Powered by Deep Web Technologies
Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Solar energy system demonstration project at Wilmington Swim School, New Castle, Delaware. Final report  

SciTech Connect (OSTI)

This document is the Final Report of the Solar Energy System located at the Wilmington, Swim School, New Castle, Delaware. This active solar system is composed of 2,700 square feet of Revere liquid flat plate collectors piped to a 2,800 gallon concrete storage tank located below ground near the building. A micro-computer based control system selects the optimal applications of the stored energy among space, domestic water and pool alternatives. The controlled logic is planned for serving the heat loads in the following order: space heat-new addition, domestic water-entire facility, and pool heating-entire facility. A modified trombe wall passive operation the active system will bypass the areas being served passively. The system was designed for a 40 percent heating and a 30 percent hot water solar contribution.

None

1980-07-01T23:59:59.000Z

2

Wilmington, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamson County, Tennessee:Willowick, Ohio:(Redirected from

3

Wilmington, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,SaveWhiskey Flats Geothermal Area Jump

4

Wilmington Manor, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamson County, Tennessee:Willowick, Ohio:

5

Delaware Land Protection Act (Delaware)  

Broader source: Energy.gov [DOE]

The Land Protection Act requires the Department of Natural Resources and Environmental Control to work with the Delaware Open Space Council to develop standards and criteria for determining the...

6

Delaware Solid Waste Authority (Delaware)  

Broader source: Energy.gov [DOE]

The Delaware Solid Waste Authority (DSWA) runs three landfills, all of which recover methane and generate electricity with a total capacity of 24 MWs. The DSWA Solid Waste Plan includes goals,...

7

Brownfield Assistance Program (Delaware)  

Broader source: Energy.gov [DOE]

The Brownfield Assistance Program, administrated by the Delaware Economic Development Office (DEDO) and funded from Delaware Strategic Fund, provides matching grants to owners and developers to...

8

ENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS  

E-Print Network [OSTI]

to a significant increase in total phosphorus. Several water quality parameters indicated a subsequent worseningENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS 2005-2006 by Michael A: The City of Wilmington, New Hanover County and the US EPA 319 Program (through NC Division of Water quality

Mallin, Michael

9

ENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS  

E-Print Network [OSTI]

, total nitrogen, orthophosphate and total phosphorus. Several water quality parameters indicatedENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS 2004-2005 by Michael A Hanover County Tidal Creeks Project and Year 7 of the Wilmington Watersheds Project. Water quality data

Mallin, Michael

10

Natural Gas Regulation- Delaware Public Service Commission (Delaware)  

Broader source: Energy.gov [DOE]

The Delaware Public Service Commission regulates only the distribution of natural gas to Delaware consumers. The delivery and administrative costs associated with natural gas distribution are...

11

Forestry Policies (Delaware)  

Broader source: Energy.gov [DOE]

Delaware's forests are managed by the State Forest Service (DFS), within the State Department of Agriculture. In 2010, the Forest Service issued its Resource Assessment and Strategy documents:

12

The South Wilmington Area remedial cost estimating methodology (RCEM) -- A planning tool and reality check for brownfield development  

SciTech Connect (OSTI)

The South Wilmington Area (SWA), which is comprised of 200 acres of multi-use urban lowlands adjacent to the Christina River, is a brownfields area that has been targeted for redevelopment/restoration as part of a major waterfront revitalization project for the City of Wilmington, Delaware. The vision for this riverfront development, which is being promoted by a state-funded development corporation, includes plans for a new harbor, convention and entertainment facilities, upscale residences, an urban wildlife refuge, and the restoration of the Christina River. However, the environmental quality of the SWA has been seriously impacted by an assortment of historic and current heavy industrial land-uses since the late 1800`s, and extensive environmental cleanup of this area will be required as part of any redevelopment plan. Given that the environmental cleanup cost will be a major factor in determining the overall economic feasibility of brownfield development in the SWA, a reliable means of estimating potential preliminary remedial costs, without the expense of costly investigative and engineering studies, was needed to assist with this redevelopment initiative. The primary chemicals-of-concern (COCs) area-wide are lead and petroleum compounds, however, there are hot-spot occurrences of polynuclear aromatic hydrocarbons (PAHs), PCBs, and other heavy metals such as arsenic and mercury.

Yancheski, T.B. [Tetra Tech, Inc., Christiana, DE (United States); Swanson, J.E. [Tetra Tech, Inc., Fairfax, VA (United States)

1996-12-31T23:59:59.000Z

13

Delaware Transportation Infrastructure Forum Problem Identification Statements  

E-Print Network [OSTI]

2013 Delaware Transportation Infrastructure Forum Problem Identification Statements Sponsored by The Delaware Center for Transportation and the Delaware Department of Transportation Delaware Center for Transportation Your main resource for transportation education and research Identifying Important Issues Related

Firestone, Jeremy

14

History of the development of the Wilmington oilfield and its EOR projects  

SciTech Connect (OSTI)

The City of Long Beach sits atop one of the largest oil fields in the world, the Wilmington Oilfield. Four areas are described: historical development of the Wilmington Oilfield, the environmental problem of subsidence, the present development and future plans for the Wilmington Oilfield including the EOR projects, and the projects about to be undertaken.

Colazas, X.C. [City of Long Beach, CA (United States)

1994-12-31T23:59:59.000Z

15

Hazardous Waste Management (Delaware)  

Broader source: Energy.gov [DOE]

The act authorizes the Delaware Department of Natural Resources and Environment Control (DNREC) to regulate hazardous waste and create a program to manage sources of hazardous waste. The act...

16

University of Delaware UNDERGRADUATE  

E-Print Network [OSTI]

Medical Institute c = National Science Foundation d = National Institute of Health e = Delaware Water: Causation for the severity difference between adult-onset and congenital Myotonic Dystrophy?. (47) Elizabeth

Firestone, Jeremy

17

Dam Safety (Delaware)  

Broader source: Energy.gov [DOE]

The Delaware Dam Safety Law was adopted in 2004 and provides the framework for proper design, construction, operation, maintenance, and inspection of dams in the interest of public health, safety,...

18

Delaware Greenhouse Gas Reduction Projects Grant Program (Delaware)  

Broader source: Energy.gov [DOE]

The Delaware Greenhouse Gas Reduction Projects Grant Program is funded by the Greenhouse Gas Reduction Projects Fund, established by the Act to Amend Title 7 of the Delaware Code Relating to a...

19

Delaware Electric Cooperative- Green Energy Fund  

Broader source: Energy.gov [DOE]

'''''Note: The Green Energy Fund regulations are currently under revision to improve program function and meet the requirements of the Delaware Energy Act. The Delaware Division of Energy and...

20

The Impact of Creating Civil Unions for Same-Sex Couples on Delawares Budget  

E-Print Network [OSTI]

Marriage on California's Budget, 16 S TAN . L. & P OL . RSex Couples on Delawares Budget Jody Herman Craig Konnothnet expenditures in the state budget by a small average of $

Herman, Jody L.; Konnoth, Craig J.; Badgett, M.V. Lee

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Chrome Deposit Corporation and the University of Delaware IAC...  

Broader source: Energy.gov (indexed) [DOE]

of Delaware students Joseph Camp and Nicole Suto; Keith Goossen, director of the Industrial Assessment Center; and Cesar Duarte, University of Delaware grad student. | Image...

22

Tax-Exempt Bond Financing (Delaware)  

Broader source: Energy.gov [DOE]

The Delaware Economic Development Authority provides tax-exempt bond financing for financial assistance to new or expanding businesses, governmental units and certain organizations that are exempt...

23

Increasing Waterflood Reserves in the Wilmington Oil Field Through Reservoir Characterization and Reservoir Management  

SciTech Connect (OSTI)

This project is intended to increase recoverable waterflood reserves in slope and basin reservoirs through improved reservoir characterization and reservoir management. The particular application of this project is in portions of Fault Blocks IV and V of the Wilmington Oil Field, in Long Beach, California, but the approach is widely applicable in slope and basin reservoirs. Transferring technology so that it can be applied in other sections of the Wilmington Field and by operators in other slope and basin reservoirs is a primary component of the project.

Chris Phillips; Dan Moos; Don Clarke; John Nguyen; Kwasi Tagbor; Roy Koerner; Scott Walker

1997-04-10T23:59:59.000Z

24

University of Delaware Energy Institute  

SciTech Connect (OSTI)

The main goal of this project funded through this DOE grant is to help in the establishment of the University of Delaware Energy Institute (UDEI) which is designed to be a long-term, on-going project. The broad mission of UDEI is to develop collaborative programs encouraging research activities in the new and emerging energy technologies and to partner with industry and government in meeting the challenges posed by the nationâ??s pressing energy needs.

Klein, Michael T

2012-09-30T23:59:59.000Z

25

Estimate of Extreme Wind, Wave, Surge, and Current Conditions Wilmington Canyon Integrated Design Project  

E-Print Network [OSTI]

1 Estimate of Extreme Wind, Wave, Surge, and Current Conditions for the Wilmington Canyon. In order to estimate loads during extreme wind and wave events, these events must be defined. The design. This paper does not treat wave spectral analysis, extreme wind shear, veer, clocking, turbulence intensity

Firestone, Jeremy

26

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. EPA requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard and must consider inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2001-09-28T23:59:59.000Z

27

Recovery Act State Memos Delaware  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L dDepartment ofList?Department09 Section 9990|UpdatedColoradoDelaware

28

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

29

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

30

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

31

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

32

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

33

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

34

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

35

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

36

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

37

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

38

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

39

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

40

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

42

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

43

Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies, Class III  

SciTech Connect (OSTI)

The objective of this project was to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California through the testing and application of advanced reservoir characterization and thermal production technologies. The successful application of these technologies would result in expanding their implementation throughout the Wilmington Field and, through technology transfer, to other slope and basin clastic (SBC) reservoirs.

City of Long Beach; Tidelands Oil Production Company; University of Southern California; David K. Davies and Associates

2002-09-30T23:59:59.000Z

44

Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies, Class III  

SciTech Connect (OSTI)

The objective of this project was to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California through the testing and application of advanced reservoir characterization and thermal production technologies. It was hoped that the successful application of these technologies would result in their implementation throughout the Wilmington Field and, through technology transfer, will be extended to increase the recoverable oil reserves in other slope and basin clastic (SBC) reservoirs.

City of Long Beach; Tidelands Oil Production Company; University of Southern California; David K. Davies and Associates

2002-09-30T23:59:59.000Z

45

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

46

Delaware River Basin Commission (Multiple States)  

Broader source: Energy.gov [DOE]

The Delaware River Basin Commission (DRBC) is a federal-interstate compact government agency that was formed by concurrent legislation enacted in 1961 by the United States and the four basin states...

47

Environmental Permit Application Background Statement (Delaware)  

Broader source: Energy.gov [DOE]

The purpose of Chapter 79 of Delaware Title 7 is to ensure that the State has adequate information about the background of applicants or regulated parties for the purposes of processing permits and...

48

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2003-09-30T23:59:59.000Z

49

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2000-09-28T23:59:59.000Z

50

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2002-09-21T23:59:59.000Z

51

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2005-09-30T23:59:59.000Z

52

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2004-09-30T23:59:59.000Z

53

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

54

Increasing Waterflooding Reservoirs in the Wilmington Oil Field through Improved Reservoir Characterization and Reservoir Management, Class III  

SciTech Connect (OSTI)

This project was intended to increase recoverable waterflood reserves in slope and basin reservoirs through improved reservoir characterization and reservoir management. The particular application of this project is in portions of Fault Blocks IV and V of the Wilmington Oil Field, in Long Beach, California, but the approach is widely applicable in slope and basin reservoirs, transferring technology so that it can be applied in other sections of the Wilmington field and by operators in other slope and basin reservoirs is a primary component of the project.

Koerner, Roy; Clarke, Don; Walker, Scott; Phillips, Chris; Nguyen, John; Moos, Dan; Tagbor, Kwasi

2001-08-07T23:59:59.000Z

55

Delaware Identity in the Cherokee Nation  

E-Print Network [OSTI]

This article examines how the Delawares responded to the challenges that living among the Cherokees posed to their identity. It also focuses on the question of how this forced co-residence developed and what the United States role in the matter was...

Haake, Claudia

2002-03-01T23:59:59.000Z

56

Alternative Fuels Data Center: Delaware Information  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home Page onAlternativeConnecticut Information to someoneDelaware

57

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

58

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

59

INCREASING WATERFLOOD RESERVES IN THE WILMINGTON OIL FIELD THROUGH IMPROVED RESERVOIR CHARACTERIZATION AND RESERVOIR MANAGEMENT  

SciTech Connect (OSTI)

This project increased recoverable waterflood reserves in slope and basin reservoirs through improved reservoir characterization and reservoir management. The particular application of this project is in portions of Fault Blocks IV and V of the Wilmington Oil Field, in Long Beach, California, but the approach is widely applicable in slope and basin reservoirs. Transferring technology so that it can be applied in other sections of the Wilmington Field and by operators in other slope and basin reservoirs is a primary component of the project. This project used advanced reservoir characterization tools, including the pulsed acoustic cased-hole logging tool, geologic three-dimensional (3-D) modeling software, and commercially available reservoir management software to identify sands with remaining high oil saturation following waterflood. Production from the identified high oil saturated sands was stimulated by recompleting existing production and injection wells in these sands using conventional means as well as a short radius redrill candidate. Although these reservoirs have been waterflooded over 40 years, researchers have found areas of remaining oil saturation. Areas such as the top sand in the Upper Terminal Zone Fault Block V, the western fault slivers of Upper Terminal Zone Fault Block V, the bottom sands of the Tar Zone Fault Block V, and the eastern edge of Fault Block IV in both the Upper Terminal and Lower Terminal Zones all show significant remaining oil saturation. Each area of interest was uncovered emphasizing a different type of reservoir characterization technique or practice. This was not the original strategy but was necessitated by the different levels of progress in each of the project activities.

