Powered by Deep Web Technologies
Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Carnegie Mellon  

NLE Websites -- All DOE Office Websites (Extended Search)

Carnegie Mellon Carnegie Mellon Salvador R esearch G roup, h 2p://neon.materials.cmu.edu/salvador/ SOFC Cathode Surface Chemistry and Op6miza6on 1 Paul Salvador Department o f M aterials S cience a nd E ngineering Carnegie M ellon U niversity Pi:sburgh, P A 1 5206 Lu Y an Philip T sang K. R . B alasubramaniam Hui D u Shanling W ang Robin C hao Lam H elmick Sarthak H avelia Oleg M aksimov Joanna M eador EISA vs SBA-15 HT Hard Template EISA Sintered particles vs. Open pores 1um 1um 200 nm 200 nm Funded b y D OE --- S ECA, T hanks t o L . W ilson, W . S urdoval, B . W hite, P . B urke, S hailesh V ora Wednesday, August 18, 2010 Carnegie Mellon Salvador R esearch G roup, h 2p://neon.materials.cmu.edu/salvador/ Program G oals a nd C ollabora/ons 2 * Improve t he P erformance o f S olid O xide F uel C ell C athodes * Reduce C athodes L osses ( increased p ower)

2

DOE Solar Decathlon: 2007 Teams - Carnegie Mellon University  

NLE Websites -- All DOE Office Websites (Extended Search)

Carnegie Mellon 2007 Solar Decathlon house. Carnegie Mellon's "plug and play" design allows the house to be upgraded with larger or smaller rooms. Download Construction Drawings...

3

DOE Solar Decathlon: Carnegie Mellon University: Passing the Torch  

NLE Websites -- All DOE Office Websites (Extended Search)

Carnegie Mellon solar-powered house at Solar Decathlon 2002. Carnegie Mellon solar-powered house at Solar Decathlon 2002. Enlarge image The Carnegie Mellon house consumed only 10% of the energy used by an average house with the help of solar electric and solar thermal systems, a water-source heat pump, and a tightly constructed building envelope made of prefabricated panels. (Credit: Chris Gunn/U.S. Department of Energy) Who: Carnegie Mellon What: Solar House Where: No longer available Solar Decathlon 2002 Carnegie Mellon University: Passing the Torch Carnegie Mellon's U.S. Department of Energy Solar Decathlon 2002 team analyzed every part of its solar-powered house during the two years it spent preparing for the competition. This forethought allowed the students to strategically place as many components as possible when they dismantled

4

DOE - Office of Legacy Management -- Carnegie-Mellon Institute...  

Office of Legacy Management (LM)

Nuclear Research Center, Carnegie-Mellon University (CMU); January 17,1975 PA.09-5 - Argonne National Laboratory (ANL) Memorandum; Luetzow to Blumenthal; regarding a request for...

5

Lessons Learned from the Intelligent Workplace Project at Carnegie Mellon  

NLE Websites -- All DOE Office Websites (Extended Search)

Lessons Learned from the Intelligent Workplace Project at Carnegie Mellon Lessons Learned from the Intelligent Workplace Project at Carnegie Mellon University Speaker(s): Sila Kiliccote Date: March 16, 2004 - 12:00pm Location: Bldg. 90 Seminar Host/Point of Contact: Francis Rubinstein The Robert L. Preger Intelligent Workplace (IW) at Carnegie Mellon University, which opened in December 1997, is a living laboratory designed to explore how new technologies and concepts can be applied to the built environment to improve building efficiency and human performance. The project's goals are to provide:1) User comfort and satisfaction; 2) Organizational Flexibility; 3) Technological Adaptability; and 4) Environmental Sustainability.At this unique site, the building systems integration issues posed a bigger challenge than expected. Most systems

6

Thin Films Department of Materials Science and Engineering, Carnegie Mellon University  

NLE Websites -- All DOE Office Websites (Extended Search)

Thin Films Department of Materials Science and Engineering, Carnegie Mellon University Lu Yan, K.R. Balasubramaniam, Shanling Wang, Hui Du, and Paul Salvador Funded b y: U.S. D epartment o f E nergy, S olid S tate E nergy C onversion A lliance ( SECA) Introduction The oxygen reduction reaction (ORR) takes place in the solid oxide fuel cell (SOFC) cathode and the overall reaction is rather complex; it involves a variety of sub-reactions, such as surface adsorption, dissociation, election transfer, incorporation, and bulk diffusion. Although a considerable amount of effort has been expended in correlating processing / microstructural features to cathode performance, there is unfortunately relatively little known about the fundamental surface properties of oxide surfaces and their relation

7

ELECTRICITY TRANSMISSION IN DEREGULATED MARKETS; CONFERENCE AT CARNEGIE MELLON UNIVERSITY, PITTSBURGH PA USA DECEMBER 2004 1 A criticality approach to monitoring cascading  

E-Print Network (OSTI)

ELECTRICITY TRANSMISSION IN DEREGULATED MARKETS; CONFERENCE AT CARNEGIE MELLON UNIVERSITY the risk of cascading failure of electric power transmission systems as overall loading is increased failure is the usual mechanism for large blackouts of electric power transmission systems. For example

Dobson, Ian

8

OTEC performance tests of the Carnegie-Mellon University vertical fluted-tube evaporator  

DOE Green Energy (OSTI)

Performance tests were conducted with the Carnegie-Mellon University (C-MU) vertical fluted-tube evaporator. Under nominal operating conditions (3200 gpm water flow, 3.2 million Btu/hr heat duty, and 100 gpm ammonia feed rate), the overall heat transfer coefficient (U/sub 0/) was 825 Btu/hr ft/sup 2/ /sup 0/F and the ammonia-side and water-side heat transfer coefficients were 1800 and 2610 Btu/hr ft/sup 2/ /sup 0/F, respectively. The water-side pressure drop was 3.2 psi. Tests were conducted at heat duties ranging from 2.4 million to 4.0 million Btu/hr and ammonia feed rates from 30 to 110 gpm. Over these ranges, U/sub 0/ increased with ammonia feed rate and decreased with heat duty. For all runs the quality of the ammonia vapor leaving the evaporator exceeded 99.9%. The measured U/sub 0/ values were very stable and repeatable for any continuous run at fixed operating conditions; however, they were not always repeatable following operating state changes or shutdown of the ammonia feed. These repeatability problems were attributed to variations in tube wetting and to the poor design of the ammonia applicator. Test results suggested that to ensure sufficient wetting and good thermal performance, the system should be started with a high ammonia feed rate and then cut back to the desired operating value.

Lorenz, J J; Yung, D T; Hillis, D L; Sather, N F

1979-07-01T23:59:59.000Z

9

OTEC performance tests of the Carnegie-Mellon University vertical fluted-tube condenser  

DOE Green Energy (OSTI)

Results of performance tests on a vertical fluted-tube condenser designed by Carnegie-Mellon University are reported. The condenser was free of operational problems and performed in a stable and repeatable manner. At nominal design conditions (a heat duty of 3.2 million Btu/hr and a water flow rate of 3200 gpm), the overall heat transfer coefficient (U/sub 0/) was 1040 Btu/hr.ft/sup 2/./sup 0/F and the water-side pressure drop was 3.3 psi. Varying the quality of the ammonia vapor feed to the condenser (in the range of 90 to 100%) did not affect performance. On the other hand, when the heat duty was increased from 2.3 million to 4.0 million Btu/hr, U/sub 0/ rose from 1024 to 105 Btu/hr.ft/sup 2/./sup 0/F. This trend resulted from an increase in the ammonia-side coefficient (from 3270 to 3730 Btu/hr.ft/sup 2/./sup 0/F) over this range of heat duties. Finally, the water-side coefficient was about 2.45 times greater than that calculated from the Sieder-Tate equation for smooth circular tubes of the same cross-sectional area. This enhancement ratio of 2.45 was some 20% greater than the enhancement factor of 2.07 expected from the increase in surface area alone.

Lewis, L G; Sather, N F

1979-05-01T23:59:59.000Z

10

Performance Modeling of a Solar Driven Absorption Cooling System for Carnegie Mellon University's Intelligent Workplace  

E-Print Network (OSTI)

The Robert L. Preger Intelligent Workplace (IW) is a 650 m2 (7,000 ft2) living laboratory of office space at Carnegie Mellon University (Pittsburgh, PA). The IW is involved in a project to develop, install, and test an effective solar thermal system for space heating and cooling. The proposed energy supply system configuration includes integrated compound parabolic concentrator (ICPC), a hot storage tank, a gas fired auxiliary heater, a steam generator, a steam driven absorption chiller and fan coils. A TRNSYS predictive model has been programmed and used to evaluate the performance of the system throughout a summer season. The effects on performance and on costs have been explored for various design variables and operating conditions. The performance calculations indicate that: - the 16.17 kW (55.2 kBtu/hr, 4.5 tons) absorption chiller is adequate to meet the IW south cooling requirements - 30-40m2 collectors can supply from 55 to 65% of the heat required to drive the chiller - estimated heat losses from the system can reach about 20-30% of the total heat collected.

Masson, S. V.; Qu, M.; Archer, D. H.

2006-01-01T23:59:59.000Z

11

THE MANY MEANS OF "SMART GRID" At Carnegie Mellon, research on the electricity system is being conducted by the campus-wide Electricity Industry  

E-Print Network (OSTI)

THE MANY MEANS OF "SMART GRID" At Carnegie Mellon, research on the electricity system is being seems to have decided that a "smart grid" is what we need to solve the problems of our electric power system. But, what exactly is a "smart grid"? The answer is that it is many different things. Some

12

conlaw-web.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

TESTS OF CONSERVATION LAWS Updated May 2012 by L. Wolfenstein (Carnegie-Mellon Uni- versity) and C.-J. Lin (LBNL) . In keeping with the current interest in tests of conservation...

13

Carnegie Mellon Electricity Industry Center  

E-Print Network (OSTI)

, Electric Power Research Institute Les Silverman, Director, McKinsey & Company Steve Specker, President

14

Radu Marculescu Carnegie Mellon University  

E-Print Network (OSTI)

Seconds usec #12;3 Traffic lacks any characteristic scale; this type of workload cannot be described

15

Carnegie Mellon University Research Showcase  

E-Print Network (OSTI)

methods became a major concern of my research, and the present book began to evolve. The modern computer me that these characteristics form a sounder conceptual basis for programming than those. This implies that the programmer should master formal proof methods, not in order to give a formal proof

Reynolds, John C.

16

CARNEGIE MELLON SALARY REDUCTION AGREEMENT  

E-Print Network (OSTI)

program (offered by TIAA-CREF and Vanguard) and Roth 403 (b) (offered by Vanguard). Please read the shaded to the designated funding vehicle for the purchase of an annuity certificate (TIAA-CREF) or deposit into a custodial Contribution, divided equally among (check below): TIAA-CREF GRA TIAA-CREF GSRA Vanguard TDA Vanguard Roth

McGaughey, Alan

17

Department of Media Relations Carnegie Mellon University  

E-Print Network (OSTI)

resistance and DIY ethics, Riot Grrrl helped a new generation to become active feminists who created

18

School of Computer Science Carnegie Mellon University  

E-Print Network (OSTI)

ISOLATION PILOT PLANT (WIPP) CATEGORY II-D: CORRESPONDENCE FROM PERSONS OUTSIDE THE AGENCY NO. Date Sent. Schneider, DOE re: provide additional info. as a result of10/12/93 EPA/DOE meeting on WIPP QA II-D-2 4/93 at the WIPP" II-D-4 7/21/94 Ltr from W. Weart, SNL/WIPP transmitting test plans requested by EPA6/10/94 II-D-5

19

IT Services Qualification Center Carnegie Mellon University  

E-Print Network (OSTI)

kilovolts) in Section 110. It covers systems with zero frequency (direct current) through radio frequency Protection Association. The 1999 NEC and the NEC Handbook are available from the NFPA, 11 Tracy Drive, Avon, MA 02322 · 800-344-3555 or 508-895-8300 · Fax: 800-593-6372 or 508-895-8301 custserv@nfpa.org · www.nfpa

20

Carnegie Mellon University CARNEGIE INSTITUTE OF TECHNOLOGY  

E-Print Network (OSTI)

.5.3 Compressed Air Energy Storage (CAES) 76 3.5.4 High Voltage Direct Current (HVDC) Transmission 78 3

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Carnegie Mellon University CARNEGIE INSTITUTE OF TECHNOLOGY  

E-Print Network (OSTI)

...................................................................................................... 22 Figure 4.3. Damaged area after Hurricane Wilma (2005), courtesy of the Miami-Dade County Office list describe techniques examined in this thesis. 2.2.1. Storm shutters Miami-Dade County Office researchers at Vermont School of Law, the Miami-Dade County Department of Emergency Management, Brick Rule

22

Carnegie Mellon University Carnegie Institute of Technology  

E-Print Network (OSTI)

blackout of 2003, a cascade of active management responses tripped out 508 generators, spreading outages

23

Carnegie Mellon University CARNEGIE INSTITUTE OF TECHNOLOGY  

E-Print Network (OSTI)

DUPIC (PWR to CANDU) PUREX (PWR to PWR) CO2 (ton/GWh) 5.7 12 8.5 3.1E-05 9.4E-05 4.5E-06 33 17 8.8 SO2

24

Carnegie Mellon University Carnegie Institute of Technology  

E-Print Network (OSTI)

that can be seen as a hedging instrument and valued as such. In the ambit of electricity transmission applications in the Electricity Industry A dissertation submitted in partial fulfillment of the requirements: Valuing Risk-Reduction: Three applications in the Electricity Industry. Committee: Benoit Morel -chair

25

Carnegie Mellon University CARNEGIE INSTITUTE OF TECHNOLOGY  

E-Print Network (OSTI)

of wind/natural gas/energy storage generation block. The scale of wind generation and the wind generation in a co-located wind/natural gas turbine/energy storage system. Chapter 3 investigates which properties by traditional generators or by compressed air energy storage (CAES). Natural gas turbines in particular are able

26

CARNEGIE MELLON UNIVERSITY Automatic Graceful Degradation  

E-Print Network (OSTI)

identifies a heretofore-unknown problem in the system syn- thesis research space and explores solution love of learning into a roar- ing fire -- or at least gave me enough fuel to make it blaze

Koopman, Philip

27

Carnegie Mellon University CARNEGIE INSTITUTE OF TECHNOLOGY  

E-Print Network (OSTI)

Increasing demand for electricity and an aging fleet of generators are the principal drivers behind; there is an increasing number of shareholder mandates requiring public utilities to reduce their exposure to potentially, the Electric Power Research Institute, the Pennsylvania Infrastructure Technology Alliance, the US National

28

Carnegie Mellon University A Technical and Economic Assessment of  

E-Print Network (OSTI)

system with a water gas shift (WGS) reactor and Selexol CO2 capture unit indicated that the CO2 avoidance production and the GE H-class gas turbine system for power generation. Study results show that these two.................................................................................................... 62 3.1.4. Gas turbine selection and steam cycle design

29

DOE Solar Decathlon: Carnegie Mellon University: Looking Forward  

NLE Websites -- All DOE Office Websites (Extended Search)

Darmstadt Georgia Illinois Kansas Lawrence Madrid Maryland MIT Montral NYIT Penn State Puerto Rico Rolla Santa Clara Texas Texas A&M Quick Links Solar Decathlon Home Solar...

30

CARNEGIE MELLON UNIVERSITY FACULTY AND STAFF RETIREMENT PLAN  

E-Print Network (OSTI)

contracts that would be replaced by the TIAA-CREF account for which you are applying. If your new TIAA investing. Please call 877 518-9161 or log on to tiaa-cref.org for a prospectuses that contains prospectuses sent to you at no charge, please call TIAA-CREF at 877 518-9161. TIAA-CREF Individual

McGaughey, Alan

31

CARNEGIE MELLON UNIVERSITY TAX-DEFERRED ANNUITY PLAN  

E-Print Network (OSTI)

that would be replaced by the TIAA-CREF account for which you are applying. If your new TIAA-CREF account OF ARIZONA: 30-Day Right to Examine Your Group Certificate. TIAA is required, upon written request at the address shown below. Upon receipt of such request, TIAA will refund all premiums allocated

McGaughey, Alan

32

Carnegie Mellon University A Technical and Economic Assessment of  

E-Print Network (OSTI)

the performance and cost of an IGCC power plant. Simulation studies of an oxygen-blown Texaco quench gasifier

33

NETL: Ambient Monitoring - Carnegie-Mellon University (CMU)  

NLE Websites -- All DOE Office Websites (Extended Search)

Coal & Power Systems Major Demonstrations Innovations for Existing Plants Gasification Turbines Fuel Cells FutureGen Advanced Research Contacts Industrial Capture & Storage...

34

CARNEGIE MELLON UNIVERSITY Electric Power Micro-grids: Opportunities and Challenges  

E-Print Network (OSTI)

Recommendations for Technologies for Microgrids on the Big Island Prepared for U.S. Department Island microgrids By Sentech, Inc. Bethesda, Maryland And University of Hawaii Hawaii Natural Energy commercial product, process, or service by tradename, trademark, manufacturer, or otherwise does

35

Sorting the reality from the hype A briefing by Carnegie Mellon University Faculty  

E-Print Network (OSTI)

, to the electric power system. Granger Morgan, Head of the Department of Engineering and public Policy (EPP this technology. However because of state laws granting "exclusive service territories" to legacy utilities, microgrids are not legal in most states. This needs to be changed. Examples: · Distributed generation

36

Carnegie Mellon University Energy Efficiency in the U.S. Residential Sector  

E-Print Network (OSTI)

]. ....................................................277& Figure 63 - UV-phosphor based white light emitting diode...........................................283& Figure 64 ­ UV-phosphor based white light emitting diode

37

Industrial Solid-State Energy Harvesting: Mechanisms and Examples Matthew Kocoloski, Carnegie Mellon University  

E-Print Network (OSTI)

Industrial Solid-State Energy Harvesting: Mechanisms and Examples Matthew Kocoloski, Carnegie the potential for solid-state energy harvesting in industrial applications. In contrast to traditional heat are on the cusp of practical use. Finally, we present an example of energy harvesting using thermionic devices

Kissock, Kelly

38

UNI-CAT  

NLE Websites -- All DOE Office Websites (Extended Search)

Home Advanced Photon Source Advanced Photon Source User Activity Report UNI-CAT, A University-National Laboratory-Industry Collaborative Access Team 33-BM 33-ID...

39

UNI GrazUNI GrazUNI GrazUNI Graz I:WSUI:WSUI:WSUI:WSU  

E-Print Network (OSTI)

UNI GrazUNI GrazUNI GrazUNI Graz I:WSUI:WSUI:WSUI:WSU Peak Oil Praktikum SS 2007 #12;O.Univ.-Prof. Dr. Gerald Schöpfer 2Peak Oil Praktikum I:WSUI:WSUI:WSUI:WSU Zum Wert einer historischen Betrachtung.Univ.-Prof. Dr. Gerald Schöpfer 3Peak Oil Praktikum I:WSUI:WSUI:WSUI:WSU Was ist eine Katastrophe? Begriff kommt

Keeling, Stephen L.

40

Energy and Environmental Economics and Policy Seminar Wednesday, April 18 117 EES Building Paulina Jaramillo, Carnegie Mellon University  

E-Print Network (OSTI)

that the short-term GHG benefits of coal plant retirement and low natural gas prices are an order of magnitude-term and b) natural gas price variation. These issues are explored through the development of reduced lower than is generally reported in life cycle studies that compare coal and natural gas on a per MWh

Boyer, Elizabeth W.

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Navigating computer science research through waves of privacy concerns: discussions among computer scientists at Carnegie Mellon University  

Science Conference Proceedings (OSTI)

Computer Science research and practice are raising growing privacy concerns among the public and government. Computer technology's increasing ability to capture, organize, interpret and share data about individuals raises questions about what privacy ... Keywords: data mining, ethics, face recognition, institutional review board, personal assistants, privacy, privacy technology, surveillance

Latanya Sweeney

2004-03-01T23:59:59.000Z

42

k0lcp_s013244-web.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

April April 2012 by L. Wolfenstein (Carnegie-Mellon Uni- versity), C.-J. Lin (LBNL), and T.G. Trippe (LBNL). The symmetries C (particle-antiparticle interchange) and P (space inversion) hold for strong and electromagnetic inter- actions. After the discovery of large C and P violation in the weak interactions, it appeared that the product CP was a good symmetry. In 1964 CP violation was observed in K 0 decays at a level given by the parameter ǫ ≈ 2.3 × 10 -3 . A unified treatment of CP violation in K, D, B, and B s mesons is given in "CP Violation in Meson Decays" by D. Kirkby and Y. Nir in this Review. A more detailed review including a thorough discussion of the experimental techniques used to determine CP violation parameters is given in a book by K. Kleinknecht [1]. Here we give a concise summary of the formalism needed to define the parameters of CP violation in K L decays, and a description

43

k0lcp_s013244-web.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

Revised Revised March 2004 by L. Wolfenstein (Carnegie-Mellon Uni- versity) and T.G. Trippe (LBNL). The symmetries C (particle-antiparticle interchange) and P (space inversion) hold for strong and electromagnetic inter- actions. After the discovery of large C and P violation in the weak interactions, it appeared that the product CP was a good symmetry. In 1964 CP violation was observed in K 0 decays at a level given by the parameter ≈ 2.3 × 10 -3 . A unified treatment of CP violation in K, D, B, and B s mesons is given in "CP Violation in Meson Decays" by D. Kirkby and Y. Nir in this Review. A recent book by K. Kleinknecht [1] gives a more detailed review including a thorough discussion of the experimental techniques used to determine CP violation parameters. Here we give a concise summary of the formalism needed to define the parameters of CP violation in K L decays and a description of our

44

August 2012 1 E D U C A T I O N  

E-Print Network (OSTI)

, Incorporating Seismic Concerns in Site Selection for Enhanced Geothermal Power Generation. In review T Carnegie Mellon University PROFESSOR, TEPPER SCHOOL OF BUSINESS DIRECTOR, CARNEGIE MELLON ELECTRICITY SCHOOL OF BUSINESS EXECUTIVE DIRECTOR, CARNEGIE MELLON ELECTRICITY INDUSTRY CENTER DISTINGUISHED SERVICE

McGaughey, Alan

45

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2010 Carnegie Mellon University 2010 Carnegie Mellon University Smart Grid Peer Review November 2-4, 2010 US Department of Energy Office of Electricity Delivery and Energy...

46
47

Carnegie Mellon Electricity Industry Center Working Paper CEIC 09-01 www.cmu.edu/electricity Large Blackouts in North America  

E-Print Network (OSTI)

on reliable electricity infrastructure. Understanding what trends exist in the history of electricity , Sarosh Talukdarc a School of Engineering, 301 Votey Hall, University of Vermont, 33 Colchester Ave-law generating mechanisms), there is some agreement that the data fit well to a power-law statistic. However

Hines, Paul

48

Uni Land | Open Energy Information  

Open Energy Info (EERE)

Land Land Jump to: navigation, search Name Uni Land Place Bologna, Italy Zip 40063 Sector Solar Product Italian property company, which buys land without permits and develops it for residential and commerical use before selling it on. The firm is involved with solar project development. Coordinates 44.50483°, 11.345169° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.50483,"lon":11.345169,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

49

UniRac Inc | Open Energy Information  

Open Energy Info (EERE)

UniRac Inc UniRac Inc Jump to: navigation, search Name UniRac Inc Place Albuquerque, New Mexico Zip 87102-1545 Product UniRac is a designer and manufacturer of stationary mounting structures for PV modules and arrays. Coordinates 35.08418°, -106.648639° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.08418,"lon":-106.648639,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

50

Hisham Zerriffi  

NLE Websites -- All DOE Office Websites (Extended Search)

at Carnegie Mellon University as well as a graduate researcher in the Carnegie Mellon Electricity Industry Center. He has a B.A. in Physics (with minors in Political Science...

51

Assessing the Reliability and Economics of Wide-Scale Grid-Connected...  

NLE Websites -- All DOE Office Websites (Extended Search)

at Carnegie Mellon University as well as a graduate researcher in the Carnegie Mellon Electricity Industry Center. He has a B.A. in Physics (with minors in Political Science...

52

Educational Computer Science Games  

NLE Websites -- All DOE Office Websites (Extended Search)

Computer Science Games Do you have a great computer science game? Please click our Ideas page. Featured Games: Alice provided by CarnegieMellon Alice provided by CarnegieMellon...

53

NAMII  

Science Conference Proceedings (OSTI)

... Universities: Carnegie Mellon University, Case Western Reserve University, Kent ... Delaware Valley Industrial Resource Center, Energy Industries of ...

54

SEI Presentation (Full Color): Preformatted Design and ...  

Science Conference Proceedings (OSTI)

... Analysis Page 10. 2013 Carnegie Mellon University Project Findings: Challenges Resulting inefficiencies from the diverse job functions and skill ...

2013-09-17T23:59:59.000Z

55

PHYSICAL METALLURGY: FUNDAMENTALS AND APPLICATIONS ...  

Science Conference Proceedings (OSTI)

Room: 232B. Session Chairperson: Warren M. Garrison, Dept. of Materials Science and Engineering, Carnegie Mellon University, Pittsburgh, PA 15213...

56

Frequency Control Performance Measurement and Requirements  

E-Print Network (OSTI)

Variable Renewable Energy Resources into the Smart Grid,Smart Grids, Carnegie Mellon Conference on the Electricity

Illian, Howard F.

2011-01-01T23:59:59.000Z

57

NETL Regional University Alliance (NETL-RUA)  

NLE Websites -- All DOE Office Websites (Extended Search)

Center for Multiscale Modeling for Engineering Materials Carnegie Mellon University Electricity Industry Center Center for Sustainable Engineering Center for Nanoenabled...

58

Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.

59

Proc. of IEEE Intl. Communications Conference (ICC), June 1995, pp. 417-22 http://www.ece.cmu.edu/~peha  

E-Print Network (OSTI)

and Technology. Partial support was also provided by PEMEX (Petróleos Mexicanos) and Carnegie Mellon University

Peha, Jon M.

60

engineering laboratory  

Science Conference Proceedings (OSTI)

... competitions: a) hard magnet (Carnegie Mellon), b) polymer-based electrostatic ... urban interface, structural fires, storm surge, flood, tsunami) and ...

2012-08-29T23:59:59.000Z

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Wednesday TMS13 News  

Science Conference Proceedings (OSTI)

By Graduate Student Reporter Alex Leary, Carnegie Mellon University .... Growth of Ultrathin Molecular Films," Jason Leszczewicz, Western Kentucky University.

62

How to Deploy Firewalls  

Science Conference Proceedings (OSTI)

... Julia Allen Carnegie Mellon University Software Engineering ... It does not cover policy, product ... network address translation - virtual private networks ...

63

FISSEA - 25th Annual Conference  

Science Conference Proceedings (OSTI)

... Jason Hong, Carnegie Mellon University. ... and Training - Warren Udy, Department of Energy (DOE). ... FedCTE)/Federal Virtual Training Environment ...

64

Alphabetical Index of (TREC) 2010 Papers by Track  

Science Conference Proceedings (OSTI)

... PDF file Combination of Evidence for Effective Web Search Dong Nguyen, Jamie Callan, Carnegie Mellon University, Language Technologies ...

65

Text REtrieval Conference (TREC) 2010 Proceedings  

Science Conference Proceedings (OSTI)

... PDF file Combination of Evidence for Effective Web Search Dong Nguyen, Jamie Callan, Carnegie Mellon University, Language Technologies ...

66

CyberCorps: Scholarship For Service (SFS)  

Science Conference Proceedings (OSTI)

... State University - San Bernardino Carnegie Mellon Dakota State University ... Texas University of Pittsburgh University of South Alabama University of ...

2013-03-28T23:59:59.000Z

67

UniSource Energy - Contractor Energy Efficiency Rebate Program (Arizona) |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

UniSource Energy - Contractor Energy Efficiency Rebate Program UniSource Energy - Contractor Energy Efficiency Rebate Program (Arizona) UniSource Energy - Contractor Energy Efficiency Rebate Program (Arizona) < Back Eligibility Construction Installer/Contractor Savings Category Home Weatherization Commercial Weatherization Heating & Cooling Commercial Heating & Cooling Cooling Sealing Your Home Ventilation Manufacturing Heat Pumps Appliances & Electronics Commercial Lighting Lighting Windows, Doors, & Skylights Maximum Rebate Air Sealing with Attic Insulation: $800 Duct Sealing: $350 (prescriptive); $650 (performance measured) Air Sealing: $250 Shade Screens or Solar Film: $250 Program Info State Arizona Program Type Utility Rebate Program Rebate Amount BrightSave Home Energy Analysis: Discounted HVAC Replacement: $250

68

Game 2 Carnegie Mellon at Allegheny September 8, 2012 UAA Champions '90, '91, '93, '94, '95, '96, '97, '06 NCAA Playoffs '38, '78, '79, '83, '85, '90, '06 ECAC Champs '99, '07  

E-Print Network (OSTI)

mkrstic@ucsd.edu Hernandez Jason Allan Abedania Juan Lasheras jlasheras@ucsd.edu Hernandez Mary Azucena Raymond De Callafon callafon@ucsd.edu Hernandez-Ibarra David Robert Bitmead rbitmead@ucsd.edu Hinden Name Mentor Mentor Email Malcolm Dustin Lee Hidenori Murakami hmurakami@ucsd.edu Malta Ramon Keiko

McGaughey, Alan

69

Game 1 Carnegie Mellon vs. Grove City September 3, 2011 UAA Champions '90, '91, '93, '94, '95, '96, '97, '06 NCAA Playoffs '38, '78, '79, '83, '85, '90, '06 ECAC Champs '99, '07  

E-Print Network (OSTI)

36 ZacharyErra-Hernandez SO FB 5-10 235 LasCruces,N.M./Onate 37 Philip Nicolaides JR OLB 6-2 195 49 Dustin Schneider FR ILB 6-0 240 Hampton, N.J./North Hunterdon No. Name Cl. Pos. Ht. Wt. Hometown ..........................................................Moon ­ ose 36 Zachary Erra-Hernandez.........................................Air ­ a Hernandez 37

Reddy, Raj

70

Game 2 Carnegie Mellon vs. Allegheny September 10, 2011 UAA Champions '90, '91, '93, '94, '95, '96, '97, '06 NCAA Playoffs '38, '78, '79, '83, '85, '90, '06 ECAC Champs '99, '07  

E-Print Network (OSTI)

, Texas/Langham Creek 36 ZacharyErra-Hernandez SO FB 5-10 235 LasCruces,N.M./Onate 37 Philip Nicolaides JR 49 Dustin Schneider FR ILB 6-0 240 Hampton, N.J./North Hunterdon No. Name Cl. Pos. Ht. Wt. Hometown 35* Dylan Munoz ..........................................................Moon ­ ose 36 Zachary Erra-Hernandez

Reddy, Raj

71

conlaw-web.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

TESTS TESTS OF CONSERVATION LAWS Updated October 2013 by L. Wolfenstein (Carnegie-Mellon University) and C.-J. Lin (LBNL). In keeping with the current interest in tests of conservation laws, we collect together a Table of experimental limits on all weak and electromagnetic decays, mass differences, and moments, and on a few reactions, whose observation would violate conservation laws. The Table is given only in the full Review of Particle Physics, not in the Particle Physics Booklet. For the benefit of Booklet readers, we include the best limits from the Table in the following text. Limits in this text are for CL=90% unless otherwise specified. The Table is in two parts: "Discrete Space-Time Symmetries," i.e., C, P , T , CP , and CP T ; and "Number Conservation Laws," i.e., lepton, baryon, hadronic flavor, and charge conservation. The references for these data can be

72

www.studienkompass.uni-bonn.de Unter diesem Link finden Sie das  

E-Print Network (OSTI)

/73-3802 biostudium@uni-bonn.de Chemie Dr. Jörg Daniels Tel.: 0228/73-3591 j.daniels@uni-bonn.de Deutsch (Lehramt) (s. Germanistik, Vergleichende Literatur- und Kulturwissenschaft) Deutsch als Zweit- und Fremdsprache Dr. Dieter Faulhaber Tel.: 0228/73-5368 d.faulhaber@slz.uni-bonn.de Deutsch-Französische Studien Dr. Willi Jung Tel

Bartels, Soeren

73

Benedikt Weggler, Denise Riedel Fachschaft Chemie und Wirtschaftschemie Uni Ulm  

E-Print Network (OSTI)

CoffeeIn* Benedikt Weggler, Denise Riedel Fachschaft Chemie und Wirtschaftschemie Uni Ulm Kloposter euch ebenfalls auf diese Weise zu informieren. Die Fachschaft Chemie und Wirtschaftschemie pr direkt mit der Promotion einzusteigen. Von dieser Ma?nahme verspricht sich die Studienkommission Chemie

Pfeifer, Holger

74

UniGuide: vers un guide dynamique pour Unistroke  

Science Conference Proceedings (OSTI)

UniGuide is a support system to use the Unistroke gesture keyboard. It is based on dynamic guides to help the user to perform the gesture associated with the character he wants. To enhance the visual feedback, the guides are spread over several pages ... Keywords: dynamic guides, text entry, unistroke

Jrmy Thimont; Benot Martin

2010-09-01T23:59:59.000Z

75

High Performance www.rrze.uni-erlangen.de  

E-Print Network (OSTI)

High Performance Computing at RRZE 2008 HPCatRRZE www.rrze.uni-erlangen.de #12;G. Hager, T. Zeiser and G. Wellein: Concepts of High Performance Computing. In: Fehske et al. Lect. Notes Phys. 739, 681 Optimization Techniques for the Hitachi SR8000 architecture. In: A. Bode (Ed.) : High Performance Computing

Fiebig, Peter

76

UniSolar Jinneng Tianjin Energy Co Ltd | Open Energy Information  

Open Energy Info (EERE)

UniSolar Jinneng Tianjin Energy Co Ltd UniSolar Jinneng Tianjin Energy Co Ltd Jump to: navigation, search Name UniSolar Jinneng (Tianjin) Energy Co Ltd Place Tianjin Municipality, China Sector Solar Product JV set-up between Tianjin Jinneng Investment, a Chinese VC investor, and United Solar Ovonic, US thin-film PV cell manufacturer. References UniSolar Jinneng (Tianjin) Energy Co Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. UniSolar Jinneng (Tianjin) Energy Co Ltd is a company located in Tianjin Municipality, China . References ↑ "UniSolar Jinneng (Tianjin) Energy Co Ltd" Retrieved from "http://en.openei.org/w/index.php?title=UniSolar_Jinneng_Tianjin_Energy_Co_Ltd&oldid=352506"

77

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

© 2010 Carnegie Mellon University © 2010 Carnegie Mellon University © 2010 Carnegie Mellon University Smart Grid Peer Review November 2-4, 2010 US Department of Energy Office of Electricity Delivery and Energy Reliability Austin Montgomery Carnegie Mellon University Software Engineering Institute amontgom@sei.cmu.edu 2 SGMM © 2010 Carnegie Mellon University Overall Project Purpose and Objectives The purpose of this project is to improve and evolve the Smart Grid Maturity Model (SGMM) and make it widely accessible and useful to the electricity sector as a management tool to assist in planning, implementing and managing a smart grid transformation. 3 SGMM © 2010 Carnegie Mellon University What is the Smart Grid Maturity Model? SGMM is a MANAGEMENT TOOL that provides a COMMON FRAMEWORK for defining key elements of

78

DOE Solar Decathlon: Pittsburgh Synergy: Working for the Greater Good  

NLE Websites -- All DOE Office Websites (Extended Search)

Pittsburgh Synergy's solar house in its permanent location on Carnegie Mellon's campus. Pittsburgh Synergy's solar house in its permanent location on Carnegie Mellon's campus. Enlarge image The Pittsburgh Synergy solar house is located near Margaret Morrison Carnegie Hall on Carnegie Mellon's campus. (Courtesy of Stephen Lee/Carnegie Mellon University) Who: Pittsburgh Synergy What: Solar house Where: Remaking Cities Institute 5045 Margaret Morrison St. Pittsburgh, PA 15213 Map This House Public tours: Not available Solar Decathlon 2005 Pittsburgh Synergy: Working for the Greater Good Carnegie Mellon partnered with the University of Pittsburgh and The Art Institute of Pittsburgh for the U.S. Department of Energy Solar Decathlon 2005. After the competition, the house was rebuilt on Carnegie Mellon's campus for use as office space. It was also grid-tied to feed excess

79

Programm "Wasser fr Mensch und Natur" Familien-und KinderUni-Mitmachtag im Botanischen Garten  

E-Print Network (OSTI)

Programm "Wasser für Mensch und Natur" Familien- und KinderUni-Mitmachtag im Botanischen Garten der Schule im Botanischen Garten untersucht werden. Aber auch die Pflanzen an Land benötigen ganz des Familien- und KinderUni- Mitmachtags am 9. Juni 2013 im Botanischen Garten der Johannes Gutenberg

Esper, Jan

80

TMS e-News: The monthly electronic newsletter for TMS  

Science Conference Proceedings (OSTI)

They keep silent watch over the long, dim corridor to the Carnegie-Mellon .... Transmission electron microscopy revealed a C amorphizing dose of ?5.0 10

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Frank DelRio  

Science Conference Proceedings (OSTI)

Frank W. DelRio. Frank W. DelRio received a BS in Mechanical Engineering from Carnegie Mellon University in 1998, after ...

2012-12-21T23:59:59.000Z

82

FermiNews - September 17, 1999  

NLE Websites -- All DOE Office Websites (Extended Search)

Issue: Minos Carnegie Mellon University Safety First, Last and Always Batavia, from Windmills to Accelerators Parking Part IV Talk of the Lab Calendar and Milestones Classifieds...

83

The UniversiTy of Texas aT aUsTin Undergraduate Catalog  

E-Print Network (OSTI)

and action, convey ideas and information effectively, and be reflective practitioners. Carnegie Mellon effectively. The National Science Foundation recently funded a new Quality of Life Technology Engineering

Hofmann, Hans A.

84

DOE Solar Decathlon: Virginia Tech: Perfecting Solar  

NLE Websites -- All DOE Office Websites (Extended Search)

Where Are the Houses Now? Auburn Carnegie Mellon Colorado Crowder Delaware Maryland Puerto Rico Rolla Texas Texas A&M Tuskegee UNC Charlotte Virginia Virginia Tech Quick...

85

Poster Session  

Science Conference Proceedings (OSTI)

Phosphorus Partitioning During EAF Refining of DRI Based Steel: Mohammed Tayeb1; Sridhar Seetharaman2; Richard Fruehan2; 1Carnegie Mellon...

86

Graduate students - CECM  

E-Print Network (OSTI)

Now Tenured Associate Professor, Miami University of Ohio. Ph.D., H.M. Strojwas (1986) Thesis title: ``Tangential Approximations,'' Carnegie Mellon. Ph.D., D.

87

Microsoft Word - Defense Science Quarterly 11-08 v2.doc  

National Nuclear Security Administration (NNSA)

Science and Engineering from Carnegie-Mellon University. Kathleen was at Oak Ridge National Laboratory, as a technical staff member and then a group leader, for nearly 11...

88

New Tool Provides Insights into How Materials Transfer Heat  

Science Conference Proceedings (OSTI)

Posted on: 05/27/2013. Researchers from the University Toronto and Carnegie Mellon University recently investigated a new tool to measure the thermal and...

89

Ins Magarida Lima de Azevedo  

NLE Websites -- All DOE Office Websites (Extended Search)

Ins Azevedo Climate Decision Making Center and the Electricity Industry Center Carnegie Mellon University This speaker was a visiting speaker who delivered a talk or talks on the...

