1188 mavko@stanford.edu PROJECT DURATION Start Date 12/01/2009 End Date 06/30/2013 COST Total Project Value $385,276 DOE/Non-DOE Share $295,777/ $89,499 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Rock Physics of Geologic Carbon Sequestration/Storage

74

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network (OSTI)

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

75

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network (OSTI)

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

76

Albany, OR Anchorage, AK Morgantown, WV Pittsburgh, PA Sugar Land, TX Website: www.netl.doe.gov  

E-Print Network (OSTI)

Albany, OR · Anchorage, AK · Morgantown, WV · Pittsburgh, PA · Sugar Land, TX Website: www.netl-285-5437 briggs.white@netl.doe.gov Neil Nofziger Principal Investigator seM-coM company, Inc. 1040 North Westwood 304-285-4717 daniel.driscoll@netl.doe.gov PARTNERS University of Toledo Ceramatec, Inc. PROJECT

Azad, Abdul-Majeed

77

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

78

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

79

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

80

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network (OSTI)

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

82

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

83

Record of Decision and Floodplain Statement of Findings: Western Greenbrier Co-Production Demonstration Project, Rainelle, Greenbrier County, WV (DOE/EIS-0361) (04/29/08)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

14 Federal Register 14 Federal Register / Vol. 73, No. 83 / Tuesday, April 29, 2008 / Notices DEPARTMENT OF ENERGY Record of Decision and Floodplain Statement of Findings: Western Greenbrier Co-Production Demonstration Project, Rainelle, Greenbrier County, WV AGENCY: Office of Fossil Energy, U.S. Department of Energy (DOE). ACTION: Record of Decision (ROD) and Floodplain Statement of Findings. SUMMARY: DOE has decided to implement the Proposed Action alternative, identified as the preferred alternative, in the Western Greenbrier Co-Production Demonstration Project, Final Environmental Impact Statement (DOE/EIS-0361; November 2007) (FEIS). That alternative is to provide approximately $107.5 million (up to 50% of the development costs) to Western Greenbrier Co-Generation, LLC

84

SOFC Anode Interaction with Trace Coal Syngas Species U.S. Dept of Energy, National Energy Technology Laboratory, Morgantown, WV 26507  

NLE Websites -- All DOE Office Websites (Extended Search)

SOFC Anode Interaction with Trace Coal Syngas Species SOFC Anode Interaction with Trace Coal Syngas Species U.S. Dept of Energy, National Energy Technology Laboratory, Morgantown, WV 26507 Gregory Hackett, Kirk Gerdes, Randall Gemmen Phone: (304)285-5279, Gregory.Hackett@NETL.DOE.GOV Utilization of coal as a fuel source for highly efficient integrated gasification fuel cell (IGFC) power generation facilities is technologically and environmentally attractive. IGFC plants are expected to offer the highest efficiency coal gasification processes, even when carbon capture and storage systems are included in the design. One element of IGFC research at the National Energy Technology Laboratory is the investigation of syngas cleanup processes for these integrated systems. Of particular interest are the effects of trace elements naturally contained in

85

Touchstone Research Laboratory | Open Energy Information  

Open Energy Info (EERE)

Centre 1142 Middle Creek Road Place: Triadelphia, WV Zip: 26059-1139 Sector: Bioenergy Technology: Algae Year Founded: 1980 Website: http:www.trl.com Coordinates:...

86

Notice of Intent to prepare an Environmental Impact Statement for the Western Greenbrier Co-Production Demonstration Project, Rainelle, WV and Notice of Floodplain/Wetlands Involvement (6/3/03)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 11 Federal Register / Vol. 68, No. 106 / Tuesday, June 3, 2003 / Notices Dated: May 27, 2003. Judge Eric Andell, Deputy Under Secretary for Safe and Drug- Free Schools. [FR Doc. 03-13836 Filed 6-2-03; 8:45 am] BILLING CODE 4000-01-P DEPARTMENT OF ENERGY Notice of Intent To Prepare an Environmental Impact Statement for the Western Greenbrier Co-Production Demonstration Project, Rainelle, WV and Notice of Floodplain/Wetlands Involvement AGENCY: Department of Energy. ACTION: Notice of Intent to prepare an Environmental Impact Statement and Notice of Floodplain/Wetlands Involvement. SUMMARY: The U.S. Department of Energy (DOE) announces its intent to prepare an Environmental Impact Statement (EIS) pursuant to the National Environmental Policy Act (NEPA), the

87

PLAYER REGISTRATION City State Zip  

E-Print Network (OSTI)

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

88

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network (OSTI)

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

89

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network (OSTI)

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

90

NETL: West Virginia Science Bowl Archive  

NLE Websites -- All DOE Office Websites (Extended Search)

West Virginia Science Bowl Archive West Virginia Science Bowl Archive More media can be found on the National Science Bowl Website 2013 WVSB winner Morgantown HS places 4th at National Science Bowl Congratulations to Morgantown High School, champions of the 2012 WV Regional Science Bowl! We've got two news releases. A preview of our new buzzer system and an interview with WV Regional Science Bowl Coordinator Steve Woodruff, who passed the reins to Kirk Gerdes for 2012. 2012 2012 WV Regional Science Bowl Pictures [ZIP-21MB] 2012 WV Regional Science Bowl Team Pictures [ZIP-42MB] Two news items about planning the 2012 competition. 2011 2011 West Virginia Regional Science Bowl Results Press Release 2011 WV Regional Science Bowl Pictures [ZIP-8MB] 2011 WV Regional Science Bowl Team Pictures [ZIP-8MB]

91

wvBLACK DIAMONDS table of contents  

E-Print Network (OSTI)

'RE ON THE WEB! www.mine.cemr.wvu.edu Statler College of Engineering and Mineral Resources DEPARTMENT OF MINING

Mohaghegh, Shahab

92

wvBLACK DIAMONDS table of contents  

E-Print Network (OSTI)

with mining! WE'RE ON THE WEB! www.mine.cemr.wvu.edu College of Engineering and Mineral Resources DEPARTMENT

Mohaghegh, Shahab

93

QER Public Meeting in Cheyenne, WY: Infrastructure Siting | Department...  

Office of Environmental Management (EM)

Edison Electric Institute - Statement Brian Jeffries, Executive Director, Wyoming Pipeline Authority - Statement Brian Jeffries, Executive Director, Wyoming Pipeline Authority...

94

Word Pro - Untitled1  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Review 2011 TX CA FL LA IL OH PA NY GA IN MI NC VA NJ TN WA KY AL MO MN WI SC OK CO IA MD AZ MA MS KS AR OR NE UT CT WV NM NV AK WY ID ND ME MT SD NH HI...

95

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA VT...

96

F-7 U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

2014 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI...

97

F-5 U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA VT...

98

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI...

99

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

2013 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI...

100

padd map  

U.S. Energy Information Administration (EIA) Indexed Site

for Defense Districts AK HI WA OR CA NV AZ MT WY CO UT ID ND SD NE KS OK MO MN WI MI IL IN OH KY TN IA NM TX AR LA AL MS WV VA NC SC GA FL ME NH VT NY PA NJ MD DE MA CT RI...

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI...

102

Microsoft Word - figure_99.doc  

Gasoline and Diesel Fuel Update (EIA)

Liquids Production." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL MS LA MO AR TX NM OK CO KS UT AZ WY NE IL IA MN WI ND SD ID MT WA OR NV CA HI AK MI Gulf...

103

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

AZ OR CA HI V MT WY ID UT CO IV OK IA KS MO IL IN KY TN WI MI OH NE SD MN ND II NM TX MS AL AR LA III NJ CT VT ME RI MA NH FL GA SC NC WV MD DE VA NY PA I PAD District I - East...

104

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

105

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding

106

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

2 s o l u b i li t y at r o o m temperature. CO 2 solubility testing of the most prom- ising eutectic combinations was completed. The results indicate that increasing the...

107

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

412-386-7343 Hunaid.Nulwala@contr.netl.doe.gov David Luebke Technical Co-ordinator for Carbon Capture National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940...

108

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Storage Research Carbon capture and storage (CCS) is a key component of the U.S. carbon management portfolio. Numerous studies have shown that CCS can account for up to 55...

109

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Membranes for Carbon Capture Background Carbon capture and storage from fossil-based power generation is a critical component of realistic strategies for arresting the rise in...

110

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Solvents for Carbon Capture Background Carbon capture and storage from fossil-based power generation is a critical com- ponent of realistic strategies for arresting the rise in...

111

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sorbents for Carbon Capture Background Carbon capture and storage from fossil-based power generation is a critical component of realistic strategies for arresting the rise in...

112

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Alamos National Laboratory Pacific Northwest National Laboratory Princeton University Carbon Capture Simulation Initiative The Carbon Capture Simulation Initiative (CCSI) is a...

113

P O Box 6004 Morgantown, WV 26506-6004  

E-Print Network (OSTI)

Miller, Veterans Advocate at (304)293-8262 or email tdmiller@mail.wvu.edu Those needing to renew benefits

Mohaghegh, Shahab

114

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Midwest Regional Carbon Sequestration Partnership - Development Phase Large-Scale Field Project Background The U.S. Department of Energy Regional Carbon Sequestration Partnership...

115

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Non-Thermal Plasma for Fossil Energy Related Applications Background The U.S. Department of Energy is investigating various non-thermal plasma tech- nologies for their catalytic...

116

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

U.S. industry in a complementary research program designed to develop and demonstrate oil and natural gas drilling and production methodologies in ultra-deep formations. This...

117

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technology Transfer at NETL Carbon capture, quantum mechanical simulations, integrated gasification, and clean power-words like these mean the future of energy to NETL's in-house...

118

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

estimates could result in a 4 - 6% gain in overall system efficiency. Rotating Detonation Combustion (RDC) capitalizes on this cycle and offers potential as a drop in...

119

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Engineering 304-285-4685 madhava.syamlal@netl.doe.gov David Miller Technical Director Carbon Capture Simulation Initiative 412-386-6555 david.miller@netl.doe.gov RESEARCH...

120

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

needs of advanced power systems. Industries that utilize natural gas, gasifier syngas, biogas, landfill gas, or any type of fuel gas can benefit from knowing the composition of the...

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

views on the following: 1) whether the electric power utilities have shown interests in upgrading their distribution service equipment, etc., 2) whether the state regulatory...

122

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of feedstock, gasifier geometry and flow conditions. Using palladium sorbents for high temperature capture of mercury and other trace elements in flue gases is also under...

123

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Solvents for Carbon Capture Background Carbon capture and storage from fossil-based power generation is a critical component of realistic strategies for arresting the rise in...

124

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

541-967-5885 david.alman@netl.doe.gov David Hopkinson Technical Portfolio Lead Carbon Capture 304-285-4360 david.hopkinson@netl.doe.gov OTHER PARTNERS Energy Frontiers Research...

125

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Membranes for Carbon Capture Background Carbon capture and storage from fossil-based power generation is a critical com- ponent of realistic strategies for arresting the rise in...

126

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

541-967-5885 david.alman@netl.doe.gov David Hopkinson Technical Portfolio Lead Carbon Capture 304-285-4360 david.hopkinson@netl.doe.gov Figure 1: Film made from a...

127

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

science to ensure safe, essentially permanent carbon sequestration; develop reliable measurement, monitoring and verification technologies acceptable to permitting agencies;...

128

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

can simulate reservoirs that are multi-layered, exhibit dip, and have variable thickness, rock porosity, and rock permeability. The reservoirs can have fractures that open and...

129

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Assessment Partnership Initiative The National Risk Assessment Partnership (NRAP) is a DOE initiative that harnesses core capabilities developed across the National Laboratory...

130

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

to offshore hydrocarbon production and the recovery of unconventional resources like shale gas, estimating CO 2 storage potential in various types of geologic formations, and...

131

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

these emissions can negatively impact air quality. The environmental risks of shale gas and shale oil development may be very different from that of conventional oil and gas...

132

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of carbon dioxide in tight formations. Benefits Production of natural gas from hydraulically-fractured shales surrounding horizontal wells is a relatively recent and...

133

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

waters with geologic media such as confining layers and fossil fuels (e.g., coal, oil shale, natural gas bearing formations); and unconventional fossil fuel extraction...

134

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

AND DEVELOPMENT Cynthia Powell Director 514-967-5803 cynthia.powell@netl.doe.gov Kelly Rose Technical Portfolio Lead Offshore Resources 541-967-5883 kelly.rose@netl.doe.gov...

135

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

AND DEVELOPMENT Cynthia Powell Director 541-967-5803 cynthia.powell@netl.doe.gov Kelly Rose Technical Portfolio Lead Offshore Resources 541-967-5883 kelly.rose@netl.doe.gov...

136

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Portfolio Lead Carbon Storage 412-386-4962 angela.goodman@netl.doe.gov Kelly Rose Technical Portfolio Lead Offshore Resources 541-967-5883 kelly.rose@netl.doe.gov...

137

Albany, OR * Archorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Portfolio Lead National Risk Assessment Program 304-285-4688 grant.bromhal@netl.doe.gov Kelly Rose Technical Portfolio Lead Offshore Resources 541-967-5883 kelly.rose@netl.doe.gov...

138

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological and Environmental Sciences Division 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Acting Geology Team Lead Office of Research and Development National Energy...

139

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Acting Geology Team Lead Office of Research and Development National Energy...

140

Albany, OR * Archorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose EDX Coordinator Office of Research and Development National Energy Technology...

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator National Energy Technology Laboratory 1450 Queen Ave SW...