Scott Walker; Chris Phillips; Roy Koerner; Don Clarke; Dan Moos; Kwasi Tagbor

2002-02-28T23:59:59.000Z

60

Program Thursday, March 10, 2011 UNIVERSITY of DELAWARE  

E-Print Network [OSTI]

Program Thursday, March 10, 2011 UNIVERSITY of DELAWARE Energy Institute Annual Symposium www.energy, Institute of Energy Conversion 11:15 a.m. Solar Hydrogen Robert Opila - Professor, Materials Science.udel.edu March 10, 2011 8:00 a.m. ­ 6:00 p.m. John M. Clayton Hall Newark, DE UNIVERSITY of DELAWARE Energy

Firestone, Jeremy

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

PEPCO Energy Services (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocusOski Energy LLC Place: Reno, NevadaOtterDelaware) Jump to:

62

Categorical Exclusion Determinations: Delaware | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartmentTie Ltd:JuneNovember 26, 20149 CategoricalColorado CategoricalDelaware

63

Delaware, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,Delaware

64

Delaware/Wind Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,DelawareResources <

65

Brookside, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Areais a village in CookEnergy Information WarmDelaware:

66

Delaware Number of Natural Gas Consumers  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42YearDelaware Natural Gas7,541

67

Delaware Supplemental Supplies of Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42YearDelaware Natural2 0.2 0.22 2

68

Energy Incentive Programs, Delaware | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergyIDIQBusinessin Jamaica, N.Y.EnergyDepartmentCaliforniaDelaware Energy

69

University of Delaware | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTagusparkCalculator JumpUnited States:Delaware Jump to: navigation,

70

Smyrna, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to: navigation,PvtSouth Dakota)Slovenia:SmilingSmithtownDelaware:

71

Claymont, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy Resources JumpSouth Dakota: EnergyClaymont, Delaware:

72

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

University of Delaware Department of Electrical and Computer Engineering Computer Architecture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 6 Curve fit to calculate Var[ffi] in plot ffi 2 vs Norm . . . . . . . . . . . . . . 9 7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 8 Error Curve analysis: tan (`) vs P i . . . . . . . . . . . . . . . . . . . . . 11 9 Dupont

Gao, Guang R.

73

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

University of Delaware Department of Electrical and Computer Engineering Computer Architecture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 6 Curve t to calculate Var ] in plot 2 vs Norm . . . . . . . . . . . . . . 9 7 Distribution Error Curve analysis: tan ( ) vs Pi . . . . . . . . . . . . . . . . . . . . . 11 9 Dupont's Data: Square

Gao, Guang R.

74

Passive solar homes in Delaware Valley  

SciTech Connect (OSTI)

This paper examines ten single family residences in the Delaware Valley area which include passive solar design features. The study identifies successful and failed solar features of the houses, evaluates solar performance of a few houses, and examines occupants satisfaction with their houses. The study described in this paper includes the following: description of the overall passive solar design and listing of solar features used in each house, survey of each house in its present condition documenting changes to the original design (if any), summary of occupant questionnaire and interviews of house owners regarding their evaluation of house performance. Owners in this study retained positive attitude to their homes in spite of the problems with some solar features. Modifications to the solar features have been significant, but in no case was the solar aspect abandoned.

Kendig, J. [New Jersey Inst. of Tech., Princeton, NJ (United States)

1997-12-31T23:59:59.000Z

75

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

76

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

77

Increasing Heavy Oil Reserves in the Wilmington Oil Field through Advanced Reservoir Characterization and Thermal Production Technologies  

SciTech Connect (OSTI)

The objective of this project is to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California. This is realized through the testing and application of advanced reservoir characterization and thermal production technologies. It is hoped that the successful application of these technologies will result in their implementation throughout the Wilmington Field and through technology transfer, will be extended to increase the recoverable oil reserves in other slope and basin clastic (SBC) reservoirs. The existing steamflood in the Tar zone of Fault Block (FB) II-A has been relatively insufficient because of several producability problems which are common in SBC reservoir; inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil and non-uniform distribution of the remaining oil. This has resulted in poor sweep efficiency, high steam-oil ratios, and early breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves.

City of Long Beach; David K.Davies and Associates; Tidelands Oil Production Company; University of Southern California

1999-06-25T23:59:59.000Z

78

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The objective of this project is to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California through the testing and application of advanced reservoir characterization and thermal production technologies. The successful application of these technologies will result in expanding their implementation throughout the Wilmington Field and, through technology transfer, to other slope and basin clastic (SBC) reservoirs. The existing steamflood in the Tar zone of Fault Block II-A (Tar II-A) has been relatively inefficient because of several producibility problems which are common in SBC reservoirs: inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil and non-uniform distribution of the remaining oil. This has resulted in poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. A suite of advanced reservoir characterization and thermal production technologies are being applied during the project to improve oil recovery and reduce operating costs.

Scott Hara

2001-06-27T23:59:59.000Z

79

2013/2014 University of Delaware Library www.udel.edu/library WELCOME TO THE LIBRARY  

E-Print Network [OSTI]

2013/2014 University of Delaware Library www.udel.edu/library WELCOME TO THE LIBRARY Greetings, Welcome to the University of Delaware Library, which includes the Morris Library and three branch libraries. This is an exciting time for the University of Delaware Library, as more and more students

Firestone, Jeremy

80

2011/2012 University of Delaware Library www.udel.edu/library WELCOME TO THE LIBRARY  

E-Print Network [OSTI]

2011/2012 University of Delaware Library www.udel.edu/library WELCOME TO THE LIBRARY New Library Home Page University of Delaware Library OFFICE OF THE VICE PROVOST & MAY MORRIS DIRECTOR OF LIBRARIES-831-2231 Fax: 302-831-1046 Greetings, Welcome to the University of Delaware Library which includes the Morris

Gao, Guang R.

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

82

Community Police Academy Hosted By: University of Delaware Police  

E-Print Network [OSTI]

Community Police Academy Hosted By: University of Delaware Police When: Wednesdays, 6:00 p.m. - 9:00 p.m. (March 4th through April 29th , 2015) Where: 413 Academy Street Newark DE 19716 - University should I expect to learn: The Community Police Academy (CPA) is an informative learning process

Firestone, Jeremy

83

University of Delaware 2014 Campus Security and Fire Safety Report  

E-Print Network [OSTI]

of Criminal Actions or Emergencies 5 Access to Campus Facilities 6 Maintenance and Security of Campus://www.udel.edu//police/policies/missing-student.html The University of Delaware is a state-assisted, privately controlled institution of higher education. The main

Firestone, Jeremy

84

EA-1782: University of Delaware Lewes Campus Onsite Wind Energy Project  

Broader source: Energy.gov [DOE]

The University of Delaware has constructed a wind turbine adjacent to its College of Earth, Ocean, and Environment campus in Lewes, Delaware. DOE proposed to provide the University a $1.43 million grant for this Wind Energy Project from funding provided in the Omnibus Appropriations Act of 2009 (Public Law 111-8) and an additional $1 million provided in the Energy and Water Development Appropriations Act of Fiscal Year 2010. This EA analyzed the potential environmental impacts of the University of Delawares Wind Energy Project at its Lewes campus and, for purposes of comparison, an alternative that assumes the wind turbine had not been constructed.

85

Chrome Deposit Corporation and the University of Delaware IAC: Another Energy Efficiency Success Story  

Broader source: Energy.gov [DOE]

Following an Energy Savings Assessment conducted by the University of Delaware's Industrial Assessment Center, Chrome Deposit Corporation's Newark, DE plant is seeing significant energy savings.

86

Delaware Company Breathes New Life into Old Post Office Building |  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion |Energy UsageAUDITVehiclesTanklessDOJ Title Standards forDepartment of Energy Delaware

87

Hess Retail Natural Gas and Elec. Acctg. (Delaware) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power BasicsGermany: EnergyPower FinanceInformation Delaware References: EIA

88

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The objective of this project is to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California, through the testing and application of advanced reservoir characterization and thermal production technologies. The hope is that successful application of these technologies will result in their implementation throughout the Wilmington Field and, through technology transfer, will be extended to increase the recoverable oil reserves in other slope and basin clastic (SBC) reservoirs. The existing steamflood in the Tar zone of Fault Block II-A (Tar II-A) has been relatively inefficient because of several producibility problems which are common in SBC reservoirs: inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil and non-uniform distribution of the remaining oil. This has resulted in poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. A suite of advanced reservoir characterization and thermal production technologies are being applied during the project to improve oil recovery and reduce operating costs, including: (1) Development of three-dimensional (3-D) deterministic and stochastic reservoir simulation models--thermal or otherwise--to aid in reservoir management of the steamflood and post-steamflood phases and subsequent development work. (2) Development of computerized 3-D visualizations of the geologic and reservoir simulation models to aid reservoir surveillance and operations. (3) Perform detailed studies of the geochemical interactions between the steam and the formation rock and fluids. (4) Testing and proposed application of a novel alkaline-steam well completion technique for the containment of the unconsolidated formation sands and control of fluid entry and injection profiles. (5) Installation of a 2100 ft, 14 inch insulated, steam line beneath a harbor channel to supply steam to an island location. (6) Testing and proposed application of thermal recovery technologies to increase oil production and reserves: (a) Performing pilot tests of cyclic steam injection and production on new horizontal wells. (b) Performing pilot tests of hot water-alternating-steam (WAS) drive in the existing steam drive area to improve thermal efficiency. (7) Perform a pilot steamflood with the four horizontal injectors and producers using a pseudo steam-assisted gravity-drainage (SAGD) process. (8) Advanced reservoir management, through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring and evaluation.

Unknown

2001-08-08T23:59:59.000Z

89

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The overall objective of this project is to increase heavy oil reserves in slope and basin clastic (SBC) reservoirs through the application of advanced reservoir characterization and thermal production technologies. The project involves improving thermal recovery techniques in the Tar Zone of Fault Blocks II-A and V (Tar II-A and Tar V) of the Wilmington Field in Los Angeles County, near Long Beach, California. A primary objective is to transfer technology which can be applied in other heavy oil formations of the Wilmington Field and other SBC reservoirs, including those under waterflood. The thermal recovery operations in the Tar II-A and Tar V have been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing an 2400 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Scott Hara

2004-03-05T23:59:59.000Z

90

Valuing Public Preferences for Offshore Wind Power Andrew D. Krueger, University of Delaware, College of Marine and Earth Studies  

E-Print Network [OSTI]

Valuing Public Preferences for Offshore Wind Power Andrew D. Krueger, University of Delaware there are no offshore projects operating in the U.S. to date, proposals for such developments are pending in Massachusetts, New York, Delaware, and Texas. For Delaware, offshore wind power is currently the only cost

Firestone, Jeremy

91

ELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Solar Cell Operation  

E-Print Network [OSTI]

is lost as heat. energy Eg 2 31 Absorption process #12;ELEG620: Solar Electric Systems UniversityELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Solar Cell and shunt resistance). #12;ELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C

Honsberg, Christiana

92

ELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Introduction  

E-Print Network [OSTI]

of Delaware, ECE Spring 2008 C. Honsberg Sources of energy Geothermal: Location of resource Wind: Site issues · Importance of energy issue · Impact of photovoltaic power · Electricity generation overview · Why use solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Importance of the energy problem

Honsberg, Christiana

93

Potential Presence of Endangered Wildlife Species at the University of Delaware Wind Power Project Site  

E-Print Network [OSTI]

Potential Presence of Endangered Wildlife Species at the University of Delaware Wind Power Project wind power project site, we conducted an analysis of the suitability of habitat within the project of potential risk to the species. #12;Corn Snake ­ Fairly common in Delaware, but is not likely to be present

Firestone, Jeremy

94

CX-001153: Categorical Exclusion Determination  

Broader source: Energy.gov [DOE]

Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Wilmington) Date: 03/11/2010Location(s): Wilmington, DelawareOffice(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory

95

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

96

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

97

Consolidated Edison Sol Inc (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin:2003) | Open EnergyConductiveInternational JumpDelaware

98

Delaware - Compare - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperativeA2.Reformulated, AverageCoos Bay Field Gulf Coast CoalData6)2Delaware

99

Delaware County Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,Delaware County Elec Coop

100

Delaware County, Indiana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,Delaware County Elec

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Delaware County, Iowa: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,Delaware County

102

Delaware County, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,Delaware CountyCounty is a

103

Delaware County, Oklahoma: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,Delaware CountyCounty is

104

Delaware County, Pennsylvania: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,Delaware CountyCounty

105

Delaware Natural Gas Vehicle Fuel Consumption (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42YearDelaware Natural Gas Vehicle

106

Delaware Price of Natural Gas Delivered to Residential Consumers (Dollars  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42YearDelaware Natural Gas7,541per

107

Town of Smyrna, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, IncTipmont RuralMiddletown Place:InformationSmyrna, Delaware

108

Delaware Recovery Act State Memo | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergy DOEDealing With the Issues of NuclearHigh ImpactDelaware Recovery Act

109

Delaware - Seds - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperativeA2. World liquids consumption by9 U.S.Colorado -Delaware - Seds - U.S.

110

City of Newark, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:Energy Nebraska (UtilityGeorgia (Utility Company)InformationDelaware

111

Delaware Regions | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 IndustrialIsadoreConnecticut Regions National Science Bowl® (NSB)DecemberDelaware

112

Increasing heavy oil reserves in the Wilmington Oil Field through advanced reservoir characterization and thermal production technologies. Annual report, March 30, 1995--March 31, 1996  

SciTech Connect (OSTI)

The objective of this project is to increase heavy oil reserves in a portion of the Wilmington Oil Field, near Long Beach, California, by implementing advanced reservoir characterization and thermal production technologies. Based on the knowledge and experience gained with this project, these technologies are intended to be extended to other sections of the Wilmington Oil Field, and, through technology transfer, will be available to increase heavy oil reserves in other slope and basin clastic (SBC) reservoirs. The project involves implementing thermal recovery in the southern half of the Fault Block II-A Tar zone. The existing steamflood in Fault Block II-A has been relatively inefficient due to several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. A suite of advanced reservoir characterization and thermal production technologies are being applied during the project to improve oil recovery efficiency and reduce operating costs.

NONE

1997-09-01T23:59:59.000Z

113

Cost-Effectiveness of ASHRAE Standard 90.1-2010 for the State of Delaware  

SciTech Connect (OSTI)

Moving to the ANSI/ASHRAE/IES Standard 90.1-2010 version from the Base Code (90.1-2007) is cost-effective for all building types and climate zones in the State of Delaware.