90

Alex Farrell  

NLE Websites -- All DOE Office Websites (Extended Search)

Executive Director of the Carnegie Mellon Electricity Industry Center. This Speaker's Seminars Combined Heat Cooling and Power: An Initial Look and Thoughts On Research Directions...

91

Computational Modelling for the Materials Professional  

Science Conference Proceedings (OSTI)

After completing his PhD in 1988 he joined Carnegie Mellon University, Pittsburgh, and worked closely with the Steel industry, applying computational modelling...

92

DOE Solar Decathlon: University of North Carolina at Charlotte...  

NLE Websites -- All DOE Office Websites (Extended Search)

Where Are the Houses Now? Auburn Carnegie Mellon Colorado Crowder Delaware Maryland Puerto Rico Rolla Texas Texas A&M Tuskegee UNC Charlotte Virginia Virginia Tech Quick...

93

Session I - Programmaster.org  

Science Conference Proceedings (OSTI)

Oct 17, 2011... Superalloys: Joseph Tucker1; Clayton Stein1; Steve Sintay2; Lisa Chan3; Tony Rollett1; 1Carnegie Mellon University; 2LANL; 3EDAX

94

Instrument Schedule for dcs  

Science Conference Proceedings (OSTI)

... of hcp Co nanoparticles, Ijiri* and Bernauer* Majetich* and Kan Borchers* Rhyne*, Oberlin College Carnegie Mellon U NCNR LANL, 10-325K CCR, ...

95

Microsoft PowerPoint - Proceedings Cover Sheets  

NLE Websites -- All DOE Office Websites (Extended Search)

production plants (ASU) * Hydrogen production plants (SMR) E.S. Rubin, Carnegie Mellon Learning Curve Formulation Learning Curve Formulation where, y i time or cost to produce...

96

ICAA-13: Home Page  

Science Conference Proceedings (OSTI)

13th International Conference on Aluminum Alloys (ICAA -13) June 3-7, 2012 Carnegie Mellon University Pittsburgh, Pennsylvania. The 13th International...

97

Incremental and Encoding Formulations for Mixed Integer ...  

E-Print Network (OSTI)

Apr 1, 2013 ... aTepper School of Business, Carnegie Mellon University, 5000 Forbes Ave., ...... sis, University of Kentucky, Lexington, KY, USA, 1998.

98

Student Paper Contest Winners  

Science Conference Proceedings (OSTI)

by Sumit Goenka, Carnegie Mellon University ... by Lisa A. Deibler, Case Western Reserve University ... 2nd Place: Jiantao Liu, University of Kentucky...

99

Event Title  

NLE Websites -- All DOE Office Websites (Extended Search)

Dr. Spyros Pandis Professor, Chemical Engineering Department University of Patras, Greece Professor, Chemical Engineering and Engineering and Public Policy Carnegie Mellon...

100

Lessons Learned from the Intelligent Workplace Project at Carnegie...  

NLE Websites -- All DOE Office Websites (Extended Search)

Workplace (IW) at Carnegie Mellon University, which opened in December 1997, is a living laboratory designed to explore how new technologies and concepts can be applied to...

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Leveraging Human Factors for Effective Security Training  

Science Conference Proceedings (OSTI)

... A B C D E. Cooling. Unit. Actual Conceptual Model. ... Screenshots. Internet Explorer 7 Passive Warning. 2012 Carnegie Mellon University : 30. ...

2012-04-06T23:59:59.000Z

102

Microsoft PowerPoint - 04CifernoStanford - Capture Project Summary...  

NLE Websites -- All DOE Office Websites (Extended Search)

Temperature Swing Adsorption Participants: NETL, Carnegie Mellon University, Sud Chemie * Pre-Combustion CO 2 capture * Pressure-Swing Adsorbents - Improved adsorption...

103

1999 TMS Dinner and Awards Presentations  

Science Conference Proceedings (OSTI)

He is currently participating in a four-university consortium (Ohio State University, Michigan State University, University of Michigan, and Carnegie Mellon...

104

Iran Thomas Auditorium, 8600 Transport Measurements by Scanning...  

NLE Websites -- All DOE Office Websites (Extended Search)

8600 Transport Measurements by Scanning Probe Microscopy: Possibilities for Graphene Randall M. Feenstra Department of Physics Carnegie Mellon University CNMS D D I I S S...

105

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Hamilton * Carnegie- Mellon University * Chevron * Conoco Phillips * US OECD Delegation * Duke Energy * EEI * Electric Power Research Institute * Illinois State Geological Survey *...

106

Art Investigating Science: Critical Art as a Meta-discourse of Science  

E-Print Network (OSTI)

Art and Artificial Intelligence, School of Computer Science,Computer Science Department, Carnegie Mellon University,Convergence of Art and Science, in: Art@Science. Ch.

Ozog, Maciej

2009-01-01T23:59:59.000Z

107

Ecological Footprint Budgeting: Environmental Analysis of the Generic American Car  

E-Print Network (OSTI)

Analysis of Composites in Cars. Goldberg, R. (1992, May).1998, June). Buying a New Car. Federal Trade Commission. car bodies. Carnegie Mellon. <

Zhang, Teresa

2005-01-01T23:59:59.000Z

108

Bayesian Analysis (2006) 1, Number 2, pp. 289320 Who Wrote Ronald Reagan's Radio Addresses?  

E-Print Network (OSTI)

Agnew, resigned over a scandal in 1973. Gerald R. Ford replaced Agnew and then assumed the presidency Science, Carnegie Mellon University, Pittsburgh, PA, http://www.cs.cmu.edu/~eairoldi/ Hoover Institution of Computer Science, Carnegie Mellon University, Pittsburgh, PA, http

Sadeh, Norman M.

109

Aprs l'uni, l'emploi ! Du 4 au 11 mars prochains aura lieu la 7me  

E-Print Network (OSTI)

://www.unige.ch/forumemploi/Inscriptions2010/mckinsey.html Le Forum Uni-emploi est organisé par Uni-emploi, en collaboration avec onze Sciences II 229 Table ronde McKinsey & Cie Je 11 mars 16h15 - 17h45 M 1140 Présentation Firmenich Me 10

Rochaix, Jean-David

110

A new monitoring design for uni-variate statistical quality control charts  

Science Conference Proceedings (OSTI)

In this research, an iterative approach is employed to analyze and classify the states of uni-variate quality control systems. To do this, a measure (called the belief that process is in-control) is first defined and then an equation is developed to ... Keywords: Average run length, CUSUM chart, EWMA chart, Process monitoring, Statistical quality control

Mohammad Saber Fallah Nezhad; Seyed Taghi Akhavan Niaki

2010-03-01T23:59:59.000Z

111

k0s3pi-web.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

S S → 3π Written 1996 by T. Nakada (Paul Scherrer Institute) and L. Wolfenstein (Carnegie-Mellon University). The possible final states for the decay K 0 → π + π - π 0 have isospin I = 0, 1, 2, and 3. The I = 0 and I = 2 states have CP = +1 and K S can decay into them without violating CP symmetry, but they are expected to be strongly suppressed by centrifugal barrier effects. The I = 1 and I = 3 states, which have no centrifugal barrier, have CP = -1 so that the K S decay to these requires CP violation. In order to see CP violation in K S → π + π - π 0 , it is necessary to observe the interference between K S and K L decay, which determines the amplitude ratio η +-0 = A(K S → π + π - π 0 ) A(K L → π + π - π 0 ) . (1) If η +-0 is obtained from an integration over the whole Dalitz plot, there is no contribution from the I = 0 and I = 2 final states and a nonzero value of η +-0 is entirely due to CP violation. Only I = 1 and I = 3

112

Magnetic properties and crystal structure of RENiA1 and UniA1 hydrides.  

DOE Green Energy (OSTI)

RENiAl (RE = rare-earth metal) and UNiAl compounds crystallizing in the hexagonal ZrNiAl-type structure (space group P{bar 6}2m) can absorb up to 2 and 3 hydrogen (deuterium) atoms per formula unit, respectively. Hydrogenation leads to a notable lattice expansion and modification of magnetic properties. However, the impact of hydrogenation on magnetism is the opposite for 4f- and 5f-materials: TN(T{sub c})is lowered in the case of rare-earth hydrides, while for UNiAlH(D){sub x} it increases by an order of magnitude. Here we present results of magnetic and structure studies performed of these compounds, focusing on the correlation between magnetic and structural variations and discussing possible reasons of the striking difference in effect of hydrogenation on rare-earth and actinide intermetallics.

Bordallo, H. N.; Drulis, H.; Havela, L.; Iwasieczko, W.; Kolomiets, A. V.; Nakotte, H.; Refaja, D.; Yartys, V. A.

1999-08-11T23:59:59.000Z

113

Improved Connectivity using Hybrid Uni/Omni-Directional Antennas in Sensor Networks  

E-Print Network (OSTI)

Connectivity in sensor networks is an important metric that describes the capability of networks to be able to report sensed information. The ability of member nodes to communicate with each other and collectively report data largely depends on connectivity. Density of node deployment, the transmission radius of the antenna and the communication paradigm employed has a significant effect on connectivity. A network deployment is said to be connected when every node within the network is capable of communicating, either via multi-hops or direct links to every other node in the network. This is a very strict connectivity requirement called 100% connectivity. This work deals with analyzing connectivity in various randomly deployed sensor network deployments and comparing metrics between omni and hybrid uni/omni-directional sensor networks. Specific results will be presented with varying node deployment densities and transmission radii and the levels of connectivity they guarantee. These results have significant impact on secure routing protocol design for wireless sensor networks and planning network deployments. I also present results on k-connectivity, which is a metric that represents network availability, along with the dependence on transmission radii, node densities and uni-directional antenna beam width.

Kwon, Ji Heon

2008-05-27T23:59:59.000Z

114

CURRENT EXPERIMENTS IN ELEMENTARY PARTICLE PHYSICS - March 1987  

E-Print Network (OSTI)

H Skodzck, B Thomauskc, G Volk, H C Weber MOSCOW, I T E P -Ling, T A P:.inanowski. J T Volk INFK. FLORENCE C Castoldi,A Moktarani. V Paoione, J T Volk, P M Yager CARNEGIE MELLON

Wohl, C.G.

2010-01-01T23:59:59.000Z

115

Alternative Transportation Technologies: Hydrogen, Biofuels,...  

NLE Websites -- All DOE Office Websites (Extended Search)

Current PHEV Battery Pack Cost* Estimates Compared (kWh nameplate) * 700-1500kWh (McKinsey Report) * 1000kWh (Carnegie Mellon University) * 800-1000kWh (Pesaran et al) *...

116

Patents and Innovation: Friends or Foes?  

E-Print Network (OSTI)

1986) Patents and R&D: is there a Lag? Internationalthe Carnegie Mellon survey of U.S. R&D managers in the earlyas a percentage of the R&D performed by the firms, including

Lvque, Franois

2007-01-01T23:59:59.000Z

117

Microsoft PowerPoint - 2013_Kyri_NETL.PPT [Compatibility Mode...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sizing and Placement of Energy Storage in a Power System Kyri Baker, Gabriela Hug, Xin Li, Carnegie Mellon University Two-Stage Stochastic Optimization Steady-State Storage Device...

118

Public Perception of Industrial Carbon Management by David Keith  

NLE Websites -- All DOE Office Websites (Extended Search)

F oundation, US DOE , E lectric Power R es earch Ins titute, NOAA, US E PA, E xxon, API, CMU CIS o HDGC Carnegie Mellon 2 Outline * What do people really think? * What is...

119

Combined Heat Cooling and Power: An Initial Look and Thoughts...  

NLE Websites -- All DOE Office Websites (Extended Search)

the Advancement of Science, Air Products and Chemicals, and the U.S. Navy. For the last two years, he was the Executive Director of the Carnegie Mellon Electricity Industry Center....

120

Alex Farrell  

NLE Websites -- All DOE Office Websites (Extended Search)

U.S. Navy. For the last two years, he was the Executive Director of the Carnegie Mellon Electricity Industry Center. This Speaker's Seminars Combined Heat Cooling and Power: An...

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

The Future of Housing - TMS  

Science Conference Proceedings (OSTI)

May 20, 2008 ... From climate change to power deregulation and suburban sprawl to the rapid ... This presentation speaks directly to our future housing needs and ... using the 2007 Carnegie Mellon Solar Decathlon house as a case study.

122

Abstract for Colin Morningstar  

NLE Websites -- All DOE Office Websites (Extended Search)

Morningstar Carnegie Mellon University Towards the spectrum of QCD using a space-time lattice Progress in extracting excited-state baryon masses in lattice QCD using large sets of...

123

ENERGY RESEARCH AND DEVELOPMENT ADMINISTRATION  

Office of Legacy Management (LM)

.' :h I : ' ENERGY RESEARCH AND DEVELOPMENT ADMINISTRATION WASHINGTON, D.C. 20545 October 24, 1975 :.. ,. Memo to Piles' CARNEGIE-MELLON SC&RCCYCLOTRON On October 23, 1975, W....

124

Shinjae Yoo | BNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Mellon University M.S., Carnegie Mellon University M.S., Seoul National University, Korea B.E., Soong-sil University, Korea Areas of Interest Large scale scientific data mining...

125

Presented by Petascale Data Storage Institute  

E-Print Network (OSTI)

_PDSI_SC07 Carnegie Mellon University Participating institutions Lawrence Berkeley National Laboratory/NERSC Roth_PDSI_0711 Led by William Kramer, National Energy Research Scientific Computing Center (NERSC) #12

126

Microsoft Word - Projects by State_2011.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

Capture Solid Sorbents for CO 2 Capture from Pre-Combustion Gas Streams Sud-Chemie, Inc. Carnegie Mellon University PA14 Pre-Combustion Capture Solvents for CO 2 Capture...

127

Postanschrift: Ernst-Moritz-Arndt-Universitt, Botanischer Garten, D-17487 Greifswald Internet: www.uni-greifswald.de/botgart  

E-Print Network (OSTI)

Postanschrift: Ernst-Moritz-Arndt-Universität, Botanischer Garten, D-17487 Greifswald Internet: www.uni-greifswald.de/botgart 250 Jahre Botanischer Garten 1763­2013 ?ffentliche Führungen im Botanischen Garten der Universität Gehölzsammlung im Winter Der Botanische Garten bietet interessierten Besuchern bzw. Besuchergruppen neben den

Schürmann, Michael

128

Radio-frequency measurements of UNiX compounds (X= Al, Ga, Ge) in high magnetic fields  

SciTech Connect

We performed radio-frequency (RF) skin-depth measurements of antiferromagnetic UNiX compounds (X=Al, Ga, Ge) in magnetic fields up to 60 T and at temperatures between 1.4 to {approx}60 K. Magnetic fields are applied along different crystallographic directions and RF penetration-depth was measured using a tunnel-diode oscillator (TDO) circuit. The sample is coupled to the inductive element of a TDO resonant tank circuit, and the shift in the resonant frequency {Delta}f of the circuit is measured. The UNiX compounds exhibit field-induced magnetic transitions at low temperatures, and those transitions are accompanied by a drastic change in {Delta}f. The results of our skin-depth measurements were compared with previously published B-T phase diagrams for these three compounds.

Mielke, Charles H [Los Alamos National Laboratory; Mcdonald, David R [Los Alamos National Laboratory; Zapf, Vivien [Los Alamos National Laboratory; Altarawneh, Moaz M [Los Alamos National Laboratory; Lacerda, Alex H [Los Alamos National Laboratory; Adak, Sourav [Los Alamos National Laboratory; Karunakar, Kothapalli [Los Alamos National Laboratory; Nakotte, Heinrich [Los Alamos National Laboratory; Chang, S [NIST; Alsmadi, A M [HASHEMITE UNIV; Alyones, S [HASHEMIT UNIV

2009-01-01T23:59:59.000Z

129

UniReport Satzungen und Ordnungen vom 03.09.2010 1 Ordnung des Fachbereichs Biochemie, Chemie, Pharmazie der Johann Wolfgang Goe-  

E-Print Network (OSTI)

UniReport Satzungen und Ordnungen vom 03.09.2010 1 Ordnung des Fachbereichs Biochemie, Chemie Biochemie, Chemie und Pharmazie am 07.06.2010 aufgrund des § 44 Abs.1 i.V. mit § 20 Abs.1 HHG beschlossene, Chemie und Pharmazie der Johann Wolfgang Goethe-Universität Frankfurt am Main den akademischen Grad

Mester, Rudolf

130

UniReport Satzungen und Ordnungen vom 25.09.2012 1 Ordnung des Fachbereichs Biochemie, Chemie und Pharmazie der Johann  

E-Print Network (OSTI)

UniReport Satzungen und Ordnungen vom 25.09.2012 1 Ordnung des Fachbereichs Biochemie, Chemie und) Die vom Fachbereich Biochemie, Chemie und Pharmazie am 12.03.2012 aufgrund des § 44 Abs.1 i.V. mit, Chemie und Pharmazie der Johann Wolfgang Goethe-Universität Frankfurt am Main den akademischen Grad

Mester, Rudolf

131

Title of Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Process Approach to Management of Operational Cyber Security Risks Antione Manson, DHS Jim Cebula, CERT DOE Cyber Security Conference Atlanta - May 2010 2 NO WARRANTY THIS MATERIAL OF CARNEGIE MELLON UNIVERSITY AND ITS SOFTWARE ENGINEERING INSTITUTE IS FURNISHED ON AN -AS-IS" BASIS. CARNEGIE MELLON UNIVERSITY MAKES NO WARRANTIES OF ANY KIND, EITHER EXPRESSED OR IMPLIED, AS TO ANY MATTER INCLUDING, BUT NOT LIMITED TO, WARRANTY OF FITNESS FOR PURPOSE OR MERCHANTABILITY, EXCLUSIVITY, OR RESULTS OBTAINED FROM USE OF THE MATERIAL. CARNEGIE MELLON UNIVERSITY DOES NOT MAKE ANY WARRANTY OF ANY KIND WITH RESPECT TO FREEDOM FROM PATENT, TRADEMARK, OR COPYRIGHT INFRINGEMENT. Use of any trademarks in this presentation is not intended in any way to infringe on the rights of the

132

Microsoft Word - Poster Abstract_2010_CMU_High Surface Area Materials.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

1th Annual SECA Workshop Poster Abstract 1th Annual SECA Workshop Poster Abstract Topic: High Surface Area, Mesoporous (La, Sr)MnO 3 For Solid Oxide Fuel Cell Cathodes Robin Chao, Graduate Student in Carnegie Mellon University 5700 Bunkerhill St. Apt 705, Pittsburgh, PA 15206 USA, hchao@andrew.cmu.edu, 412-260-5687 Dr. John Kitchin, Professor of Chemical Engineering in Carnegie Mellon University 5000 Forbes Ave, Pittsburgh PA, 15213, jkitchin@andrew.cmu.edu, 412-268-7803 Dr. Paul Salvador, Professor of Material Science and Engineering in Carnegie Mellon University 149 Roberts Eng Hall, Pittsburgh, PA 15213, paul7@andrew.cmu.edu, 412-268-2702 Abstract: The efficiency of the solid oxide fuel cell is limited by the cathode polarizations. One essential approach is to include high-surface-area cathode materials into the fabrication. However, conventional synthesis methods to

133

Chin-Shin Shiau  

NLE Websites -- All DOE Office Websites (Extended Search)

Norman Shiau Norman Shiau Mechanical Engineering Dept. Carnegie Mellon University This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. Ching-Shin "Norman" Shiau is a postdoctoral research fellow in the Department of Mechanical Engineering at Carnegie Mellon University. He is also a research member in the NSF MUSES project and Carnegie Mellon Green Design Institute. His general research interests include engineering design optimization, market system modeling, and environmental policy. The specific topics in his research focus are economic and environmental implications of plug-in hybrid technology, influence of transportation

134

AVESTAR® - Meet Our People  

NLE Websites -- All DOE Office Websites (Extended Search)

Partners Partners Simulators Invensys Operation Management Invensys Operations Management Education West Virginia University (WVU) Pierpont Community & Technical College West Virginia University (WVU) Pierpont Community & Technical College Training Invensys Operation Management Fossil Consulting Services ShaleNET Invensys Operations Management Fossil Consulting Services ShaleNET Research NETL Regional University Alliance West Virginia University (WVU) NRCCE U.S. China Clean Energy Research Center (CERC) Carnegie Mellon University URS Corporation NETL Regional University Alliance West Virginia University (WVU) National Research Center for Coal and Energy (NRCCE) U.S. China Clean Energy Research Center (CERC) Carnegie Mellon University URS Corporation

135

NETL: News Release - Energy Department Announces $9.4 Million in Grants to  

NLE Websites -- All DOE Office Websites (Extended Search)

8, 2004 8, 2004 Energy Department Announces $9.4 Million in Grants to Pennsylvania PITTSBURGH, PA - Secretary of Energy Spencer Abraham today announced $9.4 million in Department of Energy (DOE) grants to Pennsylvania universities and companies. The grants support President Bush's Hydrogen Fuel Initiative and research into cleaner fossil energy. This research promises to strengthen our nation's energy security and reduce greenhouse emissions. Secretary Abraham announced the awards today at Carnegie Mellon University. Pennsylvania companies and universities receiving funding are: University of Pittsburgh, Pittsburgh $800,000 (Fossil Energy) Carnegie Mellon University, Pittsburgh $1,378,815 (Fossil Energy) Media and Process Technology Inc, Pittsburgh $2,592,349 (Hydrogen)

136

Nobel Prize in Physics 1943  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 The prize was reserved and awarded in 1944 "for his contribution to the development of the molecular ray method and his discovery of the magnetic moment of the proton" Otto Stern Button USA Button born 1888 (Sorau, then Germany), died 1969 Button CA - Carnegie Institute of Technology (Carnegie Mellon University), Pittsburgh, Pennsylvania, USA Button AA - University of Frankfurt am Main, Frankfurt, Germany & University of Rostock, Rostock, Germany & University of Hamburg, Hamburg, Germany Button WA - University of Frankfurt am Main & University of Rostock & University of Hamburg Button Additional Information *Explanation of CA, AA & WA* Additional Information: Nobel e-Museum Prize in Physics 1943 Swiss Nobels: Otto Stern Carnegie Mellon Nobel Laureates

137

Parameter assignment for improved connectivity and security in randomly deployed wireless sensor networks via hybrid omni/uni-directional antennas  

E-Print Network (OSTI)

Conguring a network system to operate at optimal levels of performance re-quires a comprehensive understanding of the eects of a variety of system parameterson crucial metrics like connectivity and resilience to network attacks. Traditionally,omni-directional antennas have been used for communication in wireless sensor net-works. In this thesis, a hybrid communication model is presented where-in, nodes ina network are capable of both omni-directional and uni-directional communication.The eect of such a model on performance in randomly deployed wireless sensor net-works is studied, specically looking at the eect of a variety of network parameterson network performance.The work in this thesis demonstrates that, when the hybrid communication modelis employed, the probability of 100% connectivity improves by almost 90% and thatof k-connectivity improves by almost 80% even at low node densities when comparedto the traditional omni-directional model. In terms of network security, it was foundthat the hybrid approach improves network resilience to the collision attack by almost85% and the cost of launching a successful network partition attack was increased byas high as 600%. The gains in connectivity and resilience were found to improve withincreasing node densities and decreasing antenna beamwidths.

Shankar, Sonu

2008-08-01T23:59:59.000Z

138

C A R N E G I E I N S T I T U T E O F T E C H N O L O G Y F A L L 2 0 1 0 Character Building  

E-Print Network (OSTI)

materials for use in highly efficient solid state lighting systems, industrial batteries, fuel cells emitting diode systems (LED) that probably have five to ten times the efficiency of normal light bulbs their jobs through internships, job fairs and TartanTrak (Carnegie Mellon's online recruiting system

McGaughey, Alan

139

Electricity from Renewables: Status, Prospects, and Impediments  

E-Print Network (OSTI)

Electricity from Renewables: Status, Prospects, and Impediments America's Energy Future Study Panel on Electricity from Renewables K. John Holmes, National Research Council, Study Director (jholmes@nas.edu) #12, Carnegie Mellon University ·James J. Markowsky***, American Electric Power (Ret.) ·Richard A. Meserve

Kammen, Daniel M.

140

On the connectivity of extremal Ramsey graphs Andrew Beveridge  

E-Print Network (OSTI)

and Computer Science Macalester College Saint Paul, MN 55105 Oleg Pikhurko # Department of Mathematical Sciences Carnegie Mellon University Pittsburgh, PA 15213 Received: 1 December 2006, Accepted: 31 October 2007 Abstract An (r, b)­graph is a graph that contains no clique of size r and no independent set

Pikhurko, Oleg

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Encountering stronger password requirements: user attitudes and behaviors  

Science Conference Proceedings (OSTI)

Text-based passwords are still the most commonly used authentication mechanism in information systems. We took advantage of a unique opportunity presented by a significant change in the Carnegie Mellon University (CMU) computing services password policy ... Keywords: passwords, policy, security, survey, usability

Richard Shay; Saranga Komanduri; Patrick Gage Kelley; Pedro Giovanni Leon; Michelle L. Mazurek; Lujo Bauer; Nicolas Christin; Lorrie Faith Cranor

2010-07-01T23:59:59.000Z

142

School of Operations Research & Information Engineering -Undergraduate Post Graduate Activities Detail & History  

E-Print Network (OSTI)

by Operations Research & Information Engineering undergraduate students from the Class of 2011. Historical data Response Rate: 69% 2011 Graduate and Professional Schools Carnegie Mellon University PhD Operations Not Reported New York City NY Ernst & Young Commercial Due Diligence Staff San Francisco CA General Electric

Lipson, Michal

143

Early Science Instruction Addressing Fundamental Issues  

E-Print Network (OSTI)

Commentary Early Science Instruction Addressing Fundamental Issues David Klahr Carnegie Mellon (Vol. Eds.), Handbook of child psychology: Vol. 4. Child psychology in practice (6th ed.). New York acquisition in foundational domains. In W. Damon (Series Ed.) & D. Kuhn & R.S. Siegler (Vol. Eds.), Handbook

Klahr, David

144

A q u a r t e r l y n e w s l e t t e r o f t h e I n d i a n I n s t i t u t e o f Te c h n o l o g y Ka n p u r f o r a l u m n i a n d f r i e n d s Institute Milestones  

E-Print Network (OSTI)

, reflective terrace, rain water harvesting, eco-friendly refrigerant for air conditioning and the use of solar's Gold Medalist of his batch and received a Ph.D. in Electrical Engineering from Carnegie Mellon is the chairman of Signet Solar. He is an active private venture investor, serving on the Board of Directors

Srivastava, Kumar Vaibhav

145

A Risk Minimization Framework for Information Retrieval  

E-Print Network (OSTI)

A Risk Minimization Framework for Information Retrieval ChengXiang Zhai a John Lafferty b Carnegie Mellon University Abstract This paper presents a probabilistic information retrieval framework of decades of research in information retrieval, many different information retrieval models have been

Lafferty, John

146

A Case for Efficient Hardware/Software Cooperative Management of  

E-Print Network (OSTI)

*, Yixin Luo*, Samira Khan*, Jishen Zhao§, Yuan Xie§, and Onur Mutlu* *Carnegie Mellon University-level storage model q Access volatile data in memory with a load/store interface q Access persistent data in storage with a file system interface q Problem: Operating system (OS) and file system (FS) code

Mutlu, Onur

147

SUSTAINABLE  

E-Print Network (OSTI)

Software is an integral part of our everyday lives. Software has become the bottom line for many organizations who never envisioned themselves in the software business. 2006 Carnegie Mellon University Lets Teach Architecting High Quality Software Page 4WHERE BEHAVIOR COUNTS MOST much is required of software.

Architecting High; Quality Software

2006-01-01T23:59:59.000Z

148

What Energy ModelersWhat Energy Modelers Need to Know AboutNeed to Know About  

E-Print Network (OSTI)

$4­7/GJ; 90% capture; aquifer storage Current Coal Plants PC NGCC Natural Gas Plants Plants with CCS combustion (PC) Natural gas combined cycle (NGCC) Integrated coal gasification combined cycle (IGCC.S. Rubin, Carnegie Mellon Post-Combustion Technology for Industrial CO2 Capture BP Natural Gas Processing

149

Multimodal Person Tracking and Attention Classification Marek P. Michalowski  

E-Print Network (OSTI)

The problems of human detection, tracking, and attention recognition can be solved more effectively tracking of humans by a laser scanner with de- tected and tracked faces from a vision system. 2. SYSTEMMultimodal Person Tracking and Attention Classification Marek P. Michalowski Carnegie Mellon

Simmons, Reid

150

Appendix A Nuclear Waste Technical Review Board  

E-Print Network (OSTI)

from 1978 to 1985. At the same time, he continued his teaching career at the University of Kentucky chairman on January 17, 1997. Dr. Cohon is president of Carnegie Mellon University in Pittsburgh and Sciences. Dr. Cohon earned a bachelor of science degree in civil engineering from the University

151

U.S. Nuclear Waste Technical Review Board Members  

E-Print Network (OSTI)

, he continued his teaching career at the University of Kentucky. In 1985, he moved to the University ended June 25, 2002. Dr. Cohon is president of Carnegie Mellon University in Pittsburgh, Pennsylvania engineering from the University of Pennsylvania. He worked as a construction inspector in Philadelphia

152

U.S. Nuclear Waste Technical Review Board Jared L. Cohon, Ph.D.; Chairman  

E-Print Network (OSTI)

at the University of Kentucky. In 1985, he moved to the University of South Florida as an associate professor. Dr of Carnegie Mellon University in Pittsburgh, Pennsylvania. He has more than 25 years of teaching and research. In 1969, Dr. Cohon earned a bachelor of science degree in civil engineering from the University

153

Appendix A Nuclear Waste Technical Review Board  

E-Print Network (OSTI)

, he continued his teaching career at the University of Kentucky. In 1985, he moved to the University. Dr. Cohon is president of Carnegie Mellon University in Pittsburgh, Pennsylvania. He has more than 25 engineering from the University of Pennsylva- nia. He worked as a construction inspector in Philadelphia

154

Appendix A U.S. Nuclear Waste Technical Review Board  

E-Print Network (OSTI)

of Kentucky. In 1985, he moved to the University of South Florida as an associate professor. Dr. Sagüés became. Dr. Cohon is president of Carnegie Mellon University in Pittsburgh, Pennsylvania. He has more than 25 engineering from the University of Pennsylva- nia. He worked as a construction inspector in Philadelphia

155

Issues in Science and Technology, National Academy Press, Winter 1999. Making the Internet Fit for Commerce  

E-Print Network (OSTI)

such as the sale of guns to criminals. The legal, financial, and regulatory environment that has developed, and prevent illegal sales. Jon M. Peha Carnegie Mellon University peha@ece.cmu.edu, http and communications technology in the commercial exchange of products, services, and information. E-commerce sales

Peha, Jon M.

156

Khee Poh Lam  

NLE Websites -- All DOE Office Websites (Extended Search)

Khee Poh Lam Khee Poh Lam Professor of Architecture Center for Building Performance & Diagnostics, School of Architecture Carnegie Mellon University kplam@cmu.edu This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. Bachelor of Arts (Architecture and Environmental Design) (Hons), University of Nottingham, UK Bachelor of Architecture (Hons), University of Nottingham, UK PhD (Architecture), Carnegie Mellon University, Pittsburgh, PA. UK Registered Architect Chartered Member of the Royal Institute of British Architects Professor Lam is an educator, researcher, architect and consultant who

157

Shared Intellect * Shared Laboratories * Shared Resources  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 VOLUME 3, ISSUE 5 Featured Partner: Carnegie Mellon University's Department of Civil and Environmental Engineering (CEE) Since 2010, the Department of Civil and Environmental Engineering (CEE) at Carnegie Mellon University (CMU) and the National Energy Technology Laboratory (NETL) have enjoyed a fruitful partnership under the umbrella of the NETL Regional University Alliance (NETL-RUA). Although CMU researchers and those at other Alliance universities have worked with NETL scientists for decades, the formation of the NETL-RUA heralded a new era of productive collaborative research between NETL and the university, and CEE researchers have played a key role in the partnership. Currently, CEE has seven faculty and nine PhD students supporting NETL-RUA efforts.

158

Final_Tech_Session_Schedule_and_Location.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

Models of CO 2 Transport and Storage Costs and Their Importance in CCS Cost Estimates Sean T. McCoy, Carnegie Mellon University Edward S. Rubin, Carnegie Mellon University CONFERENCE PROCEEDINGS FOURTH ANNUAL CONFERENCE ON CARBON CAPTURE AND SEQUESTRATION DOE/NETL May 2-5, 2005 Abstract In recent years, global concerns about greenhouse gas emissions have stimulated considerable interest in CO 2 capture and storage (CCS) as a potential "bridging technology" that can achieve significant CO 2 emission reductions while allowing fossil fuels to be used until alternative energy sources are more widely deployed. To date, the literature in this field has focused most heavily on CO 2 capture technologies, which are believed to be the most costly components of a CCS system. Far fewer studies

159

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Cathode Surface Chemistry and Cathode Surface Chemistry and Optimization Studies-Carnegie Mellon University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Carnegie Mellon University's (CMU) project was selected to acquire the fundamental knowledge and understanding that will facilitate research and development to enhance

160

NETL-RUA Engineer Earns Presidential Award for R&D That Could Help Meet DOE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Engineer Earns Presidential Award for R&D That Could Help Engineer Earns Presidential Award for R&D That Could Help Meet DOE Carbon Capture Goals NETL-RUA Engineer Earns Presidential Award for R&D That Could Help Meet DOE Carbon Capture Goals July 23, 2012 - 1:00pm Addthis Washington, DC - A Carnegie Mellon University professor who worked with the National Energy Technology Laboratory (NETL) on research that could help meet carbon capture goals has earned a Presidential Early Career Award for Scientists and Engineers (PECASE). Dr. John Kitchin of Carnegie Mellon's Department of Chemical Engineering was recognized by the White House for his research in electrochemical separations for energy applications, which has the potential to enable clean coal technologies that meet U.S. Department of Energy (DOE) goals for

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Browse by Discipline -- E-print Network Subject Pathways: Fission and  

Office of Scientific and Technical Information (OSTI)

L M N O P Q R S L M N O P Q R S T U V W X Y Z Kaiser, David (David Kaiser) - Program in Science, Technology, and Society & Department of Physics, Massachusetts Institute of Technology (MIT) Kastens, Kim Anne (Kim Anne Kastens) - Lamont-Doherty Earth Observatory & Department of Earth and Environmental Sciences, Columbia University Kelly, Kevin (Kevin Kelly) - Department of Philosophy, Carnegie Mellon University Keniston, Kenneth (Kenneth Keniston) - Program in Science, Technology, and Society, Massachusetts Institute of Technology (MIT) Klahr, David (David Klahr) - Department of Psychology, Carnegie Mellon University Klein, Colin (Colin Klein) - Philosophy Department, University of Illinois at Chicago Klein, David (David Klein) - Department of Mathematics, California

162

It Starts with Science... | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It Starts with Science... It Starts with Science... It Starts with Science... Addthis Description Secretary Chu sits down with a journalism student at Carnegie Mellon's Education City campus in Qatar to discuss the value of science in education and what attracted him to the study of Physics. Speakers Secretary Steven Chu, Thouria Mahmoud Duration 3:09 Topic Science Education Energy Economy Credit Energy Department Video THOURIA MAHMOUD: And I'm a student in Northwestern in Qatar, a sophomore in journalism. And now we're in Carnegie Mellon University in Qatar, and I'm talking to Mr. Secretary. If you had any advice for students who are, like, looking forward to pursue any science major, what would you tell them? SECRETARY OF ENERGY STEVEN CHU: In universities they call a liberal arts

163

Electricity Subsector Cybersecurity Capability Maturity Model (ES-C2M2) - May 2012.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ElEctricity SubSEctor ElEctricity SubSEctor cybErSEcurity capability Maturity MoDEl (ES-c2M2) Version 1.0 31 May 2012 Electricity Subsector Cybersecurity Capability Maturity Model Version 1.0 © 2012 Carnegie Mellon University TABLE OF CONTENTS i Acknowledgments ..................................................................................................................................................iii CAUTIONARY NOTE Intended Scope and Use of This Publication .................................................................................vi 1 Introduction .....................................................................................................................................................1 2 Background .....................................................................................................................................................1

164

Development of a Foam OTEC System. Final technical report for Fiscal Year 1979  

Science Conference Proceedings (OSTI)

Research on Development of a Foam OTEC System, as carried out at Carnegie-Mellon University from October 1, 1978 through September 30, 1979, is described. To a brief section summarizing highlights of research results are appended 12 technical reports which detail specific sections of the program. The work described is continuing and a proposal is currently being submitted to provide support in fiscal 1980.

