Powered by Deep Web Technologies
Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

DISTRIBUTED FIBER OPTIC SENSOR FOR DISTRIBUTED FIBER OPTIC SENSOR FOR ON-LINE MONITORING OF COAL GASIFIER REFRACTORY HEALTH DE-FE0005703 Anbo Wang, Cheng Ma Virginia Tech Center for Photonics Technology Blacksburg, VA 24061 awang@vt.edu, cma1@vt.edu http://photonics.ece.vt.edu/ 1 Advanced Research Sensor and Controls Project Review Meeting DOE NETL Morgantown, WV 03/12/2012 Outline * Motivation, Overview & Objectives * Background and Fundamentals of Proposed Technology * Project Scope and Work Plan * Project Progress 2 MOTIVATION AND OBJECTIVES 3 Motivation * Refractory health monitoring in slagging coal gasifiers: * Rapid corrosion of refractory materials. * High-temperature reducing environment. * Difficult to predict remaining refractory life. * Localized thinning, spallation, cracking.


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

EMBEDDED ACTIVE FIBER OPTIC SENSING EMBEDDED ACTIVE FIBER OPTIC SENSING NETWORK FOR STRUCTURAL HEALTH MONITORING IN HARSH ENVIRONMENTS DE-FE0007405 Anbo Wang, Cheng Ma Virginia Tech Center for Photonics Technology Blacksburg, VA 24061 awang@vt.edu, cma1@vt.edu http://photonics.ece.vt.edu/ 1 Advanced Research Sensor and Controls Project Review Meeting DOE NETL Morgantown, WV 03/12/2012 Outline * Motivation, Overview & Objectives * Background and Fundamentals of Proposed Technology * Project Scope and Work Plan 2 MOTIVATION AND OBJECTIVES 3 Motivation * Non-Destructive Evaluation (NDE) of structural health in advanced energy systems. Examples: * Ultra Supercritical (USC) systems: * Steam temperature 760 o C, pressure 5000 psi. * Integrated Gasification Combined Cycle (IGCC):


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

SINGLE-CRYSTAL SAPPHIRE OPTICAL SINGLE-CRYSTAL SAPPHIRE OPTICAL FIBER SENSOR DE-FC26-99FT40685 Anbo Wang, Gary Pickrell, Ke Wang, Cheng Ma, Brian Scott Virginia Tech Center for Photonics Technology Blacksburg, VA 24061 awang@vt.edu http://photonics.ece.vt.edu/ 1 Advanced Research Sensor and Controls Project Review Meeting DOE NETL Morgantown, WV 03/12/2012 Outline * Motivation & Objective * Background and Fundamentals of Proposed Technology * Project Scope and Work Plan * Project Progress 2 MOTIVATION AND OBJECTIVE 3 Motivation 4 * Temperature sensor for harsh-environments: * Coal gasifier (major focus of prior work). * Gas turbine. * Temperature measurement is critical for: * Gasifier start-up. * Process optimization. * Event/failure detection.


Category:Elkins, WV | Open Energy Information  

Open Energy Info (EERE)

Elkins, WV Elkins, WV Jump to: navigation, search Go Back to PV Economics By Location Media in category "Elkins, WV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Elkins WV Harrison Rural Elec Assn Inc.png SVFullServiceRestauran... 59 KB SVQuickServiceRestaurant Elkins WV Harrison Rural Elec Assn Inc.png SVQuickServiceRestaura... 60 KB SVHospital Elkins WV Harrison Rural Elec Assn Inc.png SVHospital Elkins WV H... 57 KB SVLargeHotel Elkins WV Harrison Rural Elec Assn Inc.png SVLargeHotel Elkins WV... 57 KB SVLargeOffice Elkins WV Harrison Rural Elec Assn Inc.png SVLargeOffice Elkins W... 58 KB SVMediumOffice Elkins WV Harrison Rural Elec Assn Inc.png SVMediumOffice Elkins ... 59 KB SVMidriseApartment Elkins WV Harrison Rural Elec Assn Inc.png


Category:Charleston, WV | Open Energy Information  

Open Energy Info (EERE)

WV WV Jump to: navigation, search Go Back to PV Economics By Location Media in category "Charleston, WV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Charleston WV Harrison Rural Elec Assn Inc.png SVFullServiceRestauran... 59 KB SVQuickServiceRestaurant Charleston WV Harrison Rural Elec Assn Inc.png SVQuickServiceRestaura... 60 KB SVHospital Charleston WV Harrison Rural Elec Assn Inc.png SVHospital Charleston ... 57 KB SVLargeHotel Charleston WV Harrison Rural Elec Assn Inc.png SVLargeHotel Charlesto... 57 KB SVLargeOffice Charleston WV Harrison Rural Elec Assn Inc.png SVLargeOffice Charlest... 58 KB SVMediumOffice Charleston WV Harrison Rural Elec Assn Inc.png SVMediumOffice Charles... 60 KB SVMidriseApartment Charleston WV Harrison Rural Elec Assn Inc.png


West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

WV DoE-NRCCE-APERC DRAFT February 16, 2009 1 West Virginia Smart Grid Implementation Plan (WV SGIP) Project APERC Report on Customer Complaints to WV PSC about Electric Power...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Joshua Hull Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-0906 joshua.hull@netl.doe.gov Erik Westman Principal Investigator Virginia Polytechnic Institute and State University 100 Holden Hall Blacksburg, VA 24061 540-0231-7510 Fax: 540-231-4070 ewestman@vt.edu PROJECT DURATION Start Date End Date 12/01/2009 12/31/2012 COST Total Project Value $257,818 DOE/Non-DOE Share $248,441 / $9,377 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. P R OJ E C T FAC T


DOE - Office of Legacy Management -- Reduction Pilot Plant - WV 01  

Office of Legacy Management (LM)

Reduction Pilot Plant - WV 01 Reduction Pilot Plant - WV 01 FUSRAP Considered Sites Site: REDUCTION PILOT PLANT (WV.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: International Nickel Company WV.01-1 Location: Cole Street at Alterizer Ave. , Huntington , West Virginia WV.01-2 Evaluation Year: 1987 WV.01-1 Site Operations: Manufactured powdered Nickel for use at Paducah and Portsmouth gaseous diffusion plants and Nickel plated a small quantity of Uranium slugs. WV.01-2 WV.01-1 Site Disposition: Eliminated - Limited quantities of radioactive material used on the site. Potential for residual radioactive material from AEC operations conducted at the site considered remote - confirmed by radiological survey. WV.01-1 WV.01-3


VT Nuclear Services ltd | Open Energy Information  

Open Energy Info (EERE)

Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon VT Nuclear Services ltd Jump to: navigation, search Name VT Nuclear Services ltd Place...


West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

WV DoE-NRCCE-APERC DRAFT February 16, 2009 WV DoE-NRCCE-APERC DRAFT February 16, 2009 1 West Virginia Smart Grid Implementation Plan (WV SGIP) Project APERC Report on Customer Complaints to WV PSC about Electric Power Service Ali Feliachi, Muhammad Choudhry, John Saymansky and Ed Sneckenberger February 16, 2009 Introduction APERC has appreciated that one of the most important sources for data on the consumer perspective of the current electric power grid in West Virginia would be the WV Public Service Commission (WV PSC). Thus, an email request was sent on December 19, 2008 to Byron Harris at the WV PSC to request any advice or approaches to determine customer and regulatory perspectives of the current electric power grid in WV. Customer Complaint Data Bryon Harris was able to provide a spreadsheet of customer complaints in West Virginia for


NETL: 2010 WV Science Bowl Information  

NLE Websites -- All DOE Office Websites (Extended Search)

2010 WV Science Bowl 2010 WV Science Bowl The U.S. Department of Energy's National Energy Technology Laboratory (DOE/NETL) invites you to participate in one of the premier scientific events for high school students, the West Virginia High School Science Bowl 2010 on February 6, 2010. This will be NETL's 19th year sponsoring the high school competition. There is a change this year in the registration process from past years, all teams who are registering to complete, must do so through the National Science Bowl website. For those who are not familiar with the West Virginia Science Bowl here are some highlights: The competition is open to high school students (school, scouts, home school) from West Virginia. Complete eligibility requirements are located at the National Science Bowl website.


Category:Burlington, VT | Open Energy Information  

Open Energy Info (EERE)

VT VT Jump to: navigation, search Go Back to PV Economics By Location Media in category "Burlington, VT" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Burlington VT Central Vermont Pub Serv Corp.png SVFullServiceRestauran... 67 KB SVMidriseApartment Burlington VT Central Vermont Pub Serv Corp.png SVMidriseApartment Bur... 68 KB SVQuickServiceRestaurant Burlington VT Central Vermont Pub Serv Corp.png SVQuickServiceRestaura... 68 KB SVStandAloneRetail Burlington VT Central Vermont Pub Serv Corp.png SVStandAloneRetail Bur... 68 KB SVHospital Burlington VT Central Vermont Pub Serv Corp.png SVHospital Burlington ... 64 KB SVLargeHotel Burlington VT Central Vermont Pub Serv Corp.png SVLargeHotel Burlingto... 63 KB SVLargeOffice Burlington VT Central Vermont Pub Serv Corp.png


Microsoft Word - Parkersburg High School Claims 2013 WV Science...  

NLE Websites -- All DOE Office Websites (Extended Search)

Parkersburg High School Claims 2013 WV Science Bowl Regional Win Parkersburg High School demonstrated its academic prowess as it defeated 12 other teams to capture the 22 nd Annual...


Microsoft PowerPoint - NETL Morgantown, WV to Washington, DC...  

NLE Websites -- All DOE Office Websites (Extended Search)

Morgantown, WV Site to Washington, DC Headquarters 1. Take I-68 EAST toward CUMBERLAND, MD. 2 M t I 70 EASTUS 40 EUS 522 S E it EXIT 82AB t d HAGERSTOWN 2. Merge onto I-70 EAST...


DOE - Office of Legacy Management -- The Carborundum Co Inc - WV 02  

Office of Legacy Management (LM)

The Carborundum Co Inc - WV 02 The Carborundum Co Inc - WV 02 FUSRAP Considered Sites Site: THE CARBORUNDUM CO., INC (WV.02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: AMAX Inc WV.02-1 Location: Wood County , West Virginia WV.02-1 Evaluation Year: 1982 WV.02-1 Site Operations: Produced high-grade Zirconium metal for use in construction of nuclear reactors for the Navy circa late-1950s and 1960s; Conducted small scale Zirconium and Uranium testing in the mid-1970s. WV.02-2 Site Disposition: Eliminated - AEC/NRC licensed site. No Authority for cleanup under FUSRAP WV.02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium, Uranium WV.02-2 Radiological Survey(s): Yes WV.02-3 Site Status: Eliminated from further consideration under FUSRAP


Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports...  

U.S. Energy Information Administration (EIA) Indexed Site

Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports from Canada (Million Cubic Feet) Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports from Canada (Million...


West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

West Virginia Smart Grid Implementation Plan (WV SGIP) Project West Virginia Smart Grid Implementation Plan (WV SGIP) Project APERC Report on Assessment of As-Is Grid by Non-Utility Stakeholders Introduction One goal of this grid modernization project is to assess the current status of the electric power grid in West Virginia in order to define the potential to implement smart grid technologies. Thus, an initial task of this project was to define the current state or "As-Is" grid in West Virginia. Financial and time constraints prohibited the development and execution of formal surveys to solicit input from the various stakeholders. However attempts were made to obtain their input through informal questionnaires and meeting with focus groups. list of stakeholders which


,"North Troy, VT Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Troy, VT Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data...


,"Highgate Springs, VT Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

Highgate Springs, VT Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","L...


Price of Highgate Springs, VT Natural Gas LNG Imports from Canada...  

Annual Energy Outlook 2012 (EIA)

Springs, VT Natural Gas LNG Imports from Canada (Dollars per Thousand Cubic Feet) Price of Highgate Springs, VT Natural Gas LNG Imports from Canada (Dollars per Thousand...

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


If you reside in WASHINGTON, DC - MD -VA - WV your salary will...  

National Nuclear Security Administration (NNSA)

If you are employed in the WASHINGTON, DC Metropolitan Area (D.C., Baltimore, Northern VA, Eastern WV, and Southern PA) your salary will range from: Pay Band Pay Plan(s) Minimum...


North Troy, VT Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Million Cubic Feet) North Troy, VT Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's...


North Troy, VT Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) North Troy, VT Natural Gas Pipeline Imports From Canada (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


NREL: Wind Research - Ventera's VT 10 Turbine Testing and Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Ventera's VT 10 Turbine Testing and Results Ventera's VT 10 Turbine Testing and Results Ventera's VT10 wind turbine. Text Version As part of the National Renewable Energy Laboratory and U.S. Department of Energy (NREL/DOE) Independent Testing project, NREL is testing Ventera's VT10 small wind turbine at the National Wind Technology Center (NWTC). The VT10 is a horizontal-axis downwind, three-bladed turbine rated at 10 kilowatts (kW). Its diameter is 6.7 meters, and it is mounted on a lattice tower with a hub height of 21.7 meters. The VT10 uses a single-phase, grid-connected, permanent-magnet generator that operates at 240 volts AC. Testing Summary The summary of the tests is listed below, along with the final reports. Cumulative Energy Production 3/22/2010: 0; 3/29/2010: 26; 3/31/2010: 74; 4/1/2010: 75; 4/2/2010: 174;


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PO Box 880 PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea McNemar Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-2024 andrea.mcnemar@netl.doe.gov Charles D. Gorecki Technical Contact Senior Research Manager Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5355 cgorecki@undeerc.org Edward N. Steadman Deputy Associate Director for Research Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5279 esteadman@undeerc.org John A. Harju Associate Director for Research Energy & Environmental Research Center University of North Dakota


Scoping Study for Demand Respose DFT II Project in Morgantown, WV  

Science Conference Proceedings (OSTI)

This scoping study describes the underlying data resources and an analysis tool for a demand response assessment specifically tailored toward the needs of the Modern Grid Initiatives Demonstration Field Test in Phase II in Morgantown, WV. To develop demand response strategies as part of more general distribution automation, automated islanding and feeder reconfiguration schemes, an assessment of the demand response resource potential is required. This report provides the data for the resource assessment for residential customers and describes a tool that allows the analyst to estimate demand response in kW for each hour of the day, by end-use, season, day type (weekday versus weekend) with specific saturation rates of residential appliances valid for the Morgantown, WV area.

Lu, Shuai; Kintner-Meyer, Michael CW



File:EIA-Appalach6-WV-VA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-GAS.pdf Appalach6-WV-VA-GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.09 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.