142

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

REARCH AND DEVELOPMENT Cynthia Powell Director 541-967-5803 cynthia.powell@netl.doe.gov Kelly Rose Technical Portfolio Lead Offshore Resources 541-967-5883 kelly.rose@netl.doe.gov...

143

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Portfolio Lead National Risk Assessment Program 304-285-4688 grant.bromhal@netl.doe.gov Kelly Rose Technical Portfolio Lead Offshore Resources 541-967-5883 kelly.rose@netl.doe.gov...

144

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhanced Analytical Simulation Tool for CO2 Storage Capacity Estimation and Uncertainty Quantification Background The overall goal of the Department of Energy's (DOE) Carbon...

145

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting (MVA) and...

146

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

potential risks associated with oil and gas resources in shale reservoirs that require hydraulic fracturing or other engineering measures to produce. The major areas of focus...

147

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

related impacts to human health and the natural environment, and induced seismicity from hydraulic fracturing. Project Description Through collaboration with its research...

148

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

related impacts to human health and the natural environment, and induced seismicity from hydraulic fracturing. Project Description Through collaboration with its Regional...

149

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Geomechanical Impacts of Shale Gas Activities Background Hydraulic fracturing of gas shale is the injection of large volumes of fluid at high pressures in low permeability shale to...

150

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Deleterious Events Associated with Drilling and Production Background Increasingly, offshore domestic oil and natural gas activities are associated with remote and challenging...

151

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

routes responsible for the observed catalytic effects. Such efforts will allow for the optimization of plasma systems so that they may be incorporated into a broad range of...

152

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

number of individual break-through tasks in diverse number of areas. These range from identification of new materials for gas capture, storage or separation to optimization of...

153

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and material interactions that impact environmental and resource issues related to oil, gas, and CO2 storage development. However, studying the wide variety of subsurface...

154

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Association of American Railroads Augusta Systems, Incorporated Southeast Regional Carbon Sequestration Partnership-Development Phase Cranfield Site and Citronelle Site...

155

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

EOR Field Project - Development Phase Background The U.S. Department of Energy Regional Carbon Sequestration Partnership (RCSP) Initiative consists of seven partnerships. The...

156

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Services Vecta Oil & Gas, Ltd. Washington State University Big Sky Regional Carbon Sequestration Partnership-Kevin Dome Development Phase Project Background The U.S....

157

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Southwestern United States Carbon Sequestration Training Center Background The focus of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance...

158

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

to 200 o C for combustion is inefficient from both a cost and net electricity perspective. Hydrophobic solvents could be operated at higher temperatures and minimize...

159

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

heat in a combustion process while producing a concentrated CO 2 stream to facilitate carbon capture. Chemical looping research efforts can be categorized as: modeling tool...

160

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

that are difficult or impossible to measure, such as coal jet penetration into a gasifier. This system provides the capabilities for running modeling tools at various scales...

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and implementing a Sponsorship Development Program that allows SECARB-Ed to be self-sustaining after the initial three-year period by establishing an advisory board, developing...

162

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

priations) to the FutureGen Industrial Alliance (Alliance) to build FutureGen 2.0-a clean coal repowering program and CO 2 pipeline and storage network. The FutureGen 2.0 Program...

163

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

from Fossil Energy R&D 1 Bezdek, R. Wendling, R., The Return on Investment of the Clean Coal Technology Program in the USA. Energy Policy, Vol. 54, March 2013, pp. 104-112 2...

164

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fuel Cells The Solid State Energy Conversion Alliance (SECA) program is responsible for coordinating Federal efforts to facilitate development of a commercially relevant and robust...

165

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

R&D 070, November 2011, rev 1114 Research facilities include the Severe Environment Corrosion Erosion Research Facility (SECERF) for assessing materials performance in a variety...

166

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

can affect permeability and porosity (flow properties), depending on the amount of sorptiondesorption. If the geological formations of interest are deep and have high...

167

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

well and post- placement. Foamed cement stability depends on time evolution of the gas bubble-size distribution (BSD) and varies as it is pumped and placed in the well. Unstable...

168

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

or particles. * High-definition, high-speed video capabilities: - Detailed information on bubble hydrodynamics. - Unprecedented resolution of hydrate surface morphology. * Provide...

169

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

changes in CO 2 -water inter- facial tension. * Experimental CO 2 injection tests in pore micro-models and parallel network model simulations demonstrate that the sweep efficiency...

170

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

pollutants and CO 2 . Oxy-fuel combustion of hydrocarbon fuel (coal, natural-gas, biomass) generates denitrified combustion gas comprising dominantly CO 2 and H 2 O. The...

171

P O Box 6004 Morgantown, WV 26506-6004  

E-Print Network (OSTI)

-5242 Fax: (304) 293-4890 Email: finaid@mail.wvu.edu We're on the Web! www.finaid.wvu.edu 2010-2011 STUDENT

Mohaghegh, Shahab

172

P O Box 6004 Morgantown, WV 26506-6004  

E-Print Network (OSTI)

% of students complete online at www.fafsa.gov Please consider using FAFSA on the Web. There is a FAFSA worksheet that can be downloaded from the FAFSA web site. The Financial Aid Office will also have a supply

Mohaghegh, Shahab

173

P O Box 6004 Morgantown, WV 26506-6004  

E-Print Network (OSTI)

're on the Web! www.finaid.wvu.edu 2009-2010 STUDENT AID REPORT Once you submit your FAFSA to the federal

Mohaghegh, Shahab

174

P O Box 6004 Morgantown, WV 26506-6004  

E-Print Network (OSTI)

-5242 Fax: (304) 293-4890 Email: finaid@mail.wvu.edu We're on the Web! www.finaid.wvu.edu 2011-2012 STUDENT

Mohaghegh, Shahab

175

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

for the same amount of energy produced, thereby facilitating a reduction in greenhouse gas emissions. When combined, oxy-combustion comes with an efficiency loss, so it will...

176

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

near 276 MPa. Therefore, the per turbed-chain statistical associating fluid theory (PC-SAFT) model was used to calculate the fluid density, which is an input into the improved...

177

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of meeting such a challenge is the combination of a high temperature fuel cell and a gas turbine with a gasifier or reformer. This hybrid technology has been studied...

178

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Turbine Thermal Management The gas turbine is the workhorse of power generation, and technology advances to current land-based turbines are directly linked to our country's...

179

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

are used to characterize the fundamental properties of unconventional natural gas and oil reservoirs, ultra-deepwater and frontier-region reservoirs, and reservoirs that offer...

180

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

being developed for geologic carbon storage are focused on five storage types: (1) oil and natural gas reservoirs; (2) saline formations; (3) unmineable coal seams; (4)...

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Hybrid Performance Project Research programs initiated by the U.S. Department of Energy (DOE) to achieve increased efficiency and reduced emissions are expected to result in the...

182

Albany, OR * Archorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

S Materials Science Fuels Gasification will likely be the cornerstone of future energy and chemical processes due to its flexibility to accommodate numerous feedstocks such as...

183

Orbital Period Changes and Their Explanations in Two Algol Binaries: WY Per and RW Leo  

Science Journals Connector (OSTI)

......04528 (22) 45586.46200 I v 125 0.0027 0.02798 0.00271 (23) 45649.68200 I v 106 0.0073 0.03253 0.00127 (24) 46002.36000 I v 0 0.0103 0.03524 0.00087 (25) 47822.32700 I v 547 0.041 0.06443 0.01531 (26) 48564.28300 I v......

Liao Wen-Ping; Qian Sheng-Bang

2010-08-25T23:59:59.000Z

184

Microsoft Word - USDOE QER, Cheyenne WY 08-21-14, Prepared Statement...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

fail to match between field offices and in some cases are completely d isconnected f rom a ny o ther c orridor. The mismatched corridors represent an impediment to the...

185

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

186

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

187

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

188

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

189

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

190

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

191

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

192

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

193

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

194

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

195

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

196

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

197

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

198

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

199

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

200

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

202

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

203

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

204

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

205

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

206

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

207

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

208

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

209

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

210

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

211

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

212

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

213

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

214

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

215

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

216

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

217

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

218

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

219

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

220

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

222

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

223

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

224

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

225

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

226

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

227

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

228

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

229

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

230

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

231

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

232

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

233

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

234

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

235

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

236

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

237

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

238

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

239

Exploring zipping and assembly as a protein folding principle  

E-Print Network (OSTI)

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

240

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

242

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

243

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

244

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

245

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

246

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

247

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

248

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

249

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

250

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

251

BLM biological assessment for T and E species for the WyCoalGas project. Final technical report, November 1980-May 1982. [Proposed WyCoalGas project; Converse County, Wyoming  

SciTech Connect

This volume considers the water requirements of the proposed plant and possible sources of water supply. The water requirements are 7900 acre-feet per year at full production (1720 acre-feet would be supplied by the moisture in the coal). Surface and ground water sources are described and a private reservoir would be built to store water. The priority of use from each source is considered. Also, in some cases other present water rights come first. In almost every year little or no water would be available during August and September. Endangered species in the area are considered, in particular, the effect of the increased water usage on them. (LTN)

Not Available

1982-01-01T23:59:59.000Z

252

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax

253

DOE-WRI Jointly Sponsored Research Program on Energy-Related Topics  

NLE Websites -- All DOE Office Websites (Extended Search)

Power Systems Power Systems Advanced Research ContaCts Kamalendu Das Project Manager Gasification and Combustion Projects Division National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4065 kamal.das@netl.doe.gov Robert R. Romanosky Technology Manager Advanced Research National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4721 robert.romanosky@netl.doe.gov Vijay K. sethi Western Research Institute 365 North 9th Street P.O. Box 3395 Laramie, WY 82072-3380 307-721-2376 vsethi@uwyo.edu http://wri.uwyo.edu/ DOE-WRI JOIntly SpOnSORED RESEaRch pROgRam On EnERgy-RElatED tOpIcS Description For over two decades, the University of Wyoming Research Corporation - doing business as the Western Research Institute (WRI) - has been supporting the

254

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

on Local and Regional Air on Local and Regional Air Quality Impacts of Oil and Natural Gas Development Goal The NETL research effort in improving the assessment of impacts to air quality from oil and gas exploration and production activities has the following goals: (1) using NETL's mobile air monitoring laboratory, conduct targeted on-site measurements of emissions from oil and gas production activities that may impact the environment and (2) use collected data in atmospheric chemistry and transport models to further understanding of local and regional air quality impacts. Background The development of shale gas and shale oil resources requires horizontal drilling and multi-stage hydraulic fracturing, two processes that have been known for many years but have only recently become common practice. In addition, fugitive atmospheric

255

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Evaluation of the Carbon Sequestration Evaluation of the Carbon Sequestration Potential of the Cambro Ordovician Strata of the Illinois and Michigan Basins Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strand- plain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef.

256

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Air Products and Chemicals, Inc.: Air Products and Chemicals, Inc.: Demonstration of CO2 Capture and Sequestration of Steam Methane Reforming Process Gas Used for Large-Scale Hydrogen Production Background Carbon dioxide (CO2) emissions from industrial processes, among other sources, are linked to global climate change. Advancing development of technologies that capture and store or beneficially reuse CO2 that would otherwise reside in the atmosphere for extended periods is of great importance. Advanced carbon capture, utilization and storage (CCUS) technologies offer significant potential for reducing CO2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. Under the Industrial Carbon Capture and Storage (ICCS) program, the U.S. Department

257

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Filtration to Improve Single Filtration to Improve Single Crystal Casting Yield-Mikro Systems Background Single crystal (SX) nickel superalloys are a primary material choice for gas turbine hot gas path component castings because of their high resistance to deformation at elevated temperatures. However, the casting yields of these components need to be improved in order to reduce costs and encourage more widespread use within the gas turbine industry. Low yields have been associated with a number of process-related defects common to the conventional casting of SX components. One innovative improvement, advanced casting filter designs, has been identified as a potential path toward increasing the yield rates of SX castings for high-temperature gas turbine applications. Mikro Systems, Inc. (Mikro) proposes to increase SX casting yields by developing

258

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Siemens Energy Siemens Energy Background Siemens Energy, along with numerous partners, has an ongoing U.S. Department of Energy (DOE) program to develop hydrogen turbines for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). Siemens Energy is expanding this program for industrial applications such as cement, chemical, steel, and aluminum plants, refineries, manufacturing facilities, etc., under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines for industrial CCS. ARRA industrial technology acceleration,

259

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Design of Advanced Engineering Design of Advanced Hydrogen-Carbon Dioxide Palladium and Palladium/Alloy Composite Membrane Separations and Process Intensification Background Technologies for pre-combustion carbon dioxide (CO2) capture and economical hydrogen (H2) production will contribute to the development of a stable and sustainable U.S. energy sector. The integrated gasification combined cycle (IGCC) system can produce synthesis gas (syngas) that can be used to produce electricity, hydrogen, fuels, and/or chemicals from coal and coal/biomass-mixtures in an environmentally responsible manner. The water-gas shift (WGS) reaction is a key part of this process for production of H2. The application of H2 separation technology can facilitate the production of high-purity H2 from gasification-based systems, as well as allow for process

260

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhancement of SOFC Cathode Electro- Enhancement of SOFC Cathode Electro- chemical Performance Using Multi-Phase Interfaces- University of Wisconsin Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Materials Design of Computational Materials Design of Castable SX Ni-based Superalloys for IGT Blade Components-QuesTek Innovations Background Higher inlet gas temperatures in industrial gas turbines (IGTs) enable improved thermal efficiencies, but creep-the tendency of materials to deform gradually under stress-becomes more pronounced with increasing temperature. In order to raise inlet temperatures of IGTs, turbine blade materials are required to have superior creep rupture resistance. Nickel (Ni)-based single crystal (SX) blades have higher creep strength in comparison with directionally solidified blades and are widely used in aerospace engines. However, their use in IGTs, which require larger-size castings (two to three times the size needed in aerospace applications), is limited

262

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combined Pressure, Temperature Combined Pressure, Temperature Contrast, and Surface-Enhanced Separation of Carbon Dioxide (CO 2 ) for Post-Combustion Carbon Capture Background The mission of the U.S. Department of Energy/National Energy Technology Laboratory (DOE/NETL) Carbon Capture Research & Development (R&D) Program is to develop innovative environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. The Carbon Capture R&D Program portfolio of carbon dioxide (CO 2 ) emissions control tech- nologies and CO 2 compression is focused on advancing technological options for new and existing coal-fired

263

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Conductivity, High Thermal Conductivity, High Durability Thermal Barrier Coatings for IGCC Environments-University of Connecticut Background Improved turbine materials are needed to withstand higher component surface temperatures and water vapor content for successful development and deployment of integrated gasification combined cycle (IGCC) power plants. Thermal barrier coatings (TBCs) in particular are required to have higher surface temperature capability, lower thermal conductivity, and resistance to attack at high temperature by contaminants such as calcium-magnesium-alumina-silicate (CMAS) and water vapor. There is also a concurrent need to address cost and availability issues associated with rare earth elements used in all low thermal conductivity TBCs.