Not Available

1980-01-01T23:59:59.000Z

165

Coaching via cognitive apprenticeship  

Science Conference Proceedings (OSTI)

At Carnegie Mellon's Silicon Valley campus we employ a learn-by-doing educational approach in which nearly all student learning, and thus instruction, is in the context of realistic, team-based projects. Consequently, we have adopted coaching as our ... Keywords: active learning, cognitive apprenticeship, cs ed research, experience report, graduate studies, information systems, instructional technologies, learning by doing, professional practice, software engineering, story-centered curricula

Ray Bareiss; Martin Radley

2010-03-01T23:59:59.000Z

166

Department of Physics Seminar (UNI)  

E-Print Network (OSTI)

of the reactivity of nuclear reactors is pre- sented. The theory of reactor kinetics is summarized with key problems measurement methods for power reactors. #12;Contents 1 Introduction 2 2 Nuclear physics basics 3 2.1 Nuclear a considerable ammount of energy. A nuclear reactor (if we seek the simplest explanation) is sought to be as much

?umer, Slobodan

167

Detecting Molecular Features of Spectra Mainly Associated with Structural and Non-Structural Carbohydrates in Co-Products from BioEthanol Production Using DRIFT with Uni- and Multivariate Molecular Spectral Analyses  

E-Print Network (OSTI)

Abstract: The objective of this study was to use DRIFT spectroscopy with uni- and multivariate molecular spectral analyses as a novel approach to detect molecular features of spectra mainly associated with carbohydrate in the co-products (wheat DDGS, corn DDGS, blend DDGS) from bioethanol processing in comparison with original feedstock (wheat (Triticum), corn (Zea mays)). The carbohydrates related molecular spectral bands included: A_Cell (structural carbohydrates, peaks area region and baseline: ca. 14851188 cm ?1), A_1240 (structural carbohydrates, peak area centered at ca. 1240 cm ?1 with region and baseline: ca. 12921198 cm ?1), A_CHO (total carbohydrates, peaks region and baseline: ca. 1187950 cm-1), A_928 (non-structural carbohydrates, peak area centered at ca. 928 cm ?1 with region and baseline: ca. 952910 cm ?1), A_860 (non-structural carbohydrates, peak area centered at ca. 860 cm ?1 with region and baseline: ca. 880827 cm-1), H_1415 (structural carbohydrate, peak height centered at ca. 1415 cm ?1 with baseline: ca. 14851188 cm ?1), H_1370 (structural carbohydrate, peak height at ca. 1370 cm ?1 with a baseline: ca. 14851188 cm ?1). The study shows that the grains had lower spectral intensity (KM Unit) of the cellulosic compounds of A_1240 (8.5 vs. 36.6, P < 0.05), higher (P < 0.05)

Peiqiang Yu; Daalkhaijav Damiran; Arash Azarfar; Zhiyuan Niu

2011-01-01T23:59:59.000Z

168

US CMS Members Picture Gallery  

NLE Websites -- All DOE Office Websites (Extended Search)

Members Picture Gallery Members Picture Gallery Developed by Ben Sadler, FSU Updated July 29, 2008. Please send comments and corrections to Sharon Hagopian. INSTITUTIONS: Boston University Brown University University of California, Davis University of California, Los Angeles University of California, Riverside University of California, San Diego University of California, Santa Barbara California Institute of Technology Carnegie Mellon University University of Colorado Cornell University Fairfield University Fermi National Accelerator Laboratory University of Florida Florida International University Florida State University Florida Institute of Technology University of Illinois, Chicago University of Iowa Johns Hopkins University University of Kansas Kansas State University Lawrence Livermore National Laboratory

169

Cybersecurity for Energy Delivery Systems 2010 Peer Review Presentations -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Software Engineering Institute Software Engineering Institute Cybersecurity for Energy Delivery Systems 2010 Peer Review Presentations - Software Engineering Institute National lab researchers, industry partners, and academia from the Cybersecurity for Energy Delivery Systems Program in the DOE's Office of Electricity Delivery and Energy Reliability held a 2-day public peer review to examine more than 30 DOE-supported or cost-shared projects designed to enhance the security and reliability of the nation's energy delivery infrastructure. Industry experts from the Energy Sector Control Systems Working Group provided technical feedback and recommendations to each project to ensure DOE continues to support robust projects that meet industry needs. Presentations from Carnegie Mellon University's Software Engineering

170

U.S. Department of Energy Electricity Advisory Committee Meeting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Meeting Meeting NRECA Conference Center Arlington, VA June 5, 2013 Summary of Meeting 2 PARTICIPANTS EAC: BILLY BALL Southern Company LINDA BLAIR Executive Vice President, ITC Holdings MERWIN BROWN California Institute for Energy & Environment PAUL CENTOLELLA Vice President, Analysis Group BOB CURRY Commissioner Emeritus, NY; Charles River Associates CLARK GELLINGS Electric Power Research Institute DIAN GREUNICH Dian Greunich Consulting PAUL HUDSON Stratus Energy Group, Austin SUE KELLY American Public Power Association RALPH MASIELLO DNV KEMA RICH MEYER (for BARRY LAWSON) National Rural Electric Cooperative Association CLAIR MOELLER Midcontinent Independent System Operator GRANGER MORGAN Carnegie Mellon, Engineering & Public Policy

171

Leo Christodoulou | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Leo Christodoulou Leo Christodoulou About Us Leo Christodoulou, Ph.D. - Program Manager, Advanced Manufacturing Office Career Highlights Director, Defense Sciences Office, Defense Advanced Research Projects Agency Project Director, Composites, Martin Marietta Laboratories Recipient of 2006 National Materials Advancement Award, Federation of Materials Societies; 1998 Inventor of the Year, Martin Marietta Corporation; 1996 Grunfeld Medal and Prize, Institute of Materials; 1987 Jefferson Cup, Martin Marietta Corporation; among others B.S. and Ph.D. in Metallurgy, Imperial College of Science, Technology and Medicine, London; Postdoctoral Research Fellow, Carnegie Mellon University Leo Christodoulou is the Program Manager of the Department's Advanced Manufacturing Office (formerly called the Industrial Technologies

172

Distributed Generation  

NLE Websites -- All DOE Office Websites (Extended Search)

Untapped Value of Backup Generation Untapped Value of Backup Generation While new guidelines and regulations such as IEEE (Institute of Electrical and Electronics Engineers) 1547 have come a long way in addressing interconnection standards for distributed generation, utilities have largely overlooked the untapped potential of these resources. Under certain conditions, these units (primarily backup generators) represent a significant source of power that can deliver utility services at lower costs than traditional centralized solutions. These backup generators exist today in large numbers and provide utilities with another option to reduce peak load, relieve transmission congestion, and improve power reliability. Backup generation is widely deployed across the United States. Carnegie Mellon's Electricity

173

Curriculum Vitae  

NLE Websites -- All DOE Office Websites (Extended Search)

Margaret R. Taylor, Page 1 of 17 Margaret R. Taylor, Page 1 of 17 Margaret R. Taylor Education Carnegie Mellon University, Pittsburgh, PA Ph.D., Engineering & Public Policy, 2001. M.S., Engineering & Public Policy, 1998. Dissertation: "The Influence of Government Actions on Innovative Activities in the Development of Environmental Technologies to Control Sulfur Dioxide Emissions from Stationary Sources" Committee: David Hounshell, Edward Rubin, Linda Argote, Scott Farrow Columbia University, New York, NY B.A., Double Major: Environmental Science (Geochemistry), American History, 1993 Experience Stanford University. Fall 2012-present. Engineering Research Associate, Precourt Energy Efficiency Center. Lawrence Berkeley National Laboratory (LBNL). May 2010-present.

174

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R R &D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV

175

Solar Agile Delivery of Electrical Power Technology (Solar ADEPT) (2nd Quarterly)  

DOE Green Energy (OSTI)

This talk is for the ARPA-E funded program that Los Alamos is part of a team with Carnegie Mellon University, Magnetics div. of Spang, and the University of Pittsburgh. Most of the material presented in this talk has been presented before and is associated with accelerators and has a 'DUSA' 'ATDO' designator. Slight variations in circuit topology as presented here are somewhat novel and although not classified should be considered Los Alamos proprietary. The viewgraphs from 'both' talks will be presented to team members and the ARPA-E sponsor.

Reass, William A. [Los Alamos National Laboratory; Audia, Jeffrey M. [Los Alamos National Laboratory; Baca, David M. [Los Alamos National Laboratory; Kwon, Sung I. [Los Alamos National Laboratory; Scheinker, Alexander [Los Alamos National Laboratory

2012-08-13T23:59:59.000Z

176

Umbra's system representation.  

SciTech Connect

This document describes the Umbra System representation. Umbra System representation, initially developed in the spring of 2003, is implemented in Incr/Tcl using concepts borrowed from Carnegie Mellon University's Architecture Description Language (ADL) called Acme. In the spring of 2004 through January 2005, System was converted to Umbra 4, extended slightly, and adopted as the underlying software system for a variety of Umbra applications that support Complex Systems Engineering (CSE) and Complex Adaptive Systems Engineering (CASE). System is now a standard part Of Umbra 4. While Umbra 4 also includes an XML parser for System, the XML parser and Schema are not described in this document.

McDonald, Michael James

2005-07-01T23:59:59.000Z

177

Browse by Discipline -- E-print Network Subject Pathways: -- Energy,  

Office of Scientific and Technical Information (OSTI)

O P Q R S O P Q R S T U V W X Y Z Nachman, Iftach (Iftach Nachman) - Department of Molecular Genetics and Biochemistry, Tel Aviv University Naczi, Robert F. C. (Robert F. C. Naczi) - New York Botanical Garden Nadasdy, Zoltan (Zoltan Nadasdy) - Division of Biology, California Institute of Technology Nadim, Farzan (Farzan Nadim) - Federated Department of Biological Sciences, Rutgers University at Newark Nadkarni, Nalini (Nalini Nadkarni) - Environmental Studies Program, Evergreen State College Nagalingum, Nathalie (Nathalie Nagalingum) - Museum of Comparative Zoology, Harvard University Nagayama, Toshiki (Toshiki Nagayama) - Department of Biology, Yamagata University Nagle, John F. (John F. Nagle) - Departments of Physics & Biological Sciences, Carnegie Mellon University

178

Browse by Discipline -- E-print Network Subject Pathways: Physics --  

Office of Scientific and Technical Information (OSTI)

Y Z Y Z Yagle, Andrew E. (Andrew E. Yagle) - Department of Electrical Engineering and Computer Science, University of Michigan Yakhot, Alexander (Alexander Yakhot) - Department of Mechanical Engineering, Ben-Gurion University Yakovlev, Alex (Alex Yakovlev) - School of Electrical, Electronic and Computer Engineering, University of Newcastle upon Tyne Yalcin, Hulya (Hulya Yalcin) - Robotics Institute, School of Computer Science, Carnegie Mellon University Yamamoto, Hirosuke (Hirosuke Yamamoto) - Department of Complexity Science and Engineering, University of Tokyo Yaman, Yavuz (Yavuz Yaman) - Department of Aerospace Engineering, Middle East Technical University Yamilov, Alexey (Alexey Yamilov) - Department of Physics, University of Missouri-Rolla Yan, Yong (Yong Yan) - Department of Electronics, University of Kent

179

Browse by Discipline -- E-print Network Subject Pathways: Fission and  

Office of Scientific and Technical Information (OSTI)

Q R S Q R S T U V W X Y Z Peha, Jon M. (Jon M. Peha) - Department of Electrical and Computer Engineering, Carnegie Mellon University Pennock, Robert T. (Robert T. Pennock) - Department of Philosophy, Michigan State University Petkov, Vesselin (Vesselin Petkov) - Philosophy Department, Concordia University Pettenella, Davide (Davide Pettenella) - Dipartimento Territorio e Sistemi Agro-Forestali, Università degli Studi di Padova Pfaff, Alex (Alex Pfaff) - Sanford School of Public Policy, Duke University Piccinini, Gualtiero (Gualtiero Piccinini) - Center for Neurodynamics & Department of Philosophy, University of Missouri-St. Louis Pincock, Chris (Chris Pincock) - Philosophy Department , Ohio State University Pitowsky, Itamar (Itamar Pitowsky) - Sidney M. Edelstein Center for

180

Browse by Discipline -- E-print Network Subject Pathways: Fission and  

Office of Scientific and Technical Information (OSTI)

V W X Y Z V W X Y Z van Benthem, Johan (Johan van Benthem) - Institute for Logic Language and Computation, Universiteit van Amsterdam Van Cleave, Nancy K. (Nancy K. Van Cleave) - Department of Mathematics, Eastern Illinois University van Lambalgen, Michiel (Michiel van Lambalgen) - Institute for Logic, Language and Computation, Universiteit van Amsterdam van Lith, Janneke (Janneke van Lith) - Department of Philosophy, Universiteit Utrecht Velasco, Joel D. (Joel D. Velasco) - Department of Philosophy, Texas Tech University Veloso, Francisco (Francisco Veloso) - Department of Engineering and Public Policy, Carnegie Mellon University Venema, Yde (Yde Venema) - Institute for Logic Language and Computation, Universiteit van Amsterdam Verhoeff, Tom (Tom Verhoeff) - Wiskunde en Informatica, Technische

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Uni-Solar | Open Energy Information  

Open Energy Info (EERE)

Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL National Center for Photovoltaics...

182

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000015 FOA-0000015 Carnegie Mellon University FE DE-FE0002415 SCC 2010-2013 Richard Dunst 12/1/2010 thru 9/30/2014 Pittsburgh, PA RECOVERY ACT: INNOVATIVE CO2 SEQUESTRATION FROM FLUE GAS USING AN IN-DUCT SCRUBBER Carnegie Mellon will perform lab scale research and testing in support of Alcoa for CO2 and alkaline clay project, to form a beneficial and environmentally benign product - neutralized clay. 11 18 2010 Richard Dunst Digitally signed by Richard Dunst DN: cn=Richard Dunst, o=NETL, ou=Gasification Division, email=dunst@netl.doe.gov, c=US Date: 2010.11.18 08:12:04 -05'00' 12 27 2010 Jesse Garcia Digitally signed by Jesse Garcia DN: cn=Jesse Garcia, o, ou=OPFC, email=Jesse.Garcia@netl.doe.gov, c=US Date: 2010.12.27 21:19:09 -05'00' This CX covers R&D laboratory activities and design of system; work activities under Tasks 1-6 only.

183

38. JahrgangNummer 5 Juni 2011 www.presse.uni-oldenburg.de/uni-info  

E-Print Network (OSTI)

Reaktorsicherheit, das das Projekt mit bis zu 1,6 Millionen Euro fördert. ,,Die Offshore-Windenergie ist Führungsposition in der Offshore-Technologie nutze. (mr) Maritimer Cluster Kooperationsprojekt für Offshore-Windenergie/Zingst in der Ostsee ste- hen. Sie bilden den ersten kommerziellen Offshore-Windpark EnBW Baltic 1, der Anfang

Appelrath, Hans-Jürgen

184

38. JahrgangNummer 6 Juli 2011 www.presse.uni-oldenburg.de/uni-info  

E-Print Network (OSTI)

Interessen an Risiken (Schiff bau; offshore Aktivitäten) und Potentialen (Windenergie) und die ?ffentlichkeit ­Sicherheit, Offshore Windenergie, Interpretation von Messungen, ?lunfälle und chronische Belastungen://www.norddeutscherklimaatlas.de/). Typische Stakeholder haben zu tun mit Küsten schutz, Landwirtschaft, offshore Aktivitäten, Tourismus

Oldenburg, Carl von Ossietzky Universität

185

38.JahrgangNummer 2 Februar 2011 www.presse.uni-oldenburg.de/uni-info  

E-Print Network (OSTI)

auf Themen aus den Bereichen Offshore-Windenergie sowie Speicher und Netzintegration konzentrieren unterstützt Offshore-Windstudium Die Offshore-Windenergie bil- det das Kernstück beim Umbau der und Bre- men, nun mit dem berufsbegleitenden, international ausgerichteten Studium Offshore-Windenergie

Habel, Annegret

186

E-Mail: fsphysik@uni-oldenburg.de Internet: http://fachschaft.physik.uni-oldenburg.de  

E-Print Network (OSTI)

allgemeinen Bedeutung der abdeckenden Versorgung mit erneuerbarer Energie fu¨r die Funktion der zivilisatori, sa¨mtliche angebotene erneuerbare Energie aufzukaufen, so dass alle anderen Konsumenten an das kooperieren- der, heterogener Systeme im stabilen Be- trieb hinsichtlich Preis bzw. bereitgestellter Energie

Damm, Werner

187

Robotic Surveying  

SciTech Connect

ZAPATA ENGINEERING challenged our engineers and scientists, which included robotics expertise from Carnegie Mellon University, to design a solution to meet our client's requirements for rapid digital geophysical and radiological data collection of a munitions test range with no down-range personnel. A prime concern of the project was to minimize exposure of personnel to unexploded ordnance and radiation. The field season was limited by extreme heat, cold and snow. Geographical Information System (GIS) tools were used throughout this project to accurately define the limits of mapped areas, build a common mapping platform from various client products, track production progress, allocate resources and relate subsurface geophysical information to geographical features for use in rapidly reacquiring targets for investigation. We were hopeful that our platform could meet the proposed 35 acres per day, towing both a geophysical package and a radiological monitoring trailer. We held our breath and crossed our fingers as the autonomous Speedrower began to crawl across the playa lakebed. We met our proposed production rate, and we averaged just less than 50 acres per 12-hour day using the autonomous platform with a path tracking error of less than +/- 4 inches. Our project team mapped over 1,800 acres in an 8-week (4 days per week) timeframe. The expertise of our partner, Carnegie Mellon University, was recently demonstrated when their two autonomous vehicle entries finished second and third at the 2005 Defense Advanced Research Projects Agency (DARPA) Grand Challenge. 'The Grand Challenge program was established to help foster the development of autonomous vehicle technology that will some day help save the lives of Americans who are protecting our country on the battlefield', said DARPA Grand Challenge Program Manager, Ron Kurjanowicz. Our autonomous remote-controlled vehicle (ARCV) was a modified New Holland 2550 Speedrower retrofitted to allow the machine-actuated functions to be controlled by an onboard computer. The computer-controlled Speedrower was developed at Carnegie Mellon University to automate agricultural harvesting. Harvesting tasks require the vehicle to cover a field using minimally overlapping rows at slow speeds in a similar manner to geophysical data acquisition. The Speedrower had demonstrated its ability to perform as it had already logged hundreds of acres of autonomous harvesting. This project is the first use of autonomous robotic technology on a large-scale for geophysical surveying.

Suzy Cantor-McKinney; Michael Kruzic

2007-03-01T23:59:59.000Z

188

Argonne Chemical Sciences & Engineering - People - National Security -  

NLE Websites -- All DOE Office Websites (Extended Search)

National Security National Security Nuclear Forensics and Nanoscale Engineering Chemical Analysis and Research Analytical Chemistry Laboratory Management and Support David B. Chamberlain, Chemical Engineer and Department Manager phone: 630/252-7699, fax: 630/972-4409, e-mail: david.chamberlain@anl.gov M.S., Chemical Engineering, University of Idaho Spent fuel reprocessing Radiological forensics Sealed radioactive source characterization Radioactive materials and national security Mary Anne Yates, Senior Technical Advisor/Senior Chemist phone: 630/252-7699, fax: 630/972-4409, e-mail: mayates@anl.gov Ph.D., Nuclear Chemistry, Carnegie Mellon University Homeland Security Counterterrorism Publications in nuclear, atomic, and particle physics Jodi L. Canaday, Administrative Secretary

189

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000036 FOA-0000036 Aquion Energy OE OE0000226 Energy Delivery Technologies Div 2010 Kimberly R. Nuhfer 01/01/2010 - 12/31/2013 4323 Wean Hall, Pittsburgh, PA 15213 Demonstration of Sodium Ion Battery for Grid Level Application Carnegie Mellon University, a sub-recipient to Aquion Energy, will conduct lab scale material studies in support of the project. 03 03 2010 Kimberly Nuhfer Digitally signed by Kimberly Nuhfer DN: cn=Kimberly Nuhfer, o=DOE National Energy Technology Laboratory, ou=Energy Delivery Technologies Division, email=kimberly.nuhfer@netl.doe.gov, c=US Date: 2010.03.03 15:23:42 -05'00' 06 02 2010 Fred E. Pozzuto Digitally signed by Fred E. Pozzuto DN: cn=Fred E. Pozzuto, o=USDOE, ou=NETL-Office of Project Facilitation and Compliance, email=fred.pozzuto@netl.doe.gov, c=US

190

ENERGY RESEARCH AND DEVELOPMENT ADMlNlSTRATldN CHICAGO OPERATIONS OFFICE  

Office of Legacy Management (LM)

RESEARCH AND DEVELOPMENT ADMlNlSTRATldN RESEARCH AND DEVELOPMENT ADMlNlSTRATldN CHICAGO OPERATIONS OFFICE 9999 SOUTH CASS AVENUE - .~-- ARGONNE, ILL!&+ bt.499 _ In Reply Refer TO: SEP. 1 61975 Martin B. Biles, Director Division of Operational Safety, HQ CARNEGIE-MELLON UNIVERSITY (CMU) CYCLOTRON DISMANTLING PROJECT The purpose of this memorandum is to summarize the dismantling activities which have been performed or are planned at the CMU, Nuclear Research Center, Saxonburg, Pennsylvania, site for purposes of preparing the site for unrestricted release from a radiological standpoint. Facility Description and Background Attachment 1 shows a schematic of the main building (which housed the synchrocyclotron, laboratories, machine shop, and offices) and adjacent ancillary facilities. Not shown (direction of location shown by arrows)

191

Linear Collider LHC Subpanel | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Subpanel on the Linear Collider and the Large Hadron Subpanel on the Linear Collider and the Large Hadron Collider High Energy Physics Advisory Panel (HEPAP) HEPAP Home Meetings Members .pdf file (20KB) Charges/Reports Charter .pdf file (44KB) HEP Committees of Visitors HEP Home Charges/Reports Subpanel on the Linear Collider and the Large Hadron Collider Print Text Size: A A A RSS Feeds FeedbackShare Page Joseph Lykken (FNAL) Co-Chair James Siegrist (LBNL) Co-Chair Jonathan Bagger (JHU) Barry Barish (Caltech) Neil Calder (SLAC) Jonathan Feng (UC Irvine) Fred Gilman (Carnegie Mellon) JoAnne Hewett (SLAC) John Huth (Harvard) Judy Jackson (Fermilab) Young-Kee Kim (Chicago) Rocky Kolb (Fermilab) Joe Lykken (Fermilab) Konstantin Matchev (Florida) Hitoshi Murayama (UC Berkeley) Jim Siegrist (UC Berkeley) Paris Sphicas (CERN/Athens)

192

Marshall D. Newton  

NLE Websites -- All DOE Office Websites (Extended Search)

Marshall D. Newton Marshall D. Newton Picture of Marshall D. Newton Senior Chemist Mechanistic analysis of electron transfer kinetics: thermal and photoinitiated; intra- and intermolecular; homogeneous and interfacial. Calculation of nonequilibrium solvation thermodynamics for electron transfer ( free energies and entropies) using quantum chemical techniques, molecular-level force fields, and dielectric continuum models. Formulation of compact electronic state spaces for modeling electron transfer, using optical spectroscopic data Telephone #: (631) 344-4366 newton@bnl.gov B.A. Dartmouth College, 1961; M.A. Dartmough College, 1963; Ph.D. Harvard University, 1966 NSF Postdoctoral Fellow, Oxford University, Oxford, England, 1966-67; NIH Postdoctoral Fellow, Carnegie-Mellon University, Pittsburgh, PA, 1967-68;

193

A Multi-Pollutant Framework for Evaluating CO2 Control Options for Fossil Fuel Power Plants  

NLE Websites -- All DOE Office Websites (Extended Search)

Multi-Pollutant Framework for Evaluating CO Multi-Pollutant Framework for Evaluating CO 2 Control Options for Fossil Fuel Power Plants Edward S. Rubin (rubin@cmu.edu; 412-268-5897) Anand B. Rao (abr@andrew.cmu.edu; 412-268-5605) Michael B. Berkenpas (mikeb@cmu.edu; 412-268-1088) Carnegie Mellon University EPP Department, Baker Hall 128A Pittsburgh, PA 15213 Abstract As part of DOE/NETL's Carbon Sequestration Program, we are developing an integrated, multi-pollutant modeling framework to evaluate the costs and performance of alternative carbon capture and sequestration technologies for fossil-fueled power plants. The model calculates emissions, costs, and efficiency on a systematic basis at the level of an individual plant or facility. Both new and existing facilities can be modeled, including coal-based or natural gas-based combustion or gasification systems using air or oxygen.

194

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

5, 2004 5, 2004 Calendar Thursday, February 5 2:30 Theoretical Physics Seminar - Curia II Speaker: S. Fleming, Carnegie Mellon University Title: Lessons from Soft-Collinear Effective Theory 3:30 DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4:00 Accelerator Physics and Technology Seminar - 1 West Speaker: K. Shepard, Argonne National Laboratory Title: Superconducting RF Technology for Ion Accelerators Friday, February 6 3:30 DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4:00 Joint Experimental Theoretical Physics Seminar - 1 West Speaker: R. Jaffe, Massachusetts Institute of Technology Title: Exotica Cafeteria Wednesday, February 4 Wild Mushroom Bisque Baked lemon rosemary chicken w/wild rice and choice of vegetable $4.75 Turkey, roast beef and smoked bacon w/cheddar cheese on your choice of bread served w/a side salad $4.75

195

S. S. Krishnan  

NLE Websites -- All DOE Office Websites (Extended Search)

Krishnan Krishnan Principal Research Scientist, and Head Energy Efficiency and Sutsainability Program Center for Study of Science, Technology and Policy, Bangalore, India This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. S.S. Krishnan received the MS and PhD in Computer and Systems Engineering from Rensselaer Polytechnic Institute, Troy, New York in 1989 and 1992 respectively. He was a Scientist at The Robotics Institute, Carnegie Mellon University, Pittsburgh, PA, and has worked extensively on major projects with US, European, Japanese and Indian entities in the modeling, analysis

196

NewPipeline-Robot-Power-Source.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Power Sources for Power Sources for Inspection Robots in Natural Gas Transmission Pipelines By Shreekant B. Malvadkar and Edward L. Parsons Office of Systems & Policy Support INTRODUCTION Strategic Center of Natural gas's (SCNG) Natural Gas Infrastructure Reliability Product Team has undertaken the development of a prototype robot that would inspect and possibly repair transmission pipelines. NETL has granted a contract for this purpose to New York Gas Group (NYGAS) and Carnegie Mellon University's (CMU) National Robotics Engineering Consortium (NREC). The purpose of this study is to analyze various onboard power supply options for such a commercially viable robot that can operate in a transmission pipeline for extended period. The primary power sources considered are wind turbines, rechargeable batteries,

197

Larry Curtiss  

NLE Websites -- All DOE Office Websites (Extended Search)

A. Curtiss A. Curtiss Theory and Modeling Group Phone: 630-252-7380 E-mail: curtiss@anl.gov Argonne National Laboratory Center for Nanoscale Materials Materials Science and Chemistry Divisions Argonne, IL 60439 Larry Curtiss received his B.S. degree in Chemistry in 1969 from the University of Wisconsin- Madsion and Ph.D. degree in Theoretical Chemistry in 1973 from Carnegie- Mellon University. He was a Battelle Institute Fellow at Battelle Memorial Institute in Columbus Ohio from 1973 to 1976. He joined the Chemical Engineering Division at Argonne National Laboratory in 1976. He was promoted to senior scientist in 1988 and to Distinguished Senior Scientist in 2000. He has been Group Leader of the Molecular Materials Group in the Materials Science and Chemistry

198

ndelmini-web.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

N N AND ∆ RESONANCES Revised Sept. 2013 by V. Burkert (Jefferson Lab), E. Klempt (University of Bonn), M.R. Pennington (Jefferson Lab), L. Tiator (University of Mainz), and R.L. Workman (George Washington University). I. Introduction The excited states of the nucleon have been studied in a large number of formation and production experiments. The Breit-Wigner masses and widths, the pole positions, and the elasticities of the N and ∆ resonances in the Baryon Summary Table come largely from partial-wave analyses of πN total, elastic, and charge-exchange scattering data. The most com- prehensive analyses were carried out by the Karlsruhe-Helsinki (KH80) [1], Carnegie Mellon-Berkeley (CMB80) [2], and George Washington U (GWU) [3] groups. Partial-wave anal- yses have also been performed on much smaller πN reaction data sets to get ηN , KΛ, and KΣ branching fractions (see

199

An Integrated Modeling Framework for Carbon Capture and Storage Technologies  

NLE Websites -- All DOE Office Websites (Extended Search)

Karen L. cohen Karen L. cohen Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-6667 karen.cohen@netl.doe.gov Edward s. Rubin Carnegie Mellon University 5000 Forbes Avenue 128A Baker Hall Pittsburgh, PA 15213 412-268-5897 rubin@cmu.edu An IntegrAted ModelIng FrAMework For CArbon CApture And StorAge teChnologIeS Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is developing safe, lower-cost methods of carbon dioxide (CO 2 ) capture and storage (CCS) as a potential option for climate change mitigation. In addition to technology development, there is a need for modeling and assessment tools to evaluate and compare the cost and effectiveness of CCS methods. Analytical

200

Browse by Discipline -- E-print Network Subject Pathways: Physics --  

Office of Scientific and Technical Information (OSTI)

I J K L M N O P Q R S I J K L M N O P Q R S T U V W X Y Z Iceland, University of (University of Iceland) - Earthquake Engineering Research Centre Ida, Nathan (Nathan Ida) - Department of Electrical and Computer Engineering, University of Akron Ierapetritou, Marianthi G.(Marianthi G.Ierapetritou).- Department of Chemical and Biochemical Engineering, Rutgers University Iglic, Ales (Ales Iglic) - Faculty of Electrical Engineering, University of Ljubljana Ilchmann, Achim (Achim Ilchmann) - Institut für Mathematik, Technische Universität Ilmenau Ilg, Winfried (Winfried Ilg) - Centre for Integrated Neuroscience, University Clinic Tübingen Ilic, Marija D. (Marija D. Ilic) - Department of Electrical and Computer Engineering, Carnegie Mellon University Ilow, Jacek (Jacek Ilow) - Department of Electrical and Computer

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Browse by Discipline -- E-print Network Subject Pathways: Fission and  

Office of Scientific and Technical Information (OSTI)

H I J K L M N O P Q R S H I J K L M N O P Q R S T U V W X Y Z Hale, Piers J. (Piers J. Hale) - Department of the History of Science, University of Oklahoma Halvorson, Hans (Hans Halvorson) - Department of Philosophy, Princeton University Hammer, David (David Hammer) - Departments of Education & Physics and Astronomy, Tufts University Hansen, James E. (James E. Hansen) - Goddard Institute for Space Studies Harnad, Stevan (Stevan Harnad) - E-Prints on Cognitive Psychology & School of Electronics and Computer Science, University of Southampton Harrell, Mara (Mara Harrell) - Department of Philosophy, Carnegie Mellon University Harrington, Jonathan (Jonathan Harrington) - Institut für Phonetik und Sprachverarbeitung, Ludwig-Maximilians-Universität München

202

Microsoft PowerPoint - 2013_Kyri_NETL.PPT [Compatibility Mode]  

NLE Websites -- All DOE Office Websites (Extended Search)

Sizing and Placement of Energy Storage in a Power System Sizing and Placement of Energy Storage in a Power System Kyri Baker, Gabriela Hug, Xin Li, Carnegie Mellon University Two-Stage Stochastic Optimization Steady-State Storage Device Model Objectives 1) To determine the optimal locations and capacity of energy storage devices in a power system by using a 2-stage Stochastic optimization approach 2) Determine the optimal number of storage devices by implementing mixed-integer programming 3) Employ a scenario reduction technique to make the Stochastic optimization problem more computationally feasible α = efficiency T = time scale Pout Pin Simulation Results Objective Function and Constraints  Use Stochastic Optimization to represent different states of the power system  Each scenario in the optimization is a 24-hour period of load/wind

203

Characterizing Air Toxics Exposure and Risk and Evaluating EPA Modeling  

NLE Websites -- All DOE Office Websites (Extended Search)

Characterizing Air Toxics Exposure and Risk and Evaluating EPA Modeling Characterizing Air Toxics Exposure and Risk and Evaluating EPA Modeling Tools for Policy Making Speaker(s): Jennifer Logue Date: October 27, 2009 - 12:00pm Location: 90-3122 The Environmental Protection Agency (EPA) defines air toxics as pollutants that are known or suspected to cause serious health effects. Title III of the 1990 Clean Air Act established 189 chemicals as air toxics or hazardous air pollutants. Large uncertainties still exist regarding exposure, risks, and sources and there has been a heavy reliance on inventories and modeling to determine sources and risks. In January 2002, Carnegie Mellon University in collaboration with the Allegheny County Health Department (ACHD) embarked on a project to investigate air toxics in Allegheny County. This

204

Accelerated Molecular Dynamics Methods  

NLE Websites -- All DOE Office Websites (Extended Search)

Dynamics Methods Dynamics Methods for Infrequent Events Arthur F. Voter Theoretical Division Los Alamos National Laboratory Los Alamos, New Mexico U.S. Department of Energy Theory Focus Session on Hydrogen Storage Materials Crystal City, VA May 18, 2006 Los Alamos Acknowledgments Blas P. Uberuaga (LANL, MST-8) Francesco Montalenti (U. Milano-Bicocca) Graeme Henkelman (U. Texas at Austin) Timothy C. Germann (LANL, X-7) James A. Sprague (NRL) Mads Sorensen (Novo Nordisk A/S, Copenhagen) Sriram Swaminarayan (LANL, MST-8) Steve Stuart (Clemson) David Sholl (Carnegie Mellon) John Hamilton (Sandia) Wolfgang Windl (Ohio State) Roger Smith (U. Loughborough) Robin Grimes (Imperial College) Kurt Sickafus (LANL, MST-8) Jacques Amar (U. Toledo) DOE Office of Basic Energy Sciences Motorola Intel Los Alamos Outline

205

DOE-FE: 20th Year of University Coal Research Grants  

NLE Websites -- All DOE Office Websites (Extended Search)

May 5, 1999 May 5, 1999 DOE Funds 20th Year of University Coal Grants Students, Teachers Team to Explore Greenhouse Gas Reduction, Coal Science and Technologies for Pollution Free Power Plant The U.S. Department of Energy announced today that 17 university-proposed projects will share in $2.8 million in federal coal research funds - marking the 20th year of a program that combines science education for students with research that can reveal cleaner and more effective ways to use the nation's plentiful coal reserves. The winning colleges and universities include: Arizona State University Brigham Young University Brown University Carnegie Mellon University Clarkson University Colorado School of Mines Georgia Institute of Technology Kansas State University Ohio University

206

Mechanism-Based Testing Methodology for Improving the Oxidation, Hot Corrosion and Impact Resistance of High-Temperature Coatings for Advanced Gas Turbines  

NLE Websites -- All DOE Office Websites (Extended Search)

Pittsburgh Pittsburgh University of Pittsburgh PIs: F. S. Pettit, G. H. Meier Subcontractor: J. L. Beuth SCIES Project 02- 01- SR101 DOE COOPERATIVE AGREEMENT DE-FC26-02NT41431 Tom J. George, Program Manager, DOE/NETL Richard Wenglarz, Manager of Research, SCIES Project Awarded (05/01/02, 36 Month Duration + 6 mo No-Cost Extension) $ 458,420 Total Contract Value ($ 412,695 DOE) Mechanism-Based Testing Methodology For Improving the Oxidation, Hot Corrosion and Impact Resistance of High- Temperature Coatings for Advanced Gas Turbines University of Pittsburgh - Carnegie Mellon University University of Pittsburgh University of Pittsburgh In the next generation gas turbine, resistance to thermal cycling damage may be as important as resistance to long isothermal exposures. Moreover, metallic coatings and Thermal Barrier

207

NETL: Features - June 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

12 12 NETL-RUA: Celebrating 2011 The Alliance partners are NETL, Carnegie Mellon University, Penn State, the University of Pittsburgh, Virginia Tech, West Virginia University, and URS Corporation. Looking back at fiscal year 2011, the NETL-Regional University Alliance (NETL-RUA) has much to celebrate. From research successes to new educational opportunities, from growing our research portfolio to bringing technologies to market, NETL-RUA is reaping the benefits of daily collaborations undertaken by our scientists and engineers, faculty and students. Just ask NETL-RUA Manager Juli Klara. "The achievements we are realizing simply wouldn't be possible without the cooperation, expertise, and passion of NETL's onsite research staff and our university, national laboratory, and industry partners.

208

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV

209

Proj213  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 Environmental and Water Resources PRIMARY PROJECT PARTNERS Carnegie Mellon University Pittsburgh, PA U. S. EPA Research Triangle Park, NC (co-funding) PROJECT LOCATION Pittsburgh, PA CUSTOMER SERVICE 800-553-7681 WEBSITE www.netl.doe.gov homer.cheme.cmu.edu ATMOSPHERIC AEROSOL SOURCE-RECEPTOR RELATIONSHIPS: THE ROLE OF COAL-FIRED POWER PLANTS Background Epidemiological research over the past 10 years has revealed a consistent statisti- cal correlation between levels of airborne fine particulate matter (PM 2.5 ) and adverse human health effects. This has resulted in U.S. EPA's promulgation of National Am- bient Air Quality Standards (NAAQS) that limit the allowable mass concentrations of PM 2.5 . Data gathered since 1997 suggests that the region surrounding Pittsburgh, PA

210

2007 Long Range Plan Working Group Members | U.S. DOE Office of Science  

NLE Websites -- All DOE Office Websites (Extended Search)

2007 Long Range Plan Working Group Members 2007 Long Range Plan Working Group Members Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Members 2007 Long Range Plan Working Group Members Print Text Size: A A A RSS Feeds FeedbackShare Page Beise, Elizabeth University of Maryland Merninga, Lia TJNAF Bryman, Douglas TRIUMF Meyer, Curtis Carnegie Mellon University Burrows, Adam University of Arizona Meziani, Zein-Eddine Temple University Cardman, Larry TJNAF Milner, Richard MIT Casten, Richard Yale University Mueller, Berndt Duke University Cates, Gordon University of Virginia Nazarewicz, Witold University of Tennessee Cizewski, Jolie Rutgers University Nitsche, Heino University of California Dean, David ORNL Norris, Margaret LBNL Deshpande, Abhay

211

UNITED STATES ATOMIC ENERGY COMMISSION CHICAGO OPERATIONS OFFICE  

Office of Legacy Management (LM)

$$ ,_, . $$ ,_, . UNITED STATES ATOMIC ENERGY COMMISSION CHICAGO OPERATIONS OFFICE TELEPHONE 9600 SOUTH CASS AVENUE (312) 739-7711 ARCONNE. ILLINOIS 60439 ^,/" _. i ' > ;.:a c. JAN 17 1975 Martin B. Biles, Director Division of Operational Safety, HQ _ DISPOSAL OF SCRAP COPPER, CYCLOTRON DISMANTLING PROJECT, NUCLEAR RESEARCH CENTER, CARNEGIE-MELLON UNIVERSITY (CMU) Enclosed for your information is a copy of the October 28, 1974, letter from T. Morris (CMD) to J. Krupa (CH) with pages 1-4 and 8-16 of its attachment (the October 23, 1974, F. Bomba to T. Morris, memo- randum; pages 5-7 are economically omitted as they were not relevant to the subject of this letter) regarding disposal of 4 to 6 tons of copper. The enclosure contains a summary of data obtained from

212

ENERGY RESEARCH AND DEVELOPMENT ADMINISTRATION  

Office of Legacy Management (LM)

.' :h I : .' :h I : ' ENERGY RESEARCH AND DEVELOPMENT ADMINISTRATION WASHINGTON, D.C. 20545 October 24, 1975 :~.. ,. Memo to Piles' CARNEGIE-MELLON S~C&RCCYCLOTRON On October 23, 1975, W. J. McCool (HQOS), E. K. Loop (HQ-OS), R. E. Allen (HQ-OS), J. Pingel (CH), B. 3. Davis (CH), R. Drucker (CR-BAO) and I met at Germantown to discuss the clean-up of radio- activity at the Saxonburg accelerator site. After discussion, we concluded acceptable criteria would include removal of all material necessary to reduce the residual surface activity to a maximum ofO.04 mR/hr above ambient background. Since ambient backgrounds is 0.03 to 0.05 &/hr, the above 0.04 mR/hr criterion will essentially be the 0.08 mR/hr (induced +background) case discussed previously.

213

Sila Kiliccote  

NLE Websites -- All DOE Office Websites (Extended Search)

Sila Kiliccote Sila Kiliccote Sila Kiliccote Grid Integration Group Demand Response Research Center (DRRC) Lawrence Berkeley National Laboratory 1 Cyclotron Road MS 90R1121 Berkeley CA 94720 Office Location: 90-1127 (510) 495-2615 SKiliccote@lbl.gov Sila Kiliccote is Acting Leader of the Grid Integration Group. She has been a part of the automated demand response team developing an automated communication infrastructure, integrating it with building control systems and working with stakeholders to standardize the information model. Her areas of interest include characterization of buildings and demand reduction, demand responsive lighting systems, building systems integration and feedback for demand-side management. She has a MS in Building Science from Carnegie Mellon University and a BS in Electrical Engineering from

214

Microsoft Word - CCSI Clearwater 2013 V5.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

38th International Technical Conference on 38th International Technical Conference on Clean Coal & Fuel Systems June 2 to 6, 2013 Clearwater, Florida, USA Computational Tools for Accelerating Carbon Capture Process Development D.C. Miller 1,* , N.V. Sahinidis 2 , A. Cozad 2 , A. Lee 3 , H. Kim 3 , J. Morinelly 1 , J. Eslick 2 , Z. Yuan 2 1 National Energy Technology Laboratory, Pittsburgh, PA; 2 Carnegie Mellon University, Pittsburgh, PA; 3 National Energy Technology Laboratory, Morgantown, WV INTRODUCTION The U.S. Department of Energy's Carbon Capture Simulation Initiative (CCSI) was initiated in 2010 to develop and deploy state-of-the-art computational modeling and simulation tools to accelerate the development of carbon capture technology. Recently, the first components of the CCSI Toolset have been deployed and demonstrated for the design and optimization of post-

215

DOE Solar Decathlon: 2005 Photo Gallery of Homes  

NLE Websites -- All DOE Office Websites (Extended Search)

Photo Gallery of Homes Photo Gallery of Homes Here, you can see photos of the completed houses for Solar Decathlon 2005 on the National Mall. You can also read a Daily Journal and view Photos of the Day to see the students in action who built these beautiful houses and to learn more about solar energy, energy efficiency, and other renewable energy technologies. High-resolution photos can be download from the Photo Library. California Polytechnic State University Canadian Solar Decathlon (Concordia University and Université de Montréal) University of Colorado, Denver and Boulder Cornell University Crowder College Florida International University New York Institute of Technology Pittsburgh Synergy (Carnegie Mellon, University of Pittsburgh, and The Art Institute of Pittsburgh) Rhode Island School of Design

216

NETL: LabNotes - August 2007  

NLE Websites -- All DOE Office Websites (Extended Search)

August 2007 August 2007 New Technique Developed to Assess Catalyst Activity with Fuel Gases Thomas Simonyi, left, and Stephen Beer of use a thermogravimetric analyzer to analyze heavy metals to determine their suitability for making thin-film sensors for natural gas. Thomas Simonyi, left, and Stephen Beer use a thermogravimetric analyzer to analyze heavy metals to determine their suitability for making thin-film sensors for natural gas. Researchers in the Energy System Dynamics Division of NETL's Office of Research and Development are teaming with Carnegie Mellon University and West Virginia University to develop sensor arrays that can respond to rapid changes in fuel gas composition. The ability to detect and respond to changes is increasingly important because of the anticipated increased usage of liquefied natural gas in the

217

Two Line Subject Title One Line Title  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Title IX, Subtitle J (EPAct Title IX, Subtitle J (EPAct 2005) Complementary Program - Office of Research and Development September 2008 2 3 Complementary Program NETL - ORD * Areas of research - Drilling Under Extreme Conditions - Environmental Impacts of Oil and Gas - Enhanced and Unconventional Oil Recovery - Resource Assessment * Institute for Advanced Energy Solutions - West Virginia University, Carnegie-Mellon University, and University of Pittsburgh * Penn State University and Oregon State University 4 Drilling Under Extreme Conditions * Ultra-deep single cutter drilling simulator - Recreates bottom-hole drilling environment of ultra-deep wells (30,000 psi and 481 o F) - Delivered to NETL later this year - Operates with real drilling fluids - X-ray video system images cuttings - Verify the results of the full bit

218

Event Speakers List  

NLE Websites -- All DOE Office Websites (Extended Search)

John "Skip" Laitner Senior Fellow and former Director of Economic and Social AnalysisAmerican Council for an Energy-Efficient Economy (ACEEE) John "Skip" Laitner Senior Fellow and former Director of Economic and Social AnalysisAmerican Council for an Energy-Efficient Economy (ACEEE) Boris Lamontagne Researcher National Research Council (NRC), Canada Ole Langniss MS Economical Engineering Institute for Technical Thermodynamics, Stuttgart, Germany Steven Lanzisera Lawrence Berkeley National Laboratory Kent Larson Director, Smart Cities/Changing Places Group at MIT MediaLab Massachusetts Institute of Technology Bérangère Lartigue Carnegie MellonPaul Sabatier University, Toulouse, France Isabelle Lavedrine Fluid Dynamic Specialist Arup Research and Development Conor Laver Vice President EnergyScore Cards (and Bright Power) Saniya LeBlanc Ph.D. Graduate Stanford University

219

R  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACTS CONTACTS Madhava Syamlal Focus Area Lead National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880, Morgantown, WV 26507-0880 304-285-4685 madhava.syamlal@netl.doe.gov Chris Guenther National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880, Morgantown, WV 26507-0880 304-285-4483 chris.guenther@netl.doe.gov NETL-RUA PARTNERS Carnegie Mellon University Penn State University University of Pittsburgh Virginia Tech West Virginia University URS Corporation PARTNERS SGI NETL's Simulation-Based Engineering User Center Introduction The National Energy Technology Laboratory (NETL) is home to the Simulation- Based Engineering User Center (SBEUC), which hosts one of the world's largest high-performance computers along with advanced visualization centers serving the

220

Shale Energy Resources Alliance (SERA)  

NLE Websites -- All DOE Office Websites (Extended Search)

contActS contActS George Darakos Business Manager 412-386-7390 george.darakos@netl.doe.gov Barbara Kutchko, PhD Shallow Stray Gas, Research Team Leader 412-386-5149 barbara.kutchko@netl.doe.gov Natalie Pekney, PhD Air Emissions, Research Team Leader 412-386-5953 natalie.pekney@netl.doe.gov Paul Ziemkiewicz, PhD Water, Research Team Leader 304-293-6958 pziemkie@wvu.edu nEtL-RUA PARtnERS Carnegie Mellon University Penn State University of Pittsburgh URS Corporation Virginia Tech West Virginia University Shale Energy Resources Alliance (SERA) Mission To support the environmentally and socially sustainable development of shale resources through collaborative research and development among industry, university, and government partners on: resource characterization; drilling and

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Charudatta Phatak - Argonne National Laboratories, Materials Sicence  

NLE Websites -- All DOE Office Websites (Extended Search)

IM > Charudatta Phatak IM > Charudatta Phatak Charudatta Phatak Assistant Materials Scientist Bldg. 212, C-216 Phone: 630-252-5379 This e-mail address is being protected from spambots. You need JavaScript enabled to view it. Research Interests Understanding domain behavior and interactions in multiferroic heterostructures Phase reconstruction techniques and Lorentz TEM, In-situ TEM TEM Image simulations Education Ph.D - 2009, Materials Science Engineering, Carnegie Mellon University, Pittsburgh, PA, USA M. Tech - 2005 (Ceramics and Composites), Metallurgical and Materials Science Engineering, Indian Institute of Technology, Bombay, India B. Tech - 2004, Metallurgical and Materials Science Engineering, Indian Institute of Technology, Bombay, India Awards 2008 Presidential Student award for outstanding research work by the Microscopy Society of America

222

John Sheldon 2012 poster  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

proposal is supported by the Geothermal Technologies Program of the DOE/Energy proposal is supported by the Geothermal Technologies Program of the DOE/Energy Efficiency & Renewable Energy Office, DOE/National Energy Technology Laboratory - Pittsburgh, Department of Mechanical Engineering at Carnegie Mellon University. An experimentally-validated computational framework to enable nanofluid drilling technology Background and Introduction * Compared to the fixed costs of oil and gas drilling ($15.61/MWh), the exploration and drilling for geothermal resources is a cost-prohibitive process that accounts for a up to 50% ($35.04/MWh) of the capital costs for the project (See Figure 1). * High capital costs of exploration and drilling into geothermal rock formations can be attributed to the low rates of penetration and short drill bit lifetimes.

223

U  

NLE Websites -- All DOE Office Websites (Extended Search)

20, 2009 20, 2009 The National Energy Technology Laboratory (NETL) has selected Dr. Stephen Kuznetsov to join the newly formed Integrated Electric Power Systems Division at the Pittsburgh site. In his previous position he was president and chief engineer of Power Superconductor Applications Corp. and worked primarily on pulsed power and propulsion projects for the U.S. Navy and NASA. In his new role at NETL, he will be responsible for analysis of new technologies for the Smart Grid and advanced transmission and distribution technologies. Kuznetsov is a graduate of Imperial College of Science & Technology (London) and Carnegie Mellon University (Pittsburgh) in electric power engineering. He is a native of Pittsburgh and has interests in hydro-electric power generation and superconductivity.

224

NETL: NEPA Categorical Exclusions - April 2010 to June 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

April 2010 to June 2010 April 2010 to June 2010 Archive (November 2009 - December 2010) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 6/30/2010 Deployment of Flex CHP System (Princeton Junction) Gas Technologies Institute Princeton Junction, NJ EE/PVT N 6/30/2010 Deployment of Flex CHP System (New Kensington) Gas Technologies Institute New Kensington, PA EE/PVT N 6/29/2010 High Resolution Modeling of Materials for High Temperature Service Carnegie Mellon University Pittsburgh, PA FE/Advanced Research/GD Y 6/29/2010 Energy Efficient Retrofits of Schools - Six Schools in Alabama State of Alabama Multiple sites, AL EE/PMC/IPOD N 6/28/2010 Consortium for Petroleum and Natural Gas Stripper Wells The Pennsylvania State University University Park, PA FE/SCNGO

225

sage_cover  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy System Selection and Operation Chris Marnay 1 , Michael Stadler 1 , Afzal Siddiqui 2 , Nicholas DeForest 1 , Jon Donadee 3 , Prajesh Bhattacharya 1 , and Judy Lai 1 1 Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS90R1121, Berkeley CA 94720, U.S.A. 2 University College London, Gower Street London WC1E 6BT, U.K. 3 Carnegie Mellon University, 5000 Forbes Ave, Pittsburgh PA 15213, U.S.A. Environmental Energy Technologies Division Published in the February 2013 special issue of the Institution of Mechanical Engineers Journal of Power and Energy http://microgrid.lbl.gov This work was supported by the Office of Electricity Delivery and Energy Reliability's, Smart Grids Program, and also by the Energy Efficiency and Renewable Energy's Technology Commercialization Fund, both of the

226

U  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL Researchers Earn Prestigious Ceramic Industry Award for Published Work NETL Researchers Earn Prestigious Ceramic Industry Award for Published Work Albany, Ore.--Recognized for the valuable contribution of their published work to the ceramic industry, three National Energy Technology Laboratory (NETL) researchers, as part of a team that includes the URS Corporation and Carnegie Mellon University, earned the American Ceramic Society's prestigious 2012 "Richard and Patricia Spriggs Phase Equilibria Award." The American Ceramic Society annually presents the award to the author or authors of a published work that makes a valuable contribution to the field of phase-stability relationships in ceramic-based systems. To select the awardee, the American Ceramic Society reviews published material from papers, articles,

227

Microsoft Word - Poster Abstract_2010_CMU_Crystallographic.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

Thin Films Thin Films Department of Materials Science and Engineering, Carnegie Mellon University Lu Yan, K.R. Balasubramaniam, Shanling Wang, Hui Du, and Paul Salvador luyan@cmu.edu 412-999-4627 The oxygen reduction reaction (ORR) takes place in the solid oxide fuel cell (SOFC) cathode and the overall reaction is rather complex; it involves a variety of sub-reactions, such as surface adsorption, dissociation, election transfer, incorporation, and bulk diffusion. Although a considerable amount of effort has been expended in correlating processing / microstructural features to cathode performance, there is unfortunately relatively little known about the fundamental surface properties of oxide surfaces and their relation to cathode activity. In this study, to avoid the complex structural perturbation on the oxygen uptake

228

Microsoft Word - Poster Abstract_2010_UNLV.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

investigation of the impact of film thickness and post-growth investigation of the impact of film thickness and post-growth treatment on the electronic structure of La x Sr 1-x MnO 3 films S. Krause, T. Hofmann, C. Heske Department of Chemistry, University of Nevada, Las Vegas, NV L. Yan, H. Du, B. Kavaipatti, P. Salvador Carnegie Mellon University, Pittsburgh, PA H. Jalili, K. Katsiev, B. Yildiz Massachusetts Institute of Technology, Cambridge, MA La x Sr 1-x MnO 3 (LSM) is currently the material of choice for commercial use as solid oxide fuel cell (SOFC) cathodes. This is due, among other reasons, to its low chemical reactivity and a thermal expansion coefficient similar to the solid yttria-stabilized zirconia (YSZ) electrolyte. To optimize the oxygen reduction reaction (ORR) activity, the surface electronic structure and chemical

229

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Confidential Information of Aquion Energy Inc Confidential Information of Aquion Energy Inc Low Cost Energy Storage Funded in part by the Energy Storage Systems Program of the U.S. Department Of Energy through National Energy Technology Laboratory Confidential Information of Aquion Energy Inc Opportunity Co-located with Generation Assets At the neighborhood level in support of distributed generation At the substation performing grid services Confidential Information of Aquion Energy Inc Aquion Origins * Founded at Carnegie Mellon University * All materials rigorously screened for economic viability at massive scale Basic Thesis: For grid scale energy storage to be viable, it must be low cost, long lasting and highly efficient and environmentally benign Confidential Information of Aquion Energy Inc Technology

230

NETL: News Release - Robot Successfully Inspects Live Natural Gas Pipeline  

NLE Websites -- All DOE Office Websites (Extended Search)

22, 2004 22, 2004 Robot Successfully Inspects Live Natural Gas Pipeline in New York Field Test is a First for Natural Gas Industry BROCKPORT, NY - In a recent field demonstration filled with "firsts," a self-powered robot developed by the Northeast Gas Association, Carnegie Mellon University, and the Department of Energy's National Energy Technology Laboratory successfully inspected a mile of a live natural gas distribution main in Brockport, New York. Known as EXPLORER, the remote-controlled robot was launched and retrieved four times on October 8 with no interruption in customer service. The system successfully made its way through an 8-inch diameter pipeline owned and operated by Rochester Electric & Gas, and maneuvered several 70- to 90-degree bends.

231

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

4, 2011 4, 2011 spacer Subscribe | Contact Us | Archive | Classifieds | Guidelines | Help Search GO spacer Calendar Have a safe day! Friday, Oct. 14 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4 p.m. Joint Experimental-Theoretical Physics Seminar Speaker: Anyes Taffard, University of California, Irvine Title: New Results from ATLAS 8 p.m. Fermilab Lecture Series - Auditorium Tickets: $7 Speaker: Dr. Tony Wasserman, Carnegie Mellon University Title: The Rise of Free and Open Source Software Monday, Oct. 17 2:30 p.m. Particle Astrophysics Seminar - One West Speaker: Oscar Agertz, University of Chicago Title: Recent Advances in Computational Galaxy Formation 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4 p.m. All Experimenters' Meeting - Curia II Special Topics: Tevatron Decommissioning Plan; Centrifugal Barrel Polishing for SRF Cavity Processing

232

The NETL-RUA Grid Technologies Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

FEBRUARY 2013 FEBRUARY 2013 1 University partners in the NETL-RUA are: the University of Pittsburgh (Pitt), Carnegie Mellon University (CMU), West Virginia University (WVU), Pennsylvania State University (PSU), and Virginia Polytechnic Institute (VT). The URS Corporation is also an NETL-RUA partner institution. 2 The University Energy Partnership (UEP) serves as a non-profit support organization and constituency liaison for the development of key NETL-RUA initiatives. The NETL-RUA Grid Technologies Collaborative About the Grid Technologies Collaborative The Grid Technologies Collaborative (GTC) is an industry-university-government integrated research and development group that advances the state-of-the-art in transmission and distribution system level power electronics technologies. Participants

233

ATMOSPHERIC AEROSOL SOURCE-RECEPTOR RELATIONSHIPS: THE ROLE OF COAL-FIRED POWER PLANTS  

Science Conference Proceedings (OSTI)

This report describes the technical progress made on the Pittsburgh Air Quality Study (PAQS) during the period of August 2001 through January of 2002. The major activity during this project period was the continuation of the ambient monitoring effort. Work also progressed on organizing the upcoming source characterization effort, and there was continued development of several three-dimensional air quality models. The first PAQS data analysis workshop for the project was held at Carnegie Mellon in December 2001. Two new instruments were added to site during this project period: a single particle mass spectrometer and an in situ VOC instrument. The single particle mass spectrometer has been deployed since the middle of September and has collected more than 150 days of data. The VOC instrument was only deployed during the intensive sampling period. Several instruments experienced operational issues during this project period. The overall data recovery rate for the project has been high.

Allen L. Robinson; Spyros N. Pandis; Cliff I. Davidson

2002-03-01T23:59:59.000Z

234

Atmospheric Aerosol Source-Receptor Relationships: The Role of Coal-Fired Power Plants  

SciTech Connect

This document serves as the final report for the project Atmospheric Aerosol Source-Receptor Relationships: The Role of Coal-Fired Power Plants supported by the US Department of Energy. The project involved measurement of the ambient fine particle concentrations in the Pittsburgh metropolitan area, development of source profiles for important source classes in the Pittsburgh region, source apportionment using statistical and deterministic air quality models, and investigation of the response in ambient fine particle concentrations to changes in emissions. The project was led by Carnegie Mellon University in collaboration with universities, companies, national laboratories, and regional, state and local air quality agencies. This report describes the overall approach of the project and its major findings.

Robinson, Allen; Pandis, Spyros; Davidson, Cliff

2005-12-31T23:59:59.000Z

235

A Linear Parabolic Trough Solar Collector Performance Model  

E-Print Network (OSTI)

A performance model has been programmed for solar thermal collector based on a linear, tracking parabolic trough reflector focused on a surface-treated metallic pipe receiver enclosed in an evacuated transparent tube: a Parabolic Trough Solar Collector (PTSC). This steady state, single dimensional model comprises the fundamental radiative and convective heat transfer and mass and energy balance relations programmed in the Engineering Equation Solver, EES. It considers the effects of solar intensity and incident angle, collector dimensions, material properties, fluid properties, ambient conditions, and operating conditions on the performance of the collector: the PTSC. Typical performance calculations show that when hot-water at 165C flows through a 6m by 2.3m PTSC with 900 w/m^2 solar insulation and 0 incident angle, the estimated collector efficiency is about 55% The model predictions will be confirmed by the operation of PTSCs now being installed at Carnegie Mellon.

Qu, M.; Archer, D.; Masson, S.

2006-01-01T23:59:59.000Z

236

Diesel Aerosol Sampling in the Atmosphere  

DOE Green Energy (OSTI)

The University of Minnesota Center for Diesel Research along with a research team including Caterpillar, Cummins, Carnegie Mellon University, West Virginia University (WVU), Paul Scherrer Institute in Switzerland, and Tampere University in Finland have performed measurements of Diesel exhaust particle size distributions under real-world dilution conditions. A mobile aerosol emission laboratory (MEL) equipped to measure particle size distributions, number concentrations, surface area concentrations, particle bound PAHs, as well as CO 2 and NO x concentrations in real time was built and will be described. The MEL was used to follow two different Cummins powered tractors, one with an older engine (L10) and one with a state-of-the-art engine (ISM), on rural highways and measure particles in their exhaust plumes. This paper will describe the goals and objectives of the study and will describe representative particle size distributions observed in roadway experiments with the truck powered by the ISM engine.

David Kittelson; Jason Johnson; Winthrop Watts; Qiang Wei; Marcus Drayton; Dwane Paulsen; Nicolas Bukowiecki

2000-06-19T23:59:59.000Z

237

Reduction of Annealing Times for Energy Conservation in Aluminum  

SciTech Connect

Carnegie Mellon University was teamed with the Alcoa Technical Center with support from the US Dept. of Energy (Office of Industrial Technology) and the Pennsylvania Technology Investment Authority (PTIA) to make processing of aluminum less costly and more energy efficient. Researchers in the Department of Materials Science and Engineering have investigated how annealing processes in the early stages of aluminum processing affect the structure and properties of the material. Annealing at high temperatures consumes significant amounts of time and energy. By making detailed measurements of the crystallography and morphology of internal structural changes they have generated new information that will provide a scientific basis for shortening processing times and consuming less energy during annealing.

Anthony D. Rollett; Hasso Weiland; Mohammed Alvi; Abhijit Brahme

2005-08-31T23:59:59.000Z

238

Dear 30% of Gamers: Here's an Easy Way to Save Some Money | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Dear 30% of Gamers: Here's an Easy Way to Save Some Money Dear 30% of Gamers: Here's an Easy Way to Save Some Money Dear 30% of Gamers: Here's an Easy Way to Save Some Money May 14, 2012 - 5:21pm Addthis Elizabeth Spencer Communicator, National Renewable Energy Laboratory A couple of years ago, I wrote an incredibly nerdy post about videogame consoles and energy. (I'm still stupidly proud of that lame Castlevania reference in the first line. Seriously.) Why, you might ask, am I bringing up my nerdiness again? Well, it's because I ran into this article on Ars Technica on energy and videogame consoles that cites a Carnegie Mellon study with surprising results: America used nearly 16 terawatt-hours of energy on videogames in 2010, and a good chunk of it was wasted. In fact, the study assumed that 30% of all gamers left their consoles on

239

Paul Mathew  

NLE Websites -- All DOE Office Websites (Extended Search)

Paul Mathew Paul Mathew Commercial Building Systems Group Lawrence Berkeley National Laboratory 1 Cyclotron Road MS 90R2000 Berkeley CA 94720 Office Location: 90-2024R (510) 486-5116 PAMathew@lbl.gov Paul Mathew is a Staff Scientist in the Commercial Building Systems group at Lawrence Berkeley National Laboratory (LBNL), where he conducts applied research and market transformation activities on energy use in buildings. His current work is focused on energy benchmarking tools and techniques for commercial buildings, energy-related risk analysis, as well as energy efficiency for laboratories and data centers. Prior to joining LBNL, he worked at Enron Energy Services and the Center for Building Performance at Carnegie Mellon University. He has a Bachelor's degree in Architecture, and

240

McHenry-121913 - Argonne National Laboratories, Materials Sicence Division  

NLE Websites -- All DOE Office Websites (Extended Search)

McHenry-121913 McHenry-121913 MATERIALS SCIENCE COLLOQUIUM SPEAKER: Michael McHenry IEEE Distinguished Lecturer, Carnegie Mellon University TITLE: Nanocomposite Magnets for Power Electronic Applications DATE: Thursday, Dec. 19, 2013 TIME: 11:00 am PLACE: ESB 241, Conference Room D172 HOST: Olle Heinonen ABSTRACT: Recent USDOE workshops highlight the need for advanced soft magnetic materials leveraged in novel designs of power electronic components and systems for power conditioning and grid integration. Similarly soft magnetic materials figure prominently in applications in electric vehicles and high torque motors. Dramatic weight and size reductions are possible in such applications. Nanocomposites also hold potential for applications in active magneocaloric cooling of such devices.

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

5, 2004 5, 2004 Calendar Thursday, March 25 2:30 p.m. Theoretical Physics Seminar - Curia II Speaker: H. Collins, Carnegie Mellon University Title: The Fate of the Alpha-Vacuum 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over THERE WILL BE NO ACCELERATOR PHYSICS AND TECHNOLOGY SEMINAR TODAY Friday, March 26 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4:00 p.m. Joint Experimental Theoretical Physics Seminar - 1 West Speaker: A. Nomerotski, Fermilab Title: Recent Dzero Results on B, QCD, and New Phenomena Cafeteria Thursday, March 25 Wild Mushroom soup Baked ziti w/meatballs and garlic bread $3.50 Sesame chicken over steamed jasmine rice $3.50 Buffalo chicken w/blue cheese wrap $4.75 Grilled brat w/peppers and onions $4.75 Hand rolled Hanabi sushi $4.75 Eurest Dining Center Weekly Menu

242

Long Range Plan Working Group Members | U.S. DOE Office of Science (SC)  

NLE Websites -- All DOE Office Websites (Extended Search)

Long Range Plan Working Group Members Long Range Plan Working Group Members Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Members Long Range Plan Working Group Members Print Text Size: A A A RSS Feeds FeedbackShare Page Baker, Keith Hampton University Lung, Allison JLAB Beene, Jim ORNL Marx, Jay LBNL Beise, Betsy University of Maryland McLerran, Larry BNL Bland, Les Indiana University Meyer, Curtis Carnegie-Mellon Bond, Peter BNL Milner, Richard MIT Bowles, Tom LANL Moss, Joel LANL Brenner, Daeg Clark University Mueller, Al Columbia Busza, Wit MIT Mueller, Berndt Duke University Cardman, Larry JLAB Natowitz, Joe Texas A&M Casten, Rick Yale University Nazarewicz, Witek Tennessee/ORNL Cates, Gordon University of Virginia Olinto, Angela

243

X_II_DesignPhase_Topical_Report_Dec05.book  

NLE Websites -- All DOE Office Websites (Extended Search)

Topical Report Topical Report submitted to The Department of Energy (DoE) National Energy Technology Laboratory (NETL) under Contract # DE-FC26-04NT42264 for PHASE I TOPICAL REPORT Reporting Period: 10-01-2004 to 12-31-2005 compiled as part of the project titled Explorer-II: Wireless Self-powered Visual and NDE Robotic Inspection System for Live Gas Distribution Mains Document Number: REP-GOV-DOE-051231 Date of Submission: January 31 st , 2006 submitted by Carnegie Mellon University The Robotics Institute - REC #10 on 40th Street Pittsburgh, PA 15201 (412) 268-2000 Administrative Contact: Susan Burkett Technical Contact: Hagen Schempf, Ph.D. Explorer-II:Wireless Self-powered Visual and NDE Robotic Inspection System for Live Gas Distribution Mains Topical Report - Design Phase i DISCLAIMER

244

Browse by Discipline -- E-print Network Subject Pathways: Fossil Fuels --  

Office of Scientific and Technical Information (OSTI)

M N O P Q R S M N O P Q R S T U V W X Y Z Lan, Ruiting (Ruiting Lan) - School of Biotechnology and Biomolecular Sciences, University of New South Wales Lang, Matthew (Matthew Lang) - Department of Chemical and Biomolecular Engineering, Vanderbilt University Langmead, Christopher James (Christopher James Langmead) - Ray and Stephanie Lane Center for Computational Biology & School of Computer Science, Carnegie Mellon University Laurenzi, Ian J. (Ian J. Laurenzi) - Department of Chemical Engineering, Lehigh University Laux, Thomas (Thomas Laux) - Institut für Biologie III, Albert-Ludwigs-Universität Freiburg Lebendiker, Mario (Mario Lebendiker) - Wolfson Centre for Applied Structural Biology, Hebrew University of Jerusalem Lee, Doheon (Doheon Lee) - Department of Bio and Brain Engineering,

245

Browse by Discipline -- E-print Network Subject Pathways: Materials Science  

Office of Scientific and Technical Information (OSTI)

X Y Z X Y Z Wachsmut, Ipke (Ipke Wachsmut) - Technischen Fakultät, Universität Bielefeld Wactlar, Howard D. (Howard D. Wactlar) - School of Computer Science, Carnegie Mellon University Wadler, Philip (Philip Wadler) - School of Informatics, University of Edinburgh Waern, Annika (Annika Waern) - Human-Computer Interaction and Language Engineering Laboratory, Swedish Institute of Computer Science Wagner, Alan (Alan Wagner) - Department of Computer Science, University of British Columbia Wagner, David (David Wagner) - Department of Electrical Engineering and Computer Sciences, University of California at Berkeley Wagner, Flávio Rech (Flávio Rech Wagner) - Instituto de Informática, Universidade Federal do Rio Grande do Sul Wagner, Paul J. (Paul J. Wagner) - Department of Computer Science,

246

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

51 - 17560 of 26,764 results. 51 - 17560 of 26,764 results. Article Caithness Shephards Flat: The Largest Wind Farm Project in the World Oregon-based project will set the bar high for future wind energy projects. http://energy.gov/articles/caithness-shephards-flat-largest-wind-farm-project-world Article Department of Energy and FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois http://energy.gov/articles/department-energy-and-futuregen-alliance-discuss-next-steps-futuregen-20-illinois Download OCIO NEWSLETTER ARTICLE http://energy.gov/cio/downloads/ocio-newsletter-article Video It Starts with Science... Secretary Chu sits down with a journalism student at Carnegie Mellon's Education City campus in Qatar to discuss the value of science in education and what attracted him to the study of Physics.

247

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Krause, T. Hofmann, and C. Heske, Department of Chemistry, University of Nevada, Las Vegas, NV Krause, T. Hofmann, and C. Heske, Department of Chemistry, University of Nevada, Las Vegas, NV L. Yan, H. Du, B. Kavaipatti, and P. Salvador, Carnegie Mellon University, Pittsburgh, PA H. Jalili, K. Katsiev, and B. Yildiz, Massachusetts Institute of Technology, Cambridge, MA University of Nevada, Las Vegas Department of Chemistry U V NL Spectroscopic investigation of the impact of film thickness and post- growth treatment on the electronic structure of La x Sr 1-x MnO- 3 films Objectives MIT UNLV (local surface structure) (sample growth) (electronic structure, surface chemical composition) *samples *information about growth conditions *feedback on sample quality *identification of contamination sources *information on surface structure *effect of heat and sputter

248

ARM - Publications: Science Team Meeting Documents  

NLE Websites -- All DOE Office Websites (Extended Search)

The ARM Blue/Green Period: 3-Channel Color Composites of GOES-8 Data The ARM Blue/Green Period: 3-Channel Color Composites of GOES-8 Data Wagener, R., and Gregory, L., Brookhaven National Laboratory, ARM External Data Center Konidaris, N., Carnegie Mellon University; Minnett, P.J., University of Miami, Rosenstiel School of Marine and Atmospheric Sciences Ninth Atmospheric Radiation Measurement (ARM) Science Team Meeting Despite the title and the general appearance of the resulting images, this is not an attempt to emulate art nor an expression of anybody's mood. It is simply an attempt to condense as much information as possible about a day's worth of Geostationary Operational Environmental Satellite (GOES) data onto a single web page. A 24-bit red, green, blue (RGB) color composite is derived by assigning the reflectivity in the GOES-8 visible channel to red,

249

: www.ti.uni-bielefeld.de Bachelorarbeit oder Masterprojekt  

E-Print Network (OSTI)

eigenen Implementierung in ein bestehendes Client-Server-Framework und · eine Demo-Applikation in Tcl/Tk Mathematik- und sehr gute Programmierkenntnisse (hauptsächlich C/C++, Tcl/Tk für die Demo-Applikation) sowie

Moeller, Ralf

250

www.mainz.uni-mainz.de Graduate School of Excellence  

E-Print Network (OSTI)

storage and conversion devices: electrochemical capacitors [Con 1999, Pan 2006], batteries (i.e. lithium oftentimes featuring carbon electrodes, is lithium-based batteries: primary lithium batteries, rechargeable lithium-ion batteries, or still lithium-air batteries. Primary lithium batteries, such as Li/SO2, Li/SOCl2

Esper, Jan

251

www.uni-osnabrueck.de FB 09 Fachbereich  

E-Print Network (OSTI)

Instituts für Umwelttechnik und Energiewirtschaft (IUE) der Technischen Universität Hamburg-Harburg, zum

Steinhoff, Heinz-Jürgen

252

uni ulm intern 309/April 2011 Forschung 31  

E-Print Network (OSTI)

genau hier das FIB-Center UUlm des Instituts für Analytische und Bioanalytische Chemie und die FIB- roskopie zugänglich zu machen. Das Institut für Analytische und Bioanalyti- sche Chemie unter der Leitung. Finanziert wird diese zweite Ulmer Anlage durch die Deutsche Forschungsgemein- schaft und das Ministerium für

Pfeifer, Holger

253

Phase 1 - Evaluation of a Functional Interconnect System for Solid Oxide Fuel Cells  

DOE Green Energy (OSTI)

This project is focused on evaluating the suitability of materials and complex multi-materials systems for use as solid oxide fuel cell interconnects. ATI Allegheny Ludlum has generated promising results for interconnect materials which incorporate modified surfaces. Methods for producing these surfaces include cladding, which permits the use of novel materials, and modifications via unique thermomechanical processing, which allows for the modification of materials chemistry. The University of Pittsburgh is assisting in this effort by providing use of their in-place facilities for dual atmosphere testing and ASR measurements, along with substantial work to characterize post-exposure specimens. Carnegie Mellon is testing interconnects for chromia scale spallation resistance using macro-scale and nano-scale indentation tests. Chromia spallation can increase electrical resistance to unacceptable levels and interconnect systems must be developed that will not experience spallation within 40,000 hours at operating temperatures. Spallation is one of three interconnect failure mechanisms, the others being excessive growth of the chromia scale (increasing electrical resistance) and scale evaporation (which can poison the cathode). The goal of indentation fracture testing at Carnegie Mellon is to accelerate the evaluation of new interconnect systems (by inducing spalls at after short exposure times) and to use fracture mechanics to understand mechanisms leading to premature interconnect failure by spallation. Tests include bare alloys from ATI and coated systems from DOE Laboratories and industrial partners, using ATI alloy substrates. West Virginia University is working towards developing a cost-effective material for use as a contact material in the cathode chamber of the SOFC. Currently materials such as platinum are well suited for this purpose, but are cost-prohibitive. For the solid-oxide fuel cell to become a commercial reality it is imperative that lower cost components be developed. Based on the results obtained to date, it appears that sterling silver could be an inexpensive, dependable candidate for use as a contacting material in the cathode chamber of the solid-oxide fuel cell. Although data regarding pure silver samples show a lower rate of thickness reduction, the much lower cost of sterling silver makes it an attractive alternative for use in SOFC operation.

James M. Rakowski

2006-09-30T23:59:59.000Z

254

AVESTAR® - Meet Our People  

NLE Websites -- All DOE Office Websites (Extended Search)

People People Stephen E. Zitney Stephen E. Zitney Director, AVESTAR® Center U.S. Department of Energy National Energy Technology Laboratory Dr. Zitney serves as Director for the AVESTAR® Center and also directs Process & Dynamic Systems Research under NETL's Regional University Alliance (NETL-RUA). He has over 20 years experience in process systems engineering R&D, with a strong emphasis in the areas of steady-state and dynamic process simulation and optimization; real-time operator training systems (OTS) and 3D virtual immersive training systems (ITS); process/equipment co-simulation and computational fluid dynamics (CFD); and advanced numerical methods and high-performance computing. Before joining NETL in 2004, Dr. Zitney held senior consulting and R&D management positions at Fluent, a leading provider of CFD software, Aspen Technology, a major supplier of process simulation software, and Cray Research, a leading provider of supercomputing tools to the process industries. He received M.S./Ph.D. degrees in Chemical Engineering from the University of Illinois at Urbana-Champaign and a B.S. degree in Chemical Engineering and Engineering & Public Policy from Carnegie Mellon University.

255

Dynamic Simulation and Training for IGCC Power Plants  

SciTech Connect

Integrated Gasification Combined Cycle (IGCC) is emerging as the technology of choice for providing clean, low-cost electricity for the next generation of coal-fired power plants and will play a central role in the development of high-efficiency, zero-emissions power plants such as FutureGen. Several major utilities and developers recently announced plans to build IGCC plants and other major utilities are evaluating IGCCs suitability for base-load capacity additions. This recent surge of attention to IGCC power generation is creating a growing demand for experience with the analysis, operation, and control of commercial-scale IGCC plants. To meet this need, the National Energy Technology Laboratory (NETL) has launched a project to develop a generic, full-scope, IGCC dynamic plant simulator for use in establishing a state-of-the-art simulator training center at West Virginia Universitys (WVU) National Research Center for Coal and Energy (NRCCE). The IGCC Dynamic Simulator & Training (DS&T) Center will be established under the auspices of the Collaboratory for Process & Dynamic Systems Modeling (Collaboratory) organized between NETL, WVU, the University of Pittsburgh, and Carnegie Mellon University.

Erbes, M.R. (Enginomix, LLC); Zitney, S.E

2006-09-01T23:59:59.000Z

256

IGCC Dynamic Simulator and Training Center  

SciTech Connect

Integrated Gasification Combined Cycle (IGCC) is emerging as the technology of choice for providing clean, low-cost electricity for the next generation of coal-fired power plants and will play a central role in the development of high-efficiency, zero-emissions power plants such as FutureGen. Several major utilities and developers recently announced plans to build IGCC plants and other major utilities are evaluating IGCCs suitability for base-load capacity additions. This recent surge of attention to IGCC power generation is creating a growing demand for experience with the analysis, operation, and control of commercial-scale IGCC plants. To meet this need, the National Energy Technology Laboratory (NETL) has launched a project to develop a generic, full-scope, IGCC dynamic plant simulator for use in establishing a state-of-the-art simulator training center at West Virginia Universitys (WVU) National Research Center for Coal and Energy (NRCCE). The IGCC Dynamic Simulator & Training (DS&T) Center will be established under the auspices of the Collaboratory for Process & Dynamic Systems Modeling (Collaboratory) organized between NETL, WVU, the University of Pittsburgh, and Carnegie Mellon University.

Zitney, S.E.; Erbes, M.R. (Enginomix, LLC)

2006-10-01T23:59:59.000Z

257

A Study of the Advanced Systems at the CMU Intelligent Workplace with an Evaluation of Potential Applications to Texas A&M International University  

E-Print Network (OSTI)

A detailed study has been conducted of the performance of several innovative aspects of the Intelligent Workplace (IW) at Carnegie Mellon University, a low energy consumption building that uses radiant heating, cooling and a desiccant ventilation unit. The following aspects have been studied in detail: the heat transfer process of radiant mullions and overhead radiant panels, the impact of the radiator position on heating load and thermal comfort, the influence of infiltration on indoor humidity in a radiantly cooled office with a solid desiccant ventilation unit, and an energy consumption comparison of the sensible heating and cooling systems with a single duct VAV system. Transferability of the advanced building technologies that are being studied at the IW was investigated by examining them to see if they could be applied in an advanced technology test bed at Texas A&M International University (TAMIU) in Laredo, Texas. Additionally, a sustainability assessment for the current TAMIU campus was performed with an analysis of the potential for TAMIU to obtain LEED certification from the US Green Building Council. This report summarizes the conclusions and observations of these studies.

Claridge, D. E.; Gong, X.; Verdict, M.; Clingenpeel, K.

2008-04-01T23:59:59.000Z

258

An Empirical Framework for Large-Scale Policy Analysis, with an Application to School Finance Reform in Michigan  

E-Print Network (OSTI)

In this paper I develop an empirical framework for the analysis of large-scale policies, and apply it to study the effects of Michigans 1994 school finance reform on the Detroit metropolitan area. The framework includes estimating a general equilibrium model of multiple jurisdictions with data before the reform, predicting the post-reform equilibrium, and comparing this prediction with postreform data to validate the model. According to my analysis, the Michigan reform had little impact on household demographics or school quality in Detroit. The alternative school funding policies analyzed here do not seem to affect school quality much either. (JEL C52, I22, H73) I thank the Berkman Faculty Development Fund at Carnegie Mellon University for financial support. I also thank Julie Berry Cullen and Susanna Loeb for providing me with data on pass rates for Michigan. Mary Ann Cleary, Jeff Guilfoyle, Andrew Lockwood, and Glenda Rader from the government of the state of Michigan answered many of my questions on Proposal A. I am indebted to Dennis Epple, George-Levy Gayle, Holger Sieg, and Fallaw Sowell for valuable conversations, and to participants at the 2004 summer workshop at the Federal Reserve of Cleveland for comments on an

Maria Marta Ferreyra

2009-01-01T23:59:59.000Z

259

Center for Defect Physics - Energy Frontier Research Center (A "Life at the Frontiers of Energy Research" contest entry from the 2011 Energy Frontier Research Centers (EFRCs) Summit and Forum)  

SciTech Connect

'Center for Defect Physics - Energy Frontier Research Center' was submitted by the Center for Defect Physics (CDP) to the 'Life at the Frontiers of Energy Research' video contest at the 2011 Science for Our Nation's Energy Future: Energy Frontier Research Centers (EFRCs) Summit and Forum. Twenty-six EFRCs created short videos to highlight their mission and their work. CDP is directed by G. Malcolm Stocks at Oak Ridge National Laboratory, and is a partnership of scientists from nine institutions: Oak Ridge National Laboratory (lead); Ames Laboratory; Brown University; University of California, Berkeley; Carnegie Mellon University; University of Illinois, Urbana-Champaign; Lawrence Livermore National Laboratory; Ohio State University; and University of Tennessee. The Office of Basic Energy Sciences in the U.S. Department of Energy's Office of Science established the 46 Energy Frontier Research Centers (EFRCs) in 2009. These collaboratively-organized centers conduct fundamental research focused on 'grand challenges' and use-inspired 'basic research needs' recently identified in major strategic planning efforts by the scientific community. The overall purpose is to accelerate scientific progress toward meeting the nation's critical energy challenges.

Stocks, G. Malcolm (Director, Center for Defect Physics in Structural Materials); CDP Staff

2011-05-01T23:59:59.000Z

260

Advanced Building Efficiency Testbed Initiative/Intelligent Workplace Energy Supply System; ABETI/IWESS  

DOE Green Energy (OSTI)

ABETI/IWESS is a project carried out by Carnegie Mellon's Center for Building Performance and Diagnostics, the CBPD, supported by the U.S. Department of Energy/EERE, to design, procure, install, operate, and evaluate an energy supply system, an ESS, that will provide power, cooling, heating and ventilation for CBPD's Intelligent Workplace, the IW. The energy sources for this system, the IWESS, are solar radiation and bioDiesel fuel. The components of this overall system are: (1) a solar driven cooling and heating system for the IW comprising solar receivers, an absorption chiller, heat recovery exchanger, and circulation pump; (2) a bioDiesel fueled engine generator with heat recovery exchangers, one on the exhaust to provide steam and the other on the engine coolant to provide heated water; (3) a ventilation system including an enthalpy recovery wheel, an air based heat pump, an active desiccant wheel, and an air circulation fan; and (4) various convective and radiant cooling/heating units and ventilation air diffusers distributed throughout the IW. The goal of the ABETI/IWESS project is to demonstrate an energy supply system for a building space that will provide a healthy, comfortable environment for the occupants and that will reduce the quantity of energy consumed in the operation of a building space by a factor of 2 less than that of a conventional energy supply for power, cooling, heating, and ventilation based on utility power and natural gas fuel for heating.

David Archer; Frederik Betz; Yun Gu; Rong Li; Flore Marion; Sophie Masson; Ming Qu; Viraj Srivastava; Hongxi Yin; Chaoqin Zhai; Rui Zhang; Elisabeth Aslanian; Berangere Lartigue

2008-05-31T23:59:59.000Z

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Passive solar analysis and design of commercial buildings using DOE-2  

DOE Green Energy (OSTI)

The custom weighting-factor loads calculative method that was implemented in the DOE-2.1 program was refined and fully documented. This method allows direct-gain and night-ventilative-cooling passive systems to be analyzed using DOE-2. A thermal storage wall model for DOE-2 was developed and tested.This model treats vented and unvented storage walls using either masonry or water as the storage medium. It includes the effect of night insulation and selective surfaces. A model for attached sunspaces, atriums, and buffer spaces has also been developed for DOE-2. This model simulates interzone convection (forced or natural), and interzone conduction through massive walls. A case study of Warner Hall at Carnegie-Mellon University in Pittsburgh, Pennsylvania was completed, as part of the DOE Passive Solar Commercial Buildings Program. DOE-2 was used in an analysis of several passive solar and energy conservation retrofit options. The Los Alamos analysis served as a basis for comparison to a more limited (in time and budget) analysis done by the energy consultant for the retrofit project.

Hunn, B.D.

1981-01-01T23:59:59.000Z

262

kmmixrpp.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

CABIBBO-KOBAYASHI-MASKAWA CABIBBO-KOBAYASHI-MASKAWA QUARK-MIXING MATRIX Revised January 2004 by F.J. Gilman (Carnegie-Mellon University), K. Kleinknecht and B. Renk (Johannes-Gutenberg Universit¨ at Mainz). In the Standard Model with SU(2)×U(1) as the gauge group of electroweak interactions, both the quarks and leptons are assigned to be left-handed doublets and right-handed singlets. The quark mass eigenstates are not the same as the weak eigenstates, and the matrix relating these bases was defined for six quarks and given an explicit parametrization by Kobayashi and Maskawa [1] in 1973. This generalizes the four-quark case, where the matrix is described by a single parameter, the Cabibbo angle [2]. By convention, the mixing is often expressed in terms of a 3 × 3 unitary matrix V operating on the charge -e/3 quark mass eigenstates (d, s, and b):   d s b   =   V ud V us V ub V cd V cs V cb V td

263

This report was prepared as an account of work sponsored by an agency of the Uni  

NLE Websites -- All DOE Office Websites (Extended Search)

by an agency of the United States government. Neither the United States government nor any agency by an agency of the United States government. Neither the United States government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States government or any agency thereof. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States government or any agency thereof.

264

fall/winter 2010 | VOl 27 | no 3 UniVerSitYMaGaZine  

E-Print Network (OSTI)

-setting public-private collaboration that naturally builds on Say yes, we unveiled 2+2 joint admission agreements

Raina, Ramesh

265

ZooNotes 4: 1-4 (2009) ...4... www.zoonotes.bio.uni-plovdiv.bg  

E-Print Network (OSTI)

-optimal design in the regression context with uncorrelated measurement errors (see, e.g., Atkinson and Donev in Gaussian stochastic processes. Canadian Journal of Statistics 26: 127­137. Atkinson AC, Donev AN. 1992

Mollov, Ivelin Aldinov

266

San Jose Scale Management in Peaches--Bill Shane, Michigan State Uni-  

E-Print Network (OSTI)

, and entire trees if left uncon- trolled. A characteristic, red halo-like discoloration often forms around May to late June tiny 2- winged adult males emerge to mate with females still under its grey, circular

267

A survey of UNI signaling systems and protocols for ATM networks  

Science Conference Proceedings (OSTI)

The main aspect covered by signaling systems and protocols for ATM networks concerns the possibility to manage, maintain, and control a user-driven communication between arbitrary ATM end-systems connected to an ATM network. The tasks and procedures ...

Burkhard Stiller

1995-04-01T23:59:59.000Z

268

UniCast, OutCast & GroupCast: Three Steps Toward Ubiquitous, Peripheral Displays  

Science Conference Proceedings (OSTI)

Artifacts and surfaces that can display digital content are proliferating at a steady rate. Many of these displays will be peripheral, i.e., used for content that is not directly related to one's primary activities. However, what kinds of content would ...

Joseph F. McCarthy; Tony J. Costa; Edy S. Liongosari

2001-09-01T23:59:59.000Z

269

www.quest-at-ptb.de www.quest.uni-hannover.de Centre for Quantum Engineering  

E-Print Network (OSTI)

, thickfilm gold electrodes Parameters: U = 1500V, = 2 *25MHz, U = 10VRF RF DC,zW p Loss factor: L = 1,27 /2

Hensinger, Winfried

270

appalachian studies uniVeRsitY OF KentucKY  

E-Print Network (OSTI)

% of kentucky's electricity. Approximately 78% of kentucky's coal is mined in eastern kentucky. eastern kentucky miners make up 84% of the state's coal mining work force.* *Kentucky Coal Association The cre-1884 Ashland Coal & Iron Railway Co. Mines Ledger, 1888-1889 EDUCATION AND LITERACY Country Life Schools

Kim, Mi-Ok

271

Nr. 170 / 2013 // 24. Juni 2013 KinderUni am 26. Juni: Du lgst doch!  

E-Print Network (OSTI)

-Botanischen Garten" sprechen wird. Die Vielfalt an Pflanzenarten und das kleinräumige Mosaik unterschiedlicher Lebensräume im ?kologisch-Botanischen Garten haben dazu geführt, dass sich hier eine Vielzahl von Tierarten

Ott, Albrecht

272

TN-Gebhren fr Externe 2013/2014 Wir an der Uni  

E-Print Network (OSTI)

Garten: Sind sie noch zu retten? Bedrohte Pflanzen im Botanischen Garten 24.09.2013, von 12:00-13:30 Uhr Dr. Ute Becker kostenfrei 20140090 Besuch im Botanischen Garten: Die sinnliche Seite der Gewürze 09

van Straten, Duco

273

Nr. 169 / 2013 // 24. Juni 2013 KinderUni mit Professor Kannowski bei  

E-Print Network (OSTI)

beobachten im ?kologisch-Botanischen Garten" referieren. Die Vielfalt an Pflanzenarten und das kleinräumige Mosaik unterschiedlicher Lebensräume im ?kologisch-Botanischen Garten haben dazu geführt, dass sich hier

Ott, Albrecht

274

Nr. 174 / 2013 // 25. Juni 2013 KinderUni am 26. Juni: Du lgst doch!  

E-Print Network (OSTI)

: Tiere beobachten im ?kologisch- Botanischen Garten" sprechen wird. Die Vielfalt an Pflanzenarten und das kleinräumige Mosaik unterschiedlicher Lebensräume im ?kologisch-Botanischen Garten hat dazu geführt, dass sich

Ott, Albrecht

275

Kinder-Sommer-Uni 2010 der Universitt Innsbruck Programm Innsbrucker Ferienzug  

E-Print Network (OSTI)

(bei Regen 1 Woche später) 09:00-12:00 Uhr Im gerade entstandenen interkulturellen Garten wird nicht. "Interkultureller Garten/ Wilten" Ecke Fritz-Konzert-Stra?e/ Pastorstra?e; Linie 1 Stubaitalbahnhof 8-14 20

Breu, Ruth

276

Standard Operating Procedure (SOP) for MTS Single Acting Frame With UniTest  

E-Print Network (OSTI)

REMOVING COVERS FOR TROUBLESHOOTING PURPOSES. WARNING: NEVER PLACE BODY PARTS BETWEEN POTENTIAL PINCH

Thompson, Michael

277

UniPlug : a framework for ad-hoc invention sharing over a campus network  

E-Print Network (OSTI)

In the future, there will be a large number of devices, and most of us will own more than one (some of us already do). Many individual innovators write programs that exploit features on such devices for interesting, ...

Pandey, Durga Prasad, S.M. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

278

n the Big Bang at the beginning of the Uni-verse, the lightest elements, hydrogen,  

E-Print Network (OSTI)

. Butlittlewasknownabouttheproductionof elements, and the associated history of star formation, in the most distant galaxies that formed window on the early formation of elements andstarsintheUniverse. A number of studies have explored throughtheradiationtheyabsorbfromeven more distant quasars. These studies probe the earliest chemical history of gas in the Universe

Cowan, John

279

Field-Object Design of a Numerical Weather Prediction Model for Uni- and Multiprocessors  

Science Conference Proceedings (OSTI)

The performance of a numerical weather model constructed from scalar, vector, and tensor field objects is evaluated on several workstation computers and on a message-passing multiprocessor.

D. K. Purnell; M. J. Revell; P. N. McGavin

1995-02-01T23:59:59.000Z

280

www.uni-bayreuth.de ,,Universitten sind Orte, an denen die Gesellschaft ber sich nachdenkt"  

E-Print Network (OSTI)

die Flexi- bilität der Anlagen. Je flexibler ein kraftwerk strom produzieren kann, desto grösser ist definieren muss.» Wie wertvoll ist die Flexibilität, mit der ein Kraftwerk Strom produziert? #12;7 Genau um

Schmidt, Matthias

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

NETL: Water-Energy Interface - Power Plant Water Management  

NLE Websites -- All DOE Office Websites (Extended Search)

Use of Treated Municipal Wastewater as Power Plant Cooling System Makeup Water: Tertiary Treatment versus Expanded Chemical Regimen for Recirculating Water Quality Management Use of Treated Municipal Wastewater as Power Plant Cooling System Makeup Water: Tertiary Treatment versus Expanded Chemical Regimen for Recirculating Water Quality Management Carnegie Mellon University, in a joint effort with the University of Pittsburgh, is conducting a study of the use of treated municipal wastewater as cooling system makeup for coal fired power plants. This project builds upon a study sponsored by the U.S. Department of Energy entitled, "Reuse of Treated Internal or External Wastewaters in the Cooling Systems of Coal-Based Thermoelectric Power Plants," which showed that treated municipal wastewater is the most common and widespread source in the United States. Data analysis revealed that 81 percent of power plants proposed for construction by the Energy Information Administration (EIA) would have sufficient cooling water supply from one to two publicly owned treatment works (POTW) within a 10-mile radius, while 97 percent of the proposed power plants would be able to meet their cooling water needs with one to two POTWs within 25 miles of these plants. Thus, municipal wastewater will be the impaired water source most likely to be locally available in sufficient and reliable quantities for power plants. Results of initial studies indicate that it is feasible to use secondary treated municipal wastewater as cooling system makeup. The biodegradable organic matter, ammonia-nitrogen, and phosphorus in the treated wastewater pose challenges with respect to enhanced biofouling, corrosion, and scaling, although current research is demonstrating that these problems can be controlled through aggressive chemical management. It is currently unclear whether tertiary treatment of municipal waste water prior to its re-use can be a cost-effective option to aggressive chemical management of the bulk cooling water volume.

282

Exploring the fundamentals of radical assisted NO{sub x} reduction processes of coal combustors. Final report  

SciTech Connect

This report describes experimental studies performed at Carnegie Mellon University to study the parameters that affect the performance of plasma-assisted ammonia radical injection for NO{sub x} control from stationary combustion sources. First, the NO{sub x} reduction potential of hot ammonia injection was studied to determine whether the use of the plasma for radical generation was key to the high NO{sub x} reduction potential of the plasma deNO{sub x} process. It was found that while some of the NO{sub x} reduction in the plasma deNO{sub x} demonstration experiments could be attributed to the enhanced thermal breakdown of NH{sub 3} into NO{sub x} reducing radicals, the effect of using the plasma accounted for 15--35% absolute additional NO{sub x} reduction beyond any thermal benefit. This benefit of using the plasma increases with increased excess air and decreased flue gas temperature. With the benefit of using the plasma verified on the larger scale of a demonstration experiment, two additional experiments were performed to study the parameters that affect plasma deNO{sub x} performance on the local level. The opposed flow experiment failed to produce significant NO{sub x} reduction, although it did highlight some key aspects of plasma performance with ammonia injection. The reverse injection experiment successfully demonstrated the effects of NO-stream temperature, plasma power, and ammonia flow rate on plasma deNO{sub x} performance. Finally, a preliminary study of the chemical kinetics of the plasma deNO{sub x} system was performed. This study highlighted the importance of effective plasma temperature and the residence time of the reagent at that temperature to efficient radical generation.

Chess, K.; Yao, S.C.; Russell, A.G.

1996-05-31T23:59:59.000Z

283

Long-Range Untethered Real-Time Live Gas Main Robotic Inspection System  

SciTech Connect

Under funding from the Department of Energy (DOE) and the Northeast Gas Association (NGA), Carnegie Mellon University (CMU) developed an untethered, wireless remote controlled inspection robot dubbed Explorer. The project entailed the design and prototyping of a wireless self-powered video-inspection robot capable of accessing live 6- and 8-inch diameter cast-iron and steel mains, while traversing turns and Ts and elbows under real-time control with live video feedback to an operator. The design is that of a segmented actively articulated and wheel-leg powered robot design, with fisheye imaging capability and self-powered battery storage and wireless real-time communication link. The prototype was functionally tested in an above ground pipe-network, in order to debug all mechanical, electrical and software subsystems, and develop the necessary deployment and retrieval, as well as obstacle-handling scripts. A pressurized natural gas test-section was used to certify it for operation in natural gas at up to 60 psig. Two subsequent live-main field-trials in both cast-iron and steel pipe, demonstrated its ability to be safely launched, operated and retrieved under real-world conditions. The system's ability to safely and repeatably exidrecover from angled and vertical launchers, traverse multi-thousand foot long pipe-sections, make T and varied-angle elbow-turns while wirelessly sending live video and handling command and control messages, was clearly demonstrated. Video-inspection was clearly shown to be a viable tool to understand the state of this critical buried infrastructure, irrespective of low- (cast-iron) or high-pressure (steel) conditions. This report covers the different aspects of specifications, requirements, design, prototyping, integration and testing and field-trialing of the Explorer platform.

Hagen Schempf; Daphne D'Zurko

2004-10-31T23:59:59.000Z

284

Uncertainty analysis routine for the Ocean Thermal Energy Conversion (OTEC) biofouling measurement device and data reduction procedure. [HTCOEF code  

DOE Green Energy (OSTI)

Biofouling and corrosion of heat exchanger surfaces in Ocean Thermal Energy Conversion (OTEC) systems may be controlling factors in the potential success of the OTEC concept. Very little is known about the nature and behavior of marine fouling films at sites potentially suitable for OTEC power plants. To facilitate the acquisition of needed data, a biofouling measurement device developed by Professor J. G. Fetkovich and his associates at Carnegie-Mellon University (CMU) has been mass produced for use by several organizations in experiments at a variety of ocean sites. The CMU device is designed to detect small changes in thermal resistance associated with the formation of marine microfouling films. An account of the work performed at the Pacific Northwest Laboratory (PNL) to develop a computerized uncertainty analysis for estimating experimental uncertainties of results obtained with the CMU biofouling measurement device and data reduction scheme is presented. The analysis program was written as a subroutine to the CMU data reduction code and provides an alternative to the CMU procedure for estimating experimental errors. The PNL code was used to analyze sample data sets taken at Keahole Point, Hawaii; St. Croix, the Virgin Islands; and at a site in the Gulf of Mexico. The uncertainties of the experimental results were found to vary considerably with the conditions under which the data were taken. For example, uncertainties of fouling factors (where fouling factor is defined as the thermal resistance of the biofouling layer) estimated from data taken on a submerged buoy at Keahole Point, Hawaii were found to be consistently within 0.00006 hr-ft/sup 2/-/sup 0/F/Btu, while corresponding values for data taken on a tugboat in the Gulf of Mexico ranged up to 0.0010 hr-ft/sup 2/-/sup 0/F/Btu. Reasons for these differences are discussed.

Bird, S.P.

1978-03-01T23:59:59.000Z

285

Quarterly technical progress report for the period ending June 30, 1984  

SciTech Connect

The Magnetohydrodynamics Program (Component Development and Integration Facility) in Butte, Montana, continued its site preparation for the TRW first-stage combustor installation. In the area of flue gas cleanup, our in-house research program is continuing its investigation into the causes of sorbent attrition in PETC's fluidized-bed copper oxide process for simultaneous SO/sub 2//NO/sub x/ removal. Interwoven with these tests is a series of spray dryer/electrostatic precipitator tests that are being conducted with the cooperation of Wheelabrator-Frye, Inc. This test series was completed this quarter, and the data show that when using a Kentucky coal, Wheelabrator-Frye's electrostatic precipitator provides excellent particulate control efficiency while using a spray dryer for sulfur dioxide removal. A unique project at Carnegie-Mellon University is looking at the concept of integrated environmental control for coal-fired power plants making use of precombustion, combustion, and postcombustion control, including systems for the simultaneous removal of more than one pollutant. The objective of this research is to develop a computer model and assessment for integrated environmental control systems that utilize conventional or advanced systems. The Liquid Phase Methanol Project Development Unit in LaPorte, Texas, was restarted after a successful shakedown run was completed. PETC has recently begun an in-house research project aimed at exploring the basic chemistry of liquefying coal in the presence of water under supercritical conditions. In the Alternative Fuels Technology Program, the Gulf Research and Development Company has completed the preliminary testing phase of its erosion test loop. Their results indicate that when pumping a coal-water slurry fuel through a flow loop, the erosion rate increases as velocity increases, suggesting a well-defined relationship between these two parameters.

Not Available

1984-10-01T23:59:59.000Z

286

Advanced, Integrated Control for Building Operations to Achieve 40% Energy Saving  

SciTech Connect

we developed and demonstrated a software based integrated advanced building control platform called Smart Energy Box (SEB), which can coordinate building subsystem controls, integrate variety of energy optimization algorithms and provide proactive and collaborative energy management and control for building operations using weather and occupancy information. The integrated control system is a low cost solution and also features: Scalable component based architecture allows to build a solution for different building control system configurations with needed components; Open Architecture with a central data repository for data exchange among runtime components; Extendible to accommodate variety of communication protocols. Optimal building control for central loads, distributed loads and onsite energy resource Uses web server as a loosely coupled way to engage both building operators and building occupants in collaboration for energy conservation. Based on the open platform of SEB, we have investigated and evaluated a variety of operation and energy saving control strategies on Carnegie Mellon University Intelligent Work place which is equipped with alternative cooling/heating/ventilation/lighting methods, including radiant mullions, radiant cooling/heating ceiling panels, cool waves, dedicated ventilation unit, motorized window and blinds, and external louvers. Based on the validation results of these control strategies, they were integrated in SEB in a collaborative and dynamic way. This advanced control system was programmed and computer tested with a model of the Intelligent Workplace??s northern section (IWn). The advanced control program was then installed in the IWn control system; the performance were measured and compared with that of the state of the art control system to verify the overall energy savings great than 40%. In addition advanced human machine interfaces (HMI's) were developed to communicate both with building occupants and the building operator. Lifecycle cost analyses of the advanced building control were performed, and a Building Control System Guide was prepared and published to inform owners, architects, and engineers dealing with new construction or renovation of buildings.

Dr. Zhen Song, Prof. Vivian Loftness, Dr. Kun Ji, Dr. Sam Zheng, Mr. Bertrand Lasternas, Ms. Flore Marion, Mr. Yuebin Yu

2012-10-15T23:59:59.000Z

287

DESIGN, CONSTRUCTION AND FIELD DEMONSTRATION OF EXPLORER: A LONG-RANGE UNTETHERED LIVE GASOLINE INSPECTION ROBOT SYSTEM  

SciTech Connect

This program is undertaken in order to construct and field-demonstrate ''EXPLORER'', a modular, remotely controllable, self-powered, untethered robot system for the inspection of live gas distribution 150 mm (6-inch) to 200 mm (8-inch) diameter mains. The modular design of the system allows it to accommodate various components intended to accomplish different inspection, repair, sample retrieval, and other in-pipe tasks. The prototype system being built under this project will include all the basic modules needed, i.e. the locomotor, power storage, wireless communication, and camera. The camera, a solid-state fisheye-type, is used to transmit real-time video to the operator that allows for the live inspection of gas distribution pipes. The system under development significantly advances the state of the art in inspection systems for gas distribution mains, which presently consist of tethered systems of limited range (about 500 ft form the point of launch) and limited inspection views. Also current inspection systems have no ability to incorporate additional modules to expand their functionality. This development program is a joint effort among the Northeast Gas Association (formerly New York Gas Group), the Jet Propulsion Laboratory (JPL), the Johnson Space Center (JSC), Carnegie Mellon University's (CMU) National Robotics Engineering Consortium (NREC), and the US Department of Energy (DOE) through the National Energy Technology Laboratory (NETL) The present report summarizes the accomplishments of the project during its sixth six-month period. The project has in general achieved its goals for this period as outlined in the report. The prototype robot completed its first field demonstration in June 2004 and is undergoing further extensive endurance testing and some minor modifications in order to prepare for the second and last field demonstration planned for October 2004.

George C. Vradis; Hagen Schempf

2004-10-01T23:59:59.000Z

288

DESIGN, CONSTRUCTION AND FIELD DEMONSTRATION OF EXPLORER: A LONG-RANGE UNTETHERED LIVE GASLINE INSPECTION ROBOT SYSTEM  

SciTech Connect

This program is undertaken in order to construct and field-demonstrate EXPLORER, a modular, remotely controllable, self-powered, untethered robot system for the inspection of live gas distribution 150 mm (6-inch) to 200 mm (8-inch) diameter mains. The modular design of the system allows it to accommodate various components intended to accomplish different inspection, repair, sample retrieval, and other in-pipe tasks. The prototype system being built under this project will include all the basic modules needed, i.e. the locomotor, power storage, wireless communication, and camera. The camera, a solid-state fisheye-type, is used to transmit real-time video to the operator that allows for the live inspection of gas distribution pipes. The system under development significantly advances the state of the art in inspection systems for gas distribution mains, which presently consist of tethered systems of limited range (about 500 ft form the point of launch) and limited inspection views. Also current inspection systems have no ability to incorporate additional modules to expand their functionality. This development program is a joint effort among the Northeast Gas Association (formerly New York Gas Group), the Jet Propulsion Laboratory (JPL), the Johnson Space Center (JSC), Carnegie Mellon University's (CMU) National Robotics Engineering Consortium (NREC), and the US Department of Energy (DOE) through the National Energy Technology Laboratory (NETL) The present report summarizes the accomplishments of the project during its fifth six-month period. The project has in general achieved its goals for this period as outlined in the report. The prototype robot is undergoing extensive endurance testing in order to prepare for the field demonstrations planned for June 2004.

George C. Vradis, Hagen Schempf

2004-04-01T23:59:59.000Z

289

DESIGN, CONSTRUCTION AND FIELD DEMONSTRATION OF EXPLORER: A LONG-RANGE UNTETHERED LIVE GASLINE INSPECTION ROBOT SYSTEM  

SciTech Connect

This program is undertaken in order to construct and field-demonstrate ''EXPLORER'', a modular, remotely controllable, self-powered, untethered robot system for the inspection of live gas distribution 150 mm (6- inch) to 200 mm (8-inch) diameter mains. The modular design of the system allows it to accommodate various components intended to accomplish different inspection, repair, sample retrieval, and other in-pipe tasks. The prototype system being built under this project will include all the basic modules needed, i.e. the locomotor, power storage, wireless communication, and camera. The camera, a solid-state fisheye-type, is used to transmit real-time video to the operator that allows for the live inspection of gas distribution pipes. The system under development significantly advances the state of the art in inspection systems for gas distribution mains, which presently consist of tethered systems of limited range (about 500 ft form the point of launch) and limited inspection views. Also current inspection systems have no ability to incorporate additional modules to expand their functionality. This development program is a joint effort among the Northeast Gas Association (formerly New York Gas Group), the Jet Propulsion Laboratory (JPL), the Johnson Space Center (JSC), Carnegie Mellon University's (CMU) National Robotics Engineering Consortium (NREC), and the US Department of Energy (DOE) through the National Energy Technology Laboratory (NETL) The present report summarizes the accomplishments of the project during its fourth six-month period. The project has in general achieved its goals for this period as outlined in the report. The fabrication of the prototype is complete and is now been tested in the laboratory mainly focusing on endurance testing and testing of launching procedures. Testing of the prototype in the lab is expected to be completed by Fall 2003, to be followed by two field demonstrations in Winter 2003-2004.

Hagen Schempf

2003-10-01T23:59:59.000Z

290

A solar thermal cooling and heating system for a building: Experimental and model based performance analysis and design  

Science Conference Proceedings (OSTI)

A solar thermal cooling and heating system at Carnegie Mellon University was studied through its design, installation, modeling, and evaluation to deal with the question of how solar energy might most effectively be used in supplying energy for the operation of a building. This solar cooling and heating system incorporates 52 m{sup 2} of linear parabolic trough solar collectors; a 16 kW double effect, water-lithium bromide (LiBr) absorption chiller, and a heat recovery heat exchanger with their circulation pumps and control valves. It generates chilled and heated water, dependent on the season, for space cooling and heating. This system is the smallest high temperature solar cooling system in the world. Till now, only this system of the kind has been successfully operated for more than one year. Performance of the system has been tested and the measured data were used to verify system performance models developed in the TRaNsient SYstem Simulation program (TRNSYS). On the basis of the installed solar system, base case performance models were programmed; and then they were modified and extended to investigate measures for improving system performance. The measures included changes in the area and orientation of the solar collectors, the inclusion of thermal storage in the system, changes in the pipe diameter and length, and various system operational control strategies. It was found that this solar thermal system could potentially supply 39% of cooling and 20% of heating energy for this building space in Pittsburgh, PA, if it included a properly sized storage tank and short, low diameter connecting pipes. Guidelines for the design and operation of an efficient and effective solar cooling and heating system for a given building space have been provided. (author)

Qu, Ming [School of Civil Engineering, Purdue University, 550 Stadium Mall Drive, West Lafayette, IN 47907-2051 (United States); Yin, Hongxi [School of Engineering Education, Purdue University, 701 W. Stadium Ave., West Lafayette, IN 47907-2061 (United States); Archer, David H. [Department of Mechanical Engineering, Carnegie Mellon University, 5000 Forbes Ave., Pittsburgh, PA 15213 (United States)

2010-02-15T23:59:59.000Z

291

MEMORANDUM OF MUTUAL UNDERSTANDING FOR RESEARCH COOPERATION BETWEEN SCHOOL OF OCEAN & EARTH SCIENCES & TECHNOLOGY (SOEST), UNI  

NLE Websites -- All DOE Office Websites (Extended Search)

AGREEMENT AGREEMENT FOR INTERNATIONAL RESEARCH COOPERATION USING THE EARTH SIMULATOR BETWEEN THE EARTH SIMULATOR CENTER OF JAPAN MARINE SCIENCE & TECHNOLOGY CENTER (ESC/JAMSTEC) AND NATIONAL ENERGY RESEARCH SCEINTIFIC COMPUTING (NERSC) CENTER AT LAWRENCE BERKELEY NATIONAL LABORATORY WHEREAS, the Earth Simulator Center of Japan Marine Science and Technology Center (hereinafter referred to as "ESC/JAMSTEC") and the National Energy Research Scientific Computing Center (hereinafter referred to as "NERSC") desire to cooperate in international research activities in computational science. Cooperation under this Agreement shall be carried out only for peaceful purposes and aforementioned research activities and its results shall not be

292

Centre for Social Investment University of Heidelberg No. 15/ October 2013 Volume 5 www.csi.uni-heidelberg.de/report  

E-Print Network (OSTI)

organisations from Armenia, Azerbaijan, Germany, Georgia, Russia and Turkey proves, both quantitatively of an international cooperation in Armenia, Azerbaijan, Georgia, Russia and Turkey. An article written with our guest author, Ronald Menzel-Nazarov, MitOst e.V. The mountain ranges of the Caucasus do not only offer

Heermann, Dieter W.

293

2. Bauabschnitt in der Langen Gasse ist nach 23 Jahren fertig uni.kurier.aktuell 53/oktober.2004  

E-Print Network (OSTI)

Fragen zur Verfügung. Das Kraftwerk befindet sich am lin- ken Illerufer in Kempten inmitten eines-Veranstaltungskalender #12;Vertrauen als strategische Investition Seminar: Dr. Hans-Joachim Gergs (AUDI AG), Prof. Reinhard

Sanderson, Yasmine

294

Citation: W.-M. Yao  

NLE Websites -- All DOE Office Websites (Extended Search)

TESTS OF CONSERVATION LAWS Updated June 2006 by L. Wolfenstein and T.G. Trippe. In keeping with the current interest in tests of conservation laws, we collect together a Table of...

295

Studienfachberater 1. Staatsprfung Dr. M. Duderstadt  

E-Print Network (OSTI)

/218 63262 osterseh@uni-bremen.de Chemie: Prof. Ingo Eilks 0421/218-63280/-63281 eilks@uni-bremen.de Deutsch (alle Schulstufen): Dr. Ute Siewerts 0421/218 68284 siewerts@uni-bremen.de Deutsch (nur Primarstufe

Koenig, Friederike - Fachbereich 2 Biologie

296

Single-Row Equidistant Facility Layout as a Special Case of Single ...  

E-Print Network (OSTI)

Mathematics, Uni Klagenfurt, Austria, philipp.hungerlaender@uni-klu.ac.at ... issues that arise in real-world applications, such as designing dynamic layouts by ...

297

Bert Phillips  

NLE Websites -- All DOE Office Websites (Extended Search)

UNIES, Ltd., Winnipeg, Canada Mr. Phillips is a registered Professional Engineer in three Canadian provinces and part owner of UNIES Ltd., an engineering firm in Winnipeg, Manitoba...

298

Felix-Klein-Kolloquium Heinrich-Heine-Universitt Dsseldorf  

E-Print Network (OSTI)

. Einstieg: Bahnhofsvorplatz, Bstg. 7 Ausstieg: Endstation Uni-Ost/Botanischer Garten Fahrtzeit: ca. 19

299

4th Annual DOE-ERSP PI Meeting: Abstracts  

E-Print Network (OSTI)

Laboratory, Berkeley, CA, Peter Jaffe, Princeton University, Princeton, NJ, Lee Kerkhof, Rutgers Uni- versity, New Brunswick,

Hazen, Terry C.

2009-01-01T23:59:59.000Z

300

A Virtual Engineering Framework for Simulating Advanced Power System  

SciTech Connect

In this report is described the work effort performed to provide NETL with VE-Suite based Virtual Engineering software and enhanced equipment models to support NETL's Advanced Process Engineering Co-simulation (APECS) framework for advanced power generation systems. Enhancements to the software framework facilitated an important link between APECS and the virtual engineering capabilities provided by VE-Suite (e.g., equipment and process visualization, information assimilation). Model enhancements focused on improving predictions for the performance of entrained flow coal gasifiers and important auxiliary equipment (e.g., Air Separation Units) used in coal gasification systems. In addition, a Reduced Order Model generation tool and software to provide a coupling between APECS/AspenPlus and the GE GateCycle simulation system were developed. CAPE-Open model interfaces were employed where needed. The improved simulation capability is demonstrated on selected test problems. As part of the project an Advisory Panel was formed to provide guidance on the issues on which to focus the work effort. The Advisory Panel included experts from industry and academics in gasification, CO2 capture issues, process simulation and representatives from technology developers and the electric utility industry. To optimize the benefit to NETL, REI coordinated its efforts with NETL and NETL funded projects at Iowa State University, Carnegie Mellon University and ANSYS/Fluent, Inc. The improved simulation capabilities incorporated into APECS will enable researchers and engineers to better understand the interactions of different equipment components, identify weaknesses and processes needing improvement and thereby allow more efficient, less expensive plants to be developed and brought on-line faster and in a more cost-effective manner. These enhancements to APECS represent an important step toward having a fully integrated environment for performing plant simulation and engineering. Furthermore, with little effort the modeling capabilities described in this report can be extended to support other DOE programs, such as ultra super critical boiler development, oxy-combustion boiler development or modifications to existing plants to include CO2 capture and sequestration.

Mike Bockelie; Dave Swensen; Martin Denison; Stanislav Borodai

2008-06-18T23:59:59.000Z

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Fr Studenten der Physik, Chemie oder (Angewandten) Mathematik, ist am Institut fr Numerische Simulation (http://www.ins.uni-bonn.de/) ab sofort eine  

E-Print Network (OSTI)

.U., Bergmeyer, J. and Grabb, M. (Eds.) Methods of Enzymatic Analysis, Vol. V, 3rd ed., Verlag-Chemie, Weinheim

Bartels, Soeren

302

Uni-Battelle, Btiment D, Route de Drize 7 | CH-1227 Carouge Tl : 022 379 01 07 | Web : www.unige.ch/energie  

E-Print Network (OSTI)

heat recovery via district heating» Jeudi 2 mai 2013 à 17h15 Pierre Hollmuller, Université de Genève district heating and cooling: case study of the Chamartin district in Madrid » Jeudi 30 mai 2013 à 17h15

Loewith, Robbie

303

1995-2011 | LS-LAMP IMPACT REPORT uniVersity of neW orLeAns | new orleans, la  

E-Print Network (OSTI)

.S., mathematics, michigan State University, East Lansing, mI m.S., Statistical Science, Baylor University, waco was the second place winner of the 2010 Joint statistical meetings (Jsm) stat Bowl. she was also named oustanding Graduate stu- dent (2010) by Baylor university's Department of statistical sciences. she has also

Kulp, Mark

305

Christian Wiler M.A. Telefon: +49 (0) 921 / 55-7606 mediendienst-forschung@uni-bayreuth.de Herausgeber: Mediendienst Forschung Universitt Bayreuth Universittsstr. 30 D -95447 Bayreuth  

E-Print Network (OSTI)

gespeicherte Wärme. Weltweit sind heute geothermische Kraftwerke in Betrieb, um die in Warmwasser und Hei?dampf geothermischer Kraftwerke, besser aufein- ander abgestimmt werden. Auf diese Weise lässt sich der Wirkungsgrad geothermischer Kraftwerke deutlich steigern, wie die Bayreuther Wissenschaftler durch umfangreiche Simulationen

Schmidt, Matthias

306

DER STUDIENFHRER ZUM THEMA NACHHALTIGKEIT FR STUDIERENDE AN DER UNI UND ETH ZRICH STUDIO!SUSAUSGABE 04 // MRZ 2005 // CHF 5. // geld  

E-Print Network (OSTI)

Investition, da die neuen Motoren wesentlich energieeffizienter sind. «Die Anschaffungskosten sollten Departement BSSE in Basel und der Forschungsstation Chamau. Mit einem Blockheiz- Kraftwerk und mittels:Wo kann nach Stromaus- fällen der Netzbetrieb gefahrlos wieder aufgenom- men werden? Welche Kraftwerke

Schmid, Stefan

307

WATER ICE AND CARBON DIOXIDE ICE INTERACTIONS: CRATER INVESTIGATIONS IN RESIDUAL NORTH POLAR ICE CAP. M.A. Thueson and H. Xie, Earth and Environmental Science, The Uni-  

E-Print Network (OSTI)

Antonio, San Antonio, TX 78249, U.S.A. (misti.thueson@gmail.com) (Hongjie.xie@utsa.edu). Introduction sublimes. As summer progresses the walls of the crater, though above the temperature of CO2 sublima- tion (as seen in figure 2), keep a high albedo. This would imply that the walls are water ice. Inuvik

Texas at San Antonio, University of

308

UniReport Satzungen und Ordnungen vom 17.02.2012 1 Satzung der Johann Wolfgang Goethe-Universitt Frankfurt am Main fr das  

E-Print Network (OSTI)

, · Chemie, · Geschichte oder · einer Fremdsprache (nicht Deutsch und nicht die Sprache, in der der schriftliche Abschlussprüfungen in den Fächern · Mathematik, · Physik, · Biologie, · Chemie, · Geschichte oder · einer Fremdsprache (nicht Deutsch und nicht die Sprache, in der der Qualifikationsnachweis gefasst ist

Mester, Rudolf

309

UniReport Satzungen und Ordnungen vom 06.01.2009 Satzung der Johann Wolfgang Goethe-Universitt Frankfurt am Main fr die Auswahl von aus-  

E-Print Network (OSTI)

Hochschulzugangsberechtigung und zu 49 % aus dem Durchschnitt der Noten in Mathematik, Biologie, Chemie und Physik und Deutsch über die Deutsche Sprachprüfung für den Hochschulzugang (DSH) - ggf. das Ergebnis des fachspezifischen Anerkennung von Studienleistungen nebst An- lagen - ggf. der Nachweis über die Deutsche Sprachprüfung für den

Mester, Rudolf

310

UniReport Satzungen und Ordnungen vom 22.06.2009 1 Satzung der Johann Wolfgang Goethe-Universitt Frankfurt am Main fr das Verfahren  

E-Print Network (OSTI)

letzten vier Jahrgangsstufen in den naturwissenschaftlichen Fächern (Biologie, Chemie und Physik) undReport Satzungen und Ordnungen vom 22.06.2009 6 Chemie mit dem Abschluss Bachelor 1. Form des Antrags: Dem Antrag das Fach Biologie b) zu 24 % nach dem Ergebnis des Auswahlverfahrens für das Fach Deutsch c) zu 24

Mester, Rudolf

311

Property:Wave Direction | Open Energy Information  

Open Energy Info (EERE)

Direction Direction Jump to: navigation, search Property Name Wave Direction Property Type String Pages using the property "Wave Direction" Showing 25 pages using this property. (previous 25) (next 25) A Alden Small Flume + Uni-Directional + Alden Wave Basin + Both + C Carderock Maneuvering & Seakeeping Basin + Both + Carderock Tow Tank 2 + Uni-Directional + Carderock Tow Tank 3 + Uni-Directional + Chase Tow Tank + Uni-Directional + Coastal Harbors Modeling Facility + Uni-Directional + Coastal Inlet Model Facility + Uni-Directional + Coastal Structures Modeling Complex + Both + D Davidson Laboratory Tow Tank + Uni-Directional + DeFrees Large Wave Basin + Uni-Directional + DeFrees Small Wave Basin + Uni-Directional + H Haynes Wave Basin + Both +

312

Emotional effects of shooting activities: 'real' versus 'virtual' actions and targets  

Science Conference Proceedings (OSTI)

The results of an empirical study are presented to investigate the relationship between different action types (real versus virtual shooting) and different target types (real versus virtual targets) on the actual emotional state (well being) of the player. ... Keywords: Wolfenstein game, combat sport, emotional effect, laser tag, mood, shooting game, well-being

Matthias Rauterberg

2003-05-01T23:59:59.000Z

313

Microsoft PowerPoint - 080306_stm_amf.ppt [Kompatibilittsmodus...  