File:EIA-Appalach5-eastWV-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach5-eastWV-BOE.pdf Appalach5-eastWV-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.26 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Maryland File history Click on a date/time to view the file as it appeared at that time.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Program Technology Program Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Dawn Deel Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4133 dawn.deel@netl.doe.gov Sherry Mediati Business Contact California Energy Commission 1516 9th Street, MS 1 Sacramento, CA 95814 916-654-4204 smediati@energy.state.ca.us Mike Gravely Principal Investigator California Energy Commission 1516 Ninth Street, MS 43 Sacramento, CA 95814 916-327-1370 mgravely@energy.state.ca.us Elizabeth Burton Technical Director Lawrence Berkeley National Laboratory 1 Cyclotron Road, MS 90-1116 Berkeley, CA 94720 925-899-6397 eburton@lbl.gov West Coast Regional Carbon


File:EIA-Appalach6-WV-VA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-BOE.pdf Appalach6-WV-VA-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.02 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Turbines Hydrogen Turbines CONTACTS Richard A. Dennis Technology Manager, Turbines National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4515 richard.dennis@netl.doe.gov Travis Shultz Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507-0880 304-285-1370 travis.shultz@netl.doe.gov Jacob A. Mills Principal Investigator Florida Turbine Technologies, Inc 1701 Military Trail Suite 110 Jupiter, FL 33458-7887 561-427-6349 jmills@fttinc.com PARTNERS None PROJECT DURATION Start Date End Date 06/28/2012 08/13/2015 COST Total Project Value $1,149,847 DOE/Non-DOE Share $1,149,847 / $0 AWARD NUMBER SC0008218 Air-Riding Seal Technology for Advanced Gas Turbine Engines-Florida Turbine


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rodosta Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Darin Damiani Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4398 darin.damiani@netl.doe.gov Vivak Malhotra Principal Investigator Southern Illinois University Neckers 483A Mailcode: 4401 Carbondale, IL 62901 618-453-2643 Fax: 618-453-1056 vmalhotra@physics.siu.edu PARTNERS None Risk Assessment and Monitoring of Stored CO2 in Organic Rock under Non-Equilibrium Conditions Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACTS Joseph Stoffa Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-0285 joseph.stoffa@netl.doe.gov Xingbo Liu Principal Investigator Dept. MechanaWest Virginia University P.O. Box 6106 Morgantown, WV 26506-6106 304-293-3339 xingbo.liu@mail.wvu.edu Shailesh D. Vora Technology Manager, Fuel Cells National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7515 shailesh.vora@netl.doe.gov PARTNERS None PROJECT DURATION Start Date End Date 08/31/2012 09/30/2015 COST Total Project Value $634,839 DOE/Non-DOE Share $499,953 / $134,886 AWARD NUMBER FE0009675 Fundamental Understanding of Oxygen Reduction and Reaction Behavior and Developing High Performance and Stable


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Romanosky Romanosky Crosscutting Research Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-4721 robert.romanosky@netl.doe.gov Richard Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Shizhong Yang Principal Investigator Southern University



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WEST VIRGINIA WEST VIRGINIA NATIONAL ENERGY TECHNOLOGY LAB -WV POC Larry Sullivan Telephone (412) 386-6115 Email larry.sullivan@netl.doe.gov ADMINISTATIVE / WASTE / REMEDIATION Facilities Support Services 561210 Employment Placement Agencies 561311 Temporary Help Services 561320 Professional Employer Organizations 561330 Document Preparation Services 561410 Security Guards and Patrol Services 561612 Security Systems Services (except Locksmiths) 561621 Janitorial Services 561720 Landscaping Services 561730 Hazardous Waste Treatment and Disposal 562211 Remediation Services 562910 Materials Recovery Facilities 562920 All Other Miscellaneous Waste Management Services 562998 CONSTRUCTION Industrial Building Construction 236210 Commercial and Institutional Building Construction 236220 Power and Communication Line and Related Structures Construction


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R R &D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - 2014 WVSB - WV HS letter (generic for PDF).docx  

NLE Websites -- All DOE Office Websites (Extended Search)

610 Collins Ferry Road, P.O. Box 880, Morgantown, WV 26507-0880 626 Cochrans Mill Road, P.O. Box 10940, Pittsburgh, PA 15236-0940 610 Collins Ferry Road, P.O. Box 880, Morgantown, WV 26507-0880 626 Cochrans Mill Road, P.O. Box 10940, Pittsburgh, PA 15236-0940 REPLY TO: Morgantown Office  steven.woodruff@netl.doe.gov  Voice (304) 285-4175  Fax (304) 285-0903  www.netl.doe.gov September 23, 2013 Dear Science Chair or Principal: On behalf of the Secretary of Energy, I am pleased to announce the opening of the 2014 National Science Bowl, a tournament-style academic competition challenging students in the fields of science and mathematics. In support of the National Science Bowl, the U.S. Dept of Energy's National Energy Technology Laboratory is once again proud to host the West Virginia Regional Science Bowl. The WVSB is one of many regional competitions held for high school teams across



NLE Websites -- All DOE Office Websites (Extended Search)

VrnVtR^iTY OF CALIFOKKIA VrnVtR^iTY OF CALIFOKKIA L a w r e n c s BadidUon L a b o r a t o r y B e r k e l e y , Calift^raia Contract rto "*'-740n-.e,ig~48 THE EARLY ANJ'IPROTON WORK Owen GharBDeriair. DecetDfter 15, 195.9 L i G A L N O T I C E - This report was prepared as an account ot <: I nor any person acUng on beliflU of the C DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency Thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maira Reidpath Maira Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Steven S.C. Chuang Principal Investigator The University of Akron Department of Chemical and Biomolecular Engineering 230 E. Buchtel Commons Akron, OH 44325 330-972-6993 schuang@uakron.edu PARTNERS None PROJECT DURATION Start Date End Date 09/01/2009 08/31/2013 COST Total Project Value $1,713,961 DOE/Non-DOE Share $1,370,977/$342,984 AWARD NUMBER Techno-Economic Analysis of Scalable Coal-Based Fuel Cells-University of Akron Background In this congressionally directed project, the University of Akron (UA) will develop a scalable coal fuel cell manufacturing process to a megawatt scale. UA has demonstrated the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maria Reidpath Maria Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Bogdan Gurau Principal Investigator NuVant Systems, Inc. 130 N West Street Crown Point, IN 46307 219-644-3232 b.gurau@nuvant.com PARTNERS None PROJECT DURATION Start Date End Date 08/01/2009 05/31/2013 COST Total Project Value $1,142,481 DOE/Non-DOE Share $913,985 / $228,496 AWARD NUMBER Improved Flow-field Structures for Direct Methanol Fuel Cells-NuVant Systems, Inc. Background In this congressionally directed project, NuVant Systems, Inc. (NuVant) will improve the performance of direct methanol fuel cells (DMFCs) by designing anode flow-fields specifically for the delivery of liquid methanol. The goal is to deliver concentrated


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

FACTS FACTS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Joseph Labuz Principal Investigator University of Minnesota 500 Pillsbury Drive SE Room 122 CivE 0851 Minneapolis, MN 55455 612-625-9060 jlabuz@umn.edu PARTNERS None PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,568 DOE/Non-DOE Share $299,568 / $0 PROJECT NUMBER DE-FE0002020 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PROJEC PROJEC T FAC TS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Gordon Bierwagen Principal Investigator North Dakota State University P.O. Box 6050 Department 2760 Fargo, ND 58108-6050 701-231-8294 gordon.bierwagen@ndsu.edu PARTNERS None PROJECT DURATION Start Date 12/01/2009 End Date 11/30/2011 COST Total Project Value $298,949 DOE/Non-DOE Share $298,949 / $0 PROJECT NUMBER DE-FE0002054 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Jose Castillo Principal Investigator San Diego State University 5500 Campanile Drive San Diego, CA 92122 619-594-7205 castillo@myth.sdsu.edu PARTNERS Sienna Geodynamics and Consulting, Inc. PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,993 DOE/Non-DOE Share $299,993 / $0 PROJECT NUMBER DE-FE0002069 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Briggs White Briggs White Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-5437 briggs.white@netl.doe.gov Jeff Stevenson Principal Investigator Pacific Northwest National Laboratory P.O. Box 999, MS K2-44 Richland, WA 99352 509-372-4697 jeff.stevenson@pnl.com PARTNERS Oak Ridge National Laboratory University of Connecticut PROJECT DURATION Start Date End Date 10/01/1999 09/30/2013 (annual continuations) COST Total Project Value $52,889,667 DOE/Non-DOE Share $52,889,667 / $0 AWARD NUMBER FWP40552 PR OJ E C T FAC T S Fuel Cells Low Cost Modular SOFC Development- Pacific Northwest National Laboratory Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) has a mission to advance energy options to fuel our economy, strengthen our security,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Karen Kluger Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6667 karen.kluger@netl.doe.gov Gary Mavko Principal Investigator Stanford University 397 Panama Mall Stanford, CA 94305-2215 650-723-9438 Fax: 650-723-1188 mavko@stanford.edu PROJECT DURATION Start Date 12/01/2009 End Date 06/30/2013 COST Total Project Value $385,276 DOE/Non-DOE Share $295,777/ $89,499 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Rock Physics of Geologic Carbon Sequestration/Storage


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Duration Test Report for the Ventera VT10 Wind Turbine  

DOE Green Energy (OSTI)

This project was established to help reduce the barriers of wind energy expansion by providing independent testing results for small wind turbines. Five turbines were tested at the National Wind Technology Center (NWTC) at the National Renewable Energy Laboratory (NREL) as a part of round one of this project. Duration testing is one of up to five tests that may be performed on the turbines, including power performance, safety and function, noise, and power quality. Test results will provide manufacturers with reports that can be used to fulfill part of the requirements for small wind turbine certification. The test equipment included a grid-connected Ventera Energy Corporation VT10 wind turbine mounted on an 18.3-m (60-ft) self-supporting lattice tower manufactured by Rohn.

Smith, J.; Huskey, A.; Jager, D.; Hur, J.




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Wind Turbine Generator System Safety and Function Test Report for the Ventera VT10 Wind Turbine  

DOE Green Energy (OSTI)

This report summarizes the results of a safety and function test that NREL conducted on the Ventera VT10 wind turbine. This test was conducted in accordance with the International Electrotechnical Commissions' (IEC) standard, Wind Turbine Generator System Part 2: Design requirements for small wind turbines, IEC 61400-2 Ed.2.0, 2006-03.

Smith, J.; Huskey, A.; Jager, D.; Hur, J.



U.S. DOE Industrial Technologies Program Technology Delivery Plant-Wide Assessment at PPG Industries, Natrium, WV  

SciTech Connect

PPG and West Virginia University performed a plantwide energy assessment at the PPGs Natrium, WV chemical plant, an energy-intensive manufacturing facility producing chlor-alkali and related products. Implementation of all the assessment recommendations contained in this report could reduce plant energy consumption by 8.7%, saving an estimated 10,023,192 kWh/yr in electricity, 6,113 MM Btu/yr in Natural Gas, 401,156 M lb/yr in steam and 23,494 tons/yr in coal and reduce carbon dioxide emissions by 241 mm lb/yr. The total cost savings would amount to approximately $2.9 mm/yr. Projects being actively implemented will save $1.7 mm/yr; the remainder are undergoing more detailed engineering study.

Lester, Stephen R.; Wiethe, Jeff; Green, Russell; Guice, Christina; Gopalakrishnan, Bhaskaran; Turton, Richard



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

)'vtAHAGEMENT CENTER )'vtAHAGEMENT CENTER NEPA DETERl\ifINATION RECIPIENT:Colorado School of Mines Page 1 of2 STATE: CO PROJECT TITLE: Joint Inversion of Electrical and Seismic data for Fracture Characterization and Imaging of Fluid Flow in Geotllermal Systems Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE·PS36·08G098008 . DE·FG36·08G018195 GFO·G018195·002 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Projected Regional Impacts of Appliance Efficiency Standards for the U.S. Residential Sector  

E-Print Network (OSTI)

TX UT VA VT WA WI WV WY US Primary Energy Savings PetajoulesTX UT VA VT WA WI WV WY US Primary Energy Savings PetajoulcsTX UT VA VT WA WI wv WY US Primary Energy Savings Petaioules

Koomey, J.G.



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


Record of Decision and Floodplain Statement of Findings: Western Greenbrier Co-Production Demonstration Project, Rainelle, Greenbrier County, WV (DOE/EIS-0361) (04/29/08)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

14 Federal Register 14 Federal Register / Vol. 73, No. 83 / Tuesday, April 29, 2008 / Notices DEPARTMENT OF ENERGY Record of Decision and Floodplain Statement of Findings: Western Greenbrier Co-Production Demonstration Project, Rainelle, Greenbrier County, WV AGENCY: Office of Fossil Energy, U.S. Department of Energy (DOE). ACTION: Record of Decision (ROD) and Floodplain Statement of Findings. SUMMARY: DOE has decided to implement the Proposed Action alternative, identified as the preferred alternative, in the Western Greenbrier Co-Production Demonstration Project, Final Environmental Impact Statement (DOE/EIS-0361; November 2007) (FEIS). That alternative is to provide approximately $107.5 million (up to 50% of the development costs) to Western Greenbrier Co-Generation, LLC


SOFC Anode Interaction with Trace Coal Syngas Species U.S. Dept of Energy, National Energy Technology Laboratory, Morgantown, WV 26507  

NLE Websites -- All DOE Office Websites (Extended Search)

SOFC Anode Interaction with Trace Coal Syngas Species SOFC Anode Interaction with Trace Coal Syngas Species U.S. Dept of Energy, National Energy Technology Laboratory, Morgantown, WV 26507 Gregory Hackett, Kirk Gerdes, Randall Gemmen Phone: (304)285-5279, Gregory.Hackett@NETL.DOE.GOV Utilization of coal as a fuel source for highly efficient integrated gasification fuel cell (IGFC) power generation facilities is technologically and environmentally attractive. IGFC plants are expected to offer the highest efficiency coal gasification processes, even when carbon capture and storage systems are included in the design. One element of IGFC research at the National Energy Technology Laboratory is the investigation of syngas cleanup processes for these integrated systems. Of particular interest are the effects of trace elements naturally contained in


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)


Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Morgantown, WV * Pittsburgh...  

NLE Websites -- All DOE Office Websites (Extended Search)

Regional Carbon Sequestration Partnership-Validation Phase Background The U.S. Department of Energy (DOE) has selected seven partnerships, through its Regional Carbon Sequestration...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

S S . DEPART]\.1ENT OF ENERGY EERE PROJECT T'....IANACiE!vtENT CENTER NEPA DETERl\HNATION RECI PI ENT:Amonix, Inc. STATE: CA PROJECT Low Cost High Concentration Photovoltaic Power Systems for Utility Power Generation - Sandia site TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-06G 096034 DE-FC36-07G017042 GFO-G017042-006 G017042 Based on my review of the information concerning the proposed action, as N EPA Compliance Officer (authorized under DOE Order 451.1 A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation , and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Notice of Intent to prepare an Environmental Impact Statement for the Western Greenbrier Co-Production Demonstration Project, Rainelle, WV and Notice of Floodplain/Wetlands Involvement (6/3/03)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 11 Federal Register / Vol. 68, No. 106 / Tuesday, June 3, 2003 / Notices Dated: May 27, 2003. Judge Eric Andell, Deputy Under Secretary for Safe and Drug- Free Schools. [FR Doc. 03-13836 Filed 6-2-03; 8:45 am] BILLING CODE 4000-01-P DEPARTMENT OF ENERGY Notice of Intent To Prepare an Environmental Impact Statement for the Western Greenbrier Co-Production Demonstration Project, Rainelle, WV and Notice of Floodplain/Wetlands Involvement AGENCY: Department of Energy. ACTION: Notice of Intent to prepare an Environmental Impact Statement and Notice of Floodplain/Wetlands Involvement. SUMMARY: The U.S. Department of Energy (DOE) announces its intent to prepare an Environmental Impact Statement (EIS) pursuant to the National Environmental Policy Act (NEPA), the



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li


Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


The Institute for Critical Technology and Applied Science at Virginia Tech supports and promotes cutting-edge research at the intersection of engineering, science, and medicine. Please visit www.ictas.vt.edu.  