264

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reducing Uncertainties in Model Reducing Uncertainties in Model Predictions via History Matching of CO2 Migration and Reactive Transport Modeling of CO2 Fate at the Sleipner Project, Norwegian North Sea Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is todevelop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations

265

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Molecular Separations Using Micro- Molecular Separations Using Micro- Defect Free Ultra-Thin Films Background Current methods for separating carbon dioxide (CO 2 ) from methane (CH 4 ) in fuel gas streams are energy and cost-intensive. Molecular sieve membrane development for carbon capture has been pursued for several decades because of the potential these membranes have for high selectivity while using less energy than cryogenic separation methods and greater flux (permselectivity) than is possible from polymeric membranes. However, the adoption of molecular sieve membrane technology has been hindered by high production costs and the micro-defect fissures that always accompany this type of membrane when fabricated using conventional techniques. The Department of Energy's (DOE) National Energy Technology Laboratory (NETL), has

266

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Characterization of the South Characterization of the South Georgia Rift Basin for Source Proximal CO 2 Storage Background Carbon capture, utilization and storage (CCUS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional

267

File:EIA-Appalach5-eastWV-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

Eastern West Virginia and Western Maryland By 2001 Liquids Reserve Class Eastern West Virginia and Western Maryland By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.6 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Maryland File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:41, 20 December 2010 Thumbnail for version as of 17:41, 20 December 2010 6,600 × 5,100 (18.6 MB) MapBot (Talk | contribs) Automated bot upload

268

File:EIA-Appalach6-WV-VA-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

LIQ.pdf LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.77 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

269

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory Scale Liquids Production Laboratory Scale Liquids Production and Assessment: Coal and Biomass to Drop-In Fuels Background A major problem with the production of liquid fuels from coal is that the production process and subsequent combustion of the fuel generate excessive greenhouse gases over the entire production and usage lifecycle. Adding lignocellulosic biomass (as a raw feed material) along with coal has the potential to reduce lifecycle greenhouse gas emissions to below those of petroleum products. Altex Technologies Corporation (Altex) has developed an innovative thermo-chemical process capable of converting coal and biomass to transportation fuel ready for blending. The Department of Energy (DOE) National Energy Technology Laboratory (NETL) has partnered with Altex to

270

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Capture and Storage Training Carbon Capture and Storage Training Background Carbon capture, utilization, and storage (CCUS) technologies offer great potential for mitigating carbon dioxide (CO2) emissions emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will require a drastically expanded workforce trained in CCUS related disciplines, including geologists, engineers, scientists, and technicians. Training to enhance the existing CCUS workforce and to develop new professionals can be accomplished through focused educational initiatives in the CCUS technology area. Key educational topics include simulation and risk assessment; monitoring, verification, and accounting (MVA); geology-related

271

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Andrea Dunn Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Marte Gutierrez Principal Investigator Colorado School of Mines 1600 Illinois Street Golden, CO 80401 303-273-3468 Fax: 303-273-3602 mgutierr@mines.edu PROJECT DURATION Start Date 12/01/2009 End Date 5/31/2013 COST Total Project Value $297,505 DOE/Non-DOE Share $297,505 / $0 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Training and Research on Probabilistic Hydro-Thermo-Mechanical Modeling of Carbon Dioxide Geological Sequestration in Fractured Porous Rocks Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)

272

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Efficiency Molten Bed Oxy- Coal Combustion with Low Flue Gas Recirculation Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO 2 ) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO 2 capture. Additionally, the program looks to accomplish this while maintaining near

273

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasification Characteristics of Gasification Characteristics of Coal/Biomass Mixed Fuels Background Domestically abundant coal is a primary energy source and when mixed with optimum levels of biomass during the production of liquid fuels may have lower carbon footprints compared to petroleum fuel baselines. Coal and biomass mixtures are converted via gasification into synthesis gas (syngas), a mixture of predominantly carbon monoxide and hydrogen, which can be subsequently converted to liquid fuels by Fischer-Tropsch chemistry. The Department of Energy (DOE) is supporting research focused on using coal and biomass to produce clean and affordable power, fuels and chemicals. The DOE's National Energy Technology Laboratory (NETL) is partnering with Leland Stanford Junior

274

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbonaceous Chemistry for Carbonaceous Chemistry for Computational Modeling (C3M) Description C3M is chemistry management software focused on computational modeling of reacting systems. The primary function of C3M is to provide direct links between r e l i a b l e s o u r c e s o f k i n e t i c information (kinetic modeling soft- ware, databases, and literature) and commonly used CFD software su ch as M FIX , FLUEN T, an d BARRACUDA with minimal effort from the user. C3M also acts as a virtual kinetic laboratory to allow a CFD practitioner or researcher to evaluate complex, large sets of kinetic expressions for reliability and suitability and can interact with spreadsheet and process models. Once the chemical model is built within C3M, the software also allows the user to directly export

275

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Phase III Xlerator Program: Electro-deposited Phase III Xlerator Program: Electro-deposited Mn-Co Alloy Coating for Solid Oxide Fuel Cell Interconnects-Faraday Technology Background Based on preliminary cost analysis estimates, Faraday Technology has shown that its FARADAYIC TM electrodeposition process for coating interconnects is cost competitive. Funding from the American Recovery and Reinvestment Act (ARRA) under the Small Business Innovation Research (SBIR) Phase III Xlerator Program will be directed toward developing, optimizing, and validating the FARADAYIC process as an effective and economical manufacturing method for coating interconnect materials with a manganese-cobalt (Mn-Co) alloy for use in solid oxide fuel cell (SOFC) stacks. This project is managed by the U.S. Department of Energy (DOE) National Energy

276

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Technology to Mitigate Syngas Technology to Mitigate Syngas Cooler Fouling Background Coal gasification, in conjunction with integrated gasification combined cycle (IGCC) power production, is under development to increase efficiency and reduce greenhouse gas emissions associated with coal-based power production. However, coal gasification plants have not achieved their full potential for superior performance and economics due to challenges with reliability and availability. In particular, performance of the syngas cooler located downstream of the gasifier has been an issue. The syngas cooler is a fire tube heat exchanger located between the gasifier and the gas turbine. The purpose of the syngas cooler is to cool the raw syngas from the gasifier and recover heat. Although

277

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Processing and Evaluation of Next Processing and Evaluation of Next Generation Oxygen Carrier Materials for Chemical Looping Combustion Background The Department of Energy (DOE) supports research towards the development of efficient and inexpensive CO 2 capture technologies for fossil fuel based power generation. The Department of Energy Crosscutting Research Program (CCR) serves as a bridge between basic and applied research. Projects supported by the Crosscutting Research Program conduct a range of pre-competitive research focused on opening new avenues to gains in power plant efficiency, reliability, and environmental quality by research in materials and processes, coal utilization science, sensors and controls, and computational energy science. Within the CCR, the University Coal Research (UCR) Program sponsors

278

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Studies to Enable Robust, Studies to Enable Robust, Reliable, Low Emission Gas Turbine Combustion of High Hydrogen Content Fuels-University of Michigan Background The University of Michigan will perform experimental and computational studies which can provide an improved and robust understanding of the reaction kinetics and other fundamental characteristics of combustion of high hydrogen content (HHC) fuels that are vital to advancing HHC turbine design and to making coal gasification power plants environmentally sustainable and cost- competitive. The scope of work includes Rapid Compression Facility (RCF) studies of HHC ignition delay times and hydroxyl radical (OH) time-histories, flame speeds, and flammability limits. A range of temperatures, pressures, and test gas mixture compositions will

279

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rick Dunst Rick Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 MS 922-273C Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Felicia Manciu Principal Investigator University of Texas at El Paso 500 West University Avenue El Paso, TX 79968-8900 915-747-5715 fsmanciu@utep.edu PROJECT DURATION Start Date 01/15/2009 End Date 12/15/2013 COST Total Project Value $249,546 DOE/Non-DOE Share $249,546 / $0

280

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Environmental Considerations and Environmental Considerations and Cooling Strategies for Vane Leading Edges in a Syngas Environment- University of North Dakota Background Cooling airfoil leading edges of modern first stage gas turbine vanes presents a con- siderable challenge due to the aggressive heat transfer environment and efficiency penalties related to turbine hot gas path cooling. This environment is made more complex when natural gas is replaced by high hydrogen fuels (HHF) such as synthesis gas (syngas) derived from coal gasification with higher expected levels of impurities. In this project the University of North Dakota (UND) and The Ohio State University (OSU) will explore technology opportunities to improve the reliability of HHF gas turbines by analyzing the effects

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Alternative Low-Cost Process for Alternative Low-Cost Process for Deposition of MCrAlY Bond Coats for Advanced Syngas/Hydrogen Turbine Applications-Tennessee Technological University Background One of the material needs for the advancement of integrated gasification combined cycle (IGCC) power plants is the development of low-cost effective manufacturing processes for application of coating architectures with enhanced performance and durability in coal derived synthesis gas (syngas)/hydrogen environments. Thermal spray technologies such as air plasma spray (APS) and high-velocity oxy-fuel (HVOF) are currently used to fabricate thermal barrier coating (TBC) systems for large land- based turbine components. In this research Tennessee Technological University (TTU) will develop metal chromium-aluminum-yttrium (MCrAlY; where M = nickel [Ni], cobalt

282

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid-Fueled Pressurized Chemical Solid-Fueled Pressurized Chemical Looping with Flue-Gas Turbine Combined Cycle for Improved Plant Efficiency and CO2 Capture Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while

283

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hafnia-Based Nanostructured Hafnia-Based Nanostructured Thermal Barrier Coatings for Advanced Hydrogen Turbine Technology- University of Texas at El Paso Background Thermal barrier coatings (TBCs) are protective layers of low thermal conductivity ceramic refractory material that protect gas turbine components from high temperature exposure. TBCs improve efficiency by allowing gas turbine components to operate at higher temperatures and are critical to future advanced coal-based power generation systems. Next generation gas turbine engines must tolerate fuel compositions ranging from natural gas to a broad range of coal-derived synthesis gasses (syngas) with high hydrogen content. This will require TBCs to withstand surface temperatures much higher than those currently experienced by standard materials. In this project the University of Texas at El Paso (UTEP)

284

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Direct Utilization of Coal Syngas in High Direct Utilization of Coal Syngas in High Temperature Fuel Cells-West Virginia University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. West Virginia University's (WVU) project will establish the tolerance limits of contaminant

285

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

and Geotechnical Site and Geotechnical Site Investigations for the Design of a CO2 Rich Flue Gas Direct Injection and Storage Facility in an Underground Mine in the Keweenaw Basalts Background Fundamental and applied research on carbon capture, utilization and storage (CCUS) technologies is necessary in preparation for future commercial deployment. These technologies offer great potential for mitigating carbon dioxide (CO2) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCUS technical and non-technical disciplines that are currently under-represented in the United States. Education and training

286

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

National Risk Assessment Partnership National Risk Assessment Partnership The Need for Quantitative Risk Assessment for Carbon Utilization and Storage Carbon utilization and storage-the injection of carbon dioxide (CO2) into permanent underground and terrestrial storage sites-is an important part of our nation's strategy for managing CO2 emissions. Several pilot- to intermediate-scale carbon storage projects have been performed in the U.S. and across the world. However, some hurdles still exist before carbon storage becomes a reality in the U.S. at a large scale. From a technical point of view, carbon storage risk analysis is complicated by the fact that all geologic storage sites are not created equally. Every potential site comes with an individual set of characteristics, including type of storage formation, mineral make-

287

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Model Development-LG Fuel Model Development-LG Fuel Cell Systems Background In this congressionally directed project, LG Fuel Cell Systems Inc. (LGFCS), formerly known as Rolls-Royce Fuel Cell Systems (US) Inc., is developing a solid oxide fuel cell (SOFC) multi-physics code (MPC) for performance calculations of their fuel cell structure to support product design and development. The MPC is based in the computational fluid dynamics software package STAR-CCM+ (from CD-adapco) which has been enhanced with new models that allow for coupled simulations of fluid flow, porous flow, heat transfer, chemical, electrochemical and current flow processes in SOFCs. Simulations of single cell, five-cell, substrate and bundle models have been successfully validated against experimental data obtained by LGFCS. The MPC is being

288

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

of the Highest- of the Highest- Priority Geologic Formations for CO 2 Storage in Wyoming Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strand- plain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef.