NLE Websites -- All DOE Office Websites (Extended Search)

will be studied i d t il ith Important links: COPS: www.uni-hohenheim.de, www.cops2007.de, COPS Field Report: www.uni-hohenheim.despp-iopfurtherreading...

314

State of roads : public works as research, India circa 1960  

E-Print Network (OSTI)

That the road is a symbol of the prowess of the nation-state seems tautological, a uni"ed phenomenon of political symbolism that manifests as an infrastructural network. When subjected to a close historical examination, ...

Khorakiwala, Ateya A

2009-01-01T23:59:59.000Z

315

Design of Millimeter-Wave Power Ampliers in Silicon /  

E-Print Network (OSTI)

Master of Science, Electrical and Computer Engineering, Uni-VITA Bachelor of Science, Electrical Engineering, IsfahanScience, Computer Engineering, Wrigh State Uni- versity, Dayton, OH Research/Teaching Assistant, Electrical and

Kalantari, Nader

2013-01-01T23:59:59.000Z

316

INFORMATICS ISSN 0333-3590  

E-Print Network (OSTI)

-iterative Poisson solver, Rep. 294, Stanford Uni- versity Institute for Plasma Research, 1969. [2] B. Buzbee, G

Bergen, Universitetet i

317

NONNESTED MULTIGRID METHODS IN FINITE ELEMENT LINEAR STRUCTURAL ANALYSIS  

E-Print Network (OSTI)

Departamento de Projeto Mec??anico (DPM), Faculdade de Engenharia Mec??anica (FEM), Uni­ versidade Estadual de

318

Incorporation of Furan into Low Band-Gap Polymers for ...  

and Departments of Chemistry and Chemical Engineering, UniVersity of California, Berkeley, California 94720-1460, United States

319

Optical Rotatory and Circular Dichroic Scattering Werner Kaminsky,* Morten Andreas Geday, Javier Herreros-Cedres, and Bart Kahr*  

E-Print Network (OSTI)

Herreros-Cedre´s, and Bart Kahr* Department of Chemistry, Box 351700, UniVersity of Washington, Seattle

Kaminsky, Werner

320

VIBRATION TEST VIBRPT3_S1100C_19APR2K6.doc  

E-Print Network (OSTI)

modifiche; MIL-HDBK-831 23 April 1999 Preparation of Test Reports (guidance only); UNI ­10653 ­ November

Roma "La Sapienza", Università di

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Laboratorio per lo Studio degli Effetti delle Radiazioni sui  

E-Print Network (OSTI)

modifiche; MIL-HDBK-831 23 April 1999 Preparation of Test Reports (guidance only); UNI ­10653 ­ November

Roma "La Sapienza", Università di

322

C:\\Documents and Settings\\User\\Documenti\\SERMS\\0-JOB-2009\\094-S3019R\\ENVRPT33-S3019R-9DEC2K8.doc Laboratorio per lo Studio degli  

E-Print Network (OSTI)

successive modifiche; MIL-HDBK-831 23 Aprii 1999 Preparation of Test Reports (guidance only); UNI ­10653

Roma "La Sapienza", Università di

323

Elmer C. Easton '31 '33G '65H ++ Edgar H. Howells '34 '68P* ++  

E-Print Network (OSTI)

of the City Uni- versity of New York: "What the World's Rust Belts Can Learn from North America's Great Plains

Napier, Terrence

324

com  

Science Conference Proceedings (OSTI)

... Introduction to High Performance Computing: It's not Only for Computer Scientists. Dwayne John (National Institute for Computational Science, Uni. ...

325

gyptologie Marstallhof 4  

E-Print Network (OSTI)

, Treffen: Do. 20:00 Uhr, INF 234 Raum 503 E-Mail: fsbio@uni-hd.de www.fsbio.de Chemie Raum: INF 272, Raum 402, Tel: 54-4910. Treffen: Di, 18.00 E-Mail: fs.chemie@urz.uni-heidelberg.de http://www.fs-chemie-coli@cl.uni-heidelberg.de http://www.cl.uni-heidelberg.de/fachschaft/ Deutsch als Fremdsprache Institut für Deutsch als

Heermann, Dieter W.

326

Multiband deblurring for fluid lens cameras  

E-Print Network (OSTI)

Master of Science, Electrical and Computer Engineering, Uni-xvi VITA Bachelor of Science, Electrical Engineering and

Tzeng, Jack

2010-01-01T23:59:59.000Z

327

A Retrospective Filter Trust Region Algorithm For Unconstrained ...  

E-Print Network (OSTI)

School of Mathematics Science, Suzhou University, Suzhou 215006, PR ...... partment of Electrical Engineering and Computer Science, Northwestern Uni-.

328

Universitt Regensburg Fakultt Chemie und Pharmazie  

E-Print Network (OSTI)

Universität Regensburg Fakultät Chemie und Pharmazie http://www.chemie.uni-regensburg.de Module Chemie und Pharmazie http://www.chemie.uni-regensburg.de Module Catalogue Bachelor Chemistry 15.06.2011 1 Fakultät Chemie und Pharmazie http://www.chemie.uni-regensburg.de Module Catalogue Bachelor Chemistry 15

Schubart, Christoph

329

Stand: 28.09.2011 | Angelika Tapken | diz Modulbeauftragte bzw. Lehrende, die eine Vorbereitung fr das Fachpraktikum (M. Ed.) bzw. Forschungs-und Entwicklungspraktikum anbieten  

E-Print Network (OSTI)

.hoessle@uni-oldenburg.deBiologie Steffen, Benjamin alle Lehrämter FP FEP 798-3265 benjamin.steffen@uni-oldenburg.de Chemie Michaelis, Julia alle Lehrämter FP FEP 798-3961 j.michaelis@uni-oldenburg.de Deutsch Thorsten Pohl Alle Lehrämter FP FEP

Damm, Werner

330

Phonon manipulation with phononic crystals.  

Science Conference Proceedings (OSTI)

In this work, we demonstrated engineered modification of propagation of thermal phonons, i.e. at THz frequencies, using phononic crystals. This work combined theoretical work at Sandia National Laboratories, the University of New Mexico, the University of Colorado Boulder, and Carnegie Mellon University; the MESA fabrication facilities at Sandia; and the microfabrication facilities at UNM to produce world-leading control of phonon propagation in silicon at frequencies up to 3 THz. These efforts culminated in a dramatic reduction in the thermal conductivity of silicon using phononic crystals by a factor of almost 30 as compared with the bulk value, and about 6 as compared with an unpatterned slab of the same thickness. This work represents a revolutionary advance in the engineering of thermoelectric materials for optimal, high-ZT performance. We have demonstrated the significant reduction of the thermal conductivity of silicon using phononic crystal structuring using MEMS-compatible fabrication techniques and in a planar platform that is amenable to integration with typical microelectronic systems. The measured reduction in thermal conductivity as compared to bulk silicon was about a factor of 20 in the cross-plane direction [26], and a factor of 6 in the in-plane direction. Since the electrical conductivity was only reduced by a corresponding factor of about 3 due to the removal of conductive material (i.e., porosity), and the Seebeck coefficient should remain constant as an intrinsic material property, this corresponds to an effective enhancement in ZT by a factor of 2. Given the number of papers in literature devoted to only a small, incremental change in ZT, the ability to boost the ZT of a material by a factor of 2 simply by reducing thermal conductivity is groundbreaking. The results in this work were obtained using silicon, a material that has benefitted from enormous interest in the microelectronics industry and that has a fairly large thermoelectric power factor. In addition, the techniques and scientific understanding developed in the research can be applied to a wide range of materials, with the caveat that the thermal conductivity of such a material be dominated by phonon, rather than electron, transport. In particular, this includes several thermoelectric materials with attractive properties at elevated temperatures (i.e., greater than room temperature), such as silicon germanium and silicon carbide. It is reasonable that phononic crystal patterning could be used for high-temperature thermoelectric devices using such materials, with applications in energy scavenging via waste-heat recovery and thermoelectric cooling for high-performance microelectronic circuits. The only part of the ZT picture missing in this work was the experimental measurement of the Seebeck coefficient of our phononic crystal devices. While a first-order approximation indicates that the Seebeck coefficient should not change significantly from that of bulk silicon, we were not able to actually verify this assumption within the timeframe of the project. Additionally, with regards to future high-temperature applications of this technology, we plan to measure the thermal conductivity reduction factor of our phononic crystals as elevated temperatures to confirm that it does not diminish, given that the nominal thermal conductivity of most semiconductors, including silicon, decreases with temperature above room temperature. We hope to have the opportunity to address these concerns and further advance the state-of-the-art of thermoelectric materials in future projects.

Kim Bongsang; Hopkins, Patrick Edward; Leseman, Zayd C.; Goettler, Drew F.; Su, Mehmet F. (University of New Mexico, Albuquerque, NM); El-Kady, Ihab Fathy; Reinke, Charles M.; Olsson, Roy H., III

2012-01-01T23:59:59.000Z

331

Proc. Agent 2004 Conf. on Social Dynamics : Interaction, Reflexivity and Emergence  

SciTech Connect

I'd like to welcome you to the Agent 2004 conference. As most of you are aware, this conference is the fifth in a series of meetings that began in 1999. A conference followed the next year in 2000. The 2001 conference was skipped because of some conflicts with other conferences, and the conferences have proceeded annually since then. We have the proceedings of the previous conferences available here on CDs. One CD has the proceedings from 1999, 2000, and 2002; the other contains last year's proceedings. The purpose of these conferences is to advance the state of the computational social sciences and to integrate the social sciences with the decision sciences and something that is traditionally known as the management sciences. Those of you in the operations/research area are familiar with the traditional school of modeling simulation that emerged from that scientific area. This conference will bring together a different group of people to talk about the topic of agent-based theories and simulations. This fifth agent conference is one of a group of conferences held annually around the country. Most of you are probably aware of the CASOS Conference held at Carnegie Mellon University, usually in July. UCLA holds the Arrowhead Conference, generally around May. The University of Michigan is now holding a conference as well. Of course everyone is aware of SwarmFest, which has been held annually for about a decade. The Swarm seems to 'swarm' in different locations each year. As you're well aware, this conference is organized into a three-day program. This is the first time we've used three days for the full conference setting. Last year, we held simultaneous sessions, and that didn't work well for most of those who attended. We had complaints from people who missed sessions and papers because of scheduling, so we decided to extend this year's conference by one day. As a result, we now have a program designed to present the papers in a serial sequence rather than in a parallel manner. Today, we'll focus on toolkits. Tomorrow we'll look at computational social theory, and Saturday is application day. We'll talk about how we're taking some of the theories and toolkits to look at real-world problems in order to understand how our very complex world works and maybe even to predict how it might work in the future. In addition to the content of the papers themselves, one of the more important things about this conference is the discussion that is inspired by these papers. I invite you to ask penetrating questions, offer insightful comments, share your experiences with toolkits or your ideas on theories, and help to create an atmosphere that will help this field move along and grow. It's a fairly new science--it is just emerging--but it seems to have been gaining momentum in the last couple of years. This is a conference to get your energy going and perhaps foster your creativity. With that, I welcome you to Agent 2004; have a great time at the conference.

C. M. Macal, D. Sallach, M. J. North, eds.

2004-01-01T23:59:59.000Z

332

Scientific and Technical Posters from the 2010 NETL Carbon Dioxide Capture Technology Meeting  

DOE Data Explorer (OSTI)

NETL hosted the 2010 CO2 Capture Technology Meeting on September 13-17, 2010 in Pittsburgh, PA. The Meeting provided a public forum to present carbon dioxide (CO2) capture technology development status and accomplishments made under NETL's Innovations for Existing Plants, Carbon Sequestration and Demonstration Programs. In addition, ARPA-E Program Director Mark Hartney highlighted the Agency's CO2 capture portfolio. Both ARPA-E and NETL projects were featured in the poster session, and these posters are now available online. ARPA-E posters are:

  • Low-Cost Biocatalyst for Acceleration of Energy Efficient CO2 Capture Solvents, James Lalonde (Codexis Inc.)
  • A Solvent/Membrane Hybrid Post-Combustion CO2 Capture Process for Existing Coal-Fired Power Plants, Kunlei Liu (University of Kentucky, Center for Applied Energy Research)
  • High-Throughput Discovery of Robust Metal-Organic Frameworks for Carbon Dioxide Capture, Jeffrey Long (LBNL)
  • CO2 Capture with Ionic Liquids Involving Phase Change, Joan Brennecke (Univ of Notre Dame)
  • Cryogenic Carbon Capture, Larry Baxter (Sustainable Energy Solutions, BYU)
  • Chemical and Biological Catalytic Enhancement of Weathering of Silicate Minerals as Novel Carbon Capture and Storage Technology, Edward Swanson and Tushar Patel (Columbia University)
  • CO2 Binding Organic Liquids for Post-Combustion CO2 Capture, Aqil Jamal (RTI International)
  • Development of Stimuli Responsive Metal-Organic Frameworks for Energy-Efficient Post-Combustion CO2 Capture, Hongcai Zhou (Texas A&M)
  • Electrochemically Mediated Separation for Carbon Capture and Mitigation, Fritz Simeon (MIT)
  • Phase Changing Absorbents for CO2 Capture, Teresa Grocela (GE Global Research)
  • Bio-Mimetic Catalysts for Carbon Capture with Optimized System Placement, Joshuah Stolaroff (LLNL)
  • MOF Polymer Composite Membranes for CO2 Capture From Flue Gas, David Sholl (Georgia Tech)
  • Achieving a 10,000 GPU Permenace for Post-Combustion Carbon Capture with Gelled Ionic Liquid-Based Membranes, Kathyrn A. Berchtold (LANL)
  • A High Efficiency Inertial CO2 Extraction System ICES, Vladmir Balepin (ATK)
  • Carbon Nanotube Membranes for Carbon Sequestration, Aleksandr Noy (Porifera Inc.)
  • CO2 Capture with Enzyme Synthetic Analogue, Harry Cordatos (United Technologies Research Center)
  • Resin Wafer Electrodeionization for Flue Gas Carbon Dioxide Capture, Wayne M. Carson and Jitendra T. Shah (Nalco Co.)
  • Electric Field Swing Adsorption (EFSA) for Carbon Capture Applications, David Moore and Kai Landskron (Lehigh University)
  • Pilot Scale Testing of the Syngas Chemical Looping Process, Fanxing Li (Ohio State University)

Posters featured from NETL are:

  • Lab Scale & Computational Studies of Chemical Looping Combustion (CLC) for Efficient Carbon Capture, Douglas Straub (NETL)
  • Novel Warm Gas Temperature Sorbent Development for CO2 Removal from Synthesis Gas Streams, James Fisher II (URS/NETL)
  • An Investigation into Molecular Electron Density Relationships to Amine CO2 Capture Reaction Energy, Anita Lee (Carnegie Mellon)
  • Using Hydrophobic CO2-philic Polymers to Design CO2-selective Liquid Solvents and High Permeability CO2-selective Crosslinked Membranes, Robert Enrick (University of Pittsburgh)
  • Investigation of Amino Acids for Dry Sorbents, Bingyun Li (West Virginia University)
  • Radiative Heat Transfer in Oxy-Combustion, Clint Bedick and Kent Casleton (NETL)

333

Annual Report: Carbon Capture Simulation Initiative (CCSI) (30 September 2012)  

SciTech Connect

The Carbon Capture Simulation Initiative (CCSI) is a partnership among national laboratories, industry and academic institutions that is developing and deploying state-of-the-art computational modeling and simulation tools to accelerate the commercialization of carbon capture technologies from discovery to development, demonstration, and ultimately the widespread deployment to hundreds of power plants. The CCSI Toolset will provide end users in industry with a comprehensive, integrated suite of scientifically validated models, with uncertainty quantification (UQ), optimization, risk analysis and decision making capabilities. The CCSI Toolset incorporates commercial and open-source software currently in use by industry and is also developing new software tools as necessary to fill technology gaps identified during execution of the project. Ultimately, the CCSI Toolset will (1) enable promising concepts to be more quickly identified through rapid computational screening of devices and processes; (2) reduce the time to design and troubleshoot new devices and processes; (3) quantify the technical risk in taking technology from laboratory-scale to commercial-scale; and (4) stabilize deployment costs more quickly by replacing some of the physical operational tests with virtual power plant simulations. CCSI is organized into 8 technical elements that fall under two focus areas. The first focus area (Physicochemical Models and Data) addresses the steps necessary to model and simulate the various technologies and processes needed to bring a new Carbon Capture and Storage (CCS) technology into production. The second focus area (Analysis & Software) is developing the software infrastructure to integrate the various components and implement the tools that are needed to make quantifiable decisions regarding the viability of new CCS technologies. CCSI also has an Industry Advisory Board (IAB). By working closely with industry from the inception of the project to identify industrial challenge problems, CCSI ensures that the simulation tools are developed for the carbon capture technologies of most relevance to industry. CCSI is led by the National Energy Technology Laboratory (NETL) and leverages the Department of Energy (DOE) national laboratories? core strengths in modeling and simulation, bringing together the best capabilities at NETL, Los Alamos National Laboratory (LANL), Lawrence Berkeley National Laboratory (LBNL), Lawrence Livermore National Laboratory (LLNL), and Pacific Northwest National Laboratory (PNNL). The CCSI?s industrial partners provide representation from the power generation industry, equipment manufacturers, technology providers and engineering and construction firms. The CCSI?s academic participants (Carnegie Mellon University, Princeton University, West Virginia University, and Boston University) bring unparalleled expertise in multiphase flow reactors, combustion, process synthesis and optimization, planning and scheduling, and process control techniques for energy processes. During Fiscal Year (FY) 12, CCSI released its first set of computational tools and models. This pre-release, a year ahead of the originally planned first release, is the result of intense industry interest in getting early access to the tools and the phenomenal progress of the CCSI technical team. These initial components of the CCSI Toolset provide new models and computational capabilities that will accelerate the commercial development of carbon capture technologies as well as related technologies, such as those found in the power, refining, chemicals, and gas production industries. The release consists of new tools for process synthesis and optimization to help identify promising concepts more quickly, new physics-based models of potential capture equipment and processes that will reduce the time to design and troubleshoot new systems, a framework to quantify the uncertainty of model predictions, and various enabling tools that provide new capabilities such as creating reduced order models (ROMs) from reacting multiphase flow

Miller, David C; Syamlal, Madhava; Cottrell, Roger; Kress, Joel D; Sun, Xin; Sundaresan, S; Sahinidis, Nikolaos V; Zitney, Stephen E; Bhattacharyya, D; Agarwal, Deb; Tong, Charles; Lin, Guang; Dale, Crystal; Engel, Dave; Calafiura, Paolo; Beattie, Keith

2012-09-30T23:59:59.000Z

334

Proc. Agent 2004 Conf. on Social Dynamics : Interaction, Reflexivity and Emergence  

SciTech Connect

I'd like to welcome you to the Agent 2004 conference. As most of you are aware, this conference is the fifth in a series of meetings that began in 1999. A conference followed the next year in 2000. The 2001 conference was skipped because of some conflicts with other conferences, and the conferences have proceeded annually since then. We have the proceedings of the previous conferences available here on CDs. One CD has the proceedings from 1999, 2000, and 2002; the other contains last year's proceedings. The purpose of these conferences is to advance the state of the computational social sciences and to integrate the social sciences with the decision sciences and something that is traditionally known as the management sciences. Those of you in the operations/research area are familiar with the traditional school of modeling simulation that emerged from that scientific area. This conference will bring together a different group of people to talk about the topic of agent-based theories and simulations. This fifth agent conference is one of a group of conferences held annually around the country. Most of you are probably aware of the CASOS Conference held at Carnegie Mellon University, usually in July. UCLA holds the Arrowhead Conference, generally around May. The University of Michigan is now holding a conference as well. Of course everyone is aware of SwarmFest, which has been held annually for about a decade. The Swarm seems to 'swarm' in different locations each year. As you're well aware, this conference is organized into a three-day program. This is the first time we've used three days for the full conference setting. Last year, we held simultaneous sessions, and that didn't work well for most of those who attended. We had complaints from people who missed sessions and papers because of scheduling, so we decided to extend this year's conference by one day. As a result, we now have a program designed to present the papers in a serial sequence rather than in a parallel manner. Today, we'll focus on toolkits. Tomorrow we'll look at computational social theory, and Saturday is application day. We'll talk about how we're taking some of the theories and toolkits to look at real-world problems in order to understand how our very complex world works and maybe even to predict how it might work in the future. In addition to the content of the papers themselves, one of the more important things about this conference is the discussion that is inspired by these papers. I invite you to ask penetrating questions, offer insightful comments, share your experiences with toolkits or your ideas on theories, and help to create an atmosphere that will help this field move along and grow. It's a fairly new science--it is just emerging--but it seems to have been gaining momentum in the last couple of years. This is a conference to get your energy going and perhaps foster your creativity. With that, I welcome you to Agent 2004; have a great time at the conference.

C. M. Macal, D. Sallach, M. J. North, eds.

2004-01-01T23:59:59.000Z

335

A COMPUTATIONAL WORKBENCH ENVIRONMENT FOR VIRTUAL POWER PLANT SIMULATION  

DOE Green Energy (OSTI)

In this report is described the work effort to develop and demonstrate a software framework to support advanced process simulations to evaluate the performance of advanced power systems. Integrated into the framework are a broad range of models, analysis tools, and visualization methods that can be used for the plant evaluation. The framework provides a tightly integrated problem-solving environment, with plug-and-play functionality, and includes a hierarchy of models, ranging from fast running process models to detailed reacting CFD models. The framework places no inherent limitations on the type of physics that can be modeled, numerical techniques, or programming languages used to implement the equipment models, or the type or amount of data that can be exchanged between models. Tools are provided to analyze simulation results at multiple levels of detail, ranging from simple tabular outputs to advanced solution visualization methods. All models and tools communicate in a seamless manner. The framework can be coupled to other software frameworks that provide different modeling capabilities. Three software frameworks were developed during the course of the project. The first framework focused on simulating the performance of the DOE Low Emissions Boiler System Proof of Concept facility, an advanced pulverized-coal combustion-based power plant. The second framework targeted simulating the performance of an Integrated coal Gasification Combined Cycle - Fuel Cell Turbine (IGCC-FCT) plant configuration. The coal gasifier models included both CFD and process models for the commercially dominant systems. Interfacing models to the framework was performed using VES-Open, and tests were performed to demonstrate interfacing CAPE-Open compliant models to the framework. The IGCC-FCT framework was subsequently extended to support Virtual Engineering concepts in which plant configurations can be constructed and interrogated in a three-dimensional, user-centered, interactive, immersive environment. The Virtual Engineering Framework (VEF), in effect a prototype framework, was developed through close collaboration with NETL supported research teams from Iowa State University Virtual Reality Applications Center (ISU-VRAC) and Carnegie Mellon University (CMU). The VEF is open source, compatible across systems ranging from inexpensive desktop PCs to large-scale, immersive facilities and provides support for heterogeneous distributed computing of plant simulations. The ability to compute plant economics through an interface that coupled the CMU IECM tool to the VEF was demonstrated, and the ability to couple the VEF to Aspen Plus, a commercial flowsheet modeling tool, was demonstrated. Models were interfaced to the framework using VES-Open. Tests were performed for interfacing CAPE-Open-compliant models to the framework. Where available, the developed models and plant simulations have been benchmarked against data from the open literature. The VEF has been installed at NETL. The VEF provides simulation capabilities not available in commercial simulation tools. It provides DOE engineers, scientists, and decision makers with a flexible and extensible simulation system that can be used to reduce the time, technical risk, and cost to develop the next generation of advanced, coal-fired power systems that will have low emissions and high efficiency. Furthermore, the VEF provides a common simulation system that NETL can use to help manage Advanced Power Systems Research projects, including both combustion- and gasification-based technologies.

Mike Bockelie; Dave Swensen; Martin Denison; Adel Sarofim; Connie Senior

2004-12-22T23:59:59.000Z

336

Uni Mail -40 bd du Pont-d'Arve -CH-1211 Genve 4 Tl. 022 379 87 08 -Fax 022 379 87 16 -www.unige.ch/traduction-interpretation  

E-Print Network (OSTI)

conférence sont les suivantes: A1-A2 A-B1-B2 A-C1-C2 A-Bsim* A-B-C A-C1-C2-C3 A-Bsim-C A-B-C1-C2 *La combinaison A-Bsim doit comprendre une langue de faible diffusion Langue A Langue B ou C allemand (DE) anglais

Genève, Université de

337

Tel. +49-541-969 2872/2890 -Fax. +49-541-969 1221/2262 -Email. Junge@uni-osnabrueck.de 1 Prof. Dr.-Ing. Wolfgang Junge Gutenbergstrae 36, 49076 Osnabrck  

E-Print Network (OSTI)

for Biophysics, Osnabrück 1992 95th Conference of the Deutsche Bunsengesellschaft für Physikalische Chemie, Jena Chemie Deutsche Gesellschaft für Biophysik Deutsche Gesellschaft für Naturforscher und ?rzte Gesellschaft for Biophysics Chair 1984-1985 Section "Membranes" of Gesellschaft für Biologische Chemie, Board Member 1987

Junge, Wolfgang

338

Particularits d'adoption des compteurs intelligents au Royaume-Uni et en Allemagne : entre marchs de comptage libralis et rgles mettre en place pour un rel smart grid intgr.  

E-Print Network (OSTI)

marchés de comptage libéralisé et règles à mettre en place pour un réel smart grid intégré. Association maximiser les bénéfices d'un réel smart grid intégré dans lequel les compteurs sont un élément déterminant'une des composantes majeures des réseaux électriques intelligents ou smart grids. Selon la Directive

Paris-Sud XI, Université de

339

arXiv:hep-ex/0406035v31Nov2004 Measurement of Neutrino Oscillation with KamLAND  

E-Print Network (OSTI)

with solar neutrino [10] and SN1987A data [11]. The allowed region contours in m2 -tan2 parameter space.9+0.6 -0.5?10-5 eV2 . A global analysis of data from KamLAND and solar neutrino experiments yields m2 = 7] suggested that solar neutrino flavor transformation through the Mikheyev-Smirnov-Wolfenstein (MSW) [2

Learned, John

340

Fachschaft Chemie und Wirtschaftschemie  

E-Print Network (OSTI)

Fachschaft Chemie und Wirtschaftschemie Albert-Einstein-Allee 11 c/o AStA Uni Ulm 89081 Ulm Tel: +49 731 50-22407 Fax: +49 731 50-22403 E-Mail: fs-chemie@uni-ulm.de Universität Ulm Albert-Einstein-Allee 11 · 89081 Ulm · www.uni-ulm.de Prof.Dr. Gerhard Maas Institut für Organische Chemie I Albert

Pfeifer, Holger

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

JOURNAL OF GEOPHYSICAL RESEARCH, VOL. 102,NO. B3, PAGES 5281-5293, MARCH 10, 1997 Quantitative implementation of Preisach-Mayergoyz  

E-Print Network (OSTI)

Astronomy, Uni- versity of Massachusetts,Amherst, MA 01003. (e-mMl: rag@cmp.phast.umass.edu) L. B. Hilbert

342

View / Download - TMS  

Science Conference Proceedings (OSTI)

ics from the Pennsylvania State Uni- versity in 1952. Ruth's career took him ... ers into solar cell technology. He orga- nized several scientific conferences,.

343

c 2006 Nonlinear Phenomena in Complex Systems On cytoskeletal patterns and intrinsic disorder effects  

E-Print Network (OSTI)

.Zimmermann@uni-bayreuth.de 2 Theoretical Physics, University of the Saarland, D-66041, Saarbr¨ucken, Germany E-mail: maham

Schmidt, Matthias

344

UES - Commercial Energy Efficiency Rebate Program (Gas Customers...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Type Utility Rebate Program Rebate Amount Furnaces: 200 - 350 Water Heaters: 200 Boilers: 250100,000 Btu Griddles: 300 UniSource Energy Services (UES) offers the...

345

Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

& Electronics Water Heating Windows, Doors, & Skylights UniSource Residential Energy Solutions Western Interstate Nuclear Compact State Nuclear Policy (Multiple States) Arizona...

346

FT-IR Microspectroscopy and Multivariate Statistics on Plant ...  

Science Conference Proceedings (OSTI)

... The model system chosen for this study was the uni-cellular algae, chlorella.pyrenoidosa, which was found to be sensitive to many of the same ...

347

INTEGER-EMPTY POLYTOPES IN THE 0/1-CUBE WITH MAXIMAL ...  

E-Print Network (OSTI)

Dec 13, 2010... FRIEDRICH-ALEXANDER-UNIVERSITT ERLANGEN-NRNBERG, GERMANY. E-mail address: sebastian.pokutta@math.uni-erlangen.de.

348

ESS 2012 Peer Review - Advanced Membranes for VRFB - Cy Fujimoto...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and UniEnergy Technologies * Separation of energy and power * At the electrodes only electron transport is occurs. Allows for deep discharge, long life cycles and little capacity...

349

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

350

A Facile and Patternable Method for the Surface Modification of ...  

College of Chemistry and Department of Physics, UniVersity of California, Berkeley, California 94720-1460, and Materials Sciences DiVision, ...

351

Conquering Women: Women and War in the German Cultural Imagination  

E-Print Network (OSTI)

Reporting of Rape in Bosnia-Herzegovina, 1992-93, raisedWar Against Women in Bosnia-Herzegovina (Omaha: Uni- versitythe conflict in Bosnia- Herzegovina. Feminist philosophers,

Sy-Quia, Hilary Collier; Baackmann, Susanne

2000-01-01T23:59:59.000Z

352

The Reflective Mind: An Alternative Approach to Animal Cognition  

E-Print Network (OSTI)

of Psychology, State New York at Albany, Albany, NY 12222,ethics. Albany: State Uni- versity of New York Press. &standard New embedded Gallup, YoriAlbany

Gallup, Jr., Gordon G

1992-01-01T23:59:59.000Z

353

Joint Session with Computational Discovery of Novel Materials  

Science Conference Proceedings (OSTI)

Mar 5, 2013 ... Crystal Structure Prediction with the Minima Hopping Method: Stefan Goedecker 1; 1UNI Basel Given the fact that materials have in general an...

354

Credits and Acknowledgements  

NLE Websites -- All DOE Office Websites (Extended Search)

Hilfe von James Quinn. Weitere Verdankungen: Mitarbeiter der Particle Data Group am LBNL, insbesondere Betty Armstrong. Deutsche bersetzung: Henry Mhry, Uni Basel, 2001...

355

Mulitdimensional reactive transport modeling of CO2 minreal sequestration in basalts at the Helllisheidi geothermal field, Iceland  

E-Print Network (OSTI)

P. , 2004. ICEBOX. Geothermal Reservoir Engineering SoftwareUnited Nations Uni- versity Geothermal Training Programme,H. , 1982. The chemistry of geothermal waters in Iceland. I.

Aradottir, E.S.P.

2013-01-01T23:59:59.000Z

356

3-D Materials Science using Polychromatic Synchrotron X-Ray ...  

Science Conference Proceedings (OSTI)

... beamline with submicron spatial resolution at the Advanced Photon Source. ... Sciences and Engineering Division; UNI-XOR support at APS by DOE-BES.

357

READ  

Science Conference Proceedings (OSTI)

development. He earned his Ph.D. in MSE at Penn State, after receiving a master's and bachelor's degree from Pusan National Uni- versity, Korea. Cong Wang.

358

Attnuation naturelle potentielle de BTEX en aquifre de stockage de gaz.  

E-Print Network (OSTI)

??La France est dpendante en gaz naturel dont elle importe 98% de sa consommation. Comme pour plusieurs autres pays (Etats-Unis, Canada, Grande Bretagne, Autriche, Allemagne, (more)

Allo, Thomas

2013-01-01T23:59:59.000Z

359

NANO LETTERS Molecular Characterization of the Cytotoxic ...  

Department of Chemistry, UniVersity of Kentucky, Lexington, Kentucky 40506-0055, Affymetrix Inc., 3380 Central Expressway, Santa Clara, California ...

360

IFRF Combustion Journal Article Number 200303, July 2003  

E-Print Network (OSTI)

IFRF Combustion Journal Article Number 200303, July 2003 ISSN 1562-479X Waste Incineration European-mail: klaus.goerner@uni-essen.den URL: http://www.luat.uni-essen.de #12;IFRF Combustion Journal - 2 - Goerner the lower calorific value of normal municipal waste increased with the consequence of increasing combustion

Columbia University

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Masterstudium an der Ernst-Moritz-Arndt-Universitt Greifswald  

E-Print Network (OSTI)

konsekutiv 4 Semester WS/SS M.A. Germanistische Literaturwissenschaft www.phil.uni-greifswald.de/philologien/deutsch Master of Science (M.Sc.) M.Sc. Biochemie www.chemie.uni-greifswald.de/Studium.html Ansprechpartnerin Chemie, Biolo- gie, Biotechnologie, Molekulare Medizin oder Bioinformatik offen, sofern erkennbar ist

Greifswald, Ernst-Moritz-Arndt-Universität

362

Manahmen fr MS Windows Betriebssysteme Gerd Hofmann  

E-Print Network (OSTI)

Ma?nahmen für MS Windows Betriebssysteme Gerd Hofmann IT-Sicherheitsforum - Betriebssystemsicherheit 24. Juni 2004 #12;24.06.04 gerd.hofmann@rrze.uni-erlangen.de 2Windows Sicherheit Vorstellung Gerd-85-28920 RRZE: Raum RZ 2.013 #12;24.06.04 gerd.hofmann@rrze.uni-erlangen.de 3Windows Sicherheit Inhaltsliste

Fiebig, Peter

363

Explorer-II: Wireless Self-Powered Visual and NDE Robotic Inspection System for Live Gas Distribution Mains  

SciTech Connect

Carnegie Mellon University (CMU) under contract from Department of Energy/National Energy Technology Laboratory (DoE/NETL) and co-funding from the Northeast Gas Association (NGA), has completed the overall system design, field-trial and Magnetic Flux Leakage (MFL) sensor evaluation program for the next-generation Explorer-II (X-II) live gas main Non-destructive Evaluation (NDE) and visual inspection robot platform. The design is based on the Explorer-I prototype which was built and field-tested under a prior (also DoE- and NGA co-funded) program, and served as the validation that self-powered robots under wireless control could access and navigate live natural gas distribution mains. The X-II system design ({approx}8 ft. and 66 lbs.) was heavily based on the X-I design, yet was substantially expanded to allow the addition of NDE sensor systems (while retaining its visual inspection capability), making it a modular system, and expanding its ability to operate at pressures up to 750 psig (high-pressure and unpiggable steel-pipe distribution mains). A new electronics architecture and on-board software kernel were added to again improve system performance. A locating sonde system was integrated to allow for absolute position-referencing during inspection (coupled with external differential GPS) and emergency-locating. The power system was upgraded to utilize lithium-based battery-cells for an increase in mission-time. The resulting robot-train system with CAD renderings of the individual modules. The system architecture now relies on a dual set of end camera-modules to house the 32-bit processors (Single-Board Computer or SBC) as well as the imaging and wireless (off-board) and CAN-based (on-board) communication hardware and software systems (as well as the sonde-coil and -electronics). The drive-module (2 ea.) are still responsible for bracing (and centering) to drive in push/pull fashion the robot train into and through the pipes and obstacles. The steering modules and their arrangement, still allow the robot to configure itself to perform any-angle (up to 90 deg) turns in any orientation (incl. vertical), and enable the live launching and recovery of the system using custom fittings and a (to be developed) launch-chamber/-tube. The battery modules are used to power the system, by providing power to the robot's bus. The support modules perform the functions of centration for the rest of the train as well as odometry pickups using incremental encoding schemes. The electronics architecture is based on a distributed (8-bit) microprocessor architecture (at least 1 in ea. module) communicating to a (one of two) 32-bit SBC, which manages all video-processing, posture and motion control as well as CAN and wireless communications. The operator controls the entire system from an off-board (laptop) controller, which is in constant wireless communication with the robot train in the pipe. The sensor modules collect data and forward it to the robot operator computer (via the CAN-wireless communications chain), who then transfers it to a dedicated NDE data-storage and post-processing computer for further (real-time or off-line) analysis. The prototype robot system was built and tested indoors and outdoors, outfitted with a Remote-Field Eddy Current (RFEC) sensor integrated as its main NDE sensor modality. An angled launcher, allowing for live launching and retrieval, was also built to suit custom angled launch-fittings from TDW. The prototype vehicle and launcher systems are shown. The complete system, including the in-pipe robot train, launcher, integrated NDE-sensor and real-time video and control console and NDE-data collection and -processing and real-time display, were demonstrated to all sponsors prior to proceeding into final field-trials--the individual components and setting for said acceptance demonstration are shown. The launcher-tube was also used to verify that the vehicle system is capable of operating in high-pressure environments, and is safely deployable using proper evacuating/purging techniques for operation in the po

Carnegie Mellon University

2008-09-30T23:59:59.000Z

364

Wireless Self-powered Visual and NDE Robotic Inspection System for Live Gas Distribution Mains  

SciTech Connect

Carnegie Mellon University (CMU) under contract from Department of Energy/National Energy Technology Laboratory (DoE/NETL) and co-funding from the Northeast Gas Association (NGA), has completed the overall system design of the next-generation Explorer-II (X-II) live gas main NDE and visual inspection robot platform. The design is based on the Explorer-I prototype which was built and field-tested under a prior (also DoE- and NGA co-funded) program, and served as the validation that self-powered robots under wireless control could access and navigate live natural gas distribution mains. The X-II system design ({approx}8 ft. and 66 lbs.) was heavily based on the X-I design, yet was substantially expanded to allow the addition of NDE sensor systems (while retaining its visual inspection capability), making it a modular system, and expanding its ability to operate at pressures up to 750 psig (high-pressure and unpiggable steel-pipe distribution mains). A new electronics architecture and on-board software kernel were added to again improve system performance. A locating sonde system was integrated to allow for absolute position-referencing during inspection (coupled with external differential GPS) and emergency-locating. The power system was upgraded to utilize lithium-based battery-cells for an increase in mission-time. The system architecture now relies on a dual set of end camera-modules to house the 32-bit processors (Single-Board Computer or SBC) as well as the imaging and wireless (off-board) and CAN-based (on-board) communication hardware and software systems (as well as the sonde-coil and -electronics). The drive-module (2 ea.) are still responsible for bracing (and centering) to drive in push/pull fashion the robot train into and through the pipes and obstacles. The steering modules and their arrangement, still allow the robot to configure itself to perform any-angle (up to 90 deg) turns in any orientation (incl. vertical), and enable the live launching and recovery of the system using custom fittings and a (to be developed) launch-chamber/-tube. The battery modules are used to power the system, by providing power to the robot's bus. The support modules perform the functions of centration for the rest of the train as well as odometry pickups using incremental encoding schemes. The electronics architecture is based on a distributed (8-bit) microprocessor architecture (at least 1 in ea. module) communicating to a (one of two) 32-bit SBC, which manages all video-processing, posture and motion control as well as CAN and wireless communications. The operator controls the entire system from an off-board (laptop) controller, which is in constant wireless communication with the robot train in the pipe. The sensor modules collect data and forward it to the robot operator computer (via the CAN-wireless communications chain), who then transfers it to a dedicated NDE data-storage and post-processing computer for further (real-time or off-line) analysis. CMU has fully designed every module in terms of the mechanical, electrical and software elements (architecture only). Substantial effort has gone into pre-prototyping to uncover mechanical, electrical and software issues for critical elements of the design. Design requirements for sensor-providers were also detailed and finalized and provided to them for inclusion in their designs. CMU is expecting to start 2006 with a detailed design effort for both mechanical and electrical components, followed by procurement and fabrication efforts in late winter/spring 2006. The assembly and integration efforts will occupy all of the spring and summer of 2006. Software development will also be a major effort in 2006, and will result in porting and debugging of code on the module- and train-levels in late summer and Fall of 2006. Final pipe mock-up testing is expected in late fall and early winter 2006 with an acceptance demonstration of the robot train (with a sensor-module mock-up) planned to DoE/NGA towards the end of 2006.