E-Print Network (OSTI)

.ictas.vt.edu. Fuel Cell Research A Focus Area within the ICTAS Sustainable Energy Thrust Mission The mission cell technology to help meet society's energy needs. Technical Approach At its core, a fuel cell employees, students, or applicants for admission or employment on the basis of race, gender, disability, age

Beex, A. A. "Louis"


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


wvBLACK DIAMONDS table of contents  

E-Print Network (OSTI)

County Coal Corporation, presented the annual William Poundstone Lecture entitled, "My Last (and Best) 23 Years in Coal." Bradbury's 42-year coal mining career included a number of senior-level positions in engineering and management. He was president of Martin County Coal during his last 18 years in the industry

Mohaghegh, Shahab


wvBLACK DIAMONDS table of contents  

E-Print Network (OSTI)

......................12 Chris Hamilton, senior vice president of the West Virginia Coal Association (WVCA), presented a speech on "Coal, Energy, and Mountaintop Development," as part West Virginia University's College experience in the coal mining industry, 25 with the WVCA. He is responsible for legislative, regulatory

Mohaghegh, Shahab


wvBLACK DIAMONDS Engineering and  

E-Print Network (OSTI)

. Robert E. Murray is president of Murray Energy Corp., the largest privately owned coal mining company father's paralysis from a mining accident. He worked for the North American Coal Corp. for 31 years president ­ mining services for International Coal Group (ICG), presented the William Poundstone Lecture

Mohaghegh, Shahab


Oil-shale utilization at Morgantown, WV  

Science Conference Proceedings (OSTI)

Fully aware of the nation's need to develop high-risk and long-term research in eastern oil-shale and low-grade oil-shale utilization in general, the US DOE/METC initiated an eastern oil-shale characterization program. In less than 3 months, METC produced shale oil from a selected eastern-US oil shale with a Fischer assay of 8.0 gallons/ton. In view of the relatively low oil yield from this particular oil shale, efforts were directed to determine the process conditions which give the highest oil yield. A 2-inch-diameter electrically heated fluidized-bed retort was constructed, and Celina oil shale from Tennessee was selected to be used as a representative eastern oil shale. After more than 50 runs, the retorting data were analyzed and reviewed and the best oil-yield operating condition was determined. In addition, while conducting the oil-shale retorting experiments, a number of technical problems were identified, addressed, and overcome. Owing to the inherent high rates of heat and mass transfers inside the fluidized bed, the fluidized-bed combustor and retorting appear to be a desirable process technology for an effective and efficient means for oil-shale utilization. The fluidized-bed operation is a time-tested, process-proven, high-throughput, solid-processing operation which may contribute to the efficient utilization of oil-shale energy.

Shang, J.Y.; Notestein, J.E.; Mei, J.S.; Romanosky, R.R.; King, J.A.; Zeng, L.W.



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Figure 23. Average price of natural gas delivered to U.S. commercial...  

Annual Energy Outlook 2012 (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...


Microsoft Word - figure_22.doc  

Gasoline and Diesel Fuel Update (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...


Microsoft Word - figure_21.doc  

Annual Energy Outlook 2012 (EIA)

of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA...


Microsoft Word - figure_23.doc  

Annual Energy Outlook 2012 (EIA)

11.00+ Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...


Microsoft Word - figure_23.doc  

Gasoline and Diesel Fuel Update (EIA)

Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Precios de Gasolina  

NLE Websites -- All DOE Office Websites (Extended Search)

Precios de Gasolina para Ciudades en EEUU Pulse en el mapa para ver los precios de la gasolina en diferentes ciudades de su estado. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV...


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT



NLE Websites -- All DOE Office Websites (Extended Search)

DataTechnologySpecificUnitedStatesWindHighResolutionVermontWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of Vermont...


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

DISTRIBUTED FIBER OPTIC SENSOR FOR ON-LINE MONITORING OF COAL GASIFIER REFRACTORY HEALTH DE-FE0005703 Anbo Wang, Cheng Ma Virginia Tech Center for Photonics Technology Blacksburg,...


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VT, and MI A Comprehensive Investigation of Unsteady Reciprocating Effects on Near-Wall Heat Transfer in Engines The objective of the proposed project is to use collaborative...


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Facilities Description Scientists at NETL's laboratories use the Geoscience Analysis, Interpretation, and Assessments (GAIA) Computational Facilities for...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigation on Pyroelectric Ceramic Temperature Sensors for Energy System Applications Background There is an increasing need to monitor processing parameters such as...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

CO 2 -Binding Organic Liquids Gas Capture with Polarity-Swing-Assisted Regeneration Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory...

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and are also stringent in order to avoid poisoning catalysts utilized in making liquids from fuel gas, electrodes in fuel cells, and selective catalytic reduction...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

modeling, laboratory experiments, and industry input to develop physics-based methods, models, and tools to support the development and deployment of advanced...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of clean energy systems. Accomplishments The AVESTAR team successfully deployed 3-D virtual IGCC immersive training systems at NETL and West Virginia University that allow...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

volatilization from interconnect alloys using solution conductivity. Schematic of a SOFC highlighting potential degradation mechanisms. The GEGR project assists the SOFCs...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

project phases focused on cell and stack research and development with emphasis on SOFC performance enhancement (power density, fuel utilization, and degradation), cost...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

chemical state of pulse laser deposited thin-film cathodes were measured. * A symmetric SOFC cell for ultra-small angle X-ray scattering studies was designed and constructed. The...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

coatingscale durability through thermal cycling. * Drew the interest of a major SOFC manufacturer and specialty SOFC metals producer. Benefits nGimat's SBIR project...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

assists the SOFCs program in meeting its cost and performance targets by ensuring that SOFC seals can achieve reliable operation over an extended operating life. The program...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

methods developed in this ONR program can now be applied to the testing of a Delphi Gen 4 SOFC stack in the DOE research program. Benefits This NUWC project assists the SOFCs...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

region or matching oxygen vacancy concen- trations. * Demonstrated that periodic reverse SOFC operation serves to prolong SOFC lifetimes. * Demonstrated elemental surface valence...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

* Conduct bench-scale testing of the complete ICES incorporating the selected particle growth method with the optimized capture duct and diffuser systems to enable the...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Engine Technology Background The mission of the U.S. Department of Energy's National Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Testing of Rapid PSA for CO 2 Capture Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Research &...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

including lignite and sub-bituminous coal, make up about half of U.S. coal production and reserves. They have lower energy and sulfur contents than bituminous coal, but higher...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Institute Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Technology (Georgia Tech) will obtain data and develop models of the turbulent burning rate of HHC fuels at realistic conditions and in inhomo- geneous conditions such as...


West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

operating and asset health data deeply integrated with operating and asset management applications, dramatic improvement in enterprise wide processes - GIS, system...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. After only eight years from the time of...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. Only eight years after construction and...

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

capture technologies developed by the DOE program may also be applied to natural gas power plants after addressing the R&D challenges associated with the relatively low...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Transport Membrane (ITM) Oxygen Technology for Integration in IGCC and Other Advanced Power Generation Systems Background Oxygen is among the top five chemicals produced worldwide...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

materials requirements for all fossil energy systems, including materials for advanced power generation technologies, such as coal gasification, heat engines, such as turbines,...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Aerodynamics and Heat Transfer Studies of Parameters Specific to the IGCC- Requirements: High Mass Flow Endwall Contouring, Leading Edge Filleting and Blade Tip Ejection under...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Effects of Hot Streak and Phantom Cooling on Heat Transfer in a Cooled Turbine Stage Including Particulate Deposition-The Ohio State University Background Sophisticated...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

FutureGen 2.0 Background The combustion of fossil fuels for electricity generation is one of the largest contributors to carbon dioxide (CO 2 ) emissions in the United States and...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

(3) improving efficiency of storage operations; and (4) developing Best Practices Manuals. Deploying these technologies in commercial-scale applications will require a...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

main bulk phases, the Nb solid solution, and Nb silicides will be developed. Formation energies of the undoped and doped Nb-Si-Cr will be calculated and compared. Interfacial...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

can contribute to the reduction of overall greenhouse gas emissions from fossil power plants. One area of research is the development and characterization of multiple...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Vito Cedro III Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7406 vito.cedro@netl.doe.gov Jason S....


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Archer Daniels Midland Company: CO 2 Capture from Biofuels Production and Storage into the Mt. Simon Sandstone Background Carbon dioxide (CO 2 ) emissions from industrial...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

diverse number of systems and chemical processes ranging from catalysts developments for Fischer-Tropsch synthesis applications, nanoscience, development of dense membrane systems...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and unknown samples. Analyses are used to characterize the fundamental properties of unconventional natural gas and oil reservoirs, ultra-deepwater and frontier-region...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the plant. Calera's process reduces carbon dioxide and pollutant emissions by using waste streams to make useable products. In the Sub-phase 2a, Calera completed the detailed...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

WGS National Carbon Capture Center - Water-Gas Shift Tests to Reduce Steam Use Background In cooperation with Southern Company Services, the U.S. Department of Energy (DOE)...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of filter elements to remove ash from the syngas prior to it being utilized in a gas turbine or fuel cell. The elements are arranged in columns called "candles" and contained...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Unique Low Thermal Conductivity Thermal Barrier Coating (TBC) Architectures-UES Background Gas turbine engines used in integrated gasification combined cycle power plants require...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

a novel catalyzed wall heat exchanger, and a network of heat exchangers to support thermal self-sufficiency. * Completed test stand modifications at UTC Power to support...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

correspond to reflected-shock temperature (1180 K) and pressure (13.06 atm) for a stoichiometric H 2 -O 2 mixture in argon. Comparison with chemical kinetics mechanisms is good...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

oil recovery (EOR) application. The industrial source of CO 2 will be a petroleum-coke-to-chemicals (methanol and other by-products) gasification plant being developed by...

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft PowerPoint - WV SGIP 101810 rev1.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

Smart Grid Implementation Plan - Roadmap Framework GridWeek 2010 Steve Pullins October 18, 2010, Washington, DC This material is based upon work supported by the Department of...


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan




Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



VT PowerPoint Template2  

NLE Websites -- All DOE Office Websites (Extended Search)

injection site * Determine optimal sensor array Aneth - Reservoir Information * Aneth oil field, discovered in 1956 * Limestone * Permeability: 3-30 mD * Porosity: 10.2% *...


Highgate Springs, VT LNG Imports from Canada  

U.S. Energy Information Administration (EIA) Indexed Site

Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History Pipeline Volumes 8,021 8,106 9,319 8,895...


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

TX2","N3035UT2","N3035VT2","N3035VA2","N3035WA2","N3035WV2","N3035WI2","N3035WY2" "Date","U.S. Natural Gas Industrial Consumption (MMcf)","Alabama Natural Gas Industrial...


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

TX2","N3010UT2","N3010VT2","N3010VA2","N3010WA2","N3010WV2","N3010WI2","N3010WY2" "Date","U.S. Natural Gas Residential Consumption (MMcf)","Alabama Natural Gas Residential...



U.S. Energy Information Administration (EIA)

MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY U.S. Number of states in which marketer is licensed ... Service Tech & Research Corp


Gas Prices  

NLE Websites -- All DOE Office Websites (Extended Search)

Prices Gasoline Prices for U.S. Cities Click on the map to view gas prices for cities in your state. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV VA NC SC FL GA AL MS TN KY IN...


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


APPENDIX A1 Domestic (CONUS) Per Diem Rates -Effective October 1, 2012 State Primary Destination County  

E-Print Network (OSTI)

$ 66 VT Manchester Bennington $ 71 VT Middlebury Addison $ 61 VT Montpelier Washington $ 61 VT Stowe

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological Sequestration Geological Sequestration Consortium-Development Phase Illinois Basin - Decatur Project Site Background The U.S. Department of Energy Regional Carbon Sequestration Partnership (RCSP) Initiative consists of seven partnerships. The purpose of these partnerships is to determine the best regional approaches for permanently storing carbon dioxide (CO2) in geologic formations. Each RCSP includes stakeholders comprised of state and local agencies, private companies, electric utilities, universities, and nonprofit organizations. These partnerships are the core of a nationwide network helping to establish the most suitable technologies, regulations, and infrastructure needs for carbon storage. The partnerships include more than 400 distinct organizations, spanning 43 states


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACT CONTACT Cathy Summers Director, Process Development Division National Energy Technology Laboratory 1450 Queen Ave., SW Albany, OR 97321-2198 541-967-5844 cathy.summers@netl.doe.gov An Integrated Approach To Materials Development Traditional trial-and-error method in materials development is time consuming and costly. In order to speed up materials discovery for a variety of energy applications, an integrated approach for multi-scale materials simulations and materials design has


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Scale Simulations of the Large Scale Simulations of the Mechanical Properties of Layered Transition Metal Ternary Compounds for FE Power Systems Background The U.S. Department of Energy (DOE) promotes the advancement of computational capabilities to develop materials for advanced fossil energy power systems. The DOE's National Energy Technology Laboratory (NETL) Advanced Research (AR) Program is working to enable the next generation of Fossil Energy (FE) power systems. The goal of


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigations and Investigations and Rational Design of Durable High- Performance SOFC Cathodes- Georgia Institute of Technology Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration of solid SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Cathode durability is critical to long-term SOFC performance for commercial deployment.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxygen Carriers for Coal-Fueled Oxygen Carriers for Coal-Fueled Chemical Looping Combustion Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Novel Supercritical Carbon Dioxide Novel Supercritical Carbon Dioxide Power Cycle Utilizing Pressurized Oxy-combustion in Conjunction with Cryogenic Compression Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while maintaining near


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological & Environmental Sciences Geological & Environmental Sciences Subsurface Experimental Laboratories Autoclave and Core Flow Test Facilities Description Researchers at NETL study subsurface systems in order to better characterize and understand gas-fluid-rock and material interactions that impact environmental and resource issues related to oil, gas, and CO2 storage development. However, studying the wide variety of subsurface environments related to hydrocarbon and CO2 systems requires costly and technically challenging tools and techniques. As a result, NETL's Experimental Laboratory encompasses multi-functional, state-of-the-art facilities that perform a wide spectrum of geological studies providing an experimental basis for modeling of various subsurface phenomena and processes. This includes, but is not


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Improving Durability of Turbine Components through Trenched Film Cooling and Contoured Endwalls-University of Texas at Austin Background Gas turbine operation utilizing coal-derived high hydrogen fuels (synthesis gas, or syngas) requires new cooling configurations for turbine components. The use of syngas is likely to lead to degraded cooling performance resulting from rougher surfaces and partial blockage of film cooling holes. In this project the University of Texas at Austin (UT) in cooperation with The Pennsylvania State University (Penn State) will investigate the development of new film cooling and endwall cooling designs for maximum performance when subjected to high levels of contaminant depositions. This project was competitively selected under the University Turbine Systems Research


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Single-Crystal Sapphire Optical Fiber Single-Crystal Sapphire Optical Fiber Sensor Instrumentation for Coal Gasifiers Background Accurate temperature measurement inside a coal gasifier is essential for safe, efficient, and cost-effective operation. However, current sensors are prone to inaccurate readings and premature failure due to harsh operating conditions including high temperatures (1,200-1,600 degrees Celsius [°C]), high pressures (up to 1000 pounds per square inch gauge [psig]), chemical corrosiveness, and high flow rates, all of which lead to corrosion, erosion, embrittlement, and cracking of gasifier components as well as sensor failure. Temperature measurement is a critical gasifier control parameter because temperature is a critical factor influencing the gasification and it leads to impacts in efficiency and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Unraveling the Role of Transport, Unraveling the Role of Transport, Electrocatalysis, and Surface Science in the SOFC Cathode Oxygen Reduction Reaction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The electrochemical performance of SOFCs can be substantially influenced by


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Swirl Injectors for Hydrogen Gas Low-Swirl Injectors for Hydrogen Gas Turbines in Near-Zero Emissions Coal Power Plants-Lawrence Berkeley National Laboratory Background The U.S. Department of Energy Hy(DOE) Lawrence Berkeley National Laboratory (LBNL) is leading a project in partnership with gas turbine manufacturers and universities to develop a robust ultra-low emission combustor for gas turbines that burn high hydrogen content (HHC) fuels derived from gasification of coal. A high efficiency and ultra-low emissions HHC fueled gas turbine is a key component of a near-zero emis- sions integrated gasification combined cycle (IGCC) clean coal power plant. This project is managed by the DOE National Energy Technology Laboratory (NETL). NETL is researching advanced turbine technology with the goal of producing reliable,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of a Coal-Based Demonstration of a Coal-Based Transport Gasifier Background Coal is an abundant and indigenous energy resource and currently supplies almost 38 percent of the United States' electric power. Demand for electricity, vital to the nation's economy and global competitiveness, is projected to increase by almost 28 percent by 2040. The continued use of coal is essential for providing an energy supply that supports sustainable economic growth. Unfortunately, nearly half of the nation's electric power generating infrastructure is more than 30 years old and in need of substantial refurbishment or replacement. Additional capacity must also be put in service to keep pace with the nation's ever-growing demand for electricity. It is in the public interest