289

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Assessment of Factors Influencing Assessment of Factors Influencing Effective CO2 Storage Capacity and Injectivity in Eastern Gas Shales Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

290

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reflection Reflection Seismic Monitoring and Reservoir Modeling for Geologic CO2 Sequestration Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both

291

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Dry Sorbent Technology Dry Sorbent Technology for Pre-Combustion CO 2 Capture Background An important component of the Department of Energy (DOE) Carbon Capture Program is the development of carbon capture technologies for power systems. Capturing carbon dioxide (CO 2 ) from mixed-gas streams is a first and critical step in carbon sequestration. To be technically and economically viable, a successful separation method must be applicable to industrially relevant gas streams at realistic temperatures and practical CO 2 loading volumes. Current technologies that are effective at separating CO 2 from typical CO 2 -containing gas mixtures, such as coal-derived shifted synthesis gas (syngas), are both capital and energy intensive. Research and development is being conducted to identify technologies that will provide improved economics and

292

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gas Turbine Thermal Gas Turbine Thermal Performance-Ames Laboratory Background Developing turbine technologies to operate on coal-derived synthesis gas (syngas), hydrogen fuels, and oxy-fuels is critical to the development of advanced power gener-ation technologies such as integrated gasification combined cycle and the deployment of near-zero-emission type power plants with capture and separation of carbon dioxide (CO 2 ). Turbine efficiency and service life are strongly affected by the turbine expansion process, where the working fluid's high thermal energy gas is converted into mechanical energy to drive the compressor and the electric generator. The most effective way to increase the efficiency of the expansion process is to raise the temperature of the turbine's

293

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Statistical Analysis of CO2 Exposed Wells Statistical Analysis of CO2 Exposed Wells to Predict Long Term Leakage through the Development of an Integrated Neural-Genetic Algorithm Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

294

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological Sequestration Geological Sequestration Consortium-Development Phase Illinois Basin - Decatur Project Site Background The U.S. Department of Energy Regional Carbon Sequestration Partnership (RCSP) Initiative consists of seven partnerships. The purpose of these partnerships is to determine the best regional approaches for permanently storing carbon dioxide (CO2) in geologic formations. Each RCSP includes stakeholders comprised of state and local agencies, private companies, electric utilities, universities, and nonprofit organizations. These partnerships are the core of a nationwide network helping to establish the most suitable technologies, regulations, and infrastructure needs for carbon storage. The partnerships include more than 400 distinct organizations, spanning 43 states

295

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACT CONTACT Cathy Summers Director, Process Development Division National Energy Technology Laboratory 1450 Queen Ave., SW Albany, OR 97321-2198 541-967-5844 cathy.summers@netl.doe.gov An Integrated Approach To Materials Development Traditional trial-and-error method in materials development is time consuming and costly. In order to speed up materials discovery for a variety of energy applications, an integrated approach for multi-scale materials simulations and materials design has

296

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Scale Simulations of the Large Scale Simulations of the Mechanical Properties of Layered Transition Metal Ternary Compounds for FE Power Systems Background The U.S. Department of Energy (DOE) promotes the advancement of computational capabilities to develop materials for advanced fossil energy power systems. The DOE's National Energy Technology Laboratory (NETL) Advanced Research (AR) Program is working to enable the next generation of Fossil Energy (FE) power systems. The goal of

297

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigations and Investigations and Rational Design of Durable High- Performance SOFC Cathodes- Georgia Institute of Technology Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration of solid SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Cathode durability is critical to long-term SOFC performance for commercial deployment.

298

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxygen Carriers for Coal-Fueled Oxygen Carriers for Coal-Fueled Chemical Looping Combustion Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who

299

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Novel Supercritical Carbon Dioxide Novel Supercritical Carbon Dioxide Power Cycle Utilizing Pressurized Oxy-combustion in Conjunction with Cryogenic Compression Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while maintaining near

300

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological & Environmental Sciences Geological & Environmental Sciences Subsurface Experimental Laboratories Autoclave and Core Flow Test Facilities Description Researchers at NETL study subsurface systems in order to better characterize and understand gas-fluid-rock and material interactions that impact environmental and resource issues related to oil, gas, and CO2 storage development. However, studying the wide variety of subsurface environments related to hydrocarbon and CO2 systems requires costly and technically challenging tools and techniques. As a result, NETL's Experimental Laboratory encompasses multi-functional, state-of-the-art facilities that perform a wide spectrum of geological studies providing an experimental basis for modeling of various subsurface phenomena and processes. This includes, but is not

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Improving Durability of Turbine Components through Trenched Film Cooling and Contoured Endwalls-University of Texas at Austin Background Gas turbine operation utilizing coal-derived high hydrogen fuels (synthesis gas, or syngas) requires new cooling configurations for turbine components. The use of syngas is likely to lead to degraded cooling performance resulting from rougher surfaces and partial blockage of film cooling holes. In this project the University of Texas at Austin (UT) in cooperation with The Pennsylvania State University (Penn State) will investigate the development of new film cooling and endwall cooling designs for maximum performance when subjected to high levels of contaminant depositions. This project was competitively selected under the University Turbine Systems Research

302

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Single-Crystal Sapphire Optical Fiber Single-Crystal Sapphire Optical Fiber Sensor Instrumentation for Coal Gasifiers Background Accurate temperature measurement inside a coal gasifier is essential for safe, efficient, and cost-effective operation. However, current sensors are prone to inaccurate readings and premature failure due to harsh operating conditions including high temperatures (1,200-1,600 degrees Celsius [°C]), high pressures (up to 1000 pounds per square inch gauge [psig]), chemical corrosiveness, and high flow rates, all of which lead to corrosion, erosion, embrittlement, and cracking of gasifier components as well as sensor failure. Temperature measurement is a critical gasifier control parameter because temperature is a critical factor influencing the gasification and it leads to impacts in efficiency and

303

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Unraveling the Role of Transport, Unraveling the Role of Transport, Electrocatalysis, and Surface Science in the SOFC Cathode Oxygen Reduction Reaction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The electrochemical performance of SOFCs can be substantially influenced by

304

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Swirl Injectors for Hydrogen Gas Low-Swirl Injectors for Hydrogen Gas Turbines in Near-Zero Emissions Coal Power Plants-Lawrence Berkeley National Laboratory Background The U.S. Department of Energy Hy(DOE) Lawrence Berkeley National Laboratory (LBNL) is leading a project in partnership with gas turbine manufacturers and universities to develop a robust ultra-low emission combustor for gas turbines that burn high hydrogen content (HHC) fuels derived from gasification of coal. A high efficiency and ultra-low emissions HHC fueled gas turbine is a key component of a near-zero emis- sions integrated gasification combined cycle (IGCC) clean coal power plant. This project is managed by the DOE National Energy Technology Laboratory (NETL). NETL is researching advanced turbine technology with the goal of producing reliable,

305

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of a Coal-Based Demonstration of a Coal-Based Transport Gasifier Background Coal is an abundant and indigenous energy resource and currently supplies almost 38 percent of the United States' electric power. Demand for electricity, vital to the nation's economy and global competitiveness, is projected to increase by almost 28 percent by 2040. The continued use of coal is essential for providing an energy supply that supports sustainable economic growth. Unfortunately, nearly half of the nation's electric power generating infrastructure is more than 30 years old and in need of substantial refurbishment or replacement. Additional capacity must also be put in service to keep pace with the nation's ever-growing demand for electricity. It is in the public interest

306

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Foamed Wellbore Cement Foamed Wellbore Cement Stability under Deep Water Conditions Background Foamed cement is a gas-liquid dispersion that is produced when an inert gas, typically nitrogen, is injected into a conventional cement slurry to form microscopic bubbles. Foamed cements are ultralow-density systems typically employed in formations that are unable to support annular hydrostatic pressure exerted by conventional cement slurries. More recently, the use of foamed cement has expanded into regions with high-stress environments, for example, isolating problem formations typical in the Gulf of Mexico. In addition to its light-weight application, foamed cement has a unique resistance to temperature and pressure-induced stresses. Foamed cement exhibits superior fluid

307

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scale Computational Design and Scale Computational Design and Synthesis of Protective Smart Coatings for Refractory Metal Alloys Background The goal of the University Coal Research (UCR) Program within the Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to further the understanding of coal utilization. Since the program's inception in 1979, its primary objectives have been to (1) improve understanding of the chemical and physical processes involved in the conversion and utilization of coal so it can be used in an environmentally acceptable manner, (2) maintain and upgrade the coal research capabilities of and facilities at U.S. colleges and universities, and (3) support the education of students in the area of coal science. The National Energy Technology Laboratory's Office of Coal and Power Systems supports

308

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Conversion of CO2 in Commercial Conversion of CO2 in Commercial Materials using Carbon Feedstocks Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways

309

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Experimental and Chemical Kinetics Experimental and Chemical Kinetics Study of the Combustion of Syngas and High Hydrogen Content Fuels- Pennsylvania State University Background Pennsylvania State University is teaming with Princeton University to enhance scientific understanding of the underlying factors affecting combustion for turbines in integrated gasification combined cycle (IGCC) plants operating on synthesis gas (syngas). The team is using this knowledge to develop detailed, validated combustion kinetics models that are useful to support the design and future research and development needed to transition to fuel flexible operations, including high hydrogen content (HHC) fuels derived from coal syngas, the product of gasification of coal. This project also funda- mentally seeks to resolve previously reported discrepancies between published ex-

310

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Coating Issues in Coal-Derived Synthesis Coating Issues in Coal-Derived Synthesis Gas/Hydrogen-Fired Turbines-Oak Ridge National Laboratory Background The Department of Energy (DOE) Oak Ridge National Laboratory (ORNL) is leading research on the reliable operation of gas turbines when fired with synthesis gas (syngas) and hydrogen-enriched fuel gases with respect to firing temperature and fuel impurity levels (water vapor, sulfur, and condensable species). Because syngas is derived from coal, it contains more carbon and more impurities than natural gas. In order to achieve the desired efficiency, syngas-fired systems need to operate at very high temperatures but under combustion conditions necessary to reduce nitrogen oxide (NO X ) emissions. ORNL's current project is focused on understanding the performance of high-

311

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Diode Laser Cladding of High Diode Laser Cladding of High Temperature Alloys Used in USC Coal- Fired Boilers Background The Advanced Research (AR) Materials Program addresses materials requirements for all fossil energy systems, including materials for advanced power generation and coal fuels technologies. Examples of these technologies include coal gasification, heat engines such as turbines, combustion systems, fuel cells, hydrogen production, and carbon capture

312

File:EIA-Appalach5-eastWV-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Eastern West Virginia and Western Maryland By 2001 Gas Reserve Class Eastern West Virginia and Western Maryland By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.18 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Maryland File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:41, 20 December 2010 Thumbnail for version as of 17:41, 20 December 2010 6,600 × 5,100 (18.18 MB) MapBot (Talk | contribs) Automated bot upload

313

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Electrochemical Processes Electrochemical Processes for CO2 Capture and Conversion to Commodity Chemicals Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the

314

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Preparation and Testing of Corrosion- Preparation and Testing of Corrosion- and Spallation-Resistant Coatings- University of North Dakota Background The life of turbine components is a significant issue in gas fired turbine power systems. In this project the University of North Dakota (UND) will advance the maturity of a process capable of bonding oxide-dispersion strengthened alloy coatings onto nickel-based superalloy turbine parts. This will substantially improve the lifetimes and maximum use temperatures of parts with and without thermal barrier coatings (TBCs). This project is laboratory research and development and will be performed by UND at their Energy & Environmental Research Center (EERC) facility and the Department of Mechanical Engineering. Some thermal cycle testing will occur at Siemens Energy

315

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Integrated Assessment Model for Predicting Integrated Assessment Model for Predicting Potential Risks to Groundwater and Surface Water Associated with Shale Gas Development Background The EPAct Subtitle J, Section 999A-999H established a research and development (R&D) program for ultra-deepwater and unconventional natural gas and other petroleum resources. This legislation identified three program elements to be administered by a consortium under contract to the U.S. Department of Energy. Complementary research performed by the National Energy Technology Laboratory's (NETL) Office of Research and Development (ORD) is a fourth program element of this cost-shared program. NETL was also tasked with managing the consortium: Research Partnership to Secure Energy for America (RPSEA). Historically, the Complementary R&D Program being carried out by NETL's ORD has focused

316

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of Enabling Spar-Shell Demonstration of Enabling Spar-Shell Cooling Technology in Gas Turbines - Florida Turbine Technologies Background The Florida Turbine Technologies (FTT) spar-shell gas turbine airfoil concept has an internal structural support (the spar) and an external covering (the shell). This concept allows the thermal-mechanical and aerodynamic requirements of the airfoil design to be considered separately, thereby enabling the overall design to be optimized for the harsh environment these parts are exposed to during operation. Such optimization is one of the major advantages of the spar-shell approach that is not possible with today's conventional monolithic turbine components. The proposed design integrates a novel cooling approach based on Advanced Recircu-

317

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Alamos National Laboratory - Los Alamos National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization and Pre-Combustion Capture Goals Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop technologies to capture, separate, and store carbon dioxide (CO 2 ) to aid in reducing greenhouse gas (GHG) emissions without adversely influencing energy use or hindering economic growth. Carbon capture and sequestration (CCS) - the capture of CO 2 from large point sources and subsequent injection into deep geologic formations for permanent storage - is one option that is receiving considerable attention. NETL is devoted to improving geologic carbon sequestration technology by funding research projects aimed at removing barriers to commercial-scale

318

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cell Cathodes: Solid Oxide Fuel Cell Cathodes: Unraveling the Relationship among Structure, Surface Chemistry, and Oxygen Reduction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The Boston University (BU) project was competitively selected to acquire the fundamental

319

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials for Robust Repair Materials for Robust Repair of Leaky Wellbores in CO2 Storage Formations Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

320

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-fired Pressurized Fluidized Bed Oxy-fired Pressurized Fluidized Bed Combustor Development and Scale-up for New and Retrofit Coal-fired Power Plants Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy-combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Quantification Quantification of Wellbore Leakage Risk Using Non-Destructive Borehole Logging Techniques Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the

322

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Storage Research Storage Research Carbon capture and storage (CCS) is a key component of the U.S. carbon management portfolio. Numerous studies have shown that CCS can account for up to 55 percent of the emissions reductions needed to stabilize and ultimately reduce atmospheric concentrations of CO 2 . NETL's Carbon Storage Program is readying CCS technologies for widespread commercial deployment by 2020. The program's goals are:

323

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Sequestration Sequestration Training and Research Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO2). Carbon capture and storage (CCS) technologies offer great potential for reducing CO2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess the skills required for implementing and deploying CCS technologies.

