Powered by Deep Web Technologies
Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Wilmington, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Wilmington, Delaware: Energy Resources Wilmington, Delaware: Energy Resources (Redirected from Wilmington, DE) Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7459467°, -75.5465889° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7459467,"lon":-75.5465889,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

2

Wilmington Manor, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Wilmington Manor, Delaware: Energy Resources Wilmington Manor, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.6867795°, -75.5843694° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.6867795,"lon":-75.5843694,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

3

Solar energy system demonstration project at Wilmington Swim School, New Castle, Delaware. Final report  

SciTech Connect (OSTI)

This document is the Final Report of the Solar Energy System located at the Wilmington, Swim School, New Castle, Delaware. This active solar system is composed of 2,700 square feet of Revere liquid flat plate collectors piped to a 2,800 gallon concrete storage tank located below ground near the building. A micro-computer based control system selects the optimal applications of the stored energy among space, domestic water and pool alternatives. The controlled logic is planned for serving the heat loads in the following order: space heat-new addition, domestic water-entire facility, and pool heating-entire facility. A modified trombe wall passive operation the active system will bypass the areas being served passively. The system was designed for a 40 percent heating and a 30 percent hot water solar contribution.

None

1980-07-01T23:59:59.000Z

4

Wilmington, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7459467°, -75.5465889° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7459467,"lon":-75.5465889,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

5

Category:Wilmington, NC | Open Energy Information  

Open Energy Info (EERE)

NC NC Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wilmington, NC" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wilmington NC Duke Energy Carolinas LLC.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Wilmington NC Duke Energy Carolinas LLC.png SVQuickServiceRestaura... 68 KB SVHospital Wilmington NC Duke Energy Carolinas LLC.png SVHospital Wilmington ... 67 KB SVLargeHotel Wilmington NC Duke Energy Carolinas LLC.png SVLargeHotel Wilmingto... 65 KB SVLargeOffice Wilmington NC Duke Energy Carolinas LLC.png SVLargeOffice Wilmingt... 68 KB SVMediumOffice Wilmington NC Duke Energy Carolinas LLC.png SVMediumOffice Wilming... 68 KB SVMidriseApartment Wilmington NC Duke Energy Carolinas LLC.png

6

Category:Wilmington, DE | Open Energy Information  

Open Energy Info (EERE)

DE DE Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wilmington, DE" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wilmington DE Delmarva Power & Light Co.png SVFullServiceRestauran... 65 KB SVQuickServiceRestaurant Wilmington DE Delmarva Power & Light Co.png SVQuickServiceRestaura... 66 KB SVHospital Wilmington DE Delmarva Power & Light Co.png SVHospital Wilmington ... 63 KB SVLargeHotel Wilmington DE Delmarva Power & Light Co.png SVLargeHotel Wilmingto... 63 KB SVLargeOffice Wilmington DE Delmarva Power & Light Co.png SVLargeOffice Wilmingt... 64 KB SVMediumOffice Wilmington DE Delmarva Power & Light Co.png SVMediumOffice Wilming... 67 KB SVMidriseApartment Wilmington DE Delmarva Power & Light Co.png

7

Tidelands DOE Project at Wilmington  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Use browser back button to return to main text from links Use browser back button to return to main text from links Tidelands DOE Project at Wilmington : Giving an Aging Heavy Oil Giant a New Lease on Life When Ranger Petroleum Corporation of Long Beach, CA, brought in the Watson No. 2 exploratory well in January 1932, the completion yielded a flow of 150 bbl/day of clean 14 °API crude oil from pay at 3,674-784 ft. Back then, such a flow rate of low-gravity oil in a wildcat didn't exactly set the heart racing. It even took state authorities 54 months to declare the result a new field discovery. Little did they know it would evolve into one of the four largest oilfields in the United States and one of the most impressive success stories of urban oilfield development. Wilmington oilfield, the biggest in the Los Angeles Basin, extends southeast to northwest through the basin, from the middle of San Pedro Bay through the City of Long Beach and east of the Palos Verdes Peninsula. (Click here for the Wilmington field location ma.)

8

Delaware Solid Waste Authority (Delaware)  

Broader source: Energy.gov [DOE]

The Delaware Solid Waste Authority (DSWA) runs three landfills, all of which recover methane and generate electricity with a total capacity of 24 MWs. The DSWA Solid Waste Plan includes goals,...

9

Delaware Strategic Fund (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Strategic Fund (Delaware) Strategic Fund (Delaware) Delaware Strategic Fund (Delaware) < Back Eligibility Commercial Industrial Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Delaware Program Type Grant Program Provider Business Financing The Delaware Strategic Fund represents the primary funding source used by Delaware Economic Development Authority (DEDA) to provide customized loans and grants to businesses for job creation, relocation and expansion. For businesses considering locating in the state of Delaware, financial assistance may be provided in the form of low interest loans, grants, or other creative instruments to support the attraction of businesses that pay sustainable wages. Assistance terms are negotiated specific to each

10

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

11

Delaware Land Protection Act (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware Land Protection Act (Delaware) Delaware Land Protection Act (Delaware) Delaware Land Protection Act (Delaware) < Back Eligibility Utility Commercial Agricultural Investor-Owned Utility State/Provincial Govt Industrial Municipal/Public Utility Local Government Rural Electric Cooperative Tribal Government Nonprofit Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info Start Date 1990 State Delaware Program Type Environmental Regulations Provider Delaware Department of Natural Resources and Environmental Control The Land Protection Act requires the Department of Natural Resources and Environmental Control to work with the Delaware Open Space Council to develop standards and criteria for determining the existence and location

12

Accidental Release Program (Delaware)  

Broader source: Energy.gov [DOE]

The Delaware Accidental Release Prevention Regulation contains requirements for owners or operators of stationary sources having regulated extremely hazardous substances onsite to develop and...

13

University of Delaware | Contact CCEI  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Laboratory (ISE Lab) at the University of Delaware. Address Catalysis Center for Energy Innovation University of Delaware 221 Academy Street Newark, DE 19716 Phone Number...

14

Delaware/Incentives | Open Energy Information  

Open Energy Info (EERE)

Incentives Incentives < Delaware Jump to: navigation, search Contents 1 Financial Incentive Programs for Delaware 2 Rules, Regulations and Policies for Delaware Download All Financial Incentives and Policies for Delaware CSV (rows 1 - 61) Financial Incentive Programs for Delaware Download Financial Incentives for Delaware CSV (rows 1 - 22) Incentive Incentive Type Active DEMEC - Green Energy Program Incentives (Delaware) State Rebate Program No DEMEC Member Utilities - Green Energy Program Incentives (8 utilities) (Delaware) Utility Rebate Program Yes Delaware Electric Cooperative - Green Energy Program Incentives Utility Rebate Program Yes Delaware Energy An$wers Home Performance Program (Delaware) State Rebate Program No Delaware Energy An$wers for Business (Delaware) State Grant Program No

15

Natural Gas Regulation - Delaware Public Service Commission (Delaware) |  

Broader source: Energy.gov (indexed) [DOE]

Natural Gas Regulation - Delaware Public Service Commission Natural Gas Regulation - Delaware Public Service Commission (Delaware) Natural Gas Regulation - Delaware Public Service Commission (Delaware) < Back Eligibility Utility Investor-Owned Utility State/Provincial Govt Industrial Municipal/Public Utility Local Government Fuel Distributor Program Info State Delaware Program Type Generating Facility Rate-Making Provider Delaware Public Service Commission The Delaware Public Service Commission regulates only the distribution of natural gas to Delaware consumers. The delivery and administrative costs associated with natural gas distribution are determined in base rate proceedings before the Commission. The recovery of costs associated with the natural gas used by customers is determined annually as part of fuel adjustment proceedings. As a result of this process, rates for natural gas

16

Delaware State University | .EDUconnections  

Office of Scientific and Technical Information (OSTI)

Delaware State University Delaware State University Research Office of the Associate Provost for Research General Research Capability Center for Integrated Biological & Environmental Research Experimental Program to Stimulate Competitive Research Delaware IDeA Network of Biomedical Research Excellence Faculty Research DSU Leads the Way in Better Buildings DSU is one of the first university partners in the US to join the Department of Energy's Better Buildings inititative to reduce its carbon footprint by 25% by 2015. Secretary of Energy Chu participated in the DSU kick-off program to commemorate the school's efforts in July 2012. Read more about this showcase project. Search this site: Search Prestigious research projects underway by Delaware State University (DSU) serve to enhance DSU's land-grant mission and its contributions to the

17

Delaware Transportation Infrastructure Forum Problem Identification Statements  

E-Print Network [OSTI]

2013 Delaware Transportation Infrastructure Forum Problem Identification Statements Sponsored by The Delaware Center for Transportation and the Delaware Department of Transportation Delaware Center for Transportation Your main resource for transportation education and research Identifying Important Issues Related

Firestone, Jeremy

18

Delaware Greenhouse Gas Reduction Projects Grant Program (Delaware) |  

Broader source: Energy.gov (indexed) [DOE]

Greenhouse Gas Reduction Projects Grant Program (Delaware) Greenhouse Gas Reduction Projects Grant Program (Delaware) Delaware Greenhouse Gas Reduction Projects Grant Program (Delaware) < Back Eligibility Agricultural Commercial Industrial Institutional Investor-Owned Utility Local Government Municipal/Public Utility Rural Electric Cooperative Schools State/Provincial Govt Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Solar Wind Program Info Funding Source Greenhouse Gas Reduction Projects Fund State Delaware Program Type Grant Program Provider Delaware Department of Natural Resources and Environmental Control The Delaware Greenhouse Gas Reduction Projects Grant Program is funded by the Greenhouse Gas Reduction Projects Fund, established by the Act to Amend Title 7 of the Delaware Code Relating to a Regional Greenhouse Gas

19

Delaware.indd  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Delaware Delaware www.effi cientwindows.org March 2013 1. Meet the Energy Code and Look for the ENERGY STAR ® Windows must comply with your local energy code. Windows that are ENERGY STAR qualifi ed typically meet or exceed energy code requirements. To verify if specific window energy properties comply with the local code requirements, go to Step 2. 2. Look for Effi cient Properties on the NFRC Label The National Fenestration Rating Council (NFRC) label is needed for verifi cation of energy code compliance (www.nfrc. org). The NFRC label displays whole- window energy properties and appears on all fenestration products which are part of the ENERGY STAR program.

20

Borough of New Wilmington, Pennsylvania (Utility Company) | Open Energy  

Open Energy Info (EERE)

New Wilmington New Wilmington Place Pennsylvania Utility Id 13489 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service Commercial Large General Service Commercial Residential Service Residential Small General Service Commercial Average Rates Residential: $0.1400/kWh Commercial: $0.1260/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Borough_of_New_Wilmington,_Pennsylvania_(Utility_Company)&oldid=40909

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Recovery Act State Memos Delaware  

Energy Savers [EERE]

go to energyempowers.govDelaware Recovery Act Success Stories ENERGYEMPOWERS.GOV less heat and cooling loss so our facility is more efficient." Buying domestically For the...

22

University of Delaware | About CCEI  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Catalysis Center for Energy Innovation About CCEI The Catalysis Center for Energy Innovation (CCEI) is a multi-institutional research center at the University of Delaware. It was...

23

University of Delaware | CCEI Partners  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Its Partner Institutions The Catalysis Center for Energy Innovation (CCEI) is a partnership between the University of Delaware, 8 academic institutions and 1 national...

24

Brownfield Assistance Program (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Brownfield Assistance Program (Delaware) Brownfield Assistance Program (Delaware) Brownfield Assistance Program (Delaware) < Back Eligibility Commercial Agricultural Industrial Construction Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info Funding Source Delaware Strategic Fund State Delaware Program Type Grant Program Provider Business Financing The Brownfield Assistance Program, administrated by the Delaware Economic Development Office (DEDO) and funded from Delaware Strategic Fund, provides matching grants to owners and developers to encourage the redevelopment of environmentally distressed sites within the state. Brownfield redevelopment is an important tool for Delaware's livable growth, recycling the state's

25

Evaluation of the Wilmington field micellar/polymer project  

SciTech Connect (OSTI)

The Long Beach micellar/polymer pilot in the Wilmington field has been evaluated. Actual recovery efficiency is about two-thirds of coreflood and simulation model estimates. This relatively high recovery efficiency represents a technically successful flood. Oil recovery was less than optimal, however, because of problems associated with production from an unconsolidated formation and the presence of Desulfovibrio bacteria.

Fanchl, J.R.; Carroll, H.B.

1988-05-01T23:59:59.000Z

26

Alternative Fuels Data Center: Delaware Information  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Delaware Information Delaware Information to someone by E-mail Share Alternative Fuels Data Center: Delaware Information on Facebook Tweet about Alternative Fuels Data Center: Delaware Information on Twitter Bookmark Alternative Fuels Data Center: Delaware Information on Google Bookmark Alternative Fuels Data Center: Delaware Information on Delicious Rank Alternative Fuels Data Center: Delaware Information on Digg Find More places to share Alternative Fuels Data Center: Delaware Information on AddThis.com... Delaware Information This state page compiles information related to alternative fuels and advanced vehicles in Delaware and includes new incentives and laws, alternative fueling station locations, truck stop electrification sites, fuel prices, and local points of contact. Select a new state Select a State Alabama Alaska Arizona Arkansas

27

Delaware | Building Energy Codes Program  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Site Map Printable Version Development Adoption Adoption Process State Technical Assistance Status of State Energy Code Adoption Compliance Regulations Resource Center Delaware Last updated on 2013-08-02 Commercial Residential Code Change Current Code 2009 IECC with Amendments Amendments / Additional State Code Information Agriculture structures are excluded. Approved Compliance Tools Can use COMcheck State Specific Research Impacts of ASHRAE 90.1-2007 for Commercial Buildings in the State of Delaware (BECP Report, Sept. 2009) Approximate Energy Efficiency Equivalent to 2009 IECC Effective Date 07/01/2010 Adoption Date 07/29/2009 Code Enforcement Mandatory DOE Determination ASHRAE 90.1-2007: Yes ASHRAE 90.1-2010: No Delaware DOE Determination Letter, May 31, 2013 Delaware State Certification of Commercial and Residential Building Energy Codes

28

Delaware/Geothermal | Open Energy Information  

Open Energy Info (EERE)

Geothermal Geothermal < Delaware Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Print PDF Delaware Geothermal General Regulatory Roadmap Geothermal Power Projects Under Development in Delaware No geothermal projects listed. Add a geothermal project. Operational Geothermal Power Plants in Delaware No geothermal power plants listed. Add a geothermal energy generation facility. Geothermal Areas in Delaware No areas listed. GRR-logo.png Geothermal Regulatory Roadmap for Delaware Overview Flowchart The flowcharts listed below were developed as part of the Geothermal Regulatory Roadmap project. The flowcharts cover the major requirements for developing geothermal energy, including, land access, exploration and drilling, plant construction and operation, transmission siting, water

29

Forestry Policies (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware) Delaware) Forestry Policies (Delaware) < Back Eligibility Commercial Agricultural Program Info State Delaware Program Type Environmental Regulations Provider Agriculture Delaware's forests are managed by the State Forest Service (DFS), within the State Department of Agriculture. In 2010, the Forest Service issued its Resource Assessment and Strategy documents: Delaware Forest Resource Assessment: http://dda.delaware.gov/forestry/061810_DFS_ResourceAssessment.pdf Statewide Forest Strategy: http://dda.delaware.gov/forestry/061810_DFS_Strategy.pdf The Forest Strategy document sets several goals with respect to biomass energy, including an analysis of the resource, developing restrictions on wood energy facilities, promoting a Fuels for Schools program, and developing at least one new market for low-value wood such as bio-energy

30

Categorical Exclusion Determinations: Delaware | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware Delaware Categorical Exclusion Determinations: Delaware Location Categorical Exclusion Determinations issued for actions in Delaware. DOCUMENTS AVAILABLE FOR DOWNLOAD August 12, 2013 CX-011107: Categorical Exclusion Determination High Efficiency Thin Film Fe2SiS4 and Fe2GeS4-based Cells Prepared from Low-Cost Solution CX(s) Applied: B3.6 Date: 08/12/2013 Location(s): Delaware Offices(s): Golden Field Office September 18, 2012 CX-010528: Categorical Exclusion Determination Durability Investigation for Quarternary Phosphonium-based Polymer Hydroxide Exchange Membranes CX(s) Applied: B3.6 Date: 09/18/2012 Location(s): Delaware Offices(s): Advanced Research Projects Agency-Energy September 6, 2012 CX-009147: Categorical Exclusion Determination Delaware State Energy Program Formula Grant Application

31

SREC Procurement Program (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

SREC Procurement Program (Delaware) SREC Procurement Program (Delaware) SREC Procurement Program (Delaware) < Back Eligibility Agricultural Commercial Industrial Institutional Local Government Nonprofit Residential Schools Utility Savings Category Solar Buying & Making Electricity Program Info Start Date 04/02/2012 State Delaware Program Type Performance-Based Incentive Provider Delaware Sustainable Energy Utility '''''Note: The SREC procurement program will accept applications from March 25 to April 12, 2013. The summary below is intended to reflect the 2013 program as described in the [http://depsc.delaware.gov/electric/12-526%20Staff%20Report.pdf Public Service Commission Staff Report] and [http://depsc.delaware.gov/orders/8281.pdf Order No. 8281]. More information on bid requirements, the application process and payments

32

Delaware City, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

City, Delaware: Energy Resources City, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.5778901°, -75.588815° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.5778901,"lon":-75.588815,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

33

University of Delaware Wind | Open Energy Information  

Open Energy Info (EERE)

University of Delaware Wind University of Delaware Wind Jump to: navigation, search Name University of Delaware Wind Facility University of Delaware Wind Sector Wind energy Facility Type Community Wind Facility Status In Service Owner University of Delaware Developer First Marine Wind Energy Purchaser University of Delaware Location Lewes DE Coordinates 38.783739°, -75.160654° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.783739,"lon":-75.160654,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

34

Dam Safety (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Dam Safety (Delaware) Dam Safety (Delaware) Dam Safety (Delaware) < Back Eligibility Construction Fed. Government Investor-Owned Utility Local Government Municipal/Public Utility State/Provincial Govt Tribal Government Utility Savings Category Water Buying & Making Electricity Program Info Start Date 2004 State Delaware Program Type Safety and Operational Guidelines Provider Delaware Department of Natural Resources and Environmental Control The Delaware Dam Safety Law was adopted in 2004 and provides the framework for proper design, construction, operation, maintenance, and inspection of dams in the interest of public health, safety, and welfare. The law requires licensing, inspections and preparation of emergency action plans (EAPs) for publicly owned dams with a high or significant hazard potential.

35

Categorical Exclusion Determinations: Delaware | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware Delaware Categorical Exclusion Determinations: Delaware Location Categorical Exclusion Determinations issued for actions in Delaware. DOCUMENTS AVAILABLE FOR DOWNLOAD September 28, 2010 CX-004018: Categorical Exclusion Determination High Performance Hollow Fiber Membranes for Lubricating Fluid Dehydration and Stabilization Systems CX(s) Applied: B3.6, B5.1 Date: 09/28/2010 Location(s): Newport, Delaware Office(s): Energy Efficiency and Renewable Energy August 23, 2010 CX-003463: Categorical Exclusion Determination Carbon Dioxide Capture by Sub-Ambient Membrane Operation CX(s) Applied: A9, B3.6 Date: 08/23/2010 Location(s): Newark, Delaware Office(s): Fossil Energy, National Energy Technology Laboratory August 18, 2010 CX-003402: Categorical Exclusion Determination

36

DELAWARE RECOVERY ACT SNAPSHOT | Department of Energy  

Energy Savers [EERE]

in Delaware are supporting a broad range of clean energy projects, from energy efficiency and the electric grid to solar power and energy research. Through these...

37

Pollution Prevention Act (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Pollution Prevention Act (Delaware) Pollution Prevention Act (Delaware) Pollution Prevention Act (Delaware) < Back Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility State/Provincial Govt Industrial Construction Municipal/Public Utility Local Government Residential Installer/Contractor Rural Electric Cooperative Tribal Government Low-Income Residential Schools Retail Supplier Institutional Multi-Family Residential Systems Integrator Fuel Distributor Nonprofit General Public/Consumer Transportation Program Info State Delaware Program Type Environmental Regulations This act lays out objectives for pollution prevention, education and outreach. The Department shall create a multimedia waste reduction assistance program to provide technical assistance to targeted industries, focusing on small

38

EV Community Readiness projects: Delaware Valley Regional Planning...  

Broader source: Energy.gov (indexed) [DOE]

Delaware Valley Regional Planning Commission (PA); Metropolitan Energy Information Center, Inc. (KS, MO) EV Community Readiness projects: Delaware Valley Regional Planning...

39

Chrome Deposit Corporation and the University of Delaware IAC...  

Broader source: Energy.gov (indexed) [DOE]

of Delaware students Joseph Camp and Nicole Suto; Keith Goossen, director of the Industrial Assessment Center; and Cesar Duarte, University of Delaware grad student. | Image...

40

Climate Action Plan (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware) Delaware) Climate Action Plan (Delaware) < Back Eligibility Agricultural Commercial Construction Fed. Government Fuel Distributor General Public/Consumer Industrial Installer/Contractor Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential Municipal/Public Utility Nonprofit Residential Retail Supplier Rural Electric Cooperative Schools State/Provincial Govt Systems Integrator Transportation Tribal Government Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Delaware Program Type Climate Policies Provider Delaware Division of Energy and Climate To better understand the current and future vulnerabilities and risks to climate change, DNREC Secretary Collin O'Mara directed the Division of

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Energy Incentive Programs, Delaware | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware Delaware Energy Incentive Programs, Delaware October 29, 2013 - 11:29am Addthis Updated August 2013 What public-purpose-funded energy efficiency programs are available in my state? Delaware's 1999 restructuring legislation mandated the creation of a systems benefit charge to fund low-income, energy efficiency, and renewable energy programs. Also, in the late 2000s, the state created the Delaware Sustainable Energy Utility, a non-profit corporation initially funded from bond issues, proceeds from the Regional Greenhouse Gas Initiative (RGGI), and federal government stimulus monies. The SEU's business and institutional programs have not been sustained, but the state's systems benefit charge continues to fund renewable energy programs for customers of the three largest utilities (see section below).