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Foamed Wellbore Cement Foamed Wellbore Cement Stability under Deep Water Conditions Background Foamed cement is a gas-liquid dispersion that is produced when an inert gas, typically nitrogen, is injected into a conventional cement slurry to form microscopic bubbles. Foamed cements are ultralow-density systems typically employed in formations that are unable to support annular hydrostatic pressure exerted by conventional cement slurries. More recently, the use of foamed cement has expanded into regions with high-stress environments, for example, isolating problem formations typical in the Gulf of Mexico. In addition to its light-weight application, foamed cement has a unique resistance to temperature and pressure-induced stresses. Foamed cement exhibits superior fluid


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scale Computational Design and Scale Computational Design and Synthesis of Protective Smart Coatings for Refractory Metal Alloys Background The goal of the University Coal Research (UCR) Program within the Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to further the understanding of coal utilization. Since the program's inception in 1979, its primary objectives have been to (1) improve understanding of the chemical and physical processes involved in the conversion and utilization of coal so it can be used in an environmentally acceptable manner, (2) maintain and upgrade the coal research capabilities of and facilities at U.S. colleges and universities, and (3) support the education of students in the area of coal science. The National Energy Technology Laboratory's Office of Coal and Power Systems supports


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Conversion of CO2 in Commercial Conversion of CO2 in Commercial Materials using Carbon Feedstocks Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Experimental and Chemical Kinetics Experimental and Chemical Kinetics Study of the Combustion of Syngas and High Hydrogen Content Fuels- Pennsylvania State University Background Pennsylvania State University is teaming with Princeton University to enhance scientific understanding of the underlying factors affecting combustion for turbines in integrated gasification combined cycle (IGCC) plants operating on synthesis gas (syngas). The team is using this knowledge to develop detailed, validated combustion kinetics models that are useful to support the design and future research and development needed to transition to fuel flexible operations, including high hydrogen content (HHC) fuels derived from coal syngas, the product of gasification of coal. This project also funda- mentally seeks to resolve previously reported discrepancies between published ex-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Coating Issues in Coal-Derived Synthesis Coating Issues in Coal-Derived Synthesis Gas/Hydrogen-Fired Turbines-Oak Ridge National Laboratory Background The Department of Energy (DOE) Oak Ridge National Laboratory (ORNL) is leading research on the reliable operation of gas turbines when fired with synthesis gas (syngas) and hydrogen-enriched fuel gases with respect to firing temperature and fuel impurity levels (water vapor, sulfur, and condensable species). Because syngas is derived from coal, it contains more carbon and more impurities than natural gas. In order to achieve the desired efficiency, syngas-fired systems need to operate at very high temperatures but under combustion conditions necessary to reduce nitrogen oxide (NO X ) emissions. ORNL's current project is focused on understanding the performance of high-


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Diode Laser Cladding of High Diode Laser Cladding of High Temperature Alloys Used in USC Coal- Fired Boilers Background The Advanced Research (AR) Materials Program addresses materials requirements for all fossil energy systems, including materials for advanced power generation and coal fuels technologies. Examples of these technologies include coal gasification, heat engines such as turbines, combustion systems, fuel cells, hydrogen production, and carbon capture


File:EIA-Appalach5-eastWV-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Eastern West Virginia and Western Maryland By 2001 Gas Reserve Class Eastern West Virginia and Western Maryland By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.18 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Maryland File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:41, 20 December 2010 Thumbnail for version as of 17:41, 20 December 2010 6,600 × 5,100 (18.18 MB) MapBot (Talk | contribs) Automated bot upload

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Electrochemical Processes Electrochemical Processes for CO2 Capture and Conversion to Commodity Chemicals Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Preparation and Testing of Corrosion- Preparation and Testing of Corrosion- and Spallation-Resistant Coatings- University of North Dakota Background The life of turbine components is a significant issue in gas fired turbine power systems. In this project the University of North Dakota (UND) will advance the maturity of a process capable of bonding oxide-dispersion strengthened alloy coatings onto nickel-based superalloy turbine parts. This will substantially improve the lifetimes and maximum use temperatures of parts with and without thermal barrier coatings (TBCs). This project is laboratory research and development and will be performed by UND at their Energy & Environmental Research Center (EERC) facility and the Department of Mechanical Engineering. Some thermal cycle testing will occur at Siemens Energy


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Integrated Assessment Model for Predicting Integrated Assessment Model for Predicting Potential Risks to Groundwater and Surface Water Associated with Shale Gas Development Background The EPAct Subtitle J, Section 999A-999H established a research and development (R&D) program for ultra-deepwater and unconventional natural gas and other petroleum resources. This legislation identified three program elements to be administered by a consortium under contract to the U.S. Department of Energy. Complementary research performed by the National Energy Technology Laboratory's (NETL) Office of Research and Development (ORD) is a fourth program element of this cost-shared program. NETL was also tasked with managing the consortium: Research Partnership to Secure Energy for America (RPSEA). Historically, the Complementary R&D Program being carried out by NETL's ORD has focused


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of Enabling Spar-Shell Demonstration of Enabling Spar-Shell Cooling Technology in Gas Turbines - Florida Turbine Technologies Background The Florida Turbine Technologies (FTT) spar-shell gas turbine airfoil concept has an internal structural support (the spar) and an external covering (the shell). This concept allows the thermal-mechanical and aerodynamic requirements of the airfoil design to be considered separately, thereby enabling the overall design to be optimized for the harsh environment these parts are exposed to during operation. Such optimization is one of the major advantages of the spar-shell approach that is not possible with today's conventional monolithic turbine components. The proposed design integrates a novel cooling approach based on Advanced Recircu-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Alamos National Laboratory - Los Alamos National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization and Pre-Combustion Capture Goals Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop technologies to capture, separate, and store carbon dioxide (CO 2 ) to aid in reducing greenhouse gas (GHG) emissions without adversely influencing energy use or hindering economic growth. Carbon capture and sequestration (CCS) - the capture of CO 2 from large point sources and subsequent injection into deep geologic formations for permanent storage - is one option that is receiving considerable attention. NETL is devoted to improving geologic carbon sequestration technology by funding research projects aimed at removing barriers to commercial-scale


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cell Cathodes: Solid Oxide Fuel Cell Cathodes: Unraveling the Relationship among Structure, Surface Chemistry, and Oxygen Reduction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The Boston University (BU) project was competitively selected to acquire the fundamental


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials for Robust Repair Materials for Robust Repair of Leaky Wellbores in CO2 Storage Formations Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-fired Pressurized Fluidized Bed Oxy-fired Pressurized Fluidized Bed Combustor Development and Scale-up for New and Retrofit Coal-fired Power Plants Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy-combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Quantification Quantification of Wellbore Leakage Risk Using Non-Destructive Borehole Logging Techniques Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Storage Research Storage Research Carbon capture and storage (CCS) is a key component of the U.S. carbon management portfolio. Numerous studies have shown that CCS can account for up to 55 percent of the emissions reductions needed to stabilize and ultimately reduce atmospheric concentrations of CO 2 . NETL's Carbon Storage Program is readying CCS technologies for widespread commercial deployment by 2020. The program's goals are:


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Sequestration Sequestration Training and Research Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO2). Carbon capture and storage (CCS) technologies offer great potential for reducing CO2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess the skills required for implementing and deploying CCS technologies.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gulf of Mexico Miocene CO Gulf of Mexico Miocene CO 2 Site Characterization Mega Transect Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional storage types are porous permeable clastic or carbonate rocks that have


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE Leads Collaborative Effort DOE Leads Collaborative Effort to Quantify Environmental Changes that Coincide with Shale Gas Development Background DOE's National Energy Technology Laboratory (NETL) is leading a joint industry/ government research project to document environmental changes that occur during the lifecycle of shale gas development. The research plan calls for one year of environmental monitoring before development takes place to establish baseline conditions and account for seasonal variations. Monitoring then will continue through the different stages of unconventional shale gas development including: road and pad construction, drilling, and hydraulic fracturing, and for at least one year of subsequent production operations. The study will take place at a Range Resources-Appalachia


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

General Electric General Electric Background GE Power & Water, along with GE Global Research Center, has an ongoing U.S. Depart- ment of Energy (DOE) program to develop gas turbine technology for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). GE is broadening this development effort, along with expanding applicability to industrial applications such as refineries and steel mills under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines with industrial CCS. ARRA industrial technology acceleration,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Livermore National Laboratory Livermore National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop carbon capture and storage (CCS) technologies to capture, separate, and store carbon dioxide (CO 2 ) in order to reduce green-house gas emissions without adversely influencing energy use or hindering economic growth. Carbon sequestration technologies capture and store CO 2 by injecting and permanently storing it in underground geologic formations. NETL is working to advance geologic carbon sequestration technology by funding research projects that aim to accelerate deployment and remove barriers to commercial-scale carbon sequestration. Lawrence Livermore National Laboratory


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

r r oj e c t Fac t s Advanced Research Micro-Structured Sapphire Fiber Sensors for Simultaneous Measurements of High Temperature and Dynamic Gas Pressure in Harsh Environments Background Securing a sustainable energy economy by developing affordable and clean energy from coal and other fossil fuels is central to the mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL). To further this mission, NETL funds research and development of novel sensors that can function under the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-Fuel Turbo Machinery Oxy-Fuel Turbo Machinery Development for Energy Intensive Industrial Applications-Clean Energy Systems Background Clean Energy Systems (CES), with support from Siemens Energy and Florida Turbine Technologies (FTT), has an ongoing U.S. Department of Energy (DOE) program to develop an oxy-fuel combustor for highly efficient near zero emission power plants. CES is expanding this development for an industrial-scale, oxy-fuel reheat combustor- equipped intermediate-pressure oxy-fuel turbine (IP-OFT) under the American Recovery and Reinvestment Act (ARRA). Through the design, analysis, and testing of a modified Siemens SGT-900 gas turbine, the team will demonstrate a simple-cycle oxy-fuel system. ARRA funding is accelerating advancement in OFT technology for


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Passive Wireless Acoustic Wave Sensors Passive Wireless Acoustic Wave Sensors for Monitoring CO 2 Emissions for Geological Sequestration Sites Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO 2 ) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO 2 into underground formations that have the ability to securely contain the CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Criteria for Flame- Criteria for Flame- holding Tendencies within Premixer Passages for High Hydrogen Content Fuels-University of California, Irvine Background The gas turbine community must develop low emissions systems while increasing overall efficiency for a widening source of fuels. In this work, the University of California, Irvine (UCI) will acquire the fundamental knowledge and understanding to facilitate the development of robust, reliable, and low emissions combustion systems with expanded high hydrogen content (HHC) fuel flexibility. Specifically, understanding flashback and the subsequent flameholding tendencies associated with geometric features found within combustor fuel/air premixers will enable the development of design guides to estimate flame holding tendencies for lean, premixed emission combustion systems


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combining Space Geodesy, Seismology, Combining Space Geodesy, Seismology, and Geochemistry for MVA of CO2 in Sequestration Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO2) leakage at CO2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO2, with a high level of confidence that the CO2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhanced Analytical Simulation Tool for Enhanced Analytical Simulation Tool for CO2 Storage Capacity Estimation and Uncertainty Quantification Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Microsoft Word - 2014 WVSB - WV HS letter (generic for PDF).docx  

NLE Websites -- All DOE Office Websites (Extended Search)

of the Secretary of Energy, I am pleased to announce the opening of the 2014 National Science Bowl, a tournament-style academic competition challenging students in the fields...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Surface-Modified Electrodes: Enhancing Surface-Modified Electrodes: Enhancing Performance Guided by In-Situ Spectroscopy and Microscopy- Stanford University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by mass and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Eddy Simulation Modeling of Large Eddy Simulation Modeling of Flashback and Flame Stabilization in Hydrogen-Rich Gas Turbines using a Hierarchical Validation Approach- University of Texas at Austin Background The focus of this project is the development of advanced large eddy simulation (LES)-based combustion modeling tools that can be used to design low emissions combustors burning high hydrogen content fuels. The University of Texas at Austin (UT) will develop models for two key topics: (1) flame stabilization, lift- off, and blowout when fuel-containing jets are introduced into a crossflow at high pressure, and (2) flashback dynamics of lean premixed flames with detailed description of flame propagation in turbulent core and near-wall flows. The jet- in-crossflow (JICF) configuration is widely used for rapid mixing of reactants


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficient Efficient Regeneration of Physical and Chemical Solvents for CO 2 Capture Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial Scale CO2 Injection and Commercial Scale CO2 Injection and Optimization of Storage Capacity in the Southeastern United States Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Turbine Thermal Management-NETL-RUA Turbine Thermal Management-NETL-RUA Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is researching advanced turbine technology with the goal of producing reliable, affordable, and environmentally friendly electric power in response to the nation's increasing energy challenges. With the Hydrogen Turbine Program, NETL is leading the research, development, and demonstration of technologies to achieve power production from high-hydrogen-content fuels derived from coal that is clean, efficient, and cost-effective, and minimizes carbon dioxide (CO 2 ) emissions, and will help maintain the nation's leadership in the export of gas turbine equipment. The NETL Regional University Alliance (RUA) is an applied research collaboration that


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scoping Studies to Evaluate the Benefits Scoping Studies to Evaluate the Benefits of an Advanced Dry Feed System on the Use of Low Rank Coal in Integrated Gasification Combined Cycle Background Gasification of coal or other solid feedstocks (biomass, petroleum coke, etc.) produces synthesis gas (syngas), which can be cleaned and used to produce electricity and a variety of commercial products that support the U.S. economy, decrease U.S. dependence on oil imports, and meet current and future environmental emission standards. The major challenge is cost, which needs to be reduced to make integrated gasification combined cycle (IGCC) technology competitive. An IGCC plant combines a combustion turbine operating on a gasified fuel stream--syngas--with a steam turbine to capture what would otherwise be waste heat. Currently, the estimated cost of power from IGCC is higher than


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reliability and Durability of Materials Reliability and Durability of Materials and Components for SOFCs - Oak Ridge National Laboratory Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) has a mission to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Oak Ridge National Laboratory's (ORNL) project was selected to acquire the fundamental


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

SOFC Protection Coatings Based on a SOFC Protection Coatings Based on a Cost-Effective Aluminization Process- NexTech Materials Background To make solid oxide fuel cell (SOFC) systems easier to manufacture and reduce costs, less expensive stainless steels have been substituted into the stack design as alternatives to ceramic interconnects. Stainless has also been substituted for high-cost, nickel-based superalloys in balance of plant (BOP) components. For successful implementation of these steels, protective coatings are necessary to protect the air-facing metal surfaces from high-temperature corrosion/oxidation and chromium (Cr) volatilization. NexTech Materials Ltd. (NexTech) will develop an aluminide diffusion coating as a low- cost alternative to conventional aluminization processes and evaluate the ability of the


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Patricia Rawls Patricia Rawls Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-5882 patricia.rawls@netl.doe.gov Sankaran Sundaresan Principal Investigator Princeton University Department of Chemical Engineering Princeton, NJ 08544 609-258-4583 sundar@princeton.edu PROJECT DURATION Start Date 10/01/2011 End Date 09/30/2014 COST Total Project Value $420,366 DOE/Non-DOE Share $300,000 / $120,366 Implementation and Refinement


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Methanol Economy Methanol Economy Background Fossil fuels such as coal, oil, and natural gas are composed of hydrocarbons with varying ratios of carbon and hydrogen. Consumption of hydrocarbons derived from fossil fuels is integral to modern day life in the U.S. Hydrocarbons are used as fuels and raw materials in the transportation sector and in many industrial production processes including chemicals, petrochemicals, plastics, pharmaceuticals, agrochemicals, and rubber.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

on Local and Regional Air on Local and Regional Air Quality Impacts of Oil and Natural Gas Development Goal The NETL research effort in improving the assessment of impacts to air quality from oil and gas exploration and production activities has the following goals: (1) using NETL's mobile air monitoring laboratory, conduct targeted on-site measurements of emissions from oil and gas production activities that may impact the environment and (2) use collected data in atmospheric chemistry and transport models to further understanding of local and regional air quality impacts. Background The development of shale gas and shale oil resources requires horizontal drilling and multi-stage hydraulic fracturing, two processes that have been known for many years but have only recently become common practice. In addition, fugitive atmospheric


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Evaluation of the Carbon Sequestration Evaluation of the Carbon Sequestration Potential of the Cambro Ordovician Strata of the Illinois and Michigan Basins Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strand- plain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef.