324

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gulf of Mexico Miocene CO Gulf of Mexico Miocene CO 2 Site Characterization Mega Transect Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional storage types are porous permeable clastic or carbonate rocks that have

325

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE Leads Collaborative Effort DOE Leads Collaborative Effort to Quantify Environmental Changes that Coincide with Shale Gas Development Background DOE's National Energy Technology Laboratory (NETL) is leading a joint industry/ government research project to document environmental changes that occur during the lifecycle of shale gas development. The research plan calls for one year of environmental monitoring before development takes place to establish baseline conditions and account for seasonal variations. Monitoring then will continue through the different stages of unconventional shale gas development including: road and pad construction, drilling, and hydraulic fracturing, and for at least one year of subsequent production operations. The study will take place at a Range Resources-Appalachia

326

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

General Electric General Electric Background GE Power & Water, along with GE Global Research Center, has an ongoing U.S. Depart- ment of Energy (DOE) program to develop gas turbine technology for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). GE is broadening this development effort, along with expanding applicability to industrial applications such as refineries and steel mills under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines with industrial CCS. ARRA industrial technology acceleration,

327

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Livermore National Laboratory Livermore National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop carbon capture and storage (CCS) technologies to capture, separate, and store carbon dioxide (CO 2 ) in order to reduce green-house gas emissions without adversely influencing energy use or hindering economic growth. Carbon sequestration technologies capture and store CO 2 by injecting and permanently storing it in underground geologic formations. NETL is working to advance geologic carbon sequestration technology by funding research projects that aim to accelerate deployment and remove barriers to commercial-scale carbon sequestration. Lawrence Livermore National Laboratory

328

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

r r oj e c t Fac t s Advanced Research Micro-Structured Sapphire Fiber Sensors for Simultaneous Measurements of High Temperature and Dynamic Gas Pressure in Harsh Environments Background Securing a sustainable energy economy by developing affordable and clean energy from coal and other fossil fuels is central to the mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL). To further this mission, NETL funds research and development of novel sensors that can function under the

329

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-Fuel Turbo Machinery Oxy-Fuel Turbo Machinery Development for Energy Intensive Industrial Applications-Clean Energy Systems Background Clean Energy Systems (CES), with support from Siemens Energy and Florida Turbine Technologies (FTT), has an ongoing U.S. Department of Energy (DOE) program to develop an oxy-fuel combustor for highly efficient near zero emission power plants. CES is expanding this development for an industrial-scale, oxy-fuel reheat combustor- equipped intermediate-pressure oxy-fuel turbine (IP-OFT) under the American Recovery and Reinvestment Act (ARRA). Through the design, analysis, and testing of a modified Siemens SGT-900 gas turbine, the team will demonstrate a simple-cycle oxy-fuel system. ARRA funding is accelerating advancement in OFT technology for

330

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Passive Wireless Acoustic Wave Sensors Passive Wireless Acoustic Wave Sensors for Monitoring CO 2 Emissions for Geological Sequestration Sites Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO 2 ) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO 2 into underground formations that have the ability to securely contain the CO

331

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Criteria for Flame- Criteria for Flame- holding Tendencies within Premixer Passages for High Hydrogen Content Fuels-University of California, Irvine Background The gas turbine community must develop low emissions systems while increasing overall efficiency for a widening source of fuels. In this work, the University of California, Irvine (UCI) will acquire the fundamental knowledge and understanding to facilitate the development of robust, reliable, and low emissions combustion systems with expanded high hydrogen content (HHC) fuel flexibility. Specifically, understanding flashback and the subsequent flameholding tendencies associated with geometric features found within combustor fuel/air premixers will enable the development of design guides to estimate flame holding tendencies for lean, premixed emission combustion systems

332

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combining Space Geodesy, Seismology, Combining Space Geodesy, Seismology, and Geochemistry for MVA of CO2 in Sequestration Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO2) leakage at CO2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO2, with a high level of confidence that the CO2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both

333

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhanced Analytical Simulation Tool for Enhanced Analytical Simulation Tool for CO2 Storage Capacity Estimation and Uncertainty Quantification Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

334

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reactive Transport Models with Reactive Transport Models with Geomechanics to Mitigate Risks of CO2 Utilization and Storage Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

335

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

a Prototype Commercial a Prototype Commercial Gasifier Sensor Background Integrated gasification combined cycle (IGCC) technology has the potential to improve the efficiency and environmental performance of fossil fuel based electric power production. During the IGCC process, coal and/or biomass is gasified at high temperature and pressure to form synthesis gas (syngas), a mixture of hydrogen, carbon monoxide, carbon dioxide, and small amounts of contaminants such as hydrogen sulfide. The syngas can be used to produce power, chemicals, and/or fuels. The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) Gasification Technologies Program is focused on enhancing the performance of gasification systems, thus enabling U.S. industry to improve the competitiveness of

336

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Phase III Xlerator Program: Rapid Phase III Xlerator Program: Rapid Commercialization of Advanced Turbine Blades for IGCC Power Plants-Mikro Systems Background Mikro Systems, Inc. is developing their proprietary TOMO SM manufacturing technology to produce turbine blades with significantly improved internal cooling geometries that are beyond current manufacturing state-of-the-art, thus enabling higher operating temperatures. Funding from the American Recovery and Reinvestment Act (ARRA) under the Small Business Innovation Research (SBIR) Phase III Xlerator Program will be directed towards accelerating commercial adoption of TOMO SM technology by leading turbine manufacturers through the demonstration of superior manufacturability, cost, and performance. Ultimately, this technology will lead to improved efficiency

337

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Non-Thermal Plasma for Fossil Energy Non-Thermal Plasma for Fossil Energy Related Applications Background The U.S. Department of Energy is investigating various non-thermal plasma tech- nologies for their catalytic properties related to fossil energy conversion and carbon dioxide decomposition. Non-thermal plasma is an ionized gas comprised of a mixture of charged particles (electrons, ions), active chemical radicals (O 3 , O, OH), and highly excited species that are known to accelerate reforming reactions in

338

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Training Toward Advanced 3-D Seismic Training Toward Advanced 3-D Seismic Methods for CO 2 Monitoring, Verification, and Accounting Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effective- ness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO 2 ) to reduce greenhouse gas (GHG) emissions without adversely af fecting energy use or hindering economic grow th. Geologic carbon storage involves the injection of CO 2 into underground formations that have the ability to securely contain the CO

339

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Cathode Surface Chemistry and Cathode Surface Chemistry and Optimization Studies-Carnegie Mellon University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Carnegie Mellon University's (CMU) project was selected to acquire the fundamental knowledge and understanding that will facilitate research and development to enhance

340

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

a Coal-Biomass to Liquids a Coal-Biomass to Liquids Plant in Southern West Virginia Background Concerns regarding global supplies of oil, energy security, and climate change have generated renewed interest in alternative energy sources. The production of liquid fuels from coal provides an option for reducing petroleum use in the U.S. transportation sector and enhancing national and economic security by decreasing the nation's reliance on foreign oil. Two basic methods can be employed to produce liquid fuels

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Creep-Fatigue-Environment Creep-Fatigue-Environment Interactions in Steam Turbine Rotor Materials for Advanced Ultrasupercritical Coal Power Plants Background The U.S. Department of Energy (DOE) promotes the advancement of computational capabilities to develop materials for advanced fossil energy power systems. The DOE's National Energy Technology Laboratory (NETL) Advanced Research (AR) Program is working to enable the next generation of Fossil Energy (FE) power systems. One goal of the AR Materials Program is to conduct research leading to a scientific understanding of high-performance materials capable of service in the hostile environments associated with advanced ultrasupercritical (A-USC) coal-fired power plants. A-USC plants will increase coal-fired power plant efficiency by allowing operation

342

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL's Fluid Chemistry Analysis NETL's Fluid Chemistry Analysis Capacity Background Establishing the geochemistry of surface and ground waters requires an arsenal of techniques devoted to determining the constituents these waters contain and the environment in which they exist. Many standard techniques have been developed over the years, and new ones continue to be explored as more complex matrices and harsher environments are encountered. Deep geologic storage of carbon dioxide and the development of unconventional oil and gas resourses are two areas of current concern where the study of geochemical processes is challenging due to the complex nature of the natural samples, and where routine analytical techniques are being pushed to their limits. The facilities at NETL include both conventional and cutting-edge instrumentation

343

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

29,759 29,759 PROJECT NUMBER FWP-2012.03.03 Task 3 Conversion and Fouling Background Coal and biomass gasification is an approach to cleaner power generation and other uses of these resources. Currently, the service life of gasifiers does not meet the performance needs of users. Gasifiers fail to achieve on-line availability of 85-95 percent in utility applications and 95 percent in applications such as chemical production. The inability to meet these goals has created a potential roadblock to widespread acceptance and commercialization of advanced gasification technologies. Gasifier output is a hot gas mixture consisting primarily of hydrogen and carbon monoxide (CO), known as synthesis gas (syngas). The syngas cooler is one of the key components identified as negatively impacting gasifier availability. Ash originating from impurities

344

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Compact Eye-safe Scanning Differential Compact Eye-safe Scanning Differential Absorption LIDAR (DIAL) for Spatial Mapping of Carbon Dioxide for MVA at Geologic Carbon Sequestration Sites Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that

345

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Energy California Project Hydrogen Energy California Project Background A need exists to further develop carbon management technologies that capture and store or beneficially reuse carbon dioxide (CO 2 ) that would otherwise be emitted into the atmosphere from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. Under the Clean Coal Power Initiative (CCPI) Round 3 program, the U.S. Department of Energy (DOE) is providing financial assistance, including funding under the American Recovery and Reinvestment Act (ARRA) of 2009, to industry to demonstrate the commercial viability of technologies that will capture CO

346

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Simulation of CO Simulation of CO 2 Leakage and Caprock Remediation Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the environment, and can provide the basis for establishing carbon credit trading markets

347

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Pressure Membrane Contactors for Pressure Membrane Contactors for CO 2 Capture Background The mission of the U.S. Department of Energy/National Energy Technology Laboratory (DOE/NETL) Carbon Capture Research & Development (R&D) Program is to develop innovative environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. The Carbon Capture R&D Program portfolio of carbon dioxide (CO 2 ) emissions control technologies and CO 2 compression is focused on advancing technological options for new and existing coal- fired power plants in the event of carbon constraints. Post-combustion separation and capture of CO

348

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Shizhong Yang Shizhong Yang Principal Investigator Department of computer science/LoNI southern University and a&M college Baton rouge, Louisiana 70813 225-771-2060 shizhong_yang@subr.edu PROJECT DURATION Start Date End Date 06/01/2012 05/31/2015 COST Total Project Value $200,000 DOE/Non-DOE Share $200,000 / $0 Novel Nano-Size Oxide Dispersion Strengthened Steels Development through Computational and Experimental Study Background Ferritic oxide dispersion strengthened (oDs) steel alloys show promise for use at higher temperatures than conventional alloys due to their high-temperature oxidation resistance and dislocation creep properties. the development of oDs alloys with nanoscale powders of transition metal oxides (yttrium and chromium) dispersed in

349

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Clean Coal Power Initiative (CCPI 3) Clean Coal Power Initiative (CCPI 3) NRG Energy: W.A. Parish Post-Combustion CO2 Capture and Sequestration Project Background Additional development and demonstration is needed to improve the cost and efficiency of carbon management technologies that capture and store carbon dioxide (CO 2 ) that would otherwise be emitted from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. The U.S. Department of Energy (DOE) is providing financial assistance through the Clean Coal Power Initiative (CCPI) Round 3, which includes funding from the American Recovery and Reinvestment Act (ARRA), to demonstrate the commercial viability

350

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Radiocarbon as a Reactive Tracer for Radiocarbon as a Reactive Tracer for Tracking Permanent CO2 Storage in Basaltic Rocks Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

351

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Degradation of TBC Systems in Degradation of TBC Systems in Environments Relevant to Advanced Gas Turbines for IGCC Systems- University of Pittsburgh Background The conditions inside integrated gasification combined cycle (IGCC) systems, such as high steam levels from hydrogen firing, high carbon dioxide steam mixtures in oxy- fired systems, and different types of contaminants, introduce complexities associated with thermal barrier coating (TBC) durability that are currently unresolved. In this work the University of Pittsburgh will team with Praxair Surface Technologies (PST) to deter- mine the degradation mechanisms of current state-of-the-art TBCs in environments consisting of deposits and gas mixtures that are representative of gas turbines using coal-derived synthesis gas (syngas).

