Powered by Deep Web Technologies
Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

New South Wales, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Australia: Energy Resources Australia: Energy Resources Jump to: navigation, search Name New South Wales, Australia Equivalent URI DBpedia GeoNames ID 2155400 Coordinates -33°, 146° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-33,"lon":146,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

2

The solar photovoltaic feed-in tariff scheme in New South Wales, Australia  

Science Journals Connector (OSTI)

Abstract Solar Photovoltaic (PV) electricity systems are part of Australia's energy supply matrix. In the case of New South Wales (NSW), the state government has had to deal with a complex policy problem. In order to play its role in the federal Small-scale Renewable Energy Scheme, the NSW government initiated the 7 year Solar Bonus Scheme in 2010. However, in attempting to maximise community investment in small-scale solar PV systems, it relied on faulty financial modelling that applied a generous Feed-in Tariff (FiT) and underestimated the level of investor participation and installed capacity. Consequently, the scheme has resulted in very high public costs that will require policy changes that bring investors and energy retailers into conflict, and unpopular electricity retail price adjustments. This paper uses a structured case and stakeholder analysis to critically analyse the FiT policy, while also highlighting important lessons for policymakers engaging in FiT design.

Nigel Martin; John Rice

2013-01-01T23:59:59.000Z

3

A just transition from coal to renewable energy in the Hunter Valley of New South Wales, Australia  

Science Journals Connector (OSTI)

The Hunter Valley, New South Wales, Australia is one of the world's climate change hot-spots. It is where 40% of Australia's electricity is generated from five coal-fired power plants, and is the source of 100 million tonnes of black coal exported annually to the global markets. A growing number of local residents of the Hunter Valley are questioning the sustainability of the region's coal dependent economy because of its harmful local ecological and social impacts and its contribution to global warming. Environmental organisations and some labour unions have identified the need for a 'just transition' to clean, renewable energy-based economies at local, national and global scales to respond to these threats. A just transition is a process of economic restructuring from unsustainable economies towards ecological and social sustainability while creating new Green Jobs and supporting people and communities who might be disadvantaged during the change process. This article considers the potential for a just transition in the Hunter Valley with respect to coal mining, the export coal industry and domestic power generation. Attention is given to potential for common ground among key labour unions, environmentalists and local residents, and to the critical role of government intervention for a successful just transition process.

Geoff Evans

2007-01-01T23:59:59.000Z

4

The UniversiTy of new soUTh wales | sydney | aUsTralia Research Strength  

E-Print Network [OSTI]

and sustainability 08 next Generation Materials and technologies 10 social Policy, Government and Health Policy 12 i and technologies social Policy, government and health Policy Information and communications technology, robotics centres, including: australian solar Institute Bionic Vision australia the Kirby Institute national

New South Wales, University of

5

Climate change mitigation with integration of renewable energy resources in the electricity grid of New South Wales, Australia  

Science Journals Connector (OSTI)

Abstract The implementation of climate change mitigation strategies may significantly affect the current practices for electricity network operation. Increasing penetration of renewable energy generation technologies into electricity networks is one of the key mitigation strategies to achieve greenhouse gas emission reduction targets. Additional climate change mitigation strategies can also contribute to emission reduction thereby supplementing the renewable energy generation participation, which may be limited due to technical constraints of the network. In this paper, the penetration requirements for different renewable energy generation resources are assessed while concurrently examining other mitigation strategies to reduce overall emissions from electricity networks and meet requisite targets. The impacts of climate change mitigation strategies on the demand and generation mix are considered for facilitating the penetration of renewable generation. New climate change mitigation indices namely change in average demand, change in peak demand, generation flexibility and generation mix have been proposed to measure the level of emission reduction by incorporating different mitigation strategies. The marginal emissions associated with the individual generation technologies in the state of New South Wales (NSW) are modelled and the total emissions associated with the electricity grid of NSW are evaluated.

M.A. Abdullah; A.P. Agalgaonkar; K.M. Muttaqi

2014-01-01T23:59:59.000Z

6

Mid Wales Energy Agency | Open Energy Information  

Open Energy Info (EERE)

Wales Energy Agency Wales Energy Agency Jump to: navigation, search Name Mid Wales Energy Agency Place Aberystwyth, United Kingdom Zip SY23 2AZ Sector Efficiency, Renewable Energy Product Mid Wales Energy Agency is here to promote energy efficiency and appropriately scaled renewable energy throughout Mid Wales. Coordinates 52.41605°, -4.077869° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.41605,"lon":-4.077869,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

7

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

8

EPOD Solar Wales Ltd formerly ICP Solar Technologies Ltd | Open Energy  

Open Energy Info (EERE)

Wales Ltd formerly ICP Solar Technologies Ltd Wales Ltd formerly ICP Solar Technologies Ltd Jump to: navigation, search Name EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd) Place Mid Glamorgan, United Kingdom Zip CF31 3YN Sector Solar Product Research, development, manufacturing,marketing and sales of leading-edge solar energy products. References EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd) is a company located in Mid Glamorgan, United Kingdom . References ↑ "EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd)" Retrieved from "http://en.openei.org/w/index.php?title=EPOD_Solar_Wales_Ltd_formerly_ICP_Solar_Technologies_Ltd&oldid=34508

9

POLITICAL SCIENCE Waleed Mebane  

E-Print Network [OSTI]

central european university POLITICAL SCIENCE #12;Waleed Mebane country of origin: united states to CEU based on other places I considered. I also noted that the Department of Political Science and that was something that impressed me. I like that Budapest, although a vibrant and politically and culturally

Takada, Shoji

10

Royal Agricultural and Horticultural Society of South Australia | Open  

Open Energy Info (EERE)

and Horticultural Society of South Australia and Horticultural Society of South Australia Jump to: navigation, search Name Royal Agricultural and Horticultural Society of South Australia Place South Australia, Australia Zip SA 5034 Sector Buildings, Solar Product South-Australia-based agricultural and horticultural society. The society is installing 1MW solar power systems on six separate buildings. References Royal Agricultural and Horticultural Society of South Australia[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Royal Agricultural and Horticultural Society of South Australia is a company located in South Australia, Australia . References ↑ "Royal Agricultural and Horticultural Society of South

11

Privatizing Australia  

SciTech Connect (OSTI)

The sun is setting on Australia`s long tradition of state involvement in business. As part of efforts begun in the late-1980`s to stem the tide of debt rising within Australian federal and state treasuries, government-owned entities are being corporatized and privatized, and private companies are sponsoring a large share of the country`s new infrastructure projects.

Burr, M.T.

1995-07-01T23:59:59.000Z

12

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

13

Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Wales Wind Energy Project | Open Energy Information  

Open Energy Info (EERE)

Wind Energy Project Wind Energy Project Jump to: navigation, search Name Wales Wind Energy Project Facility Wales Wind Energy Project Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Alaska Village Electric Coop Developer Kotzebue Electric Assoc. Energy Purchaser Alaska Village Electric Coop Location Wales AK Coordinates 65.6113°, -168.091° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":65.6113,"lon":-168.091,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

19

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

20

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

22

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

23

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

24

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

25

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

26

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

27

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

28

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

29

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

30

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

31

England and Wales -A Competitive Electricity Richard Green  

E-Print Network [OSTI]

PWP-060 England and Wales - A Competitive Electricity Market? Richard Green September 1998 Electricity Market? Richard Green * Department of Applied Economics, University of Cambridge Department, 1998 The British sometimes exaggerate their own importance. For example, we claim that the electricity

California at Berkeley. University of

32

Variation in Incidence and Fatality of Melanoma by Season of Diagnosis in New South Wales, Australia  

Science Journals Connector (OSTI)

...respectively; P 0.0001, Kruskal-Wallis test). Cases were followed...by month of diagnosis with a Kruskal-Wallis test. We used Poisson regression...31 mm in 1998 (P 0.0001, Kruskal Wallis test on all years). The proportion...

Mathieu Boniol; Bruce K. Armstrong; Jean-Franois Dor

2006-03-01T23:59:59.000Z

33

NPP Grassland: Charleville, Australia  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Charleville, Australia, 1973-1974 Charleville, Australia, 1973-1974 Data Citation Cite this data set as follows: Christie, E. K. 1999. NPP Grassland: Charleville, Australia, 1973-1974. Data set. Available on-line [http://www.daac.ornl.gov] from Oak Ridge National Laboratory Distributed Active Archive Center, Oak Ridge, Tennessee, U.S.A. Description Above-ground and below-ground productivity of a native C3 grassland and an introduced C4 grassland were studied from 1973 to 1974 near Charleville in southern Queensland, north-east Australia. The study was carried out with a view to parameterising a simulation model of primary production and livestock carrying capacity. Measurements of above-ground and below-ground standing crop (live + dead matter) were made every 2 weeks during the growing seasons - otherwise

34

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

35

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

36

A Delegation Framework for Liberty Waleed A. Alrodhan  

E-Print Network [OSTI]

can be used to help support delegation. The Liberty Alliance Project1 (henceforth abbreviatedA Delegation Framework for Liberty Waleed A. Alrodhan Information Security Group Royal Holloway) of their access rights or privileges to other parties in the system. However, the Liberty Alliance, an industry

Mitchell, Chris

37

Forestry Commission Wales Guidance on rental levels for Hydro Power  

E-Print Network [OSTI]

initiated a process to facilitate the development of small- scale hydro-electricity schemes on land ownedForestry Commission Wales Guidance on rental levels for Hydro Power Guidance on rental levels for hydro power projects Tel: 02920 475961 Email: hydrowales@forestry.gsi.gov.uk Version 1.0 Mike Pitcher 17

38

University College of North Wales, Bangor: New Science Buildings  

Science Journals Connector (OSTI)

... part of the North Wales Heroes Memorial Fund should be used for providing new science buildings on a site in Deiniol Road. These ... on a site in Deiniol Road. These buildings were completed in 1926 and opened by Sir J. J. Thomson.

P. W. RICHARDS

1955-09-17T23:59:59.000Z

39

Commonwealth of Australia STATUTORY DECLARATION  

E-Print Network [OSTI]

Commonwealth of Australia STATUTORY DECLARATION Statutory Declarations Act 1959 1 Insert the name or Territory, or the High Court of Australia, as a legal practitioner (however described); or (3) a person who or place outside Australia; and (b) authorised under paragraph 3 (d) of the Consular Fees Act 1955; and (c

Chen, Ying

40

Geothermal development in Australia  

SciTech Connect (OSTI)

In Australia, natural hot springs and hot artesian bores have been developed for recreational and therapeutic purposes. A district heating system at Portland, in the Otway Basin of western Victoria, has provided uninterrupted service for 12 Sears without significant problems, is servicing a building area of 18 990 m{sup 2}, and has prospects of expansion to manufacturing uses. A geothermal well has provided hot water for paper manufacture at Traralgon, in the Gippsland Basin of eastern Victoria. Power production from hot water aquifers was tested at Mulka in South Australia, and is undergoing a four-year production trial at Birdsville in Queensland. An important Hot Dry Rock resource has been confirmed in the Cooper Basin. It has been proposed to build an HDR experimental facility to test power production from deep conductive resources in the Sydney Basin near Muswellbrook.

Burns, K.L. [Los Alamos National Lab., NM (United States); Creelman, R.A. [Creelman (R.A.) and Associates, Sydney, NSW (Australia); Buckingham, N.W. [Glenelg Shire Council, Portland, VIC (Australia); Harrington, H.J. [Australian National Univ., Canberra, ACT (Australia)]|[Sydney Univ., NSW (Australia)

1995-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

42

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

43

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

44

North Wales, Pennsylvania: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Wales, Pennsylvania: Energy Resources Wales, Pennsylvania: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 40.2109404°, -75.2782317° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.2109404,"lon":-75.2782317,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

45

Export.gov - Australia Home  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Australian Importers Australian Importers Register | Manage Account Search Our Site Click to Search Our Site Export.gov Home Opportunities By Industry By Country Market Research Trade Events Trade Leads Free Trade Agreements Solutions International Sales & Marketing International Financing International Logistics Licenses & Regulations Trade Data & Analysis Trade Problems Locations Domestic Offices International Offices FAQ Blog Connect Home > Australia Local time in Sydney and Melbourne: : Print | E-mail Page Australia Australia Home Doing Business in Australia Market Research on Australia Services for U.S. Companies Trade Events Business Service Providers Links Internships Contact Us Our Worldwide Network About Us Press Room Other Worldwide Markets G'day and welcome! The U.S. Commercial Service, Australia helps U.S. companies do business in

46

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

47

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

48

1997 Department of Computer Science, University of Wales Swansea 1 Providing Continuing Professional Development  

E-Print Network [OSTI]

and format of Continuing Professional Development in Information Technology (IT) in Small to Medium Sized Enterprises (SMEs) in the area of South Wales, a questionnaire has been devised. 30 SMEs have been interviewed professional development in IT in Small to Medium Sized Enterprises (SMEs) in the area of South Wales

Grant, P. W.

49

Grey seal distribution and abundance in North Wales, 2002-2003  

E-Print Network [OSTI]

i Grey seal distribution and abundance in North Wales, 2002-2003 Westcott, S.M. & Stringell, T.B. Stringell Title: "Grey seal distribution and abundance in North Wales, 2002-2003" Authors: Westcott, S Library x1 C. Duck, SMRU x1 Joe Breen EHS x1 PML, Library, Plymouth x1 S. Westcott x5 M. Baines x1 S

Bearhop, Stuart

50

Grey seal pup production for North Wales, Westcott, S.M. & Stringell, T.B.  

E-Print Network [OSTI]

Grey seal pup production for North Wales, 2002 Westcott, S.M. & Stringell, T.B. Marine Monitoring.B. Stringell Title: "Grey seal pup production for North Wales, 2002" Authors: Westcott, S.M. & Stringell, T S. Westcott x5 M. Baines x1 S. Stansfield, Bardsey Bird Observatory x1 A. Moralee, RSPB South Stack

Bearhop, Stuart

51

Stone-Wales defects in graphene and other planar sp2 -bonded materials  

E-Print Network [OSTI]

Stone-Wales defects in graphene and other planar sp2 -bonded materials Jie Ma,1,2,3 Dario Alfè,2 that the structure of the Stone-Wales SW defect in graphene is more complex than hitherto appreciated. Rather than of graphene and in so doing modify its chemical re- activity toward adsorbates, and likely impact upon its

Alfè, Dario

52

Spatial dynamics of the 1918 influenza pandemic in England, Wales and the United States  

Science Journals Connector (OSTI)

...from the England and Wales dataset can be applied to the US data with no likelihood penalty...transportation analysis: theory and extensions. Utrecht, The Netherlands: VSP. 18 Xia, Y...from the England and Wales dataset can be applied to the US data with no likelihood penalty...