Susan Burkett; Hagen Schempf

2006-01-31T23:59:59.000Z

365
366

Chemie und Pharmazie Hittorfstrasse 58-62 | 48149 Mnster  

E-Print Network (OSTI)

Chemie und Pharmazie Hittorfstrasse 58-62 | 48149 Münster dekancp@uni-muenster.de AUSSCHREIBUNG STIPENDIENPROGRAMM Zum Wintersemester 2013/14 werden am Fachbereich 12, Chemie und Pharmazie, Pro

Hinrichs, Klaus

367

GROTHENDIECK INEQUALITIES FOR SEMIDEFINITE PROGRAMS ...  

E-Print Network (OSTI)

Nov 4, 2010 ... first appeared in the work [17] of Grothendieck on the metric theory of tensor .... field, the total energy of the system is given by the Hamiltonian. H = ? ...... Summing and Nuclear Norms in Banach Space Theory, Cambridge Uni-.

368

Carbon Molecular Sieve Membrane as a True One Box Unit for Large...  

NLE Websites -- All DOE Office Websites (Extended Search)

one box uniT for large-SCale Hydrogen ProduCTion Description A potential approach to U.S. energy independence is the use of its abundant coal reserves. These coal reserves may be...

369

Development Languages and Environment  

E-Print Network (OSTI)

It combines many of the best features of the standard UNiX working environment like C, sed, awk, csh and sh. Similar to sh and csh, it is used as a scripting...

370

2013Supelcowinner  

Science Conference Proceedings (OSTI)

z FOR IMMEDIATE RELEASE March 12, 2013 SUPELCO/Nicholas Pelick AOCS Research Award Urbana, Illinois, USA The AOCS is pleased to announce that Nissim Garti, Professor, The Hebrew Uni

371

Folie 1  

Science Conference Proceedings (OSTI)

Omega-3 Index for Heart Health Prof. Dr. C. von Schacky, FAHA, FESC Preventive Cardiology Medizinische Klinik und Poliklinik I Ludwig Maximilians-Universitt Mnchen Clemens.vonSchacky@med.uni-muenchen.de and Omegametrix, Martinsried

372

Extensional rheology of bread dough  

E-Print Network (OSTI)

We investigated the extensional properties of wheat flour dough on the Filament Stretching Rheometer (FISER), in which the sample approaches uniform uni-axial extension flow at a constant strain rate over a large portion ...

Ng, Shen Kuan (Trevor Shen Kuan)

2006-01-01T23:59:59.000Z

373

ZTE Unified Platform Cryptographic Library Version 1.1 FIPS ...  

Science Conference Proceedings (OSTI)

... BSC ,ZXWN HLR,ZXWN MSCS,ZXC10 MSCe,ZXUN Mss,ZXUN MGW,ZXUN iLIG,ZXC10 HLRe,ZXC10 FLR,ZXC10 OTAFe,ZXUN HSS,ZXUN UniA ...

2011-08-09T23:59:59.000Z

374

Colloids and Surfaces A: Physicochemical and Engineering Aspects 174 (2000) 403410  

E-Print Network (OSTI)

, Peking Uni6ersity, Beijing 100871, PR China Received 3 January 2000; accepted 15 May 2000 Keywords in both theoretics and appli- cations. It is well known that many drugs are insoluble in water but soluble

Huang, Jianbin

375

UES (Electric)- Residential Efficiency Program (Arizona)  

Energy.gov (U.S. Department of Energy (DOE))

UniSource Energy Services (UES) offers rebates to electric customers for the installation of air conditioners and heat pumps, as well as offering gas customers incentives on energy efficient...

376

OBSERVATION AND STUDY OF GeV SOLAR ENERGETIC PARTICLES USING THE MILAGRITO EXTENSIVE AIR SHOWER DETECTOR  

E-Print Network (OSTI)

Pro- fessor and Director of the Geothermal Institute, Uni- versity of Auckland, New Zealand (Dr. The Board does not take the position that one or more of these alternatives is superior to the reference

California at Santa Cruz, University of

377

Simulation of the vacuum assisted resin transfer molding (VARTM) process and the development of light-weight composite bridging  

E-Print Network (OSTI)

fibers to hold the carbon fiber tows together. Photographsmm) Uni Triax Carbon Percent by Weight Fiber Type/Size FiberT 700 Filler Fiber NA C2-WCL Winding Carbon B T 700 NA C3-WE

Robinson, Marc J.

2008-01-01T23:59:59.000Z

378

Trajectory generationinhigh-speed,high-precisionmicromillingusing subdivision curves  

E-Print Network (OSTI)

uni- form, rational, b-spline (NURBS) curves. It is criticalCNC tool path in terms of B-spline curves, Computer-AidedClark, Recursively generated b-spline surface on arbitrary

Vijayaraghavan, Athulan; Sodemann, Angela; Hoover, Aaron; Mayor, J.Rhett; Dornfeld, David

2009-01-01T23:59:59.000Z

379

Mensen und Cafeterias der Universitt Bern Ist Ihr (Wissens)durst noch nicht gestillt? Gnnen Sie sich eine kulinarische Pause!  

E-Print Network (OSTI)

Mensen und Cafeterias der Universität Bern Ist Ihr (Wissens)durst noch nicht gestillt? Gönnen Sie Unitobler Gesellschaftsstr. 2 Chemie Vetsuisse Uni Engehalde Hunger, Durst? Pause? Auftanken? Sehen und

Richner, Heinz

380

Apparatus for investigation of evaporation at free liquidvapour interfaces  

E-Print Network (OSTI)

a , F. Durst a,*, C.A. Ward a,b a Institute of Fluid Mechanics, University of Erlangen 29501; fax: +49 9131 85 29503. E-mail address: durst@lstm.uni-erlangen.de (F. Durst). International

Ward, Charles A.

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Les discours sportifs en proie aux nationalismes et l'ethnicisation.  

E-Print Network (OSTI)

??Ce travail a pour objet d'e?tudier les discours sportifs et leurs rapports avec la notion d'identite? a? partir d'un corpus me?diatique re?uni autour de deux (more)

Richard, Arnaud

2009-01-01T23:59:59.000Z

382

1 Introduction - Optimization Online  

E-Print Network (OSTI)

Olshausenstr 40, 24098 Kiel, Germany, horbach@bwl.uni-kiel.de. Abstract. The k -traveling salesman problem, or k-TSP is: given a graph with edge weights and...

383

Andreas Wagner  

NLE Websites -- All DOE Office Websites (Extended Search)

Wagner Professor University of Karlsruhe, Germany wagner@fbta.uni-karlsruhe This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links...

384

"Now Dead I Begin to Sing": A Protohistoric Clothes-Burning Ceremonial Feature in the Colorado Desert  

E-Print Network (OSTI)

D. 1965 Warriors of the Colorado. Norman: Uni- versity of1861 Report Upon the Colorado River of the West. Washington:Research in the Colorado Desert: Recent Approaches and

Schaefer, Jerry

2000-01-01T23:59:59.000Z

385

Effect of Additives on LiMo3Se3 Nanowire Film Chemical Sensors Xiubin Qi, Frank E. Osterloh,*, J. A. Giacomo, and S. Chiang*,  

E-Print Network (OSTI)

. Giacomo, and S. Chiang*, Departments of Chemistry and Physics, UniVersity of California, 1 Shields AVenue, Frank E.; Barriga, S. A.; Giacomo, J. A.; Chiang, S. Anal. Chem. 2006, 78, 1306-1311. Figure 1. (a) TEM

Chiang, Shirley

386

Mixco: Killwa Texts: "When I Have Donned My Crest of Stars;" and Mixco: Killwa Dictionary  

E-Print Network (OSTI)

a strip of land lOUwa Dictionary. Mauricio J. Mixco. Uni- inand a lexicon or dictionary. With the from participants, aretexts include myths and dictionary), Mixco has discharged

Fowler, Catherine S

1987-01-01T23:59:59.000Z

387

Lowest-rank Solutions of Continuous and Discrete Lyapunov ...  

E-Print Network (OSTI)

fundamental matrix equations and play an significant role in control theory ... Jiyuan Tao is with Department of Mathematics and Statistics, Loyola Uni- ...... [2] P. Benner, Control Theory, Handbook of Linear Algebra, Chapman &. Hall/CRC...

388

State-of-the-art automated process simulation systems  

Science Conference Proceedings (OSTI)

The control and engineering tasks accomplished with the help of automated process simulation systems are described. The practical solution examples are cited. The UniSim Design system, providing modeling of all stages of production cycle, is described.

V. M. Dozortsev; E. Yu. Kreidlin

2010-09-01T23:59:59.000Z

389

TeachMeet: Librarians learning from each other.  

E-Print Network (OSTI)

the following topics: ? Library inductions using the Cephalonian method ? Some informal Facebook research ? 'Getting them early': database training in inductions ? Prezi: an improvement on Powerpoint? ? From School to Uni: transition skills ? Adobe Captivate...

Tumelty, Niamh; Kuhn, Isla; Birkwood, Katie

2012-01-01T23:59:59.000Z

390

The Impact of Forced Air System Blowers on Furnace Performance...  

NLE Websites -- All DOE Office Websites (Extended Search)

Canadian provinces and part owner of UNIES Ltd., an engineering firm in Winnipeg, Manitoba (60 miles straight north of the North DakotaMinnesota border). He does research and...

391

Bert Phillips  

NLE Websites -- All DOE Office Websites (Extended Search)

Canadian provinces and part owner of UNIES Ltd., an engineering firm in Winnipeg, Manitoba (60 miles straight north of the North DakotaMinnesota border).He does research and...

392

World Sheet Commuting beta-gamma CFT and Non-Relativistic String Theories  

E-Print Network (OSTI)

Cosmolog- ical uni?cation of string theories, arXiv:hep-landscape of supercritical string theory, arXiv:0705.0980 [invariance, supersymmetry and string theory, Nucl. Phys.

Kim, Bom Soo

2008-01-01T23:59:59.000Z

393

Information und Auskunft: UdS, FR Chemie, 0681/302-70650  

E-Print Network (OSTI)

Information und Auskunft: UdS, FR Chemie, 0681/302-70650 kickelbick@mx.uni-saarland.de LHS, Amt für GEHT OHNE SIE }?ffentliche Ringvorlesung zum internationalen Jahr der Chemie Mittwochs, 19:00 Uhr Haus der Zukunft Saarbrücken Richard-Wagner-Str. 14 -16 Wintersemester 2011/12 www.uni-saarland.de/alles-chemie

Mayberry, Marty

394

Technical Report CSPOZ: A Combination of ObjectZ and CSP  

E-Print Network (OSTI)

Technical Report CSP­OZ: A Combination of Object­Z and CSP TRCF­97­2 Clemens Fischer University@informatik.uni­oldenburg.de Date: April 30, 1997 Document Id: TRCF­97­2 #12; #12; CSP­OZ: A Combination of Object­Z and CSP Clemens­mail: Fischer@Informatik.Uni­Oldenburg.de Abstract In this paper we define a combination of Object­Z and CSP

Habel, Annegret

395

Large deviation principles for the stochastic quasigeostrophic equations  

E-Print Network (OSTI)

, University of Bielefeld, D­33615 Bielefeld, Germany E­mail: weiliu@math.uni­bielefeld.de Michael R@mathematik.uni­bielefeld.de Xiang­Chan Zhu School of Science, Beijing Jiaotong University, Beijing 100044, China Department­geostrophic equation in the periodic domain T 2 = R 2 /(2#Z) 2 : ##(t, x) #t = - (t, x) · ##(t, x) - (-#) # #(t, x

Moeller, Ralf

396

Direct DNA Photocleavage by a New Intercalating Dirhodium(II/II) Complex: Comparison to Rh2(-O2CCH3)4  

E-Print Network (OSTI)

.; Akiyama, S.-I.; Pommier, Y. Mol. Cancer Ther. 2002, 1, 1327- 1334. (b) Sodet, O.; Khan, Q. A.; Kohn, K. W-Cancer Agents 2002, 2, 387-401. (3) (a) Kanzaki, A.; Takebayashi, Y.; Ren, X.-Q.; Miyashita, H.; Mori, S of Chemistry, The Ohio State UniVersity, Columbus, Ohio 43210, and Texas A&M UniVersity, College Station, Texas

Turro, Claudia

397

Windows NT/2000/XP Sicherheits-Check RRZE, G. Hofmann 1/1 23.06.2004  

E-Print Network (OSTI)

Windows NT/2000/XP Sicherheits-Check RRZE, G. Hofmann 1/1 23.06.2004 Stand: 23.Juni 2004, Gerd://www.rrze.uni-erlangen.de/hilfe/security/patches.shtml · Aktuellste Hotfixes (fausus.exe) http://www.rrze.uni-erlangen.de/dienste/arbeiten-rechnen/windows/fausus.shtml · Internet-Explorer Hotfixes (Windows-Update) http://windowsupdate.microsoft.com · Virenscanner (06

Fiebig, Peter

398

Proceedings of the 5th ISES Europe Solar Conf., Freiburg (2004), vol. 2 591 Solar utilisation in low-energy buildings  

E-Print Network (OSTI)

and Solar Energy Walter-Flex-Str. 3, D-57068 Siegen, Germany http://nesa1.uni-siegen.de, e-mail: heidt@physik.uni-siegen.de Abstract For low-energy buildings, passive solar gains can contribute significantly to the heat bal- ance losses, the energy flux through the glazing of windows is denoted as "passive solar gains". In low-energy

Gieseler, Udo D. J.

399

TeachMeet - librarians learning from each other  

E-Print Network (OSTI)

using the Cephalonian method Some informal facebook research 'Getting them early': database training in inductions Prezi: an improvement on Powerpoint? 2 minute nano-presentations: From School to Uni transition skills Adobe Captivate video tutorials... method o Some informal facebook research o 'Getting them early': database training in inductions o Prezi: an improvement on Powerpoint? ? 2 minute nano-presentations: o From School to Uni transition skills o Adobe Captivate video tutorials o The new LAT...

Kuhn, Isla; Barker, Chris; Birkwood, Katie; Carty, Celine; Tumelty, Niamh

2011-04-29T23:59:59.000Z

400

2010veranstaltungenwww.lmu.de/aktuelles/veranstaltungen Herausgeber  

E-Print Network (OSTI)

Fakultät für Chemie und Pharmazie Buchner-Hörsaal Butenandtstr. 5-13 81377 München VeranstaLter DeutscheHreibung Vortragender: Dr. Peter Kramper (Albert-Ludwigs-Uni- versität Freiburg) termin & ort 16:30 Uhr Deutsches Museum Department für Chemie Tel.: 089 / 2180­77426 E-Mail: klk@cup.uni-muenchen.de www

Kersting, Roland

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

For The Calvert Cliffs Combined License Application  

E-Print Network (OSTI)

The purpose of this letter is to respond to the requests for additional information (RAIs) identified in the NRC letter to UniStar dated February 3, 2009 (Reference 1). The RAIs address figures needed to publish the environmental impact statement (EIS) and information necessary for completion of regulatory reviews. UniStar Regulatory Affairs staff, UniStar vendors for the Calvert Cliffs Nuclear Power Plant Unit 3 (CCNPP3) project, NRC headquarters staff, and NRC contractors supporting review of the CCNPP3 Combined License Application (COLA) environmental report discussed the scope of the RAIs (Reference 1) during four telephone conferences on February 13, 18, 19, and 24. The discussions focused on how UniStar can provide the NRC with graphics needed to develop the CCNPP3 Draft EIS and necessary additional details of environmental reviews performed by UniStar. The telephone conferences resulted in a common understanding of the NRC requests and how UniStar can provide the needed information (Reference 2).UN#09-1140 Page 2 of 2 The NRC staff agreed that certain information regarding alternate sites is available in the

unknown authors

2009-01-01T23:59:59.000Z

402

Large Extra Dimensions, Sterile Neutrinos and Solar Neutrino Data  

Science Conference Proceedings (OSTI)

Solar, atmospheric, and LSND neutrino oscillation results require a light sterile neutrino, {nu}{sub B} , which can exist in the bulk of extra dimensions. Solar {nu}{sub e} , confined to the brane, can oscillate in the vacuum to the zero mode of {nu}{sub B} and via successive Mikheyev-Smirnov-Wolfenstein transitions to Kaluza-Klein states of {nu}{sub B} . This new way to fit solar data is provided by both low and intermediate string scale models. From average rates seen in the three types of solar experiments, the Super-Kamiokande spectrum is predicted with 73% probability, but dips characteristic of the 0.06 mm extra dimension should be seen in the SNO spectrum.

Caldwell, D. O.; Mohapatra, R. N.; Yellin, S. J.

2001-07-23T23:59:59.000Z

403

Neutrino Magnetic Moments, Flavor Mixing, and the Super-Kamiokande Solar Data  

Science Conference Proceedings (OSTI)

We find that magnetic neutrino-electron scattering is unaffected by oscillations for vacuum mixing of Dirac neutrinos with only diagonal moments and for Majorana neutrinos with two flavors. For Mikheyev-Smirnov-Wolfenstein mixing, these cases are again obtained, though the effective moments can depend on the neutrino energy. Thus, e.g., the magnetic moments measured with {nu}(bar sign){sub e} from a reactor and {nu}{sub e} from the Sun could be different. With minimal assumptions, we find a new limit on {mu}{sub {nu}} using the 825-d Super-Kamiokande solar neutrino data: |{mu}{sub {nu}}|{<=}1.5x10{sup -} {sup 10}{mu}{sub B} at 90% CL, comparable to the existing reactor limit. (c) 1999 The American Physical Society.

Beacom, J. F.; Vogel, P.

1999-12-20T23:59:59.000Z

404

Two-Nucleon Scattering without partial waves using a momentum space Argonne V18 interaction  

E-Print Network (OSTI)

We test the operator form of the Fourier transform of the Argonne V18 potential by computing selected scattering observables and all Wolfenstein parameters for a variety of energies. These are compared to the GW-DAC database and to partial wave calculations. We represent the interaction and transition operators as expansions in a spin-momentum basis. In this representation the Lippmann-Schwinger equation becomes a six channel integral equation in two variables. Our calculations use different numbers of spin-momentum basis elements to represent the on- and off-shell transition operators. This is because different numbers of independent spin-momentum basis elements are required to expand the on- and off-shell transition operators. The choice of on and off-shell spin-momentum basis elements is made so that the coefficients of the on-shell spin-momentum basis vectors are simply related to the corresponding off-shell coefficients.

S. Veerasamy; Ch. Elster; W. N. Polyzou

2012-06-21T23:59:59.000Z

405

Day-night asymmetry of high and low energy solar neutrino events in Super-Kamiokande and in the Sudbury Neutrino Observatory  

E-Print Network (OSTI)

In the context of solar neutrino oscillations among active states, we briefly discuss the current likelihood of Mikheyev-Smirnov-Wolfenstein (MSW) solutions to the solar neutrino problem, which appear to be currently favored at large mixing, where small Earth regeneration effects might still be observable in Super-Kamiokande (SK) and in the Sudbury Neutrino Observatory (SNO). We point out that, since such effects are larger at high (low) solar neutrino energies for high (low) values of the mass square difference \\delta m^2, it may be useful to split the night-day rate asymmetry in two separate energy ranges. We show that the difference \\Delta of the night-day asymmetry at high and low energy may help to discriminate the two large-mixing solutions at low and high \\delta m^2 through a sign test, both in SK and in SNO, provided that the sensitivity to \\Delta can reach the (sub)percent level.

G. L. Fogli; E. Lisi; D. Montanino; A. Palazzo

2000-08-01T23:59:59.000Z

406

Low Cost Thin Film Building-Integrated PV Systems: Cooperative Research and Development Final Report, CRADA Number CRD-07-239  

DOE Green Energy (OSTI)

In this CRADA, NREL's Silicon group members performed the following research activities: (1) investigation of the role of hydrogen in growth of a mixed-phase nc-Si:H/a-Si:H material; (2) role of hydrogen in light-induced degradation of a-Si:H and development of Staebler-Wronski effect resistive a-Si:H; and (3) performing characterizations of UniSolar's a-Si:H and nc-Si materials, with goal to help optimizing large-area uniformity and quality of the UniSolar's nanocrystalline Si:H.

Stradins, P.

2011-10-01T23:59:59.000Z

407

Stand 11/2011 Ohne Gewhr. Mageblich ist die jeweils gltige Prfungsordnung. Es knnen sich noch nderungen ergeben! Chemie -Lehramt an Gymnasien  

E-Print Network (OSTI)

?nderungen ergeben! Chemie - Lehramt an Gymnasien Naturwissenschaften Kurzinformation zu den ,,neuen" Lehramtsstudiengängen (Studienbeginn ab WS 2010/2011) Anschrift Fakultät 3: Chemie Pfaffenwaldring 55, Zimmer 7. OG 70569 Stuttgart Tel.: 0711/685-64584 oder - 64585 Fax: 0711/685-64045 URL Fakultät www.uni-stuttgart.de/chemie

Möbius, Bernd

408

FACH-Fachschaft Chemie und Wirtschaftschemie  

E-Print Network (OSTI)

FACH-Fachschaft Chemie und Wirtschaftschemie Ulm e.V. FACH-Fachschaft Chemie und Wirtschaftschemie: +49 731/50-22407 Fax: +49 731/50-22403 fs-chemie@uni-ulm.de Protokoll der 5. Mitgliederversammlung des FACH-Fachschaft Chemie und Wirtschaftschemie Ulm e.V. Sitzungsort: Universit¨at Ulm O27 131 Datum der

Pfeifer, Holger

409

Ringvorlesung Sommersemester 2011 RNA im Jahr der (Bio-)Chemie  

E-Print Network (OSTI)

Seite 9 Ringvorlesung Sommersemester 2011 RNA im Jahr der (Bio-)Chemie Mittwoch, 22. 06. 2011, 17:00 bis 18:00 Uhr, Hörsaal B, Fachbereich Chemie, Martin-Luther-King-Platz 6 Aptamere ­ molekulare Chemie, Universität Hamburg www.chemie.uni-hamburg.de/bc/hahn/Mitarbeiter/index.html Das Aufgabenspektrum

Hamburg,.Universität

410

Naturwissenschaftlich-Technische Fakultt III Chemie, Pharmazie, Bio-und Werkstoffwissenschaften  

E-Print Network (OSTI)

Naturwissenschaftlich-Technische Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften Spannende Chemie-Vorträge für saarländische Schulen Professor / Fachgebiet Thema der Vorträge Prof. Dr. G. Kickelbick / Anorganische Chemie kickelbick@mx.uni-saarland.de Chemiker als Architekten für neue High

Mayberry, Marty

411

15. Tag der Organischen Chemie an der Universitt Stuttgart 14. 10. 2011 Institut fr Organische Chemie, Organisator: Prof. Dr. Dr. Clemens Richert  

E-Print Network (OSTI)

15. Tag der Organischen Chemie an der Universität Stuttgart ­ 14. 10. 2011 Institut für Organische Chemie, Organisator: Prof. Dr. Dr. Clemens Richert http://www.uni-stuttgart.de/ochem/ D-70569 Stuttgart Chemie" am Freitag, 14. Oktober 2011 nach Stuttgart einladen. Wie in den Jahren zuvor bietet diese

Möbius, Bernd

412

FACH-Fachschaft Chemie und Wirtschaftschemie  

E-Print Network (OSTI)

FACH-Fachschaft Chemie und Wirtschaftschemie Ulm e.V. FACH-Fachschaft Chemie und Wirtschaftschemie: +49 731/50-22407 Fax: +49 731/50-22403 fs-chemie@uni-ulm.de Protokoll der 3. Mitgliederversammlung des FACH Fachschaft Chemie und Wirtschaftschemie Ulm e.V. Sitzungsort: Universit¨at Ulm O27 131 Datum der

Pfeifer, Holger

413

Warum in Bayreuth studieren? der bundesweit  

E-Print Network (OSTI)

kolloidchemie stellt sich vor www.uni-bayreuth.de Modulgruppe AC Anorganische Chemie 41 SWS 38 LP Modulgruppe OC Organische Chemie 30 SWS 31 LP Modulgruppe PC Physikalische Chemie 35 SWS 36 LP Modul Makromolekulare Chemie Physikalische Chemie 9 SWS 4/8 LP Wahlpflichtmodul Technische Chemie 9 SWS 4/8 LP Wahlpflichtmodul Aktuelle For

Ott, Albrecht

414

INSTALLATION CERTIFICATE CF-6R-MECH-02 Solar Domestic Hot Water Systems (SDHW) (Page 1 of 1)  

E-Print Network (OSTI)

@physik.uni-siegen.de Abstract For low-energy buildings, passive solar gains can contribute significantly to the heat bal- ance of the building construction. Introduction Solar radiation influences the heat flux through the transparent-energy buildings, passive solar gains contribute significantly to the total heat bal- ance, consisting of heating

415

Probing the Depths of CSP-M: A new fdr-compliant Validation Tool  

E-Print Network (OSTI)

Probing the Depths of CSP-M: A new fdr-compliant Validation Tool Michael Leuschel and Marc Fontaine,fontaine}@cs.uni-duesseldorf.de Abstract. We present a new animation and model checking tool for CSP. The tool covers the CSP-M language in the source code, has an LTL model checker and can be used for combined CSP B specifications. During

Southampton, University of

416

A test case generation approach for conformance testing of SDL systems1  

E-Print Network (OSTI)

1 A test case generation approach for conformance testing of SDL systems1 C. Bourhfir2 , E This paper presents an approach for automatic executable test case and test sequence generation for a protocol modeled by an SDL system. Our methodology uses a uni- fied method which tests an Extended Finite

Aboulhamid, El Mostapha

417

Investigating voix mixte: A scientific challenge towards a renewed vocal pedagogy  

E-Print Network (OSTI)

.) Proceedings of the third Conference on Interdisciplinary Musicology (CIM07) Tallinn, Estonia, 15-19 August 2007, http://www-gewi.uni-graz.at/cim07/ Background in performance. Most often, the western lyrical on Interdiciplinary Musicology, CIM07, Tallinn : Estonia (2007)" #12;CIM07 - Conference on Interdisciplinary

Paris-Sud XI, Université de

418

Published Ahead of Print 23 March 2012. 10.1128/AEM.07679-11.  

E-Print Network (OSTI)

, and hydrolysate fermentation into a single step. These strains displayed a series of uni-, bi-, and trifunctional simultaneously hydrolyze and ferment birchwood xylan to ethanol with a yield of 0.31 g per g of sugar consumed. Liquid biofuels, such as bioethanol, are derived mainly from grain or sugarcane and are generally

Zhao, Huimin

419

En couleur sur le web www.ens.fr/actualites/  

E-Print Network (OSTI)

partenaires en Europe centrale et orientale. #12;3Juin 2005 de la linguistique à la politique en passant par seulement à la linguistique,mais à une poétique,une éthique,une politi- que enfin avec tous leurs enjeux langue uni- verselle, le rapport entre logique et linguistique,le « tournant linguistique » en

Gutkin, Boris

420

Manufacturing Defects Common to Composite Wind Turbine Blades: Effects of Defects  

E-Print Network (OSTI)

1 Manufacturing Defects Common to Composite Wind Turbine Blades: Effects of Defects Jared W. Nelson The Blade Reliability Collaborative has been formed to perform comprehensive studies to improve wind turbine uni-directional wind turbine fiber-reinforced composite material with an epoxy resin were utilized

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Development of Enhanced Electric Arc Furnace Models for Transient Analysis Gilsoo Jang  

E-Print Network (OSTI)

University Seoul, Korea Weiguo Wang ESCA-Alstom Tacoma, WA USA G. T. Heydt Ari- zona State Univer- sity Tempe, AZ USA S. S. Venkata Iowa State Uni- versity Ames, IA USA Byongjun Lee Korea University Korea to the interaction of the high demand currents of the loads with the supply system impedance. In order to adequately

422

Z .Decision Support Systems 30 2001 279288 www.elsevier.comrlocaterdsw  

E-Print Network (OSTI)

and financial options in demand-side electricity contracts Shmuel S. Oren) Department of Industrial Engineering and Operations Research, Uni?ersity of California at Berkeley, Berkeley, CA 94720, USA Abstract Z .In a competitive electricity market traditional demand-side management DSM options offering customers curtailable

Oren, Shmuel S.

423

An Estimation of the Spectral Radius of a Product of Block Ma-Mei-Qin Chen  

E-Print Network (OSTI)

Department of Mathematics and Computer Science, The Citadel, Charleston, SC 29409. Department of Mathematics and Computer Science, Georgia Southern Uni- versity, Statesboro, GA 30460 Submitted by Frank Uhlig ABSTRACT Let C(r) = [Cij], r = 1, 2, ..., R, be block m ? m matrices where Cij(r) are real nonnegative Ni ? Nj

Chen, Mei-Qin

424

LCNS, Vol 1279, pp. 364375, Springer 1997 Towards Optimal Locality in Mesh-Indexings  

E-Print Network (OSTI)

Tubingen, Sand 13, D-72076 Tubingen, fniedermr,reinhardg@informatik.uni-tuebingen.de partially supported like \\row-major." We present new tight results on 2-D and 3-D Hilbert indexings which are easy in the Hilbert indexing is bounded by 3 p ji? jj ? 2, a tight result previously given by Chochia, Cole

Wichmann, Felix

425

Subscriber access provided by STANFORD UNIV GREEN LIBR Nano Letters is published by the American Chemical Society. 1155 Sixteenth  

E-Print Network (OSTI)

(Figure 1a) was grown by hot wire chemical vapor deposition (HWCVD) on an indium-tin-oxide (ITO) coated of Chemistry, Stanford UniVersity, Stanford, California 94305, and National Renewable Energy Laboratory, 1617, Stanford University. | Department of Chemistry, Stanford University. National Renewable Energy Laboratory

Cui, Yi

426

Hawaii Ocean Current Resources and Tidal Turbine Assessment  

Science Conference Proceedings (OSTI)

Interest in converting the kinetic energy of ocean current and tidal flow into electrical power has increased in recent years. This report focuses on the ocean current resource in Hawaii, which includes tidal flows as well as uni-directional oceanic current flows around the main Hawaiian Islands, with the exception of Kauai, from the shoreline to approximately the 2000-m depth contour.

2008-09-02T23:59:59.000Z

427

Automatic Generation of Tcl Bindings for C and C++ Libraries  

E-Print Network (OSTI)

Automatic Generation of Tcl Bindings for C and C++ Libraries Wolfgang Heidrich Computer Graphics@informatik.uni-erlangen.de Abstract In the past few years Tcl has found widespread in- terest as a extensible scripting language. Numerous Tcl interfaces for a variety of C libraries have been created. While most of these language

Heidrich, Wolfgang

428

PROF. DR. BEATRIX BUSSE DR. ASTRID WIND  

E-Print Network (OSTI)

PROF. DR. BEATRIX BUSSE SPRECHERIN DR. ASTRID WIND KOORDINATORIN Vo?str. 2, Geb. 37 69115 Heidelberg Tel 06221 54 3783 Fax 06221 54 3664 astrid.wind@zegk.uni-heidelberg.de Die Heidelberger;PROF. DR. BEATRIX BUSSE SPRECHERIN DR. ASTRID WIND KOORDINATORIN Vo?str. 2, Geb. 37 69115 Heidelberg

Heermann, Dieter W.

429

Collge doctoral ED n 432 : Sciences des Mtiers de l'Ingnieur  

E-Print Network (OSTI)

out battery safety tests. The BMBF is planning to set up a pilot produc- tion line for lithium ion batteries in Ulm within the framework of the Lithium Ion Batteries (KLiB) competence network, which Entwicklung effizienter Batterie- systeme befasst, an den Start. Für uns als Uni- versität Ulm ist diese

Paris-Sud XI, Université de

430

PROCEEDINGS, Thirty-Sixth Workshop on Geothermal Reservoir Engineering Stanford University, Stanford, California, January 31 -February 2, 2011  

E-Print Network (OSTI)

PROCEEDINGS, Thirty-Sixth Workshop on Geothermal Reservoir Engineering Stanford University, Germany iulia.ghergut@geo.uni-goettingen.de ABSTRACT In fluid-based geothermal reservoirs, thermal between "heat exchange area" and RTD features of a geothermal reservoir feel natural, but act highly

Stanford University

431

Cjestmir de Boer, Juergen Braun, Norbert Klaas, Stefan Steiert Universitt Stuttgart  

E-Print Network (OSTI)

of Injection WellsVelocities in the Vicinity of Injection Wells Concentration distribution of an injected Fe0 proof this method A 60° piece of a confined aquifer around an injection well was built Minimize.deboer@iws.uni-stuttgart.de Injection of Nano-Scale Iron for the In-Situ Remediation of Chlorinated Hydrocarbons in Soil and Groundwater

Cirpka, Olaf Arie

432

22302239 Nucleic Acids Research, 2008, Vol. 36, No. 7 Published online 19 February 2008 doi:10.1093/nar/gkn038  

E-Print Network (OSTI)

from 84% for superkingdom to 61% for order. Moreover, the power of the method for studying://www-ab.informatik.uni-tuebingen.de/ software/readsim/. The 454 reads of three `real' microbial samples--a coral reef sample, a solar saltern; Dinsdale et al., submitted for publica- tion). The solar saltern sample was collected from the solar

Kelley, Scott

433

Optimal Energy Management for a Hybrid Energy Storage System for Electric Vehicles Based on  

E-Print Network (OSTI)

}@lea.uni-paderborn.de Abstract--For electric and hybrid electric cars, commonly nickel-metal hydride and lithium-ion batteries. The BMW Mini-E is an all electric powered car field-tested in the United States, United KingdomOptimal Energy Management for a Hybrid Energy Storage System for Electric Vehicles Based

Noé, Reinhold

434

42 C & E N / A U G U S T 2 2 , 2 0 0 5 W W W . C E N O N L I N E . O R G In the real world, though, finding new  

E-Print Network (OSTI)

from petroleum to hydro- gen may offer major benefits in terms of pollution- veniently and safely. And there is no uni- form procedure for storing the fuel in a car's gas tank. George quantities. Today's cars, Thomas notes, can be refueled in a fewminutesandgenerallytravelsome300 miles

Yaghi, Omar M.

435

UNITED STATES Calendar Year 2003  

E-Print Network (OSTI)

Engineering Department, King Fahd UniVersity of Petroleum & Minerals, Dhahran 31261, Saudi Arabia 1 with toluene. Thus, these processes offer a way to utilize the low-cost toluene and TMB to produce the much to having total constant pressure since the total number of moles remains constant. Coke deposited on spent

US Army Corps of Engineers

436

Bureau of Economic Geology, The University of Texas at Austin Natural Gas Trends  

E-Print Network (OSTI)

Engineering Department, King Fahd UniVersity of Petroleum & Minerals, Dhahran 31261, Saudi Arabia 1 with toluene. Thus, these processes offer a way to utilize the low-cost toluene and TMB to produce the much to having total constant pressure since the total number of moles remains constant. Coke deposited on spent

Texas at Austin, University of

437

arXiv:0805.2962v1[astro-ph]19May2008 A comprehensive comparison of the Sun to other stars: searching  

E-Print Network (OSTI)

- uation. Suppose uranium (a low abundance element in the Solar System and in the uni- verse) was central that the Sun had more uranium than any other star. How should we interpret this fact? The most reasonable way and to deter- mine whether we are justified in reading some importance into it. Although a correlation does

Lineweaver, Charles H.

438

Optimally Orienting Physical Networks Dana Silverbush ,1, Michael Elberfeld ,2, and Roded Sharan1  

E-Print Network (OSTI)

Optimally Orienting Physical Networks Dana Silverbush ,1, Michael Elberfeld ,2, and Roded Sharan1 1, elberfeld@tcs.uni-luebeck.de Abstract. In a network orientation problem one is given a mixed graph, consisting of directed and undirected edges, and a set of source-target vertex pairs. The goal is to orient

Sharan, Roded

439

Notiz Nr. 23 / 2012 // 4. Mai 2012 Notizen aus der Universitt Bayreuth  

E-Print Network (OSTI)

?kologisch-Botanischen Garten Am Sonntag, 6. Mai, ab 10.00 Uhr findet im ?kologisch-Botanischen Garten der um 10 Uhr am Eingang des Gartens. Weitere Infos: www.obg.uni-bayreuth.de. 2246 Zeichen 65 Zeilen ca

Ullmann, G. Matthias

440

AmPlanetarium Sophienstra  

E-Print Network (OSTI)

904 201 103 9 913 132 M3 M20 M4 H81 H2·3·7 Friedrich-Schiller-Universität Jena Schillers Garten,00 Euro) Schillers Garten Eintritt frei Adresse: Schillers Gartenhaus Schillergä?chen 2 · 07745 Jena Telefon: (03641) 931188 Telefax: (03641) 931187 E-Mail: schillerhaus@uni-jena.de Schillers Garten

Seyfarth, Andre

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Mitteilung fr die Medien Mitteilung fr die Medien Mitteilung fr die Medien Mitteilung fr die Medien Eine Zeile mit 39 Anschlgen (mit Leerzeichen) durchschnittlich  

E-Print Network (OSTI)

lernten im ?kologisch-Botanischen Garten das Umweltbildungsprogramm ,,Wie im Treibhaus" kennen. Lehrer schlüpfen in die Rolle ihrer Schüler Fortbildung zum Klimawandel im ?kologisch-Botanischen Garten Bayreuth: Im ?kologisch-Botanischen Garten der Uni- versität Bayreuth arbeiteten sich in das

Ullmann, G. Matthias

442

Durchschniitlich 39 Zeichen pro Zeile Universitt Bayreuth D-95440 Bayreuth Besucher: Universittsstrae 30 Verwaltungsgebude  

E-Print Network (OSTI)

, ab 10.30 Uhr findet eine Führung im ?kologisch-Botanischen Garten der Universität unter dem Motto ,,Zu Lande, zu Wasser und in der Luft: Tie- re im Botanischen Garten". Der Botani- sche Garten der Uni zum Leben. Die Führung ,,Zu Lande, zu Wasser und in der Luft: Tiere im Botanischen Garten" am Sonntag

Ullmann, G. Matthias

443

DNA Binding and Photocleavage in Vitro by New Dirhodium(II) dppz Complexes: Correlation to Cytotoxicity and Photocytotoxicity  

E-Print Network (OSTI)

Ther. 2002, 1, 1327. (b) Sodet, O.; Khan, Q. A.; Kohn, K. W.; Pommier, Y. Curr. Med. Chem: Anti) Kanzaki, A.; Takebayashi, Y.; Ren, X.-Q.; Miyashita, H.; Mori, S.; Akiyama, S.-I.; Pommier, Y. Mol. CancerVersity, Columbus, Ohio 43210, Department of Chemistry, Texas A&M UniVersity, College Station, Texas 77843, and Food

Turro, Claudia

444

Composite Solid Polymer Electrolytes Based on Pluronics: Does Ordering Matter?  