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Air Products and Chemicals, Inc.: Air Products and Chemicals, Inc.: Demonstration of CO2 Capture and Sequestration of Steam Methane Reforming Process Gas Used for Large-Scale Hydrogen Production Background Carbon dioxide (CO2) emissions from industrial processes, among other sources, are linked to global climate change. Advancing development of technologies that capture and store or beneficially reuse CO2 that would otherwise reside in the atmosphere for extended periods is of great importance. Advanced carbon capture, utilization and storage (CCUS) technologies offer significant potential for reducing CO2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. Under the Industrial Carbon Capture and Storage (ICCS) program, the U.S. Department


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Filtration to Improve Single Filtration to Improve Single Crystal Casting Yield-Mikro Systems Background Single crystal (SX) nickel superalloys are a primary material choice for gas turbine hot gas path component castings because of their high resistance to deformation at elevated temperatures. However, the casting yields of these components need to be improved in order to reduce costs and encourage more widespread use within the gas turbine industry. Low yields have been associated with a number of process-related defects common to the conventional casting of SX components. One innovative improvement, advanced casting filter designs, has been identified as a potential path toward increasing the yield rates of SX castings for high-temperature gas turbine applications. Mikro Systems, Inc. (Mikro) proposes to increase SX casting yields by developing


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Siemens Energy Siemens Energy Background Siemens Energy, along with numerous partners, has an ongoing U.S. Department of Energy (DOE) program to develop hydrogen turbines for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). Siemens Energy is expanding this program for industrial applications such as cement, chemical, steel, and aluminum plants, refineries, manufacturing facilities, etc., under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines for industrial CCS. ARRA industrial technology acceleration,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Design of Advanced Engineering Design of Advanced Hydrogen-Carbon Dioxide Palladium and Palladium/Alloy Composite Membrane Separations and Process Intensification Background Technologies for pre-combustion carbon dioxide (CO2) capture and economical hydrogen (H2) production will contribute to the development of a stable and sustainable U.S. energy sector. The integrated gasification combined cycle (IGCC) system can produce synthesis gas (syngas) that can be used to produce electricity, hydrogen, fuels, and/or chemicals from coal and coal/biomass-mixtures in an environmentally responsible manner. The water-gas shift (WGS) reaction is a key part of this process for production of H2. The application of H2 separation technology can facilitate the production of high-purity H2 from gasification-based systems, as well as allow for process


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhancement of SOFC Cathode Electro- Enhancement of SOFC Cathode Electro- chemical Performance Using Multi-Phase Interfaces- University of Wisconsin Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Materials Design of Computational Materials Design of Castable SX Ni-based Superalloys for IGT Blade Components-QuesTek Innovations Background Higher inlet gas temperatures in industrial gas turbines (IGTs) enable improved thermal efficiencies, but creep-the tendency of materials to deform gradually under stress-becomes more pronounced with increasing temperature. In order to raise inlet temperatures of IGTs, turbine blade materials are required to have superior creep rupture resistance. Nickel (Ni)-based single crystal (SX) blades have higher creep strength in comparison with directionally solidified blades and are widely used in aerospace engines. However, their use in IGTs, which require larger-size castings (two to three times the size needed in aerospace applications), is limited

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combined Pressure, Temperature Combined Pressure, Temperature Contrast, and Surface-Enhanced Separation of Carbon Dioxide (CO 2 ) for Post-Combustion Carbon Capture Background The mission of the U.S. Department of Energy/National Energy Technology Laboratory (DOE/NETL) Carbon Capture Research & Development (R&D) Program is to develop innovative environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. The Carbon Capture R&D Program portfolio of carbon dioxide (CO 2 ) emissions control tech- nologies and CO 2 compression is focused on advancing technological options for new and existing coal-fired


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Conductivity, High Thermal Conductivity, High Durability Thermal Barrier Coatings for IGCC Environments-University of Connecticut Background Improved turbine materials are needed to withstand higher component surface temperatures and water vapor content for successful development and deployment of integrated gasification combined cycle (IGCC) power plants. Thermal barrier coatings (TBCs) in particular are required to have higher surface temperature capability, lower thermal conductivity, and resistance to attack at high temperature by contaminants such as calcium-magnesium-alumina-silicate (CMAS) and water vapor. There is also a concurrent need to address cost and availability issues associated with rare earth elements used in all low thermal conductivity TBCs.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reducing Uncertainties in Model Reducing Uncertainties in Model Predictions via History Matching of CO2 Migration and Reactive Transport Modeling of CO2 Fate at the Sleipner Project, Norwegian North Sea Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is todevelop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Molecular Separations Using Micro- Molecular Separations Using Micro- Defect Free Ultra-Thin Films Background Current methods for separating carbon dioxide (CO 2 ) from methane (CH 4 ) in fuel gas streams are energy and cost-intensive. Molecular sieve membrane development for carbon capture has been pursued for several decades because of the potential these membranes have for high selectivity while using less energy than cryogenic separation methods and greater flux (permselectivity) than is possible from polymeric membranes. However, the adoption of molecular sieve membrane technology has been hindered by high production costs and the micro-defect fissures that always accompany this type of membrane when fabricated using conventional techniques. The Department of Energy's (DOE) National Energy Technology Laboratory (NETL), has


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Characterization of the South Characterization of the South Georgia Rift Basin for Source Proximal CO 2 Storage Background Carbon capture, utilization and storage (CCUS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional


File:EIA-Appalach5-eastWV-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

Eastern West Virginia and Western Maryland By 2001 Liquids Reserve Class Eastern West Virginia and Western Maryland By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.6 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern West Virginia and Western Maryland By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Maryland File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:41, 20 December 2010 Thumbnail for version as of 17:41, 20 December 2010 6,600 × 5,100 (18.6 MB) MapBot (Talk | contribs) Automated bot upload


File:EIA-Appalach6-WV-VA-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

LIQ.pdf LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.77 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory Scale Liquids Production Laboratory Scale Liquids Production and Assessment: Coal and Biomass to Drop-In Fuels Background A major problem with the production of liquid fuels from coal is that the production process and subsequent combustion of the fuel generate excessive greenhouse gases over the entire production and usage lifecycle. Adding lignocellulosic biomass (as a raw feed material) along with coal has the potential to reduce lifecycle greenhouse gas emissions to below those of petroleum products. Altex Technologies Corporation (Altex) has developed an innovative thermo-chemical process capable of converting coal and biomass to transportation fuel ready for blending. The Department of Energy (DOE) National Energy Technology Laboratory (NETL) has partnered with Altex to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Capture and Storage Training Carbon Capture and Storage Training Background Carbon capture, utilization, and storage (CCUS) technologies offer great potential for mitigating carbon dioxide (CO2) emissions emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will require a drastically expanded workforce trained in CCUS related disciplines, including geologists, engineers, scientists, and technicians. Training to enhance the existing CCUS workforce and to develop new professionals can be accomplished through focused educational initiatives in the CCUS technology area. Key educational topics include simulation and risk assessment; monitoring, verification, and accounting (MVA); geology-related


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Andrea Dunn Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Marte Gutierrez Principal Investigator Colorado School of Mines 1600 Illinois Street Golden, CO 80401 303-273-3468 Fax: 303-273-3602 mgutierr@mines.edu PROJECT DURATION Start Date 12/01/2009 End Date 5/31/2013 COST Total Project Value $297,505 DOE/Non-DOE Share $297,505 / $0 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Training and Research on Probabilistic Hydro-Thermo-Mechanical Modeling of Carbon Dioxide Geological Sequestration in Fractured Porous Rocks Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Efficiency Molten Bed Oxy- Coal Combustion with Low Flue Gas Recirculation Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO 2 ) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO 2 capture. Additionally, the program looks to accomplish this while maintaining near


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasification Characteristics of Gasification Characteristics of Coal/Biomass Mixed Fuels Background Domestically abundant coal is a primary energy source and when mixed with optimum levels of biomass during the production of liquid fuels may have lower carbon footprints compared to petroleum fuel baselines. Coal and biomass mixtures are converted via gasification into synthesis gas (syngas), a mixture of predominantly carbon monoxide and hydrogen, which can be subsequently converted to liquid fuels by Fischer-Tropsch chemistry. The Department of Energy (DOE) is supporting research focused on using coal and biomass to produce clean and affordable power, fuels and chemicals. The DOE's National Energy Technology Laboratory (NETL) is partnering with Leland Stanford Junior


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbonaceous Chemistry for Carbonaceous Chemistry for Computational Modeling (C3M) Description C3M is chemistry management software focused on computational modeling of reacting systems. The primary function of C3M is to provide direct links between r e l i a b l e s o u r c e s o f k i n e t i c information (kinetic modeling soft- ware, databases, and literature) and commonly used CFD software su ch as M FIX , FLUEN T, an d BARRACUDA with minimal effort from the user. C3M also acts as a virtual kinetic laboratory to allow a CFD practitioner or researcher to evaluate complex, large sets of kinetic expressions for reliability and suitability and can interact with spreadsheet and process models. Once the chemical model is built within C3M, the software also allows the user to directly export


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Phase III Xlerator Program: Electro-deposited Phase III Xlerator Program: Electro-deposited Mn-Co Alloy Coating for Solid Oxide Fuel Cell Interconnects-Faraday Technology Background Based on preliminary cost analysis estimates, Faraday Technology has shown that its FARADAYIC TM electrodeposition process for coating interconnects is cost competitive. Funding from the American Recovery and Reinvestment Act (ARRA) under the Small Business Innovation Research (SBIR) Phase III Xlerator Program will be directed toward developing, optimizing, and validating the FARADAYIC process as an effective and economical manufacturing method for coating interconnect materials with a manganese-cobalt (Mn-Co) alloy for use in solid oxide fuel cell (SOFC) stacks. This project is managed by the U.S. Department of Energy (DOE) National Energy


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Technology to Mitigate Syngas Technology to Mitigate Syngas Cooler Fouling Background Coal gasification, in conjunction with integrated gasification combined cycle (IGCC) power production, is under development to increase efficiency and reduce greenhouse gas emissions associated with coal-based power production. However, coal gasification plants have not achieved their full potential for superior performance and economics due to challenges with reliability and availability. In particular, performance of the syngas cooler located downstream of the gasifier has been an issue. The syngas cooler is a fire tube heat exchanger located between the gasifier and the gas turbine. The purpose of the syngas cooler is to cool the raw syngas from the gasifier and recover heat. Although


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Processing and Evaluation of Next Processing and Evaluation of Next Generation Oxygen Carrier Materials for Chemical Looping Combustion Background The Department of Energy (DOE) supports research towards the development of efficient and inexpensive CO 2 capture technologies for fossil fuel based power generation. The Department of Energy Crosscutting Research Program (CCR) serves as a bridge between basic and applied research. Projects supported by the Crosscutting Research Program conduct a range of pre-competitive research focused on opening new avenues to gains in power plant efficiency, reliability, and environmental quality by research in materials and processes, coal utilization science, sensors and controls, and computational energy science. Within the CCR, the University Coal Research (UCR) Program sponsors


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Studies to Enable Robust, Studies to Enable Robust, Reliable, Low Emission Gas Turbine Combustion of High Hydrogen Content Fuels-University of Michigan Background The University of Michigan will perform experimental and computational studies which can provide an improved and robust understanding of the reaction kinetics and other fundamental characteristics of combustion of high hydrogen content (HHC) fuels that are vital to advancing HHC turbine design and to making coal gasification power plants environmentally sustainable and cost- competitive. The scope of work includes Rapid Compression Facility (RCF) studies of HHC ignition delay times and hydroxyl radical (OH) time-histories, flame speeds, and flammability limits. A range of temperatures, pressures, and test gas mixture compositions will


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rick Dunst Rick Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 MS 922-273C Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Felicia Manciu Principal Investigator University of Texas at El Paso 500 West University Avenue El Paso, TX 79968-8900 915-747-5715 fsmanciu@utep.edu PROJECT DURATION Start Date 01/15/2009 End Date 12/15/2013 COST Total Project Value $249,546 DOE/Non-DOE Share $249,546 / $0


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Environmental Considerations and Environmental Considerations and Cooling Strategies for Vane Leading Edges in a Syngas Environment- University of North Dakota Background Cooling airfoil leading edges of modern first stage gas turbine vanes presents a con- siderable challenge due to the aggressive heat transfer environment and efficiency penalties related to turbine hot gas path cooling. This environment is made more complex when natural gas is replaced by high hydrogen fuels (HHF) such as synthesis gas (syngas) derived from coal gasification with higher expected levels of impurities. In this project the University of North Dakota (UND) and The Ohio State University (OSU) will explore technology opportunities to improve the reliability of HHF gas turbines by analyzing the effects


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Alternative Low-Cost Process for Alternative Low-Cost Process for Deposition of MCrAlY Bond Coats for Advanced Syngas/Hydrogen Turbine Applications-Tennessee Technological University Background One of the material needs for the advancement of integrated gasification combined cycle (IGCC) power plants is the development of low-cost effective manufacturing processes for application of coating architectures with enhanced performance and durability in coal derived synthesis gas (syngas)/hydrogen environments. Thermal spray technologies such as air plasma spray (APS) and high-velocity oxy-fuel (HVOF) are currently used to fabricate thermal barrier coating (TBC) systems for large land- based turbine components. In this research Tennessee Technological University (TTU) will develop metal chromium-aluminum-yttrium (MCrAlY; where M = nickel [Ni], cobalt

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid-Fueled Pressurized Chemical Solid-Fueled Pressurized Chemical Looping with Flue-Gas Turbine Combined Cycle for Improved Plant Efficiency and CO2 Capture Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hafnia-Based Nanostructured Hafnia-Based Nanostructured Thermal Barrier Coatings for Advanced Hydrogen Turbine Technology- University of Texas at El Paso Background Thermal barrier coatings (TBCs) are protective layers of low thermal conductivity ceramic refractory material that protect gas turbine components from high temperature exposure. TBCs improve efficiency by allowing gas turbine components to operate at higher temperatures and are critical to future advanced coal-based power generation systems. Next generation gas turbine engines must tolerate fuel compositions ranging from natural gas to a broad range of coal-derived synthesis gasses (syngas) with high hydrogen content. This will require TBCs to withstand surface temperatures much higher than those currently experienced by standard materials. In this project the University of Texas at El Paso (UTEP)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Direct Utilization of Coal Syngas in High Direct Utilization of Coal Syngas in High Temperature Fuel Cells-West Virginia University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. West Virginia University's (WVU) project will establish the tolerance limits of contaminant


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

and Geotechnical Site and Geotechnical Site Investigations for the Design of a CO2 Rich Flue Gas Direct Injection and Storage Facility in an Underground Mine in the Keweenaw Basalts Background Fundamental and applied research on carbon capture, utilization and storage (CCUS) technologies is necessary in preparation for future commercial deployment. These technologies offer great potential for mitigating carbon dioxide (CO2) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCUS technical and non-technical disciplines that are currently under-represented in the United States. Education and training