2011-01-01T23:59:59.000Z

53

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

54

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

55

NPP Tropical Forest: Atherton, Australia  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Atherton, Australia, 1974-1985 Atherton, Australia, 1974-1985 [PHOTOGRAPH] Photograph: View across the forest canopy near Atherton (click on the photo to view a series of images from this site) Data Citation Cite this data set as follows: Stocker, G. C. 2001. NPP Tropical Forest: Atherton, Australia, 1974-1985. Data set. Available on-line [http://www.daac.ornl.gov] from Oak Ridge National Laboratory Distributed Active Archive Center, Oak Ridge, Tennessee, U.S.A. Description Litterfall was determined over 3-4 years (1974/5-1978) for two tropical rainforest sites and for 5 years (1980-1985) for a third study site near Atherton, Queensland, in northeast Australia. Although net primary production (NPP) was not determined, the extensive site description data and the rarity of measurements on tropical forests south of the Equator

56

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

57

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

58

Macrochannels and their significance for flood-risk minimisation: examples from southeast Queensland and New South Wales, Australia  

Science Journals Connector (OSTI)

Stream power in the escarpment slopes peaked at 8,200Wm?2 resulting in widespread boulder mobilization and subsequent deposition in zones of...4...). In the central catchment zone, floodwaters were entirely con...

J. Croke; I. Reinfelds; C. Thompson

2014-01-01T23:59:59.000Z

59

Australia's Green Vehicle Guide | Open Energy Information  

Open Energy Info (EERE)

Australia's Green Vehicle Guide Australia's Green Vehicle Guide Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Australia's Green Vehicle Guide Agency/Company /Organization: Commonwealth of Australia Focus Area: Vehicles, Fuel Efficiency Topics: Analysis Tools, Market Analysis Website: www.greenvehicleguide.gov.au/GVGPublicUI/home.aspx Equivalent URI: cleanenergysolutions.org/content/australias-green-vehicle-guide,http:/ Language: English Policies: Regulations Regulations: Fuel Efficiency Standards The Green Vehicle Guide provides information about the environmental performance of new light-duty vehicles sold in Australia, including carbon dioxide (CO2) emissions and fuel consumption. The Guide includes resources such as a fuel calculator, electric vehicle information and a truck buyers

60

Primary Production of Benthic Micro-organisms in South West Arm, Port Hacking, New South Wales  

Science Journals Connector (OSTI)

Net photosynthetic incorporation of dissolved inorganic carbon into the micro-organisms of shallow benthic areas of South West Arm, Port Hacking, New South Wales was measured in situ and in the laboratory. Method...

Max S. Giles

1983-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Reduction of activation energy barrier of Stone-Wales transformation in endohedral metallofullerenes  

Science Journals Connector (OSTI)

Using ab initio calculations, we examine effects of encapsulated metal atoms inside a C60 molecule on the activation energy barrier for the Stone-Wales transformation. The encapsulated metal atoms we study are K, Ca, and La which nominally donate one, two, and three electrons to the C60 cage, respectively. We find that isomerization of the endohedral metallofullerene via the Stone-Wales transformation can occur more easily than that of the empty fullerene owing to the charge transfer. When K, Ca, and La atoms are encapsulated inside the fullerene, the activation energy barriers are lowered by 0.30, 0.55, and 0.80eV, respectively compared with that of empty C60 (7.16eV). The lower activation energy barrier of the Stone-Wales transformation implies the higher probability of isomerization and coalescence of metallofullerenes, which require a series of Stone-Wales transformations.

Woon Ih Choi; Gunn Kim; Seungwu Han; Jisoon Ihm

2006-03-28T23:59:59.000Z

62

A Resurgent Cauldron In The Early Paleozoic Of Wales, Uk | Open Energy  

Open Energy Info (EERE)

Resurgent Cauldron In The Early Paleozoic Of Wales, Uk Resurgent Cauldron In The Early Paleozoic Of Wales, Uk Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: A Resurgent Cauldron In The Early Paleozoic Of Wales, Uk Details Activities (0) Areas (0) Regions (0) Abstract: The paper presents a controversial interpretation of a mid-Ordovician volcano-sedimentary complex. It deals with the cyclic interdependence of intrusive, volcanic, and sedimentary processes, due to the development of a nearshore resurgent cauldron in the Caledonian fold belt of North Wales. Deformed volcanotectonic features include a resurgent dome and apical graben, surrounded by a moat and peripheral crescentic ring-fault, constituting a caldera 20 km in diameter. The resurgent Snowdon caldera developed through three cycles of ash-flow volcanism resulting from

63

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

64

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

65

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

66

Electricity Generation from Geothermal Energy in Australia.  

E-Print Network [OSTI]

?? This thesis aims to investigate the economical and technical prerequisites for electricity generation from geothermal energy in Australia. The Australian government has increased the (more)

Broliden, Caroline

2013-01-01T23:59:59.000Z

67

Australia HEU Removal | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Australia HEU Removal | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the...

68

Topological description of the Stone-Wales defect formation energy in carbon nanotubes and graphene  

E-Print Network [OSTI]

Topological description of the Stone-Wales defect formation energy in carbon nanotubes and graphene,10,12,16,18,26 The reported values for SW defect formation energies both in carbon nanotubes and graphene8 energies depend largely on the nanotube radius, the orientation of the dislocation dipole, and, to a lesser

Daw, Murray S.

69

Favorable conditions noted for Australia shale oil  

SciTech Connect (OSTI)

After brief descriptions of the Rundle, Condor, and Stuart/Kerosene Creek oil shale projects in Queensland, the competitive advantages of oil shale development and the state and federal governments' attitudes towards an oil shale industry in Australia are discussed. It is concluded that Australia is the ideal country in which to start an oil shale industry.

Not Available

1986-09-01T23:59:59.000Z

70

Australia - Energy Resource Assessment | Open Energy Information  

Open Energy Info (EERE)

Australia - Energy Resource Assessment Australia - Energy Resource Assessment Jump to: navigation, search Name Australia - Energy Resource Assessment Agency/Company /Organization Australian Government Sector Energy Focus Area Conventional Energy, Energy Efficiency, Renewable Energy Topics Resource assessment Resource Type Publications Website https://www.ga.gov.au/image_ca Country Australia UN Region South-Eastern Asia, "Pacific" is not in the list of possible values (Eastern Africa, Middle Africa, Northern Africa, Southern Africa, Western Africa, Caribbean, Central America, South America, Northern America, Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand, Melanesia, Micronesia, Polynesia, Latin America and the Caribbean) for this property.

71

The wave energy resource along Australias Southern margin  

Science Journals Connector (OSTI)

The Southern Australian margin is one of the most energetic regions in the world suitable for the extraction of waveenergy for electricity generation. We have produced a data set in which the deep-water waveenergy resource for the region is described by three representative deep-water wave states equivalent to the 10th 50th and 90th percentiles of the deep-water waveenergy flux derived from archives of the USA National Oceanic and Atmospheric Administration (NOAA) WaveWatch III (NWW3) operational wavemodel. The Simulating WAves Nearshore (SWAN) wavemodel is then applied along the full Southern Australian margin to propagate these representative wave states into the near-shore region to quantify the effects of shallow water processes such as refraction shoaling and bottom friction. The waveenergy incident on the 25-m isobath ( ? 30 50 ? kW / m ) is approximately 35%50% less than the World Energy Council estimates of offshore waveenergy but is approximately 20% greater than the energy observed from long-term buoy deployments on the midshelf. The latter discrepancy is attributed to an overestimation of significant wave height along the Southern Australian margin by the NWW3 model. The near-shore model applied in this study adequately simulates the attenuation of wave heights across the continental shelf when compared with estimates of wave height attenuation obtained from the Topex satellite altimeter. The attenuation of waveenergy across the continental shelf reduces the estimates of offshore waveenergy as given by the World Energy Council; however the waveenergy resource incident on the Southern Australian margin remains considerable. We estimate that if 10% of the incident near-shore energy in this region which is an ambitious target when conversion efficiency is considered were converted to electricity approximately 130 TW?h/yr (one-half of Australias total present-day electricity consumption) would be produced.

M. A. Hemer; D. A. Griffin

2010-01-01T23:59:59.000Z

72

The diamonds of South Australia  

Science Journals Connector (OSTI)

Diamonds in South Australia occur in kimberlites at Eurelia (Orroroo), and in placer deposits, which include the Springfield Basin and the historic Echunga goldfield. To identify the kimberlitic and mantle sources of the placer diamonds, and to determine any possible connections between the placer diamonds and the diamonds from the Eurelia kimberlites, we examined the physical and compositional characteristics, and the mineral inclusion content of 122 diamonds from the Springfield Basin and 43 diamonds from kimberlites at Eurelia. Additional morphological data for three Echunga diamonds are also given. Most of the diamonds from the Springfield Basin are similar to the diamonds from Eurelia with respect to their crystal shapes, surface textures, and colors. The diamond populations from both areas are characterized by a high abundance of low-nitrogen (Basin diamonds are similar to the Eurelia diamonds with ?13C values in the range ?20.0 to ?2.5, and a mode at ?6.5. Ferropericlase inclusions in two diamonds from the Springfield Basin are consistent with ferropericlase-bearing mineral inclusion assemblages found in the Eurelia diamonds and indicate that part of the diamond population from both areas is of sublithospheric origin. One diamond from the Springfield Basin contained an inclusion of lherzolitic garnet. The overall similarities between the Springfield Basin and Eurelia diamonds indicates that the bulk of the Springfield Basin diamonds are derived from kimberlitic sources that are similar (or identical) to those at Eurelia. However, three diamonds from the Springfield Basin are markedly distinct. These have well-developed crystal shapes, large sizes, yellow body colorations, and brown irradiation spots. The brown irradiation spots and abrasion textures provide evidence that these diamonds are much older than the other diamonds in the Springfield Basin, and that they are derived from distal kimberlitic sources. The diamonds are most likely derived from Permian glacigene sediments and may ultimately be sourced from kimberlites on the East Antarctic craton. Abrasion textures and brown irradiation spots are also present on diamonds from Echunga. This provides a link to the three old Springfield Basin diamonds and other alluvial diamonds in Eastern Australia, and suggests that Permian glaciations caused a widespread distribution of diamonds over large parts of southern Australia, which at that time was part of the supercontinent Gondwana.

Ralf Tappert; John Foden; Thomas Stachel; Karlis Muehlenbachs; Michelle Tappert; Kevin Wills

2009-01-01T23:59:59.000Z

73

Northwest Australia's Saladin crude assayed  

SciTech Connect (OSTI)

High-quality Saladin crude oil from offshore Western Australia has been assayed. The 48.2[degree] API, 0.02 wt % sulfur crude's characteristics--determined in 1990--are presented here for the first time. The estimated 30--40 million bbl field, south of Barrow Island, is produced from two platforms in 58 ft of water in block TP 3. Production began in late 1989 from three platforms with three wells each and from two wells drilled directionally from Thevenard Island. The paper lists data on the following properties: API gravity, density, sulfur content, pour point, flash point, viscosity, salinity, heat of combustion, ash content, asphaltene content, wax content, and metal content for the whole crude and various fractions.

Rhodes, A.K.

1993-10-18T23:59:59.000Z

74

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

75

PROGRAM OVERVIEW Australia is the size of continental  

E-Print Network [OSTI]

PROGRAM OVERVIEW Australia is the size of continental USA with about 1/15 of the population. It is the fourth most urban country and yet most Americans know Australia as "outback" and rural country. In a wet year, Australia is dry. Australia exports natural resources. It is "bordered" by the fourth most

Liskiewicz, Maciej

76

Australia Country report Description of dosimetry services in Australia  

E-Print Network [OSTI]

The Australian Radiation Protection and Nuclear Safety Agency is an agency of the Australian Government with the responsibility of undertaking research and providing advice in relation to radiation protection and nuclear safety. In addition the agency has the responsibility of regulating those radiation practices undertaken by Australian Government organizations. The activities of ARPANSA include monitoring the doses to workers in Australia. Internal dose assessment from the inhalation of insoluble dusts is a significant problem in industries associated with the mining and milling of radioactive ores and in the rehabilitation of sites contaminated by activities associated with the development of nuclear weapons. In order to assess doses to these workers ARPANSA has refurbished its whole body monitor as a lung monitor. The internal dimensions of the shielded room are 2.1 m long x 1.7 m wide x 1.8 m high. The shielding comprises 18 cm of laminated steel sheets, 2 cm of laminated lead sheets and 3 mm of copper. ...

Burns, P

1996-01-01T23:59:59.000Z

77

MHK Projects/Lunar Energy St David s Peninsula Pembrokeshire South Wales UK  

Open Energy Info (EERE)

Lunar Energy St David s Peninsula Pembrokeshire South Wales UK Lunar Energy St David s Peninsula Pembrokeshire South Wales UK < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-15.6265,"lon":30.4041,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

78

The analysis of trade liberalisation in Australia using a dynamic computable general equilibrium model.  

E-Print Network [OSTI]

??Trade liberalisation has a central role in Australia due to its significant contributions to the welfare and economic performance throughout Australia??s history. Despite its high (more)

Nguyen, Viet Ha

2013-01-01T23:59:59.000Z

79

Victoria, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Victoria, Australia: Energy Resources Victoria, Australia: Energy Resources Jump to: navigation, search Name Victoria, Australia Equivalent URI DBpedia GeoNames ID 2145234 Coordinates -37°, 145° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-37,"lon":145,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

80

Abbotsford, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Abbotsford, Australia: Energy Resources Abbotsford, Australia: Energy Resources Jump to: navigation, search Name Abbotsford, Australia Equivalent URI DBpedia GeoNames ID 2178377 Coordinates -33.85°, 151.13333° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-33.85,"lon":151.13333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Australia: Energy Resources Australia: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-25,"lon":135,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

82

Australia's home bias and cross border taxation  

Science Journals Connector (OSTI)

Abstract The paper examines the impact of cross border taxation on Australia's free float home bias. The paper controls for various sources of home bias including familiarity, explicit cost, diversification motives and governance issues when examining the impact of cross border tax variables. In our sample of 44 foreign countries where Australia invests over the period 2001 to 2009, about 66% (82%) withhold taxes on realized capital gains (dividends) of foreign investors. A tax credit variable for foreign taxes paid on dividends is constructed and found to be statistically significant in reducing home bias.

Anil V. Mishra

2014-01-01T23:59:59.000Z

83

Sustainable energy in Australia: an analysis of performance and drivers relative to other OECD countries .  

E-Print Network [OSTI]

??How sustainable is Australia???s pattern of energy supply and use? What are the major factors explaining Australia???s sustainable energy performance relative to other countries? This (more)

Kinrade, P. A.

2009-01-01T23:59:59.000Z

84

The Potential Wind Power Resource in Australia: A New Perspective  

E-Print Network [OSTI]

Australias wind resource is considered to be very good, and the utilization of this renewable energy resource is increasing rapidly: wind power installed capacity increased by 35% from 2006 to 2011 and is predicted to ...

Hallgren, Willow

85

Australia's Carbon Cap-and-Tax Fiasco 24 July 2014  

E-Print Network [OSTI]

Australia's Carbon Cap-and-Tax Fiasco 24 July 2014 James Hansen I have been fortunate to be able as a cap-and-tax. Australia is now the largest carbon polluter per capita among major nations (see Figure 1

Hansen, James E.

86

Facing Facebook: Australia's Cap-and-Tax 29 July 2014  

E-Print Network [OSTI]

Facing Facebook: Australia's Cap-and-Tax 29 July 2014 James Hansen At least until I finish my in Australia re their cap-and-trade were (1) it would be ineffectual in reducing emissions, and (2) it would

Hansen, James E.

87

Aboriginal hunting buffers climate-driven fire-size variability in Australias spinifex grasslands  

Science Journals Connector (OSTI)

...Visual Information Solutions, Boulder, Colorado) by comparing the current image with the...ponderosa pine forests of the southern Colorado Plateau region, Southwest USA . Holocene...associated rainfall, predation, and wildfire in Central Australia . J Mammal 86 : 689...

Rebecca Bliege Bird; Brian F. Codding; Peter G. Kauhanen; Douglas W. Bird

2012-01-01T23:59:59.000Z

88

Biotechnology gets big backing in Australia  

Science Journals Connector (OSTI)

... priority that the Australian Commonwealth government the national government of Australia places on biotechnology. For example, the Commonwealth government gave A$296 million (US$150 million) in ... government gave A$296 million (US$150 million) in the year 19992000 to biotechnology through funding schemes such as the National Health and Medical Research Council, the Australian ...

Sandy Radke

2001-08-23T23:59:59.000Z

89

Journal: Sunita Gupta: Australia May 23, 2007  

E-Print Network [OSTI]

tropical. I've gotten to see the Olympic Park, including the torch, Opera House, Harbor BridgeJournal: Sunita Gupta: Australia May 23, 2007 I've seen only some of Sydney so far, but it's been and beautiful beaches! Sydney is such a multicultural city. There are especially a lot of people from all over

Farritor, Shane

90

Journal: Sunita Gupta: Australia June 13, 2007  

E-Print Network [OSTI]

rain, but we still saw the cool spots like Bondi Beach, the magnificent Sydney Opera House, Harbour Bridge and the Sydney Aquarium. The opera house was so much more impressive than I could have ever and Sydney. Australia has equal parts of natural beauty and city. The Great Ocean Road was beautiful

Farritor, Shane

91

Architectural Design of a Three Dimensional FPGA Waleed M. Meleis, Miriam Leeser, Paul Zavracky, and Mankuan M. Vai  

E-Print Network [OSTI]

Architectural Design of a Three Dimensional FPGA Waleed M. Meleis, Miriam Leeser, Paul Zavracky Abstract The design and evaluation of a 3­dimensional FPGA architecture called Rothko will be described. Rothko takes advantage of a novel 3­dimensional VLSI circuit technology developed at Northeastern

Meleis, Waleed

92

Warriewood, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Warriewood, Australia: Energy Resources Warriewood, Australia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates -33.69902°, 151.300337° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-33.69902,"lon":151.300337,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

93

Sydney, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Sydney, Australia: Energy Resources Sydney, Australia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2147714 Coordinates -33.86785°, 151.20732° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-33.86785,"lon":151.20732,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

94

Melbourne, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Melbourne, Australia: Energy Resources Melbourne, Australia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2158177 Coordinates -37.814°, 144.96332° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-37.814,"lon":144.96332,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

95

Australian Solar Institute | Open Energy Information  

Open Energy Info (EERE)

Solar Institute Solar Institute Jump to: navigation, search Name Australian Solar Institute Place Newcastle, New South Wales, Australia Zip 2300 Sector Solar Product New South Wales-based institute providing support for the Australian solar community, helping to retain Australian solar expertise and develop the next generation of Australian solar researchers. References Australian Solar Institute[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Australian Solar Institute is a company located in Newcastle, New South Wales, Australia . References ↑ "Australian Solar Institute" Retrieved from "http://en.openei.org/w/index.php?title=Australian_Solar_Institute&oldid=342442

96

Energy research and development profile of Australia  

SciTech Connect (OSTI)

Australia is a large, sparsely populated country with an economy based traditionally on raw materials exports. Though still a major international trader in minerals and agricultural products, Australia has suffered a decline in productivity, employment, exports, and economic growth since the 1950s. Most energy research and development (R and D) and policymaking activities are carried out under the National Energy Research, Development, and Demonstration (NERDD) program. The NERDD program priorities include, among others, production of liquid hydrocarbon fuels from natural gas or coal-derived synthesis gas and oil and gas exploration, assessment, and recovery technology (high priority); production of liquid fuels from coal and oil shale by hydrogenation or pyrolysis, coal gasification, and achievement of cost reductions in coal and oil shale exploration and assessment techniques (medium priority); and in-situ coal gasification (low priority). Bilateral agreements for energy R and D with other countries are carried out under the Australian Department of National Development and Energy. Australia currently has agreements related to oil, gas, shale, and coal liquids R and D with the UK, the US, Japan, and West Germany.

Kenkeremath, L.

1986-01-01T23:59:59.000Z

97

D-SPARQ: Distributed, Scalable and Efficient RDF Query Engine  

E-Print Network [OSTI]

of Dammam, Saudi Arabia. University of New South Wales, High Street, Kensington, NSW, Australia 2052. ssakr

Hitzler, Pascal

98

Clim. Past, 7, 11891207, 2011 www.clim-past.net/7/1189/2011/  

E-Print Network [OSTI]

Zealand 3Climate Change Research Centre, University of New South Wales, Sydney, Australia 4GKSS Research

Phipps, Steven J.

99

Simple Refined IV Methods of Closed-Loop System Identification  

E-Print Network [OSTI]

Wales, Sydney Australia and Fenner School of Environment and Society, Australian National University

Paris-Sud XI, Université de

100

Effects of Stone-Wales and vacancy defects in atomic-scale friction on defective graphite  

SciTech Connect (OSTI)

Graphite is an excellent solid lubricant for surface coating, but its performance is significantly weakened by the vacancy or Stone-Wales (SW) defect. This study uses molecular dynamics simulations to explore the frictional behavior of a diamond tip sliding over a graphite which contains a single defect or stacked defects. Our results suggest that the friction on defective graphite shows a strong dependence on defect location and type. The 5-7-7-5 structure of SW defect results in an effectively negative slope of friction. For defective graphite containing a defect in the surface, adding a single vacancy in the interior layer will decrease the friction coefficients, while setting a SW defect in the interior layer may increase the friction coefficients. Our obtained results may provide useful information for understanding the atomic-scale friction properties of defective graphite.

Sun, Xiao-Yu [Department of Engineering Mechanics, School of Civil Engineering, Wuhan University, Wuhan 430072 (China); Key Laboratory of Hubei Province for Water Jet Theory and New Technology, Wuhan University, Wuhan 430072 (China); Wu, RunNi; Xia, Re [Key Laboratory of Hubei Province for Water Jet Theory and New Technology, Wuhan University, Wuhan 430072 (China); Chu, Xi-Hua; Xu, Yuan-Jie, E-mail: yj-xu@whu.edu.cn [Department of Engineering Mechanics, School of Civil Engineering, Wuhan University, Wuhan 430072 (China)

2014-05-05T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Secretary Bodman Begins Australia Visit | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Begins Australia Visit Begins Australia Visit Secretary Bodman Begins Australia Visit January 11, 2006 - 10:24am Addthis Two day trip highlighted by Asia-Pacific Partnership inaugural meeting SYDNEY, AUSTRALIA - Secretary of Energy Samuel W. Bodman on Wednesday began a two day visit to Australia where he will lead the United States delegation to the inaugural meeting of the Asia-Pacific Partnership for Clean Development and Climate (APP). The APP brings together governments and private sector entities from Australia, China, India, Japan, South Korea and the United States to encourage the deployment of clean energy technologies and international cooperation in eight areas: cleaner fossil energy; renewable and distributed generation; power generation and transmission; aluminum; steel; cement; buildings and appliances; and

102

australia electronic resource: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

beauty: discourses of cosmetic surgery in popular women's magazines in Australia, Germany and Japan. Open Access Theses and Dissertations Summary: ??This thesis analyses...

103

International Conference on Neutron Scattering 2005 Darling Harbour. Sydney. Australia  

E-Print Network [OSTI]

International Conference on Neutron Scattering 2005 Darling Harbour. Sydney. Australia 27 November, Hillerød, Denmark Combined application of small-angle neutron scattering and oscillatory shear

104

Morphological Continental Drift Fit of Australia and Antarctica  

Science Journals Connector (OSTI)

... of the Ross Sea. An even more extreme possibility is the placing of the Great Bight of Australia against Chile8.

WALTER P. SPROLL; ROBERT S. DIETZ

1969-04-26T23:59:59.000Z

105

Appliance Energy Consumption in Australia | Open Energy Information  

Open Energy Info (EERE)

Appliance Energy Consumption in Australia Appliance Energy Consumption in Australia Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Appliance Energy Consumption in Australia Focus Area: Appliances & Equipment Topics: Policy Impacts Website: www.energyrating.gov.au/resources/program-publications/?viewPublicatio Equivalent URI: cleanenergysolutions.org/content/appliance-energy-consumption-australi DeploymentPrograms: Industry Codes & Standards Regulations: Appliance & Equipment Standards and Required Labeling The document sets out the equations necessary to calculate the star rating index for appliances that carry an energy label in Australia. Equations for new air conditioner and refrigerator algorithms from April 2010 are included. Televisions, which have carried a mandatory energy label from

106

Are primary health care centres that target injecting drug users attracting and serving the clients they are designed for? A case study from Sydney, Australia  

Science Journals Connector (OSTI)

Background Low-threshold primary healthcare (PHC) centres targeting injecting drug users (IDUs) are increasingly being created to offer preventative and opportunistic services. However, no data are available on the characteristics of clients who utilise such services, or the effectiveness of these services in facilitating prevention or treatment. Method A retrospective clinical record audit examined the characteristics, service utilisation patterns and referral uptake of 384 clients presenting to a low-threshold PHC service in Sydney, Australia. Results Of the 384 clients, 85% were IDUs. Sixty-two percent reported also having access to a general medical practitioner (GP), with this group more likely to report taking benzodiazepines or other psychoactive medication. Despite this relatively high level of GP access, only 50% were fully vaccinated against hepatitis B virus (HBV). Testing for blood-borne viral and sexually transmitted infections were the most common reasons for presentation to the PHC. Most (82%) clients made at least one return visit, with an average of 3.5 presentations per client. All clients were offered HBV vaccination where indicated (n=145); and more than half (55%) of referrals to external services were attended. Clients accessing this PHC were younger, more likely to be male and born outside Australia than \\{IDUs\\} attending needle syringe programs (NSPs) in Australia's most populous state, New South Wales. Conclusion Results suggest that this low-threshold PHC service was underutilised and its role as a low-threshold healthcare outlet remains limited. Further research is needed to more clearly delineate the health and economic benefits of this model.

M. Mofizul Islam; Libby Topp; Katherine M. Conigrave; Ann White; Paul S. Haber; Carolyn A. Day

2013-01-01T23:59:59.000Z

107

GNSS Futures, Sydney, Australia, 7-8 July 2014GNSS Futures, Sydney, Australia, 7-8 July 2014 School of Civil & Environmental Engineering, UNSW, Sydney,  

E-Print Network [OSTI]

GNSS Futures, Sydney, Australia, 7-8 July 2014GNSS Futures, Sydney, Australia, 7-8 July 2014 School of Civil & Environmental Engineering, UNSW, Sydney, Australia The International Scene: How Precise-15) President International Association of Geodesy (2011-15) #12;GNSS Futures, Sydney, Australia, 7-8 July 2014

Sekercioglu, Y. Ahmet

108

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

109

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

110

E-Print Network 3.0 - australia potential sources Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of revenue for Australia and for this reason... resources 12;8 Table 1. WEC and BGR coal resource and reserve estimates for Australia. Data source: Hk et... , Australia *...

111

Petroleum prospectivity of Australia's southern margin  

SciTech Connect (OSTI)

Australia's southern margin extends for almost 4000 km, from the Naturaliste Plateau in the west to the South Tasman Rise in the southeast, and developed from the Gondwana rift system which also gave rise to the Bass basin and prolific Gippsland basin of southeastern Australia. It incorporates six major sedimentary basins - Bremer, Eyre, Great Australian Bight (GAB), Duntroon, Otway, and Sorell - which are the products of Gondwana fragmentation. Exploration targets generated by this complex tectonic history include fault blocks and associated rollovers; wrench-related anticlines and flower structures, often developed over reactivated transfer faults; strongly eroded unconformities; and deltas of Neocomian and Maastrichtian-Cenomanian age. The southern margin basins contain several sandstone units with good reservoir potential. Hydrocarbons are being actively generated, at least within the Otway and Sorell basins, as indicated by abnormally high concentrations of thermogenic gases in surface sediment samples and the presence of free oil in the Cape Sorell 1 well. Deposits containing oil-prone type I organic matter occur in the Lower Cretaceous section of the Otway basin. To date, exploration has been light, with 17 of the total 27 wells having been sited in the Otway basin. The huge GAB basin (/approximately/ 400 /times/ 200 /times/ 10 km thick) contains only one exploration well, sited near the northern margin of the basin, and this basin is an obvious focus for further exploration effort.

Willcox, J.B.; Stagg, H.M.J.

1989-03-01T23:59:59.000Z

112

The Potential Wind Power Resource in Australia: A New Perspective*  

E-Print Network [OSTI]

The Potential Wind Power Resource in Australia: A New Perspective* Willow Hallgren, Udaya Bhaskar: globalchange@mit.edu Website: http://globalchange.mit.edu/ #12;The Potential Wind Power Resource in Australia, and the utilization of this renewable energy resource is increasing rapidly: wind power installed capacity increased

113

The Potential Wind Power Resource in Australia: A New Perspective  

E-Print Network [OSTI]

The Potential Wind Power Resource in Australia: A New Perspective Willow Hallgren, Udaya Bhaskar;1 The Potential Wind Power Resource in Australia: A New Perspective Willow Hallgren* , Udaya Bhaskar Gunturu, and the utilization of this renewable energy resource is increasing. Wind power installed capacity increased by 35

114

Prospects for nuclear power in Australia and New Zealand  

Science Journals Connector (OSTI)

The nuclear debate in Australia was recently enlivened by a Federal Government report (released in December 2006) on the economic viability of nuclear power as an option for electricity generation. Given the nation's large reserves of coal and gas, the question of the role of nuclear power rests to a large extent on future climate policy. Australia has the world's largest reserves of uranium and is currently the second largest producer and exporter of the resource in the world. There may be some scope in the future for Australia to expand its nuclear industry to include enrichment and reprocessing activities.

Anna L. Matysek; Brian S. Fisher

2008-01-01T23:59:59.000Z

115

The Potential Wind Power Resource in Australia: A New Perspective  

E-Print Network [OSTI]

Australia is considered to have very good wind resources, and the utilization of this renewable energy resource is increasing. Wind power installed capacity increased by 35% from 2006 to 2011 and is predicted to account ...

Hallgren, Willow

116

Solar/hydrogen fuel cell car crosses Australia  

Science Journals Connector (OSTI)

A team of students from Tamagawa University in Tokyo have become the first people to cross Australia in a solar hydrogen-powered vehicle, which runs on a combination of solar cells and fuel cells. The engineering students led by Professor Hiroyuki Obara left the University of Western Australia in Perth in their Apollondine vehicle on December 19, and travelled 4084 km (2538 miles) to Sydney in just eight days.

2004-01-01T23:59:59.000Z

117

Prospect of biofuels as an alternative transport fuel in Australia  

Science Journals Connector (OSTI)

Abstract The prospect of biofuels as a transport alternative fuel in Australia is reviewed and discussed in this paper. The Australian transport sector is the second largest energy consuming sector which consumes about 24% of total energy consumption. A part of this energy demand can be met by ecofriendly biofuels. A wide array of different biofuels feedstocks including Australian native species, their distributions, oil content, traditional uses are reviewed and listed in the descending order of their oil content. The world biofuel scenario as well as the 20 largest biofuel production countries and their mandates on biofuels blending with petroleum diesel are presented. Australias biofuel production, consumption, production facilities and future investment projects are also reviewed and discussed. The study developed a biofuel supply chain for Australia and found that the second generation biofuels have better prospects as a future alternative transport fuel in Australia. These biofuel feedstocks are readily available and can overcome the shortcomings of the first generation biofuels, such as socio-economic, environmental and food versus land use challenges. Although some research is in progress, further study is needed on the process development of second generation biofuel production at commercial scale in Australia and abroad.

A.K. Azad; M.G. Rasul; M.M.K. Khan; Subhash C. Sharma; M.A. Hazrat

2015-01-01T23:59:59.000Z

118

U.S. LNG Imports from Australia  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual

119

charteredaccountantsanz.com Chartered Accountants Australia and New Zealand is a trading name for the Institute of Chartered Accountants in Australia (ABN 50 084 642 571)  

E-Print Network [OSTI]

charteredaccountantsanz.com Chartered Accountants Australia and New Zealand is a trading name for the Institute of Chartered Accountants in Australia (ABN 50 084 642 571) and the New Zealand Institute minds from Australia and New Zealand. This is an opportunity for students to apply the business skills

Hickman, Mark

120

Solar Sailor Holdings Ltd SSHL | Open Energy Information  

Open Energy Info (EERE)

Sailor Holdings Ltd SSHL Sailor Holdings Ltd SSHL Jump to: navigation, search Name Solar Sailor Holdings Ltd (SSHL) Place Chatswood, New South Wales, Australia Zip 2067 Sector Solar Product Solar Sailor 'hybrid marine power' (HMP) and 'solar wing' technology is suitable for a wide range of applications from small-unmanned vessels to large tankers, including ferries, tourist cruisers and private yachts. References Solar Sailor Holdings Ltd (SSHL)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solar Sailor Holdings Ltd (SSHL) is a company located in Chatswood, New South Wales, Australia . References ↑ "Solar Sailor Holdings Ltd (SSHL)" Retrieved from "http://en.openei.org/w/index.php?title=Solar_Sailor_Holdings_Ltd_SSHL&oldid=35132

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Renewable Energy Systems (RES Australia and New Zealand) | Open Energy  

Open Energy Info (EERE)

Australia and New Zealand) Australia and New Zealand) Jump to: navigation, search Logo: Renewable Energy Systems (RES Australia and New Zealand) Name Renewable Energy Systems (RES Australia and New Zealand) Address Level 2 39 Hume St Place Sydney, Australia Sector Wind energy Product Wind farm development and construction Phone number +61 (0)2 9431 7600 Website http://www.res-group.com/ Coordinates -33.8253189°, 151.199972° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-33.8253189,"lon":151.199972,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

122

Assessing environmental impacts on stream water quality: deforestation in mid-Wales Hydrology and Earth System Sciences, 6(3), 421431 (2002) EGS  

E-Print Network [OSTI]

the environmental sciences, there are major management issues over the impact of man on the water qualityAssessing environmental impacts on stream water quality: deforestation in mid-Wales 421 Hydrology and Earth System Sciences, 6(3), 421­431 (2002) © EGS Assessing environmental impacts on stream water

Boyer, Edmond

123

U.S. LNG Imports from Australia  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual

124

Pricing of Australia's coking coal exports: A regional hedonic analysis  

Science Journals Connector (OSTI)

Black coal is Australia's most important export commodity, but the profitability of the domestic coal industry has been low relative to the mining sector average. As a consequence, a key policy issue in Australia has been the extent to which Japan's coal pricing and investment policies have influenced coal market outcomes. In this paper, a regional hedonic pricing model of Australia's coking coal exports is estimated for the period JFY1989 to 1996. Non-Japan regional intercept dummy variables were found to be significantly different from zero, although these varied across coal categories and years. However, the empirical evidence indicates that Japan does not pay significantly lower prices relative to other major export markets for coking coal of a given quality.

Lindsay Hogan; Sally Thorpe; Anthony Swan; Simon Middleton

1999-01-01T23:59:59.000Z

125

E-Print Network 3.0 - australia wind energy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Congress, Sydney, Australia September 5-9, 2004 1 OFFSHORE WIND POWER: EASING... of wind turbines is expected to be between 12;19 th World Energy Congress, Sydney, Australia...

126

Perceived neighborhood environmental attributes associated with adults' transport-related walking and cycling: Findings from the USA, Australia and Belgium  

E-Print Network [OSTI]

and cycling: Findings from the USA, Australia and Belgium.and cycling: Findings from the USA, Australia and Belgiumgender. Methods: Data from the USA (Baltimore and Seattle),

2012-01-01T23:59:59.000Z

127

Effects of boron-nitride substrates on Stone-Wales defect formation in graphene: An ab initio molecular dynamics study  

SciTech Connect (OSTI)

Ab initio molecular dynamics simulations are performed to investigate the effects of a boron nitride (BN) substrate on Stone-Wales (SW) defect formation and recovery in graphene. It is found that SW defects can be created by an off-plane recoil atom that interacts with the BN substrate. A mechanism with complete bond breakage for formation of SW defects in suspended graphene is also revealed for recoils at large displacement angles. In addition, further irradiation can result in recovery of the SW defects through a bond rotation mechanism in both graphene and graphene/BN, and the substrate has little effect on the recovery process. This study indicates that the BN substrate enhances the irradiation resistance of graphene.

Jin, K.; Xiao, H. Y. [Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Zhang, Y. [Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Weber, W. J., E-mail: wjweber@utk.edu [Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)

2014-05-19T23:59:59.000Z

128

Towards a `cost of credit' cap in the UK: Lessons from Australia1  

E-Print Network [OSTI]

Towards a `cost of credit' cap in the UK: Lessons from Australia1 Jodi Gardner and Karen Rowlingson Authority) must introduce some limitation on the cost of credit by January 2015. It has cited Australia as an example of a country where such a cap works well. However, Australia only implemented its interest rate

Birmingham, University of

129

The University of Western Australia Submission to the Senate Education and Employment Legislation Committee  

E-Print Network [OSTI]

The University of Western Australia Submission to the Senate Education and Employment Legislation Australia welcomes the opportunity to make the following submission to the Education and Employment Senate Bill (2014). The University of Western Australia (UWA) was founded more than 100 years ago as the state

Tobar, Michael

130

Cretaceous Vertical Motion of Australia and the Australian-  

E-Print Network [OSTI]

of the SEIR be- tween 120° and 128°E, south of the Great Australian Bight (GAB), is characterized by ruggedCretaceous Vertical Motion of Australia and the Australian- Antarctic Discordance Michael Gurnis, R and the present-day distinctive geochemistry and geophysics of the Australian-Antarctic Discordance. The dynamic

Müller, Dietmar

131

Production of Mallee Biomass in Western Australia: Energy Balance Analysis  

Science Journals Connector (OSTI)

Production of Mallee Biomass in Western Australia: Energy Balance Analysis ... If mallee crops prove commercially viable, a considerable centrally harvested biomass supply could be available for conversion to renewable energy and other industrial products. ... This study presents a systematic analysis of overall energy balance of mallee biomass production in WA. ...

Hongwei Wu; Qiang Fu; Rick Giles; John Bartle

2007-09-25T23:59:59.000Z

132

Land cover change and water vapour flows: learning from Australia  

Science Journals Connector (OSTI)

...Agriculture trends Australia Conservation of Natural Resources Ecosystem Environment Fresh Water Plant Transpiration physiology...Gleick, P. H. 1993 Water in crises. New York...human well-being. Water Int. 25, 178184. Graetz...The terrestrial carbon pools of the Australian continent...

2003-01-01T23:59:59.000Z

133

Mycobacterium avium subsp. paratuberculosis in the Catchment Area and Water of the River Taff in South Wales, United Kingdom, and Its Potential Relationship to Clustering of Crohn's Disease Cases in the City of Cardiff  

Science Journals Connector (OSTI)

...prevailing southwesterly winds. This would influence...America (18, 37, 49). Wildlife reservoirs may contribute...prevailing southwesterly winds. (Map reproduced with...Agency (Wales) for the wind, river, and rainfall...infection of nonruminant wildlife in Scotland. J. Clin...

R. W. Pickup; G. Rhodes; S. Arnott; K. Sidi-Boumedine; T. J. Bull; A. Weightman; M. Hurley; J. Hermon-Taylor

2005-04-01T23:59:59.000Z

134

Mount Macedon, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Macedon, Australia: Energy Resources Macedon, Australia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2156590 Coordinates -37.38333°, 144.6° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-37.38333,"lon":144.6,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

135

Beginning of an oil shale industry in Australia  

SciTech Connect (OSTI)

This paper discusses how preparations are being made for the construction and operation of a semi commercial plant to process Australian oil shale. This plant is primarily designed to demonstrate the technical feasibility of processing these shales at low cost. Nevertheless it is expected to generate modest profits even at this demonstration level. This will be the first step in a three staged development of one of the major Australian oil shale deposits which may ultimately provide nearly 10% of Australia's anticipated oil requirements by the end of the century. In turn this development should provide the basis for a full scale oil shale industry in Australia based upon the advantageously disposed oil shale deposits there. New sources of oil are becoming critical since Australian production is declining rapidly while consumption is accelerating.

Wright, B. (Southern Pacific Petroleum NL, 143 Macquarie Street, Sydney (AU))

1989-01-01T23:59:59.000Z

136

Coal exports may make Australia's energy sector among least sustainable  

SciTech Connect (OSTI)

Plentiful coal and cheap energy prices have resulted in an unusually heavy carbon footprint. Clearly, Australia has to rethink how much coal it will use to feed its own growing economy while becoming more conscious of its significant carbon export problem. For a country long used to digging the coal out of the ground and shipping it overseas, climate change will be a game changer.

NONE

2009-11-15T23:59:59.000Z

137

Performance analysis of boron nitride embedded armchair graphene nanoribbon metaloxidesemiconductor field effect transistor with Stone Wales defects  

SciTech Connect (OSTI)

We study the performance of a hybrid Graphene-Boron Nitride armchair nanoribbon (a-GNR-BN) n-MOSFET at its ballistic transport limit. We consider three geometric configurations 3p, 3p + 1, and 3p + 2 of a-GNR-BN with BN atoms embedded on either side (2, 4, and 6 BN) on the GNR. Material properties like band gap, effective mass, and density of states of these H-passivated structures are evaluated using the Density Functional Theory. Using these material parameters, self-consistent Poisson-Schrodinger simulations are carried out under the Non Equilibrium Green's Function formalism to calculate the ballistic n-MOSFET device characteristics. For a hybrid nanoribbon of width ?5?nm, the simulated ON current is found to be in the range of 265??A280??A with an ON/OFF ratio 7.1 10{sup 6}7.4 10{sup 6} for a V{sub DD}?=?0.68?V corresponding to 10?nm technology node. We further study the impact of randomly distributed Stone Wales (SW) defects in these hybrid structures and only 2.5% degradation of ON current is observed for SW defect density of 3.18%.

Chanana, Anuja; Sengupta, Amretashis; Mahapatra, Santanu [Nano Scale Device Research Laboratory, Department of Electronic Systems Engineering, Indian Institute of Science, Bangalore 560 012 (India)

2014-01-21T23:59:59.000Z

138

SEARCHING FOR EXTRASOLAR PLANETS FROM UNSW. J. L. Christiansen, M. C. B. Ashley, J. K. Webb, M. G. Hidas, University of New South Wales, Kensington, NSW, 2052, AUSTRALIA (jessiec@phys.unsw.edu.au).  

E-Print Network [OSTI]

time and weather constraints resulted in a failure to capture our candidates in transit with the ANU 40 dwarf companion. Improvements - Hardware With the assistance of an ARC grant a new CCD camera has been are sys- tematics, implementing a period-finding program to hunt for low amplitude transits when

Ashley, Michael C. B.

139

Study and teaching of German at universities in Ukraine and Australia.  

E-Print Network [OSTI]

??The research was conducted at universities in Kyiv, Kharkiv and Lviv (Ukraine) and Melbourne (Australia). A combination of quantitative and qualitative methods was adopted which (more)

King, Oksana

2009-01-01T23:59:59.000Z

140

Metal accumulation in the greentail prawn, Metapenaeus bennettae, in Sydney and Port Hacking estuaries, Australia  

Science Journals Connector (OSTI)

Metal concentrations of the inshore greentail prawn, Metapenaeus bennettae..., and surface sediments from locations within Sydney estuary and Port Hacking (Australia) were assessed for bioaccumulation and ... est...

K. L. M. Lewtas; G. F. Birch

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Solar energy in Australia: a profile of renewable energy activity in its national context  

SciTech Connect (OSTI)

The following topics are included: country overview; energy summary; geopolitical, economic, and cultural aspects of Australia; the energy profile; and international agreements, contacts, manufacturers, and projects. (MHR)

Case, G.L.

1980-08-01T23:59:59.000Z

142

E-Print Network 3.0 - australia adaptive evolution Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

143

E-Print Network 3.0 - australia valitsuse kummuli Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

144

E-Print Network 3.0 - australia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

145

E-Print Network 3.0 - ajavad australia valitsuse Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

146

E-Print Network 3.0 - aborigeenid ajavad australia Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

147

E-Print Network 3.0 - australia empirical results Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Otago Collection: Biology and Medicine 13 Published in International Journal of Coal Geology Volume 86, Issue 4, 1 June 2011, Pages 329-341 Summary: , Australia * Global...

148

Monophyly of marsupial intraerythrocytic apicomplexan parasites from South America and Australia .  

E-Print Network [OSTI]

??Intraerythrocytic parasites (Apicomplexa: Sarcocystidae) of the South American mouse opossum (Thylamys elegans) from Chile, South America, and of the yellow-bellied glider (Petaurus australis) from Australia (more)

Merino, Santiago

2010-01-01T23:59:59.000Z

149

Origin and structure of the Ceduna delta system, offshore South Australia.  

E-Print Network [OSTI]

??This thesis consists of five papers, each of which complements the regional understanding of the Ceduna Delta System, offshore South Australia. Deltas commonly form linked (more)

MacDonald, Justin

2013-01-01T23:59:59.000Z

150

Strategic culture and non-nuclear weapon outcomes: the cases of Australia, South Africa and Sweden .  

E-Print Network [OSTI]

??This thesis uses a "strategic culture" approach to gain insights into non-nuclear weapon outcomes in Australia, South Africa and Sweden. Strategic culture refers to the (more)

Poore, S.E.

2000-01-01T23:59:59.000Z

151

report 2013 Front cover image: Greenough River Solar Farm, Western Australia.  

E-Print Network [OSTI]

. From jobs and investment in regional areas to solar panels, solar hot water and high efficiencyClean energy australia report 2013 #12;Front cover image: Greenough River Solar Farm, Western Australia. Courtesy of First Solar. #12;table of Contents 01 introduCtion 05 exeCutive summary 07 snapshot

Green, Donna

152

Gridded Operational Consensus Forecasts of 2-m Temperature over Australia CHERMELLE ENGEL  

E-Print Network [OSTI]

-resolution grid. Local and in- ternational numerical weather prediction model inputs are found to have coarse by numerical weather prediction (NWP) model forecasts. As NWP models improve, public weather forecasting University of Melbourne, Melbourne, Victoria, Australia ELIZABETH E. EBERT Centre for Australia Weather

Ebert, Beth

153

A new species of CrypllOnectria from South Africa and Australia, pathogenic to Eucalyptus  

E-Print Network [OSTI]

A new species of CrypllOnectria from South Africa and Australia, pathogenic to Eucalyptus Marieka (FABI), University of Pretoria, Pretoria 0002, South Africa Venter, M., H. Myburg, B. D. Wingfield, T. A. Coutinho & M. J. Wingfield (2002). A new species of Cryphonectria from South Africa and Australia, patho

154

PLAYER REGISTRATION City State Zip  

E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

155

Plant species of the Central European flora as aliens in Australia Stedoevropsk rostlinn druhy zavlecen do Austrlie  

E-Print Network [OSTI]

Plant species of the Central European flora as aliens in Australia Stedoevropské rostlinné druhy. (2010): Plant spe- cies of the Central European flora as aliens in Australia. ­ Preslia 82: 465 that are currently recognized as alien species in Australia. We explored temporal patterns of introduction

Richner, Heinz

156

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

157

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

158

NAM in north Wales  

Science Journals Connector (OSTI)

......ultraviolet radiation to drive photosynthesis...Charon. The gas is extremely cold...snowfalls and all the gases freezing out onto...KIDCAM uses the natural radiation emitted...regions of ionized gas (plasma) that...are much in the news as the Sun emerges...processes that drive solar activity......

Sue Bowler

2011-06-01T23:59:59.000Z

159

JOURNALOF GEOPRYSICALRESEARCH, VOL. 87, NO. B6, PAGES 4697-4714, JUNE 10, 1982 UNCERTAINTIES IN THE RELATIVE POSITIONS OF THE AUSTRALIA, ANTARCTICA,  

E-Print Network [OSTI]

IN THE RELATIVE POSITIONS OF THE AUSTRALIA, ANTARCTICA, LORD HOWE, AND PACIFIC PLATES SINCE THE LATE CRETACEOUS plates, between Australia and Antarctica, and between the Lord Howe Rise and Australia. We combined these to yield a range of possible finite rotations describing the relative posi- tions of the Pacific, Australia

Goddard III, William A.

160

Focusing management needs at the sub-catchment level via assessments of change in the cover of estuarine vegetation, Port Hacking, NSW, Australia  

Science Journals Connector (OSTI)

Aerial photographs from 1930 to 1999 were used to assess change in the distribution of seagrass, mangrove and saltmarsh in Port Hacking, New South Wales. Initially stable at ... five-fold increase in mangrove. Wi...

R. J. Williams; A. J. Meehan

2004-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Australia, Iceland and the U.S. Launch International Partnership to Promote  

Broader source: Energy.gov (indexed) [DOE]

Australia, Iceland and the U.S. Launch International Partnership to Australia, Iceland and the U.S. Launch International Partnership to Promote Advanced Geothermal Technologies Australia, Iceland and the U.S. Launch International Partnership to Promote Advanced Geothermal Technologies August 28, 2008 - 3:20pm Addthis REYKJAVIK, ICELAND - The U.S. Department of Energy's (DOE) Acting Assistant Secretary for Policy and International Affairs Katharine Fredriksen, Australia's Ambassador to Iceland Sharyn Minahan, and Iceland's Minister of Industry Energy and Tourism Ossur Skarphedinsson today signed the charter of the International Partnership for Geothermal Technology (IPGT), signaling the commitment of the three countries to aggressively foster and promote cutting edge geothermal technologies to promote energy security and

162

ISBN/ISSN 0977586103 Copyright (c) Australian Telecommunication Networks & Applications Conference (ATNAC), Australia, December 2006  

E-Print Network [OSTI]

as a person launching abuse of a content distribution system (such as Internet email). A spammer's primary (ATNAC), Australia, December 2006 Classifying Excessive Internet Resource Consumption ­ Proposed Taxonomies Minh Tran, Grenville Armitage Centre for Advanced Internet Architectures Swinburne University

Armitage, Grenville

163

NABERS: Lessons from 12 Years of Performance Based Ratings in Australia  

E-Print Network [OSTI]

The National Australian Built Environment Rating System (NABERS) has been operating for 12 years as a performance based rating system for the energy/greenhouse efficiency of office buildings in Australia. During this period, the scheme has been...

Bannister, P.

2012-01-01T23:59:59.000Z

164

Diagnosis of Upper-Level Processes Influencing an Unusually Intense Extratropical Cyclone over Southeast Australia  

Science Journals Connector (OSTI)

On 1 December 1987, an unusual midlatitude cyclone affected much of southeastern Australia. The storm was characterized by unforced rapid deepening to a near record low (locally) mean sea-level pressure, high winds, anomalously cold surface ...

Christopher S. Velden; Graham A. Mills

1990-09-01T23:59:59.000Z

165

Analysis of a Destructive Wind Storm on 16 November 2008 in Brisbane, Australia  

Science Journals Connector (OSTI)

During the late afternoon on 16 November 2008 the Brisbane (Queensland, Australia) suburb of The Gap experienced extensive wind damage caused by an intense local thunderstorm. The CP2 research radar nearby detected near-surface radial velocities ...

Harald Richter; Justin Peter; Scott Collis

2014-09-01T23:59:59.000Z

166

Terrorism in Australia: factors associated with perceived threat and incident-critical behaviours  

Science Journals Connector (OSTI)

Socioeconomic and demographic factors including low education level and migrant background predict a perception of high terrorism risk in Australia, indicating the need for group-specific terrorist risk communication strategies in this country.

Garry Stevens; Kingsley Agho; Melanie Taylor; Margo Barr; Beverley Raphael; Louisa Jorm

2009-03-27T23:59:59.000Z

167

Development of an endocrine genomics virtual research environment for Australia: building on success .  

E-Print Network [OSTI]

??The $47m Australian National eResearch Collaboration Tools and Resources (NeCTAR - www.nectar.org.au) project has recently funded an initiative to establish an Australia-wide endocrine genomics virtual (more)

Sinnott, Richard O.

2013-01-01T23:59:59.000Z

168

Correspondences: A personal photographic journey between past/Iran and present/Australia.  

E-Print Network [OSTI]

??This project is an autobiographical photography series entitled: Correspondences; A personal photographic journey between past/Iran and present/Australia. This series of photographs are partly influenced by (more)

Javan, Katayoun

2013-01-01T23:59:59.000Z

169

Low-cost geophysical investigations of a paleochannel aquifer in the Eastern Goldfields, Western Australia  

Science Journals Connector (OSTI)

...Smyth and Barrett, 1994). In Western Australia, general paleodrainage systems can be identified by examining...9c shows a horizontal event at 187 Hz, caused by a diesel engine nearby used to pump water from the open-pit mine...

Josef Holzschuh

170

A.W. Blakers, 'Solar and Wind Electricity in Australia', Australian Journal of Environmental Management, Vol 7, pp 223-236, 2000 SOLAR AND WIND ELECTRICITY IN AUSTRALIA  

E-Print Network [OSTI]

environmental impact associated with the construction of what amounts to a coastal hydro scheme. Solar energy.blakers@anu.edu.au Abstract This paper examines the renewable generation of electricity in Australia from photovoltaics (PV environmental impacts even when deployed on very large scales. They are the only fully sustainable technologies

171

Hydrocarbon potential of basins along Australia's southern margin  

SciTech Connect (OSTI)

Seven discrete sedimentary basins are recognized along the southern margin of the Australian continent; namely, from east to west, the Gippsland, Bass, Sorell, Otway, Duntroon, Bight, and Bremer. All formed since the Late Jurassic in response to the separation of Australia and Antarctica, and to the opening of the Tasman Sea. Only the Gippsland basin, which has proved initial oil reserves exceeding 3.6 billion barrels, is a prolific oil province. The search for oil in the other basins has been virtually fruitless despite many similarities between these basins and the Gippsland in terms of stratigraphy and structural geology. Rift and drift components are discernible in the sedimentary successions of all basins but the precise tectonic controls on respective basin formation remain conjectural. The lack of drilling success in the Bremer, Bight, Duntroon, Otway, and Sorell basins has been attributed mainly to the paucity of mature, oil-prone source rocks. The common occurrence of stranded bitumens along the entire coastline, however, indicates oil generation. The Bass and Gippsland basins are both characterized by excellent oil-prone source rocks developed in Late Cretaceous to Early Tertiary sediments. Limited exploration success in the Bass basin is due to poorer reservoir development. The Gippsland basin is at a mature stage of exploration whereas the other basins are moderately to very sparsely explored. Consequently, there is a comparable potential for undiscovered hydrocarbons in all basins. Success in the under-explored basins will come only to those prepared to challenge the perception of low prospectivity. Many play types remain to be tested by the drill.

Willink, R.J. (SAGASCO Resources Limited, Adelaide (Australia))

1991-03-01T23:59:59.000Z

172

The changing epidemiology of Murray Valley encephalitis virus and West Nile virus (Kunjin strain) in epizootic regions of Western Australia.  

E-Print Network [OSTI]

??[Truncated abstract] Arboviral activity in Western Australia (WA) was widespread throughout 2000 in both enzootic and epizootic areas of the state. The aim of this (more)

Sturrock, Keryn Lorraine

2009-01-01T23:59:59.000Z

173

Sedimentology, Stratigraphy and Petrography of the Permian-Triassic Coal-bearing New Lenton Deposit, Bowen Basin, Australia .  

E-Print Network [OSTI]

??The Bowen Basin is one of the most intensely explored sedimentary basins in Australia and hosts one of the worlds largest coking coal deposits. This (more)

Coffin, Lindsay M.

2013-01-01T23:59:59.000Z

174

In Situ Delta-13 CO2 from Cape Grim, Tasmania, Australia: 1982-1993  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In Situ δ13CO2 from Cape In Situ δ13CO2 from Cape Grim, Australia In Situ δ13CO2 from Cape Grim, Tasmania, Australia: 1982-1993 graphics Graphics data Data Investigators R.J. Francey and C.E. Allison CSIRO, Division of Atmospheric Research, Private Bag No. 1, Mordialloc, Victoria, Australia 3195 Period of Record 1982-1993 Methods Air samples are collected during baseline condition episodes at a frequency of around one sample per week. Baseline conditions are characterized by wind direction in the sector 190-280°, condensation nucleus concentration below 600 cm3, and steady, continuous CO2 concentrations (variation + 0.2 ppmv per hour). The Cape Grim in situ extraction line is based on 3 high-efficiency glass U-tube traps with internal cooling coils. A vacuum pump draws air from either the 10 m or 70 m intakes, and sampling

175

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C  

E-Print Network [OSTI]

Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C General; Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia

Albrecht, David

176

Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 19952007 (the  

E-Print Network [OSTI]

1 Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 1995­2007 (the International Cancer Benchmarking Partnership): an analysis of population-based cancer registry data M P Coleman Background Cancer survival is a key measure of the effectiveness of health-care systems. Persistent regional

Maizels, Rick

177

MERCURY CYCLING IN LAKE GORDON AND LAKE PEDDER, TASMANIA (AUSTRALIA). I: IN-LAKE PROCESSES  

E-Print Network [OSTI]

MERCURY CYCLING IN LAKE GORDON AND LAKE PEDDER, TASMANIA (AUSTRALIA). I: IN-LAKE PROCESSES KARL C; accepted 2 December 2002) Abstract. The processes affecting the concentrations of total mercury (total Hg- vestigated. Surface concentrations of total mercury (total Hg) were temporally and spatially uniform in both

Canberra, University of

178

Determining price differences among different classes of wool from the U.S. and Australia  

E-Print Network [OSTI]

The U.S. wool industry has long received lower prices for comparable wool types than those of Australia. In order to better understand such price differences, economic evaluations of both the U.S. and Australian wool markets were conducted...

Hager, Shayla Desha

2004-09-30T23:59:59.000Z

179

Proceedings World Geothermal Congress 2015 Melbourne, Australia, 19-25 April 2015  

E-Print Network [OSTI]

Proceedings World Geothermal Congress 2015 Melbourne, Australia, 19-25 April 2015 1 TOMO4D: Temporal Changes in Reservoir Structure at Geothermal Areas Bruce R. Julian1 , Gillian R. Foulger1 , Andrew.r.foulger@durham.ac.uk najwa.mhanna@durham.ac.uk 2 Geothermal Program Office, China Lake, CA 93555 andrew

Foulger, G. R.

180

AustraliaJapan coking coal trade: A hedonic analysis under benchmark and fair treatment pricing  

Science Journals Connector (OSTI)

Given Japan's dominant position in the AsiaPacific regional coal market and the continuing relatively low profitability of Australia's coal industry, the influence of the Japanese steel mills on coal pricing arrangements between Australia and Japan remains an issue in Australia. In Japanese fiscal year (JFY) 1996, the Japanese steel mills replaced benchmark pricing with the fair treatment pricing system whereby coal contract information is kept confidential. In this paper, Quandt's switching regime model is used to test for structural change in hedonic pricing relationships in the important AustraliaJapan coking coal trade between JFY 1992 and 1997. There is statistical evidence of significant structural change in JFY 1996 for hard coking coal and in JFY 1995 for semisoft coking coal (when soft coking coal was merged with the semisoft category). The goodness of fit of the regressions is lower in each recent period. It is concluded that price discovery in the annual coal negotiations, particularly for hard coking coal, is relatively more difficult under fair treatment pricing.

Anthony Swan; Sally Thorpe; Lindsay Hogan

1999-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Chapter 17 - To Experience the Real Australia A Liminal Authentic Cultural Experience  

Science Journals Connector (OSTI)

This chapter will pose the question: If a nation's icons are not true representations of that society's culture then what are true descriptors of that culture? Australia as a Tourist Destination Region (TDR) is denned as having 4 R's; the Roo, the Roof, the Reef and the Rock, as its main attractions. The Roo the marsupial family of kangaroos and wallabies. The Roof the exterior areas of the Sydney Opera House. The Reef refers to the Great Barrier Reef. Finally, the Rock Uluru, the world's largest monolith remotely situated in the middle of the continent. All the 4 R's are icons, and recognised worldwide as being images/pictures that describe Australia. Visitors are, to a certain degree, focused on gazing upon these icons, and the inbound tourism industry of Australia is focused on serving tourists at these attractions. An Australian is likely to regard the images as being too simplified descriptors. A normal response includes suggestions of visits to the outback to experience the real Australia, to sit in pubs talking to locals about real Australian professions such as mining or farming. The picture is painted as if to say that the tourist could not have experienced more than an overtly staged front-stage unless they have delved into other areas and activities; in short, to have gone backstage.

Johan R. Edelheim

2005-01-01T23:59:59.000Z

182

he history of collecting art in Australia contains few stories as alluring as Roddy Meagher's. Justice  

E-Print Network [OSTI]

#12;T he history of collecting art in Australia contains few stories as alluring as Roddy Meagher) is a veritable Aladdin's Cave of art. Rare oils and drawings jostle for space with decorative arts: Persian himself. Endowed with an extraordinary memory for names, dates, even prices paid for work, Roddy Meagher

Viglas, Anastasios

183

NCEDA RESEARCH THEMES The National Centre of Excellence in Desalination Australia has adopted a  

E-Print Network [OSTI]

improvement opportunities in pre-treatment: Preheating using waste heat or renewable energy and the use and remote areas relating to seasonal and location variability in feedwater composition Characterisation is particularly interested in identifying and piloting novel technologies for Australia's rural and remote needs

184

Energy Consumption and Economic Growth The Case of Australia Hong To a, *  

E-Print Network [OSTI]

;3 depend on imports of crude oil, natural gas, and coal for their industrial and residential energy needs). A decline in energy use does not, under conditions of economic efficiency, result in a reduction in economic1 Energy Consumption and Economic Growth ­ The Case of Australia Hong To a, * , Albert Wijeweera

185

Distribution of Polycyclic Aromatic Hydrocarbons in Sediments from Estuaries of South-eastern Australia  

E-Print Network [OSTI]

(PAH) in the environment has increased since the Industrial Revolution, chiefly through the widespread-eastern Australia John Bagg,AJ. David SmithBand William A. MaherB A Department of Industrial Science, University and Suess 1970). Estuarine and river sediments can be contaminated by inputs from domestic and industrial

Canberra, University of

186

,"Price of U.S. Liquefied Natural Gas Imports From Australia (Dollars per Thousand Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Australia (Dollars per Thousand Cubic Feet)" Australia (Dollars per Thousand Cubic Feet)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Price of U.S. Liquefied Natural Gas Imports From Australia (Dollars per Thousand Cubic Feet)",1,"Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n9103au3m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n9103au3m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov"

187

Three new species of shallow water, yellow zoanthids (Hexacorallia: Zoanthidea: Epizoanthidae) from southern California, USA, and southern Australia  

E-Print Network [OSTI]

In southern California and southern Australia, several species of hexacorals that are common at diving depths have been referred to as Yellow Zoanthids. We describe three new species of them in the genus Epizoanthus because all have a macrocnemic...

Phillipp, Nicholas A.; Fautin, Daphne G.

2009-03-30T23:59:59.000Z

188

Politicians, poisons and moths: ambiguity over the icon status of the Bogong moth (Agrotis infusa) (Noctuidae) in Australia  

Science Journals Connector (OSTI)

The federal Parliamentary Library of Australia recently took the unusual step of publishing an advisory briefing paper on moths (McCormick 2006). It was prompted by concerns arising from the annual invasions of...

T. R. New

2007-09-01T23:59:59.000Z

189

Multi-decadal Evaluation of WRF Downscaling Capabilities Over Western Australia in Simulating Rainfall and Temperature Extremes  

Science Journals Connector (OSTI)

We evaluate a 30 year (1981-2010) Weather Research and Forecast Model (WRF) regional climate simulation over the south-west of Western Australia (SWWA), a region with a Mediterranean climate, using ERA-Interim boundary conditions. Our analysis ...

Julia Andrys; Thomas J Lyons; Jatin Kala

190

Nuclear power can reduce emissions and maintain a strong economy: Rating Australias optimal future electricity-generation mix by technologies and policies  

Science Journals Connector (OSTI)

Abstract Legal barriers currently prohibit nuclear power for electricity generation in Australia. For this reason, published future electricity scenarios aimed at policy makers for this country have not seriously considered a full mix of energy options. Here we addressed this deficiency by comparing the life-cycle sustainability of published scenarios using multi-criteria decision-making analysis, and modeling the optimized future electricity mix using a genetic algorithm. The published CSIRO e-future scenario under its default condition (excluding nuclear) has the largest aggregate negative environmental and economic outcomes (score=4.51 out of 8), followed by the Australian Energy Market Operators 100% renewable energy scenario (4.16) and the Greenpeace scenario (3.97). The e-future projection with maximum nuclear-power penetration allowed yields the lowest negative impacts (1.46). After modeling possible future electricity mixes including or excluding nuclear power, the weighted criteria recommended an optimized scenario mix where nuclear power generated >40% of total electricity. The life-cycle greenhouse-gas emissions of the optimization scenarios including nuclear power were nuclear power is an effective and logical option for the environmental and economic sustainability of a future electricity network in Australia.

Sanghyun Hong; Corey J.A. Bradshaw; Barry W. Brook

2014-01-01T23:59:59.000Z

191

Late Jurassic-Early Cretaceous evolution of the eastern Indian Ocean adjacent to northwest Australia  

E-Print Network [OSTI]

for the degree of MASTER OF SCIENCE December 1987 Major Subject: Oceanography LATE JURASSIC-EARLY CRETACEOUS EVOLUTION OF THE EASTERN INDIAN OCEAN ADJACENT TO NORTHWEST AUSTRALIA A Thesis by LAWRENCE GILLIAM FULLERTON Approved as to style and content by...: William W. Sag (Chairman of Committee) Wi ford O. Gar ner (Member) T omas . . Hi e (Member) ert T. Rowe (Head of Department) December 1987 ABSTRACT Late Jurassic-Early Cretaceous Evolution of the Eastern Indian Ocean Adjacent to Northwest...

Fullerton, Lawrence Gilliam

2012-06-07T23:59:59.000Z

192

Climate and Landscape Factors Associated with Buruli Ulcer Incidence in Victoria, Australia  

E-Print Network [OSTI]

, 3Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, Wisconsin, United States of America, 4Center for Statistical Training and Consulting, Michigan State University, East Lansing, Michigan, United States of America, 5... transmission investigations. Citation: van Ravensway J, Benbow ME, Tsonis AA, Pierce SJ, Campbell LP, et al. (2012) Climate and Landscape Factors Associated with Buruli Ulcer Incidence in Victoria, Australia. PLoS ONE 7(12): e51074. doi:10.1371/journal...

van Ravensway, Jenni; Benbow, Mark Eric; Tsonis, Anastasios A.; Pierce, Steven J.; Campbell, Lindsay P.; Fyfe, Janet A. M.; Hayman, John A.; Johnson, Paul D. R.; Wallace, John R.; Qi, Jiaguo

2012-12-10T23:59:59.000Z

193

Century Asset Management | Open Energy Information  

Open Energy Info (EERE)

Asset Management Asset Management Place Sydney, New South Wales, Australia Zip 2000 Sector Solar, Vehicles Product String representation "Sydney based in ... mpleted assets." is too long. Coordinates -33.869629°, 151.206955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-33.869629,"lon":151.206955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

194

Choice Electric Co | Open Energy Information  

Open Energy Info (EERE)

Choice Electric Co Choice Electric Co Jump to: navigation, search Name Choice Electric Co Place Murwillumbah, New South Wales, Australia Zip 2484 Sector Solar Product Agency for Sharp solar (the largest solar panel producer in the world), Fronius, and Unitrac. Coordinates -28.32995°, 153.391693° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-28.32995,"lon":153.391693,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

195

K2 Energy | Open Energy Information  

Open Energy Info (EERE)

K2 Energy K2 Energy Jump to: navigation, search Name K2 Energy Place Sydney, New South Wales, Australia Zip NSW 2000 Sector Solar Product Sydney-based oil and gas exploration firm. The company is foraying into solar cell technology. Coordinates -33.869629°, 151.206955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-33.869629,"lon":151.206955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

196

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

197

Evidence of Progress - Measurement of Impacts of Australia's S&L Program from 1990-2010  

SciTech Connect (OSTI)

Australia first put categorical energy efficiency labels on residential appliances in the mid-1980s, and the first Minimum Energy Performance Standards (MEPS) for refrigerators was implemented in 1999. Updated in 2005, these MEPS were aligned with US 2001 levels. Considered together, these actions set Australia apart as having one of the most aggressive appliance efficiency programs in the world. For these reasons, together with good data on product sales over time, Australia represents a potentially fruitful case study for understanding the dynamics energy efficiency standards and labeling (EES&L) programs impacts on appliance markets. This analysis attempts to distinguish between the impacts of labeling alone as opposed to MEPS, and to probe the time-dependency of such impacts. Fortunately, in the Australian case, detailed market sales data and a comprehensive registration system provides a solid basis for the empirical evaluation of these questions. This paper analyzes Australian refrigerator efficiency data covering the years 1993-2009. Sales data was purchased from a commercial market research organization (in this case, the GfK Group) and includes sales and average price in each year for each appliance model; this can be used to understand broader trends by product class and star rating category, even where data is aggregated. Statistical regression analysis is used to model market introduction and adoption of high efficiency refrigerators according to logistic adoption model formalism, and parameterizes the way in which the Australian programs accelerated adoption of high-efficiency products and phased out others. Through this analysis, the paper presents a detailed, robust and quantitative picture of the impacts of EES&L in the Australian case, but also demonstrates a methodology of the evaluation of program impacts that could form the basis of an international evaluation framework for similar programs in other countries.

Lowenthal-Savy, Danielle; McNeil, Michael; Harrington, Lloyd

2013-09-11T23:59:59.000Z

198

Megaliths of England and Wales  

Science Journals Connector (OSTI)

... suggested by Dr. Daniel are very similar to the carvings on the walls at Gavr'inis in the Morbihan, Brittany ; but any art on the megaliths in this latter ...

M. C. BURKITT

1951-02-17T23:59:59.000Z

199

A New Multidrug-Resistant Strain of Neisseria gonorrhoeae in Australia  

Science Journals Connector (OSTI)

...obtained from a young female European traveler with vaginal discharge who presented to a medical clinic in central Australia in December 2013. She was tested for sexually transmitted infection and treated with metronidazole. She had reported sex with a new partner, who was a fellow European traveler, 1 week... A young woman with a vaginal discharge was found by means of sensitivity testing and genetic analysis to have ceftriaxone-resistant Neisseria gonorrhoeae. The infection did not respond to ceftriaxone but was treated successfully with ceftriaxone plus azithromycin.

2014-11-06T23:59:59.000Z

200

Detection of radioxenon in Darwin, Australia following the Fukushima Dai-ichi nuclear power plant accident  

Science Journals Connector (OSTI)

Abstract A series of 133Xe detections in April 2011 made at the Comprehensive Nuclear-Test-Ban Treaty Organisation (CTBTO) International Monitoring System noble gas station in Darwin, Australia, were analysed to determine the most likely source location. Forward and backwards atmospheric transport modelling simulations using FLEXPART were conducted. It was shown that the most likely source location was the Fukushima Dai-ichi nuclear power plant accident. Other potential sources in the southern hemisphere were analysed, including the Australian Nuclear Science and Technology Organisation (ANSTO) radiopharmaceutical facility, but it was shown that sources originating from these locations were highly unlikely to be the source of the observed 133Xe Darwin detections.

Blake Orr; Michael Schppner; Rick Tinker; Wolfango Plastino

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada...

202

Desalination 187 (2006) 115126 Presented at the International Conference on Integrated Concepts on Water Recycling, Wollongong, NSW Australia,  

E-Print Network [OSTI]

" factor. It found people more willing to use recycled water from their own wastewater than from second on Water Recycling, Wollongong, NSW Australia, 14­17 February 2005. Public perception and participation water after it is treated in a modern wastewater treatment plant is an important and underutilized

Newman, Michael C.

203

Bulletin of the Australian Meteorological and Oceanographic Society Vol.18 page 104 BLUElink> Progress on operational ocean prediction for Australia  

E-Print Network [OSTI]

of the three- dimensional ocean state (temperature, salinity and pressure) and currents for the short BLUElink> Progress on operational ocean prediction for Australia Gary B. Brassington1 , Graham Warren1 are now on standby. At their disposal are analyses and forecasts from the Bureau's new operational ocean

Oke, Peter

204

Stylobates birtlesi sp. n., a new species of carcinoecium-forming sea anemone (Cnidaria, Actiniaria, Actiniidae) from eastern Australia  

E-Print Network [OSTI]

We describe a new species of carcinoecium-forming sea anemone, Stylobates birtlesi sp. n., from sites 680-960 m deep in the Coral Sea, off the coast of Queensland, Australia. An anemone of this genus settles on a gastropod shell inhabited by a...

Crowther, Andrea Louise; Fautin, Daphne G.; Wallace, Carden C.

2014-03-11T23:59:59.000Z

205

THE INTRACONTINENTAL BASINS (ICONS) ATLAS APPLICATIONS IN EASTERN AUSTRALIA PESA Eastern Australasian Basins Symposium III Sydney, 1417 September, 2008 275  

E-Print Network [OSTI]

THE INTRACONTINENTAL BASINS (ICONS) ATLAS ­ APPLICATIONS IN EASTERN AUSTRALIA PESA Eastern Australasian Basins Symposium III Sydney, 14­17 September, 2008 275 The IntraCONtinental basinS (ICONS) atlas of intracontinental basins (ICONS atlas), using freely available global and regional datasets. Firstly, we are trying

Müller, Dietmar

206

World IMACS / MODSIM Congress, Cairns, Australia 13-17 July 2009 http://mssanz.org.au/modsim09  

E-Print Network [OSTI]

. Keywords: Land surface models, evapotranspiration, latent heat flux, satellite remote sensing Comparison of latent heat flux estimates over Australia Matthew F. McCabe1 , Yi Y. Liu1 , Raghuveer Vinukollu from such data do not contribute to model assessment and calibration. This study compares latent heat

Evans, Jason

207

Fire weather simulation skill by the Weather Research and Forecasting (WRF) model over south-east Australia  

E-Print Network [OSTI]

values were driven mainly by WRF errors in wind speed simulation. However, in both cases the qualityFire weather simulation skill by the Weather Research and Forecasting (WRF) model over south-east Australia from 1985 to 2009 has been simulated using the Weather Research and Forecasting (WRF) model

Evans, Jason

208

Economic assessment of regional bioenergy systems in Australia: a flow analysis application  

Science Journals Connector (OSTI)

This paper describes a modelling tool that integrates Material Flow Analysis, energy production and Greenhouse Gas (GHG) emissions accounting for biomass flows at a regional scale. This tool allows comprehensive analysis of alternative systems for management of biomass waste and bioenergy production in regional areas. Different possible options for processing a range of biomass waste streams can be evaluated against multiple criteria including various environmental impacts and cost-effectiveness. The objective is to support the design of integrated biomass waste and bioenergy systems that maximise synergies and optimise tradeoffs between bioenergy production, GHG emissions, recycling of valuable soil nutrients and control of harmful contaminants. This analytical tool is applied to a major agricultural region in Australia, the Murrumbidgee Irrigation Area. A scenario demonstrates how the construction of different types of bioenergy plant can offer valuable benefits with regard to renewable energy production, GHG emission reductions, increasing phosphorus cycling back to soils and reduced cadmium contamination.

Napat Jakrawatana; Stephen Moore; Iain MacGill

2009-01-01T23:59:59.000Z

209

Sedimentation and structure of the continental margin in the vicinity of the Otway Basin, southern Australia  

Science Journals Connector (OSTI)

The continental margin of southern Australia is divisible into four contrasting physiographic provinces on the basis of shelf-break depth and continental slope gradient. These provinces correspond with four structural provinces, which in turn are intimately related to the geology. Zones of relatively stable pre-Mesozoic shallow basement extending out to the shelf edge characterize two of the above provinces, one of which occurs south of Kangaroo Island and the other off Tasmania's northwest coast. In contrast, zones of Mesozoic to Tertiary deep offshore basin formation typify the remaining two provinces, one being situated at the eastern end of the Great Australian Bight and the other along the seaward portion of the Otway Basin. A possible model is presented, based on an assumption of continental rifting and drifting, which explains the structural peculiarities of that portion of the Otway Basin which occurs beneath the present continental shelf and upper slope.

C.C. Von Der Borch; J.R. Conolly; R.S. Dietz

1970-01-01T23:59:59.000Z

210

Cross-Spectrum of Wind Speed for Meso-Gamma Scales in the Upper Surface Layer over South-Eastern Australia  

Science Journals Connector (OSTI)

Analytical expressions for the cross-spectrum of wind speed are developed for the stochastic simulation of wind power in south-eastern Australia. The expressions...?1.... The influence of site separation distance...

Milton J. Woods; Robert J. Davy; Christopher J. Russell

2011-10-01T23:59:59.000Z

211

Past and future changes to inflows into Perth (Western Australia) dams  

Science Journals Connector (OSTI)

AbstractStudy region The city of Perth is located within the region referred to as south-west Western Australia (SWWA) defined as southwest of a line connecting 30S, 115E and 35S, 120E. Study focus SWWA has experienced a prolonged decline in rainfall since the early 1970s accompanied by serious reductions to inflows into the major storage systems. Consequent research questions include: What caused the decline in rainfall? Why have inflows decreased so dramatically? What can be expected over the coming decades? In this study, we consider these questions making use of recent observations and the latest generation of climate model results which attempt to simulate the effects of increased greenhouse gas concentrations. New hydrological insights for the region under study Recent observations show a continuation of dry conditions and confirm that a significant change in the relationship between rainfall and inflows appears to have occurred. There is little evidence that increasing local temperatures alone can explain this changed relationship which possibly represents long-term physical changes (e.g. groundwater levels) to the catchments. There is a strong consensus amongst recent model results that rainfall will decline further by the end of the 21st century. While this confirms findings from studies of previous model results, for the purposes of better estimating future changes to inflows it may now be more important to understand the reasons for the changed rainfall/inflows relationship.

Ian Smith; Scott Power

2014-01-01T23:59:59.000Z

212

Economic feasibility and optimisation of an energy storage system for Portland Wind Farm (Victoria, Australia)  

Science Journals Connector (OSTI)

This paper presents the details of a theoretical study of the economic advantages of using large-scale energy storage to complement a wind farm in a base-load dominated electricity grid. A computer model is developed which simulates the operation of several energy storage systems when used with the 190-MW Portland Wind Farm (PWF) located in Portland, Victoria, Australia. A variety of operating strategies are compared with the results of a dynamic programming model which finds the maximum possible revenue which a given system can generate for a set of input conditions. Three energy storage systems are modelled and costed: Pumped Seawater Hydro Storage (PSHS), Compressed Air Energy Storage (CAES), and Thermal Energy Storage (TES). It is found that CAES is the most profitable storage medium, requiring a capital expenditure of A$140M and generating a rate of return (ROR) of 15.4%. The ROR for PSHS was 9.6%, and for TES was 8.0%. Therefore, a significant investment opportunity exists for the installation of an energy storage system in this wind farm. It is therefore highly recommended that CAES is investigated further with the aim of introducing large-scale energy storage to PWF and other similar wind turbine installations.

Mir-Akbar Hessami; David R. Bowly

2011-01-01T23:59:59.000Z

213

Response of office building electricity consumption to urban weather in Adelaide, South Australia  

Science Journals Connector (OSTI)

Abstract Knowledge of climate dependency of building energy consumption is useful for predicting the impacts of climate change and urban heat island on energy demand and associated carbon emissions, and to evaluate and improve building energy performance. Climate dependent electricity consumption is examined in this study for four office buildings in Adelaide, the capital city of South Australia with a warm-summer Mediterranean climate. Influences of both outdoor temperature and specific humidity on building electricity consumption are analyzed using the multiple linear regression, based on both sub-daily and monthly electricity consumption data. The results indicate that there is a daytime mean temperature threshold of around 17C, above which, electricity consumption increases with air temperature. Specific humidity also contributes to interpreting the temporal variability of office hour electricity consumption. Daytime temperature and specific humidity together determine 8090% of office hour electricity consumption variation for days with mean daytime temperature above the threshold temperature. Office building daily electricity consumption can be examined with monthly electricity consumption data of a period of three years. The results also suggest that heatwaves may increase office building electricity demand by up to 50%, and that one degree warming can increase annual office electricity consumption by 2% in Adelaide.

Huade Guan; Veronica Soebarto; John Bennett; Roger Clay; Robert Andrew; Yunhui Guo; Saeedeh Gharib; Kathryn Bellette

2014-01-01T23:59:59.000Z

214

Citizen science for policy development: The case of koala management in South Australia  

Science Journals Connector (OSTI)

Abstract Citizen science involves the engagement of non-scientists in scientific research. Citizen science projects have been reported to be useful in policy development but there is little detail of how projects have contributed. The citizen science project, the Great Koala Count (GKC) collected ecological data about koalas and social data that have been used in the initial stages of the development of a South Australian Government koala management and conservation policy. After the GKC, we conducted an online survey of people who participated in the project and a control group. The survey focussed on opinions towards possible management options for koalas in South Australia. GKC participants were also asked about project-related changes in knowledge and opinions. We received 970 valid surveys and found some differences in opinions between GKC participants and the control group. Therefore, the GKC did not provide a representative sample of the entire South Australian population. However, we contend that the data from the citizen scientists are still valuable for policy development as it has been provided by people who are highly engaged in the topic (koala management in this case). It can be difficult to engage the public in the policy development process, and the citizen science project enabled the collection of a wide range of opinions, helping to discover and define relevant issues. Additionally, many people learnt about koalas and koala-related management issues, and some changed their opinions regarding koala management, also useful outcomes from the project in the policy development context. Our findings suggest that citizen science is useful for policy makers because projects provide the opportunity for dialogue with the people most interested in the topic of the project.

Bianca Hollow; Philip E.J. Roetman; Michele Walter; Christopher B. Daniels

2015-01-01T23:59:59.000Z

215

Analysis of solar desiccant cooling system for an institutional building in subtropical Queensland, Australia  

Science Journals Connector (OSTI)

Institutional buildings contain different types of functional spaces which require different types of heating, ventilating and air conditioning (HVAC) systems. In addition, institutional buildings should be designed to maintain an optimal indoor comfort condition with minimal energy consumption and minimal negative environmental impact. Recently there has been a significant interest in implementing desiccant cooling technologies within institutional buildings. Solar desiccant cooling systems are reliable in performance, environmentally friendly and capable of improving indoor air quality at a lower cost. In this study, a solar desiccant cooling system for an institutional building in subtropical Queensland (Australia) is assessed using TRNSYS 16 software. This system has been designed and installed at the Rockhampton campus of Central Queensland University. The system's technical performance, economic analysis, energy savings, and avoided gas emission are quantified in reference to a conventional HVAC system under the influence of Rockhampton's typical meteorological year. The technical and economic parameters that are used to assess the system's viability are: coefficient of performance (COP), solar fraction, life cycle analysis, payback period, present worth factor and the avoided gas emission. Results showed that, the installed cooling system at Central Queensland University which consists of 10m2 of solar collectors and a 0.400m3 of hot water storage tank, achieved a 0.7 COP and 22% of solar fraction during the cooling season. These values can be boosted to 1.2 COP and 69% respectively if 20m2 of evacuated tube collector's area and 1.5m3 of solar hot water storage volume are installed.

Ali M. Baniyounes; Gang Liu; M.G. Rasul; M.M.K. Khan

2012-01-01T23:59:59.000Z

216

Environmental factors associated with the distribution and range limits of the malaria vector *Anopheles farauti* in Australia  

E-Print Network [OSTI]

and Environmental Studies, Australian National University, Canberra, Australia. (http://cres.anu.edu.au/outputs/ climatesurfaces). Levine, R. S., A. T. Peterson, and M. Q. Benedict. 2004a. Distribution of members of Anopheles quadrimaculatus Say s.l. (Diptera...-Test.This software tool permits explor- atory analyses of species range limits based on simple, univariate comparisons of conditions inside and out- side of a user-specied range limit using MannWhit- ney U-tests to measure strength of association (Bauer...

Sweeney, A. W.; Beebe, N. W.; Cooper, R. D.; Bauer, John T.; Peterson, A. Townsend

2006-09-01T23:59:59.000Z

217

Supply of carbon sequestration and biodiversity services from Australia's agricultural land under global change  

Science Journals Connector (OSTI)

Abstract Global agroecosystems can contribute to both climate change mitigation and biodiversity conservation, and market mechanisms provide a highly prospective means of achieving these outcomes. However, the ability of markets to motivate the supply of carbon sequestration and biodiversity services from agricultural land is uncertain, especially given the future changes in environmental, economic, and social drivers. We quantified the potential supply of these services from the intensive agricultural land of Australia from 2013 to 2050 under four global outlooks in response to a carbon price and biodiversity payment scheme. Each global outlook specified emissions pathways, climate, food demand, energy price, and carbon price modeled using the Global Integrated Assessment Model (GIAM). Using a simplified version of the Land Use Trade-Offs (LUTO) model, economic returns to agriculture, carbon plantings, and environmental plantings were calculated each year. The supply of carbon sequestration and biodiversity services was then quantified given potential land use change under each global outlook, and the sensitivity of the results to key parameters was assessed. We found that carbon supply curves were similar across global outlooks. Sharp increases in carbon sequestration supply occurred at carbon prices exceeding 50$tCO2?1 in 2015 and exceeding 65$tCO2?1 in 2050. Based on GIAM-modeled carbon prices, little carbon sequestration was expected at 2015 under any global outlook. However, at 2050 expected carbon supply under each outlook differed markedly, ranging from 0 to 189MtCO2yr?1. Biodiversity services of 3.32% of the maximum may be achieved in 2050 for a 1$B investment under median scenario settings. We conclude that a carbon market can motivate supply of substantial carbon sequestration but only modest amounts of biodiversity services from agricultural land. A complementary biodiversity payment can synergistically increase the supply of biodiversity services but will not provide much additional carbon sequestration. The results were sensitive to global drivers, especially the carbon price, and the domestic drivers of adoption hurdle rate and agricultural productivity. The results can inform the design of an effective national policy and institutional portfolio addressing the dual objectives of climate change and biodiversity conservation that is robust to future uncertainty in both national and global drivers.

B.A. Bryan; M. Nolan; T.D. Harwood; J.D. Connor; J. Navarro-Garcia; D. King; D.M. Summers; D. Newth; Y. Cai; N. Grigg; I. Harman; N.D. Crossman; M.J. Grundy; J.J. Finnigan; S. Ferrier; K.J. Williams; K.A. Wilson; E.A. Law; S. Hatfield-Dodds

2014-01-01T23:59:59.000Z

218

Proceedings of the 2009 International Conference on  

E-Print Network [OSTI]

by the Institute of Electrical and Electronics Engineers Sydney Opera House photos (front cover & top back cover of New South Wales Sydney, Australia 9 ­ 11 December 2009 Editors: Neil Bergmann Oliver Diessel Lesley University of New South Wales Sydney aerial photos (bottom back cover): courtesy Brad Hall prepared by Causal

Diessel, Oliver

219

Development of an economical model to determine an appropriate feed-in tariff for grid-connected solar PV electricity in all states of Australia  

Science Journals Connector (OSTI)

Australia is a country with a vast amount of natural resources including sun and wind. Australia lies between latitude of 1045S and longitude of 112152E, with a daily solar exposure of between less than 3MJ/(m2day) in winter and more than 30MJ/(m2day) in summer. Global solar radiation in Australia varies between minimum of 3285MJ/(m2year) in Hobart to 8760MJ/(m2year) in Northern Territory. As a result of this wide range of radiation level there will be a big difference between costs of solar PV electricity in different locations. A study we have recently conducted on the solar PV electricity price in all states of Australia. For this purpose we have developed an economical model and a computer simulation to determine the accurate unit price of grid-connected roof-top solar photovoltaic (PV) electricity in A$/kWh for all state of Australia. The benefit of this computer simulation is that we can accurately determine the most appropriate feed-in tariff of grid-connected solar PV energy system. The main objective of this paper is to present the results of this study. A further objective of this paper is to present the details of the unit price of solar PV electricity in the state of Victoria in each month and then to compare with electricity price from conventional power systems, which is currently applied to this state. The state Victoria is located south of Australia and in terms of sun radiation is second lowest compared with the other Australian states. The computer simulation developed for this study makes it possible to determine the cost of grid-connected solar PV electricity at any location in any country based on availability of average daily solar exposure of each month as well as economical factors of the country.

A. Zahedi

2009-01-01T23:59:59.000Z

220

Coherent structures and aeolian saltation  

E-Print Network [OSTI]

transport. The relationship between unsteadiness in a turbulent wind field and pulses in a sand transport field was investigated on a beach near Shoalhaven Heads, New South Wales, Australia. Microphone-based saltation sensors, miniphones, and thermal...

Ellis, Jean Taylor

2009-05-15T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Toward Resource Recovery from Wastewater: Extraction of Phosphorus from Digested Sludge Using a Hybrid Forward OsmosisMembrane Distillation Process  

Science Journals Connector (OSTI)

Toward Resource Recovery from Wastewater: Extraction of Phosphorus from Digested Sludge Using a Hybrid Forward OsmosisMembrane Distillation Process ... Strategic Water Infrastructure Laboratory, School of Civil, Mining and Environmental Engineering, University of Wollongong, Wollongong, New South Wales 2522, Australia ...

Ming Xie; Long D. Nghiem; William E. Price; Menachem Elimelech

2014-01-06T23:59:59.000Z

222

Analytica Chimica Acta 642 (2009) 35 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

, University of New South Wales, Sydney, NSW 2052, Australia b Lappeenranta University of Technology, Department of Chemical Technology, P.O. Box 20, FIN-53851 Lappeenranta, Finland c Chemometry Consultancy

Ferreira, Márcia M. C.

223

Water Research Centre. School of Applied Science. Canberra C.A.E PO.Box' Be/connen A.C.T. 26/6. Australia.  

E-Print Network [OSTI]

. In a previous report (6) the use of fluorescence spectroscopy to identify petroleum hydrocarbon sources) and flame photometric detectors (FPD) have been used routinely to identify petroleum hydrocarbon sources (7.C.T. 26/6. Australia. Petroleum hydrocarbon pollution of natural waters is a wide spread problem (1

Canberra, University of

224

in: Scott, J.; Dalgarno, B. (eds), Proceedings of OZCHI 99, November 28 -30, 1999, Wagga Wagga, Australia, CSU-Publisher, pp. 105-111  

E-Print Network [OSTI]

in: Scott, J.; Dalgarno, B. (eds), Proceedings of OZCHI ´99, November 28 - 30, 1999, Wagga Wagga Bonn, Germany email: volker@cs.uni-bonn.de http://www.cs.uni-bonn.de/~volker/ #12;in: Scott, J.; Dalgarno, B. (eds), Proceedings of OZCHI ´99, November 28 - 30, 1999, Wagga Wagga, Australia, CSU

225

In Vitro Evaluation of 10B-BPA for Melanoma at Moata - Joint Work between Japan and Australia BNCT Research Teams  

Science Journals Connector (OSTI)

A variety of conjugated compounk have been synthesized in Japan, the USA and Australia. Among these 10B-compounds, 10B1-paraboronophenylalanine (10B1-BPA) has been widely tested in vitro and...10B1-BPA is selecti...

M. Ichihashi; H. Fukuda; J. K. Brown

1992-01-01T23:59:59.000Z

226

NCED Australia Research Update 56th Annual NM Water Conf., New Water New Energy: A Conference Linking Desalination and Renewable Energy  

E-Print Network [OSTI]

Linking Desalination and Renewable Energy 51 NCED Australia Research Update David Furukawa, National New Energy: A Conference Linking Desalination and Renewable Energy 53 9 10 11 12 13 14 #12;December 13 Desalination and Renewable Energy 55 21 22 23 24 25 26 #12;December 13-14, 2011 David Furukawa, National Centre

Johnson, Eric E.

227

Unusual flux-distance relationship for pulsars suggested by analysis of the Australia national telescopy facility pulsar catalogue  

SciTech Connect (OSTI)

We analyze pulsar fluxes at 1400 MHz (S(1400)) and distances d taken from the Australia National Telescope Facility (ATNF) Pulsar Catalogue. Under the assumption that pulsar populations in different parts of the Galaxy are similar, we find that either (a) pulsar fluxes diminish with distance according to a non-standard power law (we suggest S(1400){proportional_to} 1/d rather than {proportional_to} 1/d{sup 2}) or (b) that there are very significant (i.e. order of magnitude) errors in the distance estimates quoted in the ATNF Catalogue. The former conclusion (a) supports a recent model for pulsar emission that has also successfully explained the frequency spectrum of the Crab pulsar over 16 orders of magnitude of frequency, whilst alternative (b) would necessitate a radical re-evaluation of both the dispersion method for estimating pulsar distances and current ideas about the distribution of pulsars within our Galaxy.

Singleton, John [Los Alamos National Laboratory; Perez, M R [Los Alamos National Laboratory; Singleton, J [Los Alamos National Laboratory; Ardavan, H [UNIV OF CAMBRIDGE; Ardavan, A [UNIV OF OXFORD

2009-01-01T23:59:59.000Z

228

Wales, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

95393°, -72.2223007° 95393°, -72.2223007° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.0695393,"lon":-72.2223007,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

229

Wales, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

044549°, -88.3767626° 044549°, -88.3767626° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.0044549,"lon":-88.3767626,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

230

Science at NASAScience at NASA Waleed Abdalati  

E-Print Network [OSTI]

, and efficiency of aeronautical and space vehicles; 3) The development and operation of vehicles capable Biological and Physical Processes in the Space Environmentthe Space Environment #12;NASA Organizational Chart #12;NASA Organizational Chart OCSOffice of the d i i OCTAdministrator SMDARMD Centers SMD S0MD

231

UNIVERSITY OF WALES SWANSEA REPORT SERIES  

E-Print Network [OSTI]

and Engineering Research Council of Canada. S.B. Cooper, B. L¨owe, and L. Torenvliet (Eds.): CiE 2005, LNCS 3526

Grant, P. W.

232

Die Gruppe der ????? (Robben und Wale)  

Science Journals Connector (OSTI)

Die Bezeichnung des Meeres als ????????? (Od. 3, 158) deutet auf eine Gruppe groer Seetiere, die ???o?, plur. ????? genannt werden.

Otto Krner Dr. med.; Dr. phil. h. c.

1930-01-01T23:59:59.000Z

233

Perceptions and behaviour of access of the Internet: A study of women attending a breast screening service in Sydney, Australia  

Science Journals Connector (OSTI)

Objectives To describe the perceptions and behaviour in accessing health information from the Internet by women attending a BreastScreen, New South Wales (NSW) Service in Northern Sydney. Design Cross-sectional study. Setting A BreastScreen NSW Service in Northern Sydney. Main outcome measures Behaviour and perceptions of accessing of the Internet for breast health and screening information and other related health information. Participants Four hundred and fifteen women aged ?40 years who had a screening mammogram at a BreastScreen NSW Service in Northern Sydney. Data were collected from 1 October to 22 December 2004 (study interval). Results Four hundred and sixty-one eligible women were invited to participate in the study and of these 415 women agreed to participate in the study (participation rate=90%). Of the 415 women enrolled in the cohort, 80% (333/415) of women accessed the Internet in general and 62% (205/333) of the women who accessed the Internet also accessed health related information from the Internet, but only 7% of the total women accessed breast health and screening information from the Internet. Two hundred and eighty (70%) women in the cohort expressed their intention to access the Internet if they were diagnosed with breast cancer. Age (OR=0.94; 95% CI=0.910.97), marital status (OR=2.65; 95% CI=1.454.83), educational status (OR=3.26; 95% CI=1.776.02) and behavioural intention of accessing the Internet if diagnosed with breast cancer (OR=3.31; 95% CI=1.835.98) were found to be associated with access of Internet for general information. Furthermore, behavioural intention (OR=2.43; 95% CI=1.304.55), rating of computer skills as average (OR=0.42; 95% CI=0.220.79) and not good to poor (OR=0.23; 95% CI=0.110.49) were found to be associated with access of health related information from the Internet. Conclusions Information searching from the Internet is common among women having a screening mammogram. There is potential to provide guidance to women regarding accessing the BreastScreen NSW website and other reliable sources of Internet information on breast health, breast screening and cancer-related information.

Aditi Dey; Beth Reid; Robyn Godding; Andrew Campbell

2008-01-01T23:59:59.000Z

234

University of South Australia Adelaide, Australia  

E-Print Network [OSTI]

Sustainable Built Environments Structures Contract Administration Building Surveying Science Building and Fire Development Law Building Research Project Building Research Integrated Project Industry Based, a library, music rooms, sporting and laundry facilities Colleges are located in North Adelaide - just a 10

Duchowski, Andrew T.

235

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

236

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

237

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

238

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

239

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

240

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

242

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

243

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

244

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

245

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

246

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

247

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

248

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

249

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

250

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

251

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

252

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

253

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

254

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

255

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

256

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

257

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

258

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

259

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

260

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

262

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

263

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

264

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

265

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

266

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

267

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

268

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

269

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

270

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

271

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

272

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

273

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

274

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

275

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

276

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

277

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

278

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

279

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

280

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

282

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

283

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

284

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

285

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

286

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

287

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

288

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

289

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

290

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

291

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

292

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

293

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

294

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

295

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

296

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

297

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

298

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

299

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

300

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

The large-scale solar feed-in tariff reverse auction in the Australian Capital Territory, Australia  

Science Journals Connector (OSTI)

Abstract Feed-in tariffs (FiTs) offer renewable energy developers significant investor certainty but sometimes at the cost of being misaligned with generation costs. Reverse FiT auctions, where the FiT rights for a predetermined capacity are auctioned, can overcome this problem but can be plagued by non-delivery risks, particularly of competitively priced proposals. In 2012 and 2013 the Australian Capital Territory (ACT) Government in Australia conducted a FiT reverse auction for 40MW of large-scale solar generating capacity, the first such auction undertaken in the country. The auction was highly competitive in relation to price and demonstrating low delivery risks. Proposal capital costs, particularly engineering, procurement and construction costs, as well as internal rates of return, were lower than expected. The auction process revealed limited land availability for large-scale solar developments in the ACT as well as a significant perceived sovereign risk issue. The auction process was designed to mitigate non-delivery risk by requiring proposals to be pre-qualified on the basis of delivery risk, before considering FiT pricing. The scheme is likely to be used by the ACT Government to support further large-scale renewable energy development as part of its greenhouse gas reduction strategy which is underpinned by a 90-per cent-by-2020 renewable energy target.

Greg Buckman; Jon Sibley; Richard Bourne

2014-01-01T23:59:59.000Z

302

Social dimensions of energy supply alternatives in steelmaking: comparison of biomass and coal production scenarios in Australia  

Science Journals Connector (OSTI)

Abstract Global climatic change is driving research and development in low emissions technologies. One such technology is the use of charcoal from biomass in steelmaking. This paper adapts social life cycle assessment methodologies to analyse the social dimensions of energy supply alternatives in steelmaking using regionalised production scenarios in Australia. Three energy supply alternatives are investigated: charcoal produced from Radiata pine plantation forestry; charcoal produced from Mallee eucalypt revegetation on agricultural land; and metallurgical coal. Impact indicators analysed include land-use, employment, workplace health & safety and a qualitative analysis of identified stakeholder issues. The research finds that biomass alternatives are significant generators of direct employment at the regional level; have concomitantly higher rates of workplace injuries and represent a significant change in land-use. Charcoal produced from Mallee biomass planted as a conservation measure on farmland, however, has the benefit of representing a shared land-use that provides an additional farm revenue stream and assists dryland salinity management. The paper finds that full substitution of coal by pine or Mallee charcoal does not provide a unique solution for optimising the social performance of the energy supply alternatives across all indicators.

Fitsum S. Weldegiorgis; Daniel M. Franks

2014-01-01T23:59:59.000Z

303

Community perceptions on the significant extension of life: An exploratory study among urban adults in Brisbane, Australia  

Science Journals Connector (OSTI)

Some researchers in the field of ageing claim that significant extension of the human lifespan will be possible in the near future. While many of these researchers have assumed that the community will welcome this technology, there has been very little research on community attitudes to life extension. This paper presents the results of an in-depth qualitative study of community attitudes to life extension across age groups and religious boundaries. There were 57 individual interviews, and 8 focus groups (totalling 72 focus group participants) conducted with community members in Brisbane, Australia. Community attitudes to life extension were more varied and complex than have been assumed by some biogerontologists and bioethicists. While some participants would welcome the opportunity to extend their lives others would not even entertain the possibility. This paper details these differences of opinion and reveals contrasting positions that reflect individualism or social concern among community members. The findings also highlight the relationship between Christianity, in particular belief in an afterlife, and attitudes to life extension technology. Overall, the study raises questions about the relationship between interest in life extension, the medicalisation of ageing and the increasing acceptability of enhancement technologies that need to be addressed in more representative samples of the community.

Mair Underwood; Helen P. Bartlett; Brad Partridge; Jayne Lucke; Wayne D. Hall

2009-01-01T23:59:59.000Z

304

CURRENT TESTING ACTIVITIES AT THE ACRELAB RENEWABLE ENERGY SYSTEMS TEST FACILITY , E S Spooner2  

E-Print Network [OSTI]

, AUSTRALIA 2 University of New South Wales, Kensington, NSW, AUSTRALIA 3 Australian CRC for Renewable Energy in