National Library of Energy BETA

Sample records for water sampling field

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Salmon, Mississippi, Site, Water Sampling Location Map .........5 Water Sampling Field Activities Verification ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........1 Water Sampling Locations at the Rulison, .........3 Water Sampling Field Activities Verification ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Slick Rock, Colorado, Processing Sites .........7 Water Sampling Field Activities Verification ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Green River, Utah, Disposal Site August 2014 LMSGRN.........7 Water Sampling Field Activities Verification ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and May 2014 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal .........9 Water Sampling Field Activities Verification ...

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2014 LMSRBLS00514 .........5 Water Sampling Field Activities Verification ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Rulison, Colorado, Site November 2014 LMS.........3 Water Sampling Field Activities Verification ...

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Rulison, Colorado, Site October 2015 LMS.........5 Water Sampling Field Activities Verification ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2015 LMSMNT.........7 Water Sampling Field Activities Verification ...

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    2015 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal Site .........9 Water Sampling Field Activities Verification ...

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2015 LMSRBLS00515 .........5 Water Sampling Field Activities Verification ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Produced Water Sampling at the Rulison, Colorado, Site May 2015 LMSRULS00115 Available .........3 Water Sampling Field Activities Verification ...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Gasbuggy, New Mexico, Site December 2013 .........5 Water Sampling Field Activities Verification ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Produced Water Sampling at the Rulison, Colorado, Site January 2016 LMSRULS00915 .........3 Water Sampling Field Activities Verification ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Groundwater and Surface Water Sampling at the Monument Valley, Arizona, Processing Site .........7 Water Sampling Field Activities Verification ...

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    July 2015 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing .........5 Water Sampling Field Activities Verification ...

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2014 LMSMNT.........7 Water Sampling Field Activities Verification ...

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Water Sampling at the Monticello, Utah, Processing Site January 2014 LMSMNTS01013 This .........7 Water Sampling Field Activities Verification ...

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Naturita, Colorado Processing Site October 2013 LMSNAP.........5 Water Sampling Field Activities Verification ...

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing Site .........5 Water Sampling Field Activities Verification ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Tuba City, Arizona, Disposal Site November 2013 LMSTUB.........9 Water Sampling Field Activities Verification ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Monticello, Utah, Processing Site January .........7 Water Sampling Field Activities Verification ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........9 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Static Water Level Data ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........7 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Time-Concentration Graphs ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........9 Water Sampling Field Activities Verification ... Data Durango Processing Site Surface Water Quality Data Equipment Blank Data Static ...

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........3 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Natural Gas Analysis Data ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrographs Time-Concentration ...

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrograph Time-Concentration ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Time-Concentration Graph ...

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Quality Data Equipment Blank Data Static Water Level Data Time-Concentration Graphs ...

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Time-Concentration Graphs ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........3 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Time-Concentration Graphs ...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........7 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data Static ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data Static ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Tuba City, Arizona Disposal Site June 2015 .........7 Water Sampling Field Activities Verification ...

  17. Water Sampling | Open Energy Information

    Open Energy Info (EERE)

    Water Sampling Details Activities (63) Areas (51) Regions (5) NEPA(2) Exploration Technique Information Exploration Group: Field Techniques Exploration Sub Group: Field Sampling...

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Green River, Utah, Disposal Site August 2013 LMS/GRN/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Green River, Utah August 2013 RIN 13065402 Page i Contents Sampling Event Summary ...............................................................................................................1 Data Assessment Summary ..............................................................................................................7 Water Sampling Field Activities

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Groundwater, Surface Water, and Alternate Water Supply System Sampling at the Riverton, Wyoming, Processing Site December 2013 LMSRVTS00913 This page intentionally left blank ...

  20. Water and Sediment Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MDC Blank 7222014 Below MDC Below MDC Water Sampling Results Location Sample Date WIPP ... Tut Tank 3132014 Below MDC Below MDC Fresh Water Tank 3122014 Below MDC Below MDC Hill ...

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Groundwater, Surface Water, Produced Water, and Natural Gas Sampling at the Gasbuggy, New Mexico, Site October 2014 LMSGSBS00614 Available for sale to the public from: U.S. ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Water Sampling at the Ambrosia Lake, New Mexico, Disposal Site February 2015 LMS/AMB/S01114 This page intentionally left blank U.S. Department of Energy DVP-November 2014, Ambrosia Lake, New Mexico February 2015 RIN 14116607 Page i Contents Sampling Event Summary ...............................................................................................................1 Ambrosia Lake, NM, Disposal Site Planned Sampling Map...........................................................3 Data

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monument Valley, Arizona, Processing Site February 2015 LMS/MON/S01214 This page intentionally left blank U.S. Department of Energy DVP-December 2014, Monument Valley, Arizona February 2015 RIN 14126645 Page i Contents Sampling Event Summary ...............................................................................................................1 Monument Valley, Arizona, Disposal Site Sample Location Map ..................................................5

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Alternate Water Supply System Sampling at the Riverton, Wyoming, Processing Site May 2014 LMS/RVT/S00314 This page intentionally left blank U.S. Department of Energy DVP-March 2014, Riverton, Wyoming May 2014 RIN 14035986 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, WY, Processing Site, Sample Location Map ...................................................................3 Data

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    February 2015 Groundwater and Surface Water Sampling at the Grand Junction, Colorado, Site April 2015 LMS/GJO/S00215 This page intentionally left blank U.S. Department of Energy DVP-February 2015, Grand Junction, Colorado, Site April 2015 RIN 15026795 Page i Contents Sampling Event Summary ...............................................................................................................1 Grand Junction, Colorado, Site Sample Location Map

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Groundwater and Surface Water Sampling at the Slick Rock East and West, Colorado, Processing Sites November 2013 LMS/SRE/SRW/S0913 This page intentionally left blank U.S. Department of Energy DVP-September 2013, Slick Rock, Colorado November 2013 RIN 13095593 Page i Contents Sampling Event Summary ...............................................................................................................1 Slick Rock East and West, Colorado, Processing Sites, Sample Location Map

  7. Surface Water Sampling | Open Energy Information

    Open Energy Info (EERE)

    Surface Water Sampling Details Activities (3) Areas (2) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Field Techniques Exploration Sub Group: Field...

  8. Water Sample Concentrator

    ScienceCinema (OSTI)

    Idaho National Laboratory

    2010-01-08

    Automated portable device that concentrates and packages a sample of suspected contaminated water for safe, efficient transport to a qualified analytical laboratory. This technology will help safeguard against pathogen contamination or chemical and biolog

  9. August 2015 Groundwater and Surface Water Sampling at the Tuba...

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Tuba City, Arizona, Disposal Site November 2015 LMSTUB.........7 Water Sampling Field Activities Verification ...

  10. February 2016 Groundwater and Surface Water Sampling at the Tuba...

    Office of Legacy Management (LM)

    6 Groundwater and Surface Water Sampling at the Tuba City, Arizona, Disposal Site April .........5 Water Sampling Field Activities Verification ...

  11. Field Sampling | Open Energy Information

    Open Energy Info (EERE)

    Field Mapping Hand-held X-Ray Fluorescence (XRF) Macrophotography Portable X-Ray Diffraction (XRD) Field Sampling Gas Sampling Gas Flux Sampling Soil Gas Sampling Surface Gas...

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and September 2013 Groundwater and Surface Water Sampling at the Durango, Colorado, Disposal and Processing Sites March 2014 LMS/DUD/DUP/S00613 This page intentionally left blank U.S. Department of Energy DVP-June and September 2013, Durango, Colorado March 2014 RIN 13055370 and 13085577 Page i Contents Sampling Event Summary ...............................................................................................................1 Durango, Colorado, Disposal Site Sample Location Map-June

  13. Pulsed field sample neutralization

    DOE Patents [OSTI]

    Appelhans, Anthony D.; Dahl, David A.; Delmore, James E.

    1990-01-01

    An apparatus and method for alternating voltage and for varying the rate of extraction during the extraction of secondary particles, resulting in periods when either positive ions, or negative ions and electrons are extracted at varying rates. Using voltage with alternating charge during successive periods to extract particles from materials which accumulate charge opposite that being extracted causes accumulation of surface charge of opposite sign. Charge accumulation can then be adjusted to a ratio which maintains a balance of positive and negative charge emission, thus maintaining the charge neutrality of the sample.

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... Inductively Coupled Plasma (ICP) Interference Check Sample (ICS) Analysis ICP interference check samples ICSA and ICSAB were analyzed at the required frequency to verify the ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... 100, 17B, 1A, 72, and 81 were classified as Category II. The sample results were qualified with a "Q" flag, indicating the data are qualitative because of the sampling technique. ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... the applicable MDL. Inductively Coupled Plasma Interference Check Sample Analysis ... and background correction factors for all inductively coupled plasma instruments. ...

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Sampling at the Ambrosia Lake, New Mexico, Disposal Site March 2016 LMS/AMB/S01215 This page intentionally left blank U.S. Department of Energy DVP-December 2015, Ambrosia Lake, New Mexico March 2016 RIN 15117494 Page i Contents Sampling Event Summary ...............................................................................................................1 Ambrosia Lake, NM, Disposal Site Planned Sampling Map...........................................................3 Data Assessment

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    October 2013 Groundwater Sampling at the Bluewater, New Mexico, Disposal Site December 2013 LMS/BLU/S00813 This page intentionally left blank U.S. Department of Energy DVP-August and October 2013, Bluewater, New Mexico December 2013 RIN 13085537 and 13095651 Page i Contents Sampling Event Summary ...............................................................................................................1 Private Wells Sampled August 2013 and October 2013, Bluewater, NM, Disposal Site

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Sampling at the Grand Junction, Colorado, Disposal Site November 2013 LMS/GRJ/S00813 This page intentionally left blank U.S. Department of Energy DVP-August 2013, Grand Junction, Colorado November 2013 RIN 13075515 Page i Contents Sampling Event Summary ...............................................................................................................1 Grand Junction, Colorado, Disposal Site Sample Location Map ....................................................3 Data Assessment

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Old and New Rifle, Colorado, Processing Sites August 2013 LMS/RFN/RFO/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Rifle, Colorado August 2013 RIN 13065380 Page i Contents Sampling Event Summary ...............................................................................................................1 Sample Location Map, New Rifle, Colorado, Processing Site ........................................................5 Sample Location Map, Old Rifle,

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... The gross alpha, gross beta, radium-226, and radium-228 method blank results were below the DLC. Inductively Coupled Plasma (ICP) Interference Check Sample (ICS) Analysis ICP ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Bluewater, New Mexico, Disposal Site February 2014 LMS/BLU/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Bluewater, New Mexico February 2014 RIN 13115746 Page i Contents Sampling Event Summary ...............................................................................................................1 Bluewater, New Mexico, Disposal Site Sample Location Map.......................................................5 Data Assessment Summary

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Burrell, Pennsylvania, Disposal Site January 2014 LMS/BUR/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Burrell, Pennsylvania January 2014 RIN 13095638 Page i Contents Sampling Event Summary ...............................................................................................................1 Burrell, Pennsylvania, Disposal Site, Sample Location Map ..........................................................3 Data Assessment Summary

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Canonsburg, Pennsylvania, Disposal Site February 2014 LMS/CAN/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Canonsburg, Pennsylvania February 2014 RIN 13095639 Page i Contents Sampling Event Summary ...............................................................................................................1 Canonsburg, Pennsylvania, Disposal Site, Sample Location Map ..................................................3 Data Assessment Summary

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Disposal Site August 2014 LMS/LKD/S00514 This page intentionally left blank U.S. Department of Energy DVP-May 2014, Lakeview, Oregon, Disposal August 2014 RIN 14056157 Page i Contents Sampling Event Summary ...............................................................................................................1 Lakeview, Oregon, Disposal Site, Sample Location Map ...............................................................3 Data Assessment Summary

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Processing Site August 2014 LMS/LKP/S00514 This page intentionally left blank U.S. Department of Energy DVP-May 2014, Lakeview, Oregon, Processing August 2014 RIN 14056157 and 14056158 Page i Contents Sampling Event Summary ...............................................................................................................1 Lakeview, Oregon, Processing Site, Sample Location Map ............................................................3 Data Assessment Summary

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Riverton, Wyoming, Processing Site September 2013 LMS/RVT/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Riverton, Wyoming September 2013 RIN 13065379 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, Wyoming, Processing Site, Sample Location Map .........................................................5 Data Assessment Summary

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Riverton, Wyoming, Processing Site February 2016 LMS/RVT/S00915 This page intentionally left blank U.S. Department of Energy DVP-September 2015, Riverton, Wyoming February 2016 RINs 15097345, 15097346, and 15097347 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, Wyoming, Processing Site Planned Sampling Location Map .........................................7 Data Assessment Summary

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Rifle, Colorado, New and Old Processing Sites January 2014 LMS/RFN/RFO/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Rifle, Colorado January 2014 RIN 13115731 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Sample Location Map ........................................................5 Old Rifle, Colorado, Processing

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Old and New Rifle, Colorado, Processing Sites January 2015 LMS/RFN/RFO/S01114 This page intentionally left blank U.S. Department of Energy DVP-November 2014, Rifle, Colorado January 2015 RINs 14106568 and 14106569 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Planned Sampling Map ......................................................3 Old Rifle,

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Slick Rock, Colorado, Processing Sites January 2016 LMS/SRE/SRW/S00915 This page intentionally left blank U.S. Department of Energy DVP-September 2015, Slick Rock, Colorado January 2016 RINs 15087319 and 15107424 Page i Contents Sampling Event Summary ...............................................................................................................1 Slick Rock, Colorado, Processing Sites, Sample Location Map .....................................................5 Data Assessment

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... 10 pCiL Liquid Scintillation LMR-15 Uranium Vanadium Zinc Total No. of Analytes 4 0 ... 26, 2013 TO: Rick Findlay FROM: Jeff Price SUBJECT: Trip Report (LTHMP Sampling) ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater Sampling at the Central Nevada Test Area February 2015 LMS/CNT/S01214 Available for sale to the public from: U.S. Department of Commerce National Technical Information Service 5301 Shawnee Road Alexandria, VA 22312 Telephone: 800.553.6847 Fax: 703.605.6900 E-mail: orders@ntis.gov Online Ordering: http://www.ntis.gov/help/ordermethods.aspx Available electronically at http://www.osti.gov/scitech/ Available for a processing fee to U.S. Department of Energy and its contractors, in

  14. Category:Water Sampling | Open Energy Information

    Open Energy Info (EERE)

    Water Sampling Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermalpower.jpg Looking for the Water Sampling page? For detailed information on Water Sampling as...

  15. Appendix A, Field Sampling Data and Appendix B, Field Reduced...

    Energy Savers [EERE]

    A, Field Sampling Data and Appendix B, Field Reduced Data Appendix A, Field Sampling Data and Appendix B, Field Reduced Data Docket No. EO-05-01: Appendix A, Field Sampling Data ...

  16. [Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio]. Volume 3, Sampling and analysis plan (SAP): Phase 1, Task 4, Field Investigation: Draft

    SciTech Connect (OSTI)

    Not Available

    1991-10-01

    In April 1990, Wright-Patterson Air Force Base (WPAFB), initiated an investigation to evaluate a potential Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) removal action to prevent, to the extent practicable, the offsite migration of contaminated ground water from WPAFB. WPAFB retained the services of the Environmental Management Operations (EMO) and its principle subcontractor, International Technology Corporation (IT) to complete Phase 1 of the environmental investigation of ground-water contamination at WPAFB. Phase 1 of the investigation involves the short-term evaluation and potential design for a program to remove ground-water contamination that appears to be migrating across the western boundary of Area C, and across the northern boundary of Area B along Springfield Pike. Primarily, Task 4 of Phase 1 focuses on collection of information at the Area C and Springfield Pike boundaries of WPAFB. This Sampling and Analysis Plan (SAP) has been prepared to assist in completion of the Task 4 field investigation and is comprised of the Quality Assurance Project Plan (QAPP) and the Field Sampling Plan (FSP).

  17. Water-Gas Sampling | Open Energy Information

    Open Energy Info (EERE)

    Water-Gas Sampling (Redirected from Water-Gas Samples) Redirect page Jump to: navigation, search REDIRECT Downhole Fluid Sampling Retrieved from "http:en.openei.orgw...

  18. Category:Field Sampling | Open Energy Information

    Open Energy Info (EERE)

    Technique Subcategories This category has the following 2 subcategories, out of 2 total. G + Gas Sampling (3 categories) 4 pages W + Water Sampling (2 categories) 3...

  19. Water Sampling (Healy, 1970) | Open Energy Information

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling (Healy, 1970) Exploration Activity Details Location Unspecified Exploration...

  20. Water Sampling At International Geothermal Area, Philippines...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At International Geothermal Area, Philippines (Wood, 2002) Exploration...

  1. Visual Sample Plan (VSP) - FIELDS Integration

    SciTech Connect (OSTI)

    Pulsipher, Brent A.; Wilson, John E.; Gilbert, Richard O.; Hassig, Nancy L.; Carlson, Deborah K.; Bing-Canar, John; Cooper, Brian; Roth, Chuck

    2003-04-19

    Two software packages, VSP 2.1 and FIELDS 3.5, are being used by environmental scientists to plan the number and type of samples required to meet project objectives, display those samples on maps, query a database of past sample results, produce spatial models of the data, and analyze the data in order to arrive at defensible decisions. VSP 2.0 is an interactive tool to calculate optimal sample size and optimal sample location based on user goals, risk tolerance, and variability in the environment and in lab methods. FIELDS 3.0 is a set of tools to explore the sample results in a variety of ways to make defensible decisions with quantified levels of risk and uncertainty. However, FIELDS 3.0 has a small sample design module. VSP 2.0, on the other hand, has over 20 sampling goals, allowing the user to input site-specific assumptions such as non-normality of sample results, separate variability between field and laboratory measurements, make two-sample comparisons, perform confidence interval estimation, use sequential search sampling methods, and much more. Over 1,000 copies of VSP are in use today. FIELDS is used in nine of the ten U.S. EPA regions, by state regulatory agencies, and most recently by several international countries. Both software packages have been peer-reviewed, enjoy broad usage, and have been accepted by regulatory agencies as well as site project managers as key tools to help collect data and make environmental cleanup decisions. Recently, the two software packages were integrated, allowing the user to take advantage of the many design options of VSP, and the analysis and modeling options of FIELDS. The transition between the two is simple for the user – VSP can be called from within FIELDS, automatically passing a map to VSP and automatically retrieving sample locations and design information when the user returns to FIELDS. This paper will describe the integration, give a demonstration of the integrated package, and give users download

  2. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2001.07.11 - 2001.07.25 Lead Scientist : Marc Fischer Data Availability Data are being processed for inclusion in ARM Archive. For data sets, see below. Summary July, 2001: Three systems were deployed in four fields during a

  3. Water Sampling (Lewicki & Oldenburg, 2004) | Open Energy Information

    Open Energy Info (EERE)

    Water Sampling (Lewicki & Oldenburg, 2004) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling (Lewicki & Oldenburg, 2004) Exploration...

  4. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2004.04.15 - 2004.12.15 Lead Scientist : Marc Fischer For data sets, see below. Abstract Accurate prediction of the regional responses of CO2 flux to changing climate, land use, and management requires models that are

  5. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2005.03.01 - 2006.01.08 Lead Scientist : Marc Fischer For data sets, see below. Abstract Accurate prediction of the regional responses of CO2 flux to changing climate, land use, and management requires models that are

  6. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2007.01.01 - 2007.12.31 Lead Scientist : Marc Fischer For data sets, see below. Abstract Accurate prediction of the regional responses of CO2 flux to changing climate, land use, and management requires models that are

  7. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Related Campaigns PGS Validation 2011-2013 2011.03.01, Fischer, SGP PGS Validatation 2010 2010.03.01, Fischer, SGP PGS Validatation 2009.03.01, Fischer, SGP Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2008.01.01 - 2008.12.31 Lead Scientist : Marc Fischer For data sets,

  8. Retrofit Integrated Space & Water Heating: Field Assessment,...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Retrofit Integrated Space and Water Heating: Field Assessment Minneapolis, Minnesota PROJECT INFORMATION Project Name: Retrofit Integrated Space and Water Heating: Field Assessment ...

  9. Field Monitoring Protocol: Heat Pump Water Heaters

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Field Monitoring Protocol: Heat Pump Water Heaters B. Sparn, L. Earle, D. Christensen, J. ... 2013 Field Monitoring Protocol: Heat Pump Water Heaters B. Sparn, L. Earle, D. ...

  10. Reliability of chemical analyses of water samples

    SciTech Connect (OSTI)

    Beardon, R.

    1989-11-01

    Ground-water quality investigations require reliable chemical analyses of water samples. Unfortunately, laboratory analytical results are often unreliable. The Uranium Mill Tailings Remedial Action (UMTRA) Project`s solution to this problem was to establish a two phase quality assurance program for the analysis of water samples. In the first phase, eight laboratories analyzed three solutions of known composition. The analytical accuracy of each laboratory was ranked and three laboratories were awarded contracts. The second phase consists of on-going monitoring of the reliability of the selected laboratories. The following conclusions are based on two years experience with the UMTRA Project`s Quality Assurance Program. The reliability of laboratory analyses should not be taken for granted. Analytical reliability may be independent of the prices charged by laboratories. Quality assurance programs benefit both the customer and the laboratory.

  11. Category:Surface Water Sampling | Open Energy Information

    Open Energy Info (EERE)

    Surface Water Sampling Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermalpower.jpg Looking for the Surface Water Sampling page? For detailed information on...

  12. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland. Volume 1: Field Sampling Plan

    SciTech Connect (OSTI)

    Benioff, P.; Biang, R.; Dolak, D.; Dunn, C.; Martino, L.; Patton, T.; Wang, Y.; Yuen, C.

    1995-03-01

    The Environmental Management Division (EMD) of Aberdeen Proving Ground (APG), Maryland, is conducting a remedial investigation and feasibility study (RI/FS) of the J-Field area at APG pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended. J-Field is within the Edgewood Area of APG in Harford County, Maryland (Figure 1. 1). Since World War II activities in the Edgewood Area have included the development, manufacture, testing, and destruction of chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). Considerable archival information about J-Field exists as a result of efforts by APG staff to characterize the hazards associated with the site. Contamination of J-Field was first detected during an environmental survey of the Edgewood Area conducted in 1977 and 1978 by the US Army Toxic and Hazardous Materials Agency (USATHAMA) (predecessor to the US Army Environmental Center [AEC]). As part of a subsequent USATHAMA -environmental survey, 11 wells were installed and sampled at J-Field. Contamination at J-Field was also detected during a munitions disposal survey conducted by Princeton Aqua Science in 1983. The Princeton Aqua Science investigation involved the installation and sampling of nine wells and the collection and analysis of surficial and deep composite soil samples. In 1986, a Resource Conservation and Recovery Act (RCRA) permit (MD3-21-002-1355) requiring a basewide RCRA Facility Assessment (RFA) and a hydrogeologic assessment of J-Field was issued by the US Environmental Protection Agency (EPA). In 1987, the US Geological Survey (USGS) began a two-phased hydrogeologic assessment in data were collected to model, groundwater flow at J-Field. Soil gas investigations were conducted, several well clusters were installed, a groundwater flow model was developed, and groundwater and surface water monitoring programs were established that continue today.

  13. Field-deployable, nano-sensing approach for real-time detection of free mercury, speciation and quantification in surface stream waters and groundwater samples at the U.S. Department of Energy contaminated sites

    SciTech Connect (OSTI)

    Campiglia, Andres D.; Hernandez, Florencio E.

    2014-08-28

    The detrimental effects on human health caused by long-term exposure to trace contamination of toxic metals have been documented in numerous epidemiological and toxicological studies. The fact that metals are non-biodegradable and accumulate in the food chain poses a severe threat to the environment and human health. Their monitoring in drinking water, aquatic ecosystems, food and biological fluids samples is then essential for global sustainability. While research efforts employing established methodology continue to advance conceptual/computational models of contaminant behavior, the increasing awareness and public concern with environmental and occupational exposure to toxic metals calls for sensing devices capable to handle on-site elemental analysis in short analysis time. Field analysis with potable methodology prevents unnecessary scrutiny of un-contaminated samples via laboratory-bound methods, reduces analysis cost and expedites turnaround time for decision making and remediation purposes. Of particular toxicological interest are mercury and its species. Mercury is recognized as a major environmental pollution issue. The field-portable sensor developed in this project provides a unique and valuable tool for the on-site, real-time determination of inorganic mercury in surface waters. The ability to perform on-site analysis of mercury should prove useful in remote locations with difficult accessibility. It should facilitate data collection from statistically meaningful population sizes for a better understanding of the dose-effect role and the water-soil-plant-animal-human transfer mechanisms. The acquired knowledge should benefit the development of efficient environmental remediation processes, which is extremely relevant for a globally sustainable environment.

  14. Attosecond nanoscale near-field sampling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Forg, B.; Schotz, J.; SuBmann, F.; Forster, M.; Kruger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; et al

    2016-05-31

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. Furthermore, by comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted.

  15. Water Sampling At Lightning Dock Geothermal Area (Swanberg, 1976...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Lightning Dock Geothermal Area (Swanberg, 1976) Exploration Activity...

  16. Water Sampling At International Geothermal Area, New Zealand...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At International Geothermal Area, New Zealand (Wood, 2002) Exploration...

  17. Water Sampling At Lightning Dock Geothermal Area (Witcher, 2006...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Lightning Dock Geothermal Area (Witcher, 2006) Exploration Activity...

  18. Water Sampling At Mokapu Penninsula Area (Thomas, 1986) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details...

  19. Water Sampling At Blackfoot Reservoir Area (Hutsinpiller & Parry...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Blackfoot Reservoir Area (Hutsinpiller & Parry, 1985) Exploration Activity...

  20. Water Sampling At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valles Caldera - Sulphur Springs Geothermal Area (Trainer, 1974)...

  1. Rock Sampling At San Francisco Volcanic Field Area (Warpinski...

    Open Energy Info (EERE)

    Francisco Volcanic Field Area (Warpinski, Et Al., 2004) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Rock Sampling At San Francisco Volcanic...

  2. News Release: DOE Announces Riverton Water Sampling Results | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Announces Riverton Water Sampling Results News Release: DOE Announces Riverton Water Sampling Results May 11, 2012 - 3:25pm Addthis News Contact: Contractor, Judy Miller, S.M. Stoller Corporation Public Affairs (970) 248-6363 jmiller@lm.doe.gov Laboratory results indicate water from the alternative water supply system is safe for residents to drink The U.S. Department of Energy announced today that residential drinking water testing from an alternative water supply system in Riverton,

  3. UMTRA water sampling and analysis plan, Green River, Utah

    SciTech Connect (OSTI)

    Papusch, R.

    1993-12-01

    The purpose of this water sampling and analysis plan (WSAP) is to provide a basis for groundwater and surface water sampling at the Green River Uranium Mill Tailing Remedial Action (UMTRA) Project site. This WSAP identifies and justifies the sampling locations, analytical parameters, detection limits, and sampling frequency for the monitoring locations.

  4. Interpretation of Water Sample Analysis, Waunita Hot Spring Project...

    Open Energy Info (EERE)

    of Water Sample Analysis, Waunita Hot Spring Project, Gunnison County, Colorado Author R. H. Carpenter Organization Colorado Geological Survey in Cooperation with the U.S....

  5. Ch. III, Interpretation of water sample analyses Waunita Hot...

    Open Energy Info (EERE)

    of water sample analyses Waunita Hot Springs area Gunnison County, Colorado Author R. H. Carpenter Editor T. G. Zacharakis Published Colorado Geological Survey in Cooperation...

  6. Water Sampling At Dixie Valley Geothermal Area (Wood, 2002) ...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Dixie Valley Geothermal Area (Wood, 2002) Exploration Activity Details...

  7. Water Sampling At Valley Of Ten Thousand Smokes Region Area ...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valley Of Ten Thousand Smokes Region Area (Keith, Et Al., 1992)...

  8. Water Sampling At Little Valley Area (Wood, 2002) | Open Energy...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Little Valley Area (Wood, 2002) Exploration Activity Details Location...

  9. Water Sampling At Kilauea East Rift Geothermal Area (Thomas,...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Kilauea East Rift Geothermal Area (Thomas, 1986) Exploration Activity...

  10. Water Sampling At Teels Marsh Area (Coolbaugh, Et Al., 2006)...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Teels Marsh Area (Coolbaugh, Et Al., 2006) Exploration Activity Details...

  11. Water Sampling At Yellowstone Region (Hurwitz, Et Al., 2007)...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Yellowstone Region (Hurwitz, Et Al., 2007) Exploration Activity Details...

  12. Water Sampling At Hawthorne Area (Lazaro, Et Al., 2010) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Hawthorne Area (Lazaro, Et Al., 2010) Exploration Activity Details...

  13. Water Sampling At Hualalai Northwest Rift Area (Thomas, 1986...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Hualalai Northwest Rift Area (Thomas, 1986) Exploration Activity Details...

  14. Water Sampling At Central Nevada Seismic Zone Region (Laney,...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Central Nevada Seismic Zone Region (Laney, 2005) Exploration Activity...

  15. Surface Water Sampling At Raft River Geothermal Area (1973) ...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Surface Water Sampling At Raft River Geothermal Area (1973) Exploration Activity Details Location...

  16. Water Sampling At Alvord Hot Springs Area (Wood, 2002) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Alvord Hot Springs Area (Wood, 2002) Exploration Activity Details Location...

  17. Water Sampling At Beowawe Hot Springs Area (Wood, 2002) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Beowawe Hot Springs Area (Wood, 2002) Exploration Activity Details...

  18. Water Sampling At Salton Sea Area (Wood, 2002) | Open Energy...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Salton Sea Area (Wood, 2002) Exploration Activity Details Location Salton...

  19. Water Sampling At Rhodes Marsh Area (Coolbaugh, Et Al., 2006...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Rhodes Marsh Area (Coolbaugh, Et Al., 2006) Exploration Activity Details...

  20. Water Sampling At Waunita Hot Springs Geothermal Area (Carpenter...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Waunita Hot Springs Geothermal Area (Carpenter, 1981) Exploration Activity...

  1. Water Sampling At Mccredie Hot Springs Area (Wood, 2002) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Mccredie Hot Springs Area (Wood, 2002) Exploration Activity Details...

  2. Water Sampling At Umpqua Hot Springs Area (Wood, 2002) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Umpqua Hot Springs Area (Wood, 2002) Exploration Activity Details Location...

  3. Water Sampling At Long Valley Caldera Geothermal Area (Sorey...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Long Valley Caldera Geothermal Area (Sorey, Et Al., 1991) Exploration...

  4. Water Sampling At Salt Wells Area (Shevenell & Garside, 2003...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Salt Wells Area (Shevenell & Garside, 2003) Exploration Activity Details...

  5. Surface Water Sampling At Chena Geothermal Area (Holdmann, Et...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Surface Water Sampling At Chena Geothermal Area (Holdmann, Et Al., 2006) Exploration Activity...

  6. Water Sampling At Buffalo Valley Hot Springs Area (Laney, 2005...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Buffalo Valley Hot Springs Area (Laney, 2005) Exploration Activity Details...

  7. Water Sampling At Valles Caldera - Redondo Area (Rao, Et Al....

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valles Caldera - Redondo Area (Rao, Et Al., 1996) Exploration Activity...

  8. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson & Dellechaie, 1976)...

  9. Water-Gas Samples At Valles Caldera - Redondo Geothermal Area...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water-Gas Samples At Valles Caldera - Redondo Geothermal Area (Janik & Goff, 2002)...

  10. Water Sampling At Dixie Valley Geothermal Area (Kennedy & Soest...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Dixie Valley Geothermal Area (Kennedy & Soest, 2006) Exploration Activity...

  11. Water Sampling At Long Valley Caldera Geothermal Area (Evans...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Long Valley Caldera Geothermal Area (Evans, Et Al., 2002) Exploration...

  12. Water Sampling At Roosevelt Hot Springs Geothermal Area (Faulder...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Roosevelt Hot Springs Geothermal Area (Faulder, 1991) Exploration Activity...

  13. Water Sampling At Mt Ranier Area (Frank, 1995) | Open Energy...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Mt Ranier Area (Frank, 1995) Exploration Activity Details Location Mt...

  14. Water Sampling At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valles Caldera - Sulphur Springs Geothermal Area (Goff, Et Al., 1982)...

  15. Water Sampling At Valles Caldera - Redondo Geothermal Area (Goff...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valles Caldera - Redondo Geothermal Area (Goff, Et Al., 1982) Exploration...

  16. Water Sampling At Jemez Springs Geothermal Area (Trainer, 1974...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Jemez Springs Geothermal Area (Trainer, 1974) Exploration Activity Details...

  17. Water Sampling At Northern Basin & Range Region (Laney, 2005...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Northern Basin & Range Region (Laney, 2005) Exploration Activity Details...

  18. Water Sampling At Kauai Area (Thomas, 1986) | Open Energy Information

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Kauai Area (Thomas, 1986) Exploration Activity Details Location Kauai Area...

  19. Water Sampling At Walker-Lane Transitional Zone Region (Laney...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Walker-Lane Transitional Zone Region (Laney, 2005) Exploration Activity...

  20. Water Sampling At Zim's Hot Springs Geothermal Area (Wood, 2002...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Zim's Hot Springs Geothermal Area (Wood, 2002) Exploration Activity...

  1. Water Sampling At Heber Area (Wood, 2002) | Open Energy Information

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Heber Area (Wood, 2002) Exploration Activity Details Location Heber Area...

  2. Water Sampling At Nw Basin & Range Region (Laney, 2005) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Nw Basin & Range Region (Laney, 2005) Exploration Activity Details...

  3. Water Sampling At Breitenbush Hot Springs Area (Wood, 2002) ...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Breitenbush Hot Springs Area (Wood, 2002) Exploration Activity Details...

  4. Water Sampling At Salt Wells Area (Coolbaugh, Et Al., 2006) ...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Salt Wells Area (Coolbaugh, Et Al., 2006) Exploration Activity Details...

  5. Water Sampling At Valles Caldera - Sulphur Springs Area (Rao...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valles Caldera - Sulphur Springs Area (Rao, Et Al., 1996) Exploration...

  6. Water Sampling At Lualualei Valley Area (Thomas, 1986) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Lualualei Valley Area (Thomas, 1986) Exploration Activity Details Location...

  7. Water Sampling At Crane Hot Springs Area (Wood, 2002) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Crane Hot Springs Area (Wood, 2002) Exploration Activity Details Location...

  8. Water Sampling At Mt St Helens Area (Shevenell & Goff, 1995)...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Mt St Helens Area (Shevenell & Goff, 1995) Exploration Activity Details...

  9. Water Sampling At Kilauea East Rift Geothermal Area (FURUMOTO...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Kilauea East Rift Geothermal Area (FURUMOTO, 1976) Exploration Activity...

  10. Water Sampling At Mickey Hot Springs Area (Wood, 2002) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Mickey Hot Springs Area (Wood, 2002) Exploration Activity Details Location...

  11. Water Sampling At Long Valley Caldera Geothermal Area (Goff,...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Long Valley Caldera Geothermal Area (Goff, Et Al., 1991) Exploration...

  12. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sampling (PGS) Validation Field Campaign 2002.01.01 - 2002.07.31 Lead Scientist : Marc Fischer For data sets, see below. Abstract The PGS validation will continue measuring the...

  13. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2003.04.02 - 2003.09.02 Lead Scientist : Marc Fischer For data sets, see below. Abstract Ecosystem-atmosphere ...

  14. Field Monitoring Protocol: Heat Pump Water Heaters

    SciTech Connect (OSTI)

    Sparn, B.; Earle, L.; Christensen, D.; Maguire, J.; Wilson, E.; Hancock, E.

    2013-02-01

    This document provides a standard field monitoring protocol for evaluating the installed performance of Heat Pump Water Heaters in residential buildings. The report is organized to be consistent with the chronology of field test planning and execution. Research questions are identified first, followed by a discussion of analysis methods, and then the details of measuring the required information are laid out. A field validation of the protocol at a house near the NREL campus is included for reference.

  15. UMTRA project water sampling and analysis plan, Tuba City, Arizona

    SciTech Connect (OSTI)

    1996-02-01

    Planned, routine ground water sampling activities at the U.S. Department of Energy (DOE) Uranium Mill Tailings Remedial Action (UMTRA) Project site in Tuba City, Arizona, are described in the following sections of this water sampling and analysis plan (WSAP). This plan identifies and justifies the sampling locations, analytical parameters, detection limits, and sampling frequency for the stations routinely monitored at the site. The ground water data are used for site characterization and risk assessment. The regulatory basis for routine ground water monitoring at UMTRA Project sites is derived from the U.S. Environmental Protection Agency (EPA) regulations in 40 CFR Part 192 (1994) and the final EPA standards of 1995 (60 FR 2854). Sampling procedures are guided by the UMTRA Project standard operating procedures (SOP) (JEG, n.d.), and the most effective technical approach for the site.

  16. Long-Term Ecological Monitoring Field Sampling Plan for 2007

    SciTech Connect (OSTI)

    T. Haney R. VanHorn

    2007-07-31

    This field sampling plan describes the field investigations planned for the Long-Term Ecological Monitoring Project at the Idaho National Laboratory Site in 2007. This plan and the Quality Assurance Project Plan for Waste Area Groups 1, 2, 3, 4, 5, 6, 7, 10, and Removal Actions constitute the sampling and analysis plan supporting long-term ecological monitoring sampling in 2007. The data collected under this plan will become part of the long-term ecological monitoring data set that is being collected annually. The data will be used t determine the requirements for the subsequent long-term ecological monitoring. This plan guides the 2007 investigations, including sampling, quality assurance, quality control, analytical procedures, and data management. As such, this plan will help to ensure that the resulting monitoring data will be scientifically valid, defensible, and of known and acceptable quality.

  17. UMTRA project water sampling and analysis plan, Monument Valley, Arizona

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Monument Valley Uranium Mill Tailings Remedial Action (UMTRA) Project site in Cane Valley is a former uranium mill that has undergone surface remediation in the form of tailings and contaminated materials removal. Contaminated materials from the Monument Valley (Arizona) UMTRA Project site have been transported to the Mexican Hat (Utah) UMTRA Project site for consolidation with the Mexican Hat tailings. Tailings removal was completed in February 1994. Three geologic units at the site contain water: the unconsolidated eolian and alluvial deposits (alluvial aquifer), the Shinarump Conglomerate (Shinarump Member), and the De Chelly Sandstone. Water quality analyses indicate the contaminant plume has migrated north of the site and is mainly in the alluvial aquifer. An upward hydraulic gradient in the De Chelly Sandstone provides some protection to that aquifer. This water sampling and analysis plan recommends sampling domestic wells, monitor wells, and surface water in April and September 1994. The purpose of sampling is to continue periodic monitoring for the surface program, evaluate changes to water quality for site characterization, and provide data for the baseline risk assessment. Samples taken in April will be representative of high ground water levels and samples taken in September will be representative of low ground water levels. Filtered and nonfiltered samples will be analyzed for plume indicator parameters and baseline risk assessment parameters.

  18. Trip Report-Produced-Water Field Testing

    SciTech Connect (OSTI)

    Sullivan, Enid J.

    2012-05-25

    Los Alamos National Laboratory (LANL) conducted field testing of a produced-water pretreatment apparatus with assistance from faculty at the Texas A&M University (TAMU) protein separation sciences laboratory located on the TAMU main campus. The following report details all of the logistics surrounding the testing. The purpose of the test was to use a new, commercially-available filter media housing containing modified zeolite (surfactant-modified zeolite or SMZ) porous medium for use in pretreatment of oil and gas produced water (PW) and frac-flowback waters. The SMZ was tested previously in October, 2010 in a lab-constructed configuration ('old multicolumn system'), and performed well for removal of benzene, toluene, ethylbenzene, and xylenes (BTEX) from PW. However, a less-expensive, modular configuration is needed for field use. A modular system will allow the field operator to add or subtract SMZ filters as needed to accommodate site specific conditions, and to swap out used filters easily in a multi-unit system. This test demonstrated the use of a commercial filter housing with a simple flow modification and packed with SMZ for removing BTEX from a PW source in College Station, Texas. The system will be tested in June 2012 at a field site in Pennsylvania for treating frac-flowback waters. The goals of this test are: (1) to determine sorption efficiency of BTEX in the new configuration; and (2) to observe the range of flow rates, backpressures, and total volume treated at a given flow rate.

  19. Dynamics of lysozyme and its hydration water under electric field

    SciTech Connect (OSTI)

    Favi, Pelagie M; Zhang, Qiu; O'Neill, Hugh Michael; Mamontov, Eugene; Omar Diallo, Souleymane; Palmer, Jeremy

    2014-01-01

    The effects of static electric field on the dynamics of lysozyme and its hydration water have been investigated by means of incoherent quasi-elastic neutron scattering (QENS). Measurements were performed on lysozyme samples, hydrated respectively with heavy water (D2O) to capture the protein dynamics, and with light water (H2O), to probe the dynamics of the hydration shell, in the temperature range from 210 < T < 260 K. The hydration fraction in both cases was about 0.38 gram of water per gram of dry protein. The field strengths investigated were respectively 0 kV/mm and 2 kV/mm ( 2 106 V/m) for the protein hydrated with D2O and 0 kV and 1 kV/mm for the H2O-hydrated counterpart. While the overall internal protons dynamics of the protein appears to be unaffected by the application of electric field up to 2 kV/mm, likely due to the stronger intra-molecular interactions, there is also no appreciable quantitative enhancement of the diffusive dynamics of the hydration water, as would be anticipated based on our recent observations in water confined in silica pores under field values of 2.5 kV/mm. This may be due to the difference in surface interactions between water and the two adsorption hosts (silica and protein), or to the existence of a critical threshold field value Ec 2 3 kV/mm for increased molecular diffusion, for which electrical breakdown is a limitation for our sample.

  20. RAPID DETERMINATION OF {sup 210} PO IN WATER SAMPLES

    SciTech Connect (OSTI)

    Maxwell, S.

    2013-05-22

    A new rapid method for the determination of {sup 210}Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that can be used for emergency response or routine water analyses. If a radiological dispersive device (RDD) event or a radiological attack associated with drinking water supplies occurs, there will be an urgent need for rapid analyses of water samples, including drinking water, ground water and other water effluents. Current analytical methods for the assay of {sup 210}Po in water samples have typically involved spontaneous auto-deposition of {sup 210}Po onto silver or other metal disks followed by counting by alpha spectrometry. The auto-deposition times range from 90 minutes to 24 hours or more, at times with yields that may be less than desirable. If sample interferences are present, decreased yields and degraded alpha spectrums can occur due to unpredictable thickening in the deposited layer. Separation methods have focused on the use of Sr Resin?, often in combination with 210Pb analysis. A new rapid method for {sup 210}Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that utilizes a rapid calcium phosphate co-precipitation method, separation using DGA Resin? (N,N,N?,N? tetraoctyldiglycolamide extractant-coated resin, Eichrom Technologies or Triskem-International), followed by rapid microprecipitation of {sup 210}Po using bismuth phosphate for counting by alpha spectrometry. This new method can be performed quickly with excellent removal of interferences, high chemical yields and very good alpha peak resolution, eliminating any potential problems with the alpha source preparation for emergency or routine samples. A rapid sequential separation method to separate {sup 210} Po and actinide isotopes was also developed. This new approach, rapid separation with DGA Resin plus microprecipitation for alpha source preparation, is a significant advance in radiochemistry for the rapid

  1. DESIGN, DEVELOPMENT AND FIELD DEPLOYMENT OF A TELEOPERATED SAMPLING SYSTEM

    SciTech Connect (OSTI)

    Dalmaso, M; Robert Fogle, R; Tony Hicks, T; Larry Harpring, L; Daniel Odell, D

    2007-11-09

    A teleoperated sampling system for the identification, collection and retrieval of samples following the detonation of an Improvised Nuclear Device (IND) or Radiological Dispersion Devise (RDD) has been developed and tested in numerous field exercises. The system has been developed as part of the Defense Threat Reduction Agency's (DTRA) National Technical Nuclear Forensic (NTNF) Program. The system is based on a Remotec ANDROS Mark V-A1 platform. Extensive modifications and additions have been incorporated into the platform to enable it to meet the mission requirements. The Defense Science Board Task Force on Unconventional Nuclear Warfare Defense, 2000 Summer Study Volume III report recommended the Department of Defense (DOD) improve nuclear forensics capabilities to achieve accurate and fast identification and attribution. One of the strongest elements of protection is deterrence through the threat of reprisal, but to accomplish this objective a more rapid and authoritative attribution system is needed. The NTNF program provides the capability for attribution. Early on in the NTNF program, it was recognized that there would be a desire to collect debris samples for analysis as soon as possible after a nuclear event. Based on nuclear test experience, it was recognized that mean radiation fields associated with even low yield events could be several thousand R/Hr near the detonation point for some time after the detonation. In anticipation of pressures to rapidly sample debris near the crater, considerable effort is being devoted to developing a remotely controlled vehicle that could enter the high radiation field area and collect one or more samples for subsequent analysis.

  2. Manus Water Isotope Investigation Field Campaign Report (Program...

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Search Results Program Document: Manus Water Isotope Investigation Field Campaign Report Citation Details In-Document Search Title: Manus Water Isotope ...

  3. Water Management in Mature Oil Fields using Advanced Particle...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Water Management in Mature Oil Fields using Advanced Particle Gels Final Report Contract ... 91 6.6.8 Resistance to Water Flow after Gel Placement in Conduits ...

  4. Heat Pump Water Heaters: Controlled Field Research of Impact...

    Office of Scientific and Technical Information (OSTI)

    Water Heaters: Controlled Field Research of Impact on Space Conditioning and Demand Response Characteristics Citation Details In-Document Search Title: Heat Pump Water Heaters: ...

  5. Radiochemical Analyses of Water Samples from Selected Streams

    Office of Legacy Management (LM)

    > : , - ' and Precipitation Collected in - Connection with Calibration-Test Flaring of Gas From Test Well, - I August 15-October 13, 197,0,, Project Rulison-8, 197 1 HGS 9 DISCLAIMER Portions of this document may be illegible in electronic image products. Images are produced from the best available original document. UNITED STATES DEPARTMENT OF THE INTERIOR GEOLOGICAL SURVEY Federal center, Denver, Colorado 80225 RADIOCHEMICAL ANALYSES OF WATER SAMPLES FROM SELECTED STREAMS AND PRECIPITATION

  6. Raft River Geothermal Field Well Head Brine Sample

    SciTech Connect (OSTI)

    Tim Lanyk

    2015-12-18

    Raw data and data workup of assay for real-world brine sample. Brine sample was taken at the well head.

  7. Rock Sampling At San Juan Volcanic Field Area (Larson & Jr, 1986...

    Open Energy Info (EERE)

    Juan Volcanic Field Area (Larson & Jr, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Rock Sampling At San Juan Volcanic Field Area...

  8. UMTRA project water sampling and analysis plan, Riverton, Wyoming

    SciTech Connect (OSTI)

    Not Available

    1994-03-01

    Surface remediation was completed at the former uranium mill site in Riverton, Wyoming, in 1990. Residual radioactive materials (contaminated soil and debris) were removed and disposed of at Union Carbide Corporation`s (Umetco) nearby Gas Hills Title 2 facility. Ground water in the surficial and semiconfined aquifers (known collectively as the `uppermost aquifer`) below the former mill and tailings site has been contaminated. No contamination has been detected in the deeper, confined sandstone aquifer. The contaminant plume extends off site to the south and east. The plume is constrained by surface wetlands and small streams to the east and west of the site and by the Little Wind River to the south. Fifteen monitor wells installed in 1993 were sampled to better define the contaminant plume and to provide additional water quality data for the baseline risk assessment. Samples also were collected from domestic wells in response to a request by the Wyoming Department of Environmental Quality in January 1994. No contamination attributable to the former uranium milling operations have ever been detected in any of the domestic wells used for potable supplies.

  9. ARM - Field Campaign - Water Vapor IOP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Water Vapor IOP ... Responses to Site Operations Questionnaires for Water Vapor IOP Instrument Name Instrument ...

  10. ARM - Field Campaign - Water Vapor IOP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govCampaignsWater Vapor IOP ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Water Vapor IOP 2000.09.18 - 2000.10.08 Lead Scientist : Henry Revercomb For data sets, see below. Abstract Scientific hypothesis: 1. Microwave radiometer (MWR) observations of the 22 GHz water vapor line can accurately constrain the total column amount of water vapor (assuming a calibration accuracy of 0.5 degC or better, which

  11. Water Quality Sampling Locations Along the Shoreline of the Columbia River, Hanford Site, Washington

    SciTech Connect (OSTI)

    Peterson, Robert E.; Patton, Gregory W.

    2009-12-14

    As environmental monitoring evolved on the Hanford Site, several different conventions were used to name or describe location information for various sampling sites along the Hanford Reach of the Columbia River. These methods range from handwritten descriptions in field notebooks to the use of modern electronic surveying equipment, such as Global Positioning System receivers. These diverse methods resulted in inconsistent archiving of analytical results in various electronic databases and published reports because of multiple names being used for the same site and inaccurate position data. This document provides listings of sampling sites that are associated with groundwater and river water sampling. The report identifies names and locations for sites associated with sampling: (a) near-river groundwater using aquifer sampling tubes; (b) riverbank springs and springs areas; (c) pore water collected from riverbed sediment; and (d) Columbia River water. Included in the listings are historical names used for a particular site and the best available geographic coordinates for the site, as of 2009. In an effort to create more consistency in the descriptive names used for water quality sampling sites, a naming convention is proposed in this document. The convention assumes that a unique identifier is assigned to each site that is monitored and that this identifier serves electronic database management requirements. The descriptive name is assigned for the convenience of the subsequent data user. As the historical database is used more intensively, this document may be revised as a consequence of discovering potential errors and also because of a need to gain consensus on the proposed naming convention for some water quality monitoring sites.

  12. Field Sampling Plan for the Distler Brickyard Superfund Site, Hardin County, Kentucky

    SciTech Connect (OSTI)

    J. P. Martin; L. N. Peterson; C. J. Taylor

    1999-08-01

    This plan describes the field and analytical activities to be conducted at the Distler Brickyard Superfund Site, Hardin County, Kentucky, in order to evaluate natural attenuation processes within the aquifer system. Sampling will consist of a single round to take place in October 1999. Analytes will consist of the contaminants of concern (chlorinated aliphatic hydrocarbons), electron donors (non-chlorinated organic compounds), oxidation-reduction indicators, and water quality parameters. These activities are conducted in order to evaluate the water quality parameters. These activities are conducted in order to evaluate the extent to which natural attenuation processes, in the form of anaerobic reductive dechlorination, may be taking place in the aquifer system. These data will then be used to select the appropriate remediation technology for this site.

  13. Water-Gas Samples At Fenton Hill Hdr Geothermal Area (Goff &...

    Open Energy Info (EERE)

    Water-Gas Samples At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002) Redirect page Jump to: navigation, search REDIRECT Surface Gas Sampling At Fenton Hill Hdr Geothermal...

  14. Sediment and radionuclide transport in rivers. Summary report, field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect (OSTI)

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-11-01

    A three-phase field sampling program was conducted on the Buttermilk-Cattaraugus Creek system to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Phase 1 of the sampling program was conducted during November and December 1977; Phase 2 during September 1978; and Phase 3 during April 1979. Bed sediment, suspended sediment, and water samples were collected over a 45-mile reach of the creek system. Bed sediment samples were also collected at the mouth of Cattaraugus Creek in Lake Erie. A fourth sampling trip was conducted during May 1980 to obtain supplementary channel geometry data and flood plain sediment samples. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239,240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, CS-134, Co-60, Pu-238, Pu-239,240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks.

  15. TRITIUM UNCERTAINTY ANALYSIS FOR SURFACE WATER SAMPLES AT THE SAVANNAH RIVER SITE

    SciTech Connect (OSTI)

    Atkinson, R.

    2012-07-31

    Radiochemical analyses of surface water samples, in the framework of Environmental Monitoring, have associated uncertainties for the radioisotopic results reported. These uncertainty analyses pertain to the tritium results from surface water samples collected at five locations on the Savannah River near the U.S. Department of Energy's Savannah River Site (SRS). Uncertainties can result from the field-sampling routine, can be incurred during transport due to the physical properties of the sample, from equipment limitations, and from the measurement instrumentation used. The uncertainty reported by the SRS in their Annual Site Environmental Report currently considers only the counting uncertainty in the measurements, which is the standard reporting protocol for radioanalytical chemistry results. The focus of this work is to provide an overview of all uncertainty components associated with SRS tritium measurements, estimate the total uncertainty according to ISO 17025, and to propose additional experiments to verify some of the estimated uncertainties. The main uncertainty components discovered and investigated in this paper are tritium absorption or desorption in the sample container, HTO/H{sub 2}O isotopic effect during distillation, pipette volume, and tritium standard uncertainty. The goal is to quantify these uncertainties and to establish a combined uncertainty in order to increase the scientific depth of the SRS Annual Site Environmental Report.

  16. Gasbuggy, New Mexico, Natural Gas and Produced Water Sampling and Analysis Results for 2011

    SciTech Connect (OSTI)

    2011-09-01

    The U.S. Department of Energy (DOE) Office of Legacy Management conducted natural gas sampling for the Gasbuggy, New Mexico, site on June 7 and 8, 2011. Natural gas sampling consists of collecting both gas samples and samples of produced water from gas production wells. Water samples from gas production wells were analyzed for gamma-emitting radionuclides, gross alpha, gross beta, and tritium. Natural gas samples were analyzed for tritium and carbon-14. ALS Laboratory Group in Fort Collins, Colorado, analyzed water samples. Isotech Laboratories in Champaign, Illinois, analyzed natural gas samples.

  17. Sediment and radionuclide transport in rivers. Phase 3. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect (OSTI)

    Ecker, R.M.; Walters, W.H.; Onishi, Y.

    1982-08-01

    A field sampling program was conducted on Cattaraugus and Buttermilk Creeks, New York during April 1979 to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Bed sediment, suspended sediment and water samples were collected during unsteady flow conditions over a 45 mile reach of stream channel. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239, 240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, Cs-134, Co-60, Pu-238, Pu-239, 240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks. This field sampling effort was the last of a three phase program to collect hydrologic and radiologic data at different flow conditions.

  18. June 2015 Groundwater and Surface Water Sampling at the Green...

    Office of Legacy Management (LM)

    ... DVP-June 2015, Green River, Utah U.S. Department of Energy RIN 15067102 August 2015 Page 12 Inductively Coupled Plasma Interference Check Sample Analysis Interference check samples ...

  19. Diffusion Multilayer Sampling of Ground Water in Five Wells at...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Analysis of MSE Cores Tuba City, Arizona, Site Analysis of Contaminant Rebound in Ground Water in Extraction Wells at the Tuba City, Arizona, Site Vertical Distribution of ...

  20. 384 Power plant waste water sampling and analysis plan

    SciTech Connect (OSTI)

    Hagerty, K.J.; Knotek, H.M.

    1995-01-01

    This document presents the 384 Power House Sampling and Analysis Plan. The Plan describes sampling methods, locations, frequency, analytes, and stream descriptions. The effluent streams from 384, were characterized in 1989, in support of the Stream Specific Report (WHC-EP-0342, Addendum 1).

  1. Water frac applications in high island 384 field

    SciTech Connect (OSTI)

    Claiborne, E.B. Jr.; Saucier, R.; Wilkinson, T.W.

    1996-12-31

    A frac pack technique using water, herein referred to as a water frac, has been developed for use in wells where the goal is to achieve effective sand control at minimal cost while bypassing wellbore skin thus increasing well productivities. This increased productivity is accomplished by a properly designed, length limited, hydraulic fracture, created and propped with non-damaging fluid/prop that provides a highly conductive flow path through the wellbore damaged zone, in conjunction with a proper gravel packed completion. The process is applicable to intervals comprised of multiple pay zones by using a multi-stage water frac technique. The entire process of creating and packing the fracture(s) and gravel packing is accomplished using a properly defined gel free brine. The multi-stage water frac process has been applied and evaluated in the High Island 384 Field. Job evaluations herein illustrate the process. The process has also been applied using uncrosslinked gelled fluids in this field as well, with the evaluations to date indicating the water frac results to be superior. Comparisons with larger sized frac packs in a similar area also indicate the water fracs to be equal or superior to the frac packs in well performance. In the following, the process of a water frac will be described, typical field pumping techniques will be provided and field applications and results will be presented.

  2. Gasbuggy, New Mexico, Natural Gas and Produced Water Sampling Results for 2012

    SciTech Connect (OSTI)

    2012-12-01

    The U.S. Department of Energy (DOE) Office of Legacy Management conducted annual natural gas sampling for the Gasbuggy, New Mexico, Site on June 20 and 21, 2012. This long-term monitoring of natural gas includes samples of produced water from gas production wells that are located near the site. Water samples from gas production wells were analyzed for gamma-emitting radionuclides, gross alpha, gross beta, and tritium. Natural gas samples were analyzed for tritium and carbon-14. ALS Laboratory Group in Fort Collins, Colorado, analyzed water samples. Isotech Laboratories in Champaign, Illinois, analyzed natural gas samples.

  3. Structures of water molecules in carbon nanotubes under electric fields

    SciTech Connect (OSTI)

    Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji

    2015-03-28

    Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate.

  4. Operable Unit 3-13, Group 3, Other Surface Soils (Phase II) Field Sampling Plan

    SciTech Connect (OSTI)

    G. L. Schwendiman

    2006-07-27

    This Field Sampling Plan describes the Operable Unit 3-13, Group 3, Other Surface Soils, Phase II remediation field sampling activities to be performed at the Idaho Nuclear Technology and Engineering Center located within the Idaho National Laboratory Site. Sampling activities described in this plan support characterization sampling of new sites, real-time soil spectroscopy during excavation, and confirmation sampling that verifies that the remedial action objectives and remediation goals presented in the Final Record of Decision for Idaho Nuclear Technology and Engineering Center, Operable Unit 3-13 have been met.

  5. Final Report for ARM Project Measuring 4-D Water Vapor Fields with GPS

    SciTech Connect (OSTI)

    Braun, John

    2006-02-06

    Water vapor is a primary element in the Earth’s climate system. Atmospheric water vapor is central to cloud processes, radiation transfer, and the hydrological cycle. Using funding from Department of Energy (DOE) grant DE-FG03-02ER63327, the University Corporation for Atmospheric Research (UCAR) developed new observational techniques to measure atmospheric water vapor and applied these techniques to measure four dimensional water vapor fields throughout the United States Southern Great Plains region. This report summarizes the development of a new observation from ground based Global Positioning System (GPS) stations called Slant Water Vapor (SW) and it’s utilization in retrieving four dimensional water vapor fields. The SW observation represents the integrated amount of water vapor between a GPS station and a transmitting satellite. SW observations provide improved temporal and spatial sampling of the atmosphere when compared to column-integrated quantities such as preciptitable water vapor (PW). Under funding from the DOE Atmospheric Radiation Measurement (ARM) program, GPS networks in the Southern Great Plains (SGP) region were deployed to retrieve SW to improve the characterization of water vapor throughout the region. These observations were used to estimate four dimensional water vapor fields using tomographic approaches and through assimilation into the MM5 numerical weather model.

  6. UMTRA Project water sampling and analysis plan, Grand Junction, Colorado. Revision 1, Version 6

    SciTech Connect (OSTI)

    1995-09-01

    This water sampling and analysis plan describes the planned, routine ground water sampling activities at the Grand Junction US DOE Uranium Mill Tailings Remedial Action (UMTRA) Project site (GRJ-01) in Grand Junction, Colorado, and at the Cheney Disposal Site (GRJ-03) near Grand Junction. The plan identifies and justifies the sampling locations, analytical parameters, detection limits, and sampling frequencies for the routine monitoring stations at the sites. Regulatory basis is in the US EPA regulations in 40 CFR Part 192 (1994) and EPA ground water quality standards of 1995 (60 FR 2854). This plan summarizes results of past water sampling activities, details water sampling activities planned for the next 2 years, and projects sampling activities for the next 5 years.

  7. June 2011 Natural Gas and Produced Water Sampling at the Gasbuggy, New Mexico, Site

    SciTech Connect (OSTI)

    2011-10-01

    Annual natural gas and produced water monitoring was conducted for gas wells adjacent to Section 36, where the Gasbuggy test was conducted, in accordance with the draft Long-Term Surveillance and Maintenance Plan for the Gasbuggy Site, Rio Arriba County, New Mexico. Sampling and analysis were conducted as specified in the Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites (LMS/PLN/S04351, continually updated). Natural gas samples were collected for tritium and carbon-14 analyses. Produced water samples were collected and analyzed for tritium, gamma-emitting radionuclides (by high-resolution gamma spectrometry), gross alpha, and gross beta. A duplicate produced water sample was collected from well 30-039-21743. Produced water samples were not collected at locations 30-039-30161 and 30-039-21744 because of the lack of water. Samples were not collected from location 30-039-29988 because the well was shut-in.

  8. Water Sampling At Fenton Hill HDR Geothermal Area (Rao, Et Al...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Fenton Hill HDR Geothermal Area (Rao, Et Al., 1996) Exploration Activity...

  9. Water Sampling At Jemez Springs Area (Rao, Et Al., 1996) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Jemez Springs Area (Rao, Et Al., 1996) Exploration Activity Details...

  10. Water Sampling At Coso Geothermal Area (1977-1978) | Open Energy...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Coso Geothermal Area (1977-1978) Exploration Activity Details Location...

  11. Water Sampling At Silver Peak Area (Henkle, Et Al., 2005) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Silver Peak Area (Henkle, Et Al., 2005) Exploration Activity Details...

  12. Water-Gas Samples At Long Valley Caldera Geothermal Area (Farrar...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water-Gas Samples At Long Valley Caldera Geothermal Area (Farrar, Et Al., 2003) Exploration...

  13. Water-Gas Sampling At Fenton Hill HDR Geothermal Area (Janik...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water-Gas Sampling At Fenton Hill HDR Geothermal Area (Janik & Goff, 2002) Exploration...

  14. Water Sampling At Salt Wells Area (Henkle, Et Al., 2005) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Salt Wells Area (Henkle, Et Al., 2005) Exploration Activity Details...

  15. Water Sampling At Reese River Area (Henkle, Et Al., 2005) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Reese River Area (Henkle, Et Al., 2005) Exploration Activity Details...

  16. Water Sampling At Long Valley Caldera Geothermal Area (McKenzie...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Long Valley Caldera Geothermal Area (McKenzie & Truesdell, 1977)...

  17. Water Sampling At Jemez Springs Area (Goff, Et Al., 1981) | Open...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Jemez Springs Area (Goff, Et Al., 1981) Exploration Activity Details...

  18. Water Sampling At Hot Lake Area (Wood, 2002) | Open Energy Information

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Hot Lake Area (Wood, 2002) Exploration Activity Details Location Hot Lake...

  19. Water Sampling At Belknap-Foley-Bigelow Hot Springs Area (Wood...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Belknap-Foley-Bigelow Hot Springs Area (Wood, 2002) Exploration Activity...

  20. Water Sampling At Twenty-Nine Palms Area (Page, Et Al., 2010...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Twenty-Nine Palms Area (Page, Et Al., 2010) Exploration Activity Details...

  1. 400 area secondary cooling water sampling and analysis plan

    SciTech Connect (OSTI)

    Penn, L.L.

    1996-10-29

    This is a total rewrite of the Sampling and Analysis Plan in response to, and to ensure compliance with, the State Waste Discharge Permit ST 4501 issued on July 31, 1996. This revision describes changes in facility status and implements requirements of the permit.

  2. July 2010 Natural Gas and Produced Water Sampling at the Gasbuggy, New Mexico, Site

    SciTech Connect (OSTI)

    2011-01-01

    Annual natural gas and produced water monitoring was conducted for gas wells adjacent to Section 36, where the Gasbuggy test was conducted, in accordance with the draft Long-Term Surveillance and Maintenance Plan for the Gasbuggy Site, Rio Arriba County, New Mexico. Sampling and analysis was conducted as specified in the Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites. (LMS/PLN/S04351, continually updated). Natural gas samples were collected for tritium and carbon-14 analysis. Produced water samples were collected and analyzed for tritium, gamma-emitting radionuclides (by high-resolution gamma spectrometry), gross alpha, and gross beta. An additional water sample was collected from well 29-6 Water Hole for analysis of tritium and gamma-emitting radionuclides. A duplicate produced water sample was collected from well 30-039-21743.

  3. ARM - Field Campaign - ARM-FIRE Water Vapor Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govCampaignsARM-FIRE Water Vapor Experiment ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : ARM-FIRE Water Vapor Experiment 2000.11.01 - 2000.12.31 Lead Scientist : Henry Revercomb Data Availability Yes For data sets, see below. Summary This field mission experience indicated that it is possible for several sensors to be used in a coordinated fashion over a period of several weeks to achieve a mean water

  4. A suspended-particle rosette multi-sampler for discrete biogeochemical sampling in low-particle-density waters

    SciTech Connect (OSTI)

    Breier, J. A.; Rauch, C. G.; McCartney, K.; Toner, B. M.; Fakra, S. C.; White, S. N.; German, C. R.

    2010-06-22

    To enable detailed investigations of early stage hydrothermal plume formation and abiotic and biotic plume processes we developed a new oceanographic tool. The Suspended Particulate Rosette sampling system has been designed to collect geochemical and microbial samples from the rising portion of deep-sea hydrothermal plumes. It can be deployed on a remotely operated vehicle for sampling rising plumes, on a wire-deployed water rosette for spatially discrete sampling of non-buoyant hydrothermal plumes, or on a fixed mooring in a hydrothermal vent field for time series sampling. It has performed successfully during both its first mooring deployment at the East Pacific Rise and its first remotely-operated vehicle deployments along the Mid-Atlantic Ridge. It is currently capable of rapidly filtering 24 discrete large-water-volume samples (30-100 L per sample) for suspended particles during a single deployment (e.g. >90 L per sample at 4-7 L per minute through 1 {mu}m pore diameter polycarbonate filters). The Suspended Particulate Rosette sampler has been designed with a long-term goal of seafloor observatory deployments, where it can be used to collect samples in response to tectonic or other events. It is compatible with in situ optical sensors, such as laser Raman or visible reflectance spectroscopy systems, enabling in situ particle analysis immediately after sample collection and before the particles alter or degrade.

  5. TYPICAL HOT WATER DRAW PATTERNS BASED ON FIELD DATA

    SciTech Connect (OSTI)

    Lutz, Jim; Melody, Moya

    2012-11-08

    There is significant variation in hot water use and draw patterns among households. This report describes typical hot water use patterns in single-family residences in North America. We found that daily hot water use is highly variable both among residences and within the same residence. We compared the results of our analysis of the field data to the conditions and draw patterns established in the current U.S. Department of Energy (DOE) test procedure for residential water heaters. The results show a higher number of smaller draws at lower flow rates than used in the test procedure. The data from which the draw patterns were developed were obtained from 12 separate field studies. This report describes the ways in which we managed, cleaned, and analyzed the data and the results of our data analysis. After preparing the data, we used the complete data set to analyze inlet and outlet water temperatures. Then we divided the data into three clusters reflecting house configurations that demonstrated small, medium, or large median daily hot water use. We developed the three clusters partly to reflect efforts of the ASHRAE standard project committee (SPC) 118.2 to revise the test procedure for residential water heaters to incorporate a range of draw patterns. ASHRAE SPC 118.2 has identified the need to separately evaluate at least three, and perhaps as many as five, different water heater capacities. We analyzed the daily hot water use data within each cluster in terms of volume and number of hot water draws. The daily draw patterns in each cluster were characterized using distributions for volume of draws, duration of draws, time since previous draw, and flow rates.

  6. Dark-field X-ray imaging of unsaturated water transport in porous materials

    SciTech Connect (OSTI)

    Yang, F. E-mail: michele.griffa@empa.ch; Di Bella, C.; Lura, P.; Prade, F.; Herzen, J.; Sarapata, A.; Pfeiffer, F.; Griffa, M. E-mail: michele.griffa@empa.ch; Jerjen, I.

    2014-10-13

    We introduce in this Letter an approach to X-ray imaging of unsaturated water transport in porous materials based upon the intrinsic X-ray scattering produced by the material microstructural heterogeneity at a length scale below the imaging system spatial resolution. The basic principle for image contrast creation consists in a reduction of such scattering by permeation of the porosity by water. The implementation of the approach is based upon X-ray dark-field imaging via Talbot-Lau interferometry. The proof-of-concept is provided by performing laboratory-scale dark-field X-ray radiography of mortar samples during a water capillary uptake experiment. The results suggest that the proposed approach to visualizing unsaturated water transport in porous materials is complementary to neutron and magnetic resonance imaging and alternative to standard X-ray imaging, the latter requiring the use of contrast agents because based upon X-ray attenuation only.

  7. DEVELOPMENT OF METHODOLOGY AND FIELD DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect (OSTI)

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-06-04

    This project developed methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of the fuel storage medium and determine the oxide thickness on the spent fuel basin materials. The overall objective of this project was to determine the amount of time fuel has spent in a storage basin to determine if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations. This project developed and validated forensic tools that can be used to predict the age and condition of spent nuclear fuels stored in liquid basins based on key physical, chemical and microbiological basin characteristics. Key parameters were identified based on a literature review, the parameters were used to design test cells for corrosion analyses, tools were purchased to analyze the key parameters, and these were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The key parameters identified in the literature review included chloride concentration, conductivity, and total organic carbon level. Focus was also placed on aluminum based cladding because of their application to weapons production. The literature review was helpful in identifying important parameters, but relationships between these parameters and corrosion rates were not available. Bench scale test systems were designed, operated, harvested, and analyzed to determine corrosion relationships between water parameters and water conditions, chemistry and microbiological conditions. The data from the bench scale system indicated that corrosion rates were dependent on total organic carbon levels and chloride concentrations. The highest corrosion rates were observed in test cells amended with sediment, a large microbial inoculum and an organic carbon source. A complete characterization test kit was field tested to characterize the SRS L-Area spent fuel basin. The sampling kit consisted of a TOC analyzer, a YSI

  8. Field Performance of Heat Pump Water Heaters in the Northeast

    SciTech Connect (OSTI)

    Shapiro, C.; Puttagunta, S.

    2013-08-01

    Heat pump water heaters (HPWHs) are finally entering the mainstream residential water heater market. Potential catalysts are increased consumer demand for higher energy efficiency electric water heating and a new Federal water heating standard that effectively mandates use of HPWHs for electric storage water heaters with nominal capacities greater than 55 gallons. When compared to electric resistance water heating, the energy and cost savings potential of HPWHs is tremendous. Converting all electric resistance water heaters to HPWHs could save American consumers 7.8 billion dollars annually ($182 per household) in water heating operating costs and cut annual residential source energy consumption for water heating by 0.70 quads. Steven Winter Associates, Inc. embarked on one of the first in situ studies of these newly released HPWH products through a partnership with two sponsoring electric utility companies, National Grid and NSTAR, and one sponsoring energy efficiency service program administrator, Cape Light Compact. Recent laboratory studies have measured performance of HPWHs under various operating conditions, but publicly available field studies have not been as available. This evaluation attempts to provide publicly available field data on new HPWHs by monitoring the performance of three recently released products (General Electric GeoSpring(tm), A.O. Smith Voltex(r), and Stiebel Eltron Accelera(r)300). Fourteen HPWHs were installed in Massachusetts and Rhode Island and monitored for over a year. Of the 14 units, ten were General Electric models (50 gallon units), two were Stiebel Eltron models (80 gallon units), and two were A.O. Smith models (one 60-gallon and one 80-gallon unit).

  9. September 2015 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal Site

    Office of Legacy Management (LM)

    Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal Site February 2016 LMS/SHP/S00915 This page intentionally left blank U.S. Department of Energy DVP-September 2015, Shiprock, New Mexico February 2016 RINs 15097348 and 15097349 Page i Contents Sampling Event Summary ...............................................................................................................1 Planned Sampling Map Shiprock, New Mexico, Disposal Site

  10. January 2016 Groundwater and Surface Water Sampling at the Grand Junction, Colorado, Processing Site

    Office of Legacy Management (LM)

    6 Groundwater and Surface Water Sampling at the Grand Junction, Colorado, Processing Site March 2016 LMS/GJT/S00116 This page intentionally left blank U.S. Department of Energy DVP-January 2016, Grand Junction, Colorado March 2016 RIN 15127576 Page i Contents Sampling Event Summary ...............................................................................................................1 Grand Junction, Colorado, Processing Site, Sample Location Map

  11. November 2015 Groundwater and Surface Water Sampling at the Old and New Rifle, Colorado, Processing Sites

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Old and New Rifle, Colorado, Processing Sites February 2016 LMS/RFN/RFO/S01115 This page intentionally left blank U.S. Department of Energy DVP-November 2015, Rifle, Colorado February 2016 RINs 15107463 and 15107464 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Planned Sampling Map

  12. Sediment and radionuclide transport in rivers. Phase 2. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect (OSTI)

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-04-01

    As part of a study on sediment and radionuclide transport in rivers, Pacific Northwest Laboratory (PNL) is investigating the effect of sediment on the transport of radionuclides in Cattaraugus and Buttermilk Creeks, New York. A source of radioactivity in these creeks is the Western New York Nuclear Service Center which consists of a low-level waste disposal site and a nuclear fuel reprocessing plant. Other sources of radioactivity include fallout from worldwide weapons testing and natural background radioactivity. The major objective of the PNL Field Sampling Program is to provide data on sediment and radionuclide characteristics in Cattaraugus and Buttermilk Creeks to verify the use of the Sediment and Radionuclide Transport model, SERATRA, for nontidal rivers. This report covers the results of field data collection conducted during September 1978. Radiological analysis of sand, silt, and clay size fractions of suspended and bed sediment, and water were performed. Results of these analyses indicate that the principal radionuclides occurring in these two water courses, with levels significantly higher than background levels, during the Phase 2 sampling program were Cesium-137 and Strontium-90. These radionuclides had significantly higher activity levels above background in the bed sediment, suspended sediment, and water samples. Other radionuclides that are possibly being released into the surface water environment by the Nuclear Fuel Services facilities are Plutonium-238, 239, and 240, Americium-241, Curium-244, and Tritium. More radionuclides were consistently found in the bed sediment as compared to suspended sediment. The fewest radionuclides were found in the water of Buttermilk and Cattaraugus Creeks. The higher levels were found in the bed sediments for the gamma-emitters and in the suspended sediment for the alpha and beta-emitters (not including Tritium).

  13. Measurement of radon concentration in some water samples belonging to some adjoining areas of Pathankot, Punjab

    SciTech Connect (OSTI)

    Kumar, Ajay Sharma, Sumit

    2015-08-28

    The study of radon concentration was measured in some areas of Pathankot district, Punjab, India, from the health hazard point of view due to radon. The exposure to radon through drinking water is largely by inhalation and ingestion. RAD 7, an electronic solid state silicon detector (Durridgeco., USA) was used to measure the radon concentration in drinking water samples of the study area. The recorded values of radon concentration in these water samples are below the recommended limit by UNSCEAR and European commission. The recommended limit of radon concentration in water samples is 4 to 40 Bq/l given by UNSCEAR [1] and European commission has recommended the safe limit for radon concentration in water sample is 100 Bq/l [2].

  14. Field sampling and selecting on-site analytical methods for explosives in soil

    SciTech Connect (OSTI)

    Crockett, A.B.; Craig, H.D.; Jenkins, T.F.; Sisk, W.E.

    1996-12-01

    A large number of defense-related sites are contaminated with elevated levels of secondary explosives. Levels of contamination range from barely detectable to levels above 10% that need special handling because of the detonation potential. Characterization of explosives-contaminated sites is particularly difficult because of the very heterogeneous distribution of contamination in the environment and within samples. To improve site characterization, several options exist including collecting more samples, providing on-site analytical data to help direct the investigation, compositing samples, improving homogenization of the samples, and extracting larger samples. This publication is intended to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods for detecting and quantifying secondary explosive compounds in soils, and is not intended to include discussions of the safety issues associated with sites contaminated with explosive residues.

  15. UMTRA project water sampling and analysis plan, Naturita, Colorado. Revision 1

    SciTech Connect (OSTI)

    1995-09-01

    Planned, routine ground water sampling activities for calendar year 1995 to 1997 at the US Department of Energy (DOE) Uranium Mill Tailings Remedial Action (UMTRA) Project site near Naturita, Colorado, are described in this water sampling and analysis plan. The following plan identifies and justifies the sampling locations, analytical parameters, detection limits, sampling frequency, and specific rationale for each routine monitoring station at the site. The regulatory basis for routine ground water monitoring at UMTRA Project sites is derived from the US Environmental Protection Agency (EPA) regulations in 40 CFR Part 192. Sampling procedures are guided by the UMTRA Project standard operating procedures (SOP) (JEG, n.d.), the Technical Approach Document (TAD) (DOE, 1989), and the most effective technical approach for the site.

  16. July 2015 Groundwater and Surface Water Sampling at the Naturita, Colorado, Processing Site

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Naturita, Colorado, Processing Site October 2015 LMS/NAP/S00715 This page intentionally left blank U.S. Department of Energy DVP-July 2015, Naturita, Colorado October 2015 RIN 15077222 Page i Contents Sampling Event Summary ...............................................................................................................1 Data Assessment Summary

  17. May 2013 Groundwater and Surface Water Sampling at the Rio Blanco, Colorado, Site (Data Validation Package)

    SciTech Connect (OSTI)

    2013-10-01

    Annual sampling was conducted at the Rio Blanco, Colorado, site for the Long-Term Hydrologic Monitoring Program May 14-16, 2013, to monitor groundwater and surface water for potential radionuclide contamination. Sampling and analyses were conducted as specified in Sampling and Analysis Plan for the U.S. Department of Energy Office of Legacy Management Sites (LMS/PRO/S04351, continually updated). A duplicate sample was collected from location CER #1 Black Sulphur. Samples were analyzed for gamma-emitting radionuclides by high-resolution gamma spectrometry and for tritium using the conventional and enrichment methods.

  18. May 2011 Groundwater and Surface Water Sampling at the Rio Blanco, Colorado, Site (Data Validation Package)

    SciTech Connect (OSTI)

    2011-12-01

    Annual sampling was conducted at the Rio Blanco, Colorado, site for the Long-Term Hydrologic Monitoring Program May 16-17, 2011, to monitor groundwater and surface water for potential radionuclide contamination. Sampling and analyses were conducted as specified in Sampling and Analysis Plan for the U.S. Department of Energy Office of Legacy Management Sites (LMS/PRO/S04351, continually updated). A duplicate sample was collected from location Johnson Artesian WL. Samples were analyzed by the U.S. Environmental Protection Agency (EPA) Radiation&Indoor Environments National Laboratory in Las Vegas, Nevada. Samples were analyzed for gamma-emitting radionuclides by high-resolution gamma spectrometry, and for tritium using the conventional method. Tritium was not measured using the enrichment method because the EPA laboratory no longer offers that service. Results of this monitoring at the Rio Blanco site demonstrate that groundwater and surface water outside the boundaries have not been affected by project-related contaminants.

  19. Analysis of core soil and water samples from the Cactus Crater Disposal Site at Enewetak atoll

    SciTech Connect (OSTI)

    Robison, W.L.; Noshkin, V.E.

    1981-02-18

    Core soil samples and water samples were collected from the Cactus Crater Disposal Site at Enewetak for analysis of /sup 137/Cs, /sup 90/Sr, /sup 239 +240/Pu and /sup 241/Am by both gamma spectroscopy and, through a contractor laboratory, by wet chemistry procedures. The samples processing methods, the analytical methods and the analytical quality control are all procedures developed for the continuing Marshall Island radioecology and dose assessment work.

  20. Aqueous Processing of Atmospheric Organic Particles in Cloud Water Collected via Aircraft Sampling

    SciTech Connect (OSTI)

    Boone, Eric J.; Laskin, Alexander; Laskin, Julia; Wirth, Christopher; Shepson, Paul B.; Stirm, Brian H.; Pratt, Kerri A.

    2015-07-21

    Cloud water and below-cloud atmospheric particle samples were collected onboard a research aircraft during the Southern Oxidant and Aerosol Study (SOAS) over a forested region of Alabama in June 2013. The organic molecular composition of the samples was studied to gain insights into the aqueous-phase processing of organic compounds within cloud droplets. High resolution mass spectrometry with nanospray desorption electrospray ionization and direct infusion electrospray ionization were utilized to compare the organic composition of the particle and cloud water samples, respectively. Isoprene and monoterpene-derived organosulfates and oligomers were identified in both the particles and cloud water, showing the significant influence of biogenic volatile organic compound oxidation above the forested region. While the average O:C ratios of the organic compounds were similar between the atmospheric particle and cloud water samples, the chemical composition of these samples was quite different. Specifically, hydrolysis of organosulfates and formation of nitrogen-containing compounds were observed for the cloud water when compared to the atmospheric particle samples, demonstrating that cloud processing changes the composition of organic aerosol.

  1. May 2012 Groundwater and Surface Water Sampling at the Rio Blanco, Colorado, Site (Data Validation Package)

    SciTech Connect (OSTI)

    2012-12-01

    Annual sampling was conducted at the Rio Blanco, Colorado, site for the Long-Term Hydrologic Monitoring Program May 9-10, 2012, to monitor groundwater and surface water for potential radionuclide contamination. Sampling and analyses were conducted as specified in Sampling and Analysis Plan for the U.S. Department of Energy Office of Legacy Management Sites (LMS/PRO/S04351, continually updated). A duplicate sample was collected from location Johnson Artesian WL. Samples were analyzed for gamma-emitting radionuclides by high-resolution gamma spectrometry and for tritium using the conventional and enrichment methods. Results of this monitoring at the Rio Blanco site demonstrate that groundwater and surface water outside the site boundaries have not been affected by project-related contaminants.

  2. Petrographic description of calcite/opal samples collected on field trip of December 5-9, 1992. Special report No. 7

    SciTech Connect (OSTI)

    Hill, C.A.; Schluter, C.M.

    1993-06-01

    This study is part of the research program of the Yucca Mountain Project intended to provide the State of Nevada with a detailed analysis and assessment of the water-deposited minerals of Yucca Mountain and adjacent regions. Forty-three separate stops were made and 203 samples were collected during the five days of the field trip. This report describes petrographic observations made on the calcite/opal samples.

  3. Groundwater Monitoring and Field Sampling Plan for Operable Unit 10-08

    SciTech Connect (OSTI)

    M. S. Roddy

    2007-05-01

    This plan describes the groundwater sampling and water level monitoring that will be conducted to evaluate contaminations in the Snake River Plain Aquifer entering and leaving the Idaho National Laboratory. The sampling and monitoring locations were selected to meet the data quality objectives detailed in this plan. Data for the Snake River Plain Aquifer obtained under this plan will be evaluated in the Operable Unit 10-08 Remedial Investigation/Feasibility Study report and will be used to support the Operable Unit 10-08 Sitewide groundwater model.

  4. Note: Versatile sample stick for neutron scattering experiments in high electric fields

    SciTech Connect (OSTI)

    Bartkowiak, M., E-mail: marek.bartkowiak@psi.ch [Laboratory for Developments and Methods, Paul Scherrer Institut, CH-5232 Villigen (Switzerland); White, J. S. [Laboratory for Neutron Scattering, Paul Scherrer Institut, CH-5232 Villigen (Switzerland) [Laboratory for Neutron Scattering, Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Laboratory for Quantum Magnetism, Ecole Polytechnique Fdrale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Rnnow, H. M.; Pra, K. [Laboratory for Quantum Magnetism, Ecole Polytechnique Fdrale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)] [Laboratory for Quantum Magnetism, Ecole Polytechnique Fdrale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2014-02-15

    We present a versatile high voltage sample stick that fits into all cryomagnets and standard cryostats at the Swiss Spallation Neutron Source, Paul Scherrer Institut, and which provides a low effort route to neutron scattering experiments that combine electric field with low temperature and magnetic field. The stick allows for voltages up to 5 kV and can be easily adapted for different scattering geometries. We discuss the design consideration and thermal behavior of the stick, and give one example to showcase the abilities of the device.

  5. Field Testing of Pre-Production Prototype Residential Heat Pump Water

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Heaters | Department of Energy Field Testing of Pre-Production Prototype Residential Heat Pump Water Heaters Field Testing of Pre-Production Prototype Residential Heat Pump Water Heaters Provides and overview of field testing of 18 pre-production prototype residential heat pump water heaters heat_pump_water_heater_testing.pdf (565.45 KB) More Documents & Publications Building America Technology Solutions for New and Existing Homes: Performance of a Heat Pump Water Heater in the Hot-Humid

  6. Flow injection sample pretreatment in the determination of trace elements in waters by atomic spectrometry

    SciTech Connect (OSTI)

    Tyson, J.F.

    1995-12-31

    Flow injection (FI) techniques are a way of automating sampling pretreatment procedures with direct coupling to the instrument. For a variety of reasons, flame atomic absorption spectrometry (FAAS) would be the method of choice for the determination of trace elements in water samples were it not for some of the inherent limitations of this technique. These limitations are concerned with the various interferences that arise from matrix components and with the atom number density in the source. This together with the various noise sources sets detection limits which are not low enough for many applications. Thus many FI procedures are devised with the aim of overcoming these limitations and thus solid phase extraction (SPE) as a means of preconcentration features largely in recently published work. Results will be presented for the determination of trace elements in water samples (both fresh and saline) in which SPE procedures were used to (a) remove the potentially interfering sea-water matrix for determinations using ICP-MS and (b) preconcentrate cadmium from surface waters prior to determination by FAAS. Hydride generation methods have been applied for the determination of selenium and arsenic. In highly saline media the elevated recoveries of Se have been investigated and for the determination of As, an evaluation of the claim that the use of surfactants improves the performance of a flow based hydride generation system has critically evaluated.

  7. Simple method for highlighting the temperature distribution into a liquid sample heated by microwave power field

    SciTech Connect (OSTI)

    Surducan, V.; Surducan, E.; Dadarlat, D.

    2013-11-13

    Microwave induced heating is widely used in medical treatments, scientific and industrial applications. The temperature field inside a microwave heated sample is often inhomogenous, therefore multiple temperature sensors are required for an accurate result. Nowadays, non-contact (Infra Red thermography or microwave radiometry) or direct contact temperature measurement methods (expensive and sophisticated fiber optic temperature sensors transparent to microwave radiation) are mainly used. IR thermography gives only the surface temperature and can not be used for measuring temperature distributions in cross sections of a sample. In this paper we present a very simple experimental method for temperature distribution highlighting inside a cross section of a liquid sample, heated by a microwave radiation through a coaxial applicator. The method proposed is able to offer qualitative information about the heating distribution, using a temperature sensitive liquid crystal sheet. Inhomogeneities as smaller as 1°-2°C produced by the symmetry irregularities of the microwave applicator can be easily detected by visual inspection or by computer assisted color to temperature conversion. Therefore, the microwave applicator is tuned and verified with described method until the temperature inhomogeneities are solved.

  8. Rapid Column Extraction Method for Actinides and Sr-89/90 in Water Samples

    SciTech Connect (OSTI)

    MAXWELL III, SHERROD L.

    2005-06-15

    The SRS Environmental Laboratory analyzes water samples for environmental monitoring, including river water and ground water samples. A new, faster actinide and strontium 89/90 separation method has been developed and implemented to improve productivity, reduce labor costs and add capacity to this laboratory. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and Sr-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), curium (Cm) and thorium (Th) using a single multi-stage column combined with alpha spectrometry. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized. The method can be used for routine analysis or as a rapid method for emergency preparedness. Thorium and curium are often analyzed separately due to the interference of the daughter of Th-229 tracer, actinium (Ac)-225, on curium isotopes when measured by alpha spectrometry. This new method also adds a separation step using DGA Resin{reg_sign}, (Diglycolamide Resin, Eichrom Technologies) to remove Ac-225 and allow the separation and analysis of thorium isotopes and curium isotopes at the same time.

  9. ARM - Field Campaign - Water Cycle Pilot Study Intensive Observations

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    sets, see below. Abstract The U.S. DOE Water Cycle Pilot Study (WCPS) is a 3-year feasibility investigation focused on accurately evaluating the water cycle components and using...

  10. Quality assurance guidance for field sampling and measurement assessment plates in support of EM environmental sampling and analysis activities

    SciTech Connect (OSTI)

    Not Available

    1994-05-01

    This document is one of several guidance documents developed by the US Department of Energy (DOE) Office of Environmental Restoration and Waste Management (EM). These documents support the EM Analytical Services Program (ASP) and are based on applicable regulatory requirements and DOE Orders. They address requirements in DOE Orders by providing guidance that pertains specifically to environmental restoration and waste management sampling and analysis activities. DOE 5700.6C Quality Assurance (QA) defines policy and requirements to establish QA programs ensuring that risks and environmental impacts are minimized and that safety, reliability, and performance are maximized. This is accomplished through the application of effective management systems commensurate with the risks imposed by the facility and the project. Every organization supporting EM`s environmental sampling and analysis activities must develop and document a QA program. Management of each organization is responsible for appropriate QA program implementation, assessment, and improvement. The collection of credible and cost-effective environmental data is critical to the long-term success of remedial and waste management actions performed at DOE facilities. Only well established and management supported assessment programs within each EM-support organization will enable DOE to demonstrate data quality. The purpose of this series of documents is to offer specific guidance for establishing an effective assessment program for EM`s environmental sampling and analysis (ESA) activities.

  11. May and June 2015 Groundwater and Surface Water Sampling at the...

    Office of Legacy Management (LM)

    ... Inductively Coupled Plasma Interference Check Sample Analysis Interference check samples ... Inductively Coupled Plasma Interference Check Sample Analysis Interference check samples ...

  12. FIELD-DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect (OSTI)

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-09-12

    Methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of aqueous spent fuel storage basins and determine the oxide thickness on the spent fuel basin materials were developed to assess the corrosion potential of a basin. this assessment can then be used to determine the amount of time fuel has spent in a storage basin to ascertain if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations and assist in evaluating general storage basin operations. The test kit was developed based on the identification of key physical, chemical and microbiological parameters identified using a review of the scientific and basin operations literature. The parameters were used to design bench scale test cells for additional corrosion analyses, and then tools were purchased to analyze the key parameters. The tools were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The sampling kit consisted of a total organic carbon analyzer, an YSI multiprobe, and a thickness probe. The tools were field tested to determine their ease of use, reliability, and determine the quality of data that each tool could provide. Characterization confirmed that the L Area basin is a well operated facility with low corrosion potential.

  13. Hazard surveillance for workplace magnetic fields. 1: Walkaround sampling method for measuring ambient field magnitude; 2: Field characteristics from waveform measurements

    SciTech Connect (OSTI)

    Methner, M.M.; Bowman, J.D.

    1998-03-01

    Recent epidemiologic research has suggested that exposure to extremely low frequency (ELF) magnetic fields (MF) may be associated with leukemia, brain cancer, spontaneous abortions, and Alzheimer`s disease. A walkaround sampling method for measuring ambient ELF-MF levels was developed for use in conducting occupational hazard surveillance. This survey was designed to determine the range of MF levels at different industrial facilities so they could be categorized by MF levels and identified for possible subsequent personal exposure assessments. Industries were selected based on their annual electric power consumption in accordance with the hypothesis that large power consumers would have higher ambient MFs when compared with lower power consumers. Sixty-two facilities within thirteen 2-digit Standard Industrial Classifications (SIC) were selected based on their willingness to participate. A traditional industrial hygiene walkaround survey was conducted to identify MF sources, with a special emphasis on work stations.

  14. Rapid Method for Ra-226 and Ra-228 in Water Samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod, L. III

    2006-02-10

    The measurement of radium isotopes in natural waters is important for oceanographic studies and for public health reasons. Ra-226 (1620 year half-life) is one of the most toxic of the long-lived alpha emitters present in the environment due to its long life and its tendency to concentrate in bones, which increases the internal radiation dose of individuals. The analysis of radium-226 and radium-228 in natural waters can be tedious and time-consuming. Different sample preparation methods are often required to prepare Ra-226 and Ra-228 for separate analyses. A rapid method has been developed at the Savannah River Environmental Laboratory that effectively separates both Ra-226 and Ra-228 (via Ac-228) for assay. This method uses MnO{sub 2} Resin from Eichrom Technologies (Darien, IL, USA) to preconcentrate Ra-226 and Ra-228 rapidly from water samples, along with Ba-133 tracer. DGA Resin{reg_sign} (Eichrom) and Ln-Resin{reg_sign} (Eichrom) are employed in tandem to prepare Ra-226 for assay by alpha spectrometry and to determine Ra-228 via the measurement of Ac-228 by gas proportional counting. After preconcentration, the manganese dioxide is dissolved from the resin and passed through stacked Ln-Resin-DGA Resin cartridges that remove uranium and thorium interferences and retain Ac-228 on DGA Resin. The eluate that passed through this column is evaporated, redissolved in a lower acidity and passed through Ln-Resin again to further remove interferences before performing a barium sulfate microprecipitation. The Ac-228 is stripped from the resin, collected using cerium fluoride microprecipitation and counted by gas proportional counting. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  15. Investigation of the effects of various water mediums on desulfurization and deashing of a coal sample by flotation

    SciTech Connect (OSTI)

    Ayhan, F.D. [Dicle University, Diyarbakir (Turkey)

    2009-08-15

    The aim of this study was to investigate the effects of various water mediums on desulfurization and deashing of a coal sample using flotation. For this purpose, experimental studies were conducted on a coal sample containing high ash and sulfur contents. The effects of pH, solid concentration, collector amount and frother amount on the flotation were investigated separately in Mediterranean Sea water, Cermik thermal spring water, snow water and tap water. Flotation, results indicated that, when comparing the various water mediums, the following order for the ash content was obtained: snow water < Cermik thermal spring water < tap water < the Mediterranean Sea water. For the reduction of total sulfur, the following order was obtained: snow water > Cermik thermal spring water > Mediterranean Sea water > tap water. When snow water was used as a flotation medium, it was found that a concentrate containing 3.01% total sulfur and 27.64% ash with a total sulfur reduction of 57.06% was obtained from a feed containing 7.01% total sulfur and 4.1.17% ash.

  16. ARM - Field Campaign - Single Frequency GPS Water Vapor Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govCampaignsSingle Frequency GPS Water Vapor Network ARM Data Discovery Browse Data Comments? We would love to hear from you Send us a note below or call us at 1-888-ARM-DATA....

  17. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    SciTech Connect (OSTI)

    Armas-Perez, Julio C.; Londono-Hurtado, Alejandro; Guzman, Orlando; Hernandez-Ortiz, Juan P.; de Pablo, Juan J.

    2015-07-27

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  18. Site-Wide Integrated Water Monitoring -- Defining and Implementing Sampling Objectives to Support Site Closure

    SciTech Connect (OSTI)

    Wilborn, Bill; Marutzky, Sam; Knapp, Kathryn

    2013-02-24

    The Underground Test Area (UGTA) activity is responsible for assessing and evaluating the effects of the underground nuclear weapons tests on groundwater at the Nevada National Security Site (NNSS), formerly the Nevada Test Site (NTS), and implementing a corrective action closure strategy. The UGTA strategy is based on a combination of characterization, modeling studies, monitoring, and institutional controls (i.e., monitored natural attenuation). The closure strategy verifies through appropriate monitoring activities that contaminants of concern do not exceed the SDWA at the regulatory boundary and that adequate institutional controls are established and administered to ensure protection of the public. Other programs conducted at the NNSS supporting the environmental mission include the Routine Radiological Environmental Monitoring Program (RREMP), Waste Management, and the Infrastructure Program. Given the current programmatic and operational demands for various water-monitoring activities at the same locations, and the ever-increasing resource challenges, cooperative and collaborative approaches to conducting the work are necessary. For this reason, an integrated sampling plan is being developed by the UGTA activity to define sampling and analysis objectives, reduce duplication, eliminate unnecessary activities, and minimize costs. The sampling plan will ensure the right data sets are developed to support closure and efficient transition to long-term monitoring. The plan will include an integrated reporting mechanism for communicating results and integrating process improvements within the UGTA activity as well as between other U.S. Department of Energy (DOE) Programs.

  19. ARM - Field Campaign - Arctic Winter Water Vapor IOP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govCampaignsArctic Winter Water Vapor IOP ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Arctic Winter Water Vapor IOP 2004.03.09 - 2004.04.09 Lead Scientist : Ed Westwater Data Availability http://www.etl.noaa.gov/programs/2004/wviop/data will contain quicklooks of all of the data. For data sets, see below. Summary During the IOP, the Ground-based Scanning Radiometer of NOAA/ETL, and the ARM MicroWave

  20. Electric Field Effects on the Intermolecular Interactions in Water Whiskers: Insight from Structures, Energetics, and Properties

    SciTech Connect (OSTI)

    Bai, Yang; He, Hui-Min; Li, Ying; Zhou, Zhong-Jun; Wang, Jia-Jun; Wu, Di; Chen, Wei; Gu, Feng-Long; Sumpter, Bobby G.; Huang, Jingsong

    2015-02-19

    Modulation of intermolecular interactions in response to external electric fields could be fundamental to the formation of unusual forms of water, such as water whiskers. However, a detailed understanding of the nature of intermolecular interactions in such systems is lacking. In this study, we present novel theoretical results based on electron correlation calculations regarding the nature of H-bonds in water whiskers, which is revealed by studying their evolution under external electric fields with various field strengths. We find that the water whiskers consisting of 2-7 water molecules all have a chain-length dependent critical electric field. Under the critical electric field, the most compact chain structures are obtained, featuring very strong H-bonds, herein referred to as covalent H-bonds. In the case of a water dimer whisker, the bond length of the novel covalent H-bond shortens by 25%, the covalent bond order increases by 9 times, and accordingly the H-bond energy is strengthened by 5 times compared to the normal H-bond in a (H2O)2 cluster. Below the critical electric field, it is observed that with increasing field strength, H-bonding orbitals display gradual evolutions in the orbital energy, orbital ordering, and orbital nature (i.e., from typical -style orbital to unusual -style double H-bonding orbital). We also show that beyond the critical electric field, a single water whisker may disintegrate to form a loosely bound zwitterionic chain due to a relay-style proton transfer, whereas two water whiskers may undergo intermolecular cross-linking to form a quasi-two-dimensional water network. In conclusion, these results help shed new insight on the effects of electric fields on water whisker formation.

  1. Electric Field Effects on the Intermolecular Interactions in Water Whiskers: Insight from Structures, Energetics, and Properties

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bai, Yang; He, Hui-Min; Li, Ying; Zhou, Zhong-Jun; Wang, Jia-Jun; Wu, Di; Chen, Wei; Gu, Feng-Long; Sumpter, Bobby G.; Huang, Jingsong

    2015-02-19

    Modulation of intermolecular interactions in response to external electric fields could be fundamental to the formation of unusual forms of water, such as water whiskers. However, a detailed understanding of the nature of intermolecular interactions in such systems is lacking. In this study, we present novel theoretical results based on electron correlation calculations regarding the nature of H-bonds in water whiskers, which is revealed by studying their evolution under external electric fields with various field strengths. We find that the water whiskers consisting of 2-7 water molecules all have a chain-length dependent critical electric field. Under the critical electric field,more » the most compact chain structures are obtained, featuring very strong H-bonds, herein referred to as covalent H-bonds. In the case of a water dimer whisker, the bond length of the novel covalent H-bond shortens by 25%, the covalent bond order increases by 9 times, and accordingly the H-bond energy is strengthened by 5 times compared to the normal H-bond in a (H2O)2 cluster. Below the critical electric field, it is observed that with increasing field strength, H-bonding orbitals display gradual evolutions in the orbital energy, orbital ordering, and orbital nature (i.e., from typical -style orbital to unusual -style double H-bonding orbital). We also show that beyond the critical electric field, a single water whisker may disintegrate to form a loosely bound zwitterionic chain due to a relay-style proton transfer, whereas two water whiskers may undergo intermolecular cross-linking to form a quasi-two-dimensional water network. In conclusion, these results help shed new insight on the effects of electric fields on water whisker formation.« less

  2. Optimized Field Sampling and Monitoring of Airborne Hazardous Transport Plumes; A Geostatistical Simulation Approach

    SciTech Connect (OSTI)

    Chen, DI-WEN

    2001-11-21

    Airborne hazardous plumes inadvertently released during nuclear/chemical/biological incidents are mostly of unknown composition and concentration until measurements are taken of post-accident ground concentrations from plume-ground deposition of constituents. Unfortunately, measurements often are days post-incident and rely on hazardous manned air-vehicle measurements. Before this happens, computational plume migration models are the only source of information on the plume characteristics, constituents, concentrations, directions of travel, ground deposition, etc. A mobile ''lighter than air'' (LTA) system is being developed at Oak Ridge National Laboratory that will be part of the first response in emergency conditions. These interactive and remote unmanned air vehicles will carry light-weight detectors and weather instrumentation to measure the conditions during and after plume release. This requires a cooperative computationally organized, GPS-controlled set of LTA's that self-coordinate around the objectives in an emergency situation in restricted time frames. A critical step before an optimum and cost-effective field sampling and monitoring program proceeds is the collection of data that provides statistically significant information, collected in a reliable and expeditious manner. Efficient aerial arrangements of the detectors taking the data (for active airborne release conditions) are necessary for plume identification, computational 3-dimensional reconstruction, and source distribution functions. This report describes the application of stochastic or geostatistical simulations to delineate the plume for guiding subsequent sampling and monitoring designs. A case study is presented of building digital plume images, based on existing ''hard'' experimental data and ''soft'' preliminary transport modeling results of Prairie Grass Trials Site. Markov Bayes Simulation, a coupled Bayesian/geostatistical methodology, quantitatively combines soft information

  3. DEVELOPMENT AND FIELD IMPLEMENTATION OF AN IMPROVED METHOD FOR HEADSPACE GAS SAMPLING OF TRANSURANIC WASTE DRUMS

    SciTech Connect (OSTI)

    Polley, M.; Ankrom, J.; Wickland, T.; Warren, J.

    2003-02-27

    A fast, safe, and cost-effective method for obtaining headspace gas samples has been developed and implemented at Los Alamos National Laboratory (LANL). A sample port is installed directly into a drum lid using a pneumatic driver, allowing sampling with a side-port needle. Testing has shown that the sample port can be installed with no release of radioactive material. Use of this system at LANL has significantly reduced the time required for sampling, and eliminates the need for many safety precautions previously used. The system has significantly improved productivity and lowered radiation exposure and cost.

  4. Adsorptive Films in Support of In-field UF6 Destructive Assay Sample Collection and Analysis

    SciTech Connect (OSTI)

    Barrett, Christopher A.; Martinez, Alonzo; McNamara, Bruce K.; Cannon, Bret D.; Anheier, Norman C.

    2014-07-20

    International Atom Energy Agency (IAEA) safeguard verification measures in gaseous centrifuge enrichment plants (GCEPs) rely on environmental sampling, non-destructive assay (NDA), and destructive assay (DA) sampling and analysis to determine uranium enrichment. UF6 bias defect measurements are made by DA sampling and analysis to assure that enrichment is consistent with declarations. DA samples are collected from a limited number of cylinders for high precision, offsite mass spectrometer analysis. Samples are typically drawn from a sampling tap into a UF6 sample bottle, then packaged, sealed, and shipped under IAEA chain of custody to an offsite analytical laboratory. Future DA safeguard measures may require improvements in efficiency and effectiveness as GCEP capacities increase and UF6 shipping regulations become increasingly more restrictive. The Pacific Northwest National Laboratory (PNNL) DA sampler concept and Laser Ablation Absorption Ratio Spectrometry (LAARS) assay method are under development to potentially provide DA safeguard tools that increase inspection effectiveness and reduce sample shipping constraints. The PNNL DA sampler concept uses a handheld sampler to collect DA samples for either onsite LAARS assay or offsite laboratory analysis. The DA sampler design will use a small sampling planchet that is coated with an adsorptive film to collect controlled quantities of UF6 gas directly from a cylinder or process sampling tap. Development efforts are currently underway at PNNL to enhance LAARS assay performance to allow high-precision onsite bias defect measurements. In this paper, we report on the experimental investigation to develop adsorptive films for the PNNL DA sampler concept. These films are intended to efficiently capture UF6 and then stabilize the collected DA sample prior to onsite LAARS or offsite laboratory analysis. Several porous material composite films were investigated, including a film designed to maximize the chemical adsorption

  5. Near-field effects of asteroid impacts in deep water

    SciTech Connect (OSTI)

    Gisler, Galen R; Weaver, Robert P; Gittings, Michael L

    2009-06-11

    Our previous work has shown that ocean impacts of asteroids below 500 m in diameter do not produce devastating long-distance tsunamis. Nevertheless, a significant portion of the ocean lies close enough to land that near-field effects may prove to be the greatest danger from asteroid impacts in the ocean. Crown splashes and central jets that rise up many kilometres into the atmosphere can produce, upon their collapse, highly non-linear breaking waves that could devastate shorelines within a hundred kilometres of the impact site. We present illustrative calculations, in two and three dimensions, of such impacts for a range of asteroid sizes and impact angles. We find that, as for land impacts, the greatest dangers from oceanic impacts are the short-term near-field, and long-term atmospheric effects.

  6. Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

    SciTech Connect (OSTI)

    Almond, P. M.; Kaplan, D. I.; Langton, C. A.; Stefanko, D. B.; Spencer, W. A.; Hatfield, A.; Arai, Y.

    2012-08-23

    The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

  7. Y-12 Groundwater Protection Program Groundwater And Surface Water Sampling And Analysis Plan For Calendar Year 2012

    SciTech Connect (OSTI)

    Elvado Environmental, LLC

    2011-09-01

    the CY 2012 groundwater and surface water monitoring activities. Section 2 describes the monitoring locations in each regime and the processes used to select the sampling locations. A description of the field measurements and laboratory analytes is provided in Section 3. Sample collection methods and procedures are described in Section 4, and Section 5 lists the documents cited for more detailed operational and technical information. The narrative sections of the report reference several appendices. Figures (maps and diagrams) and tables (excluding a data summary table presented in Section 4) are in Appendix A and Appendix B, respectively. Groundwater Monitoring Schedules (when issued throughout CY 2012) will be inserted in Appendix C, and addenda to this plan (if issued) will be inserted in Appendix D. Laboratory requirements (bottle lists, holding times, etc.) are provided in Appendix E, and an approved Waste Management Plan is provided in Appendix F.

  8. Rock-Water Interactions In Hot Dry Rock Geothermal Systems- Field...

    Open Energy Info (EERE)

    Rock-Water Interactions In Hot Dry Rock Geothermal Systems- Field Investigations Of In Situ Geochemical Behavior Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  9. ARM - Field Campaign - Full-column Greenhouse Gas Sampling 2012-2014

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govCampaignsFull-column Greenhouse Gas Sampling 2012-2014 Campaign Links Final Campaign Report ARM Data Discovery Browse Data Related Campaigns Full-column Greenhouse Gas Sampling 2015-2017 2015.03.01, Fischer, SGP Balloon-Borne Full-column Greenhouse Gas Profiling 2014.03.01, Fischer, SGP Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Full-column Greenhouse Gas Sampling 2012-2014 2012.01.13 - 2014.02.28 Lead Scientist : Marc Fischer

  10. Analytical Data Report of Water Samples Collected For I-129 Analysis

    SciTech Connect (OSTI)

    Lindberg, Michael J.

    2009-10-26

    This is an analytical data report for samples received from the central plateau contractor. The samples were analyzed for iodine-129.

  11. Geological reasons for rapid water encroachment in wells at Sutorma oil field

    SciTech Connect (OSTI)

    Arkhipov, S.V.; Dvorak, S.V.; Sonich, V.P.; Nikolayeva, Ye.V.

    1987-12-01

    The Sutorma oil field on the northern Surgut dome is one of the new fields in West Siberia. It came into production in 1982, but already by 1983 it was found that the water contents in the fluids produced were much greater than the design values. The adverse effects are particularly pronounced for the main reservoir at the deposit, the BS/sub 10//sup 2/ stratum. Later, similar problems occurred at other fields in the Noyarbr and Purpey regions. It is therefore particularly important to elucidate the geological reasons for water encroachment.

  12. Biological treatment process for removing petroleum hydrocarbons from oil field produced waters

    SciTech Connect (OSTI)

    Tellez, G.; Khandan, N.

    1995-12-31

    The feasibility of removing petroleum hydrocarbons from oil fields produced waters using biological treatment was evaluated under laboratory and field conditions. Based on previous laboratory studies, a field-scale prototype system was designed and operated over a period of four months. Two different sources of produced waters were tested in this field study under various continuous flow rates ranging from 375 1/D to 1,800 1/D. One source of produced water was an open storage pit; the other, a closed storage tank. The TDS concentrations of these sources exceeded 50,000 mg/l; total n-alkanes exceeded 100 mg/l; total petroleum hydrocarbons exceeded 125 mg/l; and total BTEX exceeded 3 mg/l. Removals of total n-alkanes, total petroleum hydrocarbons, and BTEX remained consistently high over 99%. During these tests, the energy costs averaged $0.20/bbl at 12 bbl/D.

  13. Validation of a Hot Water Distribution Model Using Laboratory and Field Data

    SciTech Connect (OSTI)

    Backman, C.; Hoeschele, M.

    2013-07-01

    Characterizing the performance of hot water distribution systems is a critical step in developing best practice guidelines for the design and installation of high performance hot water systems. Developing and validating simulation models is critical to this effort, as well as collecting accurate input data to drive the models. In this project, the ARBI team validated the newly developed TRNSYS Type 604 pipe model against both detailed laboratory and field distribution system performance data. Validation efforts indicate that the model performs very well in handling different pipe materials, insulation cases, and varying hot water load conditions. Limitations of the model include the complexity of setting up the input file and long simulation run times. In addition to completing validation activities, this project looked at recent field hot water studies to better understand use patterns and potential behavioral changes as homeowners convert from conventional storage water heaters to gas tankless units. Based on these datasets, we conclude that the current Energy Factor test procedure overestimates typical use and underestimates the number of hot water draws. This has implications for both equipment and distribution system performance. Gas tankless water heaters were found to impact how people use hot water, but the data does not necessarily suggest an increase in usage. Further study in hot water usage and patterns is needed to better define these characteristics in different climates and home vintages.

  14. Validation of a Hot Water Distribution Model Using Laboratory and Field Data

    SciTech Connect (OSTI)

    Backman, C.; Hoeschele, M.

    2013-07-01

    Characterizing the performance of hot water distribution systems is a critical step in developing best practice guidelines for the design and installation of high performance hot water systems. Developing and validating simulation models is critical to this effort, as well as collecting accurate input data to drive the models. In this project, the Building America research team ARBI validated the newly developed TRNSYS Type 604 pipe model against both detailed laboratory and field distribution system performance data. Validation efforts indicate that the model performs very well in handling different pipe materials, insulation cases, and varying hot water load conditions. Limitations of the model include the complexity of setting up the input file and long simulation run times. This project also looked at recent field hot water studies to better understand use patterns and potential behavioral changes as homeowners convert from conventional storage water heaters to gas tankless units. The team concluded that the current Energy Factor test procedure overestimates typical use and underestimates the number of hot water draws, which has implications for both equipment and distribution system performance. Gas tankless water heaters were found to impact how people use hot water, but the data does not necessarily suggest an increase in usage. Further study in hot water usage and patterns is needed to better define these characteristics in different climates and home vintages.

  15. June-July 2015 Groundwater and Surface Water Sampling at the Old and New Rifle, Colorado, Processing Sites

    Office of Legacy Management (LM)

    June-July 2015 Groundwater and Surface Water Sampling at the Old and New Rifle, Colorado, Processing Sites November 2015 LMS/RFL/S00615 This page intentionally left blank U.S. Department of Energy DVP-June and July 2015, Old and New Rifle, Colorado November 2015 RINs 15067100, 15067101, and 15077206 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Planned

  16. April 2012 Groundwater and Surface Water Sampling at the Salmon, Mississippi, Site (Data Validation Package)

    SciTech Connect (OSTI)

    2012-10-12

    Sampling and analysis were conducted on April 16-19, 2012, as specified in the Sampling and Analysis Plan for U.S. Department of Energy Office Of Legacy Management Sites (LMS/PLN/S04351, continually updated). Duplicate samples were collected from locations SA1-1-H, HMH-5R, SA3-4-H, SA1-2-H, Pond W of GZ, and SA5-4-4. One trip blank was collected during this sampling event.

  17. Drilling, Sampling, and Well-Installation Plan for the IFC Well Field, 300 Area

    SciTech Connect (OSTI)

    Bjornstad, Bruce N.; Horner, Jacob A.

    2008-05-05

    The 300 Area was selected as a location for an IFC because it offers excellent opportunities for field research on the influence of mass-transfer processes on uranium in the vadose zone and groundwater. The 300 Area was the location of nuclear fuel fabrication facilities and has more than 100 waste sites. Two of these waste sites, the North and South Process Ponds received large volumes of process waste from 1943 to 1975 and are thought to represent a significant source of the groundwater uranium plume in the 300 Area. Geophysical surveys and other characterization efforts have led to selection of the South Process Pond for the IFC.

  18. Field Sampling Plan for the Operable Units 6-05 and 10-04 Remedial Action, Phase IV

    SciTech Connect (OSTI)

    R. Wells

    2006-11-14

    This Field Sampling Plan outlines the collection and analysis of samples in support of Phase IV of the Waste Area Group 10, Operable Units 6-05 and 10-04 remedial action. Phase IV addresses the remedial actions to areas with the potential for unexploded ordnance at the Idaho National Laboratory Site. These areas include portions of the Naval Proving Ground, the Arco High-Altitude Bombing Range, and the Twin Buttes Bombing Range. The remedial action consists of removal and disposal of ordnance by high-order detonation, followed by sampling to determine the extent, if any, of soil that might have been contaminated by the detonation activities associated with the disposal of ordnance during the Phase IV activities and explosives during the Phase II activities.

  19. Sampling and analysis plan for treatment water and creek water for the Lower East Fork Poplar Creek Operable Unit, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1996-04-01

    This document provides the Environmental Restoration Program with information about the methodology, organizational structure, quality assurance and health and safety practices to be employed during the water sampling and analysis activities associated with the remediation of the Lower East Fork Poplar Creek Operable Unit during remediation of the National Oceanic and Atmospheric Administration and Bruner sites.

  20. Applying high resolution SyXRD analysis on sulfate attacked concrete field samples

    SciTech Connect (OSTI)

    Stroh, J.; Schlegel, M.-C.; Irassar, E.F.; Meng, B.; Emmerling, F.

    2014-12-15

    High resolution synchrotron X-ray diffraction (SyXRD) was applied for a microstructural profile analysis of concrete deterioration after sulfate attack. The cement matrices consist of ordinary Portland cement and different amounts of supplementary cementitious materials, such as fly ash, natural pozzolana and granulated blast furnace slag. The changes of the phase composition were determined along the direction of sulfate ingress. This approach allows the identification of reaction fronts and zones of different phase compositions and conclusions about the mechanisms of sulfate attack. Two reaction fronts were localized in the initial 4 mm from the sample surface. The mechanism of deterioration caused by the exposition in the sulfate-bearing soil is discussed. SyXRD is shown to be a reliable method for investigation of cementitious materials with aggregates embedded in natural environments.

  1. NGSI FY15 Final Report. Innovative Sample Preparation for in-Field Uranium Isotopic Determinations

    SciTech Connect (OSTI)

    Yoshida, Thomas M.; Meyers, Lisa

    2015-11-10

    Our FY14 Final Report included an introduction to the project, background, literature search of uranium dissolution methods, assessment of commercial off the shelf (COTS) automated sample preparation systems, as well as data and results for dissolution of bulk quantities of uranium oxides, and dissolution of uranium oxides from swipe filter materials using ammonium bifluoride (ABF). Also, discussed were reaction studies of solid ABF with uranium oxide that provided a basis for determining the ABF/uranium oxide dissolution mechanism. This report details the final experiments for optimizing dissolution of U3O8 and UO2 using ABF and steps leading to development of a Standard Operating Procedure (SOP) for dissolution of uranium oxides on swipe filters.

  2. Statistical techniques for detecting the intergalactic magnetic field from large samples of extragalactic Faraday rotation data

    SciTech Connect (OSTI)

    Akahori, Takuya; Gaensler, B. M.; Ryu, Dongsu E-mail: bryan.gaensler@sydney.edu.au

    2014-08-01

    Rotation measure (RM) grids of extragalactic radio sources have been widely used for studying cosmic magnetism. However, their potential for exploring the intergalactic magnetic field (IGMF) in filaments of galaxies is unclear, since other Faraday-rotation media such as the radio source itself, intervening galaxies, and the interstellar medium of our Galaxy are all significant contributors. We study statistical techniques for discriminating the Faraday rotation of filaments from other sources of Faraday rotation in future large-scale surveys of radio polarization. We consider a 30° × 30° field of view toward the south Galactic pole, while varying the number of sources detected in both present and future observations. We select sources located at high redshifts and toward which depolarization and optical absorption systems are not observed so as to reduce the RM contributions from the sources and intervening galaxies. It is found that a high-pass filter can satisfactorily reduce the RM contribution from the Galaxy since the angular scale of this component toward high Galactic latitudes would be much larger than that expected for the IGMF. Present observations do not yet provide a sufficient source density to be able to estimate the RM of filaments. However, from the proposed approach with forthcoming surveys, we predict significant residuals of RM that should be ascribable to filaments. The predicted structure of the IGMF down to scales of 0.°1 should be observable with data from the Square Kilometre Array, if we achieve selections of sources toward which sightlines do not contain intervening galaxies and RM errors are less than a few rad m{sup –2}.

  3. Water-Gas Samples At Long Valley Caldera Area (Goff & Janik,...

    Open Energy Info (EERE)

    Area (Goff & Janik, 2002) Redirect page Jump to: navigation, search REDIRECT Surface Gas Sampling At Long Valley Caldera Area (Goff & Janik, 2002) Retrieved from "http:...

  4. Field Soil Water Retention of the Prototype Hanford Barrier and Its Variability with Space and Time

    SciTech Connect (OSTI)

    Zhang, Z. F.

    2015-08-14

    Engineered surface barriers are used to isolate underlying contaminants from water, plants, animals, and humans. To understand the flow processes within a barrier and the barrier’s ability to store and release water, the field hydraulic properties of the barrier need to be known. In situ measurement of soil hydraulic properties and their variation over time is challenging because most measurement methods are destructive. A multiyear test of the Prototype Hanford Barrier (PHB) has yielded in situ soil water content and pressure data for a nine-year period. The upper 2 m layer of the PHB is a silt loam. Within this layer, water content and water pressure were monitored at multiple depths at 12 water balance stations using a neutron probe and heat dissipation units. Valid monitoring data from 1995 to 2003 for 4 depths at 12 monitoring stations were used to determine the field water retention of the silt loam layer. The data covered a wide range of wetness, from near saturation to the permanent wilt point, and each retention curve contained 51 to 96 data points. The data were described well with the commonly used van Genuchten water retention model. It was found that the spatial variation of the saturated and residual water content and the pore size distribution parameter were relatively small, while that of the van Genuchten alpha was relatively large. The effects of spatial variability of the retention properties appeared to be larger than the combined effects of added 15% w/w pea gravel and plant roots on the properties. Neither of the primary hydrological processes nor time had a detectible effect on the water retention of the silt loam barrier.

  5. Results of sediment and water sampling for inorganic, organic, and radionuclide analysis at recreation areas and water intakes -- Norris, Melton Hill, and Watts Bar Lakes. Data report

    SciTech Connect (OSTI)

    1991-10-01

    Suspected water quality contamination in Watts Bar Reservoir as a result of activities in past decades at the Department of Energy`s (DOE) Oak Ridge facility is of public concern. DOE, the Tennessee Valley Authority (TVA), the State of Tennessee, and other agencies and officials have received many inquiries from the public in recent years concerning this suspected pollution, especially how this potential contamination may affect the health and safety of those persons who use beaches in the area for swimming or other water-body-contact sports. As a result of these concerns, TVA conducted a study in May and June 1991 to obtain data on potential contaminants of concern in the water and sediment of Watts Bar Reservoir. TVA collected water and sediment samples at a total of 29 sites, including 18 recreation areas and 11 water intake locations, located throughout Norris, Melton Hill, and Watts Bar Reservoirs. The samples were analyzed for radionuclides, metals, and organic compounds which could pose a threat to human health.

  6. Evaluation of an ambient air sampling system for tritium (as tritiated water vapor) using silica gel adsorbent columns

    SciTech Connect (OSTI)

    Patton, G.W.; Cooper, A.T.; Tinker, M.R.

    1995-08-01

    Ambient air samples for tritium analysis (as the tritiated water vapor [HTO] content of atmospheric moisture) are collected for the Hanford Site Surface Environmental Surveillance Project (SESP) using the solid adsorbent silica gel. The silica gel has a moisture sensitive indicator which allows for visual observation of moisture movement through a column. Despite using an established method, some silica gel columns showed a complete change in the color indicator for summertime samples suggesting that breakthrough had occurred; thus a series of tests was conducted on the sampling system in an environmental chamber. The purpose of this study was to determine the maximum practical sampling volume and overall collection efficiency for water vapor collected on silica gel columns. Another purpose was to demonstrate the use of an impinger-based system to load water vapor onto silica gel columns to provide realistic analytical spikes and blanks for the Hanford Site SESP. Breakthrough volumes (V{sub b}) were measured and the chromatographic efficiency (expressed as the number of theoretical plates [N]) was calculated for a range of environmental conditions. Tests involved visual observations of the change in the silica gel`s color indicator as a moist air stream was drawn through the column, measurement of the amount of a tritium tracer retained and then recovered from the silica gel, and gravimetric analysis for silica gel columns exposed in the environmental chamber.

  7. Field Performance of Heat Pump Water Heaters in the Northeast, Massachusetts and Rhode Island (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2013-12-01

    Heat pump water heaters (HPWHs) are finally entering the mainstream residential water heater market. Potential catalysts are increased consumer demand for higher energy efficiency electric water heating and a new Federal water heating standard that effectively mandates use of HPWHs for electric storage water heaters with nominal capacities greater than 55 gallons. When compared to electric resistance water heating, the energy and cost savings potential of HPWHs is tremendous. Converting all electric resistance water heaters to HPWHs could save American consumers 7.8 billion dollars annually ($182 per household) in water heating operating costs and cut annual residential source energy consumption for water heating by 0.70 quads. Steven Winter Associates, Inc. embarked on one of the first in situ studies of these newly released HPWH products through a partnership with two sponsoring electric utility companies, National Grid and NSTAR, and one sponsoring energy efficiency service program administrator, Cape Light Compact. Recent laboratory studies have measured performance of HPWHs under various operating conditions, but publicly available field studies have not been as available. This evaluation attempts to provide publicly available field data on new HPWHs by monitoring the performance of three recently released products (General Electric GeoSpring, A.O. Smith Voltex, and Stiebel Eltron Accelera 300). Fourteen HPWHs were installed in Massachusetts and Rhode Island and monitored for over a year. Of the 14 units, ten were General Electric models (50 gallon units), two were Stiebel Eltron models (80 gallon units), and two were A.O. Smith models (one 60-gallon and one 80-gallon unit).

  8. Extension of Studies with 3M Empore TM and Selentec MAG *SEP SM Technologies for Improved Radionuclide Field Sampling

    SciTech Connect (OSTI)

    Beals, D.M.; Bibler, J.P.; Brooks, D.A.

    1996-07-10

    The Savannah River Technology Center is evaluating new field sampling methodologies to more easily determine concentrations of radionuclides in aqueous systems. One methodology studied makes use of 3M EmporeTM disks. The disks are composed of selective resins embedded in a Teflon support. The disks remove the ion of interest from aqueous solutions when the solution is passed through the disk. The disk can then be counted directly to quantify the isotope of interest. Four types of disks were studied during this work: for the extraction of technetium (two types), cesium, plutonium, and strontium. A sampler has been developed for automated, unattended, in situ use of the EmporeTM disks.

  9. COMPARISON OF RESULTS FOR QUARTER 5 SURFACE WATER SPLIT SAMPLES COLLECTED AT THE NUCLEAR FUEL SERVICES SITE ERWIN TENNESSEE

    SciTech Connect (OSTI)

    2013-09-23

    Oak Ridge Associated Universities (ORAU), under the Oak Ridge Institute for Science and Education (ORISE) contract, collected split surface water samples with Nuclear Fuel Services (NFS) representatives on August 21, 2013. Representatives from the U.S. Nuclear Regulatory Commission (NRC) and the Tennessee Department of Environment and Conservation were also in attendance. Samples were collected at four surface water stations, as required in the approved Request for Technical Assistance number 11-018. These stations included Nolichucky River upstream (NRU), Nolichucky River downstream (NRD), Martin Creek upstream (MCU), and Martin Creek downstream (MCD). Both ORAU and NFS performed gross alpha and gross beta analyses, and the comparison of results using the duplicate error ratio (DER), also known as the normalized absolute difference, are tabulated. All DER values were less than 3 and results are consistent with low (e.g., background) concentrations.

  10. U Isotopic Compositions and Concentrations of Rocky Flats Water Samples Collected Over the Period 4/1/15 to 6/16/15 and Submitted to LBNL

    Office of Legacy Management (LM)

    U Isotopic Compositions and Concentrations of Rocky Flats Water Samples Collected Over the Period 4/1/15 to 6/16/15 and Submitted to LBNL John N. Christensen Data Report date 12/30/15 Twenty-one water samples were submitted by SM Stoller to Lawrence Berkeley National Laboratory (LBNL) for uranium (U) isotopic analysis. The sample set includes four composite samples from the WALPOC location, one composite sample from GS10, one composite sample from the SW093 location, and one sample each from

  11. Field Test Design Simulations of Pore-Water Extraction for the SX Tank Farm

    SciTech Connect (OSTI)

    Truex, Michael J.; Oostrom, Martinus

    2013-09-01

    A proof of principle test of pore water extraction is being performed by Washington River Protection Solutions for the U.S. Department of Energy, Office of River Protection. This test is being conducted to meet the requirements of Hanford Federal Facility Agreement and Consent Order (HFFACO) (Ecology et al. 1989) Milestone M 045-20, and is described in RPP-PLAN-53808, 200 West Area Tank Farms Interim Measures Investigation Work Plan. To support design of this test, numerical simulations were conducted to help define equipment and operational parameters. The modeling effort builds from information collected in laboratory studies and from field characterization information collected at the test site near the Hanford Site 241-SX Tank Farm. Numerical simulations were used to evaluate pore-water extraction performance as a function of the test site properties and for the type of extraction well configuration that can be constructed using the direct-push installation technique. Output of simulations included rates of water and soil-gas production as a function of operational conditions for use in supporting field equipment design. The simulations also investigated the impact of subsurface heterogeneities in sediment properties and moisture distribution on pore-water extraction performance. Phenomena near the extraction well were also investigated because of their importance for pore-water extraction performance.

  12. COMPARISON OF RESULTS FOR QUARTER 2 SURFACE WATER SPLIT SAMPLES COLLECTED AT THE NUCLEAR FUEL SERVICES SITE, ERWIN, TENNESSEE

    SciTech Connect (OSTI)

    2013-01-21

    Oak Ridge Associated Universities (ORAU), under the Oak Ridge Institute for Science and Education (ORISE) contract, collected split surface water samples with Nuclear Fuel Services (NFS) representatives on November 15, 2012. Representatives from the U.S. Nuclear Regulatory Commission and Tennessee Department of Environment and Conservation were also in attendance. Samples were collected at four surface water stations, as required in the approved Request for Technical Assistance number 11-018. These stations included Nolichucky River upstream (NRU), Nolichucky River downstream (NRD), Martin Creek upstream (MCU), and Martin Creek downstream (MCD). Both ORAU and NFS performed gross alpha and gross beta analyses, and the results are compared using the duplicate error ratio (DER), also known as the normalized absolute difference. A DER {<=} 3 indicates that, at a 99% confidence interval, split sample results do not differ significantly when compared to their respective one standard deviation (sigma) uncertainty (ANSI N42.22). The NFS split sample report does not specify the confidence level of reported uncertainties (NFS 2012). Therefore, standard two sigma reporting is assumed and uncertainty values were divided by 1.96. In conclusion, all DER values were less than 3 and results are consistent with low (e.g., background) concentrations.

  13. COMPARISON OF RESULTS FOR QUARTER 4 SURFACE WATER SPLIT SAMPLES COLLECTED AT THE NUCLEAR FUELS SERVICES SITE, ERWIN, TN

    SciTech Connect (OSTI)

    none,

    2013-08-15

    Oak Ridge Associated Universities (ORAU), under the Oak Ridge Institute for Science and Education (ORISE) contract, collected split surface water samples with Nuclear Fuel Services (NFS) representatives on June 12, 2013. Representatives from the U.S. Nuclear Regulatory Commission (NRC) and the Tennessee Department of Environment and Conservation were also in attendance. Samples were collected at four surface water stations, as required in the approved Request for Technical Assistance number 11-018. These stations included Nolichucky River upstream (NRU), Nolichucky River downstream (NRD), Martin Creek upstream (MCU), and Martin Creek downstream (MCD). Both ORAU and NFS performed gross alpha and gross beta analyses, and Table 1 presents the comparison of results using the duplicate error ratio (DER), also known as the normalized absolute difference. A DER ≤ 3 indicates at a 99% confidence interval that split sample results do not differ significantly when compared to their respective one standard deviation (sigma) uncertainty (ANSI N42.22). The NFS split sample report specifies 95% confidence level of reported uncertainties (NFS 2013). Therefore, standard two sigma reporting values were divided by 1.96. In conclusion, most DER values were less than 3 and results are consistent with low (e.g., background) concentrations. The gross beta result for sample 5198W0014 was the exception. The ORAU gross beta result of 6.30 ± 0.65 pCi/L from location NRD is well above NFS's non-detected result of 1.56 ± 0.59 pCi/L. NFS's data package includes no detected result for any radionuclide at location NRD. At NRC's request, ORAU performed gamma spectroscopic analysis of sample 5198W0014 to identify analytes contributing to the relatively elevated gross beta results. This analysis identified detected amounts of naturally-occurring constituents, most notably Ac-228 from the thorium decay series, and does not suggest the presence of site-related contamination.

  14. A field demonstration of the microbial treatment of sour produced water

    SciTech Connect (OSTI)

    Sublette, K.L.; Morse, D.; Raterman, K.

    1995-12-31

    The potential for detoxification and deodorization of sulfide-laden water (sour water) by microbial treatment was evaluated at a petroleum production site under field conditions. A sulfide-tolerant strain of the chemautotroph and facultative anaerobe, Thiobacillus denitrificans, was introduced into an oil-skimming pit of the Amoco Production Company LACT 10 Unit of the Salt Creek Field, Wyoming. Field-produced water enters this pit from the oil/water separation treatment train at an average flowrate of 5,000 bbl/D (795 m{sup 3}/D) with a potential maximum of 98,000 bbl/D (15,580 m{sup 3}/D). Water conditions at the pit inlet are 4,800 mg/l TDS, 100 mg/l sulfide, pH 7.8, and 107{degrees}F. To this water an aqueous solution of ammonium nitrate and diphosphorous pentoxide was added to provide required nutrients for the bacteria. The first 20% of the pit was aerated to a maximum depth of 5 ft (1.5 m) to facilitate the aerobic oxidation of sulfide. No provisions for pH control or biomass recovery and recycle were made. Pilot operations were initiated in October 1992 with the inoculation of the 19,000 bbl (3,020 m{sup 3}) pit with 40 lb (18.1 kg) of dry weight biomass. After a brief acclimation period, a nearly constant mass flux of 175 lb/D (80 kg/D) sulfide was established to the pit. Bio-oxidation of sulfide to elemental sulfur and sulfate was immediate and complete. Subsequent pilot operations focused upon process optimization and process sensitivity to system upsets. The process appeared most sensitive to large variations in sulfide loading due to maximum water discharge events. However, recoveries from such events could be accomplished within hours. This paper details all pertinent aspects of pilot operation, performance, and economics. Based on this body of evidence, it is suggested that the oxidation of inorganic sulfides by T denitrificans represents a viable concept for the treatment of sour water coproduced with oil and gas.

  15. field

    National Nuclear Security Administration (NNSA)

    09%2A en Ten-Year Site Plans (TYSP) http:nnsa.energy.govaboutusouroperationsinfopsinfopstysp

    field field-type-text field-field-page-name">
  16. field

    National Nuclear Security Administration (NNSA)

    09%2A en Ten-Year Site Plans (TYSP) http:www.nnsa.energy.govaboutusouroperationsinfopsinfopstysp

    field field-type-text field-field-page-name">
  17. COMPARISON OF RESULTS FOR QUARTER 3 SURFACE WATER SPLIT SAMPLES COLLECTED AT THE NUCLEAR FUEL SERVICES SITE, ERWIN, TENNESSEE

    SciTech Connect (OSTI)

    none,

    2013-05-28

    Oak Ridge Associated Universities (ORAU), under the Oak Ridge Institute for Science and Education (ORISE) contract, collected split surface water samples with Nuclear Fuel Services (NFS) representatives on March 20, 2013. Representatives from the U.S. Nuclear Regulatory Commission and the Tennessee Department of Environment and Conservation were also in attendance. Samples were collected at four surface water stations, as required in the approved Request for Technical Assistance number 11-018. These stations included Nolichucky River upstream (NRU), Nolichucky River downstream (NRD), Martin Creek upstream (MCU), and Martin Creek downstream (MCD). Both ORAU and NFS performed gross alpha and gross beta analyses, and Table 1 presents the comparison of results using the duplicate error ratio (DER), also known as the normalized absolute difference. A DER {<=} 3 indicates that at a 99% confidence interval, split sample results do not differ significantly when compared to their respective one standard deviation (sigma) uncertainty (ANSI N42.22). The NFS split sample report does not specify the confidence level of reported uncertainties (NFS 2013). Therefore, standard two sigma reporting is assumed and uncertainty values were divided by 1.96. In conclusion, most DER values were less than 3 and results are consistent with low (e.g., background) concentrations. The gross beta result for sample 5198W0012 was the exception. The ORAU result of 9.23 ± 0.73 pCi/L from location MCD is well above NFS's result of -0.567 ± 0.63 pCi/L (non-detected). NFS's data package included a detected result for U-233/234, but no other uranium or plutonium detection, and nothing that would suggest the presence of beta-emitting radionuclides. The ORAU laboratory reanalyzed sample 5198W0012 using the remaining portion of the sample volume and a result of 11.3 ± 1.1 pCi/L was determined. As directed, the laboratory also counted the filtrate using gamma spectrometry analysis and

  18. Analysis of water and soil from the wetlands of Upper Three Runs Creek. Volume 2A, Analytical data packages September--October 1991 sampling

    SciTech Connect (OSTI)

    Haselow, L.A.; Rogers, V.A.; Riordan, C.J.; Eidson, G.W.; Herring, M.K.

    1992-08-01

    Shallow water and soils along Upper Three Runs Creek (UTRC) and associated wetlands between SRS Road F and Cato Road were sampled for nonradioactive and radioactive constituents. The sampling program is associated with risk evaluations being performed for various regulatory documents in these areas of the Savannah River Site (SRS). WSRC selected fifty sampling sites bordering the Mixed Waste Management Facility (MWMF), F- and H-Area Seepage Basins (FHSB), and the Sanitary Landfill (SL). The analytical results from this study provided information on the water and soil quality in UTRC and its associated wetlands. The analytical results from this investigation indicated that the primary constituents and radiological indicators detected in the shallow water and soils were tritium, gross alpha, radium 226, total radium and strontium 90. This investigation involved the collection of shallow water samples during the Fall of 1991 and the Spring of 1992 at fifty (50) sampling locations. Sampling was performed during these periods to incorporate high and low water table periods. Samples were collected from three sections along UTRC denoted as Phase I (MWMF), Phase II (FHSB) and Phase III (SL). One vibracored soil sample was also collected in each phase during the Fall of 1991. This document is compiled solely of experimental data obtained from the sampling procedures.

  19. A Water-Soluble Polythiophene for Organic Field-Effect Transistors

    SciTech Connect (OSTI)

    Shao, Ming; He, Youjun; Hong, Kunlun; Rouleau, Christopher M; Geohegan, David B; Xiao, Kai

    2013-01-01

    Synthesis of a non-ionic, water-soluble poly(thiophene) (PT) derivative, poly(3-(2-(2-methoxyethoxy) ethoxy)ethoxy) methylthiophene) (P3TEGT) with a hydrophilic tri-ethylene glycol side group, is reported and thin films of the polymer suitable for organic field-effect transistors (OFETs) are characterized by combining analysis techniques that include UV-Vis absorption and fluorescence spectroscopy, x-ray diffraction, and atomic force microscopy. After thermal annealing, P3TEGT films exhibit a well-organized nanofibrillar lamellar nanostructure that originates from the strong - stacking of the thiophene backbones. P-type organic field-effect transistors (OFETs) with hole mobilities of 10-5 cm2V-1s-1 were fabricated from this water-soluble poly(thiophene) derivative, demonstrating the possibility that environmentally-friendly solvents may be promising alternatives for the low-cost, green solution-based organic electronic device manufacturing of OFETs, organic photovoltaics (OPVs), and biosensors.

  20. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect (OSTI)

    Evans, S.K.

    2002-01-31

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  1. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect (OSTI)

    Evans, Susan Kay; Orchard, B. J.

    2002-01-01

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... nickel, radium-226, radium-228, selenium, thorium-230, and uranium in site groundwater. ... The former licensee attributed elevated radium-228 levels at the site to natural thorium ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... extremely large or small relative to the rest of the data and, therefore, are suspected ... values that are much smaller than the rest of the data (case 1) and extreme values ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... DVP-June 2014, Hallam, Nebraska U.S. Department of Energy RIN 14056211 September 2014 Page 12 Electronic Data Deliverable (EDD) File The EDD files arrived on July 21, 2014. The ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Central Nevada Test Area March 2014 Approved for public release; further dissemination unlimited LMS/CNT/S01113 Available for sale to the public from: U.S. Department of Commerce National Technical Information Service 5301 Shawnee Road Alexandria, VA 22312 Telephone: 800.553.6847 Fax: 703.605.6900 E-mail: orders@ntis.gov Online Ordering: http://www.ntis.gov/help/ordermethods.aspx Available electronically at http://www.osti.gov/bridge Available for a processing fee to U.S. Department of Energy

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Gnome-Coach, New Mexico, Site October 2013 LMS/GNO/S00113 Available for sale to the public from: U.S. Department of Commerce National Technical Information Service 5301 Shawnee Road Alexandria, VA 22312 Telephone: 800.553.6847 Fax: 703.605.6900 E-mail: orders@ntis.gov Online Ordering: http://www.ntis.gov/help/ordermethods.aspx Available electronically at http://www.osti.gov/bridge Available for a processing fee to U.S. Department of Energy and its contractors, in paper, from: U.S. Department of

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Project Shoal, Nevada, Site December 2013 LMS/SHL/S00513 Available for sale to the public from: U.S. Department of Commerce National Technical Information Service 5301 Shawnee Road Alexandria, VA 22312 Telephone: 800.553.6847 Fax: 703.605.6900 E-mail: orders@ntis.gov Online Ordering: http://www.ntis.gov/help/ordermethods.aspx Available electronically at http://www.osti.gov/bridge Available for a processing fee to U.S. Department of Energy and its contractors, in paper, from: U.S. Department of

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Shoal, Nevada, Site July 2014 LMS/SHL/S00514 Available for sale to the public from: U.S. Department of Commerce National Technical Information Service 5301 Shawnee Road Alexandria, VA 22312 Telephone: 800.553.6847 Fax: 703.605.6900 E-mail: orders@ntis.gov Online Ordering: http://www.ntis.gov/help/ordermethods.aspx Available electronically at http://www.osti.gov/scitech/ Available for a processing fee to U.S. Department of Energy and its contractors, in paper, from: U.S. Department of Energy

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... whether a statistical outlier should be discarded or corrected within a data set. ... The application compares the new data set (in standard environmental database units) with ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... levels at the site to natural thorium in the uranium ore. ... screened for radium-226 by gas flow proportional counting. ... Chromatography Peak Integration The integration of analyte ...

  11. Cropland Field Monitoring: MMV Page 1 Montana Cropland Enrolled Farm Fields Carbon Sequestration Field Sampling, Measurement, Monitoring, and Verification: Application of Visible-Near Infrared Diffuse Reflectance Spectroscopy (VNIR) and Laser-induced Breakdown Spectroscopy (LIBS)

    SciTech Connect (OSTI)

    Lee Spangler; Ross Bricklemyer; David Brown

    2012-03-15

    There is growing need for rapid, accurate, and inexpensive methods to measure, and verify soil organic carbon (SOC) change for national greenhouse gas accounting and the development of a soil carbon trading market. Laboratory based soil characterization typically requires significant soil processing, which is time and resource intensive. This severely limits application for large-region soil characterization. Thus, development of rapid and accurate methods for characterizing soils are needed to map soil properties for precision agriculture applications, improve regional and global soil carbon (C) stock and flux estimates and efficiently map sub-surface metal contamination, among others. The greatest gains for efficient soil characterization will come from collecting soil data in situ, thus minimizing soil sample transportation, processing, and lab-based measurement costs. Visible and near-infrared diffuse reflectance spectroscopy (VisNIR) and laser-induced breakdown spectroscopy (LIBS) are two complementary, yet fundamentally different spectroscopic techniques that have the potential to meet this need. These sensors have the potential to be mounted on a soil penetrometer and deployed for rapid soil profile characterization at field and landscape scales. Details of sensor interaction, efficient data management, and appropriate statistical analysis techniques for model calibrations are first needed. In situ or on-the-go VisNIR spectroscopy has been proposed as a rapid and inexpensive tool for intensively mapping soil texture and organic carbon (SOC). While lab-based VisNIR has been established as a viable technique for estimating various soil properties, few experiments have compared the predictive accuracy of on-the-go and lab-based VisNIR. Eight north central Montana wheat fields were intensively interrogated using on-the-go and lab-based VisNIR. Lab-based spectral data consistently provided more accurate predictions than on-the-go data. However, neither in situ

  12. Temperature dependent low-field measurements of the magnetocaloric ΔT with sub-mK resolution in small volume and thin film samples

    SciTech Connect (OSTI)

    Döntgen, J.; Rudolph, J.; Gottschall, T.; Gutfleisch, O.; Salomon, S.; Ludwig, A.; Hägele, D.

    2015-01-19

    We present temperature dependent ΔT measurements of the magnetocaloric effect in a thin film sample of Gd, employing magnetomodulation and detection of thermal radiation. A bulk sample of the metamagnetic material LaFe{sub 11.05}Co{sub 0.91}Si{sub 1.04} shows a strong broadening of the ΔT peak for increasing field amplitudes between 4 and 45 mT. Bulk Gd in comparison shows only a weak broadening. All investigated samples exhibit a clear quadratic dependence of ΔT on the external field H{sub ext} at the ΔT peak maximum, contrary to earlier predictions. An analytic expression is derived that interpolates between the H{sub ext}{sup 2}-behavior at low and the well-known H{sub ext}{sup 2/3}-behavior at high fields.

  13. High mobility organic field-effect transistor based on water-soluble deoxyribonucleic acid via spray coating

    SciTech Connect (OSTI)

    Shi, Wei; Han, Shijiao; Huang, Wei; Yu, Junsheng

    2015-01-26

    High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm{sup 2}/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role in enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.

  14. Site characterization summary report for dry weather surface water sampling upper East Fork Poplar Creek characterization area Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1996-08-01

    This report describes activities associated with conducting dry weather surface water sampling of Upper East Fork Poplar Creek (UEFPC) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. This activity is a portion of the work to be performed at UEFPC Operable Unit (OU) 1 [now known as the UEFPC Characterization Area (CA)], as described in the RCRA Facility Investigation Plan for Group 4 at the Oak- Ridge Y-12 Plant, Oak Ridge, Tennessee and in the Response to Comments and Recommendations on RCRA Facility Investigation Plan for Group 4 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Volume 1, Operable Unit 1. Because these documents contained sensitive information, they were labeled as unclassified controlled nuclear information and as such are not readily available for public review. To address this issue the U.S. Department of Energy (DOE) published an unclassified, nonsensitive version of the initial plan, text and appendixes, of this Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI) Plan in early 1994. These documents describe a program for collecting four rounds of wet weather and dry weather surface water samples and one round of sediment samples from UEFPC. They provide the strategy for the overall sample collection program including dry weather sampling, wet weather sampling, and sediment sampling. Figure 1.1 is a schematic flowchart of the overall sampling strategy and other associated activities. A Quality Assurance Project Plan (QAPJP) was prepared to specifically address four rounds of dry weather surface water sampling and one round of sediment sampling. For a variety of reasons, sediment sampling has not been conducted and has been deferred to the UEFPC CA Remedial Investigation (RI), as has wet weather sampling.

  15. Surface water sampling and analysis plan for environmental monitoring in Waste Area Grouping 6 at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Environmental Restoration Program

    SciTech Connect (OSTI)

    Not Available

    1994-06-01

    This Sampling and Analysis Plan addresses surface water monitoring, sampling, and analysis activities that will be conducted in support of the Environmental Monitoring Plan for Waste Area Grouping (WAG) 6. WAG 6 is a shallow-burial land disposal facility for low-level radioactive waste at the Oak Ridge National Laboratory, a research facility owned by the US Department of Energy and managed by Martin Marietta Energy Systems, Inc. Surface water monitoring will be conducted at nine sites within WAG 6. Activities to be conducted will include the installation, inspection, and maintenance of automatic flow-monitoring and sampling equipment and manual collection of various water and sediment samples. The samples will be analyzed for various organic, inorganic, and radiological parameters. The information derived from the surface water monitoring, sampling, and analysis will aid in evaluating risk associated with contaminants migrating off-WAG, and will be used in calculations to establish relationships between contaminant concentration (C) and flow (Q). The C-Q relationship will be used in calculating the cumulative risk associated with the off-WAG migration of contaminants.

  16. Non-destructive observation of intact bacteria and viruses in water by the highly sensitive frequency transmission electric-field method based on SEM

    SciTech Connect (OSTI)

    Ogura, Toshihiko

    2014-08-08

    Highlights: We developed a high-sensitive frequency transmission electric-field (FTE) system. The output signal was highly enhanced by applying voltage to a metal layer on SiN. The spatial resolution of new FTE method is 41 nm. New FTE system enables observation of the intact bacteria and virus in water. - Abstract: The high-resolution structural analysis of biological specimens by scanning electron microscopy (SEM) presents several advantages. Until now, wet bacterial specimens have been examined using atmospheric sample holders. However, images of unstained specimens in water using these holders exhibit very poor contrast and heavy radiation damage. Recently, we developed the frequency transmission electric-field (FTE) method, which facilitates the SEM observation of biological specimens in water without radiation damage. However, the signal detection system presents low sensitivity. Therefore, a high EB current is required to generate clear images, and thus reducing spatial resolution and inducing thermal damage to the samples. Here a high-sensitivity detection system is developed for the FTE method, which enhances the output signal amplitude by hundredfold. The detection signal was highly enhanced when voltage was applied to the metal layer on silicon nitride thin film. This enhancement reduced the EB current and improved the spatial resolution as well as the signal-to-noise ratio. The spatial resolution of a high-sensitive FTE system is 41 nm, which is considerably higher than previous FTE system. New FTE system can easily be utilised to examine various unstained biological specimens in water, such as living bacteria and viruses.

  17. Assessment of Field Experience Related to Pressurized Water Reactor Primary System Leaks

    SciTech Connect (OSTI)

    A. G. Ware; C. Hsu; C. L. Atwood; M. B. Sattison; R. S. Hartley; V. N. Shah

    1999-02-01

    This paper presents our assessment of field experience related to pressurized water reactor (PWR) primary system leaks in terms of their number and rates, how aging affects frequency of leak events, the safety significance of such leaks, industry efforts to reduce leaks, and effectiveness of current leak detection systems. We have reviewed the licensee event reports to identify the events that took place during 1985 to the third quarter of 1996, and reviewed related technical literature and visited PWR plants to analyze these events. Our assessment shows that USNRC licensees have taken effective actions to reduce the number of leak events. One main reason for this decreasing trend was the elimination or reportable leakages from valve stem packing after 1991. Our review of leak events related to vibratory fatigue reveals a statistically significant decreasing trend with age (years of operation), but not in calendar time. Our assessment of worldwide data on leakage caused by thermal fatigue cracking is that the fatigue of aging piping is a safety significant issue. Our review of leak events has identified several susceptible sites in piping having high safety significance; but the inspection of some of these sites is not required by the ASME Code. These sites may be included in the risk-informed inspection programs.

  18. Assessment of Field Experience Related to Pressurized Water Reactor Primary System Leaks

    SciTech Connect (OSTI)

    Shah, Vikram Naginbhai; Ware, Arthur Gates; Atwood, Corwin Lee; Sattison, Martin Blaine; Hartley, Robert Scott; Hsu, C.

    1999-08-01

    This paper presents our assessment of field experience related to pressurized water reactor (PWR) primary system leaks in terms of their number of rates, how aging affects frequency of leak events, the safety significance of such leaks, industry efforts to reduce leaks, and effectiveness of current leak detection systems. We have reviewed the licensee event reports to identify the events that took place during 1985 to the third quarter of 1996, and reviewed related technical literature and visited PWR plants to analyze these events. Our assessment shows that USNRC licensees have taken effective actions to reduce the number of leak events. One main reason for this decreasing trend was the elimination or reportable leakages from valve stem packing after 1991. Our review of leak events related to vibratory fatigue reveals a statistically significant decreasing trend with age (years of operation), but not in calendar time. Our assessment of worldwide data on leakage caused by thermal fatigue cracking is that the fatigue of aging piping is a safety significant issue. Our review of leak events has identified several susceptible sites in piping having high safety significance; but the inspection of some of these sites is not required by the ASME Code. These sites may be included in the risk-informed inspection programs.

  19. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  20. Field Mapping At Salt Wells Area (Coolbaugh, Et Al., 2006) |...

    Open Energy Info (EERE)

    Basis Geochemical water sampling, mineral distribution mapping, and shallow (30 cm) temperature probe measurements were conducted to expand on a previous field mapping study...

  1. Use of Remote Technology in the Surface Water Environmental Monitoring Program at SRS Reducing Measurements in the Field - 13336

    SciTech Connect (OSTI)

    Eddy, T.; Terry, B.; Meyer, A.; Hall, J.; Allen, P.; Hughey, D.; Hartley, T.

    2013-07-01

    There are a wide range of sensor and remote technology applications available for use in environmental monitoring programs. Each application has its own set of limitations and can be challenging when attempting to utilize it under diverse environmental field conditions. The Savannah River Site Environmental Monitoring Program has implemented several remote sensing and surface water flow technologies that have increased the quality of the data while reducing the number of field measurements. Implementation of this technology reduced the field time for personnel that commute across the Savannah River Site (SRS) over a span of 310 square miles. The wireless surface water flow technology allows for immediate notification of changing field conditions or equipment failure thus reducing data-loss or erroneous field data and improving data-quality. This wireless flow technology uses the stage-to-flow methodology coupled with implementation of a robust highly accurate Acoustic Doppler Profiler system for measuring discharge under various field conditions. Savings for implementation of the wireless flow application and Flowlink{sup R} technology equates to approximately 1175 hours annually for the radiological liquid effluent and surveillance programs. The SonTek River Suveyor and Flowtracker technologies are utilized for calibration of the wireless flow monitoring devices in the site streams and validation of effluent flows at the SRS. Implementation of similar wireless devices is also planned in the National Pollutant Discharge Elimination System (NPDES) Storm-water Monitoring Program. SRS personnel have been developing a unique flow actuator device. This device activates an ISCO{sup TM} automated sampler under flowing conditions at storm-water outfall locations across the site. This technology is unique in that it was designed to be used under field conditions with rapid changes in flow and sedimentation where traditional actuators have been unsuccessful in tripping the

  2. Report on the analysis of field data relating to the reliability of solar hot water systems.

    SciTech Connect (OSTI)

    Menicucci, David F.

    2011-07-01

    Utilities are overseeing the installations of thousand of solar hot water (SHW) systems. Utility planners have begun to ask for quantitative measures of the expected lifetimes of these systems so that they can properly forecast their loads. This report, which augments a 2009 reliability analysis effort by Sandia National Laboratories (SNL), addresses this need. Additional reliability data have been collected, added to the existing database, and analyzed. The results are presented. Additionally, formal reliability theory is described, including the bathtub curve, which is the most common model to characterize the lifetime reliability character of systems, and for predicting failures in the field. Reliability theory is used to assess the SNL reliability database. This assessment shows that the database is heavily weighted with data that describe the reliability of SHW systems early in their lives, during the warranty period. But it contains few measured data to describe the ends of SHW systems lives. End-of-life data are the most critical ones to define sufficiently the reliability of SHW systems in order to answer the questions that the utilities pose. Several ideas are presented for collecting the required data, including photometric analysis of aerial photographs of installed collectors, statistical and neural network analysis of energy bills from solar homes, and the development of simple algorithms to allow conventional SHW controllers to announce system failures and record the details of the event, similar to how aircraft black box recorders perform. Some information is also presented about public expectations for the longevity of a SHW system, information that is useful in developing reliability goals.

  3. Evaluation of repeated measurements of radon-222 concentrations in well water sampled from bedrock aquifers of the Piedmont near Richmond, Virginia, USA: Effects of lithology and well characteristics

    SciTech Connect (OSTI)

    Harris, Shelley A. . E-mail: saharris@vcu.edu; Billmeyer, Ernest R.; Robinson, Michael A.

    2006-07-15

    Radon ({sup 222}Rn) concentrations in 26 ground water wells of two distinct lithologies in the Piedmont of Virginia were measured to assess variation in ground water radon concentrations (GWRC), to evaluate differences in concentrations related to well characteristics, lithology, and spatial distributions, and to assess the feasibility of predicting GWRC. Wells were sampled in accordance with American Public Health Association Method 7500 Rn-B, with modifications to include a well shaft profile analysis that determined the minimum purge time sufficient to remove the equivalent of one column of water from each well. Statistically significant differences in GWRC were found in the Trssu (1482{+-}1711 pCi/L) and Mpg (7750{+-}5188 pCi/L) lithologies, however, no significant differences were found among GWRC at each well over time. Using multiple regression, 86% of the variability (R {sup 2}) in the GWRC was explained by the lithology, latitudinal class, and water table elevation of the wells. The GWRC in a majority of the wells studied exceed US Environmental Protection Agency designated maximum contaminant level and AMCL. Results support modifications to sampling procedures and indicate that, in previous studies, variations in GWRC concentrations over time may have been due in part to differences in sampling procedures and not in source water.

  4. Method for determination of .sup.18 O/.sup.16 O and .sup.2 H/.sup.1 H ratios and .sup.3 H (tritium) concentrations of xylem waters and subsurface waters using time series sampling

    DOE Patents [OSTI]

    Smith, Brian; Menchaca, Leticia

    1999-01-01

    A method for determination of .sup.18 O/.sup.16 O and .sup.2 H/.sup.1 H ratios and .sup.3 H concentrations of xylem and subsurface waters using time series sampling, insulating sampling chambers, and combined .sup.18 O/.sup.16 O, .sup.2 H/.sup.1 H and .sup.3 H concentration data on transpired water. The method involves collecting water samples transpired from living plants and correcting the measured isotopic compositions of oxygen (.sup.18 O/.sup.16 O) and hydrogen (.sup.2 H/.sup.1 H and/or .sup.3 H concentrations) to account for evaporative isotopic fractionation in the leafy material of the plant.

  5. Retrofit Integrated Space & Water Heating: Field Assessment, Minneapolis, Minnesota (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2014-05-01

    This project analyzed combined condensing water heaters or boilers and hydronic air coils to provide high efficiency domestic hot water and forced air space heating. Called 'Combi' systems, they provided similar space and water heating performance less expensively than installing two condensing appliances. The system's installed costs were cheaper than installing a condensing furnace and either a condensing tankless or condensing storage water heater. However, combi costs must mature and be reduced before they are competitive with a condensing furnace and power vented water heater (EF of 0.60). Better insulation and tighter envelopes are reducing space heating loads for new and existing homes. For many homes, decreased space heating loads make it possible for both space and domestic water heating loads to be provided with a single heating plant. These systems can also eliminate safety issues associated with natural draft appliances through the use of one common sealed combustion vent.

  6. Report from the Field: Nutrient and Energy Recovery at DC Water

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    BLUE PLAINS - WASHINGTON DC NUTRIENT & ENERGY RECOVERY FACILITY DCWater - Mark Ramirez mramirez@dcwater.com District of Columbia Water and Sewer Authority George S. Hawkins, General Manager 2 We have been recognized as a profession that protects the environment and public health. We are now beginning to be recognized as resource stewards, needing to recover and utilize valuable and important resources as well. Introduction WATER RESOURCE RECOVERY FACILITY OUR VISION CLEAN WATER - PROCESSES

  7. Technology Case Studies: Retrofit Integrated Space and Water Heating - Field Assessment

    SciTech Connect (OSTI)

    2014-05-01

    Better insulation and tighter envelopes are reducing space heating loads for new and existing homes. For many homes, decreased space heating loads make it possible for both space and domestic water heating loads to be provided with a single heating plant. This project analyzed combined condensing water heaters or boilers and hydronic air coils to provide high efficiency domestic hot water and forced air space heating. Called 'Combi' systems, they provided similar space and water heating performance less expensively than installing two condensing appliances. These systems can also eliminate safety issues associated with natural draft appliances through the use of one common sealed combustion vent.

  8. Building America Expert Meeting: Exploring the Disconnect Between Rated and Field Performance of Water Heating Systems

    Broader source: Energy.gov [DOE]

    Water heating represents a major residential energy end use, especially in highly efficient homes where space conditioning loads and energy use has been significantly reduced. Future efforts to reduce water heating energy use requires the development of an improved understanding of equipment performance, as well as recognizing system interactions related to the distribution system and the fixture use characteristics. By bringing together a group of water heating experts, we hope to advance the shared knowledge on key water heating performance issues and identify additional data needs that will further this critical research area.

  9. Sample size requirements for estimating effective dose from computed tomography using solid-state metal-oxide-semiconductor field-effect transistor dosimetry

    SciTech Connect (OSTI)

    Trattner, Sigal; Cheng, Bin; Pieniazek, Radoslaw L.; Hoffmann, Udo; Douglas, Pamela S.; Einstein, Andrew J.

    2014-04-15

    Purpose: Effective dose (ED) is a widely used metric for comparing ionizing radiation burden between different imaging modalities, scanners, and scan protocols. In computed tomography (CT), ED can be estimated by performing scans on an anthropomorphic phantom in which metal-oxide-semiconductor field-effect transistor (MOSFET) solid-state dosimeters have been placed to enable organ dose measurements. Here a statistical framework is established to determine the sample size (number of scans) needed for estimating ED to a desired precision and confidence, for a particular scanner and scan protocol, subject to practical limitations. Methods: The statistical scheme involves solving equations which minimize the sample size required for estimating ED to desired precision and confidence. It is subject to a constrained variation of the estimated ED and solved using the Lagrange multiplier method. The scheme incorporates measurement variation introduced both by MOSFET calibration, and by variation in MOSFET readings between repeated CT scans. Sample size requirements are illustrated on cardiac, chest, and abdomenpelvis CT scans performed on a 320-row scanner and chest CT performed on a 16-row scanner. Results: Sample sizes for estimating ED vary considerably between scanners and protocols. Sample size increases as the required precision or confidence is higher and also as the anticipated ED is lower. For example, for a helical chest protocol, for 95% confidence and 5% precision for the ED, 30 measurements are required on the 320-row scanner and 11 on the 16-row scanner when the anticipated ED is 4 mSv; these sample sizes are 5 and 2, respectively, when the anticipated ED is 10 mSv. Conclusions: Applying the suggested scheme, it was found that even at modest sample sizes, it is feasible to estimate ED with high precision and a high degree of confidence. As CT technology develops enabling ED to be lowered, more MOSFET measurements are needed to estimate ED with the same

  10. Use of Ambersorb{reg_sign} carbonaceous adsorbent for removal of BTEX compounds from oil-field produced water

    SciTech Connect (OSTI)

    Gallup, D.L.; Isacoff, E.G.; Smith, D.N. III

    1996-12-31

    The removal of high concentrations of BTEX compounds (benzene, toluene, ethylbenzene and xylenes) from oil-field produced waters using a carbonaceous adsorbent was successfully demonstrated in the field. The carbonaceous adsorbent was much more effective in removing BTEX compounds from produced water than activated carbon or modified clays. The primary objectives of the field studies were to evaluate the efficiency of oil removal processes to protect the adsorbent from fouling, to determine the BTEX removal efficiency of a carbonaceous adsorbent at a high flow rate loading, and to demonstrate regeneration of the adsorbent. Adsorbent fouling with oil was mitigated by mechanical coalescing for heavier crude and emulsion-breaking for lighter crude. Adsorbent extenders and filters did not control fouling in the presence of exceedingly emulsified crude oil. Carbonaceous adsorbent reduced BTEX compounds levels from the 25-130 mg/l range to less than 1 mg/l treating approximately 500 bed volumes of produced water per cycle. Regeneration of the adsorbent using low pressure steam or solvents was successfully achieved with regeneration efficiencies exceeding 95 percent. 13 refs., 7 figs., 4 tabs.

  11. Performance of Gas-fired Water Heaters in a 10-home Field Study

    Broader source: Energy.gov [DOE]

    This presentation was given at the Summer 2012 DOE Building America meeting on July 25, 2012, and addressed the question "Are high-efficiency hot water heating systems worth the cost?"

  12. Report from the Field: Nutrient and Energy Recovery at DC Water

    Office of Energy Efficiency and Renewable Energy (EERE)

    Presentation by Mark Ramirez, DC Water, during the "Technological State of the Art" panel at the Hydrogen, Hydrocarbons, and Bioproduct Precursors from Wastewaters Workshop held March 18–19, 2015.

  13. Field sampling and analysis plan for the removal action at the former YS-860 Firing Ranges, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1998-03-01

    The former YS-860 Firing Ranges are located at the eastern end of the Oak Ridge Y-12 Plant outside the primary facility fence line and west of Scarboro Road within the Upper East Fork Poplar Creek watershed in Oak Ridge, Tennessee. A decision has been made by the US Department of Energy to conduct a removal action of lead-contaminated soils at this site as part of early source actions within the Upper East Fork Poplar Creek watershed. This non-time critical removal action of bullets and lead-contaminated soil from the YS-860 Firing Ranges is being conducted as a Comprehensive Environmental Response, Compensation, and Liability Act of 1980 action. These actions are consistent with the Oak Ridge Reservation Environmental Restoration Program. The removal action will focus on the excavation of bullets and lead-contaminated soil from the shooting range berms, transportation of the material to a permitted treatment facility for disposal, demolition and land filling of a concrete trench and asphalt pathways at the site, and grading and revegetating of the entire site. This report is the field sampling and analysis plan for the removal action at the former YS-860 Firing Ranges. The field sampling and analysis plan addresses environmental sampling for lead after the removal of lead-contaminated soil from the target berm area. The objective of this sampling plan is to obtain sufficient analytical data to confirm that the removal action excavation has successfully reduced lead levels in soil to below the action level of 1,400 micrograms/g.

  14. Y-12 Groundwater Protection Program Groundwater And Surface Water Sampling And Analysis Plan For Calendar Year 2014

    SciTech Connect (OSTI)

    2013-09-01

    This plan provides a description of the groundwater and surface water quality monitoring activities planned for calendar year (CY) 2014 at the U.S. Department of Energy (DOE) Y-12 National Security Complex (Y-12) that will be managed by the Y-12 Groundwater Protection Program (GWPP). Groundwater and surface water monitoring is performed by the GWPP during CY 2014 to achieve the following goals: 􀁸 to protect the worker, the public, and the environment; 􀁸 to maintain surveillance of existing and potential groundwater contamination sources; 􀁸 to provide for the early detection of groundwater contamination and determine the quality of groundwater and surface water where contaminants are most likely to migrate beyond the Oak Ridge Reservation property line; 􀁸 to identify and characterize long-term trends in groundwater quality at Y-12; and 􀁸 to provide data to support decisions concerning the management and protection of groundwater resources. Groundwater and surface water monitoring will be performed in three hydrogeologic regimes at Y-12.

  15. Simulations of the quart (101-bar1)/water interface: A comparison of classical force fields, ab initi molecular dynamics, and x-ray reflectivity experiments.

    SciTech Connect (OSTI)

    Skelton, Adam; Fenter, Paul; Kubicki, James D.; Wesolowski, David J; Cummings, Peter T

    2011-01-01

    Classical molecular dynamics (CMD) simulations of the (1011) surface of quartz interacting with bulk liquid water are performed using three different classical force fields, Lopes et al., ClayFF, and CHARMM water contact angle (CWCA), and compared to ab initio molecular dynamics (AIMD) and X-ray reflectivity (XR) results. The axial densities of the water and surface atoms normal to the surface are calculated and compared to previous XR experiments. Favorable agreement is shown for all the force fields with respect to the position of the water atoms. Analyses such as the radial distribution functions between water and hydroxyl atoms and the average cosine of the angle between the water dipole vector and the normal of the surface are also calculated for each force field. Significant differences are found between the different force fields from such analyses, indicating differing descriptions of the structured water in the near vicinity of the surface. AIMD simulations are also performed to obtain the water and hydroxyl structure for comparison among the predictions of the three classical force fields to better understand which force field is most accurate. It is shown that ClayFF exhibits the best agreement with the AIMD simulations for water hydroxyl radial distribution functions, suggesting that ClayFF treats the hydrogen bonding more accurately.

  16. Heat Pump Water Heaters: Controlled Field Research of Impact on Space Conditioning and Demand Response Characteristics

    SciTech Connect (OSTI)

    Parker, Graham B.; Widder, Sarah H.; Eklund, Ken; Petersen, Joseph M.; Sullivan, Greg

    2015-10-05

    A new generation of heat pump water heaters (HPWH) has been introduced into the U.S. market that promises to provide significant energy savings for water heating. Many electric utilities are promoting their widespread adoption as a key technology for meeting energy conservation goals and reducing greenhouse gas emissions. There is, however, considerable uncertainty regarding the space conditioning impact of an HPWH installed in a conditioned space. There is also uncertainty regarding the potential for deployment of HPWHs in demand response (DR) programs to help manage and balance peak utility loads in a similar manner as conventional electric resistance water heaters (ERWH). To help answer these uncertainties, controlled experiments have been undertaken over 30 months in a matched pair of unoccupied Lab Homes located on the campus of the Pacific Northwest National Laboratory (PNNL) in Richland, Washington.

  17. Heterogeneous ice nucleation and water uptake by field-collected atmospheric particles below 273 K

    SciTech Connect (OSTI)

    Wang, Bingbing; Laskin, Alexander; Roedel, Tobias R.; Gilles, Marry K.; Moffet, Ryan C.; Tivanski, Alexei V.; Knopf, Daniel A.

    2012-09-25

    Atmospheric ice formation induced by particles with complex chemical and physical properties through heterogeneous nucleation is not well understood. Heterogeneous ice nucleation and water uptake by ambient particles collected from urban environments in Los Angeles and Mexico City are presented. Using a vapour controlled cooling system equipped with an optical microscopy, the range of onset conditions for ice nucleation and water uptake by the collected particles was determined as a function of temperature (200{273 K) and relative humidity with respect to ice (RHice) up to water saturation. Three distinctly different types of authentic atmospheric particles were investigated including soot particles associated with organics/inorganics, inorganic particles of marine origin coated with organic material, and Pb/Zn containing inorganic particles apportioned to anthropogenic emissions relevant to waste incineration. Single particle characterization was provided by micro-spectroscopic analyses using computer controlled scanning electron microscopy with energy dispersive analysis of X-rays (CCSEM/EDX) and scanning transmission X-ray microscopy with near edge X-ray absorption ne structure spectroscopy (STXM/NEXAFS). Above 230 K, signicant differences in water uptake and immersion freezing effciencies of the different particle types were observed. Below 230 K, the particles exhibited high deposition ice nucleation effciencies and formed ice at RHice values well below homogeneous ice nucleation limits. The data show that the chemical composition of these eld{collected particles plays an important role in determining water uptake and immersion freezing. Heterogeneous ice nucleation rate coeffcients, cumulative ice nuclei (IN) spectrum, and IN activated fraction for deposition ice nucleation are derived. The presented ice nucleation data demonstrate that anthropogenic and marine particles comprising of various chemical and physical properties exhibit distinctly different ice

  18. Design of electric-field assisted surface plasmon resonance system for the detection of heavy metal ions in water

    SciTech Connect (OSTI)

    Kyaw, Htet Htet; Boonruang, Sakoolkan E-mail: waleed.m@bu.ac.th; Mohammed, Waleed S. E-mail: waleed.m@bu.ac.th; Dutta, Joydeep

    2015-10-15

    Surface Plasmon Resonance (SPR) sensors are widely used in diverse applications. For detecting heavy metal ions in water, surface functionalization of the metal surface is typically used to adsorb target molecules, where the ionic concentration is detected via a resonance shift (resonance angle, resonance wavelength or intensity). This paper studies the potential of a possible alternative approach that could eliminate the need of using surface functionalization by the application of an external electric field in the flow channel. The exerted electrical force on the ions pushes them against the surface for enhanced adsorption; hence it is referred to as “Electric-Field assisted SPR system”. High system sensitivity is achieved by monitoring the time dynamics of the signal shift. The ion deposition dynamics are discussed using a derived theoretical model based on ion mobility in water. On the application of an appropriate force, the target ions stack onto the sensor surface depending on the ionic concentration of target solution, ion mass, and flow rate. In the experimental part, a broad detection range of target cadmium ions (Cd{sup 2+}) in water from several parts per million (ppm) down to a few parts per billion (ppb) can be detected.

  19. Method and apparatus utilizing ionizing and microwave radiation for saturation determination of water, oil and a gas in a core sample

    DOE Patents [OSTI]

    Maerefat, N.L.; Parmeswar, R.; Brinkmeyer, A.D.; Honarpour, M.

    1994-08-23

    A system is described for determining the relative permeabilities of gas, water and oil in a core sample has a microwave emitter/detector subsystem and an X-ray emitter/detector subsystem. A core holder positions the core sample between microwave absorbers which prevent diffracted microwaves from reaching a microwave detector where they would reduce the signal-to-noise ratio of the microwave measurements. The microwave emitter/detector subsystem and the X-ray emitter/detector subsystem each have linear calibration characteristics, allowing one subsystem to be calibrated with respect to the other subsystem. The dynamic range of microwave measurements is extended through the use of adjustable attenuators. This also facilitates the use of core samples with wide diameters. The stratification characteristics of the fluids may be observed with a windowed cell separator at the outlet of the core sample. The condensation of heavy hydrocarbon gas and the dynamic characteristics of the fluids are observed with a sight glass at the outlet of the core sample. 11 figs.

  20. Method and apparatus utilizing ionizing and microwave radiation for saturation determination of water, oil and a gas in a core sample

    DOE Patents [OSTI]

    Maerefat, Nicida L.; Parmeswar, Ravi; Brinkmeyer, Alan D.; Honarpour, Mehdi

    1994-01-01

    A system for determining the relative permeabilities of gas, water and oil in a core sample has a microwave emitter/detector subsystem and an X-ray emitter/detector subsystem. A core holder positions the core sample between microwave absorbers which prevent diffracted microwaves from reaching a microwave detector where they would reduce the signal-to-noise ratio of the microwave measurements. The microwave emitter/detector subsystem and the X-ray emitter/detector subsystem each have linear calibration characteristics, allowing one subsystem to be calibrated with respect to the other subsystem. The dynamic range of microwave measurements is extended through the use of adjustable attenuators. This also facilitates the use of core samples with wide diameters. The stratification characteristics of the fluids may be observed with a windowed cell separator at the outlet of the core sample. The condensation of heavy hydrocarbon gas and the dynamic characteristics of the fluids are observed with a sight glass at the outlet of the core sample.

  1. Near-field thermal radiative transfer and thermoacoustic effects from vapor plumes produced by pulsed CO{sub 2} laser ablation of bulk water

    SciTech Connect (OSTI)

    Kudryashov, S. I.; Lyon, Kevin; Allen, S. D.

    2006-12-15

    Submillimeter deep heating of bulk water by thermal radiation from ablative water plumes produced by a 10.6 {mu}m transversely excited atmospheric CO{sub 2} laser and the related acoustic generation has been studied using a contact time-resolved photoacoustic technique. Effective penetration depths of thermal radiation in water were measured as a function of incident laser fluence and the corresponding plume temperatures were estimated. The near-field thermal and thermoacoustic effects of thermal radiation in laser-ablated bulk water and their potential near-field implications are discussed.

  2. Radiochemical procedures for analysis of Pu, Am, Cs and Sr in water, soil, sediments and biota samples

    SciTech Connect (OSTI)

    Wong, K.M.; Jokela, T.A.; Noshkin, V.E.

    1994-02-01

    The Environmental Radioactivity Analysis Laboratory (ERAL) was established as an analytical facility. The primary function of ERAL is to provide fast and accurate radiological data of environmental samples. Over the years, many radiochemical procedures have been developed by the staffs of ERAL. As result, we have found that our procedures exist in many different formats and in many different notebooks, documents and files. Therefore, in order to provide for more complete and orderly documentation of the radiochemical procedures that are being used by ERAL, we have decided to standardize the format and compile them into a series of reports. This first report covers procedures we have developed and are using for the radiochemical analysis of Pu, Am, Cs, and Sr in various matrices. Additional analytical procedures and/or revisions for other elements will be reported as they become available through continuation of these compilation efforts.

  3. Bechtel Jacobs Company LLC Sampling and Analysis Plan for the Water Resources Restoration Program for Fiscal Year 2009, Oak Ridge Reservation, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Ketelle R.H.

    2008-09-25

    The Oak Ridge Reservation (ORR) Water Resources Restoration Program (WRRP) was established by the U. S. Department of Energy (DOE) in 1996 to implement a consistent approach to long-term environmental monitoring across the ORR. The WRRP has four principal objectives: (1) to provide the data and technical analysis necessary to assess the performance of completed Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) actions on the ORR; (2) to perform monitoring to establish a baseline against which the performance of future actions will be gauged and to support watershed management decisions; (3) to perform interim-status and post-closure permit monitoring and reporting to comply with Resource Conservation and Recovery Act of 1976 (RCRA) requirements; and (4) to support ongoing waste management activities associated with WRRP activities. Water quality projects were established for each of the major facilities on the ORR: East Tennessee Technology Park (ETTP); Oak Ridge National Laboratory (ORNL), including Bethel Valley and Melton Valley; and the Y-12 National Security Complex (Y-12 Complex or Y-12), including Bear Creek Valley (BCV), Upper East Fork Poplar Creek (UEFPC), and Chestnut Ridge. Off-site (i.e., located beyond the ORR boundary) sampling requirements are also managed as part of the Y-12 Water Quality Project (YWQP). Offsite locations include those at Lower East Fork Poplar Creek (LEFPC), the Clinch River/Poplar Creek (CR/PC), and Lower Watts Bar Reservoir (LWBR). The Oak Ridge Associated Universities (ORAU) South Campus Facility (SCF) is also included as an 'off-site' location, although it is actually situated on property owned by DOE. The administrative watersheds are shown in Fig. A.l (Appendix A). The WRRP provides a central administrative and reporting function that integrates and coordinates the activities of the water quality projects, including preparation and administration of the WRRP Sampling and Analysis Plan

  4. FIELD DEMONSTRATION OF A MEMBRANE PROCESS TO RECOVER HEAVY HYDROCARBONS AND TO REMOVE WATER FROM NATURAL GAS

    SciTech Connect (OSTI)

    R. Baker; T. Hofmann; J. Kaschemekat; K.A. Lokhandwala; Membrane Group; Module Group; Systems Group

    2001-01-11

    The objective of this project is to design, construct and field demonstrate a 3-MMscfd membrane system to recover natural gas liquids (NGL) and remove water from raw natural gas. An extended field test to demonstrate system performance under real-world conditions is required to convince industry users of the efficiency and reliability of the process. The system will be designed and fabricated by Membrane Technology and Research, Inc. (MTR) and then installed and operated at British Petroleum (BP)-Amoco's Pascagoula, MS plant. The Gas Research Institute will partially support the field demonstration and BP-Amoco will help install the unit and provide onsite operators and utilities. The gas processed by the membrane system will meet pipeline specifications for dewpoint and Btu value and can be delivered without further treatment to the pipeline. Based on data from prior membrane module tests, the process is likely to be significantly less expensive than glycol dehydration followed by propane refrigeration, the principal competitive technology. At the end of this demonstration project the process will be ready for commercialization. The route to commercialization will be developed during this project and may involve collaboration with other companies already servicing the natural gas processing industry.

  5. Field Demonstration of a Membrane Process to Recover Heavy Hydrocarbons and to Remove Water from Natural Gas

    SciTech Connect (OSTI)

    Kaaeid Lokhandwala

    2003-09-29

    The objective of this project is to design, construct and field demonstrate a membrane system to recover natural gas liquids (NGLs) and remove water from raw natural gas. To convince industry users of the efficiency and reliability of the process, we plan to conduct an extended field test to demonstrate system performance under real-world conditions. The membrane system has been designed and fabricated by Membrane Technology and Research, Inc. (MTR). The MTR membrane system and the compressor are now onsite at BP's Pascagoula, MS plant. The plant is undergoing a very significant expansion and the installation of the membrane unit into the test location is being implemented, albeit at a slower rate than we expected. The startup of the system and conducting of tests will occur in the next six months, depending on the availability of the remaining budget. In the interim, significant commercial progress has been made regarding the introduction of the NGL membrane and systems into the natural gas market.

  6. Colloid characterization and quantification in groundwater samples

    SciTech Connect (OSTI)

    K. Stephen Kung

    2000-06-01

    This report describes the work conducted at Los Alamos National Laboratory for studying the groundwater colloids for the Yucca Mountain Project in conjunction with the Hydrologic Resources Management Program (HRMP) and the Underground Test Area (UGTA) Project. Colloidal particle size distributions and total particle concentration in groundwater samples are quantified and characterized. Colloid materials from cavity waters collected near underground nuclear explosion sites by HRMP field sampling personnel at the Nevada Test Site (NTS) were quantified. Selected colloid samples were further characterized by electron microscope to evaluate the colloid shapes, elemental compositions, and mineral phases. The authors have evaluated the colloid size and concentration in the natural groundwater sample that was collected from the ER-20-5 well and stored in a 50-gallon (about 200-liter) barrel for several months. This groundwater sample was studied because HRMP personnel have identified trace levels of radionuclides in the water sample. Colloid results show that even though the water sample had filtered through a series of Millipore filters, high-colloid concentrations were identified in all unfiltered and filtered samples. They had studied the samples that were diluted with distilled water and found that diluted samples contained more colloids than the undiluted ones. These results imply that colloids are probably not stable during the storage conditions. Furthermore, results demonstrate that undesired colloids have been introduced into the samples during the storage, filtration, and dilution processes. They have evaluated possible sources of colloid contamination associated with sample collection, filtrating, storage, and analyses of natural groundwaters. The effects of container types and sample storage time on colloid size distribution and total concentration were studied to evaluate colloid stability by using J13 groundwater. The data suggests that groundwater samples

  7. FIELD DEMONSTRATION OF A MEMBRANE PROCESS TO RECOVER HEAVY HYDROCARBONS AND TO REMOVE WATER FROM NATURAL GAS

    SciTech Connect (OSTI)

    Unknown

    2002-04-10

    The objective of this project is to design, construct and field demonstrate a 3-MMscfd membrane system to recover natural gas liquids (NGL) and remove water from raw natural gas. The gas processed by the membrane system will meet pipeline specifications for dew point and Btu value, and the process is likely to be significantly less expensive than glycol dehydration followed by propane refrigeration, the principal competitive technology. The BP-Amoco gas processing plant in Pascagoula, MS was finalized as the location for the field demonstration. Detailed drawings of the MTR membrane skid (already constructed) were submitted to the plant in February, 2000. However, problems in reaching an agreement on the specifications of the system compressor delayed the project significantly, so MTR requested (and was subsequently granted) a no-cost extension to the project. Following resolution of the compressor issues, the goal is to order the compressor during the first quarter of 2002, and to start field tests in mid-2002. Information from potential users of the membrane separation process in the natural gas processing industry suggests that applications such as fuel gas conditioning and wellhead gas processing are the most promising initial targets. Therefore, most of our commercialization effort is focused on promoting these applications. Requests for stream evaluations and for design and price quotations have been received through MTR's web site, from direct contact with potential users, and through announcements in industry publications. To date, about 90 commercial quotes have been supplied, and orders totaling about $1.13 million for equipment or rental of membrane units have been received.

  8. Implementation and testing of the on-the-fly thermal scattering Monte Carlo sampling method for graphite and light water in MCNP6

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pavlou, Andrew T.; Ji, Wei; Brown, Forrest B.

    2016-01-23

    Here, a proper treatment of thermal neutron scattering requires accounting for chemical binding through a scattering law S(α,β,T). Monte Carlo codes sample the secondary neutron energy and angle after a thermal scattering event from probability tables generated from S(α,β,T) tables at discrete temperatures, requiring a large amount of data for multiscale and multiphysics problems with detailed temperature gradients. We have previously developed a method to handle this temperature dependence on-the-fly during the Monte Carlo random walk using polynomial expansions in 1/T to directly sample the secondary energy and angle. In this paper, the on-the-fly method is implemented into MCNP6 andmore » tested in both graphite-moderated and light water-moderated systems. The on-the-fly method is compared with the thermal ACE libraries that come standard with MCNP6, yielding good agreement with integral reactor quantities like k-eigenvalue and differential quantities like single-scatter secondary energy and angle distributions. The simulation runtimes are comparable between the two methods (on the order of 5–15% difference for the problems tested) and the on-the-fly fit coefficients only require 5–15 MB of total data storage.« less

  9. Low-Cost Batch Solar Water Heater Research and Development Project: results from extended field monitoring. Final report, January 1, 1983-May 15, 1983

    SciTech Connect (OSTI)

    Stickney, B.L.

    1984-02-01

    This report contains the results of a four month field test and evaluation of a 30 gallon inverted batch solar water heater known as the Bottomgainer. It was installed on a residence in Santa Fe and monitored with automatic data recorders including solar radiation meter, dual channel Btu meters, water meter and 16 channel strip chart temperature recorder. Average values of heat gain, heat loss, collection efficiency, solar heating fraction and cash benefits are presented and discussed.

  10. Field Summary Report for Remedial Investigation of Hanford Site Releases to the Columbia River, Hanford Site, Washington, Collection of Surface Water, River Sediments, and Island Soils

    SciTech Connect (OSTI)

    L. C. Hulstrom

    2009-09-28

    This report has been prepared in support of the remedial investigation of Hanford Site Releases to the Columbia River and describes the 2008/2009 data collection efforts. This report documents field activities associated with collection of sediment, river water, and soil in and adjacent to the Columbia River near the Hanford Site and in nearby tributaries.

  11. [Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio]. Volume 2, Work plan: Phase 1, Task 4, Field Investigation: Draft

    SciTech Connect (OSTI)

    Not Available

    1991-10-01

    In April 1990 Wright-Patterson Air Force Base (WPAFB) initiated an investigation to evaluate a potential CERCLA removal action to prevent, to the extent practicable, the migration of ground-water contamination in the Mad River Valley Aquifer within and across WPAFB boundaries. The action will be based on a Focused Feasibility Study with an Action Memorandum serving as a decision document that is subject to approval by the Ohio Environmental Protection Agency. The first phase (Phase 1) of this effort involves an investigation of ground-water contamination migrating across the southwest boundary of Area C and across Springfield Pike adjacent to Area B. Task 4 of Phase 1 is a field investigation to collect sufficient additional information to evaluate removal alternatives. The field investigation will provide information in the following specific areas of study: water-level data which will be used to permit calibration of the ground-water flow model to a unique time in history; and ground-water quality data which will be used to characterize the current chemical conditions of ground water.

  12. Development and testing of a photometric method to identify non-operating solar hot water systems in field settings.

    SciTech Connect (OSTI)

    He, Hongbo; Vorobieff, Peter V.; Menicucci, David; Mammoli, Andrea A.; Carlson, Jeffrey J.

    2012-06-01

    This report presents the results of experimental tests of a concept for using infrared (IR) photos to identify non-operational systems based on their glazing temperatures; operating systems have lower glazing temperatures than those in stagnation. In recent years thousands of new solar hot water (SHW) systems have been installed in some utility districts. As these numbers increase, concern is growing about the systems dependability because installation rebates are often based on the assumption that all of the SHW systems will perform flawlessly for a 20-year period. If SHW systems routinely fail prematurely, then the utilities will have overpaid for grid-energy reduction performance that is unrealized. Moreover, utilities are responsible for replacing energy for loads that failed SHW system were supplying. Thus, utilities are seeking data to quantify the reliability of SHW systems. The work described herein is intended to help meet this need. The details of the experiment are presented, including a description of the SHW collectors that were examined, the testbed that was used to control the system and record data, the IR camera that was employed, and the conditions in which testing was completed. The details of the associated analysis are presented, including direct examination of the video records of operational and stagnant collectors, as well as the development of a model to predict glazing temperatures and an analysis of temporal intermittency of the images, both of which are critical to properly adjusting the IR camera for optimal performance. Many IR images and a video are presented to show the contrast between operating and stagnant collectors. The major conclusion is that the technique has potential to be applied by using an aircraft fitted with an IR camera that can fly over an area with installed SHW systems, thus recording the images. Subsequent analysis of the images can determine the operational condition of the fielded collectors. Specific

  13. Long Term Field Development of a Surfactant Modified Zeolite/Vapor Phase Bioreactor System for Treatment of Produced Waters for Power Generation

    SciTech Connect (OSTI)

    Lynn Katz; Kerry Kinney; Robert Bowman; Enid Sullivan; Soondong Kwon; Elaine Darby; Li-Jung Chen; Craig Altare

    2007-12-31

    The main goal of this research was to investigate the feasibility of using a combined physicochemical/biological treatment system to remove the organic constituents present in saline produced water. In order to meet this objective, a physical/chemical adsorption process was developed and two separate biological treatment techniques were investigated. Two previous research projects focused on the development of the surfactant modified zeolite adsorption process (DE-AC26-99BC15221) and development of a vapor phase biofilter (VPB) to treat the regeneration off-gas from the surfactant modified zeolite (SMZ) adsorption system (DE-FC26-02NT15461). In this research, the SMZ/VPB was modified to more effectively attenuate peak loads and to maintain stable biodegradation of the BTEX constituents from the produced water. Specifically, a load equalization system was incorporated into the regeneration flow stream. In addition, a membrane bioreactor (MBR) system was tested for its ability to simultaneously remove the aromatic hydrocarbon and carboxylate components from produced water. The specific objectives related to these efforts included the following: (1) Optimize the performance VPBs treating the transient loading expected during SMZ regeneration: (a) Evaluate the impact of biofilter operating parameters on process performance under stable operating conditions. (b) Investigate how transient loads affect biofilter performance, and identify an appropriate technology to improve biological treatment performance during the transient regeneration period of an SMZ adsorption system. (c) Examine the merits of a load equalization technology to attenuate peak VOC loads prior to a VPB system. (d) Evaluate the capability of an SMZ/VPB to remove BTEX from produced water in a field trial. (2) Investigate the feasibility of MBR treatment of produced water: (a) Evaluate the biodegradation of carboxylates and BTEX constituents from synthetic produced water in a laboratory-scale MBR. (b

  14. Application of Pulsed Electrical Fields for Advanced Cooling and Water Recovery in Coal-Fired Power Plant

    SciTech Connect (OSTI)

    Young Cho; Alexander Fridman

    2009-04-02

    The overall objective of the present work was to develop technologies to reduce freshwater consumption in a cooling tower of coal-based power plant so that one could significantly reduce the need of make-up water. The specific goal was to develop a scale prevention technology based an integrated system of physical water treatment (PWT) and a novel filtration method so that one could reduce the need for the water blowdown, which accounts approximately 30% of water loss in a cooling tower. The present study investigated if a pulsed spark discharge in water could be used to remove deposits from the filter membrane. The test setup included a circulating water loop and a pulsed power system. The present experiments used artificially hardened water with hardness of 1,000 mg/L of CaCO{sub 3} made from a mixture of calcium chloride (CaCl{sub 2}) and sodium carbonate (Na{sub 2}CO{sub 3}) in order to produce calcium carbonate deposits on the filter membrane. Spark discharge in water was found to produce strong shockwaves in water, and the efficiency of the spark discharge in cleaning filter surface was evaluated by measuring the pressure drop across the filter over time. Results showed that the pressure drop could be reduced to the value corresponding to the initial clean state and after that the filter could be maintained at the initial state almost indefinitely, confirming the validity of the present concept of pulsed spark discharge in water to clean dirty filter. The present study also investigated the effect of a plasma-assisted self-cleaning filter on the performance of physical water treatment (PWT) solenoid coil for the mitigation of mineral fouling in a concentric counterflow heat exchanger. The self-cleaning filter utilized shockwaves produced by pulse-spark discharges in water to continuously remove scale deposits from the surface of the filter, thus keeping the pressure drop across the filter at a relatively low value. Artificial hard water was used in the

  15. An apparatus for the study of high temperature water radiolysis in a nuclear reactor: Calibration of dose in a mixed neutron/gamma radiation field

    SciTech Connect (OSTI)

    Edwards, Eric J.; Wilson, Paul P. H.; Anderson, Mark H.; Mezyk, Stephen P.; Pimblott, Simon M.; Bartels, David M.

    2007-12-15

    The cooling water of nuclear reactors undergoes radiolytic decomposition induced by gamma, fast electron, and neutron radiation in the core. To model the process, recombination reaction rates and radiolytic yields for the water radical fragments need to be measured at high temperature and pressure. Yields for the action of neutron radiation are particularly hard to determine independently because of the beta/gamma field also present in any reactor. In this paper we report the design of an apparatus intended to measure neutron radiolysis yields as a function of temperature and pressure. A new methodology for separation of neutron and beta/gamma radiolysis yields in a mixed radiation field is proposed and demonstrated.

  16. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Protections: Sampling Protections: Sampling Protection #3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece of the Strategy, ensures that LANL collects relevant and appropriate data to answer questions about the protection of human and environmental health, and to satisfy regulatory requirements. LANL must demonstrate the data are technically justified

  17. Vapor–Liquid Equilibrium and Polarization Behavior of the GCP Water Model: Gaussian Charge-on-Spring versus Dipole Self-Consistent Field Approaches to Induced Polarization

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chialvo, Ariel A.; Moucka, Filip; Vlcek, Lukas; Nezbeda, Ivo

    2015-03-24

    Here we implemented the Gaussian charge-on-spring (GCOS) version of the original self-consistent field implementation of the Gaussian Charge Polarizable water model and test its accuracy to represent the polarization behavior of the original model involving smeared charges and induced dipole moments. Moreover, for that purpose we adapted the recently developed multiple-particle-move (MPM) within the Gibbs and isochoric-isothermal ensembles Monte Carlo methods for the efficient simulation of polarizable fluids. We also assessed the accuracy of the GCOS representation by a direct comparison of the resulting vapor-liquid phase envelope, microstructure, and relevant microscopic descriptors of water polarization along the orthobaric curve againstmore » the corresponding quantities from the actual GCP water model.« less

  18. Vapor-liquid Equilibria and Polarization Behavior of the GCP Water Model: Gaussian Charge-on-spring versus Dipole Self-consistent Field approaches to induced polarization

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chialvo, Ariel A; Moucka, Filip; Vlcek, Lukas; Nezbeda, Ivo

    2015-01-01

    We implemented the Gaussian charge-on-spring (GCOS) version of the original self-consistent field implementation of the Gaussian Charge Polarizable water model and test its accuracy to represent the polarization behavior of the original model involving smeared charges and induced dipole moments. For that purpose we adapted the recently developed multiple-particle-move (MPM) within the Gibbs and isochoric-isothermal ensembles Monte Carlo methods for the efficient simulation of polarizable fluids. We assessed the accuracy of the GCOS representation by a direct comparison of the resulting vapor-liquid phase envelope, microstructure, and relevant microscopic descriptors of water polarization along the orthobaric curve against the corresponding quantitiesmore » from the actual GCP water model.« less

  19. Semivolatile organic (GC-MS) and inorganic analyses of groundwater samples during the hydrous pyrolysis/oxidation (HPO) field test in Visalia, CA, 1997

    SciTech Connect (OSTI)

    Chiarappa, M; Knauss, K G; Kumamoto, G; Leif, R N; Newmark, R L

    1998-02-05

    Hydrous pyrolysis/oxidation (HPO) is a novel, in situ, thermal-remediation technology that uses hot, oxygenated groundwater to completely oxidize a wide range of organic pollutants. A field demonstration of HPO was performed during the summer of 1997 at the Southern California Edison Pole Yard in Visalia, California, a site contaminated with creosote. The goal of the field experiment was to confirm the success of HPO under field remediation conditions. The groundwater was heated by steam injections, and oxygen was added by co-injection of compressed air. The progress of the HPO remediation process was evaluated by monitoring groundwater from multiple wells for dissolved oxygen, dissolved inorganic carbon, and dissolved organic contaminant levels. Analyses of groundwater chemistry allowed us to measure the concentrations of creosote components and to identify oxygenated intermediates produced by the HPO treatment. Dissolved organic carbon levels increased in response to steam injections because of the enhanced dissolution and mobilization of the creosote into the heated groundwater. Elevated concentrations of phenols and benzoic acid were measured in wells affected by the steam injections. Concentrations of other oxygenated compounds (i.e., fluorenone, anthrone, and 9,10-anthracenedione) increased in response to the steam injections. The production of these partially oxidized compounds is consistent with the aqueous-phase HPO reactions of creosote. Additional changes in the groundwater in response to steam injection were also consistent with the groundwater HPO chemistry. A drop in dissolved oxygen was observed in the aquifer targeted for the steam injections, and isotope shifts in the dissolved inorganic pool reflected the input of oxidized carbon derived from the creosote carbon.

  20. Groundwater Sampling | Open Energy Information

    Open Energy Info (EERE)

    500 mL), whereas analysis for stable isotopes that are present in greater abundance in natural samples requires less water to be sampled by a full order of magnitude (approximately...

  1. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Protection 3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental ...

  2. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece...

  3. The measured field performances of eight different mechanical and air-lift water-pumping wind-turbines

    SciTech Connect (OSTI)

    Kentfield, J.A.C.

    1996-12-31

    Results are presented of the specific performances of eight, different, water-pumping wind-turbines subjected to impartial tests at the Alberta Renewable Energy Test Site (ARETS), Alberta, Canada. The results presented which were derived from the test data, obtained independently of the equipment manufacturers, are expressed per unit of rotor projected area to eliminate the influence of machine size. Hub-height wind speeds and water flow rates for a common lift of 5.5 m (18 ft) constitute the essential test data. A general finding was that, to a first approximation, there were no major differences in specific performance between four units equipped with conventional reciprocating pumps two of which employed reduction gearing and two of which did not. It was found that a unit equipped with a Moyno pump performed well but three air-lift machines had, as was expected, poorer specific performances than the more conventional equipment. 10 refs., 9 figs.

  4. Field-measured performance of four full-scale cylindrical stratified chilled-water thermal storage tanks

    SciTech Connect (OSTI)

    Musser, A.; Bahnfleth, W.P.

    1999-07-01

    Results are presented for controlled flow rate tests in four full-scale cylindrical chilled-water storage tanks. The tanks range in volume from 1.15 to 5.18 million gallons (4.35 to 19.61 million liters) and have water depths of 40 to 65 ft (12.2 to 19.8 m). Water is introduced into and withdrawn from two of these tanks using radial parallel plate diffusers, while the remaining two tanks utilize octagonal slotted pipe diffuser designs. Thermal performance is quantified for full cycles in terms of Figure of Merit, for single charge and discharge processes as half-cycle Figure of Merit, and for incomplete charge and discharge processes as Lost Capacity. Results show that the thermal performance of all four tanks is excellent, with less than 4% of theoretical cooling capacity lost to inlet mixing and other degradation mechanisms for flow rates less than or equal to design. Based on these results, the appropriateness of current design guidance is discussed. Operational issues that affect implementation of controlled flow rate full-scale tests are also identified, and measurement issues are addressed.

  5. SAMPLING SYSTEM

    DOE Patents [OSTI]

    Hannaford, B.A.; Rosenberg, R.; Segaser, C.L.; Terry, C.L.

    1961-01-17

    An apparatus is given for the batch sampling of radioactive liquids such as slurries from a system by remote control, while providing shielding for protection of operating personnel from the harmful effects of radiation.

  6. Sampling box

    DOE Patents [OSTI]

    Phillips, Terrance D.; Johnson, Craig

    2000-01-01

    An air sampling box that uses a slidable filter tray and a removable filter cartridge to allow for the easy replacement of a filter which catches radioactive particles is disclosed.

  7. WATER TREATMENT

    DOE Patents [OSTI]

    Pitman, R.W.; Conley, W.R. Jr.

    1962-12-01

    An automated system for adding clarifying chemicals to water in a water treatment plant is described. To a sample of the floc suspension polyacrylamide or similar filter aid chemicals are added, and the sample is then put through a fast filter. The resulting filtrate has the requisite properties for monitoring in an optical turbidimeter to control the automated system. (AEC)

  8. Creating Sample Plans

    Energy Science and Technology Software Center (OSTI)

    1999-03-24

    The program has been designed to increase the accuracy and reduce the preparation time for completing sampling plans. It consists of our files 1. Analyte/Combination (AnalCombo) A list of analytes and combinations of analytes that can be requested of the onsite and offsite labs. Whenever a specific combination of analytes or suite names appear on the same line as the code number, this indicates that one sample can be placed in one bottle to bemore » analyzed for these paremeters. A code number is assigned for each analyte and combination of analytes. 2. Sampling Plans Database (SPDb) A database that contains all of the analytes and combinations of analytes along with the basic information required for preparing a sample plan. That basic information includes the following fields; matrix, hold time, preservation, sample volume, container size, if the bottle caps are taped, acceptable choices. 3. Sampling plans create (SPcreate) a file that will lookup information from the Sampling Plans Database and the Job Log File (JLF98) A major database used by Sample Managemnet Services for recording more than 100 fields of information.« less

  9. SAMPLING OSCILLOSCOPE

    DOE Patents [OSTI]

    Sugarman, R.M.

    1960-08-30

    An oscilloscope is designed for displaying transient signal waveforms having random time and amplitude distributions. The oscilloscopc is a sampling device that selects for display a portion of only those waveforms having a particular range of amplitudes. For this purpose a pulse-height analyzer is provided to screen the pulses. A variable voltage-level shifter and a time-scale rampvoltage generator take the pulse height relative to the start of the waveform. The variable voltage shifter produces a voltage level raised one step for each sequential signal waveform to be sampled and this results in an unsmeared record of input signal waveforms. Appropriate delay devices permit each sample waveform to pass its peak amplitude before the circuit selects it for display.

  10. Sampling apparatus

    DOE Patents [OSTI]

    Gordon, Norman R.; King, Lloyd L.; Jackson, Peter O.; Zulich, Alan W.

    1989-01-01

    A sampling apparatus is provided for sampling substances from solid surfaces. The apparatus includes first and second elongated tubular bodies which telescopically and sealingly join relative to one another. An absorbent pad is mounted to the end of a rod which is slidably received through a passageway in the end of one of the joined bodies. The rod is preferably slidably and rotatably received through the passageway, yet provides a selective fluid tight seal relative thereto. A recess is formed in the rod. When the recess and passageway are positioned to be coincident, fluid is permitted to flow through the passageway and around the rod. The pad is preferably laterally orientable relative to the rod and foldably retractable to within one of the bodies. A solvent is provided for wetting of the pad and solubilizing or suspending the material being sampled from a particular surface.

  11. Sampling apparatus

    DOE Patents [OSTI]

    Gordon, N.R.; King, L.L.; Jackson, P.O.; Zulich, A.W.

    1989-07-18

    A sampling apparatus is provided for sampling substances from solid surfaces. The apparatus includes first and second elongated tubular bodies which telescopically and sealingly join relative to one another. An absorbent pad is mounted to the end of a rod which is slidably received through a passageway in the end of one of the joined bodies. The rod is preferably slidably and rotatably received through the passageway, yet provides a selective fluid tight seal relative thereto. A recess is formed in the rod. When the recess and passageway are positioned to be coincident, fluid is permitted to flow through the passageway and around the rod. The pad is preferably laterally orientable relative to the rod and foldably retractable to within one of the bodies. A solvent is provided for wetting of the pad and solubilizing or suspending the material being sampled from a particular surface. 15 figs.

  12. Environmental surveillance master sampling schedule

    SciTech Connect (OSTI)

    Bisping, L.E.

    1995-02-01

    Environmental surveillance of the Hanford Site and surrounding areas is conducted by the Pacific Northwest Laboratory (PNL) for the U.S. Department of Energy (DOE). This document contains the planned 1994 schedules for routine collection of samples for the Surface Environmental Surveillance Project (SESP), Drinking Water Project, and Ground-Water Surveillance Project. Samples are routinely collected for the SESP and analyzed to determine the quality of air, surface water, soil, sediment, wildlife, vegetation, foodstuffs, and farm products at Hanford Site and surrounding communities. The responsibility for monitoring onsite drinking water falls outside the scope of the SESP. PNL conducts the drinking water monitoring project concurrent with the SESP to promote efficiency and consistency, utilize expertise developed over the years, and reduce costs associated with management, procedure development, data management, quality control, and reporting. The ground-water sampling schedule identifies ground-water sampling .events used by PNL for environmental surveillance of the Hanford Site. Sampling is indicated as annual, semi-annual, quarterly, or monthly in the sampling schedule. Some samples are collected and analyzed as part of ground-water monitoring and characterization programs at Hanford (e.g. Resources Conservation and Recovery Act (RCRA), Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), or Operational). The number of samples planned by other programs are identified in the sampling schedule by a number in the analysis column and a project designation in the Cosample column. Well sampling events may be merged to avoid redundancy in cases where sampling is planned by both-environmental surveillance and another program.

  13. Optical monitor for water vapor concentration

    DOE Patents [OSTI]

    Kebabian, Paul

    1998-01-01

    A system for measuring and monitoring water vapor concentration in a sample uses as a light source an argon discharge lamp, which inherently emits light with a spectral line that is close to a water vapor absorption line. In a preferred embodiment, the argon line is split by a magnetic field parallel to the direction of light propagation from the lamp into sets of components of downshifted and upshifted frequencies of approximately 1575 Gauss. The downshifted components are centered on a water vapor absorption line and are thus readily absorbed by water vapor in the sample; the upshifted components are moved away from that absorption line and are minimally absorbed. A polarization modulator alternately selects the upshifted components or downshifted components and passes the selected components to the sample. After transmission through the sample, the transmitted intensity of a component of the argon line varies as a result of absorption by the water vapor. The system then determines the concentration of water vapor in the sample based on differences in the transmitted intensity between the two sets of components. In alternative embodiments alternate selection of sets of components is achieved by selectively reversing the polarity of the magnetic field or by selectively supplying the magnetic field to the emitting plasma.

  14. Optical monitor for water vapor concentration

    DOE Patents [OSTI]

    Kebabian, P.

    1998-06-02

    A system for measuring and monitoring water vapor concentration in a sample uses as a light source an argon discharge lamp, which inherently emits light with a spectral line that is close to a water vapor absorption line. In a preferred embodiment, the argon line is split by a magnetic field parallel to the direction of light propagation from the lamp into sets of components of downshifted and upshifted frequencies of approximately 1575 Gauss. The downshifted components are centered on a water vapor absorption line and are thus readily absorbed by water vapor in the sample; the upshifted components are moved away from that absorption line and are minimally absorbed. A polarization modulator alternately selects the upshifted components or downshifted components and passes the selected components to the sample. After transmission through the sample, the transmitted intensity of a component of the argon line varies as a result of absorption by the water vapor. The system then determines the concentration of water vapor in the sample based on differences in the transmitted intensity between the two sets of components. In alternative embodiments alternate selection of sets of components is achieved by selectively reversing the polarity of the magnetic field or by selectively supplying the magnetic field to the emitting plasma. 5 figs.

  15. The 800-meter sample toroidal field...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... The team is also improving the cryogenic freezing capability of the pellet extruder and is testing large diameter pellets and combination pellets of deuterium and neon. Long-term ...

  16. Light Water Reactor Sustainability Program: Computer-based procedure for field activities: results from three evaluations at nuclear power plants

    SciTech Connect (OSTI)

    Oxstrand, Johanna; Bly, Aaron; LeBlanc, Katya

    2014-09-01

    Nearly all activities that involve human interaction with the systems of a nuclear power plant are guided by procedures. The paper-based procedures (PBPs) currently used by industry have a demonstrated history of ensuring safety; however, improving procedure use could yield tremendous savings in increased efficiency and safety. One potential way to improve procedure-based activities is through the use of computer-based procedures (CBPs). Computer-based procedures provide the opportunity to incorporate context driven job aids, such as drawings, photos, just-in-time training, etc into CBP system. One obvious advantage of this capability is reducing the time spent tracking down the applicable documentation. Additionally, human performance tools can be integrated in the CBP system in such way that helps the worker focus on the task rather than the tools. Some tools can be completely incorporated into the CBP system, such as pre-job briefs, placekeeping, correct component verification, and peer checks. Other tools can be partly integrated in a fashion that reduces the time and labor required, such as concurrent and independent verification. Another benefit of CBPs compared to PBPs is dynamic procedure presentation. PBPs are static documents which limits the degree to which the information presented can be tailored to the task and conditions when the procedure is executed. The CBP system could be configured to display only the relevant steps based on operating mode, plant status, and the task at hand. A dynamic presentation of the procedure (also known as context-sensitive procedures) will guide the user down the path of relevant steps based on the current conditions. This feature will reduce the user’s workload and inherently reduce the risk of incorrectly marking a step as not applicable and the risk of incorrectly performing a step that should be marked as not applicable. As part of the Department of Energy’s (DOE) Light Water Reactors Sustainability Program

  17. Laboratory development and field application of a novel water-based drill-in fluid for geopressured horizontal wells

    SciTech Connect (OSTI)

    Dobson, J.W.; Harrison, J.C.; Hale, A.H.

    1996-12-31

    Research has identified a novel water-based drill-in fluid for drilling and completing geopressured horizontal wells. This fluid has a unique combination of properties which make it especially suitable for geopressured applications. They include the use of calcium and/or zinc bromide as a base brine, minimal concentration of calcium carbonate as bridging material, low plastic viscosity, tight fluid loss control, good filter cake properties, and excellent return permeability. This drill-in fluid has been used successfully to drill a 1,200 foot production interval, 4.75 inch diameter wellbore in the Gulf of Mexico with a system weight of 13.2 lbm/gal, bottom hole temperature of 185{degrees} F., and a 1400 to 1700 psi overbalance. The system functioned very well in both the drilling and completion operations. Fluid rheology was easily maintainable and the hole conditions were excellent without torque or drag problems. Initial production data suggests that the well is producing at expected rates with low drawdown pressure.

  18. Analytical and experimental study of the acoustics and the flow field characteristics of cavitating self-resonating water jets

    SciTech Connect (OSTI)

    Chahine, G.L.; Genoux, P.F.; Johnson, V.E. Jr.; Frederick, G.S.

    1984-09-01

    Waterjet nozzles (STRATOJETS) have been developed which achieve passive structuring of cavitating submerged jets into discrete ring vortices, and which possess cavitation incipient numbers six times higher than obtained with conventional cavitating jet nozzles. In this study we developed analytical and numerical techniques and conducted experimental work to gain an understanding of the basic phenomena involved. The achievements are: (1) a thorough analysis of the acoustic dynamics of the feed pipe to the nozzle; (2) a theory for bubble ring growth and collapse; (3) a numerical model for jet simulation; (4) an experimental observation and analysis of candidate second-generation low-sigma STRATOJETS. From this study we can conclude that intensification of bubble ring collapse and design of highly resonant feed tubes can lead to improved drilling rates. The models here described are excellent tools to analyze the various parameters needed for STRATOJET optimizations. Further analysis is needed to introduce such important factors as viscosity, nozzle-jet interaction, and ring-target interaction, and to develop the jet simulation model to describe the important fine details of the flow field at the nozzle exit.

  19. Transition Helmholtz free energy, entropy, and heat capacity of free-standing smectic films in water: A mean-field treatment

    SciTech Connect (OSTI)

    Śliwa, Izabela; Zakharov, A. V.

    2014-11-21

    Using the extended McMillan's mean field approach with anisotropic forces a study of both the structural and thermodynamic properties of free-standing smectic film (FSSF) in water on heating to the isotropic temperature is carried out numerically. By solving the self-consistent nonlinear equations for the order parameters, we obtained that the smectic-A-isotropic (AI) transition occurs through the series of layer-thinning transitions causing the films to thin in the stepwise manner as the temperature is increased above the bulk smectic-A-isotropic temperature T{sub AI}(bulk). With enhanced pair interactions in the bounding layers, the smectic-isotropic transition corresponds to smectic melting of the central layers. The effects of surface “enhanced” pair interactions in the bounding layers and of film thickness on the orientational and translational order parameters, the Helmholtz free energy and entropy, as well as the temperature dependence of the heat capacity of FSSFs, have also been investigated. Reasonable agreement between the theoretically predicted and the experimentally obtained – by means of optical microscopy and ellipsometry techniques – data of the temperature when the thin decylcyanobiphenyl smectic film immersing in water ruptures has been obtained.

  20. Responses of soil respiration to elevated CO2, air warming, and changing soil water availability in an old-field grassland

    SciTech Connect (OSTI)

    Wan, Shiqiang [Chinese Academy of Sciences; Norby, Richard J [ORNL; Childs, Joanne [ORNL; Weltzin, Jake [University of Tennessee, Knoxville (UTK)

    2007-01-01

    Responses of soil respiration to atmospheric and climatic change will have profound impacts on ecosystem and global C cycling in the future. This study was conducted to examine effects on soil respiration of the concurrent driving factors of elevated atmospheric CO2 concentration, rising temperature, and changing precipitation in a constructed old-field grassland in eastern Tennessee, USA. Model ecosystems of seven old-field species in 12 open-top chambers (4 m in diameter) were treated with two CO2 (ambient and ambient plus 300 ppm) and two temperature (ambient and ambient plus 3 C) levels. Two split plots with each chamber were assigned with high and low soil moisture levels. During the 19-month experimental period from June 2003 to December 2004, higher CO2 concentration and soil water availability significantly increased mean soil respiration by 35.8% and 15.7%, respectively. The effects of air warming on soil respiration varied seasonally from small reductions to significant increases to no response, and there was no significant main effect. In the wet side of elevated CO2 chambers, air warming consistently caused increases in soil respiration, whereas in other three combinations of CO2 and water treatments, warming tended to decrease soil respiration over the growing season but increase it over the winter. There were no interactive effects on soil respiration among any two or three treatment factors irrespective of testing time period. Temperature sensitivity of soil respiration was reduced by air warming, lower in the wet than the dry side, and not affected by CO2 treatment. Variations of soil respiration responses with soil temperature and soil moisture ranges could be primarily attributable to the seasonal dynamics of plant growth and its responses to the three treatments. Using a conceptual model to interpret the significant relationships of treatment-induced changes in soil respiration with changes in soil temperature and moisture observed in this study

  1. Manus Water Isotope Investigation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9 Manus Water Isotope Investigation Field Campaign Report JL Conroy D Noone KM Cobb March ... DOESC-ARM-15-079 Manus Water Isotope Investigation Field Campaign Report JL Conroy, ...

  2. Manus Water Isotope Investigation

    Office of Scientific and Technical Information (OSTI)

    ENERGY Office of Science DOESC-ARM-15-079 Manus Water Isotope Investigation Field ... DOESC-ARM-15-079 Manus Water Isotope Investigation Field Campaign Report JL Conroy, ...

  3. Visual Sample Plan

    Energy Science and Technology Software Center (OSTI)

    2007-10-25

    VSP selects the appropriate number and location of environmental samples to ensure that the results of statistical tests performed to provide input to risk decisions have the required confidence and performance. VSP Version 5.0 provides sample-size equations or algorithms needed by specific statistical tests appropriate for specific environmental sampling objectives. It also provides data quality assessment and statistical analysis functions to support evaluation of the data and determine whether the data support decisions regarding sitesmore » suspected of contamination. The easy-to-use program is highly visual and graphic. VSP runs on personal computers with Microsoft Windows operating systems (98, NT, 2000, Millennium Edition, CE, and XP) Designed primarily for project managers and users without expertise in statistics, VSP is applicable to two- and three-dimensional populations to be sampled (e.g., rooms and buildings, surface soil, a defined layer of subsurface soil, water bodies, and other similar applications) for studies of environmental quality. VSP is also applicable for designing sampling plans for assessing chem./rad/bio threat and hazard identification within rooms and buildings, and for designing geophysical surveys for UXO identification.« less

  4. Amphiphilic mediated sample preparation for micro-flow cytometry

    DOE Patents [OSTI]

    Clague, David S. (Livermore, CA); Wheeler, Elizabeth K. (Livermore, CA); Lee, Abraham P. (Irvine, CA)

    2006-07-25

    A flow cytometer includes a flow cell for detecting the sample, an oil phase in the flow cell, a water phase in the flow cell, an oil-water interface between the oil phase and the water phase, a detector for detecting the sample at the oil-water interface, and a hydrophobic unit operatively connected to the sample. The hydrophobic unit is attached to the sample. The sample and the hydrophobic unit are placed in an oil and water combination. The sample is detected at the interface between the oil phase and the water phase.

  5. Amphiphilic mediated sample preparation for micro-flow cytometry

    DOE Patents [OSTI]

    Clague, David S.; Wheeler, Elizabeth K.; Lee, Abraham P.

    2009-03-17

    A flow cytometer includes a flow cell for detecting the sample, an oil phase in the flow cell, a water phase in the flow cell, an oil-water interface between the oil phase and the water phase, a detector for detecting the sample at the oil-water interface, and a hydrophobic unit operatively connected to the sample. The hydrophobic unit is attached to the sample. The sample and the hydrophobic unit are placed in an oil and water combination. The sample is detected at the interface between the oil phase and the water phase.

  6. Micropyrolyzer for chemical analysis of liquid and solid samples

    DOE Patents [OSTI]

    Mowry, Curtis D.; Morgan, Catherine H.; Manginell, Ronald P.; Frye-Mason, Gregory C.

    2006-07-18

    A micropyrolyzer has applications to pyrolysis, heated chemistry, and thermal desorption from liquid or solid samples. The micropyrolyzer can be fabricated from semiconductor materials and metals using standard integrated circuit technologies. The micropyrolyzer enables very small volume samples of less than 3 microliters and high sample heating rates of greater than 20.degree. C. per millisecond. A portable analyzer for the field analysis of liquid and solid samples can be realized when the micropyrolyzer is combined with a chemical preconcentrator, chemical separator, and chemical detector. Such a portable analyzer can be used in a variety of government and industrial applications, such as non-proliferation monitoring, chemical and biological warfare detection, industrial process control, water and air quality monitoring, and industrial hygiene.

  7. AUTOMATING GROUNDWATER SAMPLING AT HANFORD THE NEXT STEP

    SciTech Connect (OSTI)

    CONNELL CW; CONLEY SF; HILDEBRAND RD; CUNNINGHAM DE; R_D_Doug_Hildebrand@rl.gov; DeVon_E_Cunningham@rl.gov

    2010-01-21

    Historically, the groundwater monitoring activities at the Department of Energy's Hanford Site in southeastern Washington State have been very "people intensive." Approximately 1500 wells are sampled each year by field personnel or "samplers." These individuals have been issued pre-printed forms showing information about the well(s) for a particular sampling evolution. This information is taken from 2 official electronic databases: the Hanford Well information System (HWIS) and the Hanford Environmental Information System (HEIS). The samplers used these hardcopy forms to document the groundwater samples and well water-levels. After recording the entries in the field, the samplers turned the forms in at the end of the day and other personnel posted the collected information onto a spreadsheet that was then printed and included in a log book. The log book was then used to make manual entries of the new information into the software application(s) for the HEIS and HWIS databases. A pilot project for automating this extremely tedious process was lauched in 2008. Initially, the automation was focused on water-level measurements. Now, the effort is being extended to automate the meta-data associated with collecting groundwater samples. The project allowed electronic forms produced in the field by samplers to be used in a work flow process where the data is transferred to the database and electronic form is filed in managed records - thus eliminating manually completed forms. Elimating the manual forms and streamlining the data entry not only improved the accuracy of the information recorded, but also enhanced the efficiency and sampling capacity of field office personnel.

  8. ARM - Field Campaign - PGS Validatation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govCampaignsPGS Validatation ARM Data Discovery Browse Data Related Campaigns Precision Gas Sampling (PGS) Validation Field Campaign 2008.01.01, Fischer, SGP Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : PGS Validatation 2009.03.01 - 2010.02.28 Lead Scientist : Marc Fischer For data sets, see below. Abstract The focus of this project was the prediction of landscape-scale fluxes of CO2, water, and sensible heat that drive variations

  9. Gas Sampling At Wister Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    Gas Sampling At Wister Area (DOE GTP) (Redirected from Water-Gas Samples At Wister Area (DOE GTP)) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration...

  10. Surface Gas Sampling At Lightning Dock Area (Norman & Moore,...

    Open Energy Info (EERE)

    Surface Gas Sampling At Lightning Dock Area (Norman & Moore, 2004) (Redirected from Water-Gas Samples At Lightning Dock Area (Norman & Moore, 2004)) Jump to: navigation, search...

  11. Gas Sampling At Colrado Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    Gas Sampling At Colrado Area (DOE GTP) (Redirected from Water-Gas Samples At Colrado Area (DOE GTP)) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration...

  12. Nevada National Security Site Integrated Groundwater Sampling Plan, Revision 0

    SciTech Connect (OSTI)

    Marutzky, Sam; Farnham, Irene

    2014-10-01

    The purpose of the Nevada National Security Site (NNSS) Integrated Sampling Plan (referred to herein as the Plan) is to provide a comprehensive, integrated approach for collecting and analyzing groundwater samples to meet the needs and objectives of the U.S. Department of Energy (DOE), National Nuclear Security Administration Nevada Field Office (NNSA/NFO) Underground Test Area (UGTA) Activity. Implementation of this Plan will provide high-quality data required by the UGTA Activity for ensuring public protection in an efficient and cost-effective manner. The Plan is designed to ensure compliance with the UGTA Quality Assurance Plan (QAP). The Plan’s scope comprises sample collection and analysis requirements relevant to assessing the extent of groundwater contamination from underground nuclear testing. This Plan identifies locations to be sampled by corrective action unit (CAU) and location type, sampling frequencies, sample collection methodologies, and the constituents to be analyzed. In addition, the Plan defines data collection criteria such as well-purging requirements, detection levels, and accuracy requirements; identifies reporting and data management requirements; and provides a process to ensure coordination between NNSS groundwater sampling programs for sampling of interest to UGTA. This Plan does not address compliance with requirements for wells that supply the NNSS public water system or wells involved in a permitted activity.

  13. System for treating produced water

    DOE Patents [OSTI]

    Sullivan, Enid J.; Katz, Lynn; Kinney, Kerry; Bowman, Robert S.; Kwon, Soondong

    2010-08-03

    A system and method were used to treat produced water. Field-testing demonstrated the removal of contaminants from produced water from oil and gas wells.

  14. Environmental surveillance master sampling schedule

    SciTech Connect (OSTI)

    Bisping, L.E.

    1991-01-01

    Environmental surveillance of the Hanford Site and surrounding areas is conducted by the Pacific Northwest Laboratory (PNL) for the US Department of Energy (DOE). This document contains the planned schedule for routine sample collection for the Surface Environmental Surveillance Project (SESP) and Ground-Water Monitoring Project. The routine sampling plan for the SESP has been revised this year to reflect changing site operations and priorities. Some sampling previously performed at least annually has been reduced in frequency, and some new sampling to be performed at a less than annual frequency has been added. Therefore, the SESP schedule reflects sampling to be conducted in calendar year 1991 as well as future years. The ground-water sampling schedule is for 1991. This schedule is subject to modification during the year in response to changes in Site operation, program requirements, and the nature of the observed results. Operational limitations such as weather, mechanical failures, sample availability, etc., may also require schedule modifications. Changes will be documented in the respective project files, but this plan will not be reissued. The purpose of these monitoring projects is to evaluate levels of radioactive and nonradioactive pollutants in the Hanford evirons.

  15. Field evaluation of hazardous waste site bioassessment protocols

    SciTech Connect (OSTI)

    Thomas, J.M.; Cline, J.F.; Cushing, C.E.; McShane, M.C.; Rogers, J.E.; Rogers, L.E.; Simpson, J.C.; Skalski, J.R.

    1983-04-01

    The goals were: (1) determine the variability (both within and between laboratories) for the various bioassay procedures using contaminated soil samples from the Rocky Mountain Arsenal (RMA); (2) assess variability within and between plots for several assessment techniques (for sampling small mammals, plants, insects including honeybees and microarthropods) so that field studies could be designed to detect a defined biotic change; (3) establish three field plant transects which are apparently (a) contaminated, (b) appear contaminated and (c) could serve as a control; (4) assess the feasibility (in the laboratory) of using Basin F water to contaminate RMA soil artificially, and to supply information for the design of a field plot study in 1983; (5) attempt to obtain preliminary data on any promising field or laboratory bioassessment techniques not currently mentioned in the statement of work; and (6) obtain field data to assess the ecological status of RMA lakes and compare these observations to results from bioassessment testing.

  16. Field Testing of Pre-Production Prototype Residential Heat Pump...

    Energy Savers [EERE]

    Field Testing of Pre-Production Prototype Residential Heat Pump Water Heaters Field Testing of Pre-Production Prototype Residential Heat Pump Water Heaters Provides and overview of ...

  17. Field Summary Report for Remedial Investigation of Hanford Site Releases to the Columbia River, Hanford Site, Washington

    SciTech Connect (OSTI)

    L.C. Hulstrom

    2010-08-11

    This report summarizes field sampling activities conducted in support of WCH’s Remedial Investigation of Hanford Site Releases to the Columbia River. This work was conducted form 2008 through 2010. The work included preliminary mapping and measurement of Hanford Site contaminants in sediment, pore water, and surface water located in areas where groundwater upwelling were found.

  18. Field Summary Report for Remedial Investigation of Hanford Site Releases to the Coumbia River, Hanford Site, Washington

    SciTech Connect (OSTI)

    L.C. Hulstrom

    2010-11-10

    This report summarizes field sampling activities conducted in support of WCH’s Remedial Investigation of Hanford Site Releases to the Columbia River. This work was conducted form 2008 through 2010. The work included preliminary mapping and measurement of Hanford Site contaminants in sediment, pore water, and surface water located in areas where groundwater upwelling were found.

  19. Field-Derived Hydraulic Properties for Perched-Water Aquifer Wells 299-E33-350 and 299-E33-351, Hanford Site B-Complex Area

    SciTech Connect (OSTI)

    Newcomer, Darrell R.

    2014-07-01

    During February and March 2014, Pacific Northwest National Laboratory conducted hydraulic (slug) tests at 200-DV-1 Operable Unit wells 299-E33-350 (C8914) and 299-E33-351 (C8915) as part of B-Complex Area Perched-Water characterization activities at the Hanford Site 200-East Area. During the construction/completion phase of each well, two overlapping depth intervals were tested within the unconfined perched-water aquifer contained in the silty-sand subunit of the Cold Creek Unit. The purpose of the slug-test characterization was to provide estimates of transmissivity and hydraulic conductivity for the perched-water aquifer at these selected well locations.

  20. Geothermal/Well Field | Open Energy Information

    Open Energy Info (EERE)

    Well Field < Geothermal Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Land Use Planning Leasing Exploration Well Field Power Plant Grid Connection Environment Water...

  1. LCLS Sample Preparation Laboratory | Sample Preparation Laboratories

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    LCLS Sample Preparation Laboratory Kayla Zimmerman | (650) 926-6281 Lisa Hammon, LCLS Lab Coordinator Welcome to the LCLS Sample Preparation Laboratory. This small general use wet lab is located in Rm 109 of the Far Experimental Hall near the MEC, CXI, and XCS hutches. It conveniently serves all LCLS hutches and is available for final stage sample preparation. Due to space limitations, certain types of activities may be restricted and all access must be scheduled in advance. User lab bench

  2. Hydrologic characterization of the Fry Canyon, Utah site prior to field demonstration of reactive chemical barriers to control radionuclide and trace-element contamination in ground water

    SciTech Connect (OSTI)

    Naftz, D.L.; Freethey, G.W.; Davis, J.A.

    1997-12-31

    The Fry Canyon Site in southeastern Utah has been selected as a long term demonstration site to assess the performance of selected reaction barrier technologies for the removal of uranium and other trace elements from ground water. Objectives include site characterization and evaluation of barrier technologies.

  3. Chemical Free Water Analysis with Nanoelectrode Arrays

    Energy Innovation Portal (Marketing Summaries) [EERE]

    2013-06-05

    Electrochemical analysis is a highly sensitive, chemically selective method for identifying and quantifying many different chemicals in water.  Previous art required  field samples be transported to a laboratory where additional chemicals would be added before the analysis could be performed.  Sandia National Laboratories has invented an electrochemical analysis method that has eliminated the need to add chemicals to the testing process while increasing the...

  4. Environmental surveillance master sampling schedule

    SciTech Connect (OSTI)

    Bisping, L E

    1992-01-01

    Environmental surveillance of the Hanford Site and surrounding areas is conducted by the Pacific Northwest Laboratory (PNL) for the US Department of Energy (DOE). This document contains the planned schedule for routine sample collection for the Surface Environmental Surveillance Project (SESP) and Ground-Water Monitoring Project. Samples for radiological analyses include Air-Particulate Filter, gases and vapor; Water/Columbia River, Onsite Pond, Spring, Irrigation, and Drinking; Foodstuffs/Animal Products including Whole Milk, Poultry and Eggs, and Beef; Foodstuffs/Produce including Leafy Vegetables, Vegetables, and Fruit; Foodstuffs/Farm Products including Wine, Wheat and Alfalfa; Wildlife; Soil; Vegetation; and Sediment. Direct Radiation Measurements include Terrestrial Locations, Columbia River Shoreline Locations, and Onsite Roadway, Railway and Aerial, Radiation Surveys.

  5. Visual Sample Plan Flyer

    Office of Energy Efficiency and Renewable Energy (EERE)

    This flyer better explains that VSP is a free, easy-to-use software tool that supports development of optimal sampling plans based on statistical sampling theory.

  6. Irreversible Wash Aid Additive for Cesium Mitigation: Phase II. Selection and/or Modification of COTS Field Portable Waste Water Systems

    SciTech Connect (OSTI)

    Kaminski, Michael; Mertz, Carol; Kivenas, Nadia; Magnuson, Matthew

    2015-01-01

    After an accidental or malicious release of radioactivity, large urban areas may be contaminated, compromising response efforts by first responders and law enforcement officials. In addition, some public services (e.g., drinking water and wastewater treatment, electrical power distribution, etc.) may be disrupted. In such an event, it may be important to deploy mitigation efforts in certain areas to restore response activities and public services (Fig. S-1). This report explores the state-of-the-art approach for a system to rapidly return critical infrastructure components to service following a cesium-137 (Cs-137) radiological dispersal device (RDD) release while avoiding the spread of Cs-137 beyond its original deposition area and minimizing the amount of Cs-137-contaminated wastewater. Specifically, we describe a wash system consisting of chemical additives added to fire hydrant water and irreversible solid sequestering agents added as the water is collected and treated for recycle in situ. The wash system is intended to be a rapidly deployable, cost-effective means of mitigating an urban setting for the purpose of restoring critical infrastructure and operational activities after a radiological release.

  7. Enhanced monitor system for water protection

    DOE Patents [OSTI]

    Hill, David E [Knoxville, TN; Rodriquez, Jr., Miguel [Oak Ridge, TN; Greenbaum, Elias [Knoxville, TN

    2009-09-22

    An automatic, self-contained device for detecting toxic agents in a water supply includes an analyzer for detecting at least one toxic agent in a water sample, introducing a means for introducing a water sample into the analyzer and discharging the water sample from the analyzer, holding means for holding a water sample for a pre-selected period of time before the water sample is introduced into the analyzer, and an electronics package that analyzes raw data from the analyzer and emits a signal indicating the presence of at least one toxic agent in the water sample.

  8. Calculation of resistivity of irreducible water for reserves estimation

    SciTech Connect (OSTI)

    Krieger, F.W.; Eadington, P.J.; Lisk, M.

    1996-12-31

    A new fluid inclusion technique that allows determination of the resistivity of irreducible water trapped during oil accumulation has been developed. The technique is directly applicable to problems associated with the evaluation of oil accumulations which arise when the salinity and thus the resistivity of present day formation waters differ from those of the irreducible water trapped during oil accumulation. It is possible by measuring the ice melting temperature of samples of formation water trapped during creation of three phase, oil-water-vapour inclusions to calculate a salinity for the irreducible water and thus calculate a resistivity to be used in reserves calculations. Salinities of 71,000 to 85,000 parts per million have been measured on three phase inclusions in oil zone samples from the Papuan Foldbelt. Present day salinities in the Papuan Foldbelt are about 10,000-12,000 parts per million indicating that oil charge occurred before the present day hydrologic system was emplaced. Using salinity data from three phase inclusions results in resistivity values of about 0.05 ohm/m for irreducible water while present day formation waters have a resistivity of about 0.3 ohm/m at formation temperatures of 60{degrees}C. Using the water saturation calculated from three phase fluid inclusion salinity data compared with using the water saturation from present day formation water results in an estimated 25 % increase in reserves for oil fields studied in the Papuan Foldbelt.

  9. Calculation of resistivity of irreducible water for reserves estimation

    SciTech Connect (OSTI)

    Krieger, F.W.; Eadington, P.J.; Lisk, M. )

    1996-01-01

    A new fluid inclusion technique that allows determination of the resistivity of irreducible water trapped during oil accumulation has been developed. The technique is directly applicable to problems associated with the evaluation of oil accumulations which arise when the salinity and thus the resistivity of present day formation waters differ from those of the irreducible water trapped during oil accumulation. It is possible by measuring the ice melting temperature of samples of formation water trapped during creation of three phase, oil-water-vapour inclusions to calculate a salinity for the irreducible water and thus calculate a resistivity to be used in reserves calculations. Salinities of 71,000 to 85,000 parts per million have been measured on three phase inclusions in oil zone samples from the Papuan Foldbelt. Present day salinities in the Papuan Foldbelt are about 10,000-12,000 parts per million indicating that oil charge occurred before the present day hydrologic system was emplaced. Using salinity data from three phase inclusions results in resistivity values of about 0.05 ohm/m for irreducible water while present day formation waters have a resistivity of about 0.3 ohm/m at formation temperatures of 60[degrees]C. Using the water saturation calculated from three phase fluid inclusion salinity data compared with using the water saturation from present day formation water results in an estimated 25 % increase in reserves for oil fields studied in the Papuan Foldbelt.

  10. Description of work for 100-N Hanford Generating Plant settling pond drilling and sampling

    SciTech Connect (OSTI)

    Galbraith, R.P.

    1993-09-01

    This description of work details the field activities associated with borehole drilling and sampling of the 100-N Hanford Generating Plant (HGP) Settling Pond and will serve as a field guide for those performing the work. It should be used in conjunction with the Environmental Investigations and Site Characterization Manual (WHC 1988a) for specific procedures. The borehole location is shown in Figure 1. The settling pond, the dimensions of which are 40 m by 16 m (131.3 ft by 52.5 ft), is located at the HGP adjacent to the 100-N Area. The pond received process water from the plant. The water contained trace oxygen scavenging conditioners such as morpholine, hydrazine, and ammonia. Surface radioactivity readings are 150 to 500 cpm. Trace levels of surface contamination are present. Drilling and sampling will be in accordance with procedures in the EII manual (WHC 1988a).

  11. Fluid sampling tool

    DOE Patents [OSTI]

    Garcia, Anthony R.; Johnston, Roger G.; Martinez, Ronald K.

    2000-01-01

    A fluid-sampling tool for obtaining a fluid sample from a container. When used in combination with a rotatable drill, the tool bores a hole into a container wall, withdraws a fluid sample from the container, and seals the borehole. The tool collects fluid sample without exposing the operator or the environment to the fluid or to wall shavings from the container.

  12. The Sample Preparation Laboratories | Sample Preparation Laboratories

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cynthia Patty 1 Sam Webb 2 John Bargar 3 Arizona 4 Chemicals 5 Team Work 6 Bottles 7 Glass 8 Plan Ahead! See the tabs above for Laboratory Access and forms you'll need to complete. Equipment and Chemicals tabs detail resources already available on site. Avoid delays! Hazardous materials use may require a written Standard Operating Procedure (SOP) before you work. Check the Chemicals tab for more information. The Sample Preparation Laboratories The Sample Preparation Laboratories provide wet lab

  13. Draft evaluation of the frequency for gas sampling for the high burnup confirmatory data project

    SciTech Connect (OSTI)

    Stockman, Christine T.; Alsaed, Halim A.; Bryan, Charles R.

    2015-03-26

    This report fulfills the M3 milestone M3FT-15SN0802041, “Draft Evaluation of the Frequency for Gas Sampling for the High Burn-up Storage Demonstration Project” under Work Package FT-15SN080204, “ST Field Demonstration Support – SNL”. This report provides a technically based gas sampling frequency strategy for the High Burnup (HBU) Confirmatory Data Project. The evaluation of: 1) the types and magnitudes of gases that could be present in the project cask and, 2) the degradation mechanisms that could change gas compositions culminates in an adaptive gas sampling frequency strategy. This adaptive strategy is compared against the sampling frequency that has been developed based on operational considerations. Gas sampling will provide information on the presence of residual water (and byproducts associated with its reactions and decomposition) and breach of cladding, which could inform the decision of when to open the project cask.

  14. Radionuclide Sensors for Water Monitoring

    SciTech Connect (OSTI)

    Grate, Jay W.; Egorov, Oleg B.; DeVol, Timothy A.

    2004-06-29

    Radionuclide contamination in the soil and groundwater at U.S. Department of Energy (DOE) sites is a severe problem that requires monitoring and remediation. Radionuclide measurement techniques are needed to monitor surface waters, groundwater, and process waters. Typically, water samples are collected and transported to an analytical laboratory, where costly radiochemical analyses are performed. To date, there has been very little development of selective radionuclide sensors for alpha- and beta-emitting radionuclides such as 90Sr, 99Tc, and various actinides of interest. The objective of this project is to investigate novel sensor concepts and materials for sensitive and selective determination of beta- and alpha-emitting radionuclide contaminants in water. To meet the requirements for low-level, isotope-specific detection, the proposed sensors are based on radiometric detection. As a means to address the fundamental challenge of the short ranges of beta and alpha particle s in water, our overall approach is based on localization of preconcentration/separation chemistries directly on or within the active area of a radioactivity detector. Automated microfluidics is used for sample manipulation and sensor regeneration or renewal. The outcome of these investigations will be the knowledge necessary to choose appropriate chemistries for selective preconcentration of radionuclides from environmental samples, new materials that combine chemical selectivity with scintillating properties, new materials that add chemical selectivity to solid-state diode detectors, new preconcentrating column sensors, and improved instrumentation and signal processing for selective radionuclide sensors. New knowledge will provide the basis for designing effective probes and instrumentation for field and in situ measurements.

  15. Water Analytical Data Tables for 1CQ12.xls

    Office of Legacy Management (LM)

    C Analytical Results for Water Samples-First Quarter CY 2012 This page intentionally left blank Appendix C1 Analytical Results for Water Samples - First Quarter CY 2012 ...

  16. Water Analytical Data Tables for 1CQ11.xls

    Office of Legacy Management (LM)

    Analytical Results for Water Samples-First Quarter CY 2011 This page intentionally left blank Appendix C1 Analytical Results for Water Samples - First Quarter CY 2011 LOCATIONCODE ...

  17. Water Analytical Data Tables for 1CQ10.xls

    Office of Legacy Management (LM)

    Water SamplesFirst Quarter CY 2010 This page intentionally left blank Appendix C Analytical Results for Water Samples - First Quarter CY 2010 LOCATIONCODE LOCATIONTYPE DATE ...

  18. LANSCE | Lujan Center | Chemical & Sample Prep

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Chemical & Sample Preparation For general questions, please contact the Lujan Center Chemical and Sample Preparation Laboratory responsible: Charles Kelsey | ckelsey@lanl.gov | 505.665.5579 Sample and Equipment Shipping Instructions For questions regarding shipping procedures, contact theLujan Center Experiment Coordinator: TBA Chemistry Laboratories High-Pressure Laboratory X-ray Laboratory Spectroscopy Laboratory Clean Room Laboratory Glove box - He atmosphere High-purity water Diamond

  19. Rain sampling device

    DOE Patents [OSTI]

    Nelson, D.A.; Tomich, S.D.; Glover, D.W.; Allen, E.V.; Hales, J.M.; Dana, M.T.

    1991-05-14

    The present invention constitutes a rain sampling device adapted for independent operation at locations remote from the user which allows rainfall to be sampled in accordance with any schedule desired by the user. The rain sampling device includes a mechanism for directing wet precipitation into a chamber, a chamber for temporarily holding the precipitation during the process of collection, a valve mechanism for controllably releasing samples of the precipitation from the chamber, a means for distributing the samples released from the holding chamber into vessels adapted for permanently retaining these samples, and an electrical mechanism for regulating the operation of the device. 11 figures.

  20. Rain sampling device

    DOE Patents [OSTI]

    Nelson, Danny A.; Tomich, Stanley D.; Glover, Donald W.; Allen, Errol V.; Hales, Jeremy M.; Dana, Marshall T.

    1991-01-01

    The present invention constitutes a rain sampling device adapted for independent operation at locations remote from the user which allows rainfall to be sampled in accordance with any schedule desired by the user. The rain sampling device includes a mechanism for directing wet precipitation into a chamber, a chamber for temporarily holding the precipitation during the process of collection, a valve mechanism for controllably releasing samples of said precipitation from said chamber, a means for distributing the samples released from the holding chamber into vessels adapted for permanently retaining these samples, and an electrical mechanism for regulating the operation of the device.

  1. Development of Water Radiolysis Code for the JMTR IASCC Test Loop

    SciTech Connect (OSTI)

    Satoshi Hanawa; Tomonori Sato; Yuichiro Mori; Jin Oogiyanagi; Yoshiyuki Kaji; Shunsuke Uchida

    2006-07-01

    In order to evaluate the water chemistry in the irradiation field during IASCC irradiation test, a water radiolysis code for IASCC irradiation loop system was developed. In the water radiolysis code, a multiple node model was introduced since the irradiation loop system has a wide rage temperature distribution as well as the dose distribution. To investigate the applicability of developed water radiolysis code, water chemistry at the water sampling point of the irradiation loop system was measured and compared with analytical results under several water chemistry conditions. Further, water chemistry distribution in the in-pile region as well as in the out-pile region was calculated by the developed water radiolysis code. (authors)

  2. Analysis of supersaturated air in natural waters and reservoirs

    SciTech Connect (OSTI)

    D'Aoust, B.G.; Clark, M.J.R.

    1980-11-01

    Supersaturation of water by air or other gases can be caused by temperature increase, air or gas injection by pressurized pumping, or turbulent injection by falling water that traps air. The physics of supersaturation are outlined, and alternative sampling and analysis techniques used to evaluate the extent of supersaturation are described. These techniques range from complex, exacting procedures commonly used in the biomedical analytical laboratory to simple, portable methods suited to field application or continuous monitoring. Analytical techniques tested during 1976-78 in the Columbia and Snake river system, both of which were seriously supersaturated as a result of entrainment of air into water spilling over hydroelectric dams, are comparatively evaluated.

  3. Vadose zone water fluxmeter

    DOE Patents [OSTI]

    Faybishenko, Boris A.

    2005-10-25

    A Vadose Zone Water Fluxmeter (WFM) or Direct Measurement WFM provides direct measurement of unsaturated water flow in the vadose zone. The fluxmeter is a cylindrical device that fits in a borehole or can be installed near the surface, or in pits, or in pile structures. The fluxmeter is primarily a combination of tensiometers and a porous element or plate in a water cell that is used for water injection or extraction under field conditions. The same water pressure measured outside and inside of the soil sheltered by the lower cylinder of the fluxmeter indicates that the water flux through the lower cylinder is similar to the water flux in the surrounding soil. The fluxmeter provides direct measurement of the water flow rate in the unsaturated soils and then determines the water flux, i.e. the water flow rate per unit area.

  4. Mg II ABSORPTION SYSTEMS WITH W{sub 0} >= 0.1 A FOR A RADIO SELECTED SAMPLE OF 77 QUASI-STELLAR OBJECTS AND THEIR ASSOCIATED MAGNETIC FIELDS AT HIGH REDSHIFT

    SciTech Connect (OSTI)

    Bernet, M. L.; Miniati, F.; Lilly, S. J. E-mail: fm@phys.ethz.c

    2010-03-01

    We present a catalog of Mg II absorption systems obtained from high-resolution Ultraviolet and Visual Echelle Spectrograph/VLT data of 77 quasi-stellar objects in the redshift range 0.6 < z < 2.0, and down to an equivalent width W{sub 0} >= 0.1 A. The statistical properties of our sample are found to be in agreement with those from the previous work in the literature. However, we point out that the previously observed increase with redshift of partial derivN/partial derivz for weak absorbers pertains exclusively to very weak absorbers with W{sub 0} < 0.1 A. Instead, partial derivN/partial derivz for absorbers with W{sub 0} in the range 0.1-0.3 A actually decreases with redshift, similar to the case of strong absorbers. We then use this catalog to extend our earlier analysis of the links between the Faraday rotation measure (RM) of the quasars and the presence of intervening Mg II absorbing systems in their spectra. In contrast to the case with strong Mg II absorption systems (W{sub 0} > 0.3 A), the weaker systems do not contribute significantly to the observed RM of the background quasars. This is possibly due to the higher impact parameters of the weak systems compared to strong ones, suggesting that the high column density magnetized material that is responsible for the Faraday rotation is located within about 50 kpc of the galaxies. Finally, we show that this result also rules out the possibility that some unexpected secondary correlation between the quasar redshift and its intrinsic RM is responsible for the association of high RM and strong intervening Mg II absorption that we have presented elsewhere, since this would have produced an equal effect for the weak absorption line systems, which exhibit a very similar distribution of quasar redshifts.

  5. Geothermal/Water Use | Open Energy Information

    Open Energy Info (EERE)

    Water Use < Geothermal(Redirected from Water Use) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Land Use Planning Leasing Exploration Well Field Power Plant Grid...

  6. Geothermal/Water Use | Open Energy Information

    Open Energy Info (EERE)

    Water Use < Geothermal Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Land Use Planning Leasing Exploration Well Field Power Plant Grid Connection Environment Water...

  7. Aerosol sampling system

    DOE Patents [OSTI]

    Masquelier, Donald A.

    2004-02-10

    A system for sampling air and collecting particulate of a predetermined particle size range. A low pass section has an opening of a preselected size for gathering the air but excluding particles larger than the sample particles. An impactor section is connected to the low pass section and separates the air flow into a bypass air flow that does not contain the sample particles and a product air flow that does contain the sample particles. A wetted-wall cyclone collector, connected to the impactor section, receives the product air flow and traps the sample particles in a liquid.

  8. Field emission chemical sensor

    DOE Patents [OSTI]

    Panitz, J.A.

    1983-11-22

    A field emission chemical sensor for specific detection of a chemical entity in a sample includes a closed chamber enclosing two field emission electrode sets, each field emission electrode set comprising (a) an electron emitter electrode from which field emission electrons can be emitted when an effective voltage is connected to the electrode set; and (b) a collector electrode which will capture said electrons emitted from said emitter electrode. One of the electrode sets is passive to the chemical entity and the other is active thereto and has an active emitter electrode which will bind the chemical entity when contacted therewith.

  9. Surface Gas Sampling At Lightning Dock Area (Norman, Et Al.,...

    Open Energy Info (EERE)

    Surface Gas Sampling At Lightning Dock Area (Norman, Et Al., 2002) (Redirected from Water-Gas Samples At Lightning Dock Area (Norman, Et Al., 2002)) Jump to: navigation, search...

  10. Sample Proficiency Test exercise

    SciTech Connect (OSTI)

    Alcaraz, A; Gregg, H; Koester, C

    2006-02-05

    The current format of the OPCW proficiency tests has multiple sets of 2 samples sent to an analysis laboratory. In each sample set, one is identified as a sample, the other as a blank. This method of conducting proficiency tests differs from how an OPCW designated laboratory would receive authentic samples (a set of three containers, each not identified, consisting of the authentic sample, a control sample, and a blank sample). This exercise was designed to test the reporting if the proficiency tests were to be conducted. As such, this is not an official OPCW proficiency test, and the attached report is one method by which LLNL might report their analyses under a more realistic testing scheme. Therefore, the title on the report ''Report of the Umpteenth Official OPCW Proficiency Test'' is meaningless, and provides a bit of whimsy for the analyses and readers of the report.

  11. 2003 CBECS Sample Design

    U.S. Energy Information Administration (EIA) Indexed Site

    during the field period. The rate of nonresponse cases where the respondent spoke a language other than English was notably higher for establishments than for buildings (9...

  12. Sampling system and method

    DOE Patents [OSTI]

    Decker, David L.; Lyles, Brad F.; Purcell, Richard G.; Hershey, Ronald Lee

    2013-04-16

    The present disclosure provides an apparatus and method for coupling conduit segments together. A first pump obtains a sample and transmits it through a first conduit to a reservoir accessible by a second pump. The second pump further conducts the sample from the reservoir through a second conduit.

  13. Adaptive Sampling Proxy Application

    Energy Science and Technology Software Center (OSTI)

    2012-10-22

    ASPA is an implementation of an adaptive sampling algorithm [1-3], which is used to reduce the computational expense of computer simulations that couple disparate physical scales. The purpose of ASPA is to encapsulate the algorithms required for adaptive sampling independently from any specific application, so that alternative algorithms and programming models for exascale computers can be investigated more easily.

  14. Biological sample collector

    DOE Patents [OSTI]

    Murphy, Gloria A.

    2010-09-07

    A biological sample collector is adapted to a collect several biological samples in a plurality of filter wells. A biological sample collector may comprise a manifold plate for mounting a filter plate thereon, the filter plate having a plurality of filter wells therein; a hollow slider for engaging and positioning a tube that slides therethrough; and a slide case within which the hollow slider travels to allow the tube to be aligned with a selected filter well of the plurality of filter wells, wherein when the tube is aligned with the selected filter well, the tube is pushed through the hollow slider and into the selected filter well to sealingly engage the selected filter well and to allow the tube to deposit a biological sample onto a filter in the bottom of the selected filter well. The biological sample collector may be portable.

  15. Gas Sampling At Gabbs Valley Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    Gas Sampling At Gabbs Valley Area (DOE GTP) (Redirected from Water-Gas Samples At Gabbs Valley Area (DOE GTP)) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home...

  16. Gas Sampling At Glass Buttes Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    Gas Sampling At Glass Buttes Area (DOE GTP) (Redirected from Water-Gas Samples At Glass Buttes Area (DOE GTP)) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home...

  17. ACL monitoring using a low-flow sampling technique: A case study

    SciTech Connect (OSTI)

    Hurley, D.F.; Whitehouse, J.M.

    1995-12-31

    A dedicated low-flow groundwater sample collection system was designed for implementation in a post-closure ACL monitoring program at the Yaworski Lagoon NPL site in Canterbury, Connecticut. The system includes dedicated bladder pumps with intake ports located in the screened interval of the monitoring wells. This sampling technique was implemented in the spring of 1993. The system was designed to simultaneously obtain samples directly from the screened interval of nested wells in three distinct water bearing zones. Sample collection is begun upon stabilization of field parameters. Other than line volume, no prior purging of the well is required. It was found that dedicated low-flow sampling from the screened interval provides a method of representative sample collection without the bias of suspended solids introduced by traditional techniques of pumping and bailing. Analytical data indicate that measured chemical constituents are representative of groundwater migrating through the screened interval. Upon implementation of the low-flow monitoring system, analytical results exhibited a decrease in concentrations of some organic compounds and metals. The system has also proven to be a cost effective alternative to pumping and bailing which generate large volumes of purge water requiring containment and disposal.

  18. Developing a Biosensor for Estrogens in Water Samples: Study ofthe Real-time Response of Live Cells of the Estrogen-sensitive YeastStrain RMY/ER-ERE using Fluorescence Microscopy

    SciTech Connect (OSTI)

    Wozei, E.; Hermanowicz, S.W.; Holman, H-Y.N.

    2006-01-01

    Using a fluorescein di-{beta}-d-galactopyranoside (FDG) substrate we show that in live cells of an estrogen-sensitive yeast strain RMY/ER-ERE with human estrogen receptor (ER{alpha}) gene and the lacZ gene which encodes {beta}-galactosidase, the uptake of 17{beta}-estradiol (E2) and the subsequent production of {beta}-galactosidase enzyme occur quite rapidly, with maximal enzyme-catalyzed product formation evident after about 30 min of exposure to E2. This finding which agrees with the well-known rates of enzyme-catalyzed reactions could have implications for shortening the duration of environmental sample screening and monitoring regimes using yeast-based estrogen assays, and the development of biosensors for environmental estrogens to complement quantification methods.

  19. Developing a Biosensor for Estrogens in Water Samples: Study ofthe Real-time Response of Live Cells of the Estrogen-sensitive YeastStrain RMY/ER-ERE using Fluorescence Microscopy

    SciTech Connect (OSTI)

    Wozei, E.; Hermanowicz, S.W.; Holman, H-Y.N.

    2005-07-13

    Using a fluorescein di-{beta}-D-galactopyranoside (FDG) substrate we show that in live cells of an estrogen-sensitive yeast strain RMY/ER-ERE with human estrogen receptor (ER{alpha}) gene and the lacZ gene which encodes {beta}-galactosidase, the uptake of 17 {beta}-estradiol (E2) and the subsequent production of {beta}-galactosidase enzyme occur quite rapidly, with maximal enzyme-catalyzed product formation evident after about 30 minutes of exposure to E2. This finding which agrees with the well-known rates of enzyme-catalyzed reactions could have implications for shortening the duration of environmental sample screening and monitoring regimes using yeast-based estrogen assays, and the development of biosensors for environmental estrogens to complement quantification methods.

  20. Purge water management system

    DOE Patents [OSTI]

    Cardoso-Neto, Joao E.; Williams, Daniel W.

    1996-01-01

    A purge water management system for effectively eliminating the production of purge water when obtaining a groundwater sample from a monitoring well. In its preferred embodiment, the purge water management system comprises an expandable container, a transportation system, and a return system. The purge water management system is connected to a wellhead sampling configuration, typically permanently installed at the well site. A pump, positioned with the monitoring well, pumps groundwater through the transportation system into the expandable container, which expands in direct proportion with volume of groundwater introduced, usually three or four well volumes, yet prevents the groundwater from coming into contact with the oxygen in the air. After this quantity of groundwater has been removed from the well, a sample is taken from a sampling port, after which the groundwater in the expandable container can be returned to the monitoring well through the return system. The purge water management system prevents the purge water from coming in contact with the outside environment, especially oxygen, which might cause the constituents of the groundwater to oxidize. Therefore, by introducing the purge water back into the monitoring well, the necessity of dealing with the purge water as a hazardous waste under the Resource Conservation and Recovery Act is eliminated.

  1. Purge water management system

    DOE Patents [OSTI]

    Cardoso-Neto, J.E.; Williams, D.W.

    1995-01-01

    A purge water management system is described for effectively eliminating the production of purge water when obtaining a groundwater sample from a monitoring well. In its preferred embodiment, the purge water management system comprises an expandable container, a transportation system, and a return system. The purge water management system is connected to a wellhead sampling configuration, typically permanently installed at the well site. A pump, positioned with the monitoring well, pumps groundwater through the transportation system into the expandable container, which expands in direct proportion with volume of groundwater introduced, usually three or four well volumes, yet prevents the groundwater from coming into contact with the oxygen in the air. After this quantity of groundwater has been removed from the well, a sample is taken from a sampling port, after which the groundwater in the expandable container can be returned to the monitoring well through the return system. The purge water management system prevents the purge water from coming in contact with the outside environment, especially oxygen, which might cause the constituents of the groundwater to oxidize. Therefore, by introducing the purge water back into the monitoring well, the necessity of dealing with the purge water as a hazardous waste under the Resource Conservation and Recovery Act is eliminated.

  2. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    in an example of grazed land of the Southern Great Plains. In collaboration with Dr. Herman Mayeux, of the USDA Grazing Lands Research Laboratory (GRL), we conducted a...

  3. UCRL-ID-106159 Prototype Engineered Barrier System Field Test

    Office of Scientific and Technical Information (OSTI)

    ... 51 Kenrick Lee and Tzou-Shin Ueng 5. Water Potential Measurements with Thermocouple ... Appendix A. Effective Porosity and Water Permeability of G-Tunnel Tuff Samples ......

  4. Dissolution actuated sample container

    DOE Patents [OSTI]

    Nance, Thomas A.; McCoy, Frank T.

    2013-03-26

    A sample collection vial and process of using a vial is provided. The sample collection vial has an opening secured by a dissolvable plug. When dissolved, liquids may enter into the interior of the collection vial passing along one or more edges of a dissolvable blocking member. As the blocking member is dissolved, a spring actuated closure is directed towards the opening of the vial which, when engaged, secures the vial contents against loss or contamination.

  5. SAMPLING AND ANALYSIS PROTOCOLS

    SciTech Connect (OSTI)

    Jannik, T; P Fledderman, P

    2007-02-09

    Radiological sampling and analyses are performed to collect data for a variety of specific reasons covering a wide range of projects. These activities include: Effluent monitoring; Environmental surveillance; Emergency response; Routine ambient monitoring; Background assessments; Nuclear license termination; Remediation; Deactivation and decommissioning (D&D); and Waste management. In this chapter, effluent monitoring and environmental surveillance programs at nuclear operating facilities and radiological sampling and analysis plans for remediation and D&D activities will be discussed.

  6. Liquid sampling system

    DOE Patents [OSTI]

    Larson, L.L.

    1984-09-17

    A conduit extends from a reservoir through a sampling station and back to the reservoir in a closed loop. A jet ejector in the conduit establishes suction for withdrawing liquid from the reservoir. The conduit has a self-healing septum therein upstream of the jet ejector for receiving one end of a double-ended cannula, the other end of which is received in a serum bottle for sample collection. Gas is introduced into the conduit at a gas bleed between the sample collection bottle and the reservoir. The jet ejector evacuates gas from the conduit and the bottle and aspirates a column of liquid from the reservoir at a high rate. When the withdrawn liquid reaches the jet ejector the rate of flow therethrough reduces substantially and the gas bleed increases the pressure in the conduit for driving liquid into the sample bottle, the gas bleed forming a column of gas behind the withdrawn liquid column and interrupting the withdrawal of liquid from the reservoir. In the case of hazardous and toxic liquids, the sample bottle and the jet ejector may be isolated from the reservoir and may be further isolated from a control station containing remote manipulation means for the sample bottle and control valves for the jet ejector and gas bleed. 5 figs.

  7. Liquid sampling system

    DOE Patents [OSTI]

    Larson, Loren L.

    1987-01-01

    A conduit extends from a reservoir through a sampling station and back to the reservoir in a closed loop. A jet ejector in the conduit establishes suction for withdrawing liquid from the reservoir. The conduit has a self-healing septum therein upstream of the jet ejector for receiving one end of a double-ended cannula, the other end of which is received in a serum bottle for sample collection. Gas is introduced into the conduit at a gas bleed between the sample collection bottle and the reservoir. The jet ejector evacuates gas from the conduit and the bottle and aspirates a column of liquid from the reservoir at a high rate. When the withdrawn liquid reaches the jet ejector the rate of flow therethrough reduces substantially and the gas bleed increases the pressure in the conduit for driving liquid into the sample bottle, the gas bleed forming a column of gas behind the withdrawn liquid column and interrupting the withdrawal of liquid from the reservoir. In the case of hazardous and toxic liquids, the sample bottle and the jet ejector may be isolated from the reservoir and may be further isolated from a control station containing remote manipulation means for the sample bottle and control valves for the jet ejector and gas bleed.

  8. Geochemical and isotopic water results, Barrow, Alaska, 2012-2013

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Heikoop, Jeff; Wilson, Cathy; Newman, Brent

    2012-07-18

    Data include a large suite of analytes (geochemical and isotopic) for samples collected in Barrow, Alaska (2012-2013). Sample types are indicated, and include soil pore waters, drainage waters, snowmelt, precipitation, and permafrost samples.

  9. ARM - AAF RACORO Field Campaign

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govField CampaignsRoutine AAF Clouds with Low Optical Water Depths (CLOWD) Optical Radiative Observations (RACORO)Data Plots Related Links RACORO Home AAF Home ARM Data Discovery...

  10. Optimal sampling efficiency in Monte Carlo sampling with an approximat...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Optimal sampling efficiency in Monte Carlo sampling with an approximate potential Citation Details In-Document Search Title: Optimal sampling efficiency in Monte ...

  11. Water Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Water Quality Water Quality We protect water quality through stormwater control measures and an extensive network of monitoring wells and stations encompassing groundwater, surface ...

  12. Water Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Water Quality Water Quality We protect water quality through stormwater control measures and an extensive network of monitoring wells and stations encompassing groundwater, surface...

  13. Gasbuggy, New Mexico, Hydrologic and Natural Gas Sampling and Analysis Results for 2010

    SciTech Connect (OSTI)

    None

    2010-12-01

    The U.S. Department of Energy (DOE) Office of Legacy Management conducted natural gas sampling for the Gasbuggy, New Mexico, site on July 6 and 7, 2010. Additionally, a water sample was obtained at one well known as the 29-6 Water Hole, several miles west of the Gasbuggy site. Natural gas sampling consists of collecting both gas samples and samples of produced water from gas production wells. Water samples from gas production wells were analyzed for gamma-emitting radionuclides, gross alpha, gross beta, and tritium. Natural gas samples were analyzed for tritium and carbon-14. The one water well sample was analyzed for gamma-emitting radionuclides and tritium. ALS Laboratory Group in Fort Collins, Colorado, analyzed water samples. Isotech Laboratories in Champaign, Illinois, analyzed natural gas samples.

  14. Fluid sampling system

    DOE Patents [OSTI]

    Houck, Edward D.

    1994-01-01

    An fluid sampling system allows sampling of radioactive liquid without spillage. A feed tank is connected to a liquid transfer jet powered by a pumping chamber pressurized by compressed air. The liquid is pumped upwardly into a sampling jet of a venturi design having a lumen with an inlet, an outlet, a constricted middle portion, and a port located above the constricted middle portion. The liquid is passed under pressure through the constricted portion causing its velocity to increase and its pressure to decreased, thereby preventing liquid from escaping. A septum sealing the port can be pierced by a two pointed hollow needle leading into a sample bottle also sealed by a pierceable septum affixed to one end. The bottle is evacuated by flow through the sample jet, cyclic variation in the sampler jet pressure periodically leaves the evacuated bottle with lower pressure than that of the port, thus causing solution to pass into the bottle. The remaining solution in the system is returned to the feed tank via a holding tank.

  15. Fluid sampling system

    DOE Patents [OSTI]

    Houck, E.D.

    1994-10-11

    An fluid sampling system allows sampling of radioactive liquid without spillage. A feed tank is connected to a liquid transfer jet powered by a pumping chamber pressurized by compressed air. The liquid is pumped upwardly into a sampling jet of a venturi design having a lumen with an inlet, an outlet, a constricted middle portion, and a port located above the constricted middle portion. The liquid is passed under pressure through the constricted portion causing its velocity to increase and its pressure to be decreased, thereby preventing liquid from escaping. A septum sealing the port can be pierced by a two pointed hollow needle leading into a sample bottle also sealed by a pierceable septum affixed to one end. The bottle is evacuated by flow through the sample jet, cyclic variation in the sampler jet pressure periodically leaves the evacuated bottle with lower pressure than that of the port, thus causing solution to pass into the bottle. The remaining solution in the system is returned to the feed tank via a holding tank. 4 figs.

  16. Analysis procedure for americium in environmental samples

    SciTech Connect (OSTI)

    Holloway, R.W.; Hayes, D.W.

    1982-01-01

    Several methods for the analysis of /sup 241/Am in environmental samples were evaluated and a preferred method was selected. This method was modified and used to determine the /sup 241/Am content in sediments, biota, and water. The advantages and limitations of the method are discussed. The method is also suitable for /sup 244/Cm analysis.

  17. Thermoelectrically cooled water trap

    DOE Patents [OSTI]

    Micheels, Ronald H.

    2006-02-21

    A water trap system based on a thermoelectric cooling device is employed to remove a major fraction of the water from air samples, prior to analysis of these samples for chemical composition, by a variety of analytical techniques where water vapor interferes with the measurement process. These analytical techniques include infrared spectroscopy, mass spectrometry, ion mobility spectrometry and gas chromatography. The thermoelectric system for trapping water present in air samples can substantially improve detection sensitivity in these analytical techniques when it is necessary to measure trace analytes with concentrations in the ppm (parts per million) or ppb (parts per billion) partial pressure range. The thermoelectric trap design is compact and amenable to use in a portable gas monitoring instrumentation.

  18. Viscous sludge sample collector

    DOE Patents [OSTI]

    Beitel, George A [Richland, WA

    1983-01-01

    A vertical core sample collection system for viscous sludge. A sample tube's upper end has a flange and is attached to a piston. The tube and piston are located in the upper end of a bore in a housing. The bore's lower end leads outside the housing and has an inwardly extending rim. Compressed gas, from a storage cylinder, is quickly introduced into the bore's upper end to rapidly accelerate the piston and tube down the bore. The lower end of the tube has a high sludge entering velocity to obtain a full-length sludge sample without disturbing strata detail. The tube's downward motion is stopped when its upper end flange impacts against the bore's lower end inwardly extending rim.

  19. Sampling Report for August 15, 2014 WIPP Samples

    Office of Environmental Management (EM)

    X X X X X Sampling Report for August 15, 2014 WIPP Samples UNCLASSIFIED Forensic Science Center December 19, 2014 Sampling Report for August 15 2014 WIPP Samples Lawrence ...

  20. Categorical Exclusion Determinations: Golden Field Office | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Program Date: 03252015 Location(s): Nationwide Office(s): Golden Field Office March 24, 2015 CX-100203 Categorical Exclusion Determination Solar Hot Water Project in Greenburgh,...

  1. Snake and Columbia Rivers Sediment Sampling Project

    SciTech Connect (OSTI)

    Pinza, M.R.; Word, J.Q; Barrows, E.S.; Mayhew, H.L.; Clark, D.R. )

    1992-12-01

    The disposal of dredged material in water is defined as a discharge under Section 404 of the Clean Water Act and must be evaluated in accordance with US Environmental Protection Agency regulation 40 CFR 230. Because contaminant loads in the dredged sediment or resuspended sediment may affect water quality or contaminant loading, the US Army Corps of Engineers (USACE), Walla Walla District, has requested Battelle/Marine Sciences Laboratory to collect and chemically analyze sediment samples from areas that may be dredged near the Port Authority piers on the Snake and Columbia rivers. Sediment samples were also collected at River Mile (RM) stations along the Snake River that may undergo resuspension of sediment as a result of the drawdown. Chemical analysis included grain size, total organic carbon, total volatile solids, ammonia, phosphorus, sulfides, oil and grease, total petroleum hydrocarbons, metals, polynuclear aromatic hydrocarbons, pesticides, polychlorinated biphenyls, and 21 congeners of polychlorinated dibenzodioxins and dibenzofurans.

  2. Gasbuggy, New Mexico, Hydrologic and Natural Gas Sampling and Analysis Results for 2009

    SciTech Connect (OSTI)

    2009-11-01

    The U.S. Department of Energy (DOE) Office of Legacy Management conducted hydrologic and natural gas sampling for the Gasbuggy, New Mexico, site on June 16, and 17, 2009. Hydrologic sampling consists of collecting water samples from water wells and surface water locations. Natural gas sampling consists of collecting both gas samples and samples of produced water from gas production wells. The water well samples were analyzed for gamma-emitting radionuclides and tritium. Surface water samples were analyzed for tritium. Water samples from gas production wells were analyzed for gamma-emitting radionuclides, gross alpha, gross beta, and tritium. Natural gas samples were analyzed for tritium and carbon-14. Water samples were analyzed by ALS Laboratory Group in Fort Collins, Colorado, and natural gas samples were analyzed by Isotech Laboratories in Champaign, Illinois. Concentrations of tritium and gamma-emitting radionuclides in water samples collected in the vicinity of the Gasbuggy site continue to demonstrate that the sample locations have not been impacted by detonation-related contaminants. Results from the sampling of natural gas from producing wells demonstrate that the gas wells nearest the Gasbuggy site are not currently impacted by detonation-related contaminants. Annual sampling of the gas production wells nearest the Gasbuggy site for gas and produced water will continue for the foreseeable future. The sampling frequency of water wells and surface water sources in the surrounding area will be reduced to once every 5 years. The next hydrologic sampling event at water wells, springs, and ponds will be in 2014.

  3. Automated sample collection and processing for radionuclide effluent monitoring

    SciTech Connect (OSTI)

    Beals, D.M.; Crandall, B.S.; Fledderman, P.D.

    1998-12-31

    In the United States, all nuclear facilities must provide for environmental monitoring of effluent points for radionuclides that have the potential for release to the environment. For the US Department of Energy (DOE) this means thousands of surface water analyses are performed each year at a cost of millions of dollars per year. Analytical costs for radiochemical analyses are often high due to the lengthy chemical separations required prior to counting for the selected analyte. At the Savannah River Site, a DOE facility located in South Carolina, a new technique has been demonstrated whereby samples are collected and processed in the field, at the time of collection, for selected radionuclides. The technique makes use of ion selective solid-phase extraction (SPE) disks being placed in a portable automatic aqueous sampler. Water from a surface stream or effluent sampling point is collected via an ISCO, Inc., 3710 SPX portable sampler. Weekly or biweekly (depending on the sampling requirements), the SPE disks are collected and returned to the laboratory for activity determination. The analytes that are currently being monitored by the new method are {sup 99}Tc, {sup 80}Sr, {sup 137}Cs, {sup 58}Co, and {sup 60}Co. The RAD SPE disks have been shown to be effective for the extraction of technetium, strontium, and cesium and cobalt from aqueous systems. The {sup 99}Tc and {sup 90}Sr activities are determined by direct counting of the SPE disk by gas flow beta proportional techniques; the {sup 137}Cs and radiocobalt activities are determined by direct counting of the SPE disk by gamma spectrometry. Because of the specificity of the SPE disks, there is no additional chemical separation required prior to counting the SPE disks for the selected activity determination.

  4. 36Cl/Cl ratios in geothermal systems: preliminary measurements from the Coso Field

    SciTech Connect (OSTI)

    Nimz, G.J.; Moore, J.N.; Kasameyer, P.W.

    1997-07-01

    The {sub 36}Cl/Cl isotopic composition of chlorine in geothermal systems can be a useful diagnostic tool in characterizing hydrologic structure, in determining the origins and age of waters within the systems, and in differentiating the sources of chlorine (and other solutes) in the thermal waters. The {sub 36}Cl/Cl values for several geothermal water samples and reservoir host rock samples from the Coso, California geothermal field have been measured for these purposes. The results indicate that most of the chlorine is not derived from the dominant granitoid that host the geothermal system. If the chlorine was originally input into the Coso subsurface through meteoric recharge, that input occurred at least 1-1.25 million years ago. The results suggest that the thermal waters could be connate waters derived from sedimentary formations, presumably underlying and adjacent top the granitic rocks, which have recently migrated into the host rocks. Alternatively, most of the chlorine but not the water, may have recently input into the system from magmatic sources. In either case, the results indicate that most of the chlorine in the thermal waters has existed within the granitoid host rocks for no more than about 100,00-200,00 years. this residence time for the chlorine is similar to residence times suggested by other researchers for chlorine in deep groundwaters of the Mono Basin north of the Coso field.

  5. ANNULAR IMPACTOR SAMPLING DEVICE

    DOE Patents [OSTI]

    Tait, G.W.C.

    1959-03-31

    A high-rate air sampler capable of sampling alphaemitting particles as small as 0.5 microns is described. The device is a cylindrical shaped cup that fits in front of a suction tube and which has sticky grease coating along its base. Suction forces contaminated air against the periodically monitored particle absorbing grease.

  6. Advanced Membrane Filtration Technology for Cost Effective Recovery of Fresh Water from Oil & Gas Produced Brine

    SciTech Connect (OSTI)

    David B. Burnett

    2004-09-29

    Produced water is a major waste generated at the oil and natural gas wells in the state of Texas. This water could be a possible source of new fresh water to meet the growing demands of the state after treatment and purification. Treatment of brine generated in oil fields or produced water with an ultrafiltration membranes were the subject of this thesis. The characterization of ultrafiltration membranes for oil and suspended solids removal of produced water, coupled with the reverse osmosis (RO) desalination of brine were studied on lab size membrane testing equipment and a field size testing unit to test whether a viable membrane system could be used to treat produced water. Oil and suspended solids were evaluated using turbidity and oil in water measurements taken periodically. The research considered the effect of pressure and flow rate on membrane performance of produced water treatment of three commercially available membranes for oily water. The study also analyzed the flux through the membrane and any effect it had on membrane performance. The research showed that an ultrafiltration membrane provided turbidity removal of over 99% and oil removal of 78% for the produced water samples. The results indicated that the ultrafiltration membranes would be asset as one of the first steps in purifying the water. Further results on selected RO membranes showed that salt rejection of greater than 97% could be achieved with satisfactory flux and at reasonable operating cost.

  7. Chemistry of spring and well waters on Kilauea Volcano, Hawaii...

    Open Energy Info (EERE)

    determine the chemistry of dilute meteoric water, mixtures with sea water,and thermal water. Data for well and spring samples of non-thermal water indicate that mixing with sea...

  8. Interim site characterization report and ground-water monitoring program for the Hanford site solid waste landfill

    SciTech Connect (OSTI)

    Fruland, R.M.; Hagan, R.A.; Cline, C.S.; Bates, D.J.; Evans, J.C.; Aaberg, R.L.

    1989-07-01

    Federal and state regulations governing the operation of landfills require utilization of ground-water monitoring systems to determine whether or not landfill operations impact ground water at the point of compliance (ground water beneath the perimeter of the facility). A detection-level ground-water monitoring system was designed, installed, and initiated at the Hanford Site Solid Waste Landfill (SWL). Chlorinated hydrocarbons were detected at the beginning of the ground-water monitoring program and continue to be detected more than 1 year later. The most probable source of the chlorinated hydrocarbons is washwater discharged to the SWL between 1985 and 1987. This is an interim report and includes data from the characterization work that was performed during well installation in 1987, such as field observations, sediment studies, and geophysical logging results, and data from analyses of ground-water samples collected in 1987 and 1988, such as field parameter measurements and chemical analyses. 38 refs., 27 figs., 8 tabs.

  9. Core sample truck improvement test report

    SciTech Connect (OSTI)

    Cockrell, A.B.

    1994-10-14

    This report summarizes the bit testing results done under test plan WHC-SD-WM-TP-236. The conclusions and recommendations state the drill bit that gives the best overall results and will be used in the field for push mode sampling.

  10. Water quality assessment of the Rio Conchos, Chihuahua, Mexico

    SciTech Connect (OSTI)

    Gutierrez, M.; Borrego, P.

    1999-07-01

    A baseline study was conducted to evaluate the overall quality of the Rio Conchos (Chihuahua, Mexico) and to identify those chemical parameters that can best represent the water quality in different segments of the river. Chemical analyses included the measurement of 62 elements at more than 100 sampling stations along the river, in addition to conventional field analyses (e.g., pH, conductivity). Concentrations of these elements are reported and water quality indicators were identified. Based on the element concentration patterns, the segment of the river in which the water quality is most endangered corresponds to that receiving irrigation drain returns near the confluence of the Rio San Pedro. Self-cleaning and dilution processes account for the improvement in water quality observed as the Rio Conchos approaches the Rio Grande.

  11. Category:Field Techniques | Open Energy Information

    Open Energy Info (EERE)

    Sampling Field Techniques H Hand-held X-Ray Fluorescence (XRF) P Portable X-Ray Diffraction (XRD) Retrieved from "http:en.openei.orgwindex.php?titleCategory:FieldTechniq...

  12. Water resources data, Kentucky. Water year 1991

    SciTech Connect (OSTI)

    McClain, D.L.; Byrd, F.D.; Brown, A.C.

    1991-12-31

    Water resources data for the 1991 water year for Kentucky consist of records of stage, discharge, and water quality of streams and lakes; and water-levels of wells. This report includes daily discharge records for 115 stream-gaging stations. It also includes water-quality data for 38 stations sampled at regular intervals. Also published are 13 daily temperature and 8 specific conductance records, and 85 miscellaneous temperature and specific conductance determinations for the gaging stations. Suspended-sediment data for 12 stations (of which 5 are daily) are also published. Ground-water levels are published for 23 recording and 117 partial sites. Precipitation data at a regular interval is published for 1 site. Additional water data were collected at various sites not involved in the systematic data-collection program and are published as miscellaneous measurement and analyses. These data represent that part of the National Water Data System operated by the US Geological Survey and cooperation State and Federal agencies in Kentucky.

  13. Arsenic removal from water

    DOE Patents [OSTI]

    Moore, Robert C.; Anderson, D. Richard

    2007-07-24

    Methods for removing arsenic from water by addition of inexpensive and commonly available magnesium oxide, magnesium hydroxide, calcium oxide, or calcium hydroxide to the water. The hydroxide has a strong chemical affinity for arsenic and rapidly adsorbs arsenic, even in the presence of carbonate in the water. Simple and commercially available mechanical methods for removal of magnesium hydroxide particles with adsorbed arsenic from drinking water can be used, including filtration, dissolved air flotation, vortex separation, or centrifugal separation. A method for continuous removal of arsenic from water is provided. Also provided is a method for concentrating arsenic in a water sample to facilitate quantification of arsenic, by means of magnesium or calcium hydroxide adsorption.

  14. CHARACTERIZATION OF TANK 16H ANNULUS SAMPLES

    SciTech Connect (OSTI)

    Hay, M.; Reboul, S.

    2012-04-16

    The closure of Tank 16H will require removal of material from the annulus of the tank. Samples from Tank 16H annulus were characterized and tested to provide information to evaluate various alternatives for removing the annulus waste. The analysis found all four annulus samples to be composed mainly of Si, Na, and Al and lesser amounts of other elements. The XRD data indicate quartz (SiO{sub 2}) and sodium aluminum nitrate silicate hydrate (Na{sub 8}(Al{sub 6}Si{sub 6}O{sub 24})(NO{sub 3}){sub 2}.4H{sub 2}O) as the predominant crystalline mineral phases in the samples. The XRD data also indicate the presence of crystalline sodium nitrate, sodium nitrite, gibbsite, hydrated sodium bicarbonate, and muscovite. Based on the weight of solids remaining at the end of the test, the water leaching test results indicate approximately 20-35% of the solids dissolved after three contacts with an approximately 3:1 volume of water at 45 C. The chemical analysis of the leachates and the XRD results of the remaining solids indicate sodium salts of nitrate, nitrite, sulfate, and possibly carbonate/bicarbonate make up the majority of the dissolved material. The majority of these salts were dissolved in the first water contact and simply diluted with each subsequent water contact. The water leaching removed large amounts of the uranium in two of the samples and {approx}1/3 of the {sup 99}Tc from all four samples. Most of the other radionuclides analyzed showed low solubility in the water leaching test. The preliminary data on the oxalic acid leaching test indicate the three acid contacts at 45 C dissolved from {approx}34-47% of the solids. The somewhat higher dissolution found in the oxalic acid leaching test versus the water leaching test might be offset by the tendency of the oxalic acid solutions to take on a gel-like consistency. The filtered solids left behind after three oxalic acid contacts were sticky and formed large clumps after drying. These two observations could indicate

  15. NID Copper Sample Analysis

    SciTech Connect (OSTI)

    Kouzes, Richard T.; Zhu, Zihua

    2011-09-12

    The current focal point of the nuclear physics program at PNNL is the MAJORANA DEMONSTRATOR, and the follow-on Tonne-Scale experiment, a large array of ultra-low background high-purity germanium detectors, enriched in 76Ge, designed to search for zero-neutrino double-beta decay (0νββ). This experiment requires the use of germanium isotopically enriched in 76Ge. The MAJORANA DEMONSTRATOR is a DOE and NSF funded project with a major science impact. The DEMONSTRATOR will utilize 76Ge from Russia, but for the Tonne-Scale experiment it is hoped that an alternate technology, possibly one under development at Nonlinear Ion Dynamics (NID), will be a viable, US-based, lower-cost source of separated material. Samples of separated material from NID require analysis to determine the isotopic distribution and impurities. DOE is funding NID through an SBIR grant for development of their separation technology for application to the Tonne-Scale experiment. The Environmental Molecular Sciences facility (EMSL), a DOE user facility at PNNL, has the required mass spectroscopy instruments for making isotopic measurements that are essential to the quality assurance for the MAJORANA DEMONSTRATOR and for the development of the future separation technology required for the Tonne-Scale experiment. A sample of isotopically separated copper was provided by NID to PNNL in January 2011 for isotopic analysis as a test of the NID technology. The results of that analysis are reported here. A second sample of isotopically separated copper was provided by NID to PNNL in August 2011 for isotopic analysis as a test of the NID technology. The results of that analysis are also reported here.

  16. Stack sampling apparatus

    DOE Patents [OSTI]

    Lind, Randall F; Lloyd, Peter D; Love, Lonnie J; Noakes, Mark W; Pin, Francois G; Richardson, Bradley S; Rowe, John C

    2014-09-16

    An apparatus for obtaining samples from a structure includes a support member, at least one stabilizing member, and at least one moveable member. The stabilizing member has a first portion coupled to the support member and a second portion configured to engage with the structure to restrict relative movement between the support member and the structure. The stabilizing member is radially expandable from a first configuration where the second portion does not engage with a surface of the structure to a second configuration where the second portion engages with the surface of the structure.

  17. Germanium-76 Sample Analysis

    SciTech Connect (OSTI)

    Kouzes, Richard T.; Engelhard, Mark H.; Zhu, Zihua

    2011-04-01

    The MAJORANA DEMONSTRATOR is a large array of ultra-low background high-purity germanium detectors, enriched in 76Ge, designed to search for zero-neutrino double-beta decay (0???). The DEMONSTRATOR will utilize 76Ge from Russia, and the first one gram sample was received from the supplier for analysis on April 24, 2011. The Environmental Molecular Sciences facility, a DOE user facility at PNNL, was used to make the required isotopic and chemical purity measurements that are essential to the quality assurance for the MAJORANA DEMONSTRATOR. The results of this first analysis are reported here.

  18. Post-Award Deliverables Sample (Part 2 of Sample Deliverables...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    J-4) Post-Award Deliverables Sample (Part 2 of Sample Deliverables for Task Orders, IDIQ Attachment. J-4) Document offers a post-award deliverables sample for an energy savings ...

  19. Fuel cell water transport

    DOE Patents [OSTI]

    Vanderborgh, Nicholas E.; Hedstrom, James C.

    1990-01-01

    The moisture content and temperature of hydrogen and oxygen gases is regulated throughout traverse of the gases in a fuel cell incorporating a solid polymer membrane. At least one of the gases traverses a first flow field adjacent the solid polymer membrane, where chemical reactions occur to generate an electrical current. A second flow field is located sequential with the first flow field and incorporates a membrane for effective water transport. A control fluid is then circulated adjacent the second membrane on the face opposite the fuel cell gas wherein moisture is either transported from the control fluid to humidify a fuel gas, e.g., hydrogen, or to the control fluid to prevent excess water buildup in the oxidizer gas, e.g., oxygen. Evaporation of water into the control gas and the control gas temperature act to control the fuel cell gas temperatures throughout the traverse of the fuel cell by the gases.

  20. Direct observations of field-induced assemblies in magnetite ferrofluids

    SciTech Connect (OSTI)

    Mousavi, N. S. Susan; Khapli, Sachin D.; Kumar, Sunil

    2015-03-14

    Evolution of microstructures in magnetite-based ferrofluids with weak dipolar moments (particle size ≤ 10 nm) is studied with an emphasis on examining the effects of particle concentration (ϕ) and magnetic field strength (H) on the structures. Nanoparticles are dispersed in water at three different concentrations, ϕ = 0.15%, 0.48%, and 0.59% (w/v) [g/ml%] and exposed to uniform magnetic fields in the range of H = 0.05–0.42 T. Cryogenic transmission electron microscopy is employed to provide in-situ observations of the field-induced assemblies in such systems. As the magnetic field increases, the Brownian colloids are observed to form randomly distributed chains aligned in the field direction, followed by head-to-tail chain aggregation and then lateral aggregation of chains termed as zippering. By increasing the field in low concentration samples, the number of chains increases, though their length does not change dramatically. Increasing concentration increases the length of the linear particle assemblies in the presence of a fixed external magnetic field. Thickening of the chains due to zippering is observed at relatively high fields. Through a systematic variation of concentration and magnetic field strength, this study shows that both magnetic field strength and change in concentration can strongly influence formation of microstructures even in weak dipolar systems. Additionally, the results of two commonly used support films on electron microscopy grids, continuous carbon and holey carbon films, are compared. Holey carbon film allows us to create local regions of high concentrations that further assist the development of field-induced assemblies. The experimental observations provide a validation of the zippering effect and can be utilized in the development of models for thermophysical properties such as thermal conductivity.

  1. Fluid sampling tool

    DOE Patents [OSTI]

    Garcia, Anthony R.; Johnston, Roger G.; Martinez, Ronald K.

    1999-05-25

    A fluid sampling tool for sampling fluid from a container. The tool has a fluid collecting portion which is drilled into the container wall, thereby affixing it to the wall. The tool may have a fluid extracting section which withdraws fluid collected by the fluid collecting section. The fluid collecting section has a fluted shank with an end configured to drill a hole into a container wall. The shank has a threaded portion for tapping the borehole. The shank is threadably engaged to a cylindrical housing having an inner axial passageway sealed at one end by a septum. A flexible member having a cylindrical portion and a bulbous portion is provided. The housing can be slid into an inner axial passageway in the cylindrical portion and sealed to the flexible member. The bulbous portion has an outer lip defining an opening. The housing is clamped into the chuck of a drill, the lip of the bulbous section is pressed against a container wall until the shank touches the wall, and the user operates the drill. Wall shavings (kerf) are confined in a chamber formed in the bulbous section as it folds when the shank advances inside the container. After sufficient advancement of the shank, an o-ring makes a seal with the container wall.

  2. NID Copper Sample Analysis

    SciTech Connect (OSTI)

    Kouzes, Richard T.; Zhu, Zihua

    2011-02-01

    The current focal point of the nuclear physics program at PNNL is the MAJORANA DEMONSTRATOR, and the follow-on Tonne-Scale experiment, a large array of ultra-low background high-purity germanium detectors, enriched in 76Ge, designed to search for zero-neutrino double-beta decay (0νββ). This experiment requires the use of germanium isotopically enriched in 76Ge. The DEMONSTRATOR will utilize 76Ge from Russia, but for the Tonne-Scale experiment it is hoped that an alternate technology under development at Nonlinear Ion Dynamics (NID) will be a viable, US-based, lower-cost source of separated material. Samples of separated material from NID require analysis to determine the isotopic distribution and impurities. The MAJORANA DEMONSTRATOR is a DOE and NSF funded project with a major science impact. DOE is funding NID through an SBIR grant for development of their separation technology for application to the Tonne-Scale experiment. The Environmental Molecular Sciences facility (EMSL), a DOE user facility at PNNL, has the required mass spectroscopy instruments for making these isotopic measurements that are essential to the quality assurance for the MAJORANA DEMONSTRATOR and for the development of the future separation technology required for the Tonne-Scale experiment. A sample of isotopically separated copper was provided by NID to PNNL for isotopic analysis as a test of the NID technology. The results of that analysis are reported here.

  3. Fluid sampling tool

    DOE Patents [OSTI]

    Garcia, A.R.; Johnston, R.G.; Martinez, R.K.

    1999-05-25

    A fluid sampling tool is described for sampling fluid from a container. The tool has a fluid collecting portion which is drilled into the container wall, thereby affixing it to the wall. The tool may have a fluid extracting section which withdraws fluid collected by the fluid collecting section. The fluid collecting section has a fluted shank with an end configured to drill a hole into a container wall. The shank has a threaded portion for tapping the borehole. The shank is threadably engaged to a cylindrical housing having an inner axial passageway sealed at one end by a septum. A flexible member having a cylindrical portion and a bulbous portion is provided. The housing can be slid into an inner axial passageway in the cylindrical portion and sealed to the flexible member. The bulbous portion has an outer lip defining an opening. The housing is clamped into the chuck of a drill, the lip of the bulbous section is pressed against a container wall until the shank touches the wall, and the user operates the drill. Wall shavings (kerf) are confined in a chamber formed in the bulbous section as it folds when the shank advances inside the container. After sufficient advancement of the shank, an o-ring makes a seal with the container wall. 6 figs.

  4. Surface Water Sampling At Chena Geothermal Area (Waring, Et Al...

    Open Energy Info (EERE)

    calcium and magnesium concentrations were measured, with elevated levels of silica and sulfate. Surface fumarole gases were tested with a flame to indicate carbon dioxide...

  5. Radiochemical Analyses of Water Samples from Selected Streams

    Office of Legacy Management (LM)

    and Precipitation Collected October Conjunction With the First Production Test, Project Rulison-9, HGSlO DISCLAIMER Portions of this document may be illegible in electronic image products. Images are produced from the best available original document. RQTICB ~him+.i$ort w a r n prepared aa an a c c m n t of work .pa%or;il-by the United Stacam C o v e r a n t . ~=itlw-Pthe United Statom nor the United S t a t o ~ ~ t o i ~ ~ h ~ ~ t & y U a m i o l l , nor any of t h e i r ap'lAyea/,/nor any

  6. Geochemical Sampling of Thermal Waters in Nevada | Open Energy...

    Open Energy Info (EERE)

    Area (136C), Buffalo Valley (130C), Pumpernickel Valley (Tipton Ranch; 125C), and Smith Creek Valley (119C). Authors Lisa Shevenell and Larry Garside Conference GRC Annual...

  7. Water Security

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SunShot Grand Challenge: Regional Test Centers Water Security HomeTag:Water Security Electricity use by water service sector and county. Shown are electricity use by (a) ...

  8. Water Power

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Stationary PowerEnergy Conversion EfficiencyWater Power Water Power Tara Camacho-Lopez 2016-06-01T22:32:54+00:00 Enabling a successful water power industry. Hydropower ...

  9. Analytical laboratory and mobile sampling platform

    SciTech Connect (OSTI)

    Stetzenbach, K.; Smiecinski, A.

    1996-04-30

    This is the final report for the Analytical Laboratory and Mobile Sampling Platform project. This report contains only major findings and conclusions resulting from this project. Detailed reports of all activities performed for this project were provided to the Project Office every quarter since the beginning of the project. This report contains water chemistry data for samples collected in the Nevada section of Death Valley National Park (Triangle Area Springs), Nevada Test Site springs, Pahranagat Valley springs, Nevada Test Site wells, Spring Mountain springs and Crater Flat and Amargosa Valley wells.

  10. Sample introducing apparatus and sample modules for mass spectrometer

    DOE Patents [OSTI]

    Thompson, Cyril V.; Wise, Marcus B.

    1993-01-01

    An apparatus for introducing gaseous samples from a wide range of environmental matrices into a mass spectrometer for analysis of the samples is described. Several sample preparing modules including a real-time air monitoring module, a soil/liquid purge module, and a thermal desorption module are individually and rapidly attachable to the sample introducing apparatus for supplying gaseous samples to the mass spectrometer. The sample-introducing apparatus uses a capillary column for conveying the gaseous samples into the mass spectrometer and is provided with an open/split interface in communication with the capillary and a sample archiving port through which at least about 90 percent of the gaseous sample in a mixture with an inert gas that was introduced into the sample introducing apparatus is separated from a minor portion of the mixture entering the capillary discharged from the sample introducing apparatus.

  11. Sample introducing apparatus and sample modules for mass spectrometer

    DOE Patents [OSTI]

    Thompson, C.V.; Wise, M.B.

    1993-12-21

    An apparatus for introducing gaseous samples from a wide range of environmental matrices into a mass spectrometer for analysis of the samples is described. Several sample preparing modules including a real-time air monitoring module, a soil/liquid purge module, and a thermal desorption module are individually and rapidly attachable to the sample introducing apparatus for supplying gaseous samples to the mass spectrometer. The sample-introducing apparatus uses a capillary column for conveying the gaseous samples into the mass spectrometer and is provided with an open/split interface in communication with the capillary and a sample archiving port through which at least about 90 percent of the gaseous sample in a mixture with an inert gas that was introduced into the sample introducing apparatus is separated from a minor portion of the mixture entering the capillary discharged from the sample introducing apparatus. 5 figures.

  12. water scarcity

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 ... Geochemistry Geoscience SubTER Carbon Sequestration Program Leadership EnergyWater Nexus ...

  13. water savings

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 ... Geochemistry Geoscience SubTER Carbon Sequestration Program Leadership EnergyWater Nexus ...

  14. water infrastructure

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 ... Geochemistry Geoscience SubTER Carbon Sequestration Program Leadership EnergyWater Nexus ...

  15. Water Demand

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 ... Geochemistry Geoscience SubTER Carbon Sequestration Program Leadership EnergyWater Nexus ...

  16. drinking water

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    drinking water - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us ... Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 ...

  17. Water Power

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Water Power Sandia's 117-scale WEC device with being tested in the maneuvering and ... EC, News, Renewable Energy, Water Power Sandia National Laboratories Uses Its Wave Energy ...

  18. Water Efficiency

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5-6, 2014 Cape Canaveral, Florida WATER EFFICIENCY Federal Utility Partnership ...ate.mcmordie@pnnl.gov * Francis Wheeler - Water Savers, LLC * fwheeler@watersaversllc.com ...

  19. Water Power

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 ... Geochemistry Geoscience SubTER Carbon Sequestration Program Leadership EnergyWater Nexus ...

  20. Water Security

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Water Security - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us ... Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 ...

  1. Soil sampling kit and a method of sampling therewith

    DOE Patents [OSTI]

    Thompson, Cyril V.

    1991-01-01

    A soil sampling device and a sample containment device for containing a soil sample is disclosed. In addition, a method for taking a soil sample using the soil sampling device and soil sample containment device to minimize the loss of any volatile organic compounds contained in the soil sample prior to analysis is disclosed. The soil sampling device comprises two close fitting, longitudinal tubular members of suitable length, the inner tube having the outward end closed. With the inner closed tube withdrawn a selected distance, the outer tube can be inserted into the ground or other similar soft material to withdraw a sample of material for examination. The inner closed end tube controls the volume of the sample taken and also serves to eject the sample. The soil sample containment device has a sealing member which is adapted to attach to an analytical apparatus which analyzes the volatile organic compounds contained in the sample. The soil sampling device in combination with the soil sample containment device allow an operator to obtain a soil sample containing volatile organic compounds and minimizing the loss of the volatile organic compounds prior to analysis of the soil sample for the volatile organic compounds.

  2. Soil sampling kit and a method of sampling therewith

    DOE Patents [OSTI]

    Thompson, C.V.

    1991-02-05

    A soil sampling device and a sample containment device for containing a soil sample is disclosed. In addition, a method for taking a soil sample using the soil sampling device and soil sample containment device to minimize the loss of any volatile organic compounds contained in the soil sample prior to analysis is disclosed. The soil sampling device comprises two close fitting, longitudinal tubular members of suitable length, the inner tube having the outward end closed. With the inner closed tube withdrawn a selected distance, the outer tube can be inserted into the ground or other similar soft material to withdraw a sample of material for examination. The inner closed end tube controls the volume of the sample taken and also serves to eject the sample. The soil sample containment device has a sealing member which is adapted to attach to an analytical apparatus which analyzes the volatile organic compounds contained in the sample. The soil sampling device in combination with the soil sample containment device allows an operator to obtain a soil sample containing volatile organic compounds and minimizing the loss of the volatile organic compounds prior to analysis of the soil sample for the volatile organic compounds. 11 figures.

  3. Water Challenges for the New Century: Meeting Basic Human and...

    Broader source: Energy.gov (indexed) [DOE]

    Framing Energy, Water, and Climate Critical Links USDoE Quadrennial Energy Review Task ... in the fields of water and economic and environmental justice and sustainability. Dr. ...

  4. Fluid sampling apparatus and method

    DOE Patents [OSTI]

    Yeamans, David R.

    1998-01-01

    Incorporation of a bellows in a sampling syringe eliminates ingress of contaminants, permits replication of amounts and compression of multiple sample injections, and enables remote sampling for off-site analysis.

  5. Fluid sampling apparatus and method

    DOE Patents [OSTI]

    Yeamans, D.R.

    1998-02-03

    Incorporation of a bellows in a sampling syringe eliminates ingress of contaminants, permits replication of amounts and compression of multiple sample injections, and enables remote sampling for off-site analysis. 3 figs.

  6. Fluid sampling tool

    DOE Patents [OSTI]

    Johnston, Roger G.; Garcia, Anthony R. E.; Martinez, Ronald K.

    2001-09-25

    The invention includes a rotatable tool for collecting fluid through the wall of a container. The tool includes a fluid collection section with a cylindrical shank having an end portion for drilling a hole in the container wall when the tool is rotated, and a threaded portion for tapping the hole in the container wall. A passageway in the shank in communication with at least one radial inlet hole in the drilling end and an opening at the end of the shank is adapted to receive fluid from the container. The tool also includes a cylindrical chamber affixed to the end of the shank opposite to the drilling portion thereof for receiving and storing fluid passing through the passageway. The tool also includes a flexible, deformable gasket that provides a fluid-tight chamber to confine kerf generated during the drilling and tapping of the hole. The invention also includes a fluid extractor section for extracting fluid samples from the fluid collecting section.

  7. Method and apparatus for sampling low-yield wells

    DOE Patents [OSTI]

    Last, George V.; Lanigan, David C.

    2003-04-15

    An apparatus and method for collecting a sample from a low-yield well or perched aquifer includes a pump and a controller responsive to water level sensors for filling a sample reservoir. The controller activates the pump to fill the reservoir when the water level in the well reaches a high level as indicated by the sensor. The controller deactivates the pump when the water level reaches a lower level as indicated by the sensors. The pump continuously activates and deactivates the pump until the sample reservoir is filled with a desired volume, as indicated by a reservoir sensor. At the beginning of each activation cycle, the controller optionally can select to purge an initial quantity of water prior to filling the sample reservoir. The reservoir can be substantially devoid of air and the pump is a low volumetric flow rate pump. Both the pump and the reservoir can be located either inside or outside the well.

  8. Rock Sampling | Open Energy Information

    Open Energy Info (EERE)

    resource at depth. These hand samples can be collected using a rock hammer or sledge. Data Access and Acquisition Under a detailed investigation, a systematic sampling procedure...

  9. H. R. 3052: This Act may be cited as the Coal Field Water Protection and Replacement Act, introduced in the US House of Representatives, One Hundred Second Congress, First Session, July 25, 1991

    SciTech Connect (OSTI)

    Not Available

    1991-01-01

    This bill would amend the Surface Mining Control and Reclamation Act of 1977 to provide for the protection of water resources during coal mining operations. Sections of the bill describe probable hydrologic consequences; surface and ground water monitoring plan; performance bonds; protection of water resources for permit approval; effect of underground coal mining operations; inspection and monitoring; penalty for failure of representative of Secretary or state regulatory authority to carry out certain duties; release of performance bond; water rights and replacement; regulations; and state programs.

  10. IAEA workshop and field trial at the Oak Ridge K-25 Site

    SciTech Connect (OSTI)

    Hembree, D.M. Jr.; Ross, H.H.; Carter, J.A.

    1995-03-01

    In March 1994, members of the International Safeguards Department in the National Security Program Office (NSPO) hosted an environmental monitoring field trial workshop for International Atomic Energy Agency (IAEA) inspectors. The workshop was held at the Oak Ridge K-25 Site and its primary purpose was to train the inspectors in the techniques needed for effective environmental sample collection and handling. The workshop emphasized both sampling theory and practice. First, detailed techniques for swipe, vegetation, soil, biota, and water-associated sampling were covered in the classroom. Subsequently, the inspectors were divided into three groups for actual sample collection in and around the K-25 locale. The collected samples were processed by the Department of Energy (DOE) Network of Analytical Laboratories using established analytical techniques. This activity is part of the IAEA ``Programme 93+2 in. assessment of measures to enhance IAEA safeguards.

  11. Sample holder with optical features

    DOE Patents [OSTI]

    Milas, Mirko; Zhu, Yimei; Rameau, Jonathan David

    2013-07-30

    A sample holder for holding a sample to be observed for research purposes, particularly in a transmission electron microscope (TEM), generally includes an external alignment part for directing a light beam in a predetermined beam direction, a sample holder body in optical communication with the external alignment part and a sample support member disposed at a distal end of the sample holder body opposite the external alignment part for holding a sample to be analyzed. The sample holder body defines an internal conduit for the light beam and the sample support member includes a light beam positioner for directing the light beam between the sample holder body and the sample held by the sample support member.

  12. DWPF SMECT PVV SAMPLE CHARACTERIZATION AND REMEDIATION

    SciTech Connect (OSTI)

    Bannochie, C.; Crawford, C.

    2013-06-18

    On April 2, 2013, a solid sample of material collected from the Defense Waste Processing Facilitys Process Vessel Vent (PVV) jumper for the Slurry Mix Evaporator Condensate Tank (SMECT) was received at the Savannah River National Laboratory (SRNL). DWPF has experienced pressure spikes within the SMECT and other process vessels which have resulted in processing delays while a vacuum was re-established. Work on this sample was requested in a Technical Assistance Request (TAR). This document reports the results of chemical and physical property measurements made on the sample, as well as insights into the possible impact to the material using DWPFs proposed remediation methods. DWPF was interested in what the facility could expect when the material was exposed to either 8M nitric acid or 90% formic acid, the two materials they have the ability to flush through the PVV line in addition to process water once the line is capped off during a facility outage.

  13. Characteristics of STP Pre-2004 Archived KE Basin Sludge Samples Before and After Re-Jarring in the RPL - April 2012

    SciTech Connect (OSTI)

    Sinkov, Sergey I.; Delegard, Calvin H.; Schmidt, Andrew J.; Chenault, Jeffrey W.

    2012-09-28

    This report describes results of work performed in the Shielded Analytical Laboratory (SAL) at the Pacific Northwest National Laboratory’s (PNNL) Radiochemical Processing Laboratory (RPL) with archive K East (KE) Basin sludge samples obtained before the year 2004, with some of them composited and initially characterized five years ago (Delegard et al. 2011). The previously performed testing included the physical properties determinations for selected samples (settled and particle densities, water and solids concentrations), the pH, as well as identification of crystalline phases by X-ray diffractometry (XRD) for selected samples. Another objective of the previous characterization and testing campaign was to transfer some sludge composites and individual samples into new storage containers to overcome the embrittlement effect which develops in original glass containers as a result of extended exposure to high radiation fields and which increases probability of sample loss.

  14. Federal Energy and Water Management Awards 2014

    Office of Environmental Management (EM)

    In FY 2013 Hurlburt Field Air Force Base modified its water reuse system to improve capacity, resulting in savings of 13 million gallons of water in only four months-a 9% reduction ...

  15. Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites

    SciTech Connect (OSTI)

    2012-10-24

    This plan incorporates U.S. Department of Energy (DOE) Office of Legacy Management (LM) standard operating procedures (SOPs) into environmental monitoring activities and will be implemented at all sites managed by LM. This document provides detailed procedures for the field sampling teams so that samples are collected in a consistent and technically defensible manner. Site-specific plans (e.g., long-term surveillance and maintenance plans, environmental monitoring plans) document background information and establish the basis for sampling and monitoring activities. Information will be included in site-specific tabbed sections to this plan, which identify sample locations, sample frequencies, types of samples, field measurements, and associated analytes for each site. Additionally, within each tabbed section, program directives will be included, when developed, to establish additional site-specific requirements to modify or clarify requirements in this plan as they apply to the corresponding site. A flowchart detailing project tasks required to accomplish routine sampling is displayed in Figure 1. LM environmental procedures are contained in the Environmental Procedures Catalog (LMS/PRO/S04325), which incorporates American Society for Testing and Materials (ASTM), DOE, and U.S. Environmental Protection Agency (EPA) guidance. Specific procedures used for groundwater and surface water monitoring are included in Appendix A. If other environmental media are monitored, SOPs used for air, soil/sediment, and biota monitoring can be found in the site-specific tabbed sections in Appendix D or in site-specific documents. The procedures in the Environmental Procedures Catalog are intended as general guidance and require additional detail from planning documents in order to be complete; the following sections fulfill that function and specify additional procedural requirements to form SOPs. Routine revision of this Sampling and Analysis Plan will be conducted annually at the

  16. Hanford Site Environmental Surveillance Master Sampling Schedule for Calendar Year 2011

    SciTech Connect (OSTI)

    Bisping, Lynn E.

    2011-01-21

    This document contains the calendar year 2011 schedule for the routine collection of samples for the Surface Environmental Surveillance Project and the Drinking Water Monitoring Project. Each section includes sampling locations, sampling frequencies, sample types, and analyses to be performed. In some cases, samples are scheduled on a rotating basis. If a sample will not be collected in 2011, the anticipated year for collection is provided. Maps showing approximate sampling locations are included for media scheduled for collection in 2011.

  17. A Mineralogical Petrographic And Geochemical Study Of Samples...

    Open Energy Info (EERE)

    Mineralogical Petrographic And Geochemical Study Of Samples From Wells In The Geothermal Field Of Milos Island (Greece) Jump to: navigation, search OpenEI Reference LibraryAdd to...

  18. Dose Rate Calculations for Rotary Mode Core Sampling Exhauster

    SciTech Connect (OSTI)

    FOUST, D.J.

    2000-10-26

    This document provides the calculated estimated dose rates for three external locations on the Rotary Mode Core Sampling (RMCS) exhauster HEPA filter housing, per the request of Characterization Field Engineering.

  19. Sample Questions | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    Print Text Size: A A A FeedbackShare Page Below are sample questions used at the regional competitions in previous years. Please note: as fields of science advance, the answers to ...

  20. Quarterly Technical Progress Report *** SAMPLE *...

    Office of Scientific and Technical Information (OSTI)

    ... and CO 2 flux data that were used for a 3D model of ground water flow circulations. ... Page 5 of 87 A second part of this project was to couple ground water flow to the ...