352

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Cost Alloys for High-Temperature Low-Cost Alloys for High-Temperature SOFC Systems Components - QuesTek Innovations Background One of the key opportunities for cost reduction in a solid oxide fuel cell (SOFC) system is the set of balance of plant (BOP) components supporting the fuel cell itself, including the heat exchanger and air/fuel piping. These represent about half of the overall cost of the system. A major enabling technological breakthrough is to replace incumbent nickel-based superalloys in high-temperature BOP components with low-cost ferritic stainless steel. However, the ferritic alloys are unsuitable for SOFC application without additional coatings due to the inherent volatile nature of the alloy's chromium oxide (Cr2O3) element, which tends to poison the fuel cell's cathode

353

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Southwestern United States Carbon Southwestern United States Carbon Sequestration Training Center Background Carbon capture, utilization, and storage (CCUS) technologies offer great potential for mitigating carbon dioxide (CO2) emissions emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will require a drastically expanded workforce trained in CCUS related disciplines, including geologists, engineers, scientists, and technicians. Training to enhance the existing CCUS workforce and to develop new professionals can be accomplished through focused educational initiatives in the CCUS technology area. Key educational topics include simulation and risk assessment; monitoring, verification,

354

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Beneficial Use of CO2 in Precast Beneficial Use of CO2 in Precast Concrete Products Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways

355

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Barrier Coatings for Thermal Barrier Coatings for Operation in High Hydrogen Content Fueled Gas Turbines-Stony Brook University Background Traditional thermal barrier coatings (TBCs) based on yttria-stabilized zirconia (YSZ) will likely not be suitable in gas turbines used in integrated gasification combined cycle (IGCC) power plants. This is due to higher operating temperatures that will not only affect phase stability and sintering but will accelerate corrosive degradation phenomena. Coatings provide a framework to combat degradation issues and provide performance improvements needed for higher temperature environments. The Center for Thermal Spray Research (CTSR) at Stony Brook University, in partnership with its industrial Consortium for Thermal Spray Technology, is investigating science and

356

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Cooling for IGCC Turbine Cooling for IGCC Turbine Blades-Mikro Systems Background Turbine blade and vane survivability at higher operating temperatures is the key to improving turbine engine performance for integrated gasification combined cycle (IGCC) power plants. Innovative cooling approaches are a critical enabling technology to meet this need. Mikro Systems, Inc. is applying their patented Tomo-Lithographic Molding (TOMO) manufacturing technology to produce turbine blades with significantly improved internal cooling geometries that go beyond the current manufacturing state-of-the-art to enable higher operating temperatures. This project addresses two important aspects. First is the need to increase the quality and reliability of the core manufacturing process capability to

357

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combustion Dynamics in Multi-Nozzle Combustion Dynamics in Multi-Nozzle Combustors Operating on High- Hydrogen Fuels-Pennsylvania State University Background Combustion dynamics is a major technical challenge to the development of efficient, low emission gas turbines. Current information is limited to single-nozzle combustors operating on natural gas and neglects combustors with configurations expected to meet operability requirements using a range of gaseous fuels such as coal derived synthesis gas (syngas). In this project, Pennsylvania State University (Penn State) in collaboration with Georgia Institute of Technology (Georgia Tech) will use multiple-nozzle research facilities to recreate flow conditions in an actual gas turbine to study complicated interactions between flames that can aggravate the combustion dynamics in syngas-

358

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Summit Texas Clean Energy, LLC: Texas Summit Texas Clean Energy, LLC: Texas Clean Energy Project: Pre-Combustion CO 2 Capture and Sequestration Background A need exists to further develop carbon management technologies that capture and store, or beneficially reuse, carbon dioxide (CO 2 ) that would otherwise be emitted into the atmosphere from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer the potential to significantly reduce CO 2 emissions and mitigate the anthropogenic contribution to global climate change, while substantially reducing or minimizing the economic impacts of the solution. Under Round 3 of the Clean Coal Power Initiative (CCPI), the U.S. Department of Energy (DOE) is providing up to $450 million in co-funded financial assistance to industry,

359

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Solar-Based Catalytic Efficiency Solar-Based Catalytic Structure for CO2 Reforming Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways

360

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE-WRI Cooperative Research and DOE-WRI Cooperative Research and Development Program for Fossil Energy- Related Resources Background Our nation's demand for cleaner and more efficient fossil energy production will increase during the coming decades, necessitating the development of new energy technologies to achieve energy independence in an environmentally responsible manner. The University of Wyoming (UW) Research Corporation's Western Research Institute (WRI) has been supporting the U.S. Department of Energy (DOE) Office of Fossil Energy (FE) and its mission of developing fossil energy and related environmental technologies for over two decades. Federal funding for these research efforts has usually been provided through congressionally mandated cooperative agreements, with cost share

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Unconventional Resources Unconventional Resources Background Natural gas and crude oil provide two-thirds of our Nation's primary energy supply and will continue to do so for at least the next several decades, as the Nation transitions to a more sustainable energy future. The natural gas resource estimated to exist within the United States has expanded significantly, but because this resource is increasingly harder to locate and produce, new technologies are required to extract it. Under the Energy Policy Act of 2005, the National Energy Technology Laboratory is charged with developing a complementary research program supportive of improving safety and minimizing the environmental impacts of activities related to unconventional natural gas and other petroleum resource exploration and production technology

362

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Staged, High-Pressure Oxy-Combustion Staged, High-Pressure Oxy-Combustion Technology: Development and Scale-up Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available CO2 capture and storage significantly reduces efficiency of the power cycle. The aim of the ACS program is to develop advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while maintaining near zero emissions of other flue gas pollutants.

363

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cells Operating on Solid Oxide Fuel Cells Operating on Alternative and Renewable Fuels- Pennsylvania State University Background In this congressionally directed project, the Earth and Mineral Science (EMS) Energy Institute at Pennsylvania State University (PSU) focuses on the development of fuel processors, reforming catalysts, and chemical sorbents to support the production of electricity from anaerobic digester gas (ADG) and ultra-low sulfur diesel (ULSD) via solid-oxide fuel cells (SOFCs). PSU will use the fuel processors, reforming catalysts, and chemical sorbents developed under this work to transform and clean ADG and ULSD into a syngas stream suitable as a feedstock for SOFCs. This project is managed by the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL), whose mission is to advance energy options to fuel

364

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cell Cathode Enhancement Solid Oxide Fuel Cell Cathode Enhancement Through a Vacuum-assisted Infiltration- Materials and Systems Research, Inc. Background Solid oxide fuel cell (SOFC) technology promises to provide an efficient method to generate electricity from coal-derived synthesis gas (syngas), biofuels, and natural gas. The typical SOFC composite cathode (current source) possesses excellent performance characteristics but is subject to chemical stability issues at elevated temperatures both during manufacturing and power generation. Costs attributed to the cathode and its long-term stability issues are a current limitation of SOFC technologies. These must be addressed before commercial SOFC power generation can be realized. Materials and Systems Research, Inc. (MSRI) will develop a vacuum-assisted infiltration

365

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Study of the Durability of Doped Study of the Durability of Doped Lanthanum Manganite and Cobaltite Based Cathode Materials under "Real World" Air Exposure Atmospheres- University of Connecticut Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO

366

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Comprehensive Comprehensive Monitoring Techniques to Verify the Integrity of Geological Storage Reservoirs Containing Carbon Dioxide Background Research aimed at monitoring the long-term storage stability and integrity of carbon dioxide (CO2) stored in geologic formations is one of the most pressing areas of need if geological storage is to become a significant factor in meeting the United States' stated objectives to reduce greenhouse gas emissions. The most promising geologic formations under consideration for CO2 storage are active and depleted oil and gas formations, brine formations, and deep, unmineable coal seams. Unfortunately, the long-term CO2 storage capabilities of these formations are not yet well understood. Primary Project Goal The goal of this effort is to develop

367

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

SO SO 2 -Resistent Immobilized Amine Sorbents for CO 2 Capture Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who

368

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies for Monitoring Technologies for Monitoring CO 2 Saturation and Pore Pressure in Geologic Formations: Linking the Chemical and Physical Effects to Elastic and Transport Properties Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic

369

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Monitoring and Numerical Modeling of Monitoring and Numerical Modeling of Shallow CO 2 Injection, Greene County, Missouri Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO 2 ). Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess the

370

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Tagging Carbon Dioxide to Enable Tagging Carbon Dioxide to Enable Quantitative Inventories of Geological Carbon Storage Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both

371

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Nanoporous, Metal Carbide, Surface Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations Background Both coal and biomass are readily available in the U.S. and can be thermally processed to produce hydrogen and/or power. The produced hydrogen can be sent directly to a fuel cell or hydrogen turbines for efficient and environmentally clean power generation. More efficient hydrogen production processes need to be developed before coal and biomass can become economically viable sources of hydrogen. To meet this need, the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is partnering with the Colorado School of Mines and Pall Corporation to develop nanoporous metal carbide surface diffusion membranes for use in high temperature

372

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigation on Flame Characteristics Investigation on Flame Characteristics and Burner Operability Issues of Oxy-Fuel Combustion Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently underrepresented in the United States. Education and training activities

373

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Object Optimization Approaches Object Optimization Approaches for the Design of Carbon Geological Sequestration Systems Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO 2 ). Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess

374

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Sensors and Control Sensors and Control CONTACTS Ben Chorpening Sensors & Controls Technical Team Coordinator 304-285-4673 benjamin.chorpening@netl.doe.gov Steven Woodruff Principal Investigator 304-285-4175 steven.woodruff@netl.doe.gov Michael Buric Co-Principal Investigator 304-285-2052 michael.buric@netl.doe.gov Raman Gas Composition Sensor System for Natural Gas and Syngas Applications Goal The goal of this project is to develop and test a Raman laser spectroscopy system for responsive gas composition monitoring, and to transfer the technology to industry for commercial implementation. The instrument provides state-of-the-art improvement of reduced size and increased sensitivity and sample rate to facilitate the process control

375

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Joining of Advanced Joining of Advanced High-Temperature Materials Background To remain economically competitive, the coal-fired power generation industry needs to increase system efficiency, improve component and system reliability, and meet ever tightening environmental standards. In particular, cost-effective improvements in thermal efficiency are particularly attractive because they offer two potential benefits: (1) lower variable operating cost via increased fuel utilization (fuel costs represent over 70 percent of the variable operating cost of a fossil fuel-fired power plant) and (2) an economical means of reducing carbon dioxide (CO2) and other emissions. To achieve meaningful gains, steam pressure and temperature must be increased to

376

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Basin-Scale Leakage Risks from Geologic Basin-Scale Leakage Risks from Geologic Carbon Sequestration: Impact on Carbon Capture and Storage Energy Market Competitiveness Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the

377

Jointly sponsored by the WV Geriatric Education Center and CAMC Health Education and Research Institute  

E-Print Network (OSTI)

! Light refreshments will be provided! FOR QUESTIONS AND TO PRE-REGISTER, PLEASE CALL HANNA AT 347 in accordance with the essentials and standards of the Accreditation Council for Continuing Medical Education continuing medical education for physicians. DISCLOSURE It is the policy of the CAMC Health Education

Mohaghegh, Shahab

378

A Windows based project management application for NASA WV Space Grant Consortium using SQL server.  

E-Print Network (OSTI)

??The NASA West Virginia Space Grant Consortium (WVSGC) is a group of West Virginia academic institutions, with industrial partners, which have joined together under the (more)

Bogum, Naveen K.

2010-01-01T23:59:59.000Z

379

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Surface-Modified Electrodes: Enhancing Surface-Modified Electrodes: Enhancing Performance Guided by In-Situ Spectroscopy and Microscopy- Stanford University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by mass and

380

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Eddy Simulation Modeling of Large Eddy Simulation Modeling of Flashback and Flame Stabilization in Hydrogen-Rich Gas Turbines using a Hierarchical Validation Approach- University of Texas at Austin Background The focus of this project is the development of advanced large eddy simulation (LES)-based combustion modeling tools that can be used to design low emissions combustors burning high hydrogen content fuels. The University of Texas at Austin (UT) will develop models for two key topics: (1) flame stabilization, lift- off, and blowout when fuel-containing jets are introduced into a crossflow at high pressure, and (2) flashback dynamics of lean premixed flames with detailed description of flame propagation in turbulent core and near-wall flows. The jet- in-crossflow (JICF) configuration is widely used for rapid mixing of reactants

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficient Efficient Regeneration of Physical and Chemical Solvents for CO 2 Capture Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who

382

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial Scale CO2 Injection and Commercial Scale CO2 Injection and Optimization of Storage Capacity in the Southeastern United States Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

383

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Turbine Thermal Management-NETL-RUA Turbine Thermal Management-NETL-RUA Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is researching advanced turbine technology with the goal of producing reliable, affordable, and environmentally friendly electric power in response to the nation's increasing energy challenges. With the Hydrogen Turbine Program, NETL is leading the research, development, and demonstration of technologies to achieve power production from high-hydrogen-content fuels derived from coal that is clean, efficient, and cost-effective, and minimizes carbon dioxide (CO 2 ) emissions, and will help maintain the nation's leadership in the export of gas turbine equipment. The NETL Regional University Alliance (RUA) is an applied research collaboration that