Hart, Philip R.; Rosenberg, Michael I.; Xie, YuLong; Zhang, Jian; Richman, Eric E.; Elliott, Douglas B.; Loper, Susan A.; Myer, Michael

2013-11-01T23:59:59.000Z

114

UNDERLYING MOTIVATIONS FOR DELAWARE PUBLIC PARTICIPATION IN SUPPORT OF OFFSHORE WIND  

E-Print Network [OSTI]

UNDERLYING MOTIVATIONS FOR DELAWARE PUBLIC PARTICIPATION IN SUPPORT OF OFFSHORE WIND: IMPLICATIONS PARTICIPATION IN SUPPORT OF OFFSHORE WIND: IMPLICATIONS FOR STATE ENERGY POLICY by Jacqueline D Piero Approved ................................................................................................. 3 Offshore wind: a new option in the United States.............................................. 4

Firestone, Jeremy

115

Delaware's Energy Efficiency Potential and Program Scenarios to Meet Its Energy Efficiency Resource Standard  

E-Print Network [OSTI]

, state, federal and international agencies and nonprofit organizations. The Center is composed and development, environmental justice, conservation and renewable energy options, integrated resource planningDelaware's Energy Efficiency Potential and Program Scenarios to Meet Its Energy Efficiency Resource

Delaware, University of

116

Weatherization Builds on Delaware's Innovative Past: Weatherization Assistance Close-Up Fact Sheet  

SciTech Connect (OSTI)

Delaware demonstrates its commitment to technology and efficiency through the Weatherization Program. Weatherization uses advanced technologies and techniques to reduce energy costs for low-income families by increasing the energy efficiency of their homes.

D& R International

2001-10-10T23:59:59.000Z

117

Surface Currents and Winds at the Delaware Bay Mouth  

SciTech Connect (OSTI)

Knowledge of the circulation of estuaries and adjacent shelf waters has relied on hydrographic measurements, moorings, and local wind observations usually removed from the region of interest. Although these observations are certainly sufficient to identify major characteristics, they lack both spatial resolution and temporal coverage. High resolution synoptic observations are required to identify important coastal processes at smaller scales. Long observation periods are needed to properly sample low-frequency processes that may also be important. The introduction of high-frequency (HF) radar measurements and regional wind models for coastal studies is changing this situation. Here we analyze synoptic, high-resolution surface winds and currents in the Delaware Bay mouth over an eight-month period (October 2007 through May 2008). The surface currents were measured by two high-frequency radars while the surface winds were extracted from a data-assimilating regional wind model. To illustrate the utility of these monitoring tools we focus on two 45-day periods which previously were shown to present contrasting pictures of the circulation. One, the low-outflow period is from 1 October through 14 November 2007; the other is the high-outflow period from 3 March through 16 April 2008. The large-scale characteristics noted by previous workers are clearly corroborated. Specifically the M2 tide dominates the surface currents, and the Delaware Bay outflow plume is clearly evident in the low frequency currents. Several new aspects of the surface circulation were also identified. These include a map of the spatial variability of the M2 tide (validating an earlier model study), persistent low-frequency cross-mouth flow, and a rapid response of the surface currents to a changing wind field. However, strong wind episodes did not persist long enough to set up a sustained Ekman response.

Muscarella, P A; Barton, N P; Lipphardt, B L; Veron, D E; Wong, K C; Kirwan, A D

2011-04-06T23:59:59.000Z

118

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., CA. Through June 2002, project work has been completed on the following activities: data preparation; basic reservoir engineering; developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model and a rock-log model; well drilling and completions; and surface facilities on the Fault Block II-A Tar Zone (Tar II-A). Work is continuing on research to understand the geochemistry and process regarding the sand consolidation well completion technique, final reservoir tracer work, operational work and research studies to prevent thermal-related formation compaction in the Tar II-A steamflood area, and operational work on the Tar V post-steamflood pilot and Tar II-A post-steamflood projects. During the Third Quarter 2002, the project team essentially completed implementing the accelerated oil recovery and reservoir cooling plan for the Tar II-A post-steamflood project developed in March 2002 and is proceeding with additional related work. The project team has completed developing laboratory research procedures to analyze the sand consolidation well completion technique and will initiate work in the fourth quarter. The Tar V pilot steamflood project terminated hot water injection and converted to post-steamflood cold water injection on April 19, 2002. Proposals have been approved to repair two sand consolidated horizontal wells that sanded up, Tar II-A well UP-955 and Tar V well J-205, with gravel-packed inner liner jobs to be performed next quarter. Other well work to be performed next quarter is to convert well L-337 to a Tar V water injector and to recomplete vertical well A-194 as a Tar V interior steamflood pattern producer. Plans have been approved to drill and complete well A-605 in Tar V in the first quarter 2003. Plans have been approved to update the Tar II-A 3-D deterministic reservoir simulation model and run sensitivity cases to evaluate the accelerated oil recovery and reservoir cooling plan. The Tar II-A post-steamflood operation started in February 1999 and steam chest fillup occurred in September-October 1999. The targeted reservoir pressures in the ''T'' and ''D'' sands are maintained at 90 {+-} 5% hydrostatic levels by controlling water injection and gross fluid production and through the bimonthly pressure monitoring program enacted at the start of the post-steamflood phase. Well work related to the Tar II-A accelerated oil recovery and reservoir cooling plan began in March 2002 with oil production increasing from 1009 BOPD in the first quarter to 1145 BOPD in the third quarter. Reservoir pressures have been increased during the quarter from 88% to 91% hydrostatic levels in the ''T'' sands and from 91% to 94% hydrostatic levels in the ''D'' sands. Well work during the quarter is described in the Reservoir Management section. The post-steamflood production performance in the Tar V pilot project has been below projections because of wellbore mechanical limitations and the loss of a horizontal producer a second time to sand inflow that are being addressed in the fourth quarter. As the fluid production temperatures exceeded 350 F, our self-imposed temperature limit, the pilot steamflood was converted to a hot waterflood project in June 2001 and converted to cold water injection on April 19, 2002.

Scott Hara

2002-11-08T23:59:59.000Z

119

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

120

Subscriber access provided by University of Delaware | Library Environmental Science & Technology is published by the American Chemical Society.  

E-Print Network [OSTI]

Subscriber access provided by University of Delaware | Library Environmental Science & Technology + 300?7 = 704923 Page 1 of 28 ACS Paragon Plus Environment Environmental Science & Technology 1 2 3 4 5. Sparks1 6 7 1 Environmental Soil Chemistry Group, Delaware Environmental Institute and Department

Sparks, Donald L.

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Implementation of the El Mar (Delaware) Unit CO2 flood  

SciTech Connect (OSTI)

Union Royalty, Inc., Amoco Production Company, and Enron Liquids Pipeline Company recently announced that they have commenced operations of an innovative enhanced oil recovery project at the El Mar (Delaware) Unit in Loving County, Texas, about 100 miles west of Midland, Texas. The project will convert the unit`s existing oil recovery system from a secondary (waterflood) system to a tertiary (CO2 flood) system designed to use carbon dioxide and water to increase crude oil production from the unit. What makes this EOR project unique is the creative deal structured by the partners involved. Amoco, Union Royalty, and Enron have worked out an unprecedented arrangement whereby Amoco essentially trades CO2 for an interest in Union Royalty`s future oil production from the unit. By pioneering this innovative deal new production life has been restored to a field that otherwise might dry up. Enron is participating in the project by transporting CO2 to the unit via a 40-mile expansion of its Central Basin Pipeline system from the Dollarhide oil field in Andrews county, Texas. The project will be implemented in four phases. The first phase in operation today comprises seven CO2 injection wells which have begun to process the reservoir with CO2. Plans now call for more CO2 injectors to be installed during the next three to five years until a total of 65 CO2 injectors and an on-site CO2 compression facility serve the unit`s 70 production wells.

McKnight, T.N. Jr. [Union Royalty, Inc., Midland, TX (United States); Merchant, D.L.

1995-12-31T23:59:59.000Z

122

Class III Mid-Term Project, "Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies"  

SciTech Connect (OSTI)

The overall objective of this project was to increase heavy oil reserves in slope and basin clastic (SBC) reservoirs through the application of advanced reservoir characterization and thermal production technologies. The project involved improving thermal recovery techniques in the Tar Zone of Fault Blocks II-A and V (Tar II-A and Tar V) of the Wilmington Field in Los Angeles County, near Long Beach, California. A primary objective has been to transfer technology that can be applied in other heavy oil formations of the Wilmington Field and other SBC reservoirs, including those under waterflood. The first budget period addressed several producibility problems in the Tar II-A and Tar V thermal recovery operations that are common in SBC reservoirs. A few of the advanced technologies developed include a three-dimensional (3-D) deterministic geologic model, a 3-D deterministic thermal reservoir simulation model to aid in reservoir management and subsequent post-steamflood development work, and a detailed study on the geochemical interactions between the steam and the formation rocks and fluids. State of the art operational work included drilling and performing a pilot steam injection and production project via four new horizontal wells (2 producers and 2 injectors), implementing a hot water alternating steam (WAS) drive pilot in the existing steamflood area to improve thermal efficiency, installing a 2400-foot insulated, subsurface harbor channel crossing to supply steam to an island location, testing a novel alkaline steam completion technique to control well sanding problems, and starting on an advanced reservoir management system through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation. The second budget period phase (BP2) continued to implement state-of-the-art operational work to optimize thermal recovery processes, improve well drilling and completion practices, and evaluate the geomechanical characteristics of the producing formations. The objectives were to further improve reservoir characterization of the heterogeneous turbidite sands, test the proficiency of the three-dimensional geologic and thermal reservoir simulation models, identify the high permeability thief zones to reduce water breakthrough and cycling, and analyze the nonuniform distribution of the remaining oil in place. This work resulted in the redevelopment of the Tar II-A and Tar V post-steamflood projects by drilling several new wells and converting idle wells to improve injection sweep efficiency and more effectively drain the remaining oil reserves. Reservoir management work included reducing water cuts, maintaining or increasing oil production, and evaluating and minimizing further thermal-related formation compaction. The BP2 project utilized all the tools and knowledge gained throughout the DOE project to maximize recovery of the oil in place.

Scott Hara

2007-03-31T23:59:59.000Z

123

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

124

Differential Supply of Autochthonous Organic Carbon and Nitrogen to the Microbial Loop in the Delaware Estuary  

E-Print Network [OSTI]

Differential Supply of Autochthonous Organic Carbon and Nitrogen to the Microbial Loop to heterotrophic bacteria (bacteria) has been re-evaluated in the Delaware Estuary, considering carbon (C sources of organic matter to the estuarine microbial loop. Introduction The fate of organic matter

125

Geothermal energy: tomorrow's alternative today. A handbook for geothermal-energy development in Delaware  

SciTech Connect (OSTI)

This is a general procedure guide to various technical, economic, and institutional aspects of geothermal development in Delaware. The following are covered: geothermal as an alternative, resource characteristics, geology, well mechanics and pumping systems, fluid disposal, direct heat utilization-feasibility, environmental and legal issues, permits and regulations, finance and taxation, and steps necessary for geothermal development. (MHR)

Mancus, J.; Perrone, E.

1982-08-01T23:59:59.000Z

126

ELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Photovoltaic Systems  

E-Print Network [OSTI]

1 ELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Photovoltaic Systems · Central issues in photovoltaic systems · Characteristics of energy systems & performance, these parameters determine the minimum effective system size. · Thermal-based systems are · PV systems are both

Honsberg, Christiana

127

University of Delaware Technical Analysis for On-Site Wind Generation  

E-Print Network [OSTI]

. The information and analyses presented herein is based on wind development best practices, commercially available Generation At the University of Delaware iii DISCLAIMER This report is presented in response to the contract-1 12 Month Electricity Usage Data 21 Figure 3-2 Average Demand by Month 21 Figure 3-3 PPCA Charge

Firestone, Jeremy

128

ELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Solar Radiation  

E-Print Network [OSTI]

ELEG620: Solar Electric Systems University of Delaware, ECE Spring 2008 C. Honsberg Solar Radiation Solar Radiation: Effects of atmosphere, angular dependence of radiation, variation of solar radiation ­ Calculation of Solar Radiation: · Estimate of intensity of solar radiation · Angular Dependence ­ Solar Noon

Honsberg, Christiana

129

Feasibility Study of Economics and Performance of Solar Photovoltaics at the Standard Chlorine of Delaware Superfund Site in Delaware City, Delaware. A Study Prepared in Partnership with the Environmental Protection Agency for the RE-Powering America's Land Initiative: Siting Renewable Energy on Potentially Contaminated Land and Mine Sites  

SciTech Connect (OSTI)

The U.S. Environmental Protection Agency (EPA), in accordance with the RE-Powering America's Land initiative, selected the Standard Chlorine of Delaware site in Delaware City, Delaware, for a feasibility study of renewable energy production. The National Renewable Energy Laboratory (NREL) provided technical assistance for this project. The purpose of this report is to assess the site for a possible photovoltaic (PV) system installation and estimate the cost, performance, and site impacts of different PV options. In addition, the report recommends financing options that could assist in the implementation of a PV system at the site.

Salasovich, J.; Geiger, J.; Mosey, G.; Healey, V.

2013-06-01T23:59:59.000Z

130

Subscriber access provided by University of Delaware | Library Environmental Science & Technology is published by the American Chemical Society.  

E-Print Network [OSTI]

Subscriber access provided by University of Delaware | Library Environmental Science & Technology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Article Arsenic

Sparks, Donald L.

131

Authigenic clay minerals in sandstones of the Delaware Mountain Group: Bell Canyon and Cherry Canyon Formations, Waha Field, West Texas  

E-Print Network [OSTI]

AUTHIGENIC CLAY MINERALS IN SANDSTONES OF THE DELAWARE MOUNTAIN GROUP: BELL CANYON AND CHERRY CANYON FORMATIONS, WAHA FIELD, WEST TEXAS A Thesis by SUZETTE DENISE WALLING Submitted to the Office of Graduate Studies of Texas A&M University... in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December 1992 Major Subject: Geology AUTHIGENIC CLAY MINERALS IN SANDSTONES OF THE DELAWARE MOUNTAIN GROUP: BELL CANYON AND CHERRY CANYON FORMATIONS, WAHA FIELD, WEST TEXAS...

Walling, Suzette Denise

1992-01-01T23:59:59.000Z

132

Increasing heavy oil reservers in the Wilmington oil Field through advanced reservoir characterization and thermal production technologies, technical progress report, October 1, 1996--December 31, 1996  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. using advanced reservoir characterization and thermal production technologies. The existing steamflood in the Tar zone of Fault Block (FB) 11-A has been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing a 2100 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Hara, S. [Tidelands Oil Production Co., Long Beach, CA (United States)], Casteel, J. [USDOE Bartlesville Project Office, OK (United States)

1997-05-11T23:59:59.000Z

133

Lead Sorption onto Ferrihydrite. 2. Surface Complexation Modeling  

E-Print Network [OSTI]

of Plant and Soil Sciences, University of Delaware, Newark, Delaware 19717, and DuPont Engineering Technology, Brandywine Building, Wilmington, Delaware 19898 Few studies have combined molecular- and macro of existing SCMs to predict Pb(II) sorption onto 2-line ferrihydrite over a wide range of conditions seems

Sparks, Donald L.