42

Delaware Electric Cooperative - Green Energy Fund | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware Electric Cooperative - Green Energy Fund Delaware Electric Cooperative - Green Energy Fund Delaware Electric Cooperative - Green Energy Fund < Back Eligibility Agricultural Commercial Industrial Nonprofit Residential Rural Electric Cooperative Savings Category Appliances & Electronics Commercial Lighting Lighting Alternative Fuel Vehicles Hydrogen & Fuel Cells Solar Buying & Making Electricity Heating & Cooling Commercial Heating & Cooling Heating Water Heating Wind Program Info State Delaware Program Type Public Benefits Fund Provider Delaware Department of Natural Resources and Environmental Control '''''Note: The Green Energy Fund regulations are currently under revision to improve program function and meet the requirements of the Delaware Energy Act. The Delaware Division of Energy and Climate

43

Alternative Fuels Data Center: Delaware Points of Contact  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Delaware Points of Delaware Points of Contact to someone by E-mail Share Alternative Fuels Data Center: Delaware Points of Contact on Facebook Tweet about Alternative Fuels Data Center: Delaware Points of Contact on Twitter Bookmark Alternative Fuels Data Center: Delaware Points of Contact on Google Bookmark Alternative Fuels Data Center: Delaware Points of Contact on Delicious Rank Alternative Fuels Data Center: Delaware Points of Contact on Digg Find More places to share Alternative Fuels Data Center: Delaware Points of Contact on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Points of Contact The following people or agencies can help you find more information about Delaware's clean transportation laws, incentives, and funding

44

Alternative Fuels Data Center: Delaware Laws and Incentives  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Delaware Laws and Delaware Laws and Incentives to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives Listed below are incentives, laws, and regulations related to alternative fuels and advanced vehicles for Delaware. Your Clean Cities coordinator at

45

Taking a Tour of Wilmington's Energy-Efficient Spaces | Department of  

Broader source: Energy.gov (indexed) [DOE]

a Tour of Wilmington's Energy-Efficient Spaces a Tour of Wilmington's Energy-Efficient Spaces Taking a Tour of Wilmington's Energy-Efficient Spaces February 28, 2012 - 11:30am Addthis Roya Stanley (left) on a tour of the Snipes Academy of Arts and Design with the building's architect -- Thomas Hughes. Through interactive real-time energy data tools, Snipes students incorporate energy use data in their classroom projects and studies. | Photo Courtesy of the Cape Fear Green Building Alliance. Roya Stanley (left) on a tour of the Snipes Academy of Arts and Design with the building's architect -- Thomas Hughes. Through interactive real-time energy data tools, Snipes students incorporate energy use data in their classroom projects and studies. | Photo Courtesy of the Cape Fear Green Building Alliance.

46

Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.9108325,"lon":-75.5276699,"alt":0,"address":"Delaware","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

47

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2004-09-30T23:59:59.000Z

48

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2003-09-30T23:59:59.000Z

49

Delaware Basin Monitoring Annual Report  

SciTech Connect (OSTI)

The Delaware Basin Drilling Surveillance Program (DBDSP) is designed to monitor drilling activities in the vicinity of the Waste Isolation Pilot Plant (WIPP). This program is based on Environmental Protection Agency (EPA) requirements. The EPA environmental standards for the management and disposal of transuranic (TRU) radioactive waste are codified in 40 CFR Part 191 (EPA 1993). Subparts B and C of the standard address the disposal of radioactive waste. The standard requires the Department of Energy (DOE) to demonstrate the expected performance of the disposal system using a probabilistic risk assessment or performance assessment (PA). This PA must show that the expected repository performance will not release radioactive material above limits set by the EPA's standard. This assessment must include the consideration of inadvertent drilling into the repository at some future time.

Washington Regulatory and Environmental Services; Washington TRU Solutions LLC

2005-09-30T23:59:59.000Z

50

Environmental Control (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Control (Delaware) Control (Delaware) Environmental Control (Delaware) < Back Eligibility Utility Commercial Agricultural Investor-Owned Utility State/Provincial Govt Industrial Municipal/Public Utility Local Government Rural Electric Cooperative Tribal Government Nonprofit Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Delaware Program Type Environmental Regulations This act has various provisions set for the local governments for greenhouse gas trading initiatives, solid waste recycling and water protection. The act also includes the Clean Air Act Operating Permit Program with a detailed account of fees to be paid for air pollution sources. The act establishes the collection of CO2 allowances, with 65 percent of

51

University of Delaware | Open Energy Information  

Open Energy Info (EERE)

Delaware Delaware Jump to: navigation, search Name University of Delaware Place Newark, Delaware Sector Solar Product University with a research department leading a solar cell development consortium. Coordinates 44.690435°, -71.951685° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.690435,"lon":-71.951685,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

52

WHOLE BASIN MANAGEMENT: POLICY IMPLICATIONS FOR DELAWARE  

E-Print Network [OSTI]

Richard T. Sylves, Senior Policy Fellow Yda Schreuder, Senior Policy Fellow Center for Energy....................................................................37 A. DelawareWatershed Assessment.........................................................37 B and physical science, as well as industrial and economic interests, into natural resource management plans

Delaware, University of

53

Environmental Permit Application Background Statement (Delaware)  

Broader source: Energy.gov [DOE]

The purpose of Chapter 79 of Delaware Title 7 is to ensure that the State has adequate information about the background of applicants or regulated parties for the purposes of processing permits and...

54

Tax-Exempt Bond Financing (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Bond Financing (Delaware) Bond Financing (Delaware) Tax-Exempt Bond Financing (Delaware) < Back Eligibility Utility Commercial Agricultural Investor-Owned Utility State/Provincial Govt Industrial Construction Municipal/Public Utility Local Government Installer/Contractor Rural Electric Cooperative Tribal Government Retail Supplier Systems Integrator Fuel Distributor Transportation Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Delaware Program Type Bond Program Provider Delaware Economic Development Office The Delaware Economic Development Authority provides tax-exempt bond financing for financial assistance to new or expanding businesses, governmental units and certain organizations that are exempt from federal

55

ELEG620: Solar Electric Systems University of Delaware Spring 2008 1 University of Delaware  

E-Print Network [OSTI]

obtained as an approximation to your design load, using 200Ws of solar panels. Existing loads which we haveELEG620: Solar Electric Systems University of Delaware Spring 2008 1 University of Delaware Department of Electrical and Computer Engineering ELEG620: Solar Electric Systems Photovoltaic System Design

Honsberg, Christiana

56

Alternative Fuels Data Center: Delaware Laws and Incentives for EVs  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

EVs to someone by E-mail EVs to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for EVs on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for EVs on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for EVs on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for EVs on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for EVs on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for EVs on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for EVs The list below contains summaries of all Delaware laws and incentives

57

Clean Cities: State of Delaware Clean Cities coalition  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

State of Delaware Clean Cities Coalition State of Delaware Clean Cities Coalition The State of Delaware Clean Cities coalition works with vehicle fleets, fuel providers, community leaders, and other stakeholders to reduce petroleum use in transportation. State of Delaware Clean Cities coalition Contact Information Morgan Ellis 302-739-9053 morgan.ellis@state.de.us Clean Cities Coordinator Morgan Ellis Photo of Morgan Ellis Morgan Ellis has been with the Delaware Division of Energy and Climate for three years and became the Clean Cities coordinator in 2013. Her roles and responsibilities include representing the State of Delaware on the Transportation Climate Initiative, the Regional Greenhouse Gas Initiative, as well as working on climate related policies for the State of Delaware. Ellis worked with Delaware's Clean Cities Coalition on implementing the

58

Alternative Fuels Data Center: Delaware Laws and Incentives for Exemptions  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Exemptions to someone by E-mail Exemptions to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Exemptions on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Exemptions on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Exemptions on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Exemptions on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Exemptions on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Exemptions on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Exemptions The list below contains summaries of all Delaware laws and incentives

59

Alternative Fuels Data Center: Delaware Laws and Incentives for Ethanol  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Ethanol to someone by E-mail Ethanol to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Ethanol on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Ethanol on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Ethanol on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Ethanol on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Ethanol on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Ethanol on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Ethanol The list below contains summaries of all Delaware laws and incentives

60

Alternative Fuels Data Center: Delaware Reduces Truck Idling With  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Delaware Reduces Truck Delaware Reduces Truck Idling With Electrified Parking Areas to someone by E-mail Share Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Facebook Tweet about Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Twitter Bookmark Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Google Bookmark Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Delicious Rank Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Digg Find More places to share Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on AddThis.com...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Alternative Fuels Data Center: Delaware Laws and Incentives for Other  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Other to someone by E-mail Other to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Other on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Other The list below contains summaries of all Delaware laws and incentives

62

Alternative Fuels Data Center: Delaware Laws and Incentives  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

to someone by E-mail to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives Listed below are the summaries of all current Delaware laws, incentives, regulations, funding opportunities, and other initiatives related to

63

Alternative Fuels Data Center: Delaware Laws and Incentives for NEVs  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

NEVs to someone by E-mail NEVs to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for NEVs on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for NEVs on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for NEVs on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for NEVs on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for NEVs on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for NEVs on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for NEVs The list below contains summaries of all Delaware laws and incentives

64

Alternative Fuels Data Center: Delaware Laws and Incentives for Other  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Other to someone by E-mail Other to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Other on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Other on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Other The list below contains summaries of all Delaware laws and incentives

65

Alternative Fuels Data Center: Delaware Laws and Incentives for Rebates  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Rebates to someone by E-mail Rebates to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Rebates on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Rebates on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Rebates on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Rebates on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Rebates on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Rebates on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Rebates The list below contains summaries of all Delaware laws and incentives

66

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

67

Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

68

Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies, Class III  

SciTech Connect (OSTI)

The objective of this project was to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California through the testing and application of advanced reservoir characterization and thermal production technologies. It was hoped that the successful application of these technologies would result in their implementation throughout the Wilmington Field and, through technology transfer, will be extended to increase the recoverable oil reserves in other slope and basin clastic (SBC) reservoirs.

City of Long Beach; Tidelands Oil Production Company; University of Southern California; David K. Davies and Associates

2002-09-30T23:59:59.000Z

69

Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies, Class III  

SciTech Connect (OSTI)

The objective of this project was to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California through the testing and application of advanced reservoir characterization and thermal production technologies. The successful application of these technologies would result in expanding their implementation throughout the Wilmington Field and, through technology transfer, to other slope and basin clastic (SBC) reservoirs.

City of Long Beach; Tidelands Oil Production Company; University of Southern California; David K. Davies and Associates

2002-09-30T23:59:59.000Z

70

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

71

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

72

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

73

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

74

Delaware Electric Cooperative - Green Energy Program Incentives |  

Broader source: Energy.gov (indexed) [DOE]

Delaware Electric Cooperative - Green Energy Program Incentives Delaware Electric Cooperative - Green Energy Program Incentives Delaware Electric Cooperative - Green Energy Program Incentives < Back Eligibility Agricultural Commercial Industrial Institutional Local Government Nonprofit Residential Schools Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Solar Buying & Making Electricity Heating & Cooling Commercial Heating & Cooling Heating Water Heating Wind Maximum Rebate PV: $7,500 for Class A, $10,000 for Class B or non-profits Solar Thermal (domestic water): $3,000 for residential, $7,500 for non-residential Solar Thermal (radiant space heating): $5,000 for residential, $7,500 for non-residential Wind: $2,500 Fuel Cells: $7,500 for residential, $10,000 for non-residential Geothermal Heat Pumps: $5,000 for residential, $10,000 for non-residential

75

Delaware/Wind Resources | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Delaware/Wind Resources < Delaware Jump to: navigation, search Print PDF Print Full Version WIND ENERGY STAKEHOLDER ENGAGEMENT & OUTREACHSmall Wind Guidebook Home OpenEI Home >> Wind >> Small Wind Guidebook >> Delaware Wind Resources WindTurbine-icon.png Small Wind Guidebook * Introduction * First, How Can I Make My Home More Energy Efficient? * Is Wind Energy Practical for Me? * What Size Wind Turbine Do I Need? * What Are the Basic Parts of a Small Wind Electric System? * What Do Wind Systems Cost? * Where Can I Find Installation and Maintenance Support?

76

Delaware River Basin Commission (Multiple States) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware River Basin Commission (Multiple States) Delaware River Basin Commission (Multiple States) Delaware River Basin Commission (Multiple States) < Back Eligibility Utility Commercial Agricultural Investor-Owned Utility State/Provincial Govt Industrial Construction Municipal/Public Utility Local Government Installer/Contractor Rural Electric Cooperative Tribal Government Systems Integrator Savings Category Water Buying & Making Electricity Home Weatherization Program Info Start Date 1961 State Delaware Program Type Environmental Regulations Siting and Permitting Provider Project Review Section The Delaware River Basin Commission (DRBC) is a federal-interstate compact government agency that was formed by concurrent legislation enacted in 1961 by the United States and the four basin states (Pennsylvania, New York, New

77

Alternative Fuels Data Center: Delaware Laws and Incentives for Idle  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Idle Reduction to someone by E-mail Idle Reduction to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Idle Reduction on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Idle Reduction on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Idle Reduction on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Idle Reduction on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Idle Reduction on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Idle Reduction on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Idle Reduction

78

Alternative Fuels Data Center: Delaware Laws and Incentives for Driving /  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Driving / Idling to someone by E-mail Driving / Idling to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Driving / Idling on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Driving / Idling on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Driving / Idling on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Driving / Idling on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Driving / Idling on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Driving / Idling on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Driving / Idling

79

Alternative Fuels Data Center: Delaware Laws and Incentives for Tax  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Tax Incentives to someone by E-mail Tax Incentives to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Tax Incentives on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Tax Incentives on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Tax Incentives on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Tax Incentives on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Tax Incentives on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Tax Incentives on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Tax Incentives

80

Chrome Deposit Corporation and the University of Delaware IAC: Another  

Broader source: Energy.gov (indexed) [DOE]

Chrome Deposit Corporation and the University of Delaware IAC: Chrome Deposit Corporation and the University of Delaware IAC: Another Energy Efficiency Success Story Chrome Deposit Corporation and the University of Delaware IAC: Another Energy Efficiency Success Story November 2, 2011 - 2:11pm Addthis Pictured left to right: University of Delaware students Joseph Camp and Nicole Suto; Keith Goossen, director of the Industrial Assessment Center; and Cesar Duarte, University of Delaware grad student. | Image courtesy of UD. Pictured left to right: University of Delaware students Joseph Camp and Nicole Suto; Keith Goossen, director of the Industrial Assessment Center; and Cesar Duarte, University of Delaware grad student. | Image courtesy of UD. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Alternative Fuels Data Center: Delaware Laws and Incentives for Propane  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Propane (LPG) to someone by E-mail Propane (LPG) to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Propane (LPG) on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Propane (LPG) on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Propane (LPG) on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Propane (LPG) on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Propane (LPG) on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Propane (LPG) on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Propane (LPG)

82

Delaware Mountain Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Delaware Mountain Wind Farm Delaware Mountain Wind Farm Jump to: navigation, search Name Delaware Mountain Wind Farm Facility Delaware Mountain Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner NextEra Energy Resources Developer American National Wind Power/Orion Energy Energy Purchaser Lower Colorado River Authority Location Culberson County TX Coordinates 31.670717°, -104.739534° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.670717,"lon":-104.739534,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

83

Delaware Identity in the Cherokee Nation  

E-Print Network [OSTI]

This article examines how the Delawares responded to the challenges that living among the Cherokees posed to their identity. It also focuses on the question of how this forced co-residence developed and what the United States role in the matter was...

Haake, Claudia

2002-03-01T23:59:59.000Z

84

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

85

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

86

DOE Solar Decathlon: The University of Delaware: Soaring to New Heights  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Innovation Technology Exploration Center that shows the solar panels on the University of Delaware house. Innovation Technology Exploration Center that shows the solar panels on the University of Delaware house. Enlarge image The University of Delaware's Solar Decathlon entry has been integrated into the Innovation Technology Exploration Center at the Delaware AeroSpace Education Foundation. (Courtesy of Lynn Bloom, Delaware AeroSpace Education Foundation) Who: University of Delaware What: Solar House Where: Delaware AeroSpace Education Foundation 585 Big Oak Road Smyrna, Delaware 19977 Map This House Public tours: Contact the Delaware AeroSpace Education Foundation at 302-659-5003 for information about visiting the Innovation Technology Exploration Center. Solar Decathlon 2002 The University of Delaware: Soaring to New Heights The University of Delaware donated its solar-powered house to the Delaware

87

Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Purchaser to someone by E-mail Purchaser to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Purchaser on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Purchaser on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Purchaser on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Purchaser on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Purchaser on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Purchaser on AddThis.com... More in this section... Federal State Advanced Search

88

Renewable Energy Facilities Revolving Loan Fund (Delaware) | Department of  

Broader source: Energy.gov (indexed) [DOE]

Facilities Revolving Loan Fund (Delaware) Facilities Revolving Loan Fund (Delaware) Renewable Energy Facilities Revolving Loan Fund (Delaware) < Back Eligibility Commercial Industrial Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Solar Wind Program Info Funding Source U.S. Department of Commerce, Delaware Strategic Fund State Delaware Program Type Loan Program Provider Delaware Economic Development Office Renewable Energy Facilities Revolving Loan Fund provides loans at market to below-market interest rates to businesses that cannot otherwise obtain capital, provided that those businesses will create or retain jobs in industries that promote energy efficiency and/or recycling. The new fund was made possible with a $500,000 grant from the U.S. Department of

89

Delaware's At-large congressional district: Energy Resources | Open Energy  

Open Energy Info (EERE)

Delaware's At-large congressional district: Energy Resources Delaware's At-large congressional district: Energy Resources Jump to: navigation, search Equivalent URI DBpedia This article is a stub. You can help OpenEI by expanding it. This page represents a congressional district in Delaware. Registered Energy Companies in Delaware's At-large congressional district AstroPower Inc Building Media, Inc. (Du Pont) (Building America Retrofit Alliance) Butamax Advanced Biofuels LLC Citizenre Group Delmarva Power Light Company Delmarva Power DuPont DuPont Biofuels Dupont Fuel Cells Galt Power Inc GlobalWatt Inc Ion Power Inc Naveen Energy Hydra Energy LLC O2Diesel Corporation formerly Dynamic Ventures RNK Capital LLC Sentry Power LLC Sentry Power Technology Textronics Inc Tristabella Consulting LLC University of Delaware Registered Financial Organizations in Delaware's At-large congressional

90

Alternative Fuels Data Center: Delaware Laws and Incentives for Vehicle  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Vehicle Owner/Driver to someone by E-mail Vehicle Owner/Driver to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Vehicle Owner/Driver on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Vehicle Owner/Driver on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Vehicle Owner/Driver on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Vehicle Owner/Driver on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Vehicle Owner/Driver on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Vehicle Owner/Driver on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

91

Alternative Fuels Data Center: Delaware Laws and Incentives for Fueling /  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Fueling / TSE Infrastructure Owner to someone by E-mail Fueling / TSE Infrastructure Owner to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Fueling / TSE Infrastructure Owner on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Fueling / TSE Infrastructure Owner on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Fueling / TSE Infrastructure Owner on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Fueling / TSE Infrastructure Owner on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Fueling / TSE Infrastructure Owner on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Fueling / TSE Infrastructure Owner on

92

Alternative Fuels Data Center: Delaware Laws and Incentives for Acquisition  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Acquisition / Fuel Use to someone by E-mail Acquisition / Fuel Use to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Acquisition / Fuel Use on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Acquisition / Fuel Use on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Acquisition / Fuel Use on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Acquisition / Fuel Use on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Acquisition / Fuel Use on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Acquisition / Fuel Use on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

93

Alternative Fuels Data Center: Delaware Laws and Incentives for Fuel  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Fuel Economy / Efficiency to someone by E-mail Fuel Economy / Efficiency to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Fuel Economy / Efficiency on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Fuel Economy / Efficiency on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Fuel Economy / Efficiency on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Fuel Economy / Efficiency on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Fuel Economy / Efficiency on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Fuel Economy / Efficiency on AddThis.com... More in this section... Federal State Advanced Search

94

Delaware Company Breathes New Life into Old Post Office Building |  

Broader source: Energy.gov (indexed) [DOE]

Delaware Company Breathes New Life into Old Post Office Building Delaware Company Breathes New Life into Old Post Office Building Delaware Company Breathes New Life into Old Post Office Building November 26, 2013 - 12:51pm Addthis Thanks to the Energy Department, Delaware-based Brandywine CAD Design was able to breathe new life into a local historic building while saving on its energy costs. | Photo courtesy of Brandywine CAD Design. Thanks to the Energy Department, Delaware-based Brandywine CAD Design was able to breathe new life into a local historic building while saving on its energy costs. | Photo courtesy of Brandywine CAD Design. Christina Stowers Communications Specialist in the Office of Weatherization and Intergovernmental Program What are the key facts? Delaware company Brandywine CAD Design, Inc., (B-CAD) purchased a

95

Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Dealer to someone by E-mail Dealer to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Dealer on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Dealer on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Dealer on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Dealer on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Dealer on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Alternative Fuel Dealer on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

96

Alternative Fuels Data Center: Delaware Laws and Incentives for Hydrogen  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Hydrogen Fuel Cells to someone by E-mail Hydrogen Fuel Cells to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Hydrogen Fuel Cells on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Hydrogen Fuel Cells on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Hydrogen Fuel Cells on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Hydrogen Fuel Cells on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Hydrogen Fuel Cells on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Hydrogen Fuel Cells on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

97

Alternative Fuels Data Center: Delaware Laws and Incentives for Fleet  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Fleet Purchaser/Manager to someone by E-mail Fleet Purchaser/Manager to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Fleet Purchaser/Manager on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Fleet Purchaser/Manager on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Fleet Purchaser/Manager on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Fleet Purchaser/Manager on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Fleet Purchaser/Manager on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Fleet Purchaser/Manager on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

98

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

99

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

100

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

102

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

103

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

104

Newport, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7137237°, -75.6093709° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7137237,"lon":-75.6093709,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

105

Bear, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bear, Delaware: Energy Resources Bear, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.6292788°, -75.6582628° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.6292788,"lon":-75.6582628,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

106

Delaware, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware, Ohio: Energy Resources Delaware, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 40.2986724°, -83.067965° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.2986724,"lon":-83.067965,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

107

Edgemoor, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Edgemoor, Delaware: Energy Resources Edgemoor, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7501139°, -75.4996414° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7501139,"lon":-75.4996414,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

108

Ardentown, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ardentown, Delaware: Energy Resources Ardentown, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.808446°, -75.4829752° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.808446,"lon":-75.4829752,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

109

Arden, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Arden, Delaware: Energy Resources Arden, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.8092794°, -75.4865866° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.8092794,"lon":-75.4865866,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

110

Delaware Electric Cooperative | Open Energy Information  

Open Energy Info (EERE)

Electric Cooperative Electric Cooperative Jump to: navigation, search Name Delaware Electric Cooperative Place Delaware Utility Id 5070 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Energy Efficiency Rider Residential General Service--Schedule GS Commercial General Service--Schedule GS-TOU Commercial Home Surge Protection Program--Schedule HSPP Residential Irrigation Service--Schedule IR Commercial Irrigation-Demand Off-Peak--Schedule IR-DOP Lighting Service--Schedule L-1 - Yard Light (100w) Halide Lighting

111

Hockessin, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hockessin, Delaware: Energy Resources Hockessin, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7876112°, -75.6966001° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7876112,"lon":-75.6966001,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

112

Odessa, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Odessa, Delaware: Energy Resources Odessa, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.457334°, -75.6613184° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.457334,"lon":-75.6613184,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

113

Brookside, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.6670561°, -75.7268779° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.6670561,"lon":-75.7268779,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

114

Claymont, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Claymont, Delaware: Energy Resources Claymont, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.8006685°, -75.4596404° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.8006685,"lon":-75.4596404,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

115

Clayton, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.2906671°, -75.6343727° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.2906671,"lon":-75.6343727,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

116

Ardencroft, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ardencroft, Delaware: Energy Resources Ardencroft, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.8051323°, -75.4861752° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.8051323,"lon":-75.4861752,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

117

Elsmere, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Elsmere, Delaware: Energy Resources Elsmere, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7392796°, -75.5979812° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7392796,"lon":-75.5979812,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

118

Think Tank: Delaware Department of Natural Resources  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Spring 2009 Number 58 Spring 2009 Number 58 UST Regulations Revision Update Jill Hall The Tank Management Branch (TMB) conducted 3 public workshops in October 2008 to roll out changes to the Delaware Regulations Governing Underground Storage Tanks (UST Regulations). The UST Regulations were completely re- vamped last year and became effective January 11, 2008. Changes were made last year for 2 reasons: (1) the UST Reg- ulations were woefully out of date with regards to technological changes, and (2) the Federal Energy Policy Act (EPACT) dictated that states make several chang- es to their UST programs. The changes required by EPACT have deadlines rang- ing from 2008 to August 2009. Delaware could not make all the required changes by January 11, 2008 because the United States Environmental Protection Agency

119

Delaware Recovery Act State Memo | Department of Energy  

Energy Savers [EERE]

in Delaware are supporting a broad range of clean energy projects, from energy efficiency and the electric grid to solar power and energy research. Through these...