E-Print Network (OSTI)

, 149, A212. (13) Li, Q.; Imanishi, N.; Takeda, Y.; Hirano, A.; Yamamoto, O. Ionics 2002, 8, 79. (14 I. Svergun,,# Angelica Sanchez, and Saad Khan Departments of Chemistry and Physics, Indiana Uni, 2245. (7) Kurian, M.; Galvin, M. E.; Trapa, P. E.; Sadoway, D. R.; Mayes, A. M. Electrochim. Acta 2005

Khan, Saad A.

445

Chemical Engineering Education150 ChE department  

E-Print Network (OSTI)

Chemical Engineering Education150 ChE department ChE at... The University of Houston C hemical engineering at the Uni- versity of Houston has reflected the growth and diversification of the field: from. The Department of Chemical & Biomolecular Engineering (ChBE) at the University of Houston started as a program

Azevedo, Ricardo

446

Why the Theta+ is seen in some experiments and not in others: A Possible explanation.  

E-Print Network (OSTI)

-ph/0312344. [30] M. Battaglieri [presenting CLAS Coll. data], talk at Pentaquark Workshop, Feb. 10-12, 2004, Trento, Italy, http://www.tp2.ruhr-uni-bochum.de/talks/trento04/battaglieri.pdf . [31] M. Karliner and H. J. Lipkin, Phys. Lett. B 586, 303 (2004) hep...

Karliner, Marek; Lipkin, Harry J

447

Traffic Measurement and Statistical Analysis in a Disaster Area Scenario  

E-Print Network (OSTI)

-of-Hospital] disaster response."([5]) Public safety units need reliable communication independent of any inTraffic Measurement and Statistical Analysis in a Disaster Area Scenario Nils Aschenbruck, Matthias, 53117 Bonn, Germany {aschenbruck, matthew, martini, toelle}@cs.uni-bonn.de Abstract-- Disaster areas

Frank, Matthias

448

New Catalyst Might Expand Bio-Ethanol's Possible uses: fuel additives, rubber and solvents  

E-Print Network (OSTI)

of Science and of Energy Effi- ciency and Renewable Energy. The team used resources at DOE's EMSL, En at the Pacific Northwest National Laboratory and Washington State Uni- versity have developed a new catalyst it first, potentially keeping costs lower and production times faster. Reported by researchers

449

ADHCGS3.1 University of New Hampshire Graduate School Page 1 of 1 01/12/2012 10:01:02 AM  

E-Print Network (OSTI)

Lecture 15 The Necklace around the Arctic Arctic indigenous peoples and ANWR in Alaska Islands (Scotland) Labrador Sea (see fig.19) Alaska, ANWR 10K-20 years ago 4500 years ago AD 500://www.unis.no/ #12;ANWR and Arctic indigenous peoples Arctic Refuge is celebrating its 50th anniversary in 2010

New Hampshire, University of

450

Path-coupled Signaling for Dynamic Metering Configuration in IP-based Networks  

E-Print Network (OSTI)

Path-coupled Signaling for Dynamic Metering Configuration in IP-based Networks Falko Dressler1,klenk,fessi,carle}@informatik.uni-tuebingen.de 3 Siemens Communications, Berlin, Germany cornelia.kappler@siemens.com Abstract Metering of the metering entities is based on centralized management systems. These systems usually have no knowledge about

Carle, Georg

451

Discovery's Final Flight Lightning Signature Could Help Reveal Solar System's Origin  

E-Print Network (OSTI)

of exploration, learning, and fun. The theme, "Explore Our World," gave visitors an opportunity to move objects in the distant uni- verse, as well as here on Earth. At the thermal engineering table, attendees Goddard Updates The Weekly - 2 NASA Exhibits Inspire Maryland Day Explorers - 3 Lightning Signature Could

452

STABILITY OF MOVING MESH SYSTEMS OF PARTIAL DIFFERENTIAL EQUATIONS  

E-Print Network (OSTI)

://www.siam.org/journals/sisc/20-2/30201.html Dept. of Computer Science and Army High Performance Computing Research Center High Performance Computing Research Center, Uni- versity of Minnesota, Minneapolis, MN 55455. Current and by the Army High Performance Computing Research Center under the auspices of the Depart- ment of the Army

Kurien, Susan

453

Nat. Hazards Earth Syst. Sci., 10, 23592369, 2010 www.nat-hazards-earth-syst-sci.net/10/2359/2010/  

E-Print Network (OSTI)

System Sciences Numerical simulation of a tsunami event during the 1996 volcanic eruption in Karymskoye. Belousova5,6 1Bergen Center for Computational Science, Uni Research, Bergen, Norway 2CNRS-GEOLAB, Clermont by volcanic explosions. Karymskoye lake is a nearly circular, bowl-like water body, approximately 4 km

Belousov, Alexander

454

Z .Materials Science and Engineering C 7 2000 149160 www.elsevier.comrlocatermsec  

E-Print Network (OSTI)

, Mind, and Beha?ior, Department of Biological Sciences, Bowling Green State Uni?ersity, Bowling GreenZ .Materials Science and Engineering C 7 2000 149­160 www.elsevier.comrlocatermsec An electrical fluctuations to which a single cell will respond. q 2000 Elsevier Science S.A. All rights reserved. Keywords

Moore, Paul A.

455

Single-Crystalline LaB6 Nanowires Han Zhang, Qi Zhang, Jie Tang,, and Lu-Chang Qin*,,  

E-Print Network (OSTI)

in Applied and Materials Sciences and Department of Physics and Astronomy, UniVersity of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3255, and National Institute for Materials Science vaporized in a tantalum bowl placed inside the tube furnace. The reaction was conducted in an atmosphere

Qin, Lu-Chang

456

Improvement of the computer methods for grounding analysis in layered soils by using  

E-Print Network (OSTI)

of the substation site. Thus, when a fault condition occurs, the grounding grid transports and dissipatesImprovement of the computer methods for grounding analysis in layered soils by using high of grounding systems embedded in uni- form soils. This approach has been implemented in a CAD system

Colominas, Ignasi

457

Higher Education's Role in Adapting to a Changing Climate  

E-Print Network (OSTI)

uni- versity of the State of Louisiana, was established by the Louisiana Legislature in 1956 to bring of 1958. In September 1958, Louisiana State University in New Orleans, which was renamed the University can be found at http://upcom.uno.edu/ docs/StrategicPlan2007-2010.pdf. As a member of the Louisiana

Linsley, Braddock K.

458

catalogaugust 2010 undergraduate/graduate  

E-Print Network (OSTI)

Orleans (UNO), the urban research uni- versity of the State of Louisiana, was established by the Louisiana the winter and spring of 1958. In September 1958, Louisiana State University in New Orleans, which the Louisiana State University System to the University of Louisiana System. Legislation was passed in the 2011

Kulp, Mark

459

Table of Contents University Calendar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .1  

E-Print Network (OSTI)

research uni- versity of the State of Louisiana, was established by the Louisiana Legislature in 1956 of 1958. In September 1958, Louisiana State University in New Orleans, which was renamed the University at http://upcom.uno. edu/docs/StrategicPlan2007-2010.pdf. As a member of the Louisiana State University

Kulp, Mark

460

PROCESS DESIGN AND CONTROL Steady-State Operational Degrees of Freedom with Application to Refrigeration  

E-Print Network (OSTI)

PROCESS DESIGN AND CONTROL Steady-State Operational Degrees of Freedom with Application to Refrigeration Cycles Jørgen Bauck Jensen and Sigurd Skogestad* Department of Chemical Engineering, Norwegian Uni of the circulating refrigerant are also discussed. Two liquified natural gas (LNG) processes of current interest

Skogestad, Sigurd

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Multicast Server Architectures for MARS-based ATM multicasting  

Science Conference Proceedings (OSTI)

A mechanism to support the multicast needs of layer 3 protocols in general, and IP in particular, over UNI 3.0/3.1 based ATM networks has been described in RFC 2022. Two basic approaches exist for the intra-subnet (intra-cluster) multicasting of IP ...

R. Talpade; M. Ammar

1997-05-01T23:59:59.000Z

462

26 March 1999 Z .Chemical Physics Letters 302 1999 411417  

E-Print Network (OSTI)

of Geology, Uni?ersity of Illinois at Urbana-Champaign, 1301 W. Green St., 245 NHB, Urbana, IL 61801, USA b Chernogolovka, Moscow Region, Russia. E-mail: andreyk@hercules.geology.uiuc.edu w x3­9,11,12,16,17 that H rea- sons. For example, recent estimations suggest that large pressure effects on the isotope

Kalinichev, Andrey G.

463

Mid-air Pan-and-Zoom on Wall-sized Displays Mathieu Nancel1,2  

E-Print Network (OSTI)

, Mid-air interaction techniques. ACM Classification Keywords H.5.2 Information InterfacesMid-air Pan-and-Zoom on Wall-sized Displays Mathieu Nancel1,2 Julie Wagner2,1 Emmanuel Pietriga2 of remote pointing, we identified three key factors for the design of mid-air pan-and-zoom techniques: uni

Paris-Sud XI, Université de

464

Molecular Packing Parameter in Bolaamphiphile Solutions: Adjustment of Aggregate Morphology by Modifying the Solution Conditions  

E-Print Network (OSTI)

Molecular Packing Parameter in Bolaamphiphile Solutions: Adjustment of Aggregate Morphology of Chemistry and Molecular Engineering, and College of Life Science, Peking UniVersity, Beijing, 100871, People of molecular packing parameters in a bolaamphiphile solution was tested with experimental results. By modifying

Huang, Jianbin

465

NATIONAL AND GLOBAL FORECASTS WEST VIRGINIA PROFILES AND FORECASTS  

E-Print Network (OSTI)

· NATIONAL AND GLOBAL FORECASTS · WEST VIRGINIA PROFILES AND FORECASTS · ENERGY · HEALTHCARE Industry Insight: West Virginia Fiscal Forecast 34 CHAPTER 4: WEST ViRGiNiA'S 35 COUNTiES AND MSAs West Forecast Summary 2 CHAPTER 1: THE UNiTED STATES ECONOMY Figure 1.1: United States Real GDP Growth 3 Figure

Mohaghegh, Shahab

466

Efficiency of -Tunneling in [2]Rotaxane Molecular Electronic Switches Yong-Hoon Kim*, and William A. Goddard, III  

E-Print Network (OSTI)

function principles in these elegant yet complex devices. To resolve such controversies and provide a firm explain the device function, as can be seen by the fact that the [2]catenane device that has a similar A. Goddard, III Department of Materials Science and Engineering, UniVersity of Seoul, 90 Jeonnong

Goddard III, William A.

467

Lecture Session (LeS): E.4 REMEDIATION Thermal techniques -1 STEAM-AIR-INJECTION FOR IN-SITU GROUNDWATER AND SOIL REMEDIATION: PILOT  

E-Print Network (OSTI)

Lecture Session (LeS): E.4 REMEDIATION Thermal techniques -1 STEAM-AIR-INJECTION FOR IN@iws.uni-stuttgart.de Keywords: Partial Source removal, thermally enhanced soil vapor extraction, steam-air-injection, pilot methods (steam-air injection and thermal wells), developed and verified in several field applications

Cirpka, Olaf Arie

468

The team conducted a pilot project to identify preclinical  

E-Print Network (OSTI)

at ORNL and the universities of Kentucky and Tennessee on a method that could help primary care doctors with electrodes attached to the scalp. Researchers at the Uni- versity of Kentucky Medi- cal Center collected EEG and University of Tennessee collaboration revealed that the EEG tests succeeded in terms of sensitivity, accuracy

469

When we hurt the ones we love: Predicting violence against women from mens mate retention  

E-Print Network (OSTI)

. SHACKELFORD,a AARON T. GOETZ,a DAVID M. BUSS,b HARALD A. EULER,c AND SABINE HOIERc a Florida Atlantic be addressed to Todd K. Shackelford or Aaron T. Goetz, Florida Atlantic Uni- versity, Department of Psychology

Pillow, Jonathan

470

NANO TOOLS & PRODUCTS IN MICRO & NANOTECHNOLOGY Engineered Carbon Nanotube (CNT) and  

E-Print Network (OSTI)

MICRO NANO TOOLS & PRODUCTS IN MICRO & NANOTECHNOLOGY Engineered Carbon Nanotube (CNT aligned nanorods, helices, and chevrons. Hybrid Nano-CMOS Chips--Hewlett-Packard Laboratories www coating. The result is a uni- form, durable nano-thin film treatment that delivers quantum physical

471

Factors Contributing to Petroleum Foaming. 2. Synthetic Crude Oil Systems  

E-Print Network (OSTI)

between · 01.10.13: Chemie, B.Sc. · 02.10.13: Lateinische Literatur der Antike u.i. Fortleben, Zweifach- B in German (e.g. DSH): http://www3.uni-bonn.de/studium/studium-in-bonn-fuer-internationale-studierende/deutsch

Kilpatrick, Peter K.

472

Seite 1 von 49 FRIEDRICH -SCHILLER -UNIVERSITT  

E-Print Network (OSTI)

.................................................................................................................................................... 36 Chemie Sprache: Deutsch Zuordnung zu den Studiengängen Pflichtmodul im 1. Semester BSc Physik Pflichtmodul im 1://friedolin.uni-jena.de für jedes Semester festgelegt) Dozent(in): Modul-Verantwortliche(r) Sprache: Deutsch Zuordnung zu den

Knüpfer, Christian

473

U N I -F O K U S Geheimnisse der Netzhaut  

E-Print Network (OSTI)

setzt ein Forschungsprojekt an, an dem WissenschaftlerInnen aus den Bereichen Chemie (Prof. Dr Institut für Chemie und Biologie des Meeres (ICBM), das sich mit Küsten- und Flachmeerforschung befasst rekonstruieren. www.staff.uni-oldenburg.de/thomas.et- zemueller Deutsch-arabischer Dialog Mit der Situation von

Boll, Susanne

474

Hinter Humboldts Tren Studierende der HU bieten drei-  

E-Print Network (OSTI)

Händen nicht den Fu?boden. Diese Ergebnisse einer Stu- die zur Kindergesundheit in Deutsch- land, die das Chemie der HU, bietet ab Juli Kurse zur naturwissen- schaftlichen Grundbildung für Schüler an. Einen Anmeldung gibt es im Internet unter www.chemie.hu- berlin.de/forschung/fachdidaktik/aktiv/elan. UNI F?R ALLE

Röder, Beate

475

Das Mitteilungsblatt erscheint jeweils am 1. und 3. Mittwoch jeden Monats. Eigentmer, Herausgeber, Vervielfltigung und Vertrieb: Universittsdirektion der Universitt Innsbruck, Innrain 52, A-6020  

E-Print Network (OSTI)

­ Anhörungsverfahren gem. § 12 Abs. 2 UniStG 292. Reform der Studienpläne für die Lehramtsfächer Deutsch, Englisch. Reform des Studienplans der Studienrichtung Wirtschaftsingenieurwesen -Technische Chemie und Technische Chemie an der Johannes-Kepler-Universität Linz 294. Reform des Studienplans der Studienrichtung Biologie

Breu, Ruth

476

Polyhedral Ionic Molecules Alexander I. Boldyrev and Jack Simons*  

E-Print Network (OSTI)

of Chemistry, The UniVersity of Utah, Salt Lake City, Utah 84112 ReceiVed NoVember 25, 1996. ReVised Manuscript species composed of closed-shell atomic ions are known to prefer densely packed structures similar, for example, in alkali halide tetramers, no other ionic polyhedral structures containing only atomic ions

Simons, Jack

477

TethyanMediterranean organic carbon-rich sediments from Mesozoic black shales to sapropels  

E-Print Network (OSTI)

Tethyan­Mediterranean organic carbon-rich sediments from Mesozoic black shales to sapropels KAY@geowiss.uni-hamburg.de) Geological Institute, ETH Zurich, Zurich, Switzerland ABSTRACT The Jurassic to Holocene record of black shale sections or drill cores. The term `black shale' is used here broadly for sediments with elevated organic

Gilli, Adrian

478

Quasi-energy-independent solar neutrino transitions  

E-Print Network (OSTI)

Current solar, atmospheric, and reactor neutrino data still allow oscillation scenarios where the squared mass differences are all close to 10^-3 eV^2, rather than being hierarchically separated. For solar neutrinos, this situation (realized in the upper part of the so-called large-mixing angle solution) implies adiabatic transitions which depend weakly on the neutrino energy and on the matter density, as well as on the ``atmospheric'' squared mass difference. In such a regime of ``quasi-energy-independent'' (QEI) transitions, intermediate between the more familiar ``Mikheyev-Smirnov-Wolfenstein'' (MSW) and energy-independent (EI) regimes, we first perform analytical calculations of the solar nu_e survival probability at first order in the matter density, beyond the usual hierarchical approximations. We then provide accurate, generalized expressions for the solar neutrino mixing angles in matter, which reduce to those valid in the MSW, QEI and EI regimes in appropriate limits. Finally, a representative QEI scenario is discussed in some detail.

G. L. Fogli; E. Lisi; A. Palazzo

2001-05-09T23:59:59.000Z

479

The status of the solar neutrino problem  

Science Conference Proceedings (OSTI)

Perhaps the most outstanding discrepancy between prediction and measurements in current particle physics comes from the solar neutrino problem, in which a large deficit of high-energy solar neutrinos is observed. Many Nonstandard Solar Models have been invoked to try to reduce the predicted flux, but all have run into problems in trying to reproduce other measured parameters (e.g., the luminosity) of the Sun. Other explanations involving new physics such as neutrino decay and neutrino oscillations, etc. have also been proffered. Again, most of these explanations have been ruled out by either laboratory or astrophysical measurements. It appears that perhaps the most likely particle physics solution is that of matter enhanced neutrino oscillation, the Mikheyev-Smirnov-Wolfenstein (MSW) oscillations. Two new radiochemical gallium experiments, which have a low enough threshold to be sensitive to the dominant flux of low-energy p-p neutrinos, now also report a deficit and also favor a particle physics solution. The next generation of solar experiments promise to finally resolve the source of the ``solar neutrino problem`` by the end of this decade.

Bowles, T.J.

1993-12-01T23:59:59.000Z

480

BETWEEN RANDALL COUNTY, TEXAS AND 'I'HE UNITED STATES DEPARTMENT OF ENEKGY  

NLE Websites -- All DOE Office Websites (Extended Search)

BETWEEN BETWEEN RANDALL COUNTY, TEXAS AND - 'I'HE UNITED STATES DEPARTMENT OF ENEKGY This Memorandum of Understanding (hereinslfier callcd "MOU") is between Randall County. Texas, (hereinaner callcd "Cnunty") and thc Uni~ed States Department of Energy: (hcrcinafter called "I3ClE'' or b'l'an?ex"). 1. INTRODUCTION A. BACKGKOUN L) Both prties havc a mutual interest and responsibility for fire fighting activities tu protect penplc, propxty. and the cnvimnmcnt. B. fl RPOSE 'Ihe purpose of this Mot' is to recognize the need Tor coopemtion on certain fire lighting responsibilities of mutuaI conccrn and to provide for the mutual assistance of parties in accordance \hi tith thc Standard Opemting Pmedures (SOP) contained in Appendix A of this

Note: This page contains sample records for the topic "wolfenstein carnegie-mellon uni" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Theory Seminar Schedule  

NLE Websites -- All DOE Office Websites (Extended Search)

6-2007 6-2007 Click on a title to read an abstract, if available (underlined). 10 July 2007 Special Day: Tuesday, 3:00pm Robert Wiringa Argonne National Laboratory wiringa@theory.phy.anl.gov Dependence of nuclear binding on hadronic mass variation 3 July 2007 Special Day and Time: Tuesday, 10:30am Renato Higa University of Bonn, Germany higa@itkp.uni-bonn.de Coulomb interactions within Halo EFT 5 June 2007 Special Day and Time: Tuesday, 10.30am Omar Benhar Istituto Nazionale di Fisica Nucleare, Rome, Italy benhar@roma1.infn.it The equation of state of neutron star matter and gravitational wave emission 29 May 2007 Special Day: Tuesday Ulrich Mosel Giessen University, Germany Ulrich.Mosel@theo.physik.uni-giessen.de Hadrons in Medium - Theory meets experiment 10 May 2007

482

http://www.ornl.gov/Procurement.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

93 93 1. All Grade 5 and Grade 8 fasteners of foreign origin which do not bear any manufacturer's headmarks: Grade 5 Grade 8 2. Grade 5 fasteners with the following manufacturers' headmarks: J Jinn Her (TW) KS Kosaka Kogyo (JP) J KS 3. Grade 8 fasteners with the following manufacturers' headmarks: A Asahi Mfg (JP) KS Kosaka Kogyo (JP) A KS NF RT NF Nippon Fasteners (JP) RT Takai Ltd (JP) H Hinomoto Metal (JP) FM Fastener Co (of JP) H FM J M MS KY M Minamida Sieybo (JP) KY Kyoei (JP) MS Minato Kogyo (JP) J Jinn Her (JP) E Hollow Infasco Co. (CA TW JP YU) Triangle (sizes greater than 1/2-in dia) UNY E Daiei (JP) UNY Unytite (JP) 4. Grade 8.2 fasteners with the following headmarks: KS Kosaka Kogyo (JP) KS 5. Grade A325 Fasteners (Bennett Denver Target only) with the following headmarks: A325 KS Kosaka Kogyo (JP)

483

Saccharification  

NLE Websites -- All DOE Office Websites (Extended Search)

Saccharification Saccharification of a Potential Bioenergy Crop, Phragmites australis (Common Reed), by Lignocellulose Fractionation Followed by Enzymatic Hydrolysis at Decreased Cellulase Loadings Noppadon Sathitsuksanoh, †,‡ Zhiguang Zhu, † Neil Templeton, † Joseph A. Rollin, † Steven P. Harvey, § and Y-H. Percival Zhang* ,†,‡,| Biological Systems Engineering Department, Virginia Polytechnic Institute and State UniVersity, 210-A Seitz Hall, Blacksburg, Virginia 24061, Institute for Critical Technology and Applied Science (ICTAS), Virginia Polytechnic and State UniVersity, Blacksburg, Virginia 24061, US Army ECBC, Research & Technology Directorate, 5183 Blackhawk, Road, Aberdeen ProVing Ground Maryland 21010, and DOE BioEnergy Science Center (BESC), Oak Ridge, Tennessee 37831 Cost-effective biological saccharification of nonfood lignocellulosic

484

Predicting the Pipeline Behavior of Superscalar Processors by Abstract Interpretation  

E-Print Network (OSTI)

Interpretation Jorn Schneider , Reinhard Wilhelm Christian Ferdinand Universitat des Saarlandes AbsInt Angewandte Informatik GmbH Fachbereich Informatik Universitat des Saarlandes Postfach 15 11 50 Starterzentrum { Gebaude 45 D-66041 Saarbrucken, Germany D-66123 Saarbrucken, Germany js@cs.uni-sb.de, wilhelm@cs.uni-sb.de ferdinand@AbsInt.de Abstract For real time systems not only the logical function is important but also the timing behavior, e. g. hard real time systems must react inside their deadlines. To guarantee this it is necessary to know upper bounds for the worst case execution times (WCETs). The accuracy of the prediction of WCETs depends strongly on the ability to model the features of the target processor.

Schneider; Reinhard Wilhelm; Christian Ferdin; Universitat Des Saarl; Es Absint Angew; Te Informatik Gmbh

2000-01-01T23:59:59.000Z

485

TEMPO fr Studierende in den Bachelor-und Masterstudiengngen der Chemie Was ist TEMPO?  

E-Print Network (OSTI)

TEMPO für Studierende in den Bachelor- und Masterstudiengängen der Chemie Was ist TEMPO? Mit TEMPO (Terminverwaltung für Modulprüfungen Chemie Online) können Sie Ihre Termine für die Modulprüfungen über eine: peter.kreitmeier@chemie.uni-regensburg.de). Bei allen anderen Fragen kontaktieren Sie bitte die

Schubart, Christoph

486

Evaluation and Optimization of a Supercritical Carbon Dioxide Power Conversion Cycle for Nuclear Applications  

Science Conference Proceedings (OSTI)

There have been a number of studies involving the use of gases operating in the supercritical mode for power production and process heat applications. Supercritical carbon dioxide (CO2) is particularly attractive because it is capable of achieving relatively high power conversion cycle efficiencies in the temperature range between 550C and 750C. Therefore, it has the potential for use with any type of high-temperature nuclear reactor concept, assuming reactor core outlet temperatures of at least 550C. The particular power cycle investigated in this paper is a supercritical CO2 Recompression Brayton Cycle. The CO2 Recompression Brayton Cycle can be used as either a direct or indirect power conversion cycle, depending on the reactor type and reactor outlet temperature. The advantage of this cycle when compared to the helium Brayton Cycle is the lower required operating temperature; 550C versus 850C. However, the supercritical CO2 Recompression Brayton Cycle requires an operating pressure in the range of 20 MPa, which is considerably higher than the required helium Brayton cycle operating pressure of 8 MPa. This paper presents results of analyses performed using the UniSim process analyses software to evaluate the performance of the supercritical CO2 Brayton Recompression Cycle for different reactor outlet temperatures. The UniSim model assumed a 600 MWt reactor power source, which provides heat to the power cycle at a maximum temperature of between 550C and 750C. The UniSim model used realistic component parameters and operating conditions to model the complete power conversion system. CO2 properties were evaluated, and the operating range for the cycle was adjusted to take advantage of the rapidly changing conditions near the critical point. The UniSim model was then optimized to maximize the power cycle thermal efficiency at the different maximum power cycle operating temperatures. The results of the analyses showed that power cycle thermal efficiencies in the range of 40 to 50% can be achieved.

Edwin A. Harvego; Michael G. McKellar

2011-05-01T23:59:59.000Z

487

Parametric Study Of Large-Scale Production Of Syngas Via High Temperature Co-Electrolysis  

DOE Green Energy (OSTI)

A process model has been developed to evaluate the potential performance of a largescale high-temperature co-electrolysis plant for the production of syngas from steam and carbon dioxide. The co-electrolysis process allows for direct electrochemical reduction of the steam carbon dioxide gas mixture, yielding hydrogen and carbon monoxide, or syngas. The process model has been developed using the Honeywell UniSim systems analysis code. Using this code, a detailed process flow sheet has been defined that includes all the components that would be present in an actual plant such as pumps, compressors, heat exchangers, turbines, and the electrolyzer. Since the electrolyzer is not a standard UniSim component, a custom one-dimensional co-electrolysis model was developed for incorporation into the overall UniSim process flow sheet. The one dimensional co-electrolysis model assumes local chemical equilibrium among the four process-gas species via the gas shift reaction. The electrolyzer model allows for the determination of co-electrolysis outlet temperature, composition (anode and cathode sides); mean Nernst potential, operating voltage and electrolyzer power based on specified inlet gas flow rates, heat loss or gain, current density, and cell area-specific resistance. The one-dimensional electrolyzer model was validated by comparison with results obtained from a fully three dimensional computational fluid dynamics model developed using FLUENT, and by comparison to experimental data. This paper provides representative results obtained from the UniSim flow sheet model for a 300 MW co-electrolysis plant, coupled to a high-temperature gas-cooled nuclear reactor. The coelectrolysis process, coupled to a nuclear reactor, provides a means of recycling carbon dioxide back into a useful liquid fuel. If the carbon dioxide source is based on biomass, the overall process, from production through utilization, would be climate neutral.

J. E. O'Brien; M. G. McKellar; C. M. Stoots; J. S. Herring; G. L. Hawkes

2007-11-01T23:59:59.000Z

488

Exploring the link between MORF4L1 and risk of breast cancer  

E-Print Network (OSTI)

by the Caenorhabditis Genetics Center (Uni- versity of Minnesota, Minneapolis, MN, USA): DW104 brc-2(tm1086) III/hT2[bli-4(e937) let-?(q782) qIs48](I; III); VC1873: rad-51(ok2218) IV/nT1[qIs51](IV;V); and XA6226 mrg-1(qa6200)/qC1 dpy-19(e1259) glp-1(q339) [qIs26...

Martrat, Griselda; Maxwell, Christopher A; Tominaga, Emiko; Porta, Montserrat; Bonifaci, Nuria; Gomez-Baldo, Laia; Bogliolo, Massimo; Lazaro, Conxi; Blanco, Ignacio; Brunet, Joan; Aguilar, Helena; Uhrhammer, Nancy; Torres, Diana; Caligo, Maria Adelaide; Godwin, Andrew K; Fernandez-Rodriguez, Juana; Imyanitov, Evgeny N; Janavicius, Ramunas; (gemo), Groupe Genetique et Cancer; Sinilnikova, Olga M; Stoppa-Lyonnet, Dominique; Davidson, Rosemarie; Mazoyer, Sylvie; Peyrat, Jean-Philippe; Verny-Pierre, Carole; Castera, Laurent; de Pauw, Antoine; Bignon, Yves-Jean; Vennin, Philippe; Fert Ferrer, Sandra; Collonge-Rame, Marie-Agnes; Mortemousque, Isabelle; Ramirez, Maria J; McGuffog, Lesley; Chenevix-Trench, Georgia; Pereira-Smith, Olivia M; Chu, Carol; Antoniou, Antonis C; Renwick, Anthony; Ceron, Julian; Tominaga, Kaoru; Surralles, Jordi; Pujana, Miguel Angel; Castella, Maria; Rahman, Nazneen; Kuhl, Julia; Neveling, Kornelia; Schindler, Detlev; Hernandez, Gonzalo; (embrace), Epidemiological Study of Familial Breast Cancers; Easton, Douglas F; Peock, Susan; Cook, Margaret; Oliver, Clare T; Frost, Debra; Blok, Marinus J; Platte, Radka; Ong, Kai-Ren; Evans, D Gareth; Lalloo, Fiona; Eeles, Rosalind; Izatt, Louise; Cook, Jackie; Douglas, Fiona; Hodgson, Shirley V; Brewer, Carole; Bernard, Loris; Morrison, Patrick J; Porteous, Mary; Peterlongo, Paolo; van Os, Theo A; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Roversi, Gaia; Barile, Monica; Viel, Alessandra; Radice, Paolo; Pasini, Barbara; Ottini, Laura; Putignano, Anna Laura; Savarese, Antonella; Healey, Sue; Spurdle, Amanda B; Chen, Xiaoqing; Beesley, Jonathan; (kConFab), Kathleen Cuningham Foundation Consortium for Research; Rookus, Matti A; Verhoef, Senno; Osorio, Ana; Tilanus-Linthorst, Madeleine A; Meijers-Heijboer, Hanne E J; Vreeswijk, Maaike P; Asperen, Christi J; Bodmer, Danielle; Ausems, Margreet G E M; Hogervorst, Frans B; (hebon), Hereditary Breast and Ovarian Cancer Research Group Netherlands; Goldgar, David E; Buys, Saundra; Laitman, Yael; John, Esther M; Miron, Alexander; Southey, Melissa C; Caldes, Trinidad; Daly, Mary B; (bcfr), Breast Cancer Family Registry; (swe-brca), Swedish Breast Cancer Study; Harbst, Katja; Borg, Ake; Rantala, Johanna; Milgrom, Roni; Barbany-Bustinza, Gisela; Ehrencrona, Hans; Stenmark-Askmalm, Marie; Kaufman, Bella; Friedman, Eitan; Domchek, Susan M; Nathanson, Katherine L; Rebbeck, Timothy R; Johannsson, Oskar Thor; Couch, Fergus J; Wang, Xianshu; Seal, Sheila; Fredericksen, Zachary S; Benitez, Javier; Cuadras, Daniel; Moreno, Victor; Pientka, Friederike K; Depping, Reinhard; Bueren, Juan; Heikkinen, Tuomas; Nevanlinna, Heli; Hamann, Ute

2011-04-05T23:59:59.000Z

489

Einfuhrung in Tcl/Tk Wolfram Schenck  

E-Print Network (OSTI)

Einf¨uhrung in Tcl/Tk Teil 3 Wolfram Schenck AG Technische Informatik Universit¨at Bielefeld email: wschenck@ti.uni-bielefeld.de Version 1.01 14. Januar 2005 #12;Einf¨uhrung Tcl/Tk-Kurs (WS 04/05) Gesamt¨ubersicht 1. Einf¨uhrung 2. Einstieg in die Programmierung mit Tcl 3. Fortgeschrittener Umgang mit Tcl 4

Moeller, Ralf

490

Einfuhrung in Tcl/Tk Wolfram Schenck  

E-Print Network (OSTI)

Einf¨uhrung in Tcl/Tk Teil 2 Wolfram Schenck AG Technische Informatik Universit¨at Bielefeld email: wschenck@ti.uni-bielefeld.de Version 1.0 17. Dezember 2004 #12;Einf¨uhrung Tcl/Tk-Kurs (WS 04/05) Gesamt¨ubersicht 1. Einf¨uhrung 2. Einstieg in die Programmierung mit Tcl 3. Fortgeschrittener Umgang mit Tcl 4

Moeller, Ralf

491

Einfuhrung in Tcl/Tk Wolfram Schenck  

E-Print Network (OSTI)

Einf¨uhrung in Tcl/Tk Teil 4 Wolfram Schenck AG Technische Informatik Universit¨at Bielefeld email: wschenck@ti.uni-bielefeld.de Version 1.01 14. Januar 2005 #12;Einf¨uhrung Tcl/Tk-Kurs (WS 04/05) Gesamt¨ubersicht 1. Einf¨uhrung 2. Einstieg in die Programmierung mit Tcl 3. Fortgeschrittener Umgang mit Tcl 4

Moeller, Ralf

492

Einfuhrung in Tcl/Tk Wolfram Schenck  

E-Print Network (OSTI)

Einf¨uhrung in Tcl/Tk Wolfram Schenck AG Technische Informatik Universit¨at Bielefeld email: wschenck@ti.uni-bielefeld.de Version 1.0 10. Dezember 2004 #12;Einf¨uhrung Tcl/Tk-Kurs (WS 04/05) Gesamt¨ubersicht 1. Einf¨uhrung 2. Einstieg in die Programmierung mit Tcl 3. Fortgeschrittener Umgang mit Tcl 4

Moeller, Ralf

493

Script Handbook for Interactive Scientific Website Building  

E-Print Network (OSTI)

In this handbook, I collect the basic (and eventually upgraded) PHP scripts used for building the AMIDAS website (http://pisrv0.pit.physik.uni-tuebingen.de/darkmatter/amidas/), an online interactive simulation/data analysis system for direct Dark Matter detection experiments. Some basic, often used commands of (X)HTML, CSS, JavaScript, HTML DOM, and PHP are also given in an appendix.

Chung-Lin Shan

2010-08-06T23:59:59.000Z

494

Interacting Frameworks in Catalysis KungKiu Lau \\Lambda  

E-Print Network (OSTI)

of Manchester Manchester M13 9PL, UK kung­kiu@cs.man.ac.uk Shaoying Liu y Dept. of Computer Science Hiroshima City University 151­5, Ozuka, Numata­cho,Asaminami­ku Hiroshima, 731­31, Japan liu@white.sel.cs.hiroshima of the existing (semi­ \\Lambda Sponsored by Hiroshima City University under Hiroshima City Uni­ versity Grant

Lau, Kung-Kiu

495

Script Handbook for Interactive Scientific Website Building  

E-Print Network (OSTI)

In this handbook, I collect the basic (and eventually upgraded) PHP scripts used for building the AMIDAS website (http://pisrv0.pit.physik.uni-tuebingen.de/darkmatter/amidas/), an online interactive simulation/data analysis system for direct Dark Matter detection experiments. Some basic, often used commands of (X)HTML, CSS, JavaScript, HTML DOM, and PHP are also given in the appendix.

Shan, Chung-Lin

2010-01-01T23:59:59.000Z

496

JOURNAL DE PHYSIQUE Colloque C8, Supplement au no 12, Tome 49, decembre 1988  

E-Print Network (OSTI)

at the onset temperature 0.54 K. Since then, many experimentshave been performed to deter- mine the exact be shifted uni- formly (e.g. towards the U-poor side if uranium ox- ides are present). The samples were in Ta-foil and together with a piece of uranium, that serves as a get- ter, it is put into a quartz tube

Paris-Sud XI, Université de

497

Optical pH Sensors for High Temperature Environments  

Science Conference Proceedings (OSTI)

A novel pH measurement system based on remote absorption spectroscopy via two uni-directional optical fibers has been developed for use in cooling water sampling lines in power plants. The system was designed to operate at 200 degrees Celsius (392 degrees Fahrenheit) and 1379 kPa (200 psi) and, so far, has been shown to measure reproducibly the pH of a flowing stream at room temperature and 1379 kPa (200 psi).

2000-11-28T23:59:59.000Z

498

Z .Comparative Biochemistry and Physiology Part A 129 2001 405 415 Renal function in suckling and fasting pups of the  

E-Print Network (OSTI)

and fasting pups of the northern elephant seal Dorian S. Housera,U , Daniel E. Crockerb , Paul M. Webbc, Roger Williams Uni¨ersity, Bristol, RI 02809, USA Received 4 September 2000; received in revised form 11 with sterile water. w3 xPups were given 0.1 mCi of H methoxy-inulin at 9 days postpartum and 0.2 mCi at 18 22

Webb, Paul M.

499

Durchschniitlich 39 Zeichen pro Zeile Universitt Bayreuth D-95440 Bayreuth Besucher: Universittsstrae 30 Verwaltungsgebude  

E-Print Network (OSTI)

Garten: Von Steil-Eiche bis Berg-Ahorn Am Mittwoch, 28. Juli, ab 17.30 Uhr, findet eine Führung durch den ?kologisch- Botanischen Garten der Universität Bay- reuth unter dem Motto ,,Von Stiel-Eiche bis Berg'" im Botanischen Garten der Uni- versität Bayreuth am Mittwoch, 14. Juli, stellt die gekürten Baumarten

Ullmann, G. Matthias

500

Durchschniitlich 39 Zeichen pro Zeile Universitt Bayreuth D-95440 Bayreuth Besucher: Universittsstrae 30 Verwaltungsgebude  

E-Print Network (OSTI)

-Botanischen Garten Am Sonntag (7. Februar, ab 10 Uhr) findet im ?kologisch-Botanischer Garten der Universität- punkt ist der Eingang des Gartens, Uni- versitäts-Campus. Ab 11.30 Uhr schlie?t sich daran eine-Botanischer Garten, Ausstellungs- halle in den Gewächshäusern. * * * * * * * * * * * * Lesung: Aus den Stuben über

Ullmann, G. Matthias