134

Delaware Energy and Cost Savings for New Single- and Multifamily Homes: 2012 IECC as Compared to the 2009 IECC  

SciTech Connect (OSTI)

The 2012 International Energy Conservation Code (IECC) yields positive benefits for Delaware homeowners. Moving to the 2012 IECC from the 2009 IECC is cost effective over a 30-year life cycle. On average, Delaware homeowners will save $10,409 with the 2012 IECC. After accounting for upfront costs and additional costs financed in the mortgage, homeowners should see net positive cash flows (i.e., cumulative savings exceeding cumulative cash outlays) in 1 year for the 2012 IECC. Average annual energy savings are $616 for the 2012 IECC.

Lucas, Robert G.; Taylor, Zachary T.; Mendon, Vrushali V.; Goel, Supriya

2012-04-01T23:59:59.000Z

135

Delaware Natural Gas Vehicle Fuel Price (Dollars per Thousand Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42YearDelaware Natural Gas

136

Delaware Price of Natural Gas Sold to Commercial Consumers (Dollars per  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42YearDelaware Natural

137

Delaware Share of Total U.S. Natural Gas Delivered to Consumers  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42YearDelaware Natural2 0.2 0.2

138

Advanced reservoir characterization for improved oil recovery in a New Mexico Delaware basin project  

SciTech Connect (OSTI)

The Nash Draw Brushy Canyon Pool in Eddy County, New Mexico is a field demonstration site in the Department of Energy Class III program. The basic problem at the Nash Draw Pool is the low recovery typically observed in similar Delaware fields. By comparing a control area using standard infill drilling techniques to a pilot area developed using advanced reservoir characterization methods, the goal of the project is to demonstrate that advanced technology can significantly improve oil recovery. During the first year of the project, four new producing wells were drilled, serving as data acquisition wells. Vertical seismic profiles and a 3-D seismic survey were acquired to assist in interwell correlations and facies prediction. Limited surface access at the Nash Draw Pool, caused by proximity of underground potash mining and surface playa lakes, limits development with conventional drilling. Combinations of vertical and horizontal wells combined with selective completions are being evaluated to optimize production performance. Based on the production response of similar Delaware fields, pressure maintenance is a likely requirement at the Nash Draw Pool. A detailed reservoir model of pilot area was developed, and enhanced recovery options, including waterflooding, lean gas, and carbon dioxide injection, are being evaluated.

Martin, F.D.; Kendall, R.P.; Whitney, E.M. [Dave Martin and Associates, Inc., Socorro, NM (United States)] [and others

1997-08-01T23:59:59.000Z

139

POST-CONSTRUCTION AVIAN AND BAT IMPACT ASSESSMENT OF THE UNIVERSITY OF DELAWARE WIND TURBINE IN LEWES, DE  

E-Print Network [OSTI]

POST-CONSTRUCTION AVIAN AND BAT IMPACT ASSESSMENT OF THE UNIVERSITY OF DELAWARE WIND TURBINE-831-1306 In May 2010, a Gamesa G90 2.0 megawatt wind turbine was erected in Lewes, DE through a collaborative Developments, Inc. The turbine was commissioned and began generating electricity in June 2010. The turbine has

Firestone, Jeremy

140

Application of Advanced Reservoir Characterization, Simulation, and Production Optimization Strategies to Maximize Recovery in Slope and Basin Clastic Reservoirs, West Texas (Delaware Basin), Class III  

SciTech Connect (OSTI)

The objective of this Class III project was demonstrate that reservoir characterization and enhanced oil recovery (EOR) by CO2 flood can increase production from slope and basin clastic reservoirs in sandstones of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico. Phase 1 of the project, reservoir characterization, focused on Geraldine Ford and East Ford fields, which are Delaware Mountain Group fields that produce from the upper Bell Canyon Formation (Ramsey sandstone). The demonstration phase of the project was a CO2 flood conducted in East Ford field, which is operated by Orla Petco, Inc., as the East Ford unit.

Dutton, Shirley P.; Flanders, William A.

2001-11-04T23:59:59.000Z

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Application of Advanced Reservoir Characterization, Simulation, and Production Optimization Strategies to Maximize Recovery in Slope and Basin Clastic Reservoirs, West Texas (Delaware Basin), Class III  

SciTech Connect (OSTI)

The objective of this Class 3 project was demonstrate that detailed reservoir characterization of slope and basin clastic reservoirs in sandstone's of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico is a cost effective way to recover oil more economically through geologically based field development. This project was focused on East Ford field, a Delaware Mountain Group field that produced from the upper Bell Canyon Formation (Ramsey sandstone). The field, discovered in 9160, is operated by Oral Petco, Inc., as the East Ford unit. A CO2 flood was being conducted in the unit, and this flood is the Phase 2 demonstration for the project.

Dutton, Shirley P.; Flanders, William A.; Mendez, Daniel L.

2001-05-08T23:59:59.000Z

142

ELSEVIER JournalofCrystalGrowth166(1996)779-785 ,........ CRYSTAL  

E-Print Network [OSTI]

treatment and solar-energy conver- sion, storage capacitors in DRAMs, insulators in MOS devices. Roshko b J.B. Rothman c G.S. Rohrer d a DuPont Company, Experimental Station, Wilmington, Delaware 19880

Rohrer, Gregory S.

143

CX-008218: Categorical Exclusion Determination  

Broader source: Energy.gov [DOE]

A System Design Study for Wilmington Canyon Offshore Wind Farm CX(s) Applied: A9 Date: 04/02/2012 Location(s): Delaware Offices(s): Golden Field Office

144

Community Energy Systems and the Law of Public Utilities. Volume Ten. Delaware  

SciTech Connect (OSTI)

A detailed description is given of the laws and programs of the State of Delaware governing the regulation of public energy utilities, the siting of energy generating and transmission facilities, the municipal franchising of public energy utilities, and the prescription of rates to be charged by utilities including attendant problems of cost allocations, rate base and operating expense determinations, and rate of return allowances. These laws and programs are analyzed to identify impediments which they may present to the implementation of Integrated Community Energy Systems (ICES). This report is one of fifty-one separate volumes which describe such regulatory programs at the Federal level and in each state as background to the report entitled Community Energy Systems and the Law of Public Utilities - Volume One: An Overview. This report also contains a summary of a strategy described in Volume One - An Overview for overcoming these impediments by working within the existing regulatory framework and by making changes in the regulatory programs to enhance the likelihood of ICES implementation.

Feurer, D A; Weaver, C L

1981-01-01T23:59:59.000Z

145

Microbial enhanced waterflooding pilot project, Mink Unit, Delaware-Childers (OK) field  

SciTech Connect (OSTI)

The first microbial-enhanced waterflood field project was initiated in October of 1986. The site selected for the project is in the Mink Unit of Delaware-Childers field in Nowata County, Oklahoma. The pilot area consists of four adjacent inverted five-spot patterns drilled on 5-acre spacing. There are 21 injection and 15 production wells on this pilot. Four of the 21 injection wells were treated with microbial formulation. Laboratory screening criteria were developed to evaluate microorganisms for this project. Several different microbial formulations were tested. Injectivity and microbial field survivability tests were conducted during the baseline period on two off-pattern wells, and a chemical tracer, fluorescein, was injected into the four injection wells during the baseline period. Methodologies for field applications of microorganisms in ongoing waterfloods were developed as a result of this project. Results from the field pilot showed that microorganisms could be injected into an ongoing waterflood without causing any problems in injectivity. Microbial treatment did improve oil production rate, and water/oil ratios for producing wells nearest the microbially treated injection wells continue to be more favorable than baseline values. 23 refs., 30 figs., 28 tabs.

Bryant, R.S.; Burchfield, T.E.; Dennis, D.M.; Hitzman, D.O.

1991-08-01T23:59:59.000Z

146

Coal transfer: can an environmentally safe coal transfer operation be undertaken in the lower Delaware Bay. Delaware Estuary situation report. [Dusts from transport of coal from barges to colliers  

SciTech Connect (OSTI)

Effective August 1983, the U.S. Coast Guard authorized coal transfer between vessels moored in Anchorage Area A, off Big Stone Beach in lower Delaware Bay. Two general methods may be used to transfer coal from shallow-draft barges to deep-draft colliers: auger or conveyor-belt operation and clamshell operation. Although dust emission is inherent in coal transfer, best available data from similar situations indicate dust emission can vary from 0.168 pounds per ton for clamshell to 0.0024 pounds per ton for auger/conveyor transfer. Air quality and bottom water deterioration are the major potential environmental impacts.

Biggs, R.B.; Sharp, J.H.; Manus, A.T.; Wypyszinski, A.W.

1983-01-01T23:59:59.000Z

147

Hydronic Heating Coil Versus Propane Furnace, Rehoboth Beach, Delaware (Fact Sheet)  

SciTech Connect (OSTI)

Insight Homes constructed two houses in Rehoboth Beach, Delaware, with identical floor plans and thermal envelopes but different heating and domestic hot water (DHW) systems. Each house is 1,715-ft2 with a single story, three bedrooms, two bathrooms, and the heating, ventilation, and air conditioning (HVAC) systems and ductwork located in conditioned crawlspaces. The standard house, which the builder offers as its standard production house, uses an air source heat pump (ASHP) with supplemental propane furnace heating. The Building America test house uses the same ASHP unit with supplemental heat provided by the DHW heater (a combined DHW and hydronic heating system, where the hydronic heating element is in the air handler). Both houses were occupied during the test period. Results indicate that efficiency of the two heating systems was not significantly different. Three issues dominate these results; lower system design performance resulting from the indoor refrigerant coil selected for the standard house, an incorrectly functioning defrost cycle in the standard house, and the low resolution of the natural gas monitoring equipment. The thermal comfort of both houses fell outside the ASHRAE Standard 55 heating range but was within the ACCA room-to-room temperature range when compared to the thermostat temperature. The monitored DHW draw schedules were input into EnergyPlus to evaluate the efficiency of the tankless hot water heater model using the two monitored profiles and the Building America House Simulation Protocols. The results indicate that the simulation is not significantly impacted by the draw profiles.

Not Available

2014-01-01T23:59:59.000Z

148

Reservoir Character of the Avalon Shale (Bone Spring Formation) of the Delaware Basin, West Texas and Southeast New Mexico: Effect of Carbonate-rich Sediment Gravity Flows  

E-Print Network [OSTI]

play is not considered to extend to the top of the first Bone Spring carbonate because hydraulic fracturing in the upper parts may penetrate overlying water-bearing units within the Delaware Mountains Group. The Avalon has been reported to range from...

Stolz, Dustin

2014-05-31T23:59:59.000Z

149

Distribution and generation of the overpressure system, Eastern Delaware Basin, Western Texas and Southern New Mexico: Discussion  

SciTech Connect (OSTI)

Interest in the paper by Luo et al. (1994) on Delaware basin overpressure was probably as great among drilling and completion engineers as the geologic community because of the obvious implications on drilling mud and well tubular programs. However, there are some inaccuracies in the paper`s comments relating to drill-stem test (DST) interpretation, which Luo et al. used to predict formation pressures in the study area. Referring to figure 3 in the paper, the authors identify points a and e as initial and final hydrostatic pressures (IHP and FP, respectively). Luo et al. state, `...the IHP and FHP represent the true fluid pressure of the formation at the depth of the testing tool.` The IHP and FP values actually represent the pressure exerted by the column of mud of a given weight in the well bore at the depth of the gauge, rather than the true fluid pressure of the formation.

Cox, D.L. [Mobil Exploration and Producing, Midland, TX (United States)

1995-12-01T23:59:59.000Z

150

Category:Wilmington, DE | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarreis aCallahanWindSyracuse, NY JumpKS" The following 16DE

151

Wilmington, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place:ReferenceEdit JumpWill County, Illinois: Facility

152

Wilmington, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamson County, Tennessee:Willowick, Ohio:(Redirected

153

Analysis of dust samples collected from spent nuclear fuel interim storage containers at Hope Creek, Delaware, and Diablo Canyon, California.  

SciTech Connect (OSTI)

Potentially corrosive environments may form on the surface of spent nuclear fuel dry storage canisters by deliquescence of deposited dusts. To assess this, samples of dust were collected from in-service dry storage canisters at two near-marine sites, the Hope Creek and Diablo Canyon storage installations, and have been characterized with respect to mineralogy, chemistry, and texture. At both sites, terrestrially-derived silicate minerals, including quartz, feldspars, micas, and clays, comprise the largest fraction of the dust. Also significant at both sites were particles of iron and iron-chromium metal and oxides generated by the manufacturing process. Soluble salt phases were minor component of the Hope Creek dusts, and were compositionally similar to inland salt aerosols, rich in calcium, sulfate, and nitrate. At Diablo Canyon, however, sea-salt aerosols, occurring as aggregates of NaCl and Mg-sulfate, were a major component of the dust samples. The seasalt aerosols commonly occurred as hollow spheres, which may have formed by evaporation of suspended aerosol seawater droplets, possibly while rising through the heated annulus between the canister and the overpack. The differences in salt composition and abundance for the two sites are attributed to differences in proximity to the open ocean and wave action. The Diablo Canyon facility is on the shores of the Pacific Ocean, while the Hope Creek facility is on the shores of the Delaware River, several miles from the open ocean.

Bryan, Charles R.; Enos, David George

2014-07-01T23:59:59.000Z

154

Comparison of the National Green Building Standard (ICC 700-2008) and LEED for Homes to the Residential Provisions of the 2009 IECC for the Delaware Green for Green Program  

SciTech Connect (OSTI)

Adhering to Delawares Green for Green program specifications results in homes being built to more energy-efficient levels than the 2009 IECC levels. Specifically: Certifying at the Silver Performance Level for the ICC 700 standard using either the Prescriptive or Performance Paths will result in a residential building that is more efficient than if the building only complied with the 2009 IECC. Certifying at the Silver level under LEED for Homes standard, including mandatory compliance with ENERGY STAR 2006 and earning two additional energy points will result in a residential building that is more efficient than if the building only complied with the 2009 IECC.

Britt, Michelle L.; Makela, Eric J.

2011-01-30T23:59:59.000Z

155

Application of advanced reservoir characterization, simulation, and production optimization strategies to maximize recovery in slope and basin clastic reservoirs, West Texas (Delaware Basin). Technical progress report  

SciTech Connect (OSTI)

The objective of this project is to demonstrate that detailed reservoir characterization of slope and basin clastic reservoirs in sandstones of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico is a cost effective way to recover a higher percentage of the original oil in place through strategic placement of infill wells and geologically based field development. Project objectives are divided into two major phases. The objectives of the reservoir characterization phase of the project are to provide a detailed understanding of the architecture and heterogeneity of two fields, the Ford Geraldine unit and Ford West field, which produce from the Bell Canyon and Cherry Canyon Formations, respectively, of the Delaware Mountain Group and to compare Bell Canyon and Cherry Canyon reservoirs. Reservoir characterization will utilize 3-D seismic data, high-resolution sequence stratigraphy, subsurface field studies, outcrop characterization, and other techniques. One the reservoir-characterization study of both field is completed, a pilot area of approximately 1 mi{sup 2} in one of the fields will be chosen for reservoir simulation. The objectives of the implementation phase of the project are to: (1) apply the knowledge gained from reservoir characterization and simulation studies to increase recovery from the pilot area; (2) demonstrate that economically significant unrecovered oil remains in geologically resolvable untapped compartments; and (3) test the accuracy of reservoir characterization and flow simulation as predictive tools in resource preservation of mature fields. A geologically designed, enhanced recovery program (CO{sub 2} flood, waterflood, or polymer flood) and well-completion program will be developed, and one to three infill well will be drilled and cored. Technical progress is summarized for: geophysical characterization; reservoir characterization; outcrop characterization; and producibility problem characterization.

Dutton, S.P.

1996-04-30T23:59:59.000Z

156

The Department of Communication at the University of Delaware offers a strong theory and research-based program coupled with skills training in oral communication, video production, broadcast journalism, and public  

E-Print Network [OSTI]

The Department of Communication at the University of Delaware offers a strong theory and research-based program coupled with skills training in oral communication, video production, broadcast journalism, and public relations. Students also study intercultural communication, principles in advertising, media

Firestone, Jeremy

157

Journal of Colloid and Interface Science 270 (2004) 5665 www.elsevier.com/locate/jcis  

E-Print Network [OSTI]

,b and Donald L. Sparks a a Department of Plant and Soil Sciences, University of Delaware, Newark, DE 19717, USA b DuPont Engineering Technology, Brandywine Building, Wilmington, DE 19898, USA c Department(II) indicate that the existing thermodynamic framework for the modified TLM is able to reproduce the metal

Sparks, Donald L.

158

Journal of Colloid and Interface Science 270 (2004) 7785 www.elsevier.com/locate/jcis  

E-Print Network [OSTI]

Fairbanks, Fairbanks, AK 99775, USA b Department of Plant and Soil Sciences, University of Delaware, Newark, DE 19717, USA c DuPont Engineering Technology, Brandywine Building, Wilmington, DE 19898, USA d NRL with ubiquitously existing hydrous oxides of Fe, Al, and Mn as well as with clays and clay minerals are important

Sparks, Donald L.

159

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

160

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Delaware Natural Gas Prices  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (Million CubicThousand6.92

162

Delaware Natural Gas Summary  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesData Files Data Files 1B&W Y-12studies inBImpact of

163

University of Delaware UNDERGRADUATE  

E-Print Network [OSTI]

& Environmental Engineering: Bryan a , C. Davis, Loughery, Russo, Shank. Electrical & Computer Engineering: Abdou Program Presenters listed in alphabetical order. Presenter Department Faculty Sponsor Meena Abdou

Firestone, Jeremy

164

Application of advanced reservoir characterization, simulation, and production optimization strategies to maximize recovery in slope and basin clastic reservoirs, West Texas (Delaware Basin). Quarterly report, July 1 - September 30, 1996  

SciTech Connect (OSTI)

The objective of this project is to demonstrate that detailed reservoir characterization of slope and basin clastic reservoirs in sandstones of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico is a cost effective way to recover a higher percentage of the original oil in place through strategic placement of infill wells and geologically based field development. Project objectives are divided into two major phases. The objectives of the reservoir characterization phase of the project are to provide a detailed understanding of the architecture and heterogeneity of two fields, the Ford Geraldine unit and Ford West field, which produce from the Bell Canyon and Cherry Canyon Formations, respectively, of the Delaware Mountain Group and to compare Bell Canyon and Cherry Canyon reservoirs. Reservoir characterization will utilize 3-D seismic data, high-resolution sequence stratigraphy, subsurface field studies, outcrop characterization, and other techniques. Once the reservoir- characterization study of both fields is completed, a pilot area of approximately 1 mi{sup 2} in one of the fields will be chosen for reservoir simulation. The objectives of the implementation phase of the project are to (1) apply the knowledge gained from reservoir characterization and simulation studies to increase recovery from the pilot area, (2) demonstrate that economically significant unrecovered oil remains in geologically resolvable untapped compartments, and (3) test the accuracy of reservoir characterization and flow simulation as predictive tools in resource preservation of mature fields. A geologically designed, enhanced-recovery program (CO{sup 2} flood, waterflood, or polymer flood) and well-completion program will be developed, and one to three infill wells will be drilled and cored. Accomplishments for this past quarter are discussed.

Dutton, S.P.

1996-10-01T23:59:59.000Z

165

Borough of New Wilmington, Pennsylvania (Utility Company) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio JumpVenturesCoralBoroughNewMilltown Place:

166

Predicting Steam Turbine Performance  

E-Print Network [OSTI]

," PREDICTING STEAM TURBINE PERFORMANCE James T. Harriz, EIT Waterland, Viar & Associates, Inc. Wilmington, Delaware ABSTRACT Tracking the performance of extraction, back pressure and condensing steam turbines is a crucial part... energy) and test data are presented. Techniques for deriving efficiency curves from each source are described. These techniques can be applied directly to any steam turbine reliability study effort. INTRODUCTION As the cost of energy resources...

Harriz, J. T.

167

Delaware City, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park, Ohio:Mar,

168

University of Delaware | About CCEI  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProduction

169

University of Delaware | CCEI Equipment  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board Our advisory

170

University of Delaware | CCEI Events  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board Our advisoryCCEI's

171

University of Delaware | CCEI Leadership  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board OurCCEI

172

University of Delaware | CCEI News  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board OurCCEINews

173

University of Delaware | CCEI Outreach  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board

174

University of Delaware | CCEI Outreach  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory BoardK-12 Education For

175

University of Delaware | CCEI Partners  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory BoardK-12 Education Forand

176

University of Delaware | CCEI Patents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory BoardK-12 Education

177

University of Delaware | CCEI Staff  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory BoardK-12ResearchCCEI

178

University of Delaware | Contact CCEI  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEIResearch Thrust PyrolysisContact

179

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

180

How Wood Chip Size Affects Pretreatment Effectiveness of Woody Biomass for Biological Processing  

E-Print Network [OSTI]

mg Cellic CTec2 cellulase (Novozymes, Wilmington, DE, USA, HTec2 hemicellulase (Novozymes, Wilmington, DE, USA,

Tam, Jerry

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Anton Betten betten@math.colostate.edu  

E-Print Network [OSTI]

, WI Winston-Salem, NWinnipeg, MB Winnipeg, MB Winchester, VA Wilmington, NC Wilmington, DE Williston

Betten, Anton

182

December 11, 2008 UNIVERSITY OF DELAWARE  

E-Print Network [OSTI]

:10 Photoelectric Catalysis for Hydrogen Generation Ismat Shah 9:10 ­ 9:30 Fuel Cells and Batteries Ajay Prasad:00 ­ 10:10 Coupled Quantum Dots in Photovoltaic Devices Matt Doty 10:10 ­ 10:30 Morning Break 10:30 ­ 10

Firestone, Jeremy

183

Contact us at: 420 Delaware St. SE  

E-Print Network [OSTI]

or "osteoporosis". Nutrition recommendations to minimize the risk of osteoporosis are as follows: 1. Calcium

Thomas, David D.

184

Delaware Electric Cooperative- Green Energy Program Incentives  

Broader source: Energy.gov [DOE]

'''''NOTE: The Renewable Resource Program will accept requests for grant funding for calendar year 2013 beginning January 9, 2013. Applications for residential PV and geothermal systems will not...

185

Contact us at: 420 Delaware St. SE  

E-Print Network [OSTI]

and counseling patients/family during MDA clinic visits. We use a team approach in the MDA sponsored Clinic patient, situation and disease course is unique; although you can get many useful general facts from websites, patients must interpret that information based on their own situation as described by their MD

Thomas, David D.

186

Renewable Energy Facilities Revolving Loan Fund (Delaware)  

Broader source: Energy.gov [DOE]

Renewable Energy Facilities Revolving Loan Fund provides loans at market to below-market interest rates to businesses that cannot otherwise obtain capital, provided that those businesses will...

187

Clean Energy Technology Device Manufacturers' Credits (Delaware)  

Broader source: Energy.gov [DOE]

Qualified manufacturers can apply for a tax break equal to 75% of the corporation income tax. The incentive is an increase from the Investment and Employment Credit Against Corporation Income Tax,...

188

Newark, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(Utility Company) Jump to:City) Jump to: navigation, searchCalifornia:

189

Newport, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(Utility Company) Jump to:City) Jump to:Newmarket, New Hampshire:137237°,

190

Odessa, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan: Energy Resources Jump to:Ocoee,OcontoOctus EnergyOdessa,

191

Accidental Release Program (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists' ResearchThe Office ofReporting (Connecticut) |Department ofStructuralthe WasteUtility

192

Greenville, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio: EnergyGrasslandsGreen2V790012°, -75.5982599° Loading map...

193

Hockessin, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHi Gtel JumpHoard, Wisconsin: Energy ResourcesHoboken,

194

Arden, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergy InformationArcata, California: EnergyArco EnergyArctic

195

Ardencroft, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergy InformationArcata, California: EnergyArcoArdencroft,

196

Ardentown, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergy InformationArcata, California:

197

Bear, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine:Barbers PointEnergy Information Hot Springs Pool & SpaBear,

198

Extremely Hazardous Substances Risk Management Act (Delaware)  

Broader source: Energy.gov [DOE]

This act lays out provisions for local governments to implement regulations and standards for the management of extremely hazardous substances, which are defined and categorized as follows:

199

Bellefonte, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine:Barbers PointEnergyJingneng861° Loading map...Isle,

200

Delaware Heat Content of Natural Gas Consumed  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb Mar132009 2010 2011

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Delaware Heat Content of Natural Gas Consumed  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb Mar132009 2010

202

Delaware Natural Gas Consumption by End Use  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb Mar1320097,930

203

Liberty Power Corp. (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October, 2012LeeCalifornia References:

204

University of Delaware Wind | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTagusparkCalculator JumpUnited States:

205

Delaware State Historic Preservation Programmatic Agreement  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergy CooperationRequirements Matrix

206

Middletown, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte GmbH JumpSprings, Vermont: Energy Resources Jump

207

University of Delaware | CCEI Past Events  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption by sectorlong version)UndergroundPast Events DATE EVENT

208

Think Tank: Delaware Department of Natural Resources  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center HomeNew YorkLouisiana Laws andDakota1A2:New England New23,Spring

209

Glasgow, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeaugaInformationGilroy, California:Gladeview,Glascock

210

Delaware Mountain Wind Farm | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has been approvedMeasurements

211

Delaware/Geothermal | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has been

212

Delaware/Incentives | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has beenFinancial Incentive Programs for

213

Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has beenFinancial Incentive ProgramsLoading

214

DELAWARE RECOVERY ACT SNAPSHOT | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartmentTieCelebratePartners with Siemens31,CanadaOTHERAFPs 1ACESEnergy

215

Delaware Electric Cooperative | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The following text09-0018-CXBasin JumpTexas Elec Coop Inc

216

GEXA Corp. (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (TheEtelligence (SmartHomeFremont,usingGEO2 Technologies Jump to:

217

Glacial Energy Holdings (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power BasicsGermany: Energy Resources Jump to:Connecticut References: EIA

218

Clayton, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy Resources JumpSouth Dakota: EnergyClaymont,43.

219

University of Delaware | CCEI Advisory Board  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board Our advisory board

220

University of Delaware | CCEI Faculty Publications  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board Our

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

University of Delaware | CCEI Industrial Consortium  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory Board OurCCEI Industrial

222

University of Delaware | CCEI Principal Investigators  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory BoardK-12

223

University of Delaware | CCEI Research Highlights  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory BoardK-12Research

224

University of Delaware | CCEI Visiting Scholars  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI AdvisoryVisiting Scholars Blaz

225

Edgemoor, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified asThisEcoGrid EUEdgecombe-Martin County E M CEdgemoor,

226

Elsmere, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classifiedProject) | OpenTexas:County is a countyElmwoodElsmere,

227

UNIVERSITY OF DELAWARE DEPARTMENT OF MECHANICAL ENGINEERING  

E-Print Network [OSTI]

for delivery. A hydrogen refueling station was also established at Air Liquide for our Fuel Cell Bus Program with the fuel cell bus program, the hydrogen refueling station, and the fuel cell bus parking and maintenance and demonstration projects with the fuel cell bus program, the hydrogen refueling station, and the fuel cell bus

Gao, Guang R.

228

Investigation of sand consolidation using steam for the Tar Zone, Wilmington field, California  

E-Print Network [OSTI]

during the steamflood project. Assuming that the residual liquid phase and the vapor phase partition in the wellbore and enter separate sand zones in a reservoir, the results suggest that permeability reduction in sands contacted by residual liquid... good engineer. I also wish to thank Dr. Renald N. Guillemette, research scientist at the Department of Geology and Geophysics for all his help and innovative suggestions during the analysis made in the electron microprobe laboratory. This project...

Nilsen, Knut Arild

1999-01-01T23:59:59.000Z

229

Increasing Waterflood Reserves in the Wilmington Oil Field through Improved Reservoir Characterization and Reservoir Management  

SciTech Connect (OSTI)

This project used advanced reservoir characterization tools, including the pulsed acoustic cased-hole logging tool, geologic three-dimensional (3-D) modeling software, and commercially available reservoir management software to identify sands with remaining high oil saturation following waterflood. Production from the identified high oil saturated sands was stimulated by recompleting existing production and injection wells in these sands using conventional means as well as a short radius redrill candidate.

Clarke, D.; Koerner, R.; Moos D.; Nguyen, J.; Phillips, C.; Tagbor, K.; Walker, S.

1999-04-05T23:59:59.000Z

230

Health-hazard evaluation report HETA 82-341-1682, Great Lakes Carbon, Wilmington, California  

SciTech Connect (OSTI)

An evaluation of environmental conditions and possible health effects among workers exposed to coke dust was conducted. Personal breathing-zone (PBZ) concentrations of total airborne dust ranged from 0.1 to 12 milligrams/cubic meter (mg/m3) with a median of 1.6 mg/m3; mass median particle diameter was about 8 micrometers. Very high PBZ concentrations of coke dust occurred during a semimonthly cleanup of underground coke pits; levels ranged from 98 to 190mg/m3 with a mean of 140mg/m3. Oil mists were not detected. Exposures to polynuclear aromatic compounds were below the analytical limit of detection among workers for routine jobs. Abnormal pulmonary function tests were found in 12% of those tested. Five cases of chronic bronchitis and seven of chronic cough, 10 and 13% respectively, were identified among those interviewed. The authors conclude that there were potentially hazardous exposures to high dust levels during semimonthly coke-pit cleaning jobs.

Lee, S.A.; Lipscomb, J.A.; Neumeister, C.E.

1986-04-01T23:59:59.000Z

231

Taking a Tour of Wilmington's Energy-Efficient Spaces | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion |Energy Usage »of Energy StrainClient updateTRI-STATE GENERATION 1.Take aSteps to

232

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

233

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

234

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

235

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

236

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

237

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

238

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

239

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

240

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

242

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

243

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

244

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

245

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

246

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

247

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

248

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

249

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

250

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

251

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

252

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

253

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

254

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

255

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

256

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

257

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

258

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

259

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

260

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

262

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

263

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

264

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

265

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

266

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

267

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

268

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

269

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

270

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

271

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

272

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

273

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

274

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

275

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

276

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

277

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

278

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

279

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

280

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

282

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

283

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

284

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

285

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

286

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

287

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

288

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

289

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

290

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

291

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

292

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

293

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

294

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

295

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

296

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

297

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

298

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

299

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

300

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

302

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

303

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

304

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

305

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

306

ELEG620: Solar Electric Systems University of Delaware Spring 2008 1 University of Delaware  

E-Print Network [OSTI]

Department of Electrical and Computer Engineering ELEG620: Solar Electric Systems Photovoltaic System Design-alone photovoltaic system. Working in groups, you will: · Decide on a load and design goal for your system; · Write system is to determine the type and size of the system. You are given substantial latitude in choosing

Honsberg, Christiana

307

Delaware Company Breathes New Life into Old Post Office Building...  

Broader source: Energy.gov (indexed) [DOE]

the company set out to create the new workspace. The long-term goal: Qualify for the U.S. Green Building Council's Leadership in Energy and Environmental Design (LEED) Platinum...

308

BEFORE THE PUBLIC SERVICE COMMISSION OF THE STATE OF DELAWARE  

E-Print Network [OSTI]

and an "Additional Coal Retirements" case. 2. Impact of recent NYMEX natural gas prices on Conectiv's proposal. 3 these assumptions. With additional coal retirements assumed in the region, the impact on market prices and SOS costs-term power sale from its proposed coal-fired integrated gasification combined cycle (IGCC) project. 4. PJM

Firestone, Jeremy

309

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

and Parallel Systems Laboratory Collaborative Research: Programming Models and Storage System for High://ftp.capsl.udel.edu · capsladm@capsl.udel.edu #12;#12;Collaborative Research: Programming Models and Storage System for High is the storage system since the available memory and bandwidth per processor core is starting to decline

Gao, Guang R.

310

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

://ftp.capsl.udel.edu · capsladm@capsl.udel.edu #12;#12;Contents 1 Introduction 1 2 Energy Consumption Model on a Many.2 Energy Consumption model for Cyclops-64 . . . . . . . . . . . . . . . . . . . . . 4 3 Tiling Techniques Experimental Evaluation 9 4.1 Evaluation of the Energy Consumption Model

Gao, Guang R.

311

HIGHER EDUCATION OPPORTUNITY ACT REPORTING University of Delaware  

E-Print Network [OSTI]

/17/13@ 2:15pm Unattended electric fan left on upholstered chair 0 0 $400 Warner Hall Attic 4/20/13@ 4:47am 0 $400 Rodney Hall- B Room 190 8/23/13@ 6:26 pm Short-circuit in a supplemental heating unit 0 0 REPORTING B. Description of On-Campus Student Housing Fire Safety Systems: o All On-Campus Student Housing

Firestone, Jeremy

312

How One Delaware County is Saving Money and Creating Jobs  

Broader source: Energy.gov [DOE]

New Castle County will carry out 158 conservation measures, including heat pump and boiler replacements, high-efficiency motors, lighting retrofits and controls, and a white reflective roof.

313

BEFORE THE PUBLIC SERVICE COMMISSION OF THE STATE OF DELAWARE  

E-Print Network [OSTI]

.................................................................................................................................. 12 IV. GENERATION AND/OR TRANSMISSION CAPACITY SHORTFALL-INDUCED PRICE AND RELIABILITY RISKS. § 1007(c) & (d): REVIEW AND APPROVAL OF THE REQUEST FOR PROPOSALS FOR THE CONSTRUCTION OF NEW GENERATION............................................................................................... 16 A. GENERATION SUPPLY AND DEMAND IMBALANCE RISKS

Firestone, Jeremy

314

Human Resources 413 Academy Street Newark, Delaware 19716  

E-Print Network [OSTI]

Options and Your Health Coverage." The health care reform law known as the Affordable Care Act ("ACA Information When key parts of the health care law take effect in 2014, there will be a new way to buy health.udel.edu/hr September 27, 2013 Dear Colleague: Attached is a Notice entitled "New Health Insurance Marketplace Coverage

Firestone, Jeremy

315

University of Delaware Register Forgotten Password Athens/Institution Login  

E-Print Network [OSTI]

@geosc.psu.edu Summary Hybrid molecular orbital/density functional theory (MO/DFT) calculations on molecular clusters; revised version accepted 14 May 2007 Synergy Home | Browse | Search | My Synergy | Books Online

Sparks, Donald L.

316

Department of Energy Official in Newark, Delaware, to Highlight...  

Energy Savers [EERE]

electrons to flow through the material to produce electricity. The process of converting light to electricity is called the photovoltaic effect. The Energy Policy Act of 2005...

317

Fuel Cell Research at the University of Delaware  

SciTech Connect (OSTI)

The grant initiated nine basic and applied research projects to improve fundamental understanding and performance of the proton exchange membrane (PEM) fuel cells, to explore innovative methods for hydrogen production and storage, and to address the critical issues and barriers to commercialization. The focus was on catalysis, hydrogen production and storage, membrane durability and flow modeling and characterization of Gas Diffusion Media. Three different types of equipment were purchase with this grant to provide testing and characterization infrastructure for fuel cell research and to provide undergraduate and graduate students with the opportunity to study fuel cell membrane design and operation. They are (i) Arbin Hydrogen cell testing station, (ii) MTS Alliance?¢???¢ RT/5 material testing system with an ESPEC custom-designed environmental chamber for membrane Durability Testing and (iii) Chemisorption for surface area measurements of electrocatalysts. The research team included ten faculty members who addressed various issues that pertain to Fuel Cells, Hydrogen Production and Storage, Fuel Cell transport mechanisms. Nine research tasks were conducted to address the critical issues and various barriers to commercialization of Fuel Cells. These research tasks are subdivided in the general areas of (i) Alternative electrocatalysis (ii) Fuel Processing and Hydrogen Storage and (iii) Modeling and Characterization of Membranes as applied to Fuel Cells research.. The summary of accomplishments and approaches for each of the tasks is presented below

Chen, Jingguang G.; Advani, Suresh G.

2006-01-27T23:59:59.000Z

318

Introduction to the University of Delaware Energy Institute  

E-Print Network [OSTI]

! World Energy consumption is roughly 400 quadrillion BTUs per year. The US, with 5% of the world to secure our energy future. I would like to thank each of them for sharing their perspectives with us our consumption in slightly more accessible terms, EACH DAY the US uses 20 million barrels of oil PLUS

Firestone, Jeremy

319

University of Delaware Department of Civil and Environmental Engineering  

E-Print Network [OSTI]

............................................................................................4 Master of Ocean Engineering .............................................................................................5 Ph.D. in Ocean Engineering ............................................................................7 B. Master's Degree Requirements (Ocean Engineering

Kirby, James T.

320

SEP Success Story: Delaware Company Breathes New Life into Old...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Design, Inc. set out to create a new workspace. The long-term goal: qualify for the U.S. Green Building Council's Leadership in Energy and Environmental Design (LEED) Platinum...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

EV Community Readiness projects: Delaware Valley Regional Planning...  

Broader source: Energy.gov (indexed) [DOE]

Kansas City; Douglas County; Unified Government of Wyandotte County * EV manufacturer: Smith Electric Vehicles * EV and EVSE dealerships LilyPad EV, Olathe Ford * Technical...

322

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

and Parallel Systems Laboratory Optimizing the LU Factorization for Energy Efficiency on a Many . . . . . . . . . . . . . . . . . . 7 2.2 Energy Consumption model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 2.3 LU Factorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 3 Energy Optimizations 9

Gao, Guang R.

323

EECBG Success Story: Delaware Community Saves with Solar | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergy DOEDealingVehicle1 ClosingA Tradition of

324

Suez Energy Resources North America (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place: MissouriPrograms |

325

Tenaska Power Services Co (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation & Solutions

326

Delaware Community Saves with Solar | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomentheATLANTA, GA - U.S. DepartmenttoJune 16,AprilFrankDavis-Bacon3,AprilofTheWith a

327

Delaware State Historic Preservation Programmatic Agreement | Department of  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomentheATLANTA, GA - U.S. DepartmenttoJune

328

New Castle, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte3InformationofServicesNeuCo620572°, -75.5663132° Loading

329

North Star, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(Utility Company) JumpNorth Haven, Maine:Ohio:Pole,North Scituate°,Electric

330

,"Delaware Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: Energy SourcesWyoming"Coalbed Methane ProvedDry Natural GasMarketedCoalbedNetGas,PricePrice

331

Delaware - Rankings - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperativeA2.Reformulated, AverageCoos Bay Field Gulf Coast

332

Delaware - Search - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperativeA2.Reformulated, AverageCoos Bay Field Gulf Coast

333

University of Delaware | Catalysis Center for Energy Innovation  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation InInformation InExplosion Monitoring:Home|Physics ResearchLCLS Sign Register today

334

Natural Gas Delivered to Consumers in Delaware (Including Vehicle Fuel)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia,(Million Barrels) Crude Oil Reserves in Nonproducing Reservoirs Year2per6.48 6.18 5.63(Million Cubic(Million(Million

335

Delaware Liquefied Natural Gas Additions to and Withdrawals from Storage  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb Mar132009 201017 3

336

Delaware Natural Gas % of Total Residential - Sales (Percent)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb Mar132009 201017

337

Delaware Natural Gas % of Total Residential - Sales (Percent)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb Mar132009

338

Delaware Natural Gas Delivered for the Account of Others  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb

339

Delaware Natural Gas Deliveries to Electric Power Consumers (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan FebFeet) Decade

340

Delaware Natural Gas Industrial Consumption (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan FebFeet)

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan FebFeet)Decade

342

Delaware Natural Gas LNG Storage Additions (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan

343

Delaware Natural Gas LNG Storage Withdrawals (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year JanWithdrawals (Million

344

Delaware Natural Gas Number of Commercial Consumers (Number of Elements)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year JanWithdrawalsCommercial

345

Delaware Natural Gas Number of Industrial Consumers (Number of Elements)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year

346

Delaware Natural Gas Pipeline and Distribution Use (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (Million Cubic Feet)

347

Delaware Natural Gas Pipeline and Distribution Use Price (Dollars per  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (Million Cubic

348

Delaware Natural Gas Residential Consumption (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (Million

349

Delaware Natural Gas Total Consumption (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (MillionTotal Consumption

350

Delaware Natural Gas Underground Storage Injections All Operators (Million  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (MillionTotal

351

Delaware Natural Gas Underground Storage Net Withdrawals All Operators  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (MillionTotal(Million Cubic

352

Delaware Natural Gas Underground Storage Withdrawals (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (MillionTotal(Million

353

Delaware Natural Gas Vehicle Fuel Consumption (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year

354

Integrys Energy Services, Inc. (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer2002) |Integrys

355

University of Delaware Institute of Energy Conversion | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTagusparkCalculator JumpUnited States: EnergyInstitutionalNewJump

356

New Castle County, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithunCenter Jump to:2 JumpCanaan, Connecticut:

357

Delaware Natural Gas % of Total Residential Deliveries (Percent)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% of Total

358

Delaware Natural Gas Deliveries to Electric Power Consumers (Million Cubic  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% of

359

Delaware Natural Gas Industrial Consumption (Million Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% ofYear Jan Feb

360

Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% ofYear Jan

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Delaware Natural Gas Input Supplemental Fuels (Million Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% ofYear JanInput

362

Delaware Natural Gas LNG Storage Net Withdrawals (Million Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% ofYear

363

Delaware Natural Gas Number of Residential Consumers (Number of Elements)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% ofYearResidential

364

Delaware Natural Gas Residential Consumption (Million Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)%Year Jan Feb Mar

365

Delaware Price of Natural Gas Delivered to Residential Consumers (Dollars  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)%Year Jan Febper

366

Delaware County, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has been approvedMeasurements fromDelano,County,

367

Delaware's At-large congressional district: Energy Resources | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has been approvedMeasurementsInformation

368

Delaware/Wind Resources/Full Version | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has beenFinancial Incentive Programs

369

Pike Creek, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine: EnergyPierce County, Nebraska: EnergyJumpInnovative7309451°,

370

Kent County, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen6 ClimateKamas,KelseyMichigan: Energy Resources

371

Town of Middletown, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, IncTipmont Rural

372

UGI Energy Services, Inc. (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,Save Energy Now Jump to: navigation, search

373

Washington Gas Energy Services (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,Save EnergyGlouster,Winside,Warren County Rural E M CDC

374

Department of Energy Official in Newark, Delaware, to Highlight $168  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergy DOEDealing WithDevelopment ofNo DepartmentConditional

375

University of Delaware Energy Institute Inauguration | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists' Research Petroleum ReserveDepartment ofEnergy, OfficeDepartment ofDepartment

376

Constellation NewEnergy, Inc (Delaware) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The following text is derivedCo Jump to:

377

Natural Gas Delivered to Consumers in Delaware (Including Vehicle Fuel)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelinesProved ReservesFeet) Year Jan Feb Mar Apr MayYearDecadeFeet)9

378

City of Dover, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhio (Utility Company) JumpDoerun, Georgia (Utility Company) Jump

379

City of Lewes, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhio (UtilityHolyrood, KansasLampasas, Texas (UtilityLeesburg,

380

Clean Cities: State of Delaware Clean Cities coalition  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed New SubstationClean Communities of Western NewSouth Shore CleanSt. Louis Clean

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

City of Seaford, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:Energy Nebraska (UtilityGeorgiaArkansasRushford,City of SanSantaSauk

382

Sussex County, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen, Minnesota:36052°,Sunfield,FarmsSupport|Economies

383

Town of Clayton, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd JumpOperations JumpTooele County,BelmontBostic,Clayton Place:

384

University of Delaware | CCEI Students & Postdoctoral Researchers  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI Advisory

385

University of Delaware | Catalysis Center for Energy Innovation | Aromatics  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI AdvisoryVisiting Scholars

386

University of Delaware | Catalysis Center for Energy Innovation | Biomass  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI AdvisoryVisiting

387

University of Delaware | Catalysis Center for Energy Innovation | Fuel  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI AdvisoryVisitingCells Research

388

University of Delaware | Catalysis Center for Energy Innovation | Furans  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI AdvisoryVisitingCells

389

University of Delaware | Catalysis Center for Energy Innovation | Materials  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI AdvisoryVisitingCellsMaterials

390

University of Delaware | Catalysis Center for Energy Innovation | Modeling  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEI

391

University of Delaware | Catalysis Center for Energy Innovation | Pyrolysis  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduledProductionCCEIResearch Thrust Pyrolysis

392

Delaware Regions | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 IndustrialIsadoreConnecticut Regions National Science Bowl®

393

Alternative Fuels Data Center: Delaware Reduces Truck Idling With  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAbout theOFFICE OFFuels in Its Fleeton

394

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

395

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

396

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

397

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

398

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

399

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

400

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

402

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

403

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schfer, Eberhard

404

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

405

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

406

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

407

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

408

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

409

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

410

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

411

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

412

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

413

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

414

Increasing waterflood reserves in the Wilmington Oil Field through improved reservoir characterization and reservoir management. Annual report, March 21, 1995--March 20, 1996  

SciTech Connect (OSTI)

This project uses advanced reservoir characterization tools, including the pulsed acoustic cased-hole logging tool, geologic three- dimensional (3-D) modeling software, and commercially available reservoir management software to identify sands with remaining high oil saturation following waterflood. Production from the identified high oil saturation sands will be stimulated by recompleting existing production and injection wells in these sands using conventional means as well as short radius and ultra-short radius laterals. Although these reservoirs have been waterflooded over 40 years, researchers have found areas of remaining oil saturation. Areas such as the top sand in the Upper Terminal Zone Fault Block V, the western fault slivers of Upper Terminal Zone Fault Block V, the bottom sands of the Tar Zone Fault Block V, and the eastern edge of Fault Block IV in both the Upper Terminal and Lower Terminal Zones all show significant remaining oil saturation. Each area of interest was uncovered emphasizing a different type of reservoir characterization technique or practice. This was not the original strategy but was necessitated by the different levels of progress in each of the project activities.

Sullivan, D.; Clarke, D.; Walker, S.; Phillips, C.; Nguyen, J.; Moos, D.; Tagbor, K.

1997-08-01T23:59:59.000Z

415

Increasing heavy oil reserves in the Wilmington oil field through advanced reservoir characterization and thermal production technologies. Quarterly technical progress report, March 30, 1995--June 30, 1995  

SciTech Connect (OSTI)

This is the first quarterly technical progress report for the project. Although the contract was awarded on March 30, 1995 and Pre-Award Approval was given on January 26, 1995, the partners of this project initiated work on October 1, 1994. As such, this progress report summarizes the work performed from project inception. The production and injection data, reservoir engineering data, and digitized and normalized log data were all completed sufficiently by the end of the quarter to start work on the basic reservoir engineering and geologic stochastic models. Basic reservoir engineering analysis began June 1 and will continue to March, 1996. Design work for the 5 observation/core holes, oil finger printing of the cored oil sands, and tracers surveys began in January, 1995. The wells will be drilled from July--August, 1995 and tracer injection work is projected to start in October, 1995. A preliminary deterministic 3-D geologic model was completed in June which is sufficient to start work on the stochastic 3-D geologic model. The four proposed horizontal wells (two injectors and two producers) have been designed, equipment has been ordered, and the wells will be drilled from mid-August through September. Four existing steam injection wells were converted to hot water injection in March, 1995. Initial rates were kept low to minimize operational problems. Injection rates will be increased significantly in July.

Clarke, D. [Long Beach City Dept. of Oil Properties, CA (United States); Ershaghi, I. [Southern California, CA (United States); Davies, D. [Davies (David K.) and Associates, Kingwood, TX (United States); Phillips, C.; Mondragon, J. [Tidelands Oil Production Company (United States)

1995-07-28T23:59:59.000Z

416

Sustainable Energy Utility (SEU)- Green for Green Home Rebate  

Broader source: Energy.gov [DOE]

The Delaware Sustainable Energy Utility, in partnership with the Delaware Department of Natural Resources and Environmental Control (DNREC) and the Home Builders Association of Delaware, is...

417

Cenozoic pelagic Sr//Ca records: Exploring a link to paleoproductivity College of Marine Sciences, University of Delaware, Lewes, Delaware, USA  

E-Print Network [OSTI]

Cenozoic pelagic Sr//Ca records: Exploring a link to paleoproductivity K. Billups College of Marine May 2004; accepted 24 May 2004; published 20 July 2004. [1] Recent studies have revealed that Sr/Ca ratios of coccolithophores may be affected by productivity. Here we compile published Sr/Ca data from

Schrag, Daniel

418

LONG-RANGE RECONNAISSANCE IMAGER ON NEW HORIZONS A. F. Cheng1  

E-Print Network [OSTI]

Tel. 240-228-5415 andrew.cheng@jhuapl.edu 2 SSG Precision Optronics, Wilmington MA ABSTRACT The LOng

Stern, S. Alan

419

Ralph: A Visible/Infrared Imager for the New Horizons Pluto/Kuiper Belt Mission  

E-Print Network [OSTI]

, CO 80301 5 SSG Precision Optronics, 65 Jonspin Rd., Wilmington MA, 01887 6 NASA/Ames Research Center

Stern, S. Alan

420

Abstract--The goal of this project is to develop a means for individuals with stroke to practice arm movement therapy at  

E-Print Network [OSTI]

to be practiced and monitored. Toward this end, we modified an anti-gravity arm orthosis, the Wilmington Robotic

Bobrow, James E.

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

UNITED STATES DEPARTMENT OF THE INTERIOR, Fred A. Seaton, Secret8l7 Fish and WUdl.1f'e Service, Arnie J. Suomela, Commissioner  

E-Print Network [OSTI]

City. Trawler Sales Co., Wilmington. Williston Boat Works, Williston. FLORIDA (AtlantiC and Gulf) J. F

422

Interconnection Guidelines  

Broader source: Energy.gov [DOE]

'''''Note: Delaware law ([http://delcode.delaware.gov/title26/c010/index.shtml#1014 26 Del. C. 1014]) requires the Delaware Public Service Commission (PSC), Delaware Electric Cooperative (DEC),...

423

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

424

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

425

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

426

Examination of Babcock and Wilcox tubes after exposure in an industrial waste incinerator  

SciTech Connect (OSTI)

Seven ceramic tubes provided by, and in most cases manufactured by, Babcock and Wilcox were exposed in E. I. DuPont`s Wilmington, Delaware, hazardous waste incinerator. These tubes were subsequently examined at Oak Ridge National Laboratory to determine the effect of exposure on the strength and microstructural integrity of the tube materials. An unexposed tube section of one of the materials was also examined. Evaluation methods included c-ring compression tests, light microscopy, and electron microprobe spectroscopy. The c-ring compression tests revealed a very wide range in the strengths of the materials tested; the strongest was DuPont Lanxide Composites (DLC) silicon carbide particulate-strengthened alumina, and the weakest was the DLC Type B mixed-oxide material. The only material for which data on unexposed samples were available showed lower strength than the exposed material. Microstructural examination of the samples yielded minimal evidence of interaction of most of the tube materials with the components of the environment. Microprobe examination showed some segregation of yttrium in the matrix and along the surface of one of the PRD166/zirconia tubes and limited interaction of the fibers in the same tube with the components of the environment.

Keiser, J.R.; Ferber, M.K.; Longmire, H.F.; Walker, L.R.; Hindman, D.L.

1996-06-01T23:59:59.000Z

427

University of Delaware -Tribology Laboratory Atlantic Advanced O shore Wind Energy Consortium  

E-Print Network [OSTI]

Wind Energy Consortium Assessing Tribological Aspects of Gearbox Reliability in Wind Turbines Prof for analysis by the group. Downtime hours accumulated from 2003 to 2007 for wind turbines in Germany #12. Instrument Lewes Turbine - Evaluate the loads on a large-scale turbine; Q4 D. Collect Turbine Data; Q4-8 E

Firestone, Jeremy

428

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Delaware  

E-Print Network [OSTI]

-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone of atmospheric acid deposition on soils: 1) does acid rain enhance mobilization of harmful heavy metals in soils to the development of our forest and water resources3 . It could seriously hinder the prospects of using coal

Sparks, Donald L.

429

Final Technical Report: Residential Fuel Cell Demonstration by the Delaware County Electric Cooperative, Inc.  

SciTech Connect (OSTI)

This demonstration project contributes to the knowledge base in the area of fuel cells in stationary applications, propane fuel cells, edge-of-grid applications for fuel cells, and energy storage in combination with fuel cells. The project demonstrated that it is technically feasible to meet the whole-house electrical energy needs of a typical upstate New York residence with a 5-kW fuel cell in combination with in-home energy storage without any major modifications to the residence or modifications to the consumption patterns of the residents of the home. The use of a fuel cell at constant output power through a 120-Volt inverter leads to system performance issues including: relatively poor power quality as quantified by the IEEE-defined short term flicker parameter relatively low overall system efficiency Each of these issues is discussed in detail in the text of this report. The fuel cell performed well over the 1-year demonstration period in terms of availability and efficiency of conversion from chemical energy (propane) to electrical energy at the fuel cell output terminals. Another strength of fuel cell performance in the demonstration was the low requirements for maintenance and repair on the fuel cell. The project uncovered a new and important installation consideration for propane fuel cells. Alcohol added to new propane storage tanks is preferentially absorbed on the surface of some fuel cell reformer desulfurization filters. The experience on this project indicates that special attention must be paid to the volume and composition of propane tank additives. Size, composition, and replacement schedules for the de-sulfurization filter bed should be adjusted to account for propane tank additives to avoid sulfur poisoning of fuel cell stacks. Despite good overall technical performance of the fuel cell and the whole energy system, the demonstration showed that such a system is not economically feasible as compared to other commercially available technologies such as propane reciprocating engine generators.

Mark Hilson Schneider

2007-06-06T23:59:59.000Z

430

A comparison of two GIV mechanisms for providing ancillary services at the University of Delaware  

E-Print Network [OSTI]

, called a "GIV (Grid Integrated Vehicle) mechanism". In literature, many GIV mechanisms are proposed decide autonomously on the amount of power available for ancillary services. In the centralized mechanism. INTRODUCTION Growing concerns about the environment and increasing fuel prices are causing a shift towards EVs

Firestone, Jeremy

431

Sustainable Landscape Practices Drafted by the University of Delaware Botanic Garden Advisory Board's Green Initiatives  

E-Print Network [OSTI]

establishment or management during extended drought. · Use captured and treated rainwater, grey gardens, green roofs) rather than relying on stormwater collection and removal from the site. · Prevent-products. For example, collect and shred leaves to use as mulch and compost vegetative debris. · Select and use

Taufer, Michela

432

Toxic Release Inventory (TRI), Delaware, 1991 and 1992 (in Dbase III plus) (for microcomputers). Data file  

SciTech Connect (OSTI)

The Toxic Chemical Release Inventory (TRI) data gives annual estimated releases of toxic chemicals to the environment for the area indicated. Section 313 of the Emergency Planning and Community Right-to-Know Act (also known as Title III) of the Superfund Amendments and Reauthorization Act (SARA) of 1986 (Public Law 99- 499) requires EPA to establish an inventory of toxic chemical emissions from certain facilities. Section 313 informs the public of the presence of chemicals in their communities and releases of these chemicals into the community. With this information, States and communities, working with industrial facilities required to comply with this law, will be better able to protect public health and the environment. The TRI data on diskette includes (1) the names, addresses, counties, and public contacts of facilities manufacturing, processing or using the reported chemicals; (2) the SIC code for the plants; (3) the chemical involved; and (4) the estimated quantity emitted into the air (point and non-point emissions), discharged into bodies of water, injected underground, released to land, or released to publicly owned treatment works. Beginning with the 1991 reports, facilities also are required to provide information about pollution prevention and source reduction activities. New data elements include quantities of the listed chemical recycled and used for energy recovery on-site; quanties transferred off- site for recycling and energy recovery. Source reduction activities, and methods used to indentify those activities. All releases are in pounds per year. Also provided is the FIPS code corresponding to the facility state and county; the unique ID number assigned by Dun and Bradstreet to the parent company of the reporting facility as well as the name of the corporation or other business entity that owns or controls the reporting facility.

Not Available

1992-01-01T23:59:59.000Z

433

Ambient dissolved oxygen concentrations in Delaware's Inland Bays. Final report, June 6, 1984  

SciTech Connect (OSTI)

Ambient dissolved oxygen concentrations were measured at dawn during August, 1983, in Rehoboth and Indian River Bays. In Indian River Bay, 59% of the D.O. measurements were below the State minimum water quality standard of 5 mg L/sup -1/, while in Rehoboth Bay 17% of the values fail to meet the State standards. Diurnal dissolved oxygen curves measured at 5 stations in the Bays and tributary creeks, provide evidence that, although the Bays are in reasonable balance with respect to apparent net daytime photosynthesis (Pa) and nighttime respiration (Rn), the absolute values of Pa and Rn are very high, compared with other coastal ecosystems, except for central Rehoboth Bay. These conclusions are consistent with the annual nutrient loads to the systems, which are about double for Indian River when contrasted with Rehoboth. 11 references, 1 figure, 7 tables.

Biggs, R.B.

1984-01-01T23:59:59.000Z

434

(Delaware Study) National Study of Instructional Costs and Productivity -Fall 2011 Report of Fall 2010 Data  

E-Print Network [OSTI]

.00 1.0 0.0 0.0 0.0 1.0 1,136.5 1,231.5 81.0 2,449.0 254.8 168.0 422.8 2,871.8Total 22.0 12.5 19.2 9.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 1,871.5 0.0 0.0 0.0 Regular TTT Other Regular.52 0.00 0.0 0.0 0.0 0.0 0.0 1,521.5 213.0 137.0 1,871.5 190.0 147.0 337.0 2,208.5Total 4.0 10.5 4.1 8

Farritor, Shane

435

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Delaware  

E-Print Network [OSTI]

reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form of micaceous and vermiculitic clay ( Coastal Plain soils, N is readily lost via leaching and denitrification due to low clay and organic matter

Sparks, Donald L.

436

University of Delaware EnErgy InstItUtE syMPOsIUM  

E-Print Network [OSTI]

Institute, and Symposium Objectives Mark A. Barteau Director, UD Energy Institute The Sustainable Energy. Birkmire Director, Institute of Energy Conversion Solar Demonstration Project Robin Morgan Dean for High Energy and Power Density I George Hadjipanayis Chair, Physics and Astronomy Novel Materials

Firestone, Jeremy

437

UNIVERSITY OF DELAWARE Information on biosafety is available on the Environmental Health & Safety web page at  

E-Print Network [OSTI]

:_____________________________________________________ 5. Please attach an abstract of the work being performed. 6. Labs to be used for work:_____________________________________________ 7. List of individuals participating in work, including job title:_________________________________________________ Is effectiveness verified? How? ________________________________________ 17. Will animals be used in work? YES

Firestone, Jeremy

438

,"Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: Energy SourcesWyoming"Coalbed Methane ProvedDry Natural GasMarketedCoalbedNetGas,Price SoldPrice

439

,"Delaware Natural Gas LNG Storage Net Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: Energy SourcesWyoming"Coalbed Methane ProvedDry Natural GasMarketedCoalbedNetGas,Price

440

Percent of Commercial Natural Gas Deliveries in Delaware Represented by the  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan Feb Mar Apr May Junthe PricePricethePrice

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Percent of Industrial Natural Gas Deliveries in Delaware Represented by the  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan Feb MarPrice (Percent)

442

Percent of Industrial Natural Gas Deliveries in Delaware Represented by the  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan Feb MarPrice (Percent)Price

443

The University of Delaware is an equal opportunity employer and will not discrim  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert Southwest RegionatSearchScheduled System BurstLong Term ScheduleProjectTheUniversity of

444

Natural Gas Citygate Price in Delaware (Dollars per Thousand Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia,(Million Barrels) Crude Oil Reserves in Nonproducing Reservoirs Year2per6.48 6.18 5.63 4.73 4.88 5.72Year JanYearYear

445

Percent of Commercial Natural Gas Deliveries in Delaware Represented by the  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia,(Million Barrels) Crude Oil Reserves in Nonproducing ReservoirsYear-MonthCoalbed Methane(Dollars perPricethePrice

446

OscarAndrewHammersteinIIITheHammersteins:AMusicalTheatreFamily University of Delaware  

E-Print Network [OSTI]

Noodles and Grilled Asparagus OR Pan-seared Scallion Crusted Red Tail Sea Bass with Lemon-roasted Heirloom - Please Select One* Member(s) __________________________________ Pork Fish Vegetarian First Last _______________________________________________ Pork Fish Vegetarian First Last Guest(s) ____________________________________ Pork Fish Vegetarian

Kirby, James T.

447

The Delaware Lahore Delhi Partnership for Peace Invites you to a luncheon featuring  

E-Print Network [OSTI]

.S. foreign policy. He entered the Foreign Service of the United States in 1985 and since then has served: United States business opportunities in India and Pakistan. United States-India and United States and India and Pakistan. The luncheon program will provide ample time for questions from the audience. #12

Cakoni, Fioralba

448

Delaware Natural Gas Lease and Plant Fuel Consumption (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year JanWithdrawals

449

Delaware Natural Gas Price Sold to Electric Power Consumers (Dollars per  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year (Million CubicThousand

450

Delaware State University | OSTI, US Dept of Energy, Office of Scientific  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesData Files Data Files 1B&W Y-12studies inBImpact ofand

451

Delaware Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998 10,643 10,998 10,998 10,6439723 42Feet)CubicDecade

452

©2013 Catalysis Center for Energy Innovation * University of Delaware * N  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNLBuildingsScattering atTh eFebruary 12,

453

American Ref-Fuel of Delaware Valley Biomass Facility | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergy InformationTuriAlexandriaAlstomAmedeePowerNetPowerNet Jump

454

Electric Cars Coming to Former Delaware GM Plant | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-UpHeat PumpRecord ofESPC ENABLE: ECM Summary ECMWeartheEfficiently RecoveringEightto

455

Delaware Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03) ElectricFoot)

456

Delaware Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)

457

Delaware Natural Gas Delivered to Commercial Consumers for the Account of  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)% of TotalOthers

458

Delaware Natural Gas Price Sold to Electric Power Consumers (Dollars per  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)%

459

Delaware Price of Natural Gas Sold to Commercial Consumers (Dollars per  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam Coal Import96 4.87CBECS Public Use Data0 0 0 00/03)%Year Jan

460

SEP Success Story: Delaware Company Breathes New Life into Old Post Office  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists' Research |Regulation Services2014 Update |

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Natural Gas Citygate Price in Delaware (Dollars per Thousand Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelinesProved ReservesFeet) Year Jan Feb Mar Apr MayYear Monthly Annual530

462

New Whole-House Solutions Case Study: Insight Homes, Seaford, Delaware  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F S iPartnership Program |Million DOE AwardCDC Realty,the

463

Low E Brings High Savings in Newark, Delaware | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in3.pdfEnergy Health andofIanJenniferLeslieEnergy LoanOfficial Dr.TechnicalLowLow E

464

Testimony of Jeremy Firestone Delaware House Energy and Natural Resources Committee  

E-Print Network [OSTI]

;2 rather than the government projections are correct, the wind contract would likely lower electric prices for Delmarva households, not raise them. Third, a long-term fixed price wind contract is like insurance. Most; rather I am here to answer questions. Turning to the Bluewater agreement, first, it is fixed-price

Firestone, Jeremy

465

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

466

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

467

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

468

CX-003827: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

469

CX-000751: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide (Seismic) CX(s)...

470

CX-000752: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide (Pier F Drilling)...

471

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Broader source: Energy.gov (indexed) [DOE]

offshore, Long Beach Harbor, California Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for large Scale Geologic Storage of CO2....

472

CX-003818: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

473

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Offshore Long Beach Harbor, CA Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Project awarded under ARRA DE-FOA0000033. NEPA...

474

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

CA Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Project awarded under ARRA DE-FOA0000033. NEPA action is to cover...

475

CX-003825: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

476

CX-012265: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles... CX(s) Applied: B3.1 Date: 06262014 Location(s): California,...

477

CX-012266: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles... CX(s) Applied: A9 Date: 06262014 Location(s): California Offices(s):...

478

CX-000750: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide (Terminal Island...

479

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Broader source: Energy.gov (indexed) [DOE]

CA Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for large Scale Geologic Storage of CO2. Project awarded under ARRA...

480

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles... Extending the length of the project. Office work and modeling at...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for large Scale Geologic Storage of CO2. Project awarded under ARRA...

482

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for NEPA action is to cover literature reviews, computer work, and other...

483

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Technologies FE SCCSequestration Division FY13-14 062013 - 9302014 Brian Dressel Offshore Los Angeles, CA Characterization of Pliocene and Miocene Formations in the Wilmington...

484

CX-003829: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

485

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

C Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Project awarded under ARRA DE-FOA0000033. NEPA action is to cover...

486

CX-000753: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide (Literature and...

487

CX-003814: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9...

488

Department of Energy Selects U.S. University-led Teams for $30...  

Energy Savers [EERE]

University; University of New Mexico; University of North Carolina -Wilmington; PNNL; LBNL; INL An Innovative Approach to Precision Fission Measurements using a Time Projection...

489

CX-008517: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Applied: B5.22 Date: 07122012 Location(s): North Carolina Offices(s): National Energy Technology Laboratory Install biodiesel fueling infrastructure in Wilmington, North...

490

Categorical Exclusion Determination Form Proposed Action Title...  

Broader source: Energy.gov (indexed) [DOE]

place at Smart Wire Grid, Inc. (Oakland, CA), Innoventor, Inc. (Earth City, MO), New Potato Technologies, Inc. (Wilmington, NC), National Electric Testing Research and...

491

The Convergence of Good Faith and Oversight  

E-Print Network [OSTI]

two important strands of corporate governance jurisprudence.pervades Delawares corporate governance jurisprudence. 14Directors and the ALI Corporate Governance Project, 61 G

Bainbridge, Stephen M

2007-01-01T23:59:59.000Z

492

E-Print Network 3.0 - archael system ignicoccus Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Source: Green, Pamela - Delaware Biotechnology Institute & Department of Plant and Soil Sciences, University of Delaware; Lowe, Todd M. - Department of Biomolecular...

493

E-Print Network 3.0 - alpha-herpesvirus infection induces Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Green, Pamela - Delaware Biotechnology Institute & Department of Plant and Soil Sciences, University of Delaware Collection: Biotechnology ; Biology and Medicine 16...

494

EA-1782: Final Environmental Assessment | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

EA-1782: Final Environmental Assessment University of Delaware Lewes Campus Onsite Wind Energy Project The University of Delaware has constructed a wind turbine adjacent to its...

495

Depositional environment and hydrodynamic flow in Guadalupian Cherry Canyon sandstone, West Ford and West Geraldine fields, Delaware Basin, Texas  

E-Print Network [OSTI]

. Composition, texture and sedimentary structur es in the B1 and B2 sandstones, Conoco G. E. Ramsey 46-16, 3479-3537 ft, Geraldine field. Letters at the right of center column indicate turbidite divisions 31 12. Burial diagenesis of Cherry Canyon sandstones..., permeability and fluid saturations in the 81 and 82 intervals, Conoco G. E. Ramsey 46-16, Geraldine field 58 25. Secondary porosity in Cherry Canyon sandstones, Conoco G. E. Ramsey 14-3, Conoco G. E. Ramsey 22-3, and Conoco G. E. Ramsey 46-1 6, West For d...

Linn, Anne Marie

1985-01-01T23:59:59.000Z

496

Endless career opportunities Department of Civil & Environmental Engineering University of Delaware 302-831-2442 www.ce.udel.edu  

E-Print Network [OSTI]

engineering, environmental engineering, sustainable infrastructure, and environmental sustainability. Active structures; computer modeling of wave/ shoreline interactions; intelligent transportation systems; management and operation of civil infrastructure systems; remediation of contaminated soil and groundwater

Kirby, James T.

497

The occurrence of clays and their bearing on evaporite mineralogy in the Salado Formation, Delaware Basin, New Mexico  

E-Print Network [OSTI]

, potassium, and magnesium K-alpha linescans from sample in SEM photograph (thin 'line). The dark area corresponding to the high silicon area is clay. The mineral to the left of the clay is langbefnite, and to the right of the clay is halite. . . . Thin.... Thin sections were made from samples in intervals include potash minerals in clay-rich areas, potash minerals in clay-free areas, clay occurrences in halite/poIyhalite areas, and clay-free occurrences of halite and polyhalite. These thin sections...

Harville, Donald Gene

1985-01-01T23:59:59.000Z

498

Toxic Release Inventory (TRI), Delaware, 1991 and 1992 (in Lotus 1-2-3) (for microcomputers). Data file  

SciTech Connect (OSTI)

The Toxic Chemical Release Inventory (TRI) data gives annual estimated releases of toxic chemicals to the environment for the area indicated. Section 313 of the Emergency Planning and Community Right-to- Know Act (also known as Title III) of the Superfund Amendments and Reauthorization Act (SARA) of 1986 (Public Law 99-499) requires EPA to establish an inventory of toxic chemical emissions from certain facilities. Section 313 informs the public of the presence of chemicals in their communities and releases of these chemicals into the community. With this information, States and communities, working with industrial facilities required to comply with this law, will be better able to protect public health and the environment. The TRI data on diskette includes (1) the names, addresses, counties, and public contacts of facilities manufacturing, processing or using the reported chemicals; (2) the SIC code for the plants; (3) the chemical involved; and (4) the estimated quantity emitted into the air (point and non-point emissions), discharged into bodies of water, injected underground, released to land, or released to publicly owned treatment works. Beginning with the 1991 reports, facilities also are required to provide information about pollution prevention and source reduction activities. New data elements include quantities of the listed chemical recycled and used for energy recovery on-site; quanties transferred off- site for recycling and energy recovery. Source reduction activities, and methods used to indentify those activities. All releases are in pounds per year. Also provided is the FIPS code corresponding to the facility state and county; the unique ID number assigned by Dun and Bradstreet to the parent company of the reporting facility as well as the name of the corporation or other business entity that owns or controls the reporting facility.

Not Available

1992-01-01T23:59:59.000Z

499

University of Delaware Laboratory Chemical Waste Disposal Guide ALL CHEMICAL WASTE MUST BE DISPOSED OF THROUGH THE  

E-Print Network [OSTI]

experiments and procedures Non-Returnable gas cylinders Batteries Spent solvents, Stains, Strippers, Thinners, Fertilizers Formaldehyde and Formalin Solutions Mercury containing items (other heavy metals) Liquid OR SMALL CONTAINERS IMPORTANT: DO NOT DISPOSE OF REACTIVE, AIR SENSITIVE, OR OXIDIZER SAMPLES

Firestone, Jeremy

500

NEWSLETTER OF THE PARTNERSHIP FOR THE DELAWARE ESTUARY: A NATIONAL ESTUARY PROGRAM VOLUME 20 ISSUE 5 SUMMER 2010  

E-Print Network [OSTI]

-- to lives, livelihoods, and the environment -- taken to secure the energy that pow- ers our society. Among "Fracking" Delayed to Ensure Clean Water 7 Electricity Lines: Coming to a Watershed Near You 9 Wind Power most of the water is returned to the river, intakes can have significant impacts on fish and other

Firestone, Jeremy