120

,"Delaware Natural Gas Price Sold to Electric Power Consumers...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas Price Sold to Electric Power Consumers (Dollars per Thousand Cubic...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

EECBG Success Story: Delaware Community Saves with Solar | Department...  

Energy Savers [EERE]

from the shore, an administration building in Ocean View, Delaware, is soaking up the sun -- saving taxpayer dollars on town utility bills. Learn more. Addthis Related Articles...

122

UGI Energy Services, Inc. (Delaware) | Open Energy Information  

Open Energy Info (EERE)

References "EIA Form EIA-861 Final Data File for 2010 - File22010" Retrieved from "http:en.openei.orgwindex.php?titleUGIEnergyServices,Inc.(Delaware)&oldid788741...

123

Increasing Waterflooding Reservoirs in the Wilmington Oil Field through Improved Reservoir Characterization and Reservoir Management, Class III  

SciTech Connect (OSTI)

This project was intended to increase recoverable waterflood reserves in slope and basin reservoirs through improved reservoir characterization and reservoir management. The particular application of this project is in portions of Fault Blocks IV and V of the Wilmington Oil Field, in Long Beach, California, but the approach is widely applicable in slope and basin reservoirs, transferring technology so that it can be applied in other sections of the Wilmington field and by operators in other slope and basin reservoirs is a primary component of the project.

Koerner, Roy; Clarke, Don; Walker, Scott; Phillips, Chris; Nguyen, John; Moos, Dan; Tagbor, Kwasi

2001-08-07T23:59:59.000Z

124

Qualifying RPS State Export Markets (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware) Delaware) Qualifying RPS State Export Markets (Delaware) < Back Eligibility Developer Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Delaware Program Type Renewables Portfolio Standards and Goals This entry lists the states with Renewable Portfolio Standard (RPS) policies that accept generation located in Delaware as eligible sources towards their RPS targets or goals. For specific information with regard to eligible technologies or other restrictions which may vary by state, see the RPS policy entries for the individual states, shown below in the Authority listings. Typically energy must be delivered to an in-state utility or Load Serving Entity, and often only a portion of compliance

125

Delaware Community Saves with Solar | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware Community Saves with Solar Delaware Community Saves with Solar Delaware Community Saves with Solar November 28, 2012 - 4:41pm Addthis With a grant from the Energy Department's Energy Efficiency and Conservation Block Grant Program, the community of Ocean View, Delaware, installed a carport-mounted solar array that is saving taxpayers money on town utility bills. | Photo courtesy of the Town of Ocean View. With a grant from the Energy Department's Energy Efficiency and Conservation Block Grant Program, the community of Ocean View, Delaware, installed a carport-mounted solar array that is saving taxpayers money on town utility bills. | Photo courtesy of the Town of Ocean View. Christina Stowers Communications Specialist in the Office of Weatherization and Intergovernmental Program

126

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

127

Delaware-Val Verde gas drilling busy  

SciTech Connect (OSTI)

Deep and not so deep exploration is under way in the southeastern Delaware and northwestern Val Verde basins in West Texas. Northern Terrell County is seeing a good agenda of Permian Wolfcamp development drilling in spite of testy gas prices. This paper reports that none of the drilling appears to be targeted to Ouachita facies along the Marathon portion of the Ouachita Overthrust, although oil production from several of those fields has been respectable. And a number of exploratory tests to 20,000 ft and deeper are under way or on tap in eastern Pecos County and Terrell County.

Petzet, G.A.

1992-01-13T23:59:59.000Z

128

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

129

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

130

INCREASING WATERFLOOD RESERVES IN THE WILMINGTON OIL FIELD THROUGH IMPROVED RESERVOIR CHARACTERIZATION AND RESERVOIR MANAGEMENT  

SciTech Connect (OSTI)

This project increased recoverable waterflood reserves in slope and basin reservoirs through improved reservoir characterization and reservoir management. The particular application of this project is in portions of Fault Blocks IV and V of the Wilmington Oil Field, in Long Beach, California, but the approach is widely applicable in slope and basin reservoirs. Transferring technology so that it can be applied in other sections of the Wilmington Field and by operators in other slope and basin reservoirs is a primary component of the project. This project used advanced reservoir characterization tools, including the pulsed acoustic cased-hole logging tool, geologic three-dimensional (3-D) modeling software, and commercially available reservoir management software to identify sands with remaining high oil saturation following waterflood. Production from the identified high oil saturated sands was stimulated by recompleting existing production and injection wells in these sands using conventional means as well as a short radius redrill candidate. Although these reservoirs have been waterflooded over 40 years, researchers have found areas of remaining oil saturation. Areas such as the top sand in the Upper Terminal Zone Fault Block V, the western fault slivers of Upper Terminal Zone Fault Block V, the bottom sands of the Tar Zone Fault Block V, and the eastern edge of Fault Block IV in both the Upper Terminal and Lower Terminal Zones all show significant remaining oil saturation. Each area of interest was uncovered emphasizing a different type of reservoir characterization technique or practice. This was not the original strategy but was necessitated by the different levels of progress in each of the project activities.

Scott Walker; Chris Phillips; Roy Koerner; Don Clarke; Dan Moos; Kwasi Tagbor

2002-02-28T23:59:59.000Z

131

Town of Clayton, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Clayton, Delaware (Utility Company) Clayton, Delaware (Utility Company) Jump to: navigation, search Name Town of Clayton Place Delaware Utility Id 3732 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Demand (less than 300 KW) Commercial Commercial/ non-demand (less than 3500 kwh) Commercial Residential Rate Residential Average Rates Residential: $0.1630/kWh Commercial: $0.1590/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Town_of_Clayton,_Delaware_(Utility_Company)&oldid=411710"

132

Delaware Regions | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Delaware Regions Delaware Regions National Science Bowl® (NSB) NSB Home About High School High School Students High School Coaches High School Regionals High School Rules, Forms, and Resources Middle School Attending National Event Volunteers 2013 Competition Results News Media WDTS Home Contact Information National Science Bowl® U.S. Department of Energy SC-27/ Forrestal Building 1000 Independence Ave., SW Washington, DC 20585 P: 202-586-6702 E: National.Science.Bowl@science.doe.gov High School Regionals Delaware Regions Print Text Size: A A A RSS Feeds FeedbackShare Page Delaware Coaches can review the high school regional locations listed below. Please note: Registrations are based on the location of your school. Please be sure to select the regional that is designated for your school's state, county, city, or district.

133

University of Delaware Energy Institute Inauguration | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

University of Delaware Energy Institute Inauguration University of Delaware Energy Institute Inauguration University of Delaware Energy Institute Inauguration September 19, 2008 - 3:43pm Addthis Remarks as Prepared for Secretary Bodman Thank you very much, Dr. Harker. I applaud your contributions to the field of higher education - as well as your commitment to a more secure energy future. Throughout history, our universities have played a key role in finding solutions to our most pressing and complex challenges. The federal government - certainly the Energy Department - relies on our partners in academia, as well as in the private sector, to fulfill our critical missions. With its many contributions to the field of energy research, the University of Delaware is certainly one of our valued partners. With the launch of the Energy Institute here today, you are not only

134

Delaware Regions | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Delaware Regions Delaware Regions National Science Bowl® (NSB) NSB Home About High School Middle School Middle School Students Middle School Coaches Middle School Regionals Middle School Rules, Forms, and Resources Attending National Event Volunteers 2013 Competition Results News Media WDTS Home Contact Information National Science Bowl® U.S. Department of Energy SC-27/ Forrestal Building 1000 Independence Ave., SW Washington, DC 20585 P: 202-586-6702 E: National.Science.Bowl@science.doe.gov Middle School Regionals Delaware Regions Print Text Size: A A A RSS Feeds FeedbackShare Page Delaware Coaches can review the middle school regional locations listed below. Please note: Registrations are based on the location of your school. Please be sure to select the regional that is designated for your

135

Public Utilities Tax Rebate (Delaware) | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Utilities Tax Rebate (Delaware) Utilities Tax Rebate (Delaware) Public Utilities Tax Rebate (Delaware) < Back Eligibility Commercial Agricultural Industrial Retail Supplier Fuel Distributor Transportation Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Delaware Program Type Corporate Tax Incentive Provider Department of Finance This rebate is part of the Blue Collar Jobs Act, which establishes tax breaks for businesses that have sustainable jobs and make significant investments in the state. Firms meeting the criteria for targeted industry tax credits are eligible for a rebate of 50 percent of the public utilities tax imposed on new or increased consumption of natural gas and electricity for four years. The

136

Delaware - Seds - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

Delaware - Seds - U.S. Energy Information Administration (EIA) Delaware - Seds - U.S. Energy Information Administration (EIA) The page does not exist for . To view this page, please select a state: United States Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware District of Columbia Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming The page does not exist for . To view this page, please select a state: Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware District of Columbia Florida

137

Washington Gas Energy Services (Delaware) | Open Energy Information  

Open Energy Info (EERE)

Services (Delaware) Services (Delaware) Jump to: navigation, search Name Washington Gas Energy Services Place Delaware Utility Id 20659 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1080/kWh Commercial: $0.0893/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File2_2010" Retrieved from "http://en.openei.org/w/index.php?title=Washington_Gas_Energy_Services_(Delaware)&oldid=412876" Categories: EIA Utility Companies and Aliases Utility Companies Organizations Stubs What links here Related changes

138

Delaware Natural Gas LNG Storage Additions (Million Cubic Feet...  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Additions (Million Cubic Feet) Delaware Natural Gas LNG Storage Additions (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1980's...

139

Delaware Natural Gas LNG Storage Withdrawals (Million Cubic Feet...  

Gasoline and Diesel Fuel Update (EIA)

Withdrawals (Million Cubic Feet) Delaware Natural Gas LNG Storage Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9...

140

Delaware Natural Gas LNG Storage Net Withdrawals (Million Cubic...  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Net Withdrawals (Million Cubic Feet) Delaware Natural Gas LNG Storage Net Withdrawals (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Constellation NewEnergy, Inc (Delaware) | Open Energy Information  

Open Energy Info (EERE)

Constellation NewEnergy, Inc Place: Delaware References: EIA Form EIA-861 Final Data File for 2010 - File220101 EIA Form 861 Data Utility Id 13374 This article is a stub. You...

142

Hess Retail Natural Gas and Elec. Acctg. (Delaware) | Open Energy...  

Open Energy Info (EERE)

"EIA Form EIA-861 Final Data File for 2010 - File22010" Retrieved from "http:en.openei.orgwindex.php?titleHessRetailNaturalGasandElec.Acctg.(Delaware)&oldid786279...

143

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

University of Delaware Department of Electrical and Computer Engineering Computer Architecture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 6 Curve fit to calculate Var[ffi] in plot ffi 2 vs Norm . . . . . . . . . . . . . . 9 7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 8 Error Curve analysis: tan (`) vs P i . . . . . . . . . . . . . . . . . . . . . 11 9 Dupont

Gao, Guang R.

144

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

University of Delaware Department of Electrical and Computer Engineering Computer Architecture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 6 Curve t to calculate Var ] in plot 2 vs Norm . . . . . . . . . . . . . . 9 7 Distribution Error Curve analysis: tan ( ) vs Pi . . . . . . . . . . . . . . . . . . . . . 11 9 Dupont's Data: Square

Gao, Guang R.

145

Delaware Natural Gas Pipeline and Distribution Use (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

(Million Cubic Feet) Delaware Natural Gas Pipeline and Distribution Use (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 13...

146

Delaware Natural Gas Pipeline and Distribution Use Price (Dollars...  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Price (Dollars per Thousand Cubic Feet) Delaware Natural Gas Pipeline and Distribution Use Price (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...

147

Delaware Natural Gas Vehicle Fuel Price (Dollars per Thousand...  

Gasoline and Diesel Fuel Update (EIA)

Vehicle Fuel Price (Dollars per Thousand Cubic Feet) Delaware Natural Gas Vehicle Fuel Price (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...

148

University of Delaware Energy Institute Inauguration | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Delaware Energy Institute Inauguration Delaware Energy Institute Inauguration University of Delaware Energy Institute Inauguration September 19, 2008 - 3:43pm Addthis Remarks as Prepared for Secretary Bodman Thank you very much, Dr. Harker. I applaud your contributions to the field of higher education - as well as your commitment to a more secure energy future. Throughout history, our universities have played a key role in finding solutions to our most pressing and complex challenges. The federal government - certainly the Energy Department - relies on our partners in academia, as well as in the private sector, to fulfill our critical missions. With its many contributions to the field of energy research, the University of Delaware is certainly one of our valued partners. With the launch of the Energy Institute here today, you are not only

149

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

150

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

151

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

152

Impacts of the 2009 IECC for Residential Buildings at State Level - Delaware  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Delaware Delaware September 2009 Prepared by Pacific Northwest National Laboratory for the U.S. Department of Energy Building Energy Codes Program BUILDING ENERGY CODES PROGRAM IMPACTS OF THE 2009 IECC FOR RESIDENTIAL BUILDINGS IN DELAWARE BUILDING ENERGY CODES PROGRAM IMPACTS OF THE 2009 IECC FOR RESIDENTIAL BUILDINGS IN DELAWARE Analysis of 2009 International Energy Conservation Code Requirements for Residential Buildings in Delaware Summary Delaware recently adopted the 2009 International Energy Conservation Code (IECC). The code becomes effective July 1, 2010. Overview of the 2009 IECC The IECC scope includes residential single-family housing and multifamily housing three stories or less above-

153

Alternative Fuels Data Center: Delaware Laws and Incentives for Natural Gas  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Natural Gas to someone by E-mail Natural Gas to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Natural Gas on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Natural Gas on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Natural Gas on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Natural Gas on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Natural Gas on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Natural Gas on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Delaware Laws and Incentives for Natural Gas The list below contains summaries of all Delaware laws and incentives

154

City of Lewes, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Lewes, Delaware (Utility Company) Lewes, Delaware (Utility Company) Jump to: navigation, search Name City of Lewes Place Delaware Utility Id 10935 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Single Phase Commercial Commercial, Three Phase Commercial Industrial Single Phase Industrial Industrial, Three Phase Industrial Residential Residential Average Rates Residential: $0.1880/kWh Commercial: $0.1690/kWh Industrial: $0.1300/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"

155

Department of Energy Official in Newark, Delaware, to Highlight $168  

Broader source: Energy.gov (indexed) [DOE]

Official in Newark, Delaware, to Highlight Official in Newark, Delaware, to Highlight $168 Million for Solar Energy Projects Department of Energy Official in Newark, Delaware, to Highlight $168 Million for Solar Energy Projects March 16, 2007 - 12:00pm Addthis Funding will help further President Bush's Solar America Initiative NEWARK, DE - U.S. Department of Energy (DOE) Assistant Secretary for Energy Efficiency and Renewable Energy Andy Karsner today highlighted DOE's selection of 13 industry-led solar technology development projects for negotiation of up to $168 million (FY'07-'09), subject to appropriation from Congress. These solar projects serve as the centerpiece of the President's Solar America Initiative (SAI), which aims to make solar energy cost-competitive with conventional forms of electricity by 2015 - helping

156

City of Seaford, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Seaford, Delaware (Utility Company) Seaford, Delaware (Utility Company) Jump to: navigation, search Name City of Seaford Place Delaware Utility Id 16852 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL NON-DEMAND METERING Commercial COMMERCIAL WITH DEMAND METERING Commercial LARGE GENERAL SERVICE -PRIMARY ENERGY Industrial LARGE GENERAL SERVICE ENERGY Industrial MEDIUM GENERAL SERVICE Industrial RESIDENTIAL Residential SECURITY LIGHTS Lighting STREET CHARGE Commercial Average Rates Residential: $0.1580/kWh

157

City of Dover, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Dover, Delaware (Utility Company) Dover, Delaware (Utility Company) Jump to: navigation, search Name Dover City of Place Delaware Utility Id 5335 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes RTO PJM Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Private Outdoor Lighting: Decorative Lighting, Metered, 150 watt HPS w/o ladder rest Lighting Private Outdoor Lighting: Decorative Lighting, Metered, 70 watt HPS w/o ladder rest Lighting Private Outdoor Lighting: Decorative Lighting, Unmetered, 150 watt HPS w/o

158

City of Newark, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Delaware (Utility Company) Delaware (Utility Company) Jump to: navigation, search Name Newark City of Place Delaware Utility Id 13519 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Commercial General Service Demand Industrial Large Light and Power Service(Classification UD) Industrial Large Light and Power Service(P) Industrial Large Light and Power Service(U) Industrial Residential Service Residential Average Rates Residential: $0.1550/kWh

159

Delaware/Wind Resources/Full Version | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Delaware/Wind Resources/Full Version < Delaware‎ | Wind Resources Jump to: navigation, search Print PDF Delaware Wind Resources DelawareMap.jpg More information about these 30-m height wind resource maps is available on the Wind Powering America website. Introduction Can I use wind energy to power my home? This question is being asked across the country as more people look for a hedge against increasing electricity rates and a way to harvest their local wind resources. Small wind electric systems can make a significant contribution to our nation's energy needs. Although wind turbines large enough to provide a significant portion of the

160

Residual oil saturation determination. Wilmington micellar-polymer project. Final report  

SciTech Connect (OSTI)

The City of Long Beach, California conducted a program to obtain residual oil saturation (ROS) data in the HX/sub a/ Sand, Fault Block VB, Wilmington Field. This program utilized many complementary techniques for determining the ROS in a watered-out unconsolidated sand, typical of many reservoirs in the California Coastal Province. This program was to be performed in two stages. The first, Phase 1, was intended to determine the ROS in an area which had been flooded out during the course of a peripheral waterflood and to make a comparative analysis of current methods for determination of in-situ oil in place. The second stage, Phase 2 of the ROS program, was intended to measure the ROS after tertiary recovery by a micellar-polymer flood; however, the second phase was not carried out for lack of funds. This report describes the diagnostic tools and techniques which have been used to establish ROS. It then presents a comparative analysis of the results obtained using the different techniques. Inasmuch as the determination of in-situ oil saturation is directly dependent upon the in-situ value for porosity, it is required that the pore volume as a fraction of the reservoir rock be determined before the residual oil equation can be solved. Because of this, much of the study necessarily was concerned with measurement of porosity of the unconsolidated sand. The method finally used to obtain a very good core recovery in this highly unconsolidated sand is described. Present oil saturation and oil content of the HX/sub a/ sand in the Pilot is now believed to be better defined. This conclusion is supported by results obtained for electrical log analysis, analysis of full sized native state cores run under stress conditions, plug core analysis under stressed conditions and a Single-Well Tracer Survey. 15 references, 18 figures, 16 tables.

Staub, H.L.

1983-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

162

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The objective of this project is to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California through the testing and application of advanced reservoir characterization and thermal production technologies. The successful application of these technologies will result in expanding their implementation throughout the Wilmington Field and, through technology transfer, to other slope and basin clastic (SBC) reservoirs. The existing steamflood in the Tar zone of Fault Block II-A (Tar II-A) has been relatively inefficient because of several producibility problems which are common in SBC reservoirs: inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil and non-uniform distribution of the remaining oil. This has resulted in poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. A suite of advanced reservoir characterization and thermal production technologies are being applied during the project to improve oil recovery and reduce operating costs.

Scott Hara

2001-06-27T23:59:59.000Z

163

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

164

Alternative Fuels Data Center: Delaware Laws and Incentives for Air Quality  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Air Quality / Emissions to someone by E-mail Air Quality / Emissions to someone by E-mail Share Alternative Fuels Data Center: Delaware Laws and Incentives for Air Quality / Emissions on Facebook Tweet about Alternative Fuels Data Center: Delaware Laws and Incentives for Air Quality / Emissions on Twitter Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Air Quality / Emissions on Google Bookmark Alternative Fuels Data Center: Delaware Laws and Incentives for Air Quality / Emissions on Delicious Rank Alternative Fuels Data Center: Delaware Laws and Incentives for Air Quality / Emissions on Digg Find More places to share Alternative Fuels Data Center: Delaware Laws and Incentives for Air Quality / Emissions on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

165

EA-1782: University of Delaware Lewes Campus Onsite Wind Energy Project |  

Broader source: Energy.gov (indexed) [DOE]

82: University of Delaware Lewes Campus Onsite Wind Energy 82: University of Delaware Lewes Campus Onsite Wind Energy Project EA-1782: University of Delaware Lewes Campus Onsite Wind Energy Project SUMMARY The University of Delaware has constructed a wind turbine adjacent to its College of Earth, Ocean, and Environment campus in Lewes, Delaware. DOE proposed to provide the University a $1.43 million grant for this Wind Energy Project from funding provided in the Omnibus Appropriations Act of 2009 (Public Law 111-8) and an additional $1 million provided in the Energy and Water Development Appropriations Act of Fiscal Year 2010. This EA analyzed the potential environmental impacts of the University of Delaware's Wind Energy Project at its Lewes campus and, for purposes of comparison, an alternative that assumes the wind turbine had not been

166

Impacts of Standard 90.1-2007 for Commercial Buildings at State Level - Delaware  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Delaware Delaware September 2009 Prepared by Pacific Northwest National Laboratory for the U.S. Department of Energy Building Energy Codes Program BUILDING ENERGY CODES PROGRAM IMPACTS OF STANDARD 90.1-2007 FOR COMMERCIAL BUILDINGS IN DELAWARE BUILDING ENERGY CODES PROGRAM IMPACTS OF STANDARD 90.1-2007 FOR COMMERCIAL BUILDINGS IN DELAWARE Delaware Summary Standard 90.1-2007 contains improvements in energy efficiency over the current state code, the 2001 IECC. Standard 90.1-2007 would improve energy efficiency in commercial buildings in Delaware. The analysis of the impact of Standard 90.1-2007 resulted in energy and cost savings. Main Differences Between the Current State Code and Standard 90.1-2007

167

New Castle, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.6620572°, -75.5663132° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.6620572,"lon":-75.5663132,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

168

North Star, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7612226°, -75.7191006° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7612226,"lon":-75.7191006,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

169

New Castle County, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Castle County, Delaware: Energy Resources Castle County, Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.5392979°, -75.667356° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.5392979,"lon":-75.667356,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

170

Delaware Natural Gas Input Supplemental Fuels (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

Input Supplemental Fuels (Million Cubic Feet) Input Supplemental Fuels (Million Cubic Feet) Delaware Natural Gas Input Supplemental Fuels (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1960's 0 0 0 1970's 0 0 0 0 0 0 0 0 0 0 1980's 55 135 56 20 13 12 9 0 2 18 1990's 4,410 4,262 3,665 3,597 3,032 1 1 2 0 0 2000's 6 0 0 7 17 0 W 5 2 2 2010's 1 0 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 12/12/2013 Next Release Date: 1/7/2014 Referring Pages: Total Supplemental Supply of Natural Gas Delaware Supplemental Supplies of Natural Gas Supplies of Natural Gas Supplemental Fuels (Annual Supply & Disposition

171

Pike Creek, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.7309451°, -75.704099° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7309451,"lon":-75.704099,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

172

Kent County, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Delaware: Energy Resources Delaware: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.2713804°, -76.1319953° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.2713804,"lon":-76.1319953,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

173

City of Milford, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Milford Milford Place Delaware Utility Id 12540 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Contract Service-Primary Voltage Industrial General Service- Primary Voltage Industrial Large General Industrial Medium General Industrial Residential Residential Small General Commercial Average Rates Residential: $0.1470/kWh Commercial: $0.1450/kWh Industrial: $0.1200/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Milford,_Delaware_(Utility_Company)&oldid=409946

174

Town of Smyrna, Delaware (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Town of Smyrna Town of Smyrna Place Delaware Utility Id 17457 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Commercial Electric Hot Water/Heat Commercial Industrial Industrial Residential Residential Residential Electric Heat Only Residential Average Rates Residential: $0.1570/kWh Commercial: $0.1580/kWh Industrial: $0.1190/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Town_of_Smyrna,_Delaware_(Utility_Company)&oldid=411816

175

Derivation of Delaware Bay tidal parameters from space shuttle photography  

SciTech Connect (OSTI)

The tide-related parameters of the Delaware Bay are derived from space shuttle time-series photographs. The water areas in the bay are measured from interpretation maps of the photographs with a CALCOMP 9100 digitizer and ERDAS Image Processing System. The corresponding tidal levels are calculated using the exposure time annotated on the photographs. From these data, an approximate function relating the water area to the tidal level at a reference point is determined. Based on the function, the water areas of the Delaware Bay at mean high water (MHW) and mean low water (MLW), below 0 m, and for the tidal zone are inferred. With MHW and MLW areas and the mean tidal range, the authors calculate the tidal influx of the Delaware Bay, which is 2.76 x 1O[sup 9] m[sup 3]. Furthermore, the velocity of flood tide at the bay mouth is determined using the tidal flux and an integral of the velocity distribution function at the cross section between Cape Henlopen and Cape May. The result is 132 cm/s, which compares well with the data on tidal current charts.

Zheng, Quanan; Yan, Xiaohai; Klemas, V. (Univ. of Delaware, Newark (United States))

1993-06-01T23:59:59.000Z

176

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., CA. Through September 2000, project work has been completed on the following activities: data preparation; basic reservoir engineering; developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model and a rock-log model; well drilling and completions; and surface facilities on the Fault Block II-A Tar Zone (Tar II-A). Work is continuing on improving core analysis techniques, final reservoir tracer work, operational work and research studies to prevent thermal-related formation compaction in the Tar II-A steamflood area, and operational work on the Tar V steamflood pilot and Tar II-A post steamflood projects. Work was discontinued on the stochastic geologic model and developing a 3-D stochastic thermal reservoir simulation model of the Tar II-A Zone so the project team could use the 3-D deterministic reservoir simulation model to provide alternatives for the Tar II-A post steamflood operations and shale compaction studies. The project team spent the fourth quarter 2000 performing well work and reservoir surveillance on the Tar II-A post-steamflood project and the Tar V horizontal well steamflood pilot. Expanding thermal recovery operations to other sections of the Wilmington Oil Field, including the Tar V horizontal well pilot steamflood project, is a critical part of the City of Long Beach and Tidelands Oil Production Company's development strategy for the field. The current steamflood operations in the Tar V pilot are economical, but recent performance is below projections because of wellbore mechanical limitations that are being evaluated.

Scott Hara

2001-05-07T23:59:59.000Z

177

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

178

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

179

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

180

Valuing Public Preferences for Offshore Wind Power Andrew D. Krueger, University of Delaware, College of Marine and Earth Studies  

E-Print Network [OSTI]

Valuing Public Preferences for Offshore Wind Power Andrew D. Krueger, University of Delaware there are no offshore projects operating in the U.S. to date, proposals for such developments are pending in Massachusetts, New York, Delaware, and Texas. For Delaware, offshore wind power is currently the only cost

Firestone, Jeremy

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

182

Delaware Energy and Cost Savings for New Single- and Multifamily Homes  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Delaware Delaware Energy and Cost Savings for New Single- and Multifamily Homes: 2012 IECC as Compared to the 2009 IECC BUILDING TECHNOLOGIES PROGRAM 2 2012 IECC AS COMPARED TO THE 2009 IECC Delaware Energy and Cost Savings for New Single- and Multifamily Homes: 2012 IECC as Compared to the 2009 IECC The 2012 International Energy Conservation Code (IECC) yields positive benefits for Delaware homeowners. Moving to the 2012 IECC from the 2009 IECC is cost-effective over a 30-year life cycle. On average, Delaware homeowners will save $10,409 with the 2012 IECC. Each year, the reduction to energy bills will significantly exceed increased mortgage costs. After accounting for up-front costs and additional costs financed in the mortgage, homeowners should see net positive cash flows

183

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The objective of this project is to increase the recoverable heavy oil reserves within sections of the Wilmington Oil Field, near Long Beach, California, through the testing and application of advanced reservoir characterization and thermal production technologies. The hope is that successful application of these technologies will result in their implementation throughout the Wilmington Field and, through technology transfer, will be extended to increase the recoverable oil reserves in other slope and basin clastic (SBC) reservoirs. The existing steamflood in the Tar zone of Fault Block II-A (Tar II-A) has been relatively inefficient because of several producibility problems which are common in SBC reservoirs: inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil and non-uniform distribution of the remaining oil. This has resulted in poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. A suite of advanced reservoir characterization and thermal production technologies are being applied during the project to improve oil recovery and reduce operating costs, including: (1) Development of three-dimensional (3-D) deterministic and stochastic reservoir simulation models--thermal or otherwise--to aid in reservoir management of the steamflood and post-steamflood phases and subsequent development work. (2) Development of computerized 3-D visualizations of the geologic and reservoir simulation models to aid reservoir surveillance and operations. (3) Perform detailed studies of the geochemical interactions between the steam and the formation rock and fluids. (4) Testing and proposed application of a novel alkaline-steam well completion technique for the containment of the unconsolidated formation sands and control of fluid entry and injection profiles. (5) Installation of a 2100 ft, 14 inch insulated, steam line beneath a harbor channel to supply steam to an island location. (6) Testing and proposed application of thermal recovery technologies to increase oil production and reserves: (a) Performing pilot tests of cyclic steam injection and production on new horizontal wells. (b) Performing pilot tests of hot water-alternating-steam (WAS) drive in the existing steam drive area to improve thermal efficiency. (7) Perform a pilot steamflood with the four horizontal injectors and producers using a pseudo steam-assisted gravity-drainage (SAGD) process. (8) Advanced reservoir management, through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring and evaluation.

Unknown

2001-08-08T23:59:59.000Z

184

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The overall objective of this project is to increase heavy oil reserves in slope and basin clastic (SBC) reservoirs through the application of advanced reservoir characterization and thermal production technologies. The project involves improving thermal recovery techniques in the Tar Zone of Fault Blocks II-A and V (Tar II-A and Tar V) of the Wilmington Field in Los Angeles County, near Long Beach, California. A primary objective is to transfer technology which can be applied in other heavy oil formations of the Wilmington Field and other SBC reservoirs, including those under waterflood. The thermal recovery operations in the Tar II-A and Tar V have been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing an 2400 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Scott Hara

2004-03-05T23:59:59.000Z

185

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. Through September 2001, project work has been completed on the following activities: data preparation; basic reservoir engineering; developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model and a rock-log model; well drilling and completions; and surface facilities on the Fault Block II-A Tar Zone (Tar II-A). Work is continuing on research to understand the geochemistry and process regarding the sand consolidation well completion technique, final reservoir tracer work, operational work and research studies to prevent thermal-related formation compaction in the Tar II-A steamflood area, and operational work on the Tar V steamflood pilot and Tar II-A post-steamflood projects. The project team spent the Fourth Quarter 2001 performing routine well work and reservoir surveillance on the Tar II-A post-steamflood and Tar V pilot steamflood projects. The Tar II-A post-steamflood operation started in February 1999 and steam chest fillup occurred in September-October 1999. The targeted reservoir pressures in the ''T'' and ''D'' sands are maintained at 90 {+-} 5% hydrostatic levels by controlling water injection and gross fluid production and through the bimonthly pressure monitoring program enacted at the start of the post-steamflood phase. The project team ramped up well work activity from October 2000 through November 2001 to increase production and injection. In December, water injection well FW-88 was plug and abandoned and replaced by new well FW-295 into the ''D'' sands to accommodate the Port of Long Beach at their expense. Well workovers are planned for 2002 as described in the Operational Management section. Expanding thermal recovery operations to other sections of the Wilmington Oil Field, including the Tar V horizontal well pilot steamflood project, is a critical part of the City of Long Beach and Tidelands Oil Production Company's development strategy for the field. The steamflood operation in the Tar V pilot project is mature and profitable. Recent production performance is below projections because of wellbore mechanical limitations that were being addressed in 2001. As the fluid production is hot, the pilot steamflood was converted to a hot waterflood project in June 2001.

Scott Hara

2002-01-31T23:59:59.000Z

186

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. Through June 2001, project work has been completed on the following activities: data preparation; basic reservoir engineering; developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model and a rock-log model; well drilling and completions; and surface facilities on the Fault Block II-A Tar Zone (Tar II-A). Work is continuing on research to understand the geochemistry and process regarding the sand consolidation well completion technique, final reservoir tracer work, operational work and research studies to prevent thermal-related formation compaction in the Tar II-A steamflood area, and operational work on the Tar V steamflood pilot and Tar II-A post-steamflood projects. The project team spent the Third Quarter 2001 performing well work and reservoir surveillance on the Tar II-A post-steamflood project. The Tar II-A post-steamflood operation started in February 1999 and steam chest fillup occurred in September-October 1999. The targeted reservoir pressures in the ''T'' and ''D'' sands are maintained at 90 {+-} 5% hydrostatic levels by controlling water injection and gross fluid production and through the bimonthly pressure monitoring program enacted at the start of the post-steamflood phase. The project team ramped up well work activity from October 2000 to September 2001 to increase production and injection. This work will continue through 2001 as described in the Operational Management section. Expanding thermal recovery operations to other sections of the Wilmington Oil Field, including the Tar V horizontal well pilot steamflood project, is a critical part of the City of Long Beach and Tidelands Oil Production Company's development strategy for the field. The current steamflood operations in the Tar V pilot are economical, but recent performance is below projections because of wellbore mechanical limitations that are being addressed in 2001.

Scott Hara

2001-11-01T23:59:59.000Z

187

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The overall objective of this project is to increase heavy oil reserves in slope and basin clastic (SBC) reservoirs through the application of advanced reservoir characterization and thermal production technologies. The project involves improving thermal recovery techniques in the Tar Zone of Fault Blocks II-A and V (Tar II-A and Tar V) of the Wilmington Field in Los Angeles County, near Long Beach, California. A primary objective is to transfer technology which can be applied in other heavy oil formations of the Wilmington Field and other SBC reservoirs, including those under waterflood. The thermal recovery operations in the Tar II-A and Tar V have been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing an 2400 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Scott Hara

2003-09-04T23:59:59.000Z

188

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The overall objective of this project is to increase heavy oil reserves in slope and basin clastic (SBC) reservoirs through the application of advanced reservoir characterization and thermal production technologies. The project involves improving thermal recovery techniques in the Tar Zone of Fault Blocks II-A and V (Tar II-A and Tar V) of the Wilmington Field in Los Angeles County, near Long Beach, California. A primary objective is to transfer technology which can be applied in other heavy oil formations of the Wilmington Field and other SBC reservoirs, including those under waterflood. The thermal recovery operations in the Tar II-A and Tar V have been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing an 2400 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Scott Hara

2003-06-04T23:59:59.000Z

189

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., CA. Through March 2001, project work has been completed on the following activities: data preparation; basic reservoir engineering; developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model and a rock-log model; well drilling and completions; and surface facilities on the Fault Block II-A Tar Zone (Tar II-A). Work is continuing on research to understand the geochemistry and process regarding the sand consolidation well completion technique, final reservoir tracer work, operational work and research studies to prevent thermal-related formation compaction in the Tar II-A steamflood area, and operational work on the Tar V steamflood pilot and Tar II-A post-steamflood projects. The project team spent the Second Quarter 2001 performing well work and reservoir surveillance on the Tar II-A post-steamflood project. The Tar II-A steamflood reservoirs have been operated over fifteen months at relatively stable pressures, due in large part to the bimonthly pressure monitoring program enacted at the start of the post-steamflood phase in January 1999. Starting in the Fourth Quarter 2000, the project team has ramped up activity to increase production and injection. This work will continue through 2001 as described in the Operational Management section. Expanding thermal recovery operations to other sections of the Wilmington Oil Field, including the Tar V horizontal well pilot steamflood project, is a critical part of the City of Long Beach and Tidelands Oil Production Company's development strategy for the field. The current steamflood operations in the Tar V pilot are economical, but recent performance is below projections because of wellbore mechanical limitations that are being addressed in 2001. Much of the second quarter was spent writing DOE annual and quarterly reports to stay current with contract requirements.

Scott Hara

2001-05-08T23:59:59.000Z

190

Tertiary development of heavy oil sands through thermal stimulation in the Wilmington Oil Field, California: A geological perspective  

SciTech Connect (OSTI)

In 1995, a DOE cost share project was initiated to extend thermal recovery in the Tar Zone, Fault Block 11 of the West Wilmington Oil Field, California. The project involved the collection of old oil well data and the construction of a modern digital data base in order to develop a deterministic geological model. The plan was to rigorously define the geology such that horizontal wells could be accurately placed within the sands containing heavy oil to facilitate gravity drainage. A detailed deterministic geological model was constructed using a state of the art 3D mapping and modeling package. Beginning in July, 1995, five observation wells were drilled. Data inconsistencies were revealed when core hole OB2-003 was drilled. It was discovered that the data used to make the maps was corrupted; as a result, the predicted coring point was missed by more than 20'. Significant modifications to the data base were required due to inaccurate subsidence corrections in the original data set. Horizontal wells were then laid out based on the revised data and the geological model was completely reconstructed. Detailed cross sections extracted from the model were use for geosteering. These cross sections proved to be highly accurate and five more wells are now planned for the target sands. This detailed deterministic model will be further refined and combined with our geostatistical mode for geological control in an advanced reservoir simulator. If successful, the thermal stimulation project will be expanded to other fault blocks.

Clarke, D.D. (Department of Oil Properties, Long Beach, CA (United States)); Henry, M.J.; Strehle, R.W. (Dept. of Oil Properties, Long Beach, CA (United States))

1996-01-01T23:59:59.000Z

191

Increasing heavy oil reserves in the Wilmington oil field through advanced reservoir characterization and thermal production technologies. Technical progress report  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., California using advanced reservoir characterization and thermal production technologies. This is the third quarterly technical progress report for the project. Significant technical achievements accomplished include the drilling of four horizontal wells (two producers and two steam injectors) utilizing a new and lower cost drilling program, the drilling of five observation wells to monitor the horizontal steamflood pilot, the installation of a subsurface harbor channel crossing for delivering steam to an island location, and a geochemical study of the scale minerals being created in the wellbore. Cyclic steam injection into the two horizontal injection wells began in mid-December 1995 utilizing the new 2400 ft steam line under the Cerritos channel and the wells will be placed on production in May. Cyclic steam injection into the two horizontal producers will start in May. Work on the basic reservoir engineering is expected to be completed in March 1996. The deterministic geologic model was improved to add eight layers to the previous ten.

Hara, S.

1996-05-06T23:59:59.000Z

192

Tertiary development of heavy oil sands through thermal stimulation in the Wilmington Oil Field, California: A geological perspective  

SciTech Connect (OSTI)

In 1995, a DOE cost share project was initiated to extend thermal recovery in the Tar Zone, Fault Block 11 of the West Wilmington Oil Field, California. The project involved the collection of old oil well data and the construction of a modern digital data base in order to develop a deterministic geological model. The plan was to rigorously define the geology such that horizontal wells could be accurately placed within the sands containing heavy oil to facilitate gravity drainage. A detailed deterministic geological model was constructed using a state of the art 3D mapping and modeling package. Beginning in July, 1995, five observation wells were drilled. Data inconsistencies were revealed when core hole OB2-003 was drilled. It was discovered that the data used to make the maps was corrupted; as a result, the predicted coring point was missed by more than 20`. Significant modifications to the data base were required due to inaccurate subsidence corrections in the original data set. Horizontal wells were then laid out based on the revised data and the geological model was completely reconstructed. Detailed cross sections extracted from the model were use for geosteering. These cross sections proved to be highly accurate and five more wells are now planned for the target sands. This detailed deterministic model will be further refined and combined with our geostatistical mode for geological control in an advanced reservoir simulator. If successful, the thermal stimulation project will be expanded to other fault blocks.

Clarke, D.D. [Department of Oil Properties, Long Beach, CA (United States); Henry, M.J.; Strehle, R.W. [Dept. of Oil Properties, Long Beach, CA (United States)

1996-12-31T23:59:59.000Z

193

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

194

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

195

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

196

Surface Currents and Winds at the Delaware Bay Mouth  

SciTech Connect (OSTI)

Knowledge of the circulation of estuaries and adjacent shelf waters has relied on hydrographic measurements, moorings, and local wind observations usually removed from the region of interest. Although these observations are certainly sufficient to identify major characteristics, they lack both spatial resolution and temporal coverage. High resolution synoptic observations are required to identify important coastal processes at smaller scales. Long observation periods are needed to properly sample low-frequency processes that may also be important. The introduction of high-frequency (HF) radar measurements and regional wind models for coastal studies is changing this situation. Here we analyze synoptic, high-resolution surface winds and currents in the Delaware Bay mouth over an eight-month period (October 2007 through May 2008). The surface currents were measured by two high-frequency radars while the surface winds were extracted from a data-assimilating regional wind model. To illustrate the utility of these monitoring tools we focus on two 45-day periods which previously were shown to present contrasting pictures of the circulation. One, the low-outflow period is from 1 October through 14 November 2007; the other is the high-outflow period from 3 March through 16 April 2008. The large-scale characteristics noted by previous workers are clearly corroborated. Specifically the M2 tide dominates the surface currents, and the Delaware Bay outflow plume is clearly evident in the low frequency currents. Several new aspects of the surface circulation were also identified. These include a map of the spatial variability of the M2 tide (validating an earlier model study), persistent low-frequency cross-mouth flow, and a rapid response of the surface currents to a changing wind field. However, strong wind episodes did not persist long enough to set up a sustained Ekman response.

Muscarella, P A; Barton, N P; Lipphardt, B L; Veron, D E; Wong, K C; Kirwan, A D

2011-04-06T23:59:59.000Z

197

How One Delaware County is Saving Money and Creating Jobs | Department of  

Broader source: Energy.gov (indexed) [DOE]

One Delaware County is Saving Money and Creating Jobs One Delaware County is Saving Money and Creating Jobs How One Delaware County is Saving Money and Creating Jobs April 26, 2011 - 3:23pm Addthis Tweedie Doe Project Officer, Golden Field Office What does this project do? New Castle County will carry out 158 conservation measures, including heat pump and boiler replacements, high-efficiency motors, lighting retrofits and controls, and a white reflective roof. The project impacts over 20 facilities and 461,643 square feet of building space. Solar arrays, installed on the Government Center and Hockessin Library roofs, will provide 128 kilowatts of electricity to the two buildings. Federal, state and county officials were in New Castle County, Delaware last week to kick off the next phase of the county's Smart Energy

198

Weatherization Builds on Delaware's Innovative Past: Weatherization Assistance Close-Up Fact Sheet  

SciTech Connect (OSTI)

Delaware demonstrates its commitment to technology and efficiency through the Weatherization Program. Weatherization uses advanced technologies and techniques to reduce energy costs for low-income families by increasing the energy efficiency of their homes.

D& R International

2001-10-10T23:59:59.000Z

199

Potential Presence of Endangered Wildlife Species at the University of Delaware Wind Power Project Site  

E-Print Network [OSTI]

Potential Presence of Endangered Wildlife Species at the University of Delaware Wind Power Project wind power project site, we conducted an analysis of the suitability of habitat within the project

Firestone, Jeremy

200

UNDERLYING MOTIVATIONS FOR DELAWARE PUBLIC PARTICIPATION IN SUPPORT OF OFFSHORE WIND  

E-Print Network [OSTI]

UNDERLYING MOTIVATIONS FOR DELAWARE PUBLIC PARTICIPATION IN SUPPORT OF OFFSHORE WIND: IMPLICATIONS PARTICIPATION IN SUPPORT OF OFFSHORE WIND: IMPLICATIONS FOR STATE ENERGY POLICY by Jacqueline D Piero Approved ................................................................................................. 3 Offshore wind: a new option in the United States.............................................. 4

Firestone, Jeremy

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

An unusually large turtle barnacle (Chelonibia p. patula) on a blue crab from Delaware Bay  

Science Journals Connector (OSTI)

A turtle barnacle,Chelonibia patula patula (Ranzani) of unusually large size was found on a large female blue crab in Delaware Bay in September, 1954. This appears to be the largest known specimen ofC. p. patula....

Austin B. Williams; Hugh J. Portner

1964-01-01T23:59:59.000Z

202

Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. using advanced reservoir characterization and thermal production technologies. The existing steamflood in the Tar zone of Fault Block (FB) II-A has been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing a 2100 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation. Summary of Technical Progress

Scott Hara

1997-08-08T23:59:59.000Z

203

Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. using advanced reservoir characterization and thermal production technologies. The existing steamflood in the Tar zone of Fault Block (FB) II-A has been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing a 2100 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Scott Hara

1998-03-03T23:59:59.000Z

204

Increasing Heavy Oil Reservers in the Wilmington Oil field Through Advanced Reservoir Characterization and Thermal Production Technologies  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. using advanced reservoir characterization and thermal production technologies. The existing steamflood in the Tar zone of Fault Block (FB) 11-A has been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing a 2100 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Hara, Scott [Tidelands Oil Production Co., Long Beach, CA (United States)

1997-05-05T23:59:59.000Z

205

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

206

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

207

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. Through December 2001, project work has been completed on the following activities: data preparation; basic reservoir engineering; developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model and a rock-log model; well drilling and completions; and surface facilities on the Fault Block II-A Tar Zone (Tar II-A). Work is continuing on research to understand the geochemistry and process regarding the sand consolidation well completion technique, final reservoir tracer work, operational work and research studies to prevent thermal-related formation compaction in the Tar II-A steamflood area, and operational work on the Tar V steamflood pilot and Tar II-A post-steamflood projects. During the First Quarter 2002, the project team developed an accelerated oil recovery and reservoir cooling plan for the Tar II-A post-steamflood project and began implementing the associated well work in March. The Tar V pilot steamflood project will be converted to post-steamflood cold water injection in April 2002. The Tar II-A post-steamflood operation started in February 1999 and steam chest fillup occurred in September-October 1999. The targeted reservoir pressures in the ''T'' and ''D'' sands are maintained at 90 {+-} 5% hydrostatic levels by controlling water injection and gross fluid production and through the bimonthly pressure monitoring program enacted at the start of the post-steamflood phase. Most of the 2001 well work resulted in maintaining oil and gross fluid production and water injection rates. Reservoir pressures in the ''T'' and ''D'' sands are at 88% and 91% hydrostatic levels, respectively. Well work during the first quarter and plans for 2002 are described in the Reservoir Management section. The steamflood operation in the Tar V pilot project is mature and profitable. Recent production performance has been below projections because of wellbore mechanical limitations that have been addressed during this quarter. As the fluid production temperatures were beginning to exceed 350 F, our self-imposed temperature limit, the pilot steamflood was converted to a hot waterflood project in June 2001 and will be converted to cold water injection next quarter.

Scott Hara

2002-04-30T23:59:59.000Z

208

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., CA. Through March 1999, project work has been completed related to data preparation, basic reservoir engineering, developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model, and a rock-log model, well drilling and completions, and surface facilities. Work is continuing on the stochastic geologic model, developing a 3-D stochastic thermal reservoir simulation model of the Fault Block IIA Tar (Tar II-A) Zone, and operational work and research studies to prevent thermal-related formation compaction. Thermal-related formation compaction is a concern of the project team due to observed surface subsidence in the local area above the steamflood project. Last quarter on January 12, the steamflood project lost its inexpensive steam source from the Harbor Cogeneration Plant as a result of the recent deregulation of electrical power rates in California. An operational plan was developed and implemented to mitigate the effects of the two situations. Seven water injection wells were placed in service in November and December 1998 on the flanks of the Phase 1 steamflood area to pressure up the reservoir to fill up the existing steam chest. Intensive reservoir engineering and geomechanics studies are continuing to determine the best ways to shut down the steamflood operations in Fault Block II while minimizing any future surface subsidence. The new 3-D deterministic thermal reservoir simulator model is being used to provide sensitivity cases to optimize production, steam injection, future flank cold water injection and reservoir temperature and pressure. According to the model, reservoir fill up of the steam chest at the current injection rate of 28,000 BPD and gross and net oil production rates of 7,700 BPD and 750 BOPD (injection to production ratio of 4) will occur in October 1999. At that time, the reservoir should act more like a waterflood and production and cold water injection can be operated at lower net injection rates to be determined. Modeling runs developed this quarter found that varying individual well injection rates to meet added production and local pressure problems by sub-zone could reduce steam chest fill-up by up to one month.

Scott Hara

2000-02-18T23:59:59.000Z

209

Implementation of the El Mar (Delaware) Unit CO2 flood  

SciTech Connect (OSTI)

Union Royalty, Inc., Amoco Production Company, and Enron Liquids Pipeline Company recently announced that they have commenced operations of an innovative enhanced oil recovery project at the El Mar (Delaware) Unit in Loving County, Texas, about 100 miles west of Midland, Texas. The project will convert the unit`s existing oil recovery system from a secondary (waterflood) system to a tertiary (CO2 flood) system designed to use carbon dioxide and water to increase crude oil production from the unit. What makes this EOR project unique is the creative deal structured by the partners involved. Amoco, Union Royalty, and Enron have worked out an unprecedented arrangement whereby Amoco essentially trades CO2 for an interest in Union Royalty`s future oil production from the unit. By pioneering this innovative deal new production life has been restored to a field that otherwise might dry up. Enron is participating in the project by transporting CO2 to the unit via a 40-mile expansion of its Central Basin Pipeline system from the Dollarhide oil field in Andrews county, Texas. The project will be implemented in four phases. The first phase in operation today comprises seven CO2 injection wells which have begun to process the reservoir with CO2. Plans now call for more CO2 injectors to be installed during the next three to five years until a total of 65 CO2 injectors and an on-site CO2 compression facility serve the unit`s 70 production wells.

McKnight, T.N. Jr. [Union Royalty, Inc., Midland, TX (United States); Merchant, D.L.

1995-12-31T23:59:59.000Z

210

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

211

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

212

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

213

American Ref-Fuel of Delaware Valley Biomass Facility | Open Energy  

Open Energy Info (EERE)

Biomass Facility Biomass Facility Jump to: navigation, search Name American Ref-Fuel of Delaware Valley Biomass Facility Facility American Ref-Fuel of Delaware Valley Sector Biomass Facility Type Municipal Solid Waste Location Delaware County, Pennsylvania Coordinates 39.907793°, -75.3878525° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.907793,"lon":-75.3878525,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

214

INCREASING HEAVY OIL RESERVES IN THE WILMINGTON OIL FIELD THROUGH ADVANCED RESERVOIR CHARACTERIZATION AND THERMAL PRODUCTION TECHNOLOGIES  

SciTech Connect (OSTI)

The project involves using advanced reservoir characterization and thermal production technologies to improve thermal recovery techniques and lower operating and capital costs in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., CA. Through June 2002, project work has been completed on the following activities: data preparation; basic reservoir engineering; developing a deterministic three dimensional (3-D) geologic model, a 3-D deterministic reservoir simulation model and a rock-log model; well drilling and completions; and surface facilities on the Fault Block II-A Tar Zone (Tar II-A). Work is continuing on research to understand the geochemistry and process regarding the sand consolidation well completion technique, final reservoir tracer work, operational work and research studies to prevent thermal-related formation compaction in the Tar II-A steamflood area, and operational work on the Tar V post-steamflood pilot and Tar II-A post-steamflood projects. During the Third Quarter 2002, the project team essentially completed implementing the accelerated oil recovery and reservoir cooling plan for the Tar II-A post-steamflood project developed in March 2002 and is proceeding with additional related work. The project team has completed developing laboratory research procedures to analyze the sand consolidation well completion technique and will initiate work in the fourth quarter. The Tar V pilot steamflood project terminated hot water injection and converted to post-steamflood cold water injection on April 19, 2002. Proposals have been approved to repair two sand consolidated horizontal wells that sanded up, Tar II-A well UP-955 and Tar V well J-205, with gravel-packed inner liner jobs to be performed next quarter. Other well work to be performed next quarter is to convert well L-337 to a Tar V water injector and to recomplete vertical well A-194 as a Tar V interior steamflood pattern producer. Plans have been approved to drill and complete well A-605 in Tar V in the first quarter 2003. Plans have been approved to update the Tar II-A 3-D deterministic reservoir simulation model and run sensitivity cases to evaluate the accelerated oil recovery and reservoir cooling plan. The Tar II-A post-steamflood operation started in February 1999 and steam chest fillup occurred in September-October 1999. The targeted reservoir pressures in the ''T'' and ''D'' sands are maintained at 90 {+-} 5% hydrostatic levels by controlling water injection and gross fluid production and through the bimonthly pressure monitoring program enacted at the start of the post-steamflood phase. Well work related to the Tar II-A accelerated oil recovery and reservoir cooling plan began in March 2002 with oil production increasing from 1009 BOPD in the first quarter to 1145 BOPD in the third quarter. Reservoir pressures have been increased during the quarter from 88% to 91% hydrostatic levels in the ''T'' sands and from 91% to 94% hydrostatic levels in the ''D'' sands. Well work during the quarter is described in the Reservoir Management section. The post-steamflood production performance in the Tar V pilot project has been below projections because of wellbore mechanical limitations and the loss of a horizontal producer a second time to sand inflow that are being addressed in the fourth quarter. As the fluid production temperatures exceeded 350 F, our self-imposed temperature limit, the pilot steamflood was converted to a hot waterflood project in June 2001 and converted to cold water injection on April 19, 2002.

Scott Hara

2002-11-08T23:59:59.000Z

215

Increasing heavy oil reserves in the Wilmington oil field through advanced reservoir characterization and thermal production technologies. Quarterly report, July 1 - September 30, 1996  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. using advanced reservoir characterization and thermal production technologies. This is the sixth quarterly technical progress report for the project. Through September 1996, the project continues to make good progress but is slightly behind schedule. Estimated costs are on budget for the work performed to date. Technical achievements accomplished during the quarter include placing the first two horizontal wells on production following cyclic steam stimulation, completing several draft technical reports and preparing presentations on the deterministic geologic model, steam channel crossing and horizontal well drilling for technical transfer. Cyclic steam injection into the first two horizontal wells was completed in June 1996 and initial oil production from the project began the same month. Work has commenced on the stochastic geologic and reservoir simulation models. High temperature core work and reservoir tracer work will commence in the First Quarter 1997.

Hara, S. [Tidelands Oil Production Co., Long Beach, CA (United States)

1996-12-01T23:59:59.000Z

216

Cost Transfer Procedure The University of Delaware has a stewardship responsibility for all sponsored funds; proper  

E-Print Network [OSTI]

- 1 - Cost Transfer Procedure Summary The University of Delaware has a stewardship responsibility this obligation. The University recognizes that cost transfers are sometimes necessary to correct bookkeeping, and inadequately explained transfers, especially those involving projects with cost overruns or unexpended balances

Firestone, Jeremy

217

Regional geologic characterization of the Second Bone Spring Sandstone, Delaware basin, Lea and Eddy Counties, New Mexico  

E-Print Network [OSTI]

The Bone Spring Formation is a series of interbedded siliciclastics and carbonates that were deposited in the Delaware basin during the Leonardian (Early Permian). It consists of the First, Second and Third Carbonate and the First, Second and Third...

Downing, Amanda Beth

2012-06-07T23:59:59.000Z

218

Class III Mid-Term Project, "Increasing Heavy Oil Reserves in the Wilmington Oil Field Through Advanced Reservoir Characterization and Thermal Production Technologies"  

SciTech Connect (OSTI)

The overall objective of this project was to increase heavy oil reserves in slope and basin clastic (SBC) reservoirs through the application of advanced reservoir characterization and thermal production technologies. The project involved improving thermal recovery techniques in the Tar Zone of Fault Blocks II-A and V (Tar II-A and Tar V) of the Wilmington Field in Los Angeles County, near Long Beach, California. A primary objective has been to transfer technology that can be applied in other heavy oil formations of the Wilmington Field and other SBC reservoirs, including those under waterflood. The first budget period addressed several producibility problems in the Tar II-A and Tar V thermal recovery operations that are common in SBC reservoirs. A few of the advanced technologies developed include a three-dimensional (3-D) deterministic geologic model, a 3-D deterministic thermal reservoir simulation model to aid in reservoir management and subsequent post-steamflood development work, and a detailed study on the geochemical interactions between the steam and the formation rocks and fluids. State of the art operational work included drilling and performing a pilot steam injection and production project via four new horizontal wells (2 producers and 2 injectors), implementing a hot water alternating steam (WAS) drive pilot in the existing steamflood area to improve thermal efficiency, installing a 2400-foot insulated, subsurface harbor channel crossing to supply steam to an island location, testing a novel alkaline steam completion technique to control well sanding problems, and starting on an advanced reservoir management system through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation. The second budget period phase (BP2) continued to implement state-of-the-art operational work to optimize thermal recovery processes, improve well drilling and completion practices, and evaluate the geomechanical characteristics of the producing formations. The objectives were to further improve reservoir characterization of the heterogeneous turbidite sands, test the proficiency of the three-dimensional geologic and thermal reservoir simulation models, identify the high permeability thief zones to reduce water breakthrough and cycling, and analyze the nonuniform distribution of the remaining oil in place. This work resulted in the redevelopment of the Tar II-A and Tar V post-steamflood projects by drilling several new wells and converting idle wells to improve injection sweep efficiency and more effectively drain the remaining oil reserves. Reservoir management work included reducing water cuts, maintaining or increasing oil production, and evaluating and minimizing further thermal-related formation compaction. The BP2 project utilized all the tools and knowledge gained throughout the DOE project to maximize recovery of the oil in place.

Scott Hara

2007-03-31T23:59:59.000Z

219

Butamax Advanced Biofuels LLC | Open Energy Information  

Open Energy Info (EERE)

Butamax Advanced Biofuels LLC Butamax Advanced Biofuels LLC Jump to: navigation, search Name Butamax Advanced Biofuels LLC Place Wilmington, Delaware Zip 19880-0268 Sector Biofuels Product Delaware-based biofuels joint venture between Dupont and BP that was formed in 2009 to develop biobutanol. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

220

,"Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly","9/2013" Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n3035de3m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3035de3m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:24:04 PM" "Back to Contents","Data 1: Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)" "Sourcekey","N3035DE3" "Date","Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)" 36906,7.37 36937,4.61

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

,"Delaware Natural Gas Vehicle Fuel Consumption (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Annual",2012 Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1570_sde_2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1570_sde_2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:51:13 PM" "Back to Contents","Data 1: Delaware Natural Gas Vehicle Fuel Consumption (MMcf)" "Sourcekey","NA1570_SDE_2" "Date","Delaware Natural Gas Vehicle Fuel Consumption (MMcf)" 32324,0 32689,0 33054,0 33419,0 33785,0 34150,0 34515,1 34880,1

222

Increasing heavy oil reserves in the Wilmington oil field through advanced reservoir characterization and thermal production technologies. [Quarterly report], October 1, 1995--December 31, 1995  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., California using advanced reservoir characterization and thermal production technologies. This is the third quarterly technical progress report for the project. Through December 1995, the project is on schedule and on budget. Several significant technical achievements have already been successfully accomplished including the drilling of four horizontal wells (two producers and two steam injectors) utilizing a new and lower cost drilling program, the drilling of five observation wells to monitor the horizontal steamflood pilot, the installation of a subsurface harbor channel crossing for delivering steam to an island location, and a geochemical study of the scale minerals being created in the wellbore. Steam injection into the two horizontal injection wells began in mid-December 1995 utilizing the new 2400 ft steam line under the Cerritos Channel. Work on the basic reservoir engineering is expected to be completed in March 1996. A working deterministic geologic model was completed which allowed work to commence on the stochastic geologic and reservoir simulation models.

Hara, S. [Tidelands Oil Production Co., Long Beach, CA (United States)

1996-01-31T23:59:59.000Z

223

Health assessment for New Hanover County Burn Pit, Wilmington, New Hanover County, North Carolina, Region 4. CERCLIS No. NCD981021157. Preliminary report  

SciTech Connect (OSTI)

The New Hanover County Burn Pit, Wilmington, New Hanover County, North Carolina, has been proposed for the National Priorities List by the Environmental Protection Agency (EPA). The burn pit is part of an active airport and was used from 1968-1979 for fire-training exercises. Aviation fuel, waste oil, and petroleum tank bottoms were burned and extinguished with water, carbon dioxide, or dry chemicals. Samples from the pit and soil adjacent to the pit, where pit contents were drained, showed the presence of heavy metals, polynuclear aromatic hydrocarbons (PAHs), and volatile organic compounds (VOCs). Investigation of the site has been limited to the pit and surrounding soil. Groundwater is close to land surface in the area and may be affected. Groundwater is used for domestic purposes within a 3-mile radius of the site. Based on the available information, the site is considered to be of potential public health concern because of the risk to human health caused by the possibility of exposure to hazardous substances.

Not Available

1990-05-09T23:59:59.000Z

224

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

225

Increasing heavy oil reservers in the Wilmington oil Field through advanced reservoir characterization and thermal production technologies, technical progress report, October 1, 1996--December 31, 1996  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., Calif. using advanced reservoir characterization and thermal production technologies. The existing steamflood in the Tar zone of Fault Block (FB) 11-A has been relatively inefficient because of several producibility problems which are common in SBC reservoirs. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The advanced technologies to be applied include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing a 2100 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Hara, S. [Tidelands Oil Production Co., Long Beach, CA (United States)], Casteel, J. [USDOE Bartlesville Project Office, OK (United States)

1997-05-11T23:59:59.000Z

226

Increasing heavy oil reserves in the Wilmington Oil field through advanced reservoir characterization and thermal production technologies. Quarterly report, April 1, 1996--June 30, 1996  

SciTech Connect (OSTI)

The project involves improving thermal recovery techniques in a slope and basin clastic (SBC) reservoir in the Wilmington field, Los Angeles Co., California using advanced reservoir characterization and thermal production technologies. Inadequate characterization of the heterogeneous turbidite sands, high permeability thief zones, low gravity oil, and nonuniform distribution of remaining oil have all contributed to poor sweep efficiency, high steam-oil ratios, and early steam breakthrough. Operational problems related to steam breakthrough, high reservoir pressure, and unconsolidated formation sands have caused premature well and downhole equipment failures. In aggregate, these reservoir and operational constraints have resulted in increased operating costs and decreased recoverable reserves. The technologies include: (1) Develop three-dimensional (3-D) deterministic and stochastic geologic models. (2) Develop 3-D deterministic and stochastic thermal reservoir simulation models to aid in reservoir management and subsequent development work. (3) Develop computerized 3-D visualizations of the geologic and reservoir simulation models to aid in analysis. (4) Perform detailed study on the geochemical interactions between the steam and the formation rock and fluids. (5) Pilot steam injection and production via four new horizontal wells (2 producers and 2 injectors). (6) Hot water alternating steam (WAS) drive pilot in the existing steam drive area to improve thermal efficiency. (7) Installing an 2400 foot insulated, subsurface harbor channel crossing to supply steam to an island location. (8) Test a novel alkaline steam completion technique to control well sanding problems and fluid entry profiles. (9) Advanced reservoir management through computer-aided access to production and geologic data to integrate reservoir characterization, engineering, monitoring, and evaluation.

Hara, S.

1996-08-05T23:59:59.000Z

227

,"Delaware Natural Gas Underground Storage Injections All Operators (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Injections All Operators (MMcf)" Injections All Operators (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas Underground Storage Injections All Operators (MMcf)",1,"Annual",1975 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n5050de2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n5050de2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:28:50 PM"

228

,"Delaware Natural Gas Input Supplemental Fuels (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Input Supplemental Fuels (MMcf)" Input Supplemental Fuels (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas Input Supplemental Fuels (MMcf)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1400_sde_2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1400_sde_2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/19/2013 6:58:50 AM"

229

,"Delaware Natural Gas LNG Storage Net Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Net Withdrawals (MMcf)" Net Withdrawals (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas LNG Storage Net Withdrawals (MMcf)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1350_sde_2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1350_sde_2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:42:28 PM"

230

,"Delaware Natural Gas Underground Storage Withdrawals (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Withdrawals (MMcf)" Withdrawals (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas Underground Storage Withdrawals (MMcf)",1,"Annual",1975 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n5060de2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n5060de2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:29:19 PM"

231

Advanced reservoir characterization for improved oil recovery in a New Mexico Delaware basin project  

SciTech Connect (OSTI)

The Nash Draw Brushy Canyon Pool in Eddy County, New Mexico is a field demonstration site in the Department of Energy Class III program. The basic problem at the Nash Draw Pool is the low recovery typically observed in similar Delaware fields. By comparing a control area using standard infill drilling techniques to a pilot area developed using advanced reservoir characterization methods, the goal of the project is to demonstrate that advanced technology can significantly improve oil recovery. During the first year of the project, four new producing wells were drilled, serving as data acquisition wells. Vertical seismic profiles and a 3-D seismic survey were acquired to assist in interwell correlations and facies prediction. Limited surface access at the Nash Draw Pool, caused by proximity of underground potash mining and surface playa lakes, limits development with conventional drilling. Combinations of vertical and horizontal wells combined with selective completions are being evaluated to optimize production performance. Based on the production response of similar Delaware fields, pressure maintenance is a likely requirement at the Nash Draw Pool. A detailed reservoir model of pilot area was developed, and enhanced recovery options, including waterflooding, lean gas, and carbon dioxide injection, are being evaluated.

Martin, F.D.; Kendall, R.P.; Whitney, E.M. [Dave Martin and Associates, Inc., Socorro, NM (United States)] [and others

1997-08-01T23:59:59.000Z

232

UNIVERSITY OF DELAWARE-FACILITIES DESIGN STANDARDS Rev. 1/03 -1 -fds\\pdf\\fpc\\introduction.pdf  

E-Print Network [OSTI]

environment, these standards may be deficient in some areas. It is the responsibility of the prime consultant to architects and engineers designing facilities for the University of Delaware. These guidelines are offered requirements should not be limited to those codes. It is the consultant's responsibility to investigate

Firestone, Jeremy

233

Application of Advanced Reservoir Characterization, Simulation, and Production Optimization Strategies to Maximize Recovery in Slope and Basin Clastic Reservoirs, West Texas (Delaware Basin), Class III  

SciTech Connect (OSTI)

The objective of this Class 3 project was demonstrate that detailed reservoir characterization of slope and basin clastic reservoirs in sandstone's of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico is a cost effective way to recover oil more economically through geologically based field development. This project was focused on East Ford field, a Delaware Mountain Group field that produced from the upper Bell Canyon Formation (Ramsey sandstone). The field, discovered in 9160, is operated by Oral Petco, Inc., as the East Ford unit. A CO2 flood was being conducted in the unit, and this flood is the Phase 2 demonstration for the project.

Dutton, Shirley P.; Flanders, William A.; Mendez, Daniel L.

2001-05-08T23:59:59.000Z

234

,"Delaware Natural Gas Underground Storage Net Withdrawals All Operators (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Net Withdrawals All Operators (MMcf)" Net Withdrawals All Operators (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas Underground Storage Net Withdrawals All Operators (MMcf)",1,"Annual",1975 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n5070de2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n5070de2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:29:45 PM"

235

,"Delaware Natural Gas Vehicle Fuel Price (Dollars per Thousand Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Price (Dollars per Thousand Cubic Feet)" Price (Dollars per Thousand Cubic Feet)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas Vehicle Fuel Price (Dollars per Thousand Cubic Feet)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","na1570_sde_3a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/na1570_sde_3a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:51:13 PM"

236

District heating and cooling feasibility study for Dover, Delaware: Final report (September 2, 1986-May 31, 1988)  

SciTech Connect (OSTI)

The following is a general description of the Burns and Roe study for Dover, Delaware. The study assesses the feasibility of district heating in Dover, Delaware, and develops a conceptual district heating system. The system would use the McKee Run Station, and a new boiler plant as the heat source, and the area surrounding the plant and the legislative areas as the heat load. The study assesses the available heat load for the city, determines the available heat from the McKee Run Station, and develops a conceptual distribution network and system implementation plan. The study analyzes the environmental impacts, institutional issues, and project economics of the conceptual system. 24 figs., 26 tabs.

Not Available

1988-04-11T23:59:59.000Z

237

Depositional environment and hydrodynamic flow in Guadalupian Cherry Canyon sandstone, West Ford and West Geraldine fields, Delaware Basin, Texas  

E-Print Network [OSTI]

and entrapment of hydrocarbons. Delaware Mountain Group sediments are currently generating oil. Decementation enhances the reservoir by the formation of secondary porosity. The reservoir sandstones have an aver age porosity of 26$ and an aver age permeability... of 24 md. Oil accumulates in stratigraphic traps located along the updip meander loops of tur bidite channels. A tilted oil/water contact in West Ford and West Ger aldine fields indicates that hydrodynamic flow is pr esent. Heads calculated...

Linn, Anne Marie

2012-06-07T23:59:59.000Z

238

DuPont | Open Energy Information  

Open Energy Info (EERE)

DuPont DuPont Jump to: navigation, search Name DuPont Place Wilmington, Delaware Zip 19898 Product US holding company; manufacturer of tedlar films used as a material for TPT backsheet in PV module production. Website http://www2.dupont.com/ Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

239

Delmarva Power Light Company Delmarva Power | Open Energy Information  

Open Energy Info (EERE)

Power Light Company Delmarva Power Power Light Company Delmarva Power Jump to: navigation, search Name Delmarva Power & Light Company (Delmarva Power) Place Wilmington, Delaware Zip 19886 Product Delmarva Power, a subsidiary of Pepco Holdings, is an electricity and natural gas provider. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

240

Mid Atlantic Renewable Partners | Open Energy Information  

Open Energy Info (EERE)

Logo: Mid Atlantic Renewable Partners Name Mid Atlantic Renewable Partners Address 2036 Foulk Rd Place Wilmington, Delaware Zip 19810 Region Northeast - NY NJ CT PA Area Product Project Finance Number of employees 1-10 Year founded 2009 Website http://www.midatlanticrenewabl Coordinates 39.8153445°, -75.5087445° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.8153445,"lon":-75.5087445,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Textronics Inc | Open Energy Information  

Open Energy Info (EERE)

Textronics Inc Textronics Inc Jump to: navigation, search Name Textronics Inc Place Wilmington, Delaware Zip 19808 Product Developing textiles with built in electronics, including photovoltaic production equipment. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

242

ELSEVIER JournalofCrystalGrowth166(1996)779-785 ,........ CRYSTAL  

E-Print Network [OSTI]

treatment and solar-energy conver- sion, storage capacitors in DRAMs, insulators in MOS devices. Roshko b J.B. Rothman c G.S. Rohrer d a DuPont Company, Experimental Station, Wilmington, Delaware 19880

Rohrer, Gregory S.

243

CX-008218: Categorical Exclusion Determination  

Broader source: Energy.gov [DOE]

A System Design Study for Wilmington Canyon Offshore Wind Farm CX(s) Applied: A9 Date: 04/02/2012 Location(s): Delaware Offices(s): Golden Field Office

244

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

245

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

246

Reservoir Character of the Avalon Shale (Bone Spring Formation) of the Delaware Basin, West Texas and Southeast New Mexico: Effect of Carbonate-rich Sediment Gravity Flows  

E-Print Network [OSTI]

play is not considered to extend to the top of the first Bone Spring carbonate because hydraulic fracturing in the upper parts may penetrate overlying water-bearing units within the Delaware Mountains Group. The Avalon has been reported to range from...

Stolz, Dustin

2014-05-31T23:59:59.000Z

247

Assessment of Delaware and Groningen effects on dual-laterolog measurements with a self-adaptive hp finite-element method  

E-Print Network [OSTI]

Assessment of Delaware and Groningen effects on dual-laterolog measurements with a self-adaptive hp and Groningen effects. Both effects give rise to abnormally high readings of DLL measurements under extreme laterolog mea- surements, generating the so-called Groningen effect. INTRODUCTION The electrical resistivity

Torres-Verdín, Carlos

248

Authors' Note: Address correspondence to John Byrne, Center for Energy & Environmental Policy, University of Delaware, Newark, DE 19716-7301; e-mail: jbbyrne@udel.edu.  

E-Print Network [OSTI]

, University of Delaware, Newark, DE 19716-7301; e-mail: jbbyrne@udel.edu. In an October, 2008 New York Times81 Authors' Note: Address correspondence to John Byrne, Center for Energy & Environmental Policy article, journalist John Tierney argued that recent discus- sions about energy futures ". . . have

Delaware, University of

249

Application of Advanced Reservoir Characterization, Simulation, and Production Optimization Strategies to Maximize Recovery in Slope and Basin Clastic Reservoirs, West Texas (Delaware Basin)  

SciTech Connect (OSTI)

The objective of this Class III project is to demonstrate that detailed reservoir characterization of slope and basin clastic reservoirs in sandstones of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico is a cost-effective way to recover a higher percentage of the original oil in place through geologically based field development. This year the project focused on reservoir characterization of the East Ford unit, a representative Delaware Mountain Group field that produces from the upper Bell Canyon Formation (Ramsey Sandstone). The field, discovered in 1960, is operated by Orla Petco, Inc., as the East Ford unit; it contained an estimated 19.8 million barrels (MMbbl) of original oil in place. Petrophysical characterization of the East Ford unit was accomplished by integrating core and log data and quantifying petrophysical properties from wireline logs. Most methods of petrophysical analysis that had been developed during an earlier study of the Ford Geraldine unit were successfully transferred to the East Ford unit. The approach that was used to interpret water saturation from resistivity logs, however, had to be modified because in some East Ford wells the log-calculated water saturation was too high and inconsistent with observations made during the actual production. Log-porosity to core-porosity transforms and core-porosity to core-permeability transforms were derived from the East Ford reservoir. The petrophysical data were used to map porosity, permeability, net pay, water saturation, mobil-oil saturation, and other reservoir properties.

Dutton, S.P.; Flanders, W.A.; Guzman, J.I.; Zirczy, H.

1999-06-08T23:59:59.000Z

250

Naveen Energy Hydra Energy LLC | Open Energy Information  

Open Energy Info (EERE)

Naveen Energy Hydra Energy LLC Naveen Energy Hydra Energy LLC Jump to: navigation, search Name Naveen Energy (Hydra Energy LLC) Place Wilmington, Delaware Zip 19801 Sector Wind energy Product Naveen/Hydra is a Delaware-incorporated wind project developer that had 11 projects under development in February 2008 when it sold six early-stage projects to EDP. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

251

Ion Power Inc | Open Energy Information  

Open Energy Info (EERE)

Delaware Zip: 19720 Product: Manufacturer of membrane electrode assemblies (MEAs) for fuel cell and water electrolyser applications. References: Ion Power Inc1 This article...

252

Wilmington, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

3078093°, -88.1467243° 3078093°, -88.1467243° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.3078093,"lon":-88.1467243,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

253

Wilmington, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

8°, -71.1736669° 8°, -71.1736669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.5464828,"lon":-71.1736669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

254

Application of advanced reservoir characterization, simulation, and production optimization strategies to maximize recovery in slope and basin clastic reservoirs, West Texas (Delaware Basin). Technical progress report  

SciTech Connect (OSTI)

The objective of this project is to demonstrate that detailed reservoir characterization of slope and basin clastic reservoirs in sandstones of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico is a cost effective way to recover a higher percentage of the original oil in place through strategic placement of infill wells and geologically based field development. Project objectives are divided into two major phases. The objectives of the reservoir characterization phase of the project are to provide a detailed understanding of the architecture and heterogeneity of two fields, the Ford Geraldine unit and Ford West field, which produce from the Bell Canyon and Cherry Canyon Formations, respectively, of the Delaware Mountain Group and to compare Bell Canyon and Cherry Canyon reservoirs. Reservoir characterization will utilize 3-D seismic data, high-resolution sequence stratigraphy, subsurface field studies, outcrop characterization, and other techniques. One the reservoir-characterization study of both field is completed, a pilot area of approximately 1 mi{sup 2} in one of the fields will be chosen for reservoir simulation. The objectives of the implementation phase of the project are to: (1) apply the knowledge gained from reservoir characterization and simulation studies to increase recovery from the pilot area; (2) demonstrate that economically significant unrecovered oil remains in geologically resolvable untapped compartments; and (3) test the accuracy of reservoir characterization and flow simulation as predictive tools in resource preservation of mature fields. A geologically designed, enhanced recovery program (CO{sub 2} flood, waterflood, or polymer flood) and well-completion program will be developed, and one to three infill well will be drilled and cored. Technical progress is summarized for: geophysical characterization; reservoir characterization; outcrop characterization; and producibility problem characterization.

Dutton, S.P.

1996-04-30T23:59:59.000Z

255

PLAYER REGISTRATION City State Zip  

E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

256

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

257

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

258

Delaware Natural Gas Summary  

Gasoline and Diesel Fuel Update (EIA)

78-2005 78-2005 Citygate 7.58 8.32 6.54 5.67 9.03 7.19 1984-2012 Residential 16.21 16.07 17.79 15.12 15.38 15.24 1967-2012 Commercial 14.48 14.24 15.87 13.26 13.58 13.31 1967-2012 Industrial 8.93 12.54 13.99 10.18 11.69 11.61 1997-2012 Vehicle Fuel 21.90 26.48 14.12 24.55 28.76 30.97 1995-2012 Electric Power W W W W W -- 1997-2012 Underground Storage (Million Cubic Feet) Injections 1967-1975 Withdrawals 1967-1975 Net Withdrawals 1967-1975 Liquefied Natural Gas Storage (Million Cubic Feet) Additions 215 122 121 73 64 117 1980-2012 Withdrawals 220 104 118 76 96 66 1980-2012 Net Withdrawals -6 17 3 -2 -31 51 1980-2012 Consumption (Million Cubic Feet) Total Consumption 48,155 48,162 50,148 54,825 79,715 101,676 1997-2012 Lease and Plant Fuel

259

,"Delaware Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1967" ,"Data 2","Underground Storage",3,"Annual",1975,"6301967" ,"Data 3","Liquefied Natural Gas Storage",3,"Annual",2013,"6301980" ,"Data 4","Consumption",9,"Annual",2013,"...

260

RNK Capital LLC | Open Energy Information  

Open Energy Info (EERE)

RNK Capital LLC RNK Capital LLC Jump to: navigation, search Name RNK Capital LLC Place Wilmington, Delaware Zip 19808 Sector Renewable Energy Product RNK intends to invest money in the purchase of CERs to be delivered during the 2008-2012 commitment period under the Kyoto Protocol and the US domestic renewable energy market. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Dupont Fuel Cells | Open Energy Information  

Open Energy Info (EERE)

Dupont Fuel Cells Dupont Fuel Cells Jump to: navigation, search Name Dupont Fuel Cells Place Wilmington, Delaware Zip DE 19880-0 Product A subsidiary of Dupont which specializes in fuel cell technology. It produces DuPontâ"¢ Nafion® membranes and dispersions to multilayer membrane electrode assemblies and specialty conductive plates for fuel cells. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

262

Vice President Biden Announces Reopening of Former GM Boxwood Plant |  

Broader source: Energy.gov (indexed) [DOE]

Reopening of Former GM Boxwood Plant Reopening of Former GM Boxwood Plant Vice President Biden Announces Reopening of Former GM Boxwood Plant October 27, 2009 - 12:00am Addthis Wilmington, DE - As part of the of the Administration's commitment to jumpstarting the production of fuel efficient vehicles in America, Vice President Joe Biden today announced Fisker Automotive is re-opening a shuttered former GM factory in Wilmington, Delaware, to produce long-range, plug-in, electric hybrid vehicles. The Wilmington assembly plant was selected by Fisker Automotive for its primary global production facility based on its size, production capacity; and access to shipping ports, rail lines and skilled workforce. "While some wanted to write off America's auto industry, we said no. We knew that we needed to do something different - in Delaware and all across

263

Application of advanced reservoir characterization, simulation, and production optimization strategies to maximize recovery in slope and basin clastic reservoirs, West Texas (Delaware Basin). Quarterly report, July 1 - September 30, 1996  

SciTech Connect (OSTI)

The objective of this project is to demonstrate that detailed reservoir characterization of slope and basin clastic reservoirs in sandstones of the Delaware Mountain Group in the Delaware Basin of West Texas and New Mexico is a cost effective way to recover a higher percentage of the original oil in place through strategic placement of infill wells and geologically based field development. Project objectives are divided into two major phases. The objectives of the reservoir characterization phase of the project are to provide a detailed understanding of the architecture and heterogeneity of two fields, the Ford Geraldine unit and Ford West field, which produce from the Bell Canyon and Cherry Canyon Formations, respectively, of the Delaware Mountain Group and to compare Bell Canyon and Cherry Canyon reservoirs. Reservoir characterization will utilize 3-D seismic data, high-resolution sequence stratigraphy, subsurface field studies, outcrop characterization, and other techniques. Once the reservoir- characterization study of both fields is completed, a pilot area of approximately 1 mi{sup 2} in one of the fields will be chosen for reservoir simulation. The objectives of the implementation phase of the project are to (1) apply the knowledge gained from reservoir characterization and simulation studies to increase recovery from the pilot area, (2) demonstrate that economically significant unrecovered oil remains in geologically resolvable untapped compartments, and (3) test the accuracy of reservoir characterization and flow simulation as predictive tools in resource preservation of mature fields. A geologically designed, enhanced-recovery program (CO{sup 2} flood, waterflood, or polymer flood) and well-completion program will be developed, and one to three infill wells will be drilled and cored. Accomplishments for this past quarter are discussed.

Dutton, S.P.

1996-10-01T23:59:59.000Z

264

Delsea Energy | Open Energy Information  

Open Energy Info (EERE)

New Jersey Zip: 8753 Sector: Wind energy Product: New Jersey-based firm planning an offshore wind project in Delaware Bay, New Jersey and an onshore wind project in Pennsylvania....

265

ENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS, 2009  

E-Print Network [OSTI]

.uncw.edu/cmsr/aquaticecology/tidalcreeks February 2010 Whiskey Creek Marina UNCW class in NHC salt marsh Upper Futch Creek Upper Pages Creek Funded

Mallin, Michael

266

ENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS  

E-Print Network [OSTI]

stations. Futch Creek ­ Futch Creek is situated on the New Hanover-Pender County line and drains a 3,106 acre watershed into the ICW. Six locations were sampled by boat. Futch Creek maintained good

Mallin, Michael

267

ENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS, 2011  

E-Print Network [OSTI]

sampling in Hewletts Creek Sampling for sewage leaks entering Burnt Mill Creek Game trail upper Futch Creek

Mallin, Michael

268

ENVIRONMENTAL QUALITY OF WILMINGTON AND NEW HANOVER COUNTY WATERSHEDS, 2010  

E-Print Network [OSTI]

trail upper Futch Creek Looking for leaks along Princess Place with Beth of WDSS Funded by: The City and phosphorus. #12;3 Futch Creek ­ Futch Creek is situated on the New Hanover-Pender County line and drains a 3

Mallin, Michael

269

University of Delaware | CCEI Staff  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CCEI Staff Sheila Boulden Business Administrator Phone: (302) 831-4061 Email: Send email Location:250P ISE Lab Weihua Deng Catalyst Lab Manager and Senior Scientist Phone: (302)...

270

University of Delaware | CCEI Outreach  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

career opportunities from across the web Clean Tech Recruits Specialists in Renewable Energy Jobs Green Careers Guide Resources for finding jobs in the green industry...

271

University of Delaware | CCEI Events  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(during CCEI's Spring Symposium) Dr. Prasanna Joshi ExxonMobil Research & Engineering "Energy in the 21st Century - Outlook for Energy to 2040" 7:15 p.m. - 8:15 p.m. Embassy Suites...

272

University of Delaware | CCEI Patents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Patents and Patent Applications Production of Para-xylene by Catalytically Reacting 2,5-Dimethylfuran and Ethylene in a Solvent Dauenhauer, P. J.; Williams, C. L.; Vlachos, D. G.;...

273

University of Delaware | CCEI Equipment  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CCEI Equipment Click column headings to sort Type Equipment Details Institution Type Equipment Details Institution: Lab Lab BACK TO TOP...

274

University of Delaware | CCEI News  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with complementary research skills to collaborate on solving the world's most pressing energy challenges. (UDaily article) April 2014 Alex Mironenko Wins Best Poster Award...

275

University of Delaware | CCEI Outreach  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by CCEI engage students in learning by facilitating discussions on alternative energy and giving campers the opportunities to perform hands-on activities. In 2011, the...

276

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

277

Regenerative Boiler Feedwater Heater Economics  

E-Print Network [OSTI]

REGENERATIVE BOILER FEEDWATER HEATER ECONOMICS William L. Viar, PE waterland, Viar & Associates, Inc. Wilmington, Delaware ABSTRACT The basic Rankine Vapor Cycle has been r,~peatedly modified to improve efficiency. Always, the objective....g., first and second laws of thermodynamics) have improved and contributed to the evolution. The demands for larger systems with higher performance have been persistent. Progress i ve changes in the app1icat ion of the fundamental Rankine cycle have...

Viar, W. L.

278

Anton Betten betten@math.colostate.edu  

E-Print Network [OSTI]

, WI Winston-Salem, NWinnipeg, MB Winnipeg, MB Winchester, VA Wilmington, NC Wilmington, DE Williston

Betten, Anton

279

Delaware Natural Gas Consumption by End Use  

U.S. Energy Information Administration (EIA) Indexed Site

Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History Volumes Delivered to Consumers

280

Delaware Natural Gas Consumption by End Use  

U.S. Energy Information Administration (EIA) Indexed Site

Gulf of Mexico Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Gulf of Mexico Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History Total Consumption

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Smyrna, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

998339°, -75.6046494° 998339°, -75.6046494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.2998339,"lon":-75.6046494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

282

Bellefonte, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

663°, -75.498313° 663°, -75.498313° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7663,"lon":-75.498313,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

283

Glasgow, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

048338°, -75.7452119° 048338°, -75.7452119° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.6048338,"lon":-75.7452119,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

284

Greenville, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

790012°, -75.5982599° 790012°, -75.5982599° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7790012,"lon":-75.5982599,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

285

Delaware Natural Gas Consumption by End Use  

Gasoline and Diesel Fuel Update (EIA)

Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 View History Volumes Delivered to Consumers

286

Delaware Natural Gas Consumption by End Use  

Gasoline and Diesel Fuel Update (EIA)

Gulf of Mexico Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Gulf of Mexico Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Period: Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History Total Consumption

287

Clean Energy Technology Device Manufacturers' Credits (Delaware)  

Broader source: Energy.gov [DOE]

Qualified manufacturers can apply for a tax break equal to 75% of the corporation income tax. The incentive is an increase from the Investment and Employment Credit Against Corporation Income Tax,...

288

University of Delaware | CCEI Visiting Scholars  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Scholars Blaz Likozar- Visiting Professor National Institute of Chemistry Slovenia Advisor: Vlachos, Dion Office: 250J ISE Lab Phone: (302) 831-6384 Email: Send email Adriano...

289

Energy Incentive Programs, Delaware | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

programs are currently available to federal customers. What load managementdemand response options are available to me? The PJM Interconnection (PJM), a regional...

290

THE I TERIOR h V Delaware II  

E-Print Network [OSTI]

accommodations Propulsion system Auxiliary-po w ered equipment. Central hydraulic system (hoists and winches of fishing and research tasks. George G. Sharp, Inc. of New York City, 1 naval architects and marine

291

December 11, 2008 UNIVERSITY OF DELAWARE  

E-Print Network [OSTI]

:10 Photoelectric Catalysis for Hydrogen Generation Ismat Shah 9:10 ­ 9:30 Fuel Cells and Batteries Ajay Prasad

Firestone, Jeremy

292

Contact us at: 420 Delaware St. SE  

E-Print Network [OSTI]

and counseling patients/family during MDA clinic visits. We use a team approach in the MDA sponsored Clinic patient, situation and disease course is unique; although you can get many useful general facts from websites, patients must interpret that information based on their own situation as described by their MD

Thomas, David D.

293

Delaware Heat Content of Natural Gas Consumed  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Apr-14 May-14 Jun-14 Jul-14 Aug-14 Sep-14 View History Delivered to Consumers 1,051 1,045 1,049 1,063 1,065 1,062 2013-2014...

294

University of Delaware | CCEI Students & Postdoctoral Researchers  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Graduate Students and Postdoctoral Researchers Click column headings to sort Name Institution Title Advisor Name Institution Title Advisor BACK TO TOP...

295

UNIVERSITY OF DELAWARE DEPARTMENT OF MECHANICAL ENGINEERING  

E-Print Network [OSTI]

for delivery. A hydrogen refueling station was also established at Air Liquide for our Fuel Cell Bus Program with the fuel cell bus program, the hydrogen refueling station, and the fuel cell bus parking and maintenance and demonstration projects with the fuel cell bus program, the hydrogen refueling station, and the fuel cell bus

Gao, Guang R.

296

University of Delaware | CCEI Principal Investigators  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Principal Investigators Image Name - Affiliation Title Email Phone: Phone Research Interests: ResearchInterests Profile ResearchGroupWebsite BACK TO TOP...

297

University of Delaware | CCEI Faculty Publications  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Carlson, T.R., Cheng, Y.-T., Jae, J. and Huber, G.W., "Production of Green Aromatics and Olefins by Catalytic Fast Pyrolysis of Wood Sawdust," Energy Environ....

298

University of Delaware | CCEI Advisory Board  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Advisory Board Our advisory board is comprised of the following distinguished board members: Image Name Affiliation BACK TO TOP...

299

University of Delaware | CCEI Industrial Consortium  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

we advance the research of viable catalytic technologies for applications in renewable energy. The director and faculty work with industrial partners to define their needs and...

300

University of Delaware | CCEI Past Events  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

p.m. December 2, 2014 Guest Speaker Seminar Dr. Thomas D. Foust National Renewable Energy Laboratory Abstract Title: to be announced 11:30 a.m. - 12:30 p.m. November 6, 2014...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

University of Delaware | CCEI Research Highlights  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Research Highlights Discovering New Catalytic Technologies Click on the links below to learn about our exciting new discoveries impacting the scientific community. (beginning with...

302

Delaware Heat Content of Natural Gas Consumed  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

2008 2009 2010 2011 2012 2013 View History Delivered to Consumers 1,033 1,030 1,023 1,025 1,027 1,049 2007-2013...

303

Newark, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

9.6837226°, -75.7496572° 9.6837226°, -75.7496572° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.6837226,"lon":-75.7496572,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

304

Townsend, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

3951115°, -75.6915973° 3951115°, -75.6915973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.3951115,"lon":-75.6915973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

305

Middletown, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

449556°, -75.7163207° 449556°, -75.7163207° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.449556,"lon":-75.7163207,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

306

Extremely Hazardous Substances Risk Management Act (Delaware)  

Broader source: Energy.gov [DOE]

This act lays out provisions for local governments to implement regulations and standards for the management of extremely hazardous substances, which are defined and categorized as follows:

307

Categorical Exclusion Determinations: National Energy Technology Laboratory  

Broader source: Energy.gov (indexed) [DOE]

1, 2010 1, 2010 CX-001158: Categorical Exclusion Determination An Evaluation of the Carbon Sequestration Potential of the Cambro-Ordovician Strata of the Illinois and Michigan Basins CX(s) Applied: A9 Date: 03/11/2010 Location(s): Bloomington, Indiana Office(s): Fossil Energy, National Energy Technology Laboratory March 11, 2010 CX-001153: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Wilmington) Date: 03/11/2010 Location(s): Wilmington, Delaware Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory March 11, 2010 CX-001152: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Niskayuna) CX(s) Applied: B3.6

308

Categorical Exclusion (CX) Determinations By Date | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

1, 2010 1, 2010 CX-001158: Categorical Exclusion Determination An Evaluation of the Carbon Sequestration Potential of the Cambro-Ordovician Strata of the Illinois and Michigan Basins CX(s) Applied: A9 Date: 03/11/2010 Location(s): Bloomington, Indiana Office(s): Fossil Energy, National Energy Technology Laboratory March 11, 2010 CX-001153: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Wilmington) Date: 03/11/2010 Location(s): Wilmington, Delaware Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory March 11, 2010 CX-001152: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Niskayuna) CX(s) Applied: B3.6

309

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

61 - 6270 of 29,416 results. 61 - 6270 of 29,416 results. Download CX-001153: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Wilmington) Date: 03/11/2010 Location(s): Wilmington, Delaware Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-001153-categorical-exclusion-determination Download CX-001158: Categorical Exclusion Determination An Evaluation of the Carbon Sequestration Potential of the Cambro-Ordovician Strata of the Illinois and Michigan Basins CX(s) Applied: A9 Date: 03/11/2010 Location(s): Bloomington, Indiana Office(s): Fossil Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-001158-categorical-exclusion-determination

310

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

51 - 11960 of 28,560 results. 51 - 11960 of 28,560 results. Download CX-001152: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Niskayuna) CX(s) Applied: B3.6 Date: 03/11/2010 Location(s): Niskayuna, New York Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-001152-categorical-exclusion-determination Download CX-001153: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Wilmington) Date: 03/11/2010 Location(s): Wilmington, Delaware Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-001153-categorical-exclusion-determination

311

Categorical Exclusion (CX) Determinations By Date | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

1, 2010 1, 2010 CX-001153: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Wilmington) Date: 03/11/2010 Location(s): Wilmington, Delaware Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory March 11, 2010 CX-001152: Categorical Exclusion Determination Roll-to-Roll Solution-Processable Small-Molecule Organic Light-Emitting Diodes (Niskayuna) CX(s) Applied: B3.6 Date: 03/11/2010 Location(s): Niskayuna, New York Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory March 11, 2010 CX-001169: Categorical Exclusion Determination Pre-Combustion Carbon Dioxide Capture by a New Dual-Phase Ceramic Carbonate Membrane Reactor CX(s) Applied: B3.6

312

Galt Power Inc | Open Energy Information  

Open Energy Info (EERE)

Galt Power Inc Galt Power Inc Jump to: navigation, search Name Galt Power Inc Place Wilmington, Delaware Product Wilmington-based energy management company focused on demand response. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

313

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

314

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

315

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

316

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

317

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

318

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

319

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

320

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

322

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

323

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

324

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

325

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

326

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

327

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

328

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

329

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

330

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

331

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

332

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

333

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

334

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

335

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

336

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

337

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

338

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

339

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

340

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

342

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

343

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

344

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

345

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

346

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

347

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

348

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

349

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

350

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

351

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

352

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

353

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

354

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

355

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

356

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

357

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

358

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

359

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

360

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

362

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

363

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

364

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

365

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

366

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

367

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

368

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

369

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

370

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

371

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

372

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

373

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

374

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

375

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

376

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

377

Public sentiment in the United States towards the tariff, 1816-1828  

E-Print Network [OSTI]

to be regained. " . ". 1bert Gallatin, Gecratary of ?28 Treasury under Jefferson and IIadison, was not willing to go as far in givir- pzotection as Briggs ~ Gallatin, letter to Thomas R. Gold, Congressman from Oneida County, New York, said: "If 1 was either a... manufacturers. Congressman Thomas R. Gold of 21 letter from a resident of Wilmington, Delaware, Kay, 1814, in ~ilis' ~R~ist r, June 3, 1815. 0neida County, Hew Tork, pointed out, that manufacturing was becoming the "people's cause, " and that its protec...

Matthews, John Francis

2012-06-07T23:59:59.000Z

378

Chemtex | Open Energy Information  

Open Energy Info (EERE)

Chemtex Chemtex Jump to: navigation, search Name Chemtex Place Wilmington, North Carolina Zip 28403 Sector Biofuels Product Wilmington-based engineering company for petrochemical, polymers, biofuels and energy projects. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

379

Delaware Natural Gas Deliveries to Electric Power Consumers (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 78 189 1,109 89 959 1,358 1,474 2,856 2,998 2,483 1,094 443 2002 797 1,123 1,226 1,067 1,018 1,357 4,884 2,210 1,932 1,248 269 329 2003 465 353 1,273 861 358 890 2,222 2,118 1,127 904 476 665 2004 968 796 838 626 1,701 1,105 1,129 1,055 1,324 504 913 2,110 2005 1,412 1,001 965 280 440 1,474 2,014 2,335 1,312 930 494 217 2006 453 387 812 234 530 1,286 2,111 1,535 718 527 313 614 2007 606 365 817 624 762 1,342 2,210 2,502 1,533 1,280 474 975 2008 452 484 446 432 259 1,922 2,307 1,643 1,423 383 696 733 2009 720 257 565 133 362 663 1,173 1,790 1,830 1,669 616 1,212 2010 921 750 874 1,133 2,114 3,163 4,614 3,574 2,762 2,324 1,448 705

380

Delaware Natural Gas Industrial Consumption (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 1,989 2,006 1,830 1,718 1,229 1,429 1,454 1,433 1,557 1,971 1,804 1,639 2002 1,550 1,301 1,328 1,111 857 804 1,053 1,166 1,778 1,965 2,120 2,600 2003 2,167 1,702 1,251 847 748 850 828 969 1,095 1,212 1,668 1,836 2004 1,938 1,515 1,466 1,176 1,290 964 1,027 911 1,043 1,164 1,571 1,960 2005 2,068 1,465 1,558 1,055 1,185 825 804 930 864 1,222 1,597 1,683 2006 1,663 1,364 1,329 1,032 1,376 1,328 1,187 1,412 1,288 1,505 1,544 1,371 2007 1,514 1,183 1,274 1,227 1,208 1,213 1,128 1,170 1,091 1,425 1,750 1,831 2008 1,548 1,592 1,583 1,726 1,718 1,225 1,259 1,411 1,084 1,796 1,708 1,565 2009 1,341 1,542 1,505 1,330 1,628 1,168 1,067 1,021 1,072 2,242 1,729 1,756

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

,"Delaware Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

7,"Annual",2012,"6/30/1967" 7,"Annual",2012,"6/30/1967" ,"Data 2","Underground Storage",3,"Annual",1975,"6/30/1967" ,"Data 3","Liquefied Natural Gas Storage",3,"Annual",2012,"6/30/1980" ,"Data 4","Consumption",9,"Annual",2012,"6/30/1967" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_sum_lsum_dcu_sde_a.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_sum_lsum_dcu_sde_a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:43:06 AM"

382

Delaware County, Indiana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

2583533°, -85.3962769° 2583533°, -85.3962769° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.2583533,"lon":-85.3962769,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

383

Delaware County, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

098°, -83.0361376° 098°, -83.0361376° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.3033098,"lon":-83.0361376,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

384

Delaware Natural Gas % of Total Residential - Sales (Percent)  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2002 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 2003 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 2004 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 2005 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 2006 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 2007 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 2008 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 2009 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0

385

Natural Gas Delivered to Consumers in Delaware (Including Vehicle Fuel)  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 5,014 4,742 5,389 3,439 2,924 3,276 3,324 4,609 4,923 5,078 3,908 3,419 2002 5,258 4,880 4,847 3,830 2,810 2,738 6,396 3,816 4,170 3,843 3,936 5,597 2003 6,397 5,499 5,102 3,399 2,081 2,433 3,570 3,550 2,728 2,949 3,547 4,833 2004 6,827 5,602 4,600 3,387 3,731 2,595 2,620 2,437 2,880 2,484 4,033 6,759 2005 6,870 5,543 5,427 2,696 2,517 2,866 3,287 3,735 2,652 2,870 3,515 4,876 2006 5,025 4,699 4,451 2,549 2,659 3,204 3,812 3,447 2,516 2,972 3,454 4,379 2007 4,855 5,154 4,783 3,486 2,804 3,196 3,833 4,160 3,127 3,346 3,838 5,551 2008 5,197 5,132 4,474 3,574 2,885 3,871 4,077 3,567 3,009 2,937 4,178 5,239

386

Delaware County Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop Inc County Elec Coop Inc Place New York Utility Id 5021 Utility Location Yes Ownership C NERC Location NPCC NERC NPCC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service-Single Phase(Residential Service Class #2) Residential General Service-Single Phase(Residential Service class #1) Residential Large CommerciaL (SC-4B-; <25 kw) Commercial Large Commercial(> 25kW) Industrial Public Building Commercial Security Lights (40W Unit LED-Unmetered) Lighting Security Lights(100 W HPS-Unmetered) Lighting Small Commercial (SC-3) Commercial

387

Delaware County, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

°, -74.8741045° °, -74.8741045° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.2452081,"lon":-74.8741045,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

388

Delaware County, Iowa: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

91.443469° 91.443469° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.4634009,"lon":-91.443469,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

389

Delaware Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 7.37 4.61 11.53 7.36 8.20 6.89 6.65 6.54 6.29 6.19 5.68 6.11 2002 6.58 6.02 6.11 6.16 5.47 7.23 6.29 6.47 6.68 6.34 5.84 5.53 2003 5.33 5.80 7.15 6.71 6.71 6.78 6.38 6.70 7.27 5.95 6.08 6.75 2004 6.39 7.89 6.75 7.26 7.28 7.46 8.39 8.59 8.40 7.30 8.83 8.47 2005 8.85 9.59 9.28 11.33 10.93 10.46 10.46 9.33 10.77 11.27 13.11 14.05 2006 13.87 13.00 13.68 14.08 10.91 14.98 11.75 11.23 11.93 10.64 8.81 9.20 2007 9.31 8.86 9.25 9.00 10.67 9.30 9.62 8.00 9.60 8.78 7.09 8.47 2008 10.72 11.37 11.84 10.72 11.06 15.31 16.21 15.57 15.11 13.79 12.46 13.44 2009 12.90 12.77 13.55 15.74 14.38 14.52 16.66 19.10 16.89 17.49 14.52 10.94

390

Delaware County, Oklahoma: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

°, -94.8105955° °, -94.8105955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.4263135,"lon":-94.8105955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

391

Delaware County, Pennsylvania: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

793°, -75.3878525° 793°, -75.3878525° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.907793,"lon":-75.3878525,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

392

University of Delaware | Catalysis Center for Energy Innovation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Fuel Cells Schematic for a large-scale DCFC system based on molten Sb anodes. CCEI's technology is based on electrolytes that are ceramic oxygen-ion conductors, such as cubic...

393

University of Delaware | Catalysis Center for Energy Innovation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sugars to Furans Converting sugars to high-value intermediates. CCEI introduced an iconic technology for the isomerization of aldoses to ketoses production via Sn-beta zeolite and...

394

University of Delaware Register Forgotten Password Athens/Institution Login  

E-Print Network [OSTI]

@geosc.psu.edu Summary Hybrid molecular orbital/density functional theory (MO/DFT) calculations on molecular clusters; revised version accepted 14 May 2007 Synergy Home | Browse | Search | My Synergy | Books Online

Sparks, Donald L.

395

Electric Cars Coming to Former Delaware GM Plant | Department...  

Office of Environmental Management (EM)

"Another reason we chose the site is because it can be very difficult and expensive to train workers to build world-class cars. The team over there had won several awards, so...

396

University of Delaware | Catalysis Center for Energy Innovation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sample. The next generation of biofuels will be produced by high-temperature (>1000 F) pyrolysis or gasification of lignocellulosic biomass. At these temperatures, large...

397

Delaware Natural Gas Deliveries to Electric Power Consumers ...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 16,092 11,135 19,879 2000's 8,371 15,129 17,460 11,712 13,067 12,875 9,522 13,493 11,181 10,990...

398

Fuel Cell Research at the University of Delaware  

SciTech Connect (OSTI)

The grant initiated nine basic and applied research projects to improve fundamental understanding and performance of the proton exchange membrane (PEM) fuel cells, to explore innovative methods for hydrogen production and storage, and to address the critical issues and barriers to commercialization. The focus was on catalysis, hydrogen production and storage, membrane durability and flow modeling and characterization of Gas Diffusion Media. Three different types of equipment were purchase with this grant to provide testing and characterization infrastructure for fuel cell research and to provide undergraduate and graduate students with the opportunity to study fuel cell membrane design and operation. They are (i) Arbin Hydrogen cell testing station, (ii) MTS Alliance?¢???¢ RT/5 material testing system with an ESPEC custom-designed environmental chamber for membrane Durability Testing and (iii) Chemisorption for surface area measurements of electrocatalysts. The research team included ten faculty members who addressed various issues that pertain to Fuel Cells, Hydrogen Production and Storage, Fuel Cell transport mechanisms. Nine research tasks were conducted to address the critical issues and various barriers to commercialization of Fuel Cells. These research tasks are subdivided in the general areas of (i) Alternative electrocatalysis (ii) Fuel Processing and Hydrogen Storage and (iii) Modeling and Characterization of Membranes as applied to Fuel Cells research.. The summary of accomplishments and approaches for each of the tasks is presented below

Chen, Jingguang G.; Advani, Suresh G.

2006-01-27T23:59:59.000Z

399

HIGHER EDUCATION OPPORTUNITY ACT REPORTING University of Delaware  

E-Print Network [OSTI]

/17/13@ 2:15pm Unattended electric fan left on upholstered chair 0 0 $400 Warner Hall Attic 4/20/13@ 4:47am 0 $400 Rodney Hall- B Room 190 8/23/13@ 6:26 pm Short-circuit in a supplemental heating unit 0 0 REPORTING B. Description of On-Campus Student Housing Fire Safety Systems: o All On-Campus Student Housing

Firestone, Jeremy

400

Program Wednesday, May 15, 2013 UNIVERSITY of DELAWARE  

E-Print Network [OSTI]

.m. Clean Energy: Hydroxide Exchange Membrane Fuel Cells and Flow Batteries Yushan Yan, Professor Chemical

Firestone, Jeremy

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Delaware State University | OSTI, US Dept of Energy, Office of...  

Office of Scientific and Technical Information (OSTI)

Angela Lundbert will help analyze Curiosity's Mars data DSU Breaks Ground for New Optics Research Building Noureddine Melikechi, D. Phil., Dean, College of Math, Natural...

402

HIGHER EDUCATION OPPORTUNITY ACT REPORTING University of Delaware  

E-Print Network [OSTI]

conducted by University Police and evaluated by the University Fire Protection Engineer each semester. #12 outages of heat). E. Use of extension cords. F. Tampering with or blocking any fire protection equipment://www.facilities.udel.edu/resfacilitiesmaintenance.aspx E. Fire safety education and training programs for students, faculty and staff: The Fire Protection

Firestone, Jeremy

403

Low E Brings High Savings in Newark, Delaware | Department of...  

Broader source: Energy.gov (indexed) [DOE]

says Carol Houck, assistant to the city manager. "But most importantly, there's less heat and cooling loss so our facility is more efficient." Buying domestically For the...

404

Introduction to the University of Delaware Energy Institute  

E-Print Network [OSTI]

! World Energy consumption is roughly 400 quadrillion BTUs per year. The US, with 5% of the world to secure our energy future. I would like to thank each of them for sharing their perspectives with us our consumption in slightly more accessible terms, EACH DAY the US uses 20 million barrels of oil PLUS

Firestone, Jeremy

405

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

energy consumption model and shows that the techniques proposed reduce the total energy consumption://ftp.capsl.udel.edu · capsladm@capsl.udel.edu #12;#12;Contents 1 Introduction 1 2 Energy Consumption Model on a Many.2 Energy Consumption model for Cyclops-64 . . . . . . . . . . . . . . . . . . . . . 4 3 Tiling Techniques

Gao, Guang R.

406

Program Wednesday, June 6, 2012 UNIVERSITY of DELAWARE  

E-Print Network [OSTI]

of Marine Science and Policy 9:20 a.m. Center for Catalytic Science and Technology Raul Lobo, Professor Kurdgelashvili 10:00 a.m. Center for Fuel Cell Research Ajay Prasad, Professor & Director Mechanical Engineering & Asia 1:50 p.m. Wind Projects Cristina Archer, Associate Professor School of Marine Science and Policy 2

Firestone, Jeremy

407

University of Delaware | Catalysis Center for Energy Innovation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biomass Upgrade Upgrade of furans via hydrodeoxygenation technology. Bio-oil and oxygenated intermediates derived from sugars are oxygen rich. In order to be transformed to fuels...

408

University of Delaware | Catalysis Center for Energy Innovation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Modeling Activity map produced from the new high-throughput computational engine. Example for ethylene glycol catalysis. Reforming, hydrodeoxygenation, dehydrogenation, and...

409

SEP Success Story: Delaware Company Breathes New Life into Old...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Design, Inc. set out to create a new workspace. The long-term goal: qualify for the U.S. Green Building Council's Leadership in Energy and Environmental Design (LEED) Platinum...

410

University of Delaware | Catalysis Center for Energy Innovation  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

as an Energy Frontier Research Center in 2009 by a grant from the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences. The center's research focus is...

411

University of Delaware | Catalysis Center for Energy Innovation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Green Aromatics Transition state for the Diels-Alder reaction of 2,5-dimethylfuran and ethylene in zeolite LiY Most polymers and plastics require six-carbon ring structures. Sugars...

412

EV Community Readiness projects: Delaware Valley Regional Planning...  

Broader source: Energy.gov (indexed) [DOE]

Kansas City; Douglas County; Unified Government of Wyandotte County * EV manufacturer: Smith Electric Vehicles * EV and EVSE dealerships LilyPad EV, Olathe Ford * Technical...

413

University of Delaware Department of Electrical and Computer Engineering  

E-Print Network [OSTI]

and Parallel Systems Laboratory Optimizing the LU Factorization for Energy Efficiency on a Many . . . . . . . . . . . . . . . . . . 7 2.2 Energy Consumption model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 2.3 LU Factorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 3 Energy Optimizations 9

Gao, Guang R.

414

Delaware Heat Content of Natural Gas Deliveries to Consumers...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2013 1,050 1,049 1,046 1,048 1,041 1,049 1,058 1,054 1,065 1,064 1,067 1,057 2014 1,052 1,048 1,048 1,051 1,045 1,049 1,063...

415

Delaware Heat Content of Natural Gas Deliveries to Consumers...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 1,037 1,033 1,030 2010's 1,023 1,025 1,027 1,049...

416

,"Delaware Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

5,"Monthly","9/2013","1/15/1989" 5,"Monthly","9/2013","1/15/1989" ,"Data 2","Consumption",6,"Monthly","9/2013","1/15/1989" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_sum_lsum_dcu_sde_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_sum_lsum_dcu_sde_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:43:07 AM" "Back to Contents","Data 1: Prices" "Sourcekey","N3050DE3","N3010DE3","N3020DE3","N3035DE3","N3045DE3"

417

Sussex County, Delaware: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

6530841°, -75.4344727° 6530841°, -75.4344727° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.6530841,"lon":-75.4344727,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

418

Tristabella Consulting LLC | Open Energy Information  

Open Energy Info (EERE)

Tristabella Consulting LLC Tristabella Consulting LLC Jump to: navigation, search Name Tristabella Consulting LLC Place Wilmington, Delaware Website http://www.tristabella.com/ Coordinates 39.7458333°, -75.5466667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.7458333,"lon":-75.5466667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

419

Energy Secretary Chu to Tour DuPont Clean Energy Innovation Facilities |  

Broader source: Energy.gov (indexed) [DOE]

DuPont Clean Energy Innovation DuPont Clean Energy Innovation Facilities Energy Secretary Chu to Tour DuPont Clean Energy Innovation Facilities May 22, 2012 - 5:13pm Addthis WASHINGTON - Tomorrow, Wednesday, May 23, 2012, U.S. Energy Secretary Steven Chu will visit DuPont in Wilmington, Delaware, where he will tour the company's clean energy research and development facilities, including innovative work on advanced biofuels. Secretary Chu will highlight how companies like DuPont are helping the United States lead the global race for clean energy technologies and reduce our dependence on foreign oil. Following the tour, Secretary Chu will participate in a media availability with DuPont's Chief Innovation Officer Tom Connelly and Chief Science & Technology Officer Doug Muzyka. WHEN:

420

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

422

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

423

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

424

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

425

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

426

Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures Ventures Jump to: navigation, search Name @Ventures Place Wilmington, Massachusetts Zip 18870 Product Massachusetts-based venture capital firm investing in early stage clean technology enterprises. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

427

@Ventures (Massachusetts) | Open Energy Information  

Open Energy Info (EERE)

Massachusetts) Massachusetts) Jump to: navigation, search Logo: @Ventures (Massachusetts) Name @Ventures (Massachusetts) Address 187 Ballardvale Street, Suite A260 Place Wilmington, Massachusetts Zip 01887 Region Greater Boston Area Product Venture capital firm investing in early stage clean technology enterprises Phone number (978) 658-8980 Website http://www.ventures.com/ Coordinates 42.581566°, -71.158217° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.581566,"lon":-71.158217,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

428

International Coastal Biofuels | Open Energy Information  

Open Energy Info (EERE)

Coastal Biofuels Coastal Biofuels Jump to: navigation, search Name International Coastal Biofuels Place Tazewell, Virginia Zip 24651 Sector Biofuels Product International Coastal Biofuels is a development stage biofuels company that has proposed a biodiesel plant for Wilmington, North Carolina and is currently in negotiations for a second site in South Carolina. Coordinates 37.116177°, -81.518678° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.116177,"lon":-81.518678,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

429

Lilliputian Systems Inc | Open Energy Information  

Open Energy Info (EERE)

Lilliputian Systems Inc Lilliputian Systems Inc Jump to: navigation, search Name Lilliputian Systems Inc Address 36 Jonspin Road Place Wilmington, Massachusetts Zip 01887 Sector Hydrogen Product Portable fuel cell generators Website http://www.lilliputiansystemsi Coordinates 42.5960633°, -71.1509692° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.5960633,"lon":-71.1509692,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

430

MKS Instruments Inc | Open Energy Information  

Open Energy Info (EERE)

MKS Instruments Inc MKS Instruments Inc Jump to: navigation, search Name MKS Instruments Inc Place Wilmington, Massachusetts Zip 1887 Product Manufactures vacuum deposition equipment, with potential applications in PV manufacture. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

431

Increasing waterflood reserves in the Wilmington Oil Field through improved reservoir characterization and reservoir management. Annual report, March 21, 1995--March 20, 1996  

SciTech Connect (OSTI)

This project uses advanced reservoir characterization tools, including the pulsed acoustic cased-hole logging tool, geologic three- dimensional (3-D) modeling software, and commercially available reservoir management software to identify sands with remaining high oil saturation following waterflood. Production from the identified high oil saturation sands will be stimulated by recompleting existing production and injection wells in these sands using conventional means as well as short radius and ultra-short radius laterals. Although these reservoirs have been waterflooded over 40 years, researchers have found areas of remaining oil saturation. Areas such as the top sand in the Upper Terminal Zone Fault Block V, the western fault slivers of Upper Terminal Zone Fault Block V, the bottom sands of the Tar Zone Fault Block V, and the eastern edge of Fault Block IV in both the Upper Terminal and Lower Terminal Zones all show significant remaining oil saturation. Each area of interest was uncovered emphasizing a different type of reservoir characterization technique or practice. This was not the original strategy but was necessitated by the different levels of progress in each of the project activities.

Sullivan, D.; Clarke, D.; Walker, S.; Phillips, C.; Nguyen, J.; Moos, D.; Tagbor, K.

1997-08-01T23:59:59.000Z

432

Superfund record of decision (EPA Region 4): New Hanover County Airport Burn Pit Site, New Hanover County, Wilmington, NC. (First remedial action), September 1992. Final report  

SciTech Connect (OSTI)

The New Hanover site was located on Gardner Road approximately 500 feet west of the New Hanover County Airport terminal, New Hanover, North Carolina. From 1968 to 1979, the site was used for fire-fighter training purposes. During training exercises, jet fuel, gasoline, petroleum storage bottoms, fuel oil, kerosene, and sorbent materials from oil spill cleanup were burned in a pit. During its active years, water from the pit was allowed to flow onto land surfaces. Inspections conducted after the pit was abandoned showed that most of the standing liquid in the pit was water. In addition to the burn pit area, fire-fighting activities resulted in contamination at several other site areas, including an auto burn area; a railroad tank burn area; an aircraft mock-up area; a fuel tank and pipelines area; and two stained soil areas north of the burn pit. The ROD addressed restoration of the aquifer to drinking water quality as a final action for the site. The primary contaminants of concern that affect the soil and ground water were VOCs, including benzene; and metals, including chromium and lead.

Not Available

1992-09-29T23:59:59.000Z

433

Cenozoic pelagic Sr//Ca records: Exploring a link to paleoproductivity College of Marine Sciences, University of Delaware, Lewes, Delaware, USA  

E-Print Network [OSTI]

Cenozoic pelagic Sr//Ca records: Exploring a link to paleoproductivity K. Billups College of Marine May 2004; accepted 24 May 2004; published 20 July 2004. [1] Recent studies have revealed that Sr/Ca ratios of coccolithophores may be affected by productivity. Here we compile published Sr/Ca data from

Schrag, Daniel

434

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

435

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

436

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

437

Percent of Commercial Natural Gas Deliveries in Delaware Represented by the  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1989 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 1990 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 1991 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 1992 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 1993 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 1994 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 1995 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 1996 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0

438

Delaware Price of Natural Gas Sold to Commercial Consumers (Dollars per  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1989 5.33 5.27 5.33 5.43 5.50 5.61 5.65 5.46 5.48 5.56 5.45 5.35 1990 4.97 5.01 5.15 5.08 5.18 5.24 5.30 5.06 5.60 5.41 5.15 5.11 1991 5.22 4.30 4.99 4.84 4.86 4.99 4.83 4.90 4.86 4.95 4.75 4.57 1992 4.72 4.99 4.57 4.89 5.01 5.14 5.16 5.14 5.16 5.07 5.07 5.18 1993 5.20 5.15 5.14 5.22 5.49 7.80 5.68 5.68 6.04 5.63 5.83 5.75 1994 6.05 6.05 6.06 6.17 6.69 6.39 6.59 6.63 6.65 6.48 6.20 5.95 1995 5.26 5.18 5.15 5.31 5.39 5.64 5.32 5.86 5.64 5.38 5.64 4.97 1996 5.33 5.34 5.64 5.52 6.06 6.82 6.93 6.88 6.45 6.39 5.96 6.19 1997 6.25 6.46 6.39 6.53 6.74 7.30 7.81 8.54 7.15 7.46 6.88 6.60 1998 6.66 6.68 6.70 6.85 7.33 7.81 8.14 8.40 8.72 8.05 6.93 6.89

439

Natural Gas Citygate Price in Delaware (Dollars per Thousand Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1989 3.95 3.17 3.14 2.38 2.90 2.14 3.53 2.66 2.29 2.09 2.98 3.29 1990 2.84 3.16 2.91 2.41 2.97 2.44 2.42 2.30 2.49 2.54 3.62 3.46 1991 3.28 2.82 2.48 2.33 2.38 2.15 2.21 2.14 2.46 2.62 3.08 2.83 1992 3.01 1.81 2.62 2.55 2.59 2.90 2.72 1.78 2.74 3.74 3.93 3.53 1993 3.13 3.03 3.22 3.33 3.52 3.52 3.15 2.98 3.56 3.19 2.94 3.45 1994 3.29 3.41 3.19 2.98 3.00 2.73 3.00 2.98 2.69 2.42 2.82 2.75 1995 2.69 2.45 2.47 3.11 3.20 3.38 1.73 2.48 2.85 2.81 2.89 3.01 1996 3.27 3.43 4.20 3.75 3.18 3.44 4.22 3.80 3.03 2.94 3.66 4.96 1997 5.66 4.48 3.69 2.88 3.17 3.42 3.35 3.17 1.44 5.23 5.78 2.43 1998 2.69 3.04 2.74 2.63 1.79 4.35 2.93 2.79 3.90 3.75 3.83 4.10

440

University of Delaware -Tribology Laboratory Atlantic Advanced O shore Wind Energy Consortium  

E-Print Network [OSTI]

for analysis by the group. Downtime hours accumulated from 2003 to 2007 for wind turbines in Germany #12) log cycles NormalForce(N) Failure Characterization Log life (failure cycles) logforce 1 3 106 C10 ex Wind Energy Consortium Assessing Tribological Aspects of Gearbox Reliability in Wind Turbines Prof

Firestone, Jeremy

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

SEP Success Story: Delaware Company Breathes New Life into Old Post Office Building  

Broader source: Energy.gov [DOE]

With the help of the Energy Departments State Energy Program, Brandywine CAD Design, Inc. set out to create a new workspace. The long-term goal: qualify for the U.S. Green Building Councils Leadership in Energy and Environmental Design (LEED) Platinum rating -- something that they hope to achieve by mid 2014. Learn more.

442

Building America Whole-House Solutions for New Homes: Insight Homes, Seaford, Delaware  

Broader source: Energy.gov [DOE]

Case study of Insight Homes, who worked with the Building America research partner IBACOS to design HERS-49 homes with high-efficiency HVAC, ducts in insulated crawl spaces, raised heel trusses, dehumidifiers, and central manifold plumbing.

443

Final Technical Report: Residential Fuel Cell Demonstration by the Delaware County Electric Cooperative, Inc.  

SciTech Connect (OSTI)

This demonstration project contributes to the knowledge base in the area of fuel cells in stationary applications, propane fuel cells, edge-of-grid applications for fuel cells, and energy storage in combination with fuel cells. The project demonstrated that it is technically feasible to meet the whole-house electrical energy needs of a typical upstate New York residence with a 5-kW fuel cell in combination with in-home energy storage without any major modifications to the residence or modifications to the consumption patterns of the residents of the home. The use of a fuel cell at constant output power through a 120-Volt inverter leads to system performance issues including: relatively poor power quality as quantified by the IEEE-defined short term flicker parameter relatively low overall system efficiency Each of these issues is discussed in detail in the text of this report. The fuel cell performed well over the 1-year demonstration period in terms of availability and efficiency of conversion from chemical energy (propane) to electrical energy at the fuel cell output terminals. Another strength of fuel cell performance in the demonstration was the low requirements for maintenance and repair on the fuel cell. The project uncovered a new and important installation consideration for propane fuel cells. Alcohol added to new propane storage tanks is preferentially absorbed on the surface of some fuel cell reformer desulfurization filters. The experience on this project indicates that special attention must be paid to the volume and composition of propane tank additives. Size, composition, and replacement schedules for the de-sulfurization filter bed should be adjusted to account for propane tank additives to avoid sulfur poisoning of fuel cell stacks. Despite good overall technical performance of the fuel cell and the whole energy system, the demonstration showed that such a system is not economically feasible as compared to other commercially available technologies such as propane reciprocating engine generators.

Mark Hilson Schneider

2007-06-06T23:59:59.000Z

444

(Delaware Study) National Study of Instructional Costs and Productivity -Fall 2011 Report of Fall 2010 Data  

E-Print Network [OSTI]

.00 1.0 0.0 0.0 0.0 1.0 1,136.5 1,231.5 81.0 2,449.0 254.8 168.0 422.8 2,871.8Total 22.0 12.5 19.2 9.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 1,871.5 0.0 0.0 0.0 Regular TTT Other Regular.52 0.00 0.0 0.0 0.0 0.0 0.0 1,521.5 213.0 137.0 1,871.5 190.0 147.0 337.0 2,208.5Total 4.0 10.5 4.1 8

Farritor, Shane

445

University of Delaware EnErgy InstItUtE syMPOsIUM  

E-Print Network [OSTI]

in Electric Vehicles Willett M. Kempton ­ Associate Professor, Marine and Earth Studies Novel Materials for High Energy and Power Density II John Q. Xiao ­ Professor, Physics and Astronomy Fuel Cells: Opportunities and Challenges Ajay K. Prasad ­ Director, Center for Fuel Cell Research Electrocatalysts for Fuel

Firestone, Jeremy

446

UNIVERSITY OF DELAWARE Information on biosafety is available on the Environmental Health & Safety web page at  

E-Print Network [OSTI]

:_____________________________________________________ 5. Please attach an abstract of the work being performed. 6. Labs to be used for work:_____________________________________________ 7. List of individuals participating in work, including job title:_________________________________________________ Is effectiveness verified? How? ________________________________________ 17. Will animals be used in work? YES

Firestone, Jeremy

447

University of Delaware Technical Analysis for On-Site Wind Generation  

E-Print Network [OSTI]

Energy Developments, Inc. Tuesday, May 19, 2009 #12;Final Report ­ Technical Analysis for On-site Wind. Gross P.E. prepared Section 4, Electrical System Impact Study and AWSTruewind, LLC provided wind.3 TERRAIN AND ROUGHNESS MAPS 12 2.4 RESOURCE GRID 13 2.5 WIND TURBINE POWER CURVE 14 2.6 SUMMMARY OF MODEL

Firestone, Jeremy

448

The dicer-like1 Homolog fuzzy tassel Is Required for the Regulation of Meristem Determinacy in the Inflorescence and Vegetative Growth in Maize  

Science Journals Connector (OSTI)

...Bioinformatics and Computational Biology, University of Delaware, Newark, Delaware 19714 c Department of Plant and Soil Sciences, University of Delaware, Newark, Delaware 19711 d Pioneer, A Dupont Company, Johnston, Iowa 50131 e Plant Gene Expression...

Beth E. Thompson; Christine Basham; Reza Hammond; Queying Ding; Atul Kakrana; Tzuu-Fen Lee; Stacey A. Simon; Robert Meeley; Blake C. Meyers; Sarah Hake

2014-12-02T23:59:59.000Z

449

LONG-RANGE RECONNAISSANCE IMAGER ON NEW HORIZONS A. F. Cheng1  

E-Print Network [OSTI]

Tel. 240-228-5415 andrew.cheng@jhuapl.edu 2 SSG Precision Optronics, Wilmington MA ABSTRACT The LOng

Stern, S. Alan

450

Ralph: A Visible/Infrared Imager for the New Horizons Pluto/Kuiper Belt Mission  

E-Print Network [OSTI]

, CO 80301 5 SSG Precision Optronics, 65 Jonspin Rd., Wilmington MA, 01887 6 NASA/Ames Research Center

Stern, S. Alan

451

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

452

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

453

GlobalWatt Inc | Open Energy Information  

Open Energy Info (EERE)

GlobalWatt Inc GlobalWatt Inc Jump to: navigation, search Name GlobalWatt Inc Place Dover, Delaware Zip 19801 Product Shell company, once planned to float on AIM to raise money in order to acquire the business of semiconductor and/or PV manufacturing equipment suppliers. Coordinates 42.67954°, -88.110374° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.67954,"lon":-88.110374,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

454

JSX Energy Inc | Open Energy Information  

Open Energy Info (EERE)

JSX Energy Inc JSX Energy Inc Jump to: navigation, search Name JSX Energy Inc Place Bangkok, Thailand Zip 10500 Product Delaware-headquartered company, set up to explore for petroleum in Thailand, also considering PV project development. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

455

Home Energy Saver  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search case studies... Entire US Alabama Alaska Arizona Arkansas California Search case studies... Entire US Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware District of Columbia Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Puerto Rico Zip code or Keyword Go Results Green acres | Deep retro | Green palace | My house | John's place | Big retro | Baby steps | Green acres | Deep retro | Green palace | My house | John's place | Big retro | Baby steps Untitled Name , City State: Alabama Alaska Arizona Arkansas California Colorado Connecticut

456

St Lawrence Energy Corp formerly known as UroMed Corporation | Open Energy  

Open Energy Info (EERE)

Lawrence Energy Corp formerly known as UroMed Corporation Lawrence Energy Corp formerly known as UroMed Corporation Jump to: navigation, search Name St. Lawrence Energy Corp (formerly known as UroMed Corporation) Place New York, New York Zip 10038 Sector Renewable Energy Product St. Lawrence Energy Corp. (OTC: SLAW) is a Delaware company focused on the energy sector, including renewable energy and chemical transportation. References St. Lawrence Energy Corp (formerly known as UroMed Corporation)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. St. Lawrence Energy Corp (formerly known as UroMed Corporation) is a company located in New York, New York . References ↑ "St. Lawrence Energy Corp (formerly known as UroMed

457

GE Hitachi Nuclear Energy | Open Energy Information  

Open Energy Info (EERE)

GE Hitachi Nuclear Energy GE Hitachi Nuclear Energy Jump to: navigation, search Name GE Hitachi Nuclear Energy Place Wilmington, North Carolina Zip 28402 Sector Efficiency, Services Product GE Hitachi Nuclear Energy develops advanced light water reactors and offers products and services used by operators of boiling water reactor (BWR) nuclear power plants to improve efficiency and boost output. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

458

Authigenic clay minerals in sandstones of the Delaware Mountain Group: Bell Canyon and Cherry Canyon Formations, Waha Field, West Texas  

E-Print Network [OSTI]

feldspars dominate over the plagioclases. Calcite is the dominant cementing mineral, though sulfate and halite cements have been observed. Hays (1992) showed that a diverse suite of authigenic minerals occurs in these sandstones, including silicate...

Walling, Suzette Denise

2012-06-07T23:59:59.000Z

459

The occurrence of clays and their bearing on evaporite mineralogy in the Salado Formation, Delaware Basin, New Mexico  

E-Print Network [OSTI]

-existing minerals resulting in deposition of clays on the last solution front. Although the clay chemistry does not vary, the clay mineralogy differs with respect to its associ- ated evaporite mineralogy. Low-charge corrensite is associated with iv halite... Diagenesfs. Polyhalite-Halite, Massive Langbeinite-Halite . Langbeinite-Loeweite-Halite. Langbei ni te-Syl vite-Halite Langbeinite-Kainite-Halite . Clay Chemistry and Mineralogy. Evolution of Observed Sequence . CONCLUSIONS REFERENCES. APPENDIX I...

Harville, Donald Gene

2012-06-07T23:59:59.000Z

460

Subscriber access provided by University of Delaware | Library Environmental Science & Technology is published by the American Chemical  

E-Print Network [OSTI]

to that of crystalline layered double hydroxides (LDH), characterized by brucite octahedral sheets, in which trivalent Al

Sparks, Donald L.

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

NEWSLETTER OF THE PARTNERSHIP FOR THE DELAWARE ESTUARY: A NATIONAL ESTUARY PROGRAM VOLUME 20 ISSUE 5 SUMMER 2010  

E-Print Network [OSTI]

mix of energy for the future. But develop- ing non-polluting sources of energy -- like the new solar 5 SUMMER 2010 T he oil spill in the Gulf of Mexico is a frightening reminder of the risks -- to lives, livelihoods, and the environment -- taken to secure the energy that pow- ers our society. Among

Firestone, Jeremy

462

University of Delaware Laboratory Chemical Waste Disposal Guide ALL CHEMICAL WASTE MUST BE DISPOSED OF THROUGH THE  

E-Print Network [OSTI]

experiments and procedures Non-Returnable gas cylinders Batteries Spent solvents, Stains, Strippers, Thinners, Fertilizers Formaldehyde and Formalin Solutions Mercury containing items (other heavy metals) Liquid OR SMALL CONTAINERS IMPORTANT: DO NOT DISPOSE OF REACTIVE, AIR SENSITIVE, OR OXIDIZER SAMPLES

Firestone, Jeremy

463

EV Community Readiness projects: Delaware Valley Regional Planning Commission (PA); Metropolitan Energy Information Center, Inc. (KS, MO)  

Broader source: Energy.gov [DOE]

2013 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting

464

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

465

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

466

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

467

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

468

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

469

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

470

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

471

An Atlas of Soybean Small RNAs Identifies Phased siRNAs from Hundreds of Coding Genes  

Science Journals Connector (OSTI)

...edu . a Department of Plant and Soil Sciences, University of Delaware, Newark, Delaware...Delaware 19711 c Division of Plant Science, University of Missouri, Columbia...Soybean Biotechnology and Division of Plant Sciences, University of Missouri, Columbia...

Siwaret Arikit; Rui Xia; Atul Kakrana; Kun Huang; Jixian Zhai; Zhe Yan; Oswaldo Valdés-López; Silvas Prince; Theresa A. Musket; Henry T. Nguyen; Gary Stacey; Blake C. Meyers

2014-12-02T23:59:59.000Z

472

Omaha District  

Office of Environmental Management (EM)

Deployment to Jordan Steve Jones Wilmington Hydropower Business Line Manager Forward Engineering Support Team - Advanced (FEST-A): * Consists of civilian Mechanical, Civil,...

473

CX-003827: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

474

CX-000751: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide (Seismic) CX(s)...

475

CX-000752: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide (Pier F Drilling)...

476

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Broader source: Energy.gov (indexed) [DOE]

offshore, Long Beach Harbor, California Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for large Scale Geologic Storage of CO2....

477

CX-003818: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

478

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Offshore Long Beach Harbor, CA Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Project awarded under ARRA DE-FOA0000033. NEPA...

479

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

CA Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Project awarded under ARRA DE-FOA0000033. NEPA action is to cover...

480

CX-003825: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

Note: This page contains sample records for the topic "wilmington delaware zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Albany, OR * Anchorage, AK * Morgantown...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles, for Large Scale Geologic Storage of CO 2 Background Carbon capture and storage...

482

CX-012265: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles... CX(s) Applied: B3.1 Date: 06262014 Location(s): California,...

483

CX-012266: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles... CX(s) Applied: A9 Date: 06262014 Location(s): California Offices(s):...

484

CX-000750: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide (Terminal Island...

485

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Broader source: Energy.gov (indexed) [DOE]

CA Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for large Scale Geologic Storage of CO2. Project awarded under ARRA...

486

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles... Extending the length of the project. Office work and modeling at...

487

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for large Scale Geologic Storage of CO2. Project awarded under ARRA...

488

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pilocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for NEPA action is to cover literature reviews, computer work, and other...

489

CX-003829: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Characterization of Pliocene and Miocene Formations in the Wilmington Graben, Offshore Los Angeles for Large Scale Geologic Storage of Carbon Dioxide CX(s) Applied: A9,...

490

E-Print Network 3.0 - amo tecnis z9000 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Carolina at Wilmington Collection: Environmental Sciences and Ecology 70 ERIUSTIOFaccum eui endionse ent praestie con eriustio odolupt ationulpute tat. Nel corso del 2009 il...

491

http://www.c-p-c.com/products/B-25.html  

National Nuclear Security Administration (NNSA)

Steel, Aluminum, Stainless Steel Copyright 2006 | All rights reserved. Wilmington Web Site Design by Port City Digital Container Products Corp. 112 North College Road P.O....

492

ON E WA Y N E W L O N D O N R D R A Y ST C L E V E L A N D A  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

BCC Back Red 113 113 Allen Lab Red 114 Graduate House Restricted * This lot has motorcycle parking spaces. This lot has handicap parking spaces. Wilmington location not...

493

E-Print Network 3.0 - archael system ignicoccus Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Source: Green, Pamela - Delaware Biotechnology Institute & Department of Plant and Soil Sciences, University of Delaware; Lowe, Todd M. - Department of Biomolecular...

494

E-Print Network 3.0 - alpha-herpesvirus infection induces Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Green, Pamela - Delaware Biotechnology Institute & Department of Plant and Soil Sciences, University of Delaware Collection: Biotechnology ; Biology and Medicine 16...

495

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

496

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

497

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

498

SOUND COMPLIANCE MONITORING FOR THE GAMESA WIND TURBINE  

E-Print Network [OSTI]

SOUND COMPLIANCE MONITORING FOR THE GAMESA WIND TURBINE UD - LEWES, DELAWARE January 2011 ` #12;SOUND COMPLIANCE MONITORING FOR THE GAMESA WIND TURBINE AT THE UNIVERSITY OF DELAWARE LEWES, DELAWARE A Gamesa G90 2.0-MW wind turbine operates at the University of Delaware (UD), Lewes campus on a parcel

Firestone, Jeremy

499

Preliminary report on fluid inclusions from halites in the Castile and lower Salado formations of the Delaware Basin, southeastern New Mexico. [Freezing-point depression  

SciTech Connect (OSTI)

A suite of samples composed primarily of halite from the upper Castile and lower Salado Formations of the Permian Basin was selected from Waste Isolation Pilot Plant (WIPP) core for a reconnaissance study of fluid inclusions. Volume percent of these trapped fluids averaged 0.7% to 1%. Freezing-point depressions varied widely and appeared to be unrelated to fluid-inclusion type, to sedimentary facies, or to stratigraphic depth. However, because very low freezing points were usually associated with anhydrite, a relation may exist between freezing-point data and lithology. Dissolved sulfate values were constant through the Castile, then decreased markedly with lesser depth in the lower Salado. This trend correlates very well with observed mineralogy and is consistent with an interpretation of the occurrence of secondary polyhalite as a result of gypsum or anhydrite alteration with simultaneous consumption of dissolved sulfate from the coexisting fluids. Together with the abundance and distribution of fluid inclusions in primary or ''hopper'' crystal structures, this evidence suggests that inclusions seen in these halites did not migrate any significant geographical distance since their formation. 28 refs., 17 figs., 2 tabs.

Stein, C.L.

1985-09-01T23:59:59.000Z

500

Overview of the structural geology and tectonics of the Central Basin Platform, Delaware Basin, and Midland Basin, West Texas and New Mexico  

SciTech Connect (OSTI)

The structural geology and tectonics of the Permian Basin were investigated using an integrated approach incorporating satellite imagery, aeromagnetics, gravity, seismic, regional subsurface mapping and published literature. The two primary emphases were on: (1) delineating the temporal and spatial evolution of the regional stress state; and (2) calculating the amount of regional shortening or contraction. Secondary objectives included delineation of basement and shallower fault zones, identification of structural style, characterization of fractured zones, analysis of surficial linear features on satellite imagery and their correlation to deeper structures. Gandu Unit, also known as Andector Field at the Ellenburger level and Goldsmith Field at Permian and younger reservoir horizons, is the primary area of interest and lies in the northern part of Ector county. The field trends northwest across the county line into Andrews County. The field(s) are located along an Ellenburger thrust anticline trap on the eastern margin of the Central Basin Platform.

Hoak, T. [Kestrel Geoscience, Littleton, CO (United States); Sundberg, K. [Phillips Petroleum Co., Bartlesville, OK (United States); Ortoleva, P. [Indiana Univ., Bloomington, IN (United States)

1998-12-31T23:59:59.000Z