384

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scoping Studies to Evaluate the Benefits Scoping Studies to Evaluate the Benefits of an Advanced Dry Feed System on the Use of Low Rank Coal in Integrated Gasification Combined Cycle Background Gasification of coal or other solid feedstocks (biomass, petroleum coke, etc.) produces synthesis gas (syngas), which can be cleaned and used to produce electricity and a variety of commercial products that support the U.S. economy, decrease U.S. dependence on oil imports, and meet current and future environmental emission standards. The major challenge is cost, which needs to be reduced to make integrated gasification combined cycle (IGCC) technology competitive. An IGCC plant combines a combustion turbine operating on a gasified fuel stream--syngas--with a steam turbine to capture what would otherwise be waste heat. Currently, the estimated cost of power from IGCC is higher than

385

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reliability and Durability of Materials Reliability and Durability of Materials and Components for SOFCs - Oak Ridge National Laboratory Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) has a mission to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Oak Ridge National Laboratory's (ORNL) project was selected to acquire the fundamental

386

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

SOFC Protection Coatings Based on a SOFC Protection Coatings Based on a Cost-Effective Aluminization Process- NexTech Materials Background To make solid oxide fuel cell (SOFC) systems easier to manufacture and reduce costs, less expensive stainless steels have been substituted into the stack design as alternatives to ceramic interconnects. Stainless has also been substituted for high-cost, nickel-based superalloys in balance of plant (BOP) components. For successful implementation of these steels, protective coatings are necessary to protect the air-facing metal surfaces from high-temperature corrosion/oxidation and chromium (Cr) volatilization. NexTech Materials Ltd. (NexTech) will develop an aluminide diffusion coating as a low- cost alternative to conventional aluminization processes and evaluate the ability of the

387

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Patricia Rawls Patricia Rawls Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-5882 patricia.rawls@netl.doe.gov Sankaran Sundaresan Principal Investigator Princeton University Department of Chemical Engineering Princeton, NJ 08544 609-258-4583 sundar@princeton.edu PROJECT DURATION Start Date 10/01/2011 End Date 09/30/2014 COST Total Project Value $420,366 DOE/Non-DOE Share $300,000 / $120,366 Implementation and Refinement

388

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Methanol Economy Methanol Economy Background Fossil fuels such as coal, oil, and natural gas are composed of hydrocarbons with varying ratios of carbon and hydrogen. Consumption of hydrocarbons derived from fossil fuels is integral to modern day life in the U.S. Hydrocarbons are used as fuels and raw materials in the transportation sector and in many industrial production processes including chemicals, petrochemicals, plastics, pharmaceuticals, agrochemicals, and rubber.

389

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

390

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

391

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

392

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

393

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

394

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

395

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

396

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

397

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

398

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 - 7320 of 26,764 results. 11 - 7320 of 26,764 results. Download EA-1938: Finding of No Significant Impact Grieve Unit CO2 Enhanced Recovery Project, Natrona County, WY http://energy.gov/nepa/downloads/ea-1938-finding-no-significant-impact Download EIS-0312: Record of Decision (2012) Bonneville Power Administration Administrator's Record of Decision: Columbia Basin Fish Accords Memorandum of Agreement (MOA) with the Kalispel Tribe http://energy.gov/nepa/downloads/eis-0312-record-decision-2012 Download Reference Buildings by Climate Zone and Representative City: 4A Baltimore, Maryland In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP

399

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network (OSTI)

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

400

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network (OSTI)

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

402

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network (OSTI)

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

403

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

404

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network (OSTI)

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

405

,"Wyoming Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

3","N3050WY3","N3010WY3","N3020WY3","N3035WY3","NA1570SWY3","N3045WY3" "Date","Wyoming Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","Wyoming Natural Gas...

406

Data Driven Analytics in Powder River Basin, WY Mohammad Maysami, Razi Gaskari, Intelligent Solutions, Inc., Shahab D. Mohaghegh, Intelligent Solutions, Inc.  

E-Print Network (OSTI)

that adapt themselves to specific needs of individual users. There are many mobile and web-based services

Mohaghegh, Shahab

407

Microsoft PowerPoint - How To Do Business with DOE Charleston WV Nov 14 2011 BOS.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Office of Small and Disadvantaged Business Utilization (OSDBU) Office of Small and Disadvantaged Business Utilization (OSDBU) Presenter: Nickolas A. Demer Senior Procurement Analyst Business Opportunities Session Charleston, West Virginia November 14, 2011 EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE Manhattan Project - August 1941 - Development of nuclear energy warheads Atomic Energy Act of 1946 - Established the Atomic Energy Commission (AEC) - Established the Atomic Energy Commission (AEC) - Civilian control of atomic energy weapons Atomic Energy Act of 1954 - Empowered AEC to also regulate commercial nuclear power industry 2 EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE Energy Reorganization Act of 1974 - Established Energy Research and Development Administration (ERDA) to manage R&D for nuclear

408

Feasibility study of wood-fired cogeneration at a Wood Products Industrial Park, Belington, WV. Phase II  

SciTech Connect

Customarily, electricity is generated in a utility power plant while thermal energy is generated in a heating/cooling plant; the electricity produced at the power plant is transmitted to the heating/cooling plant to power equipments. These two separate systems waste vast amounts of heat and result in individual efficiencies of about 35%. Cogeneration is the sequential production of power (electrical or mechanical) and thermal energy (process steam, hot/chilled water) from a single power source; the reject heat of one process issued as input into the subsequent process. Cogeneration increases the efficiency of these stand-alone systems by producing these two products sequentially at one location using a small additional amount of fuel, rendering the system efficiency greater than 70%. This report discusses cogeneration technologies as applied to wood fuel fired system.

Vasenda, S.K.; Hassler, C.C.

1992-06-01T23:59:59.000Z

409

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

410

Department of Energy Business Opportunity Session  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pafe Pafe Title: Deputy Director, Office of Budget and Financial Management Office: Office of Fossil Energy E-Mail: Robert.Pafe@hq.doe.gov Phone: 202-586-4026 Website: http://fe.doe.gov/ Office of Fossil Energy Department of Energy's Business Opportunity Session Fossil Energy Locations DOE Headquarters Washington, DC and Germantown, M.D. National Energy Technology Laboratory Pittsburgh, PA; Morgantown, WV; Tulsa, OK;Albany, OR; and Fairbanks, AK Strategic Petroleum Reserve New Orleans, LA Rocky Mountain Oilfield Testing Center Casper, WY Department of Energy's Business Opportunity Session Fossil Energy Services Offered * Facility Management * Construction * R&D * Management/Scientific Consulting * Administrative Services * IT & Data Processing * Security * Engineering * Waste Treatment & Disposal

411

Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects

412

Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012

413

Book2  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Activity Code Additional Activity Code Description of Activity Competed Type of Competition Location (State) # of FTE in study Source Selection Strategy Used (If Known) Incremental Costs of Conducting Studies Anticipated Savings or Quantifiable Description of Improvements in Service or Performance (if available) DOE D200 Data Collection and Analysis D704 Program Monitoring and Evaluation D707 Program Evaluation Albany Research Center Standard competition conducted under a deviation OR 72 cost-technical trade-off 0.000 72 0.000 72 0.000 DOE E120 Environmental and Natural Resource Services Environmental Engineering Services Competition was cancelled (N/A-C) MD,DC,NM,IL, CO,ID,PA,WV, CA,WY,NV,TN, WA,LA,SC 684 cost-technical trade-off 0.664 Competition Description STREAMLINED COMPETITIONS

414

Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

415

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

416

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

417

Wyoming Oil and Gas Conservation Commission | Open Energy Information  

Open Energy Info (EERE)

Wyoming Oil and Gas Conservation Commission Wyoming Oil and Gas Conservation Commission Jump to: navigation, search State Wyoming Name Wyoming Oil and Gas Conservation Commission Address 2211 King Blvd City, State Casper, Wyoming Zip 82602 Website http://wogcc.state.wy.us/ Coordinates 42.8433001°, -106.3511243° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.8433001,"lon":-106.3511243,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

418

--No Title--  

U.S. Energy Information Administration (EIA) Indexed Site

| IV | | | | | Year || | | | | Month | | | | | | | | | AK | | | Federal | | | North | AK | | Offshore | | Average | Slope | Other | CA |California | WY | | | | |...

419

A Review of the 2003 Water Year in Colorado  

E-Print Network (OSTI)

Gillespie Snow Survey Division, USDA, NRCS Prepared by Odie Bliss http://ccc.atmos.colostate.edu http Precipitation #12;28 Fort Collins Daily AccumulatedFort Collins Daily Accumulated Precipitation for WY2002 and WY2003Precipitation for WY2002 and WY2003 Fort Collins Daily Accumulated Precipitation 0 5 10 15 20

420

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network (OSTI)

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

422

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

423

Abstract LB-297: Mortality trends from lung and bronchus cancer in Boone County, W.V., USA before and after mountaintop removal mining practices  

Science Journals Connector (OSTI)

...county or sub-county-wide health in West Virginia is difficult to assess due to...villages are arranged in a narrow, winding valley or lying between mountain peaks and situated...estimates suggest greater than 30 percent of West Virginias coal is produced using this technique...

Lynn M. Crosby; Christina DeVera; Kaylene Charles; and William Orem

2014-10-01T23:59:59.000Z

424

The luxury second home market : an analysis of historical sales and property data at The Greenbrier Resort (White Sulphur Springs, WV)  

E-Print Network (OSTI)

The global economic expansion and subsequent creation of wealth as well as increased purchasing power and disposable income has contributed to the growth in the secondary home market. Over the past decade developers that ...

Kass, Hunter L. (Hunter Lindsay)

2011-01-01T23:59:59.000Z

425

_____________________ Diana Knott Martinelli, Ph.D. ___________________ P.I. Reed School of Journalism, 206 Martin Hall, Morgantown, WV 26506-6010  

E-Print Network (OSTI)

previous year's work): best student-run PR firm; best Web site; student Adrienne Gavula awarded President

Mohaghegh, Shahab

426

_____________________ Diana Knott Martinelli, Ph.D. ___________________ P.I. Reed School of Journalism, 206 Martin Hall, Morgantown, WV 26506-6010  

E-Print Network (OSTI)

student-run PR firm; best Web site; student Adrienne Gavula awarded President's Citation Awarded in 2003

Mohaghegh, Shahab

427

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network (OSTI)

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

428

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network (OSTI)

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

429

West Virginia University 1 Governance and Administration  

E-Print Network (OSTI)

-Officio, State Superintendent of Schools, Charleston, WV · David R. Tyson, Huntington, WV West Virginia, Faculty Representative, Morgantown, WV · Raymond J. Lane, Menlo Park, CA · Diane Lewis, Morgantown, WV · Andrew A. Payne III, Charleston, WV · Edward L. Robinson, Charleston, WV · J. Robert Rogers, Hurricane

Mohaghegh, Shahab

430

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","12312014" ,"Excel File Name:","n9010wy2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9010wy2a.htm" ,"Source:","Energy Information...

431

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","12312014" ,"Excel File Name:","n9010wy2m.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9010wy2m.htm" ,"Source:","Energy Information...

432

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","2272015" ,"Excel File Name:","n3010wy3m.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn3010wy3m.htm" ,"Source:","Energy Information...

433

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","2272015" ,"Excel File Name:","n3010wy2m.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn3010wy2m.htm" ,"Source:","Energy Information...

434

app_d  

NLE Websites -- All DOE Office Websites (Extended Search)

Appendix D Document 10, Jeffrey Joel, Kelly, WY Page 1 of 1 Document 11, Avril Currier, Jackson, WY Page 1 of 2 - New Information - D-19 DOEEIS-0287 Idaho HLW & FD EIS Document...

435

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","10312014" ,"Excel File Name:","n9050wy2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050wy2a.htm" ,"Source:","Energy Information...

436

EIS-0432: Medicine Bow Fuel & Power Coal-to-Liquid Facility in...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2: Medicine Bow Fuel & Power Coal-to-Liquid Facility in Carbon County, WY EIS-0432: Medicine Bow Fuel & Power Coal-to-Liquid Facility in Carbon County, WY Documents Available for...

437

app_d  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Appendix D Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY Page 24 of 54 Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY Page 25 of 54 - New Information - D-69 DOE/EIS-0287 Idaho HLW & FD EIS Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY Page 26 of 54 Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY Page 27 of 54 - New Information - DOE/EIS-0287 D-70 Appendix D Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY Page 28 of 54 Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY Page 29 of 54 - New Information - D-71 DOE/EIS-0287 Idaho HLW & FD EIS Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY Page 30 of 54 Document 36, Public Comment Hearing, February 9, 2000, Jackson, WY

438

1st Rangeland Research Symposium 1/19/2012 http://rangelandwatersheds.ucdavis.edu 1  

E-Print Network (OSTI)

CA survey ­ Lubell presentation on key findings WY survey ­ Just sent out Both will have on- ranch

Tate, Kenneth

439

SALINITY AND TEMPERATURE IN SOUTH SAN FRANCISCO BAY, CALIFORNIA, AT DUMBARTON BRIDGE  

E-Print Network (OSTI)

-mean-square) Tide (height) at Dumbarton Bridge and the Golden Gate Bridge during 2000WYSALINITY AND TEMPERATURE IN SOUTH SAN FRANCISCO BAY, CALIFORNIA, AT DUMBARTON BRIDGE: RESULTS FROM . . . . . . . . . . . . . . . . . . . 25 Fig. 10. Time-series plots of daily mean salinity at Dumbarton Bridge for 1990WY-1993WY, 1994WY

440

AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

442

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013

443

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value

444

DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

445

Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product

446

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)

447

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423

448

Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8

449

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming

450

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848

451

Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006

452

Coal surface control for advanced physical fine coal cleaning technologies. Final report, September 19, 1988--August 31, 1992  

SciTech Connect

This final report presents the research work carried out on the Coal Surface Control for Advanced Physical Fine Coal Cleaning Technologies project, sponsored by the US Department of Energy, Pittsburgh Energy Technology Center (DOE/PETC). The project was to support the engineering development of the selective agglomeration technology in order to reduce the sulfur content of US coals for controlling SO{sub 2} emissions (i.e., acid rain precursors). The overall effort was a part of the DOE/PETCs Acid Rain Control Initiative (ARCI). The overall objective of the project is to develop techniques for coal surface control prior to the advanced physical fine coal cleaning process of selective agglomeration in order to achieve 85% pyrite sulfur rejection at an energy recovery greater than 85% based on run-of-mine coal. The surface control is meant to encompass surface modification during grinding and laboratory beneficiation testing. The project includes the following tasks: Project planning; methods for analysis of samples; development of standard beneficiation test; grinding studies; modification of particle surface; and exploratory R&D and support. The coal samples used in this project include three base coals, Upper Freeport - Indiana County, PA, Pittsburgh NO. 8 - Belmont County, OH, and Illinois No. 6 - Randolph County, IL, and three additional coals, Upper Freeport - Grant County- WV, Kentucky No. 9 Hopkins County, KY, and Wyodak - Campbell County, WY. A total of 149 drums of coal were received.

Morsi, B.I.; Chiang, S.H.; Sharkey, A.; Blachere, J.; Klinzing, G.; Araujo, G.; Cheng, Y.S.; Gray, R.; Streeter, R.; Bi, H.; Campbell, P.; Chiarlli, P.; Ciocco, M.; Hittle, L.; Kim, S.; Kim, Y.; Perez, L.; Venkatadri, R.

1992-12-31T23:59:59.000Z

453

Coal surface control for advanced physical fine coal cleaning technologies  

SciTech Connect

This final report presents the research work carried out on the Coal Surface Control for Advanced Physical Fine Coal Cleaning Technologies project, sponsored by the US Department of Energy, Pittsburgh Energy Technology Center (DOE/PETC). The project was to support the engineering development of the selective agglomeration technology in order to reduce the sulfur content of US coals for controlling SO[sub 2] emissions (i.e., acid rain precursors). The overall effort was a part of the DOE/PETCs Acid Rain Control Initiative (ARCI). The overall objective of the project is to develop techniques for coal surface control prior to the advanced physical fine coal cleaning process of selective agglomeration in order to achieve 85% pyrite sulfur rejection at an energy recovery greater than 85% based on run-of-mine coal. The surface control is meant to encompass surface modification during grinding and laboratory beneficiation testing. The project includes the following tasks: Project planning; methods for analysis of samples; development of standard beneficiation test; grinding studies; modification of particle surface; and exploratory R D and support. The coal samples used in this project include three base coals, Upper Freeport - Indiana County, PA, Pittsburgh NO. 8 - Belmont County, OH, and Illinois No. 6 - Randolph County, IL, and three additional coals, Upper Freeport - Grant County- WV, Kentucky No. 9 Hopkins County, KY, and Wyodak - Campbell County, WY. A total of 149 drums of coal were received.

Morsi, B.I.; Chiang, S.H.; Sharkey, A.; Blachere, J.; Klinzing, G.; Araujo, G.; Cheng, Y.S.; Gray, R.; Streeter, R.; Bi, H.; Campbell, P.; Chiarlli, P.; Ciocco, M.; Hittle, L.; Kim, S.; Kim, Y.; Perez, L.; Venkatadri, R.

1992-01-01T23:59:59.000Z

454

Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC

455

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity

456

West Virginia Office of Oil and Gas | Open Energy Information  

Open Energy Info (EERE)

Virginia Office of Oil and Gas Virginia Office of Oil and Gas Jump to: navigation, search State West Virginia Name West Virginia Office of Oil and Gas Address 601 57th Street, SE City, State Charleston, West Virginia Zip 25304-2345 Website http://www.dep.wv.gov/oil-and- Coordinates 38.31256°, -81.570616° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.31256,"lon":-81.570616,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

457

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network (OSTI)

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

458

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

459

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

460

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

462

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

463

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network (OSTI)

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

464

,"West Virginia Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

3050WV3","N3010WV3","N3020WV3","N3035WV3","NA1570SWV3","N3045WV3" "Date","West Virginia Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","West Virginia Natural Gas...

465

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network (OSTI)

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

466

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network (OSTI)

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

467

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network (OSTI)

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

468

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"

469

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

470

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly

471

Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

472

Platte River Cooperative Agreement  

NLE Websites -- All DOE Office Websites (Extended Search)

Platte River Cooperative Agreement Skip Navigation Links Transmission Functions Infrastructure projects Interconnection OASIS OATT Platte River Cooperative Agreement PEIS, NE, WY,...

473

E-Print Network 3.0 - artillery charge system Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Training Ranges Camp Guernsey, WY Artillery Range Yakima Training Center, WA... Ranges CFB Valcartier, Quebec Training Ranges Jefferson Proving Ground, IN Artillery Range Fort...

474

Other Participants 2000 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

, Richland , WA Huron High School , Huron, SD Idaho Falls High School , Idaho Falls, ID Kelly Walsh High School , Casper , WY Kirtland Central High School , Kirtland , NM Lake...

475

Other Participants 2001 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Ignacio, CO Iolani High School , Honolulu , HI J. I. Case High School , Racine , WI Kelly Walsh High School , Casper , WY Lake Brantley High School , Altamonte Springs , FL...

476

International Symposium on Site Characterization for CO2 Geological Storage  

E-Print Network (OSTI)

INJECTION FEASIBILITY: TEAPOT DOME EOR PILOT L. Chiaramonte,of an engineered leak at the Teapot Dome field experimentalleakage experiment at Teapot Dome, WY, NETL 3rd Annual

Tsang, Chin-Fu

2006-01-01T23:59:59.000Z

477

Quadrennial Energy Review Stakeholder Meeting #11: Cheyenne,...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Presentations and Comments At the Quadrennial Energy Review Stakeholder Meeting 11: Cheyenne, WY Infrastructure Siting August 21, 2014 Opening Remarks Dr. Karen Wayland, Deputy...

478

Resource dispersion and consumer dominance: scavenging at wolf- and hunter-killed carcasses in Greater Yellowstone, USA  

E-Print Network (OSTI)

in Greater Yellowstone, USA Abstract The Greater Yellowstoneof California, Berkeley, CA, USA Yellowstone Center forYellowstone National Park, WY, USA Yellowstone Ecological

Wilmers, C C; Stahler, D R; Crabtree, R L; Smith, D W; Getz, Wayne M

2003-01-01T23:59:59.000Z

479

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

480

"Your past is at the core of creating WVU's future" Graduate Emeritus  

E-Print Network (OSTI)

-4269 GraduatE EmEritus rEunion Schedule of Events saturday, JunE 8 (Continued) 3-5 p.m. | Concurrent Sessions-to- date information, please visit emeritus.wvu.edu for additional details. rEGistration The cost Morgantown, WV C.E. "Buck" Byron Beckley, WV Thomas "Tom" Covey Morgantown, WV Tara Curtis Morgantown, WV J

Mohaghegh, Shahab

Note: This page contains sample records for the topic "wv wy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Wind Energy Resource Atlas of Armenia (CD-ROM)  

NLE Websites -- All DOE Office Websites (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...

482

Boise State University Human Resource Services Employee Information Form  

E-Print Network (OSTI)

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

483

NATURAL GAS STORAGE ENGINEERING Kashy Aminian  

E-Print Network (OSTI)

NATURAL GAS STORAGE ENGINEERING Kashy Aminian Petroleum & Natural Gas Engineering, West Virginia University, Morgantown, WV, USA. Shahab D. Mohaghegh Petroleum & Natural Gas Engineering, West Virginia University, Morgantown, WV, USA. Keywords: Gas Storage, Natural Gas, Storage, Deliverability, Inventory

Mohaghegh, Shahab

484

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","2272015" ,"Excel File Name:","n3010wv3m.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn3010wv3m.htm" ,"Source:","Energy Information...

485

Abstract 276: Appalachian mountaintop mining particulate matter induces malignant transformation and tumorigenesis of human lung epithelial cells  

Science Journals Connector (OSTI)

...276: Appalachian mountaintop mining particulate matter induces malignant...Virginia (WV), the biggest coal mining state in Appalachia, ranks the third highest rate...that living near WV mountaintop coal mining (MTM) activities is a contributing...

Sudjit Luanpitpong; Juhua Luo; Travis Kneuckles; Michael Hendryx; and Yon Rojanasakul

2014-10-01T23:59:59.000Z

486

Existing Commercial Reference Buildings Constructed Before 1980 - Archive  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Existing Commercial Reference Buildings Constructed Before 1980 - Existing Commercial Reference Buildings Constructed Before 1980 - Archive Existing Commercial Reference Buildings Constructed Before 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB) Full service restaurant

487

Existing Commercial Reference Buildings Constructed In or After 1980 -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Existing Commercial Reference Buildings Constructed In or After Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB)

488

U.S. Department of Energy Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WY-TRIBE-EASTERN SHOSHONE TRIBE OF THE WIND RIVER INDIAN WY-TRIBE-EASTERN SHOSHONE TRIBE OF THE WIND RIVER INDIAN RESERVATION Location: Tribe WY-TRIBE- EASTERN SHOSHONE TRIBE OF THE WIND RIVER INDIAN RESERVATION WY American Recovery and Reinvestment Act: Proposed Action or Project Description The Shoshone Tribe of Wind River Indian Reservation in Wyoming proposes to develop, implement, and install on the Shoshone Tribe Youth Center Building (a newly constructed building) an onsite renewable solar energy technology that generates electricity as a renewable resource to reduce energy consumption and is environmentally sustainable. The solar photovoltaic system proposed would be approximately 14 kW in size and would be roof mounted on the Shoshone Tribe Youth Center Building. Conditions: None Categorical Exclusion(s) Applied: B3.6, B5.1

489

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WRI FE DE-FC26-08NT43293 Task 19-S2 Gasification Division 2010 Ronald. Breault July 1, 2009 to Dec 31, 2011 Laramie, WY A NOVEL INTEGRATED OXY-COMBUSTION FLUE GAS PURIFICATION...

490

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Research Institute (WRI) FE DE-FC26-08NT43293, Task 22-N1 Gasification Division 2011 Arthur L. Baldwin 01 September 2011- 31 August 2012 Laramie, WY Conversion of Low-Rank...

491

NIDIS Weekly Climate, Water and Drought Assessment Summary  

E-Print Network (OSTI)

of March. Sweetwater County, WY, western CO and the Colorado River valleyNIDIS Weekly Climate, Water and Drought Assessment Summary Upper Colorado Colorado River Basin (UCRB) received below average precipitaQon (Fig. 1). Some

492

NIDIS Weekly Climate, Water and Drought Assessment Summary  

E-Print Network (OSTI)

of March. Sweetwater County, WY, western CO and the Colorado River valleyNIDIS Weekly Climate, Water and Drought Assessment Summary Upper Colorado Colorado River Basin (UCRB) received below average precipitaPon (Fig. 1). Some

493

NEPA Determination: LM-08-12 Amendment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8-12 Amendment NEPA Determination: LM-08-12 Amendment Grazing Agreement Amendment, Acid Pond, Spook, Wyoming CX(s) Applied: B1.24 Date: 09122012 Location(s): Spook, WY...

494

1  

NLE Websites -- All DOE Office Websites (Extended Search)

Zhang, MH, WY Lin,SA Klein, JT Bacmeister, S Bony, RT Cederwall, AD Del Genio, JJ Hack, NG Loeb, U Lohmann, P Minnis, I Musat, R Pincus, P Stier, MJ Suarez, MJ Webb, JB Wu,...

495

SEE ADDENDUM IS CHECKED CODE 18a. PAYMENT WILL BE MADE BY CODE  

NLE Websites -- All DOE Office Websites (Extended Search)

SEE ADDENDUM IS CHECKED CODE 18a. PAYMENT WILL BE MADE BY CODE FACILITY CODE 17b. CHECK IF REMITTANCE IS DIFFERENT AND PUT SUCH ADDRESS IN OFFER OFFEROR 00146 Casper WY 82601 Shale...

496

Microsoft Word - Funds-In Sample.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

payable to the Department of Energy to: U.S. Department of Energy Naval Petroleum and Oil Shale Reserves-CUW (NPR-3) 907 North Poplar, Suite 150 Casper, WY 82601 6. NPRRMOTC, DOE...

497

Microsoft Word - ORPS Facility Registration Form 20070109.doc  

Office of Environmental Management (EM)

Y-12 Site NO New Orleans Site YUCCA Yucca Mountain Project Office NPOSRCUW Naval Pet. Oil Shale Res. - CO,UT,WY Attachment 2 LIST OF ORGANIZATIONAL NAMES AND CODES (cont'd)...

498

International Symposium on Site Characterization for CO2 Geological Storage  

E-Print Network (OSTI)

experiment at Teapot Dome, WY, NETL 3rd Annual Carbon Se-CAPTURE AND SEQUESTRATION DOE/NETL, 2005. Span, R. and W.Canada Grant Bromhal, NETL Mike Celia, Princeton University

Tsang, Chin-Fu

2006-01-01T23:59:59.000Z

499

untitled  

U.S. Energy Information Administration (EIA) Indexed Site

- Continued Year Month PAD District IV PAD District V Average CO MT UT WY Average AK North Slope AK Other CA Federal Offshore California 1978 ... 9.50 10.84...

500

untitled  

U.S. Energy Information Administration (EIA) Indexed Site

- Continued Year Month PAD District IV PAD District V Average CO MT UT WY Average AK North Slope AK Other CA Federal Offshore California 1983 ... 27.81 28.92...