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

National Risk Assessment Partnership National Risk Assessment Partnership The Need for Quantitative Risk Assessment for Carbon Utilization and Storage Carbon utilization and storage-the injection of carbon dioxide (CO2) into permanent underground and terrestrial storage sites-is an important part of our nation's strategy for managing CO2 emissions. Several pilot- to intermediate-scale carbon storage projects have been performed in the U.S. and across the world. However, some hurdles still exist before carbon storage becomes a reality in the U.S. at a large scale. From a technical point of view, carbon storage risk analysis is complicated by the fact that all geologic storage sites are not created equally. Every potential site comes with an individual set of characteristics, including type of storage formation, mineral make-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Model Development-LG Fuel Model Development-LG Fuel Cell Systems Background In this congressionally directed project, LG Fuel Cell Systems Inc. (LGFCS), formerly known as Rolls-Royce Fuel Cell Systems (US) Inc., is developing a solid oxide fuel cell (SOFC) multi-physics code (MPC) for performance calculations of their fuel cell structure to support product design and development. The MPC is based in the computational fluid dynamics software package STAR-CCM+ (from CD-adapco) which has been enhanced with new models that allow for coupled simulations of fluid flow, porous flow, heat transfer, chemical, electrochemical and current flow processes in SOFCs. Simulations of single cell, five-cell, substrate and bundle models have been successfully validated against experimental data obtained by LGFCS. The MPC is being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

of the Highest- of the Highest- Priority Geologic Formations for CO 2 Storage in Wyoming Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strand- plain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Assessment of Factors Influencing Assessment of Factors Influencing Effective CO2 Storage Capacity and Injectivity in Eastern Gas Shales Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reflection Reflection Seismic Monitoring and Reservoir Modeling for Geologic CO2 Sequestration Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Dry Sorbent Technology Dry Sorbent Technology for Pre-Combustion CO 2 Capture Background An important component of the Department of Energy (DOE) Carbon Capture Program is the development of carbon capture technologies for power systems. Capturing carbon dioxide (CO 2 ) from mixed-gas streams is a first and critical step in carbon sequestration. To be technically and economically viable, a successful separation method must be applicable to industrially relevant gas streams at realistic temperatures and practical CO 2 loading volumes. Current technologies that are effective at separating CO 2 from typical CO 2 -containing gas mixtures, such as coal-derived shifted synthesis gas (syngas), are both capital and energy intensive. Research and development is being conducted to identify technologies that will provide improved economics and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gas Turbine Thermal Gas Turbine Thermal Performance-Ames Laboratory Background Developing turbine technologies to operate on coal-derived synthesis gas (syngas), hydrogen fuels, and oxy-fuels is critical to the development of advanced power gener-ation technologies such as integrated gasification combined cycle and the deployment of near-zero-emission type power plants with capture and separation of carbon dioxide (CO 2 ). Turbine efficiency and service life are strongly affected by the turbine expansion process, where the working fluid's high thermal energy gas is converted into mechanical energy to drive the compressor and the electric generator. The most effective way to increase the efficiency of the expansion process is to raise the temperature of the turbine's


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Statistical Analysis of CO2 Exposed Wells Statistical Analysis of CO2 Exposed Wells to Predict Long Term Leakage through the Development of an Integrated Neural-Genetic Algorithm Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reactive Transport Models with Reactive Transport Models with Geomechanics to Mitigate Risks of CO2 Utilization and Storage Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

a Prototype Commercial a Prototype Commercial Gasifier Sensor Background Integrated gasification combined cycle (IGCC) technology has the potential to improve the efficiency and environmental performance of fossil fuel based electric power production. During the IGCC process, coal and/or biomass is gasified at high temperature and pressure to form synthesis gas (syngas), a mixture of hydrogen, carbon monoxide, carbon dioxide, and small amounts of contaminants such as hydrogen sulfide. The syngas can be used to produce power, chemicals, and/or fuels. The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) Gasification Technologies Program is focused on enhancing the performance of gasification systems, thus enabling U.S. industry to improve the competitiveness of


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Phase III Xlerator Program: Rapid Phase III Xlerator Program: Rapid Commercialization of Advanced Turbine Blades for IGCC Power Plants-Mikro Systems Background Mikro Systems, Inc. is developing their proprietary TOMO SM manufacturing technology to produce turbine blades with significantly improved internal cooling geometries that are beyond current manufacturing state-of-the-art, thus enabling higher operating temperatures. Funding from the American Recovery and Reinvestment Act (ARRA) under the Small Business Innovation Research (SBIR) Phase III Xlerator Program will be directed towards accelerating commercial adoption of TOMO SM technology by leading turbine manufacturers through the demonstration of superior manufacturability, cost, and performance. Ultimately, this technology will lead to improved efficiency


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Non-Thermal Plasma for Fossil Energy Non-Thermal Plasma for Fossil Energy Related Applications Background The U.S. Department of Energy is investigating various non-thermal plasma tech- nologies for their catalytic properties related to fossil energy conversion and carbon dioxide decomposition. Non-thermal plasma is an ionized gas comprised of a mixture of charged particles (electrons, ions), active chemical radicals (O 3 , O, OH), and highly excited species that are known to accelerate reforming reactions in


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Training Toward Advanced 3-D Seismic Training Toward Advanced 3-D Seismic Methods for CO 2 Monitoring, Verification, and Accounting Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effective- ness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO 2 ) to reduce greenhouse gas (GHG) emissions without adversely af fecting energy use or hindering economic grow th. Geologic carbon storage involves the injection of CO 2 into underground formations that have the ability to securely contain the CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Cathode Surface Chemistry and Cathode Surface Chemistry and Optimization Studies-Carnegie Mellon University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Carnegie Mellon University's (CMU) project was selected to acquire the fundamental knowledge and understanding that will facilitate research and development to enhance


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

a Coal-Biomass to Liquids a Coal-Biomass to Liquids Plant in Southern West Virginia Background Concerns regarding global supplies of oil, energy security, and climate change have generated renewed interest in alternative energy sources. The production of liquid fuels from coal provides an option for reducing petroleum use in the U.S. transportation sector and enhancing national and economic security by decreasing the nation's reliance on foreign oil. Two basic methods can be employed to produce liquid fuels


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Creep-Fatigue-Environment Creep-Fatigue-Environment Interactions in Steam Turbine Rotor Materials for Advanced Ultrasupercritical Coal Power Plants Background The U.S. Department of Energy (DOE) promotes the advancement of computational capabilities to develop materials for advanced fossil energy power systems. The DOE's National Energy Technology Laboratory (NETL) Advanced Research (AR) Program is working to enable the next generation of Fossil Energy (FE) power systems. One goal of the AR Materials Program is to conduct research leading to a scientific understanding of high-performance materials capable of service in the hostile environments associated with advanced ultrasupercritical (A-USC) coal-fired power plants. A-USC plants will increase coal-fired power plant efficiency by allowing operation

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL's Fluid Chemistry Analysis NETL's Fluid Chemistry Analysis Capacity Background Establishing the geochemistry of surface and ground waters requires an arsenal of techniques devoted to determining the constituents these waters contain and the environment in which they exist. Many standard techniques have been developed over the years, and new ones continue to be explored as more complex matrices and harsher environments are encountered. Deep geologic storage of carbon dioxide and the development of unconventional oil and gas resourses are two areas of current concern where the study of geochemical processes is challenging due to the complex nature of the natural samples, and where routine analytical techniques are being pushed to their limits. The facilities at NETL include both conventional and cutting-edge instrumentation


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

29,759 29,759 PROJECT NUMBER FWP-2012.03.03 Task 3 Conversion and Fouling Background Coal and biomass gasification is an approach to cleaner power generation and other uses of these resources. Currently, the service life of gasifiers does not meet the performance needs of users. Gasifiers fail to achieve on-line availability of 85-95 percent in utility applications and 95 percent in applications such as chemical production. The inability to meet these goals has created a potential roadblock to widespread acceptance and commercialization of advanced gasification technologies. Gasifier output is a hot gas mixture consisting primarily of hydrogen and carbon monoxide (CO), known as synthesis gas (syngas). The syngas cooler is one of the key components identified as negatively impacting gasifier availability. Ash originating from impurities


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Compact Eye-safe Scanning Differential Compact Eye-safe Scanning Differential Absorption LIDAR (DIAL) for Spatial Mapping of Carbon Dioxide for MVA at Geologic Carbon Sequestration Sites Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Energy California Project Hydrogen Energy California Project Background A need exists to further develop carbon management technologies that capture and store or beneficially reuse carbon dioxide (CO 2 ) that would otherwise be emitted into the atmosphere from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. Under the Clean Coal Power Initiative (CCPI) Round 3 program, the U.S. Department of Energy (DOE) is providing financial assistance, including funding under the American Recovery and Reinvestment Act (ARRA) of 2009, to industry to demonstrate the commercial viability of technologies that will capture CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Simulation of CO Simulation of CO 2 Leakage and Caprock Remediation Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the environment, and can provide the basis for establishing carbon credit trading markets


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Pressure Membrane Contactors for Pressure Membrane Contactors for CO 2 Capture Background The mission of the U.S. Department of Energy/National Energy Technology Laboratory (DOE/NETL) Carbon Capture Research & Development (R&D) Program is to develop innovative environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. The Carbon Capture R&D Program portfolio of carbon dioxide (CO 2 ) emissions control technologies and CO 2 compression is focused on advancing technological options for new and existing coal- fired power plants in the event of carbon constraints. Post-combustion separation and capture of CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Shizhong Yang Shizhong Yang Principal Investigator Department of computer science/LoNI southern University and a&M college Baton rouge, Louisiana 70813 225-771-2060 shizhong_yang@subr.edu PROJECT DURATION Start Date End Date 06/01/2012 05/31/2015 COST Total Project Value $200,000 DOE/Non-DOE Share $200,000 / $0 Novel Nano-Size Oxide Dispersion Strengthened Steels Development through Computational and Experimental Study Background Ferritic oxide dispersion strengthened (oDs) steel alloys show promise for use at higher temperatures than conventional alloys due to their high-temperature oxidation resistance and dislocation creep properties. the development of oDs alloys with nanoscale powders of transition metal oxides (yttrium and chromium) dispersed in


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Clean Coal Power Initiative (CCPI 3) Clean Coal Power Initiative (CCPI 3) NRG Energy: W.A. Parish Post-Combustion CO2 Capture and Sequestration Project Background Additional development and demonstration is needed to improve the cost and efficiency of carbon management technologies that capture and store carbon dioxide (CO 2 ) that would otherwise be emitted from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. The U.S. Department of Energy (DOE) is providing financial assistance through the Clean Coal Power Initiative (CCPI) Round 3, which includes funding from the American Recovery and Reinvestment Act (ARRA), to demonstrate the commercial viability


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Radiocarbon as a Reactive Tracer for Radiocarbon as a Reactive Tracer for Tracking Permanent CO2 Storage in Basaltic Rocks Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Degradation of TBC Systems in Degradation of TBC Systems in Environments Relevant to Advanced Gas Turbines for IGCC Systems- University of Pittsburgh Background The conditions inside integrated gasification combined cycle (IGCC) systems, such as high steam levels from hydrogen firing, high carbon dioxide steam mixtures in oxy- fired systems, and different types of contaminants, introduce complexities associated with thermal barrier coating (TBC) durability that are currently unresolved. In this work the University of Pittsburgh will team with Praxair Surface Technologies (PST) to deter- mine the degradation mechanisms of current state-of-the-art TBCs in environments consisting of deposits and gas mixtures that are representative of gas turbines using coal-derived synthesis gas (syngas).


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Cost Alloys for High-Temperature Low-Cost Alloys for High-Temperature SOFC Systems Components - QuesTek Innovations Background One of the key opportunities for cost reduction in a solid oxide fuel cell (SOFC) system is the set of balance of plant (BOP) components supporting the fuel cell itself, including the heat exchanger and air/fuel piping. These represent about half of the overall cost of the system. A major enabling technological breakthrough is to replace incumbent nickel-based superalloys in high-temperature BOP components with low-cost ferritic stainless steel. However, the ferritic alloys are unsuitable for SOFC application without additional coatings due to the inherent volatile nature of the alloy's chromium oxide (Cr2O3) element, which tends to poison the fuel cell's cathode


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Southwestern United States Carbon Southwestern United States Carbon Sequestration Training Center Background Carbon capture, utilization, and storage (CCUS) technologies offer great potential for mitigating carbon dioxide (CO2) emissions emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will require a drastically expanded workforce trained in CCUS related disciplines, including geologists, engineers, scientists, and technicians. Training to enhance the existing CCUS workforce and to develop new professionals can be accomplished through focused educational initiatives in the CCUS technology area. Key educational topics include simulation and risk assessment; monitoring, verification,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Beneficial Use of CO2 in Precast Beneficial Use of CO2 in Precast Concrete Products Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Barrier Coatings for Thermal Barrier Coatings for Operation in High Hydrogen Content Fueled Gas Turbines-Stony Brook University Background Traditional thermal barrier coatings (TBCs) based on yttria-stabilized zirconia (YSZ) will likely not be suitable in gas turbines used in integrated gasification combined cycle (IGCC) power plants. This is due to higher operating temperatures that will not only affect phase stability and sintering but will accelerate corrosive degradation phenomena. Coatings provide a framework to combat degradation issues and provide performance improvements needed for higher temperature environments. The Center for Thermal Spray Research (CTSR) at Stony Brook University, in partnership with its industrial Consortium for Thermal Spray Technology, is investigating science and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Cooling for IGCC Turbine Cooling for IGCC Turbine Blades-Mikro Systems Background Turbine blade and vane survivability at higher operating temperatures is the key to improving turbine engine performance for integrated gasification combined cycle (IGCC) power plants. Innovative cooling approaches are a critical enabling technology to meet this need. Mikro Systems, Inc. is applying their patented Tomo-Lithographic Molding (TOMO) manufacturing technology to produce turbine blades with significantly improved internal cooling geometries that go beyond the current manufacturing state-of-the-art to enable higher operating temperatures. This project addresses two important aspects. First is the need to increase the quality and reliability of the core manufacturing process capability to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combustion Dynamics in Multi-Nozzle Combustion Dynamics in Multi-Nozzle Combustors Operating on High- Hydrogen Fuels-Pennsylvania State University Background Combustion dynamics is a major technical challenge to the development of efficient, low emission gas turbines. Current information is limited to single-nozzle combustors operating on natural gas and neglects combustors with configurations expected to meet operability requirements using a range of gaseous fuels such as coal derived synthesis gas (syngas). In this project, Pennsylvania State University (Penn State) in collaboration with Georgia Institute of Technology (Georgia Tech) will use multiple-nozzle research facilities to recreate flow conditions in an actual gas turbine to study complicated interactions between flames that can aggravate the combustion dynamics in syngas-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Summit Texas Clean Energy, LLC: Texas Summit Texas Clean Energy, LLC: Texas Clean Energy Project: Pre-Combustion CO 2 Capture and Sequestration Background A need exists to further develop carbon management technologies that capture and store, or beneficially reuse, carbon dioxide (CO 2 ) that would otherwise be emitted into the atmosphere from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer the potential to significantly reduce CO 2 emissions and mitigate the anthropogenic contribution to global climate change, while substantially reducing or minimizing the economic impacts of the solution. Under Round 3 of the Clean Coal Power Initiative (CCPI), the U.S. Department of Energy (DOE) is providing up to $450 million in co-funded financial assistance to industry,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Solar-Based Catalytic Efficiency Solar-Based Catalytic Structure for CO2 Reforming Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE-WRI Cooperative Research and DOE-WRI Cooperative Research and Development Program for Fossil Energy- Related Resources Background Our nation's demand for cleaner and more efficient fossil energy production will increase during the coming decades, necessitating the development of new energy technologies to achieve energy independence in an environmentally responsible manner. The University of Wyoming (UW) Research Corporation's Western Research Institute (WRI) has been supporting the U.S. Department of Energy (DOE) Office of Fossil Energy (FE) and its mission of developing fossil energy and related environmental technologies for over two decades. Federal funding for these research efforts has usually been provided through congressionally mandated cooperative agreements, with cost share


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Unconventional Resources Unconventional Resources Background Natural gas and crude oil provide two-thirds of our Nation's primary energy supply and will continue to do so for at least the next several decades, as the Nation transitions to a more sustainable energy future. The natural gas resource estimated to exist within the United States has expanded significantly, but because this resource is increasingly harder to locate and produce, new technologies are required to extract it. Under the Energy Policy Act of 2005, the National Energy Technology Laboratory is charged with developing a complementary research program supportive of improving safety and minimizing the environmental impacts of activities related to unconventional natural gas and other petroleum resource exploration and production technology

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Staged, High-Pressure Oxy-Combustion Staged, High-Pressure Oxy-Combustion Technology: Development and Scale-up Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available CO2 capture and storage significantly reduces efficiency of the power cycle. The aim of the ACS program is to develop advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while maintaining near zero emissions of other flue gas pollutants.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cells Operating on Solid Oxide Fuel Cells Operating on Alternative and Renewable Fuels- Pennsylvania State University Background In this congressionally directed project, the Earth and Mineral Science (EMS) Energy Institute at Pennsylvania State University (PSU) focuses on the development of fuel processors, reforming catalysts, and chemical sorbents to support the production of electricity from anaerobic digester gas (ADG) and ultra-low sulfur diesel (ULSD) via solid-oxide fuel cells (SOFCs). PSU will use the fuel processors, reforming catalysts, and chemical sorbents developed under this work to transform and clean ADG and ULSD into a syngas stream suitable as a feedstock for SOFCs. This project is managed by the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL), whose mission is to advance energy options to fuel


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cell Cathode Enhancement Solid Oxide Fuel Cell Cathode Enhancement Through a Vacuum-assisted Infiltration- Materials and Systems Research, Inc. Background Solid oxide fuel cell (SOFC) technology promises to provide an efficient method to generate electricity from coal-derived synthesis gas (syngas), biofuels, and natural gas. The typical SOFC composite cathode (current source) possesses excellent performance characteristics but is subject to chemical stability issues at elevated temperatures both during manufacturing and power generation. Costs attributed to the cathode and its long-term stability issues are a current limitation of SOFC technologies. These must be addressed before commercial SOFC power generation can be realized. Materials and Systems Research, Inc. (MSRI) will develop a vacuum-assisted infiltration


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Study of the Durability of Doped Study of the Durability of Doped Lanthanum Manganite and Cobaltite Based Cathode Materials under "Real World" Air Exposure Atmospheres- University of Connecticut Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Comprehensive Comprehensive Monitoring Techniques to Verify the Integrity of Geological Storage Reservoirs Containing Carbon Dioxide Background Research aimed at monitoring the long-term storage stability and integrity of carbon dioxide (CO2) stored in geologic formations is one of the most pressing areas of need if geological storage is to become a significant factor in meeting the United States' stated objectives to reduce greenhouse gas emissions. The most promising geologic formations under consideration for CO2 storage are active and depleted oil and gas formations, brine formations, and deep, unmineable coal seams. Unfortunately, the long-term CO2 storage capabilities of these formations are not yet well understood. Primary Project Goal The goal of this effort is to develop


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

SO SO 2 -Resistent Immobilized Amine Sorbents for CO 2 Capture Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies for Monitoring Technologies for Monitoring CO 2 Saturation and Pore Pressure in Geologic Formations: Linking the Chemical and Physical Effects to Elastic and Transport Properties Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Monitoring and Numerical Modeling of Monitoring and Numerical Modeling of Shallow CO 2 Injection, Greene County, Missouri Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO 2 ). Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Tagging Carbon Dioxide to Enable Tagging Carbon Dioxide to Enable Quantitative Inventories of Geological Carbon Storage Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Nanoporous, Metal Carbide, Surface Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations Background Both coal and biomass are readily available in the U.S. and can be thermally processed to produce hydrogen and/or power. The produced hydrogen can be sent directly to a fuel cell or hydrogen turbines for efficient and environmentally clean power generation. More efficient hydrogen production processes need to be developed before coal and biomass can become economically viable sources of hydrogen. To meet this need, the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is partnering with the Colorado School of Mines and Pall Corporation to develop nanoporous metal carbide surface diffusion membranes for use in high temperature


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigation on Flame Characteristics Investigation on Flame Characteristics and Burner Operability Issues of Oxy-Fuel Combustion Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently underrepresented in the United States. Education and training activities


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Object Optimization Approaches Object Optimization Approaches for the Design of Carbon Geological Sequestration Systems Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO 2 ). Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Sensors and Control Sensors and Control CONTACTS Ben Chorpening Sensors & Controls Technical Team Coordinator 304-285-4673 benjamin.chorpening@netl.doe.gov Steven Woodruff Principal Investigator 304-285-4175 steven.woodruff@netl.doe.gov Michael Buric Co-Principal Investigator 304-285-2052 michael.buric@netl.doe.gov Raman Gas Composition Sensor System for Natural Gas and Syngas Applications Goal The goal of this project is to develop and test a Raman laser spectroscopy system for responsive gas composition monitoring, and to transfer the technology to industry for commercial implementation. The instrument provides state-of-the-art improvement of reduced size and increased sensitivity and sample rate to facilitate the process control


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Joining of Advanced Joining of Advanced High-Temperature Materials Background To remain economically competitive, the coal-fired power generation industry needs to increase system efficiency, improve component and system reliability, and meet ever tightening environmental standards. In particular, cost-effective improvements in thermal efficiency are particularly attractive because they offer two potential benefits: (1) lower variable operating cost via increased fuel utilization (fuel costs represent over 70 percent of the variable operating cost of a fossil fuel-fired power plant) and (2) an economical means of reducing carbon dioxide (CO2) and other emissions. To achieve meaningful gains, steam pressure and temperature must be increased to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Basin-Scale Leakage Risks from Geologic Basin-Scale Leakage Risks from Geologic Carbon Sequestration: Impact on Carbon Capture and Storage Energy Market Competitiveness Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the


PUBLICATION 460-131 www.ext.vt.edu  

E-Print Network (OSTI)

, but it is similar to that of other coal-mining states in the Appalachian coal region. Modern coal, waste rock, and low-grade coals from run-of-mine coal. Up to 50 percent of the raw, mined product may end up as refuse, particularly when the coal originates from longwall mining operations -- thin

Liskiewicz, Maciej


North Troy, VT Natural Gas Imports by Pipeline from Canada  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 1997 1998 1999 2000 2001 2002 View...


PUBLICATION 420-145 www.ext.vt.edu  

E-Print Network (OSTI)

such functions as sales, distribu- tion, pricing, promotion, products, and many others. Here is an example-satisfying products and services and to price, promote, distribute, and effect exchange of these products generally bring a price premium. Examples of these are specialty hardwood boards for the do

Liskiewicz, Maciej


Highgate Springs, VT Natural Gas Pipeline Imports From Canada...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 7,711 8,136 7,680 8,141 2000's 9,980 7,815 8,421 8,272 8,761 8,392 8,404 8,021 8,106 9,319...



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...


APPENDIX A1 Domestic (CONUS) Per Diem Rates -Effective October 1, 2010 State Primary Destination County  

E-Print Network (OSTI)

Manchester Bennington $71 VT Middlebury Addison $61 VT Montpelier Washington $61 VT Stowe Lamoille October 1



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...


Microsoft PowerPoint - How To Do Business with DOE Charleston WV Nov 14 2011 BOS.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Office of Small and Disadvantaged Business Utilization (OSDBU) Office of Small and Disadvantaged Business Utilization (OSDBU) Presenter: Nickolas A. Demer Senior Procurement Analyst Business Opportunities Session Charleston, West Virginia November 14, 2011 EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE Manhattan Project - August 1941 - Development of nuclear energy warheads Atomic Energy Act of 1946 - Established the Atomic Energy Commission (AEC) - Established the Atomic Energy Commission (AEC) - Civilian control of atomic energy weapons Atomic Energy Act of 1954 - Empowered AEC to also regulate commercial nuclear power industry 2 EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE EVOLUTION OF DOE Energy Reorganization Act of 1974 - Established Energy Research and Development Administration (ERDA) to manage R&D for nuclear


Feasibility study of wood-fired cogeneration at a Wood Products Industrial Park, Belington, WV. Phase II  

DOE Green Energy (OSTI)

Customarily, electricity is generated in a utility power plant while thermal energy is generated in a heating/cooling plant; the electricity produced at the power plant is transmitted to the heating/cooling plant to power equipments. These two separate systems waste vast amounts of heat and result in individual efficiencies of about 35%. Cogeneration is the sequential production of power (electrical or mechanical) and thermal energy (process steam, hot/chilled water) from a single power source; the reject heat of one process issued as input into the subsequent process. Cogeneration increases the efficiency of these stand-alone systems by producing these two products sequentially at one location using a small additional amount of fuel, rendering the system efficiency greater than 70%. This report discusses cogeneration technologies as applied to wood fuel fired system.

Vasenda, S.K.; Hassler, C.C.



1WV Business & Economic Review 1 Summer 2009 Volume 17 Summer 2009 West Virginia University College of Business and Economics  

E-Print Network (OSTI)

Provisions), Article 6a (Motor Vehicle Dealers, Distributors, Wholesalers and Manufacturers), http small employment shares in manufacturing; financial activities; information; trade, transportation share at 1.6 percent. Manufacturing Manufacturing employment in West Virginia in 2008 was 2.4 percentage

Mohaghegh, Shahab


Evaluation of 2 Percent CrMoWV HP/LP Rotor Gap Forging for Single Cylinder Steam Turbine Use  

Science Conference Proceedings (OSTI)

There has been considerable industry interest in developing a single shaft rotor configuration that uses the same rotor in the high-pressure (HP) as well as the Low Pressure (LP) sections of a steam turbine. This report evaluates an HP/LP rotor forging for single cylinder steam turbines.



Utility-Scale Smart Meter Deployments, Plans & Proposals  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

edisonfoundation.net/IEE edisonfoundation.net/IEE Utility-Scale Smart Meter Deployments, Plans & Proposals April 2010 Utility State Target Number of Meters Notes Resources AEP 1 IN, KY, MI, OH, OK, TX, VA, WV 5,000,000 AEP plans on deploying smart meters to all customers within their service territory and have deployed 10,000 meters to customers in South Bend, IN, and are presently deploying another 700,000 to AEP-Texas customers. Timing for the remaining deployments will depend on specific conditions in each of the seven operating company subsidiaries. AEP Corporate Sustainability Report 2009 2 Allegheny Power MD, PA, WV 700,000 Allegheny launched pilots in Morgantown, WV and Urbana, MD to test smart meters and thermostats (1,140 meters installed). In PA, Act 129 (2008)


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


APPENDIX A1 Domestic (CONUS) Per Diem Rates -Effective October 1, 2011 State Primary Destination County  

E-Print Network (OSTI)

Date M&IE Rate VT Middlebury Addison $61 VT Montpelier Washington $61 VT Stowe Lamoille October 1 March


Conserving the Connections: A Nationwide Inventory of State-Based Habitat Connectivity Analysis  

E-Print Network (OSTI)

of Transportation. Montpelier, VT. Personal Communicationin Vermont. Montpelier, VT. http://repositories.cdlib.org/Transportation, Montpelier, VT. http://www.aot.state.vt.us/

Feinberg, Jesse



West Virginia University 1 Governance and Administration  

E-Print Network (OSTI)

, Chairman, Charleston, WV · Edward L. Robinson, Charleston, WV · J. Robert Rogers, Hurricane, WV · Charles M and the Arts, Charleston, WV · David K. Hendrickson, Chairman, Charleston, WV · Paul L. Hill, Chancellor

Mohaghegh, Shahab


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

residential lots. RD takes roof runoff that has been collected in gutters and piped directly to streets, storm Management Handbook,"VCE publication 430-350. #12;2 of 6 to 10 inches, and adding 2 to 4 inches of compost

Liskiewicz, Maciej

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

recovery on coal surface-mined lands reclaimed in the Appala- chian region using different reclamation that will encourage native forest recovery on reclaimed coal surface mines. Table 2. Common species observed succession in surface coal mine reclamation. Minerals and the Environment 6(1): 10-22. Burger,J.A

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

the 1940s, surface mining for coal in Southwest Virginia has disturbed more than 100,000 acres of land disturbances such as coal mining. #12;3 and occasionally in the rocks around the coal seams. As discussed later. 1994. Improving coal surface mine reclamation in the central Appala- chian region. In: Rehabilitating

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

is essential to comply with the federal Surface Mining Control and Reclamation Act (SMCRA) by coal-mining seeding of vegetation on coal refuse; these practices may be adapted to reclamation of mine sites, but this is not a general practice in coal surface-mine reclamation. Quality should be considered carefully when purchasing

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

region, owners of lands mined for coal are increasingly interested in assuring that productive for- estsForestryReclamationApproach The Forestry Reclamation Approach (FRA) is a method for reclaiming coal-mined land to forest under SMCRA (see by coal-mining firms in past years to establish both hayland/pasture and unmanaged for- est postmining

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

of mined lands in the Appalachian coal region has resulted in the successful establishment and utilization that reduce forage quality and quantity, resulting in reduced cattle performance on reclaimed, coal-mined by coal mining. Incorporating goats Managing Shrub-Infested, Postmined Pasturelands With Goats and Cattle

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

to advances in reclamation science, Virginia coal mining operations can establish high-value, productive Success on Coal Surface Mines, describes grading practices that are recommended for use in reforestation Grading to Enhance Reforestation Success on Coal Surface Mines. Forest Reclamation Advisory No. 4

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

With the decline of coal-mining jobs in Virginia's coal- fields, availability of local employment in high in the coalfield region is a shortage of suitable industrial sites. In some cases, coal surface mines can create, compared to the woodlands and pastures typi- cally established on reclaimed mines in Virginia's coal

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

or have in the past been used for rec- lamation of coal-mined sites. Due to the nature of the land positive influences on botanical composition and invasive plant species control on reclaimed, coal-mined on reclaimed, coal-mined lands. Mixed grazing resulted in greater utilization of pasture resources, mainly due

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

, coal mining became the region's economic mainstay. After the virgin timber cut, the Appalachian forest and good plant- ing stock. The FRA method has been used successfully by many coal-mining firms productivity of land mined for coal. Thus, mining firms that can dem- onstrate the capability to restore

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

on mined lands in Virginia's coalfields. When active coal mines are being preparing for graz- ing use after concern on coal surface mines is pH. Generally, water used to support livestock should have a pH that is no less than 6.0. Highly acidic (low pH) water from coal mines can often be recognized visually from

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

The development of Southwest Virginia's coal mining region is limited by a lack of building sites. Much develop- ment. In recent years, widespread surface coal mining has created land that is favorably located treatment options is often an obstacle to residential development on reclaimed coal mines. In response

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

infrastructure construction, industrial recruitment, and business development. Reclaimed coal mines are widely typically employed by Appalachian coal surface mines; they are intended to minimize settlement- cialized compaction equipment will be cost-prohibitive for most coal-mining operations. An alternative

Liskiewicz, Maciej


Hinsdale, NH Wal-Mart's impact on small businesses in Brattleboro, VT : a case study.  

E-Print Network (OSTI)

??The debate over the effects of big box retail on smaller communities is one of the most contentious topics of public planning discourse. Many feel (more)

Sadlowski, Jin, 1970-




NLE Websites -- All DOE Office Websites (Extended Search)

Solar Thermal Test Facility in Albuquerque, New Mexico. The manufacturing of these solar panels is already approved under the original NEPA Control Number GFO-08-005. The...


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

primarily based on your LDL number. Persons with a history of heart disease may be put on a very restricted-modifiable Risk Factors Age: Male 45 years or older; Female 55 years or older Family history of premature CHD. · Choose foods low in total fat. · Select soft or liquid margarines or spreads that list liquid oil

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

style, material costs, and labor costs. Initial cost of construction can range from $4.00 per square foot for an open-sided barn to over $6.00 per square foot for a fully enclosed barn. 1 This represents of a 100-foot by 50-foot, open-sided farm storage building. Initial cost of the building is $20

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

never develop cancer despite years of exposure to tobacco, poor diet, alco- hol, sunlight, etc., while as carcinogens. For unlucky others, a combination of modi- fied genes and a suitable internal environment results, excessive ultraviolet light and radiation provides a strong defense against many common cancers. Food

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

explains the significant price increase of not just petroleum but most raw materials since 2000. During and assesses their impact on the Southwest region's transportation sector. Biofuel transportation requirements, biofuels constitute the focus of this research given the current level of development and potential

Liskiewicz, Maciej


Total power optimization combining placement, sizing and multi-Vt through slack distribution management  

Science Conference Proceedings (OSTI)

Power dissipation is quickly becoming one of the most important limiters in nanometer IC design for leakage increases exponentially as the technology scaling down. However, power and timing are often conflicting objectives during optimization. In this ...

Tao Luo; David Newmark; David Z. Pan



www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

is to minimize pesticide use and to define where such use is appropriate, while controlling pests effectively.S. Environmental Protection Agency of certain pesticides and biopesticides. Mostly, these are pest controls for use on a minor crop--that is, a crop grown on less than 300,000 acres nationwide. But IR-4 projects also address

Liskiewicz, Maciej

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

Hands ­ On Science with NOAA TITLE: Tying Science to History... Making Rope by Hand OVERVIEW, or wool yarn. INSTRUCTIONS: 1. Each participant should receive 2 lengths of single strand fiber about 15 is fascinating! Research and discuss the development of rope-making technology through human history. · Research

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

't suggest that later software versions have fewer errors. Avishai Wool Tel Aviv University Trends a poorer security history than others. Also, having all 65,536 TCP ports open is probably more risky than. A. Wool, "A Quantitative Study of Firewall Configura- tion Errors," Computer, vol. 37, no. 6, 2004

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

oxygen to the gasoline. Engine warranty Automobiles: Currently, all major automakers (Gen- eral Motors, with fuel ethanol play- ing an important role in this transition. Fuel ethanol can be blended with gasoline (from 10 percent to 85 percent), and thus reduce the amount of gasoline used. In the United States, corn

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

production to maximize marketability and by making modest increases in the selling price. Add fuel surcharges that adding a fuel surcharge to everything they sold during the spring would reverse their losses and restore afford that? Strongly consider adding delivery charges, or at least fuel surcharges, to delivery services

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

inter- mixed with open weedy areas. They also use riparian and wetland areas as sources of food, or sardine oil, · bear hounds or guard dogs to ward off depredating bears, · habitat manipulation (epp. Black Bear Conservation Committee. 1992. Black bear management handbook for Louisiana

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

-producing state, accounting for about half of the nation's supply. Minne- sota, Kansas, Louisiana, Mississippi for food in the United States are pro- duced in the southern states, primarily Louisiana, Mis- sissippi water gardens, and for stocking natural wetlands to attract waterfowl. Figure 38. Water Lily Figure 39

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

? If so, are there any risks associated with this approach? Biochar is a charcoal-based material of purported benefits of biochar usage in soils is long, but are these claims justified when biochar is used in Canadian soils? Are there any environmental risks associated with biochar usage? This talk will summarize

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

replaces them with high- protein foods such as beef, chicken, pork, eggs, and fish and high-fat foods of the Atkins Diet are to remove "carbo- hydrate cravings," "reset" the body's metabolism, and induce fat loss that insulin, not the types or quantity of foods, leads to an imbalanced metabolism and, ultimately, to fat

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

), rendered animal fats, or waste veg- etable oils (WVO). The major components of these feedstocks, and emissions. This pub- lication addresses producing one's own biodiesel fuel from waste oil, fats, and oilseed Fuels Inc. How Biodiesel Is Made Biodiesel is made through a chemical reaction between oils or fats

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

of tricylglycerols 2. Animal Fats The second group of feedstock for biodiesel produc- tion is fats and tallow derived

Liskiewicz, Maciej



E-Print Network (OSTI)

Pakistan Vêt. J., 22(4): 2002 STRESS MANAGEMENT FOLLOWING VACCINATION AGAINST COCCIDIOSISPathology, 'Department ofParasitology University ofVeterinary and Animal sciences, Lahore, Pakistan ABSTRACT The présent

Paris-Sud XI, Université de


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

·11 /2 Tbsp whole wheat flour · 1 /2 Tbsp whole wheat flour and 1 /2 Tbsp all-purpose flour Flour, 1 flour, result in a rye flour or whole wheat flour and reduced volume 1 /2 cup all-purpose flour and a · 3 /4 cup whole wheat flour or bran heavier product. flour and 1 /4 cup all-purpose flour ·1 cup rye

Liskiewicz, Maciej


Microsoft PowerPoint - AnnualReview1011_Westman_VT.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

Status - 50% complete * Synthetic data generated * Initial analysis completed Initial analysis completed Combination Receiver Array Plume Event Loc. 56 Spiral 750 Plume...


Selling the Alpine Frontier: The Development of Winter Resorts, Sports, and Tourism in Europe and America, 1865-1941  

E-Print Network (OSTI)

Cross Country Skiing (Montpelier, VT: privately printed,Cross Country Skiing. Montpelier, VT: privately printed,

Esson, Dylan Jim



The Cost of Enforcing Building Energy Codes: Phase 1  

E-Print Network (OSTI)

90% Compliance by 2017. Montpelier, VT: Vermont Department90% Compliance by 2017. Montpelier, VT : Vermont Department

Williams, Alison



The luxury second home market : an analysis of historical sales and property data at The Greenbrier Resort (White Sulphur Springs, WV)  

E-Print Network (OSTI)

The global economic expansion and subsequent creation of wealth as well as increased purchasing power and disposable income has contributed to the growth in the secondary home market. Over the past decade developers that ...

Kass, Hunter L. (Hunter Lindsay)



Multifunctional Carbon Nanomaterials  

Science Conference Proceedings (OSTI)

... Offices in Charleston (WV), Morgantown (WV) and Oak Ridge (TN) Expertise in Biomass fuels & products Fossil fuels & products ...



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael



Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


US Relations with Mexico and Central America, 1977-1999  

E-Print Network (OSTI)

United States Relations. Montpelier, VT: The Academy ofUnited States Relations. Montpelier, VT: The Academy ofUnited States Relations. Montpelier, VT: The Academy of

Rosenblum, Marc



NETL: NEPA Categorical Exclusions - January 2011 to March 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to March 2011 1 to March 2011 Archive (November 2009 -March 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 3/31/2011 The Oil Recovery Tool: Acoustic Source for Increased Oil Production Hydroacoustics Inc. Torrey, NY FE/SCNGO N 3/31/2011 National Biodiesel Foundation: Biodiesel Terminal Installation Project National Biodiesel Foundation Port Chester, NY EE/VT/PVT N 3/31/2011 Portable Raman Gas Composition Monitor Benjamin Chorpening Morgantown, WV FE/ORD Y 3/29/2011 Grant for State Sponsored RE and EE Projects - Montclair State University Solar Farm New Jersey Board of Public Utilities Montclair, NJ EE/PMC/IPOD Y 3/29/2011 RI Non-Utility Scale Renewable Energy Program Rhode Island Warwick, RI EE/PMC/IPOD Y 3/28/2011 Workforce Development Initiative Market Title North Carolina Multiple sites, NC EERE/PMC/IPOD


Graphic Comm Central http://teched.vt.edu:16080/gcc/[6/29/09 8:58:26 AM  

E-Print Network (OSTI)

Strips For Chelsea Handler, Jennifer Aniston Jealous! Marie Osmond Battles Brother Donny Osmond: Writes With Chelsea Handler Did Hulk Hogan Leak His Own Sex Tape? Brooklyn Decker Goes Brunette -- Better Blonde

Beex, A. A. "Louis"


A 65 nm Sub- V_{t} Microcontroller With Integrated SRAM and Switched Capacitor DC-DC Converter  

E-Print Network (OSTI)

Aggressive supply voltage scaling to below the device threshold voltage provides significant energy and leakage power reduction in logic and SRAM circuits. Consequently, it is a compelling strategy for energy-constrained ...

Verma, Naveen



E-Print Network (OSTI)

Pakistan Vêt. ./., 22(4): 2002 A STUDY ON THE PATHOGENESIS OF YOLK RETENTION IN BROILER CHICKS Laboratories Complex. Lahore, Pakistan ABSTRACT The présent project was designed to identify thé factors commonest cause of early chick mortality in Pakistan (Anjum, 1997). Whcn thé chick émerges from it's shell

Paris-Sud XI, Université de


Performance Measures for Complete, Green Streets: A Proposal for Urban Arterials in California  

E-Print Network (OSTI)

and Bicycle Policy Plan. Montpelier, VT: Vermont Agency ofand Bicycle Policy Plan. Montpelier, VT: Vermont Agency of

Macdonald, Elizabeth; Sanders, Rebecca; Anderson, Alia



,"West Virginia Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050WV3","N3010WV3","N3020WV3","N3035WV3","N3045WV3" "Date","Natural Gas Citygate Price in West Virginia (Dollars per Thousand Cubic Feet)","West Virginia...



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

Note: This page contains sample records for the topic "wv mi vt" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A novel finding of a low-molecular-weight compound, SMTP-7 ...  

Science Conference Proceedings (OSTI)

of Tris-HCl, pH 6.8, 4% (w/v) sodium dodecyl sulfate. (SDS), 0.04% (w/v) bromophenol blue, and 20% (w/v) sucrose. ... Treatment protocol. The mice with...


,"Vermont Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

80SVT3","N3050VT3","N3010VT3","N3020VT3","N3035VT3","N3045VT3" "Date","Vermont Natural Gas Imports Price (Dollars per Thousand Cubic Feet)","Vermont Natural Gas Pipeline and...


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


EIA Drilling Productivity Report  

U.S. Energy Information Administration (EIA) Indexed Site

Drilling Productivity Report Drilling Productivity Report For Center on Global Energy Policy, Columbia University October 29, 2013 | New York, NY By Adam Sieminski, Administrator The U.S. has experienced a rapid increase in natural gas and oil production from shale and other tight resources Adam Sieminski, EIA Drilling Productivity Report October 29, 2013 2 0 5 10 15 20 25 30 35 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) 0.0 0.4 0.8 1.2 1.6 2.0 2.4 2.8 2000 2002 2004 2006 2008 2010 2012 Eagle Ford (TX) Bakken (MT & ND) Granite Wash (OK & TX) Bonespring (TX Permian) Wolfcamp (TX Permian) Spraberry (TX Permian) Niobrara-Codell (CO) Woodford (OK)



Office of Scientific and Technical Information (OSTI)

AIR SEPARATION BY PRESSURE SWING ADSORPTION USING AIR SEPARATION BY PRESSURE SWING ADSORPTION USING SUPERIOR ADSORBENTS DE-FG26-98FT40115 FINAL TECHNICAL REPORT September 1, 1998 - August 31, 2001 Submitted to Dr. Kamalendu Das U.S. Department of Energy Federal Energy Technology Center 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 And FETC AAD Document Center Federal Energy Technology Center U.S. Department of Energy P. O. Box 10940 Pittsburgh, PA 15236-0940 By Ralph T. Yang Authors: Nick D. Hutson, Stefan C. Zajic, Salil U. Rege and Ralph T. Yang Department of Chemical Engineering University of Michigan Ann Arbor, MI 48109-2136 2 Table of Contents Page Disclaimer 3 Executive Summary 4 Chapter 1. Adsorption Properties and Structures of Pure Ag-Faujasites 7 Chapter 2. Mixed Ag-Li-X Zeolites and Their PSA Air Separation 48


Status and outlook for shale gas and tight oil development in the U.S.  

Gasoline and Diesel Fuel Update (EIA)

Joint Forum on US Shale Gas & Pacific Gas Markets Joint Forum on US Shale Gas & Pacific Gas Markets May 14, 2013 | New York, NY By Adam Sieminski, Administrator U.S. Shale Gas 2 Adam Sieminski , May 14, 2013 Domestic production of shale gas has grown dramatically over the past few years Adam Sieminski , May 14, 2013 3 0 5 10 15 20 25 30 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) shale gas production (dry) billion cubic feet per day Sources: LCI Energy Insight gross withdrawal estimates as of March 2013 and converted to dry production estimates with EIA-calculated average gross-to-dry shrinkage factors by state and/or shale play. Shale gas leads growth in total gas production through 2040 to


Multi-fluid shocks in clusters of galaxies: entropy, sigma_ v-T, M-T and L_x-T scalings  

E-Print Network (OSTI)

The nonthermal phenomena in clusters of galaxies are considered in the context of the hierarchical model of cosmic structure formation by accretion and merging of the dark matter (DM) substructures.Accretion and merging processes produce large-scale gas shocks. The plasma shocks are expected to be collisionless. In the course of cluster's aggregation, the shocks, being the main gas-heating agent, generate turbulent magnetic fields and accelerate energetic particles via collisionless multi-fluid plasma relaxation processes. The intracluster gas heating and entropy production rate by a collisionless shock may differ significantly from that in a single-fluid collisional shock. Simple scaling relations for postshock ion temperature and entropy as functions of shock velocity in strong collisionless multi-fluid shocks are presented. We show that the multi-fluid nature of the collisionless shocks results in high gas compression, reduced entropy production and modified sigma_v-T, M-T and L_x-T scalings. The scaling i...

Bykov, A M



Multi-fluid shocks in clusters of galaxies: entropy, sigma_ v-T, M-T and L_x-T scalings  

E-Print Network (OSTI)

The nonthermal phenomena in clusters of galaxies are considered in the context of the hierarchical model of cosmic structure formation by accretion and merging of the dark matter (DM) substructures.Accretion and merging processes produce large-scale gas shocks. The plasma shocks are expected to be collisionless. In the course of cluster's aggregation, the shocks, being the main gas-heating agent, generate turbulent magnetic fields and accelerate energetic particles via collisionless multi-fluid plasma relaxation processes. The intracluster gas heating and entropy production rate by a collisionless shock may differ significantly from that in a single-fluid collisional shock. Simple scaling relations for postshock ion temperature and entropy as functions of shock velocity in strong collisionless multi-fluid shocks are presented. We show that the multi-fluid nature of the collisionless shocks results in high gas compression, reduced entropy production and modified sigma_v-T, M-T and L_x-T scalings. The scaling indexes estimated for a simple model of a strong accretion multi-fluid shock are generally consistent with observations. Soft X-ray and extreme ultraviolet photons dominate the emission of strong accretion shock precursors that appear as large-scale filaments. Magnetic fields, turbulence and energetic particles constitute the nonthermal components contributing into the pressure balance, energy transport and emission of clusters. Nonthermal emission of energetic particles could be a test to constrain the cluster properties.

A. M. Bykov




U.S. Energy Information Administration (EIA) Indexed Site

VT)","VT",2013,1,1372,8449,16525,2476,15128,3706,777,5247,12,0,0,0,4625,28824,20243 7601,"Green Mountain Power Corp","VT",2013,1,28620,159754,218382,18657,134557,38190,10074,105040...


Virtualization (Panel Discussion)  

Science Conference Proceedings (OSTI)

... Perf improvements for interrupt intensive env, faster VM boot Interrupt isolation & remapping PCI-SIG ATS support Intel VT-x Intel VT-d Intel VT-c ...



A Review of the Representation of Induced Highway Travel in Current Travel and Land Use Models  

E-Print Network (OSTI)

and User Reference Report. SACOG. Sacramento, CA.number of case studies (Sacramento, CA, Chittenden, VT, andhighway capacity in Sacramento (CA), Chittenden (VT), and

Rodier, Caroline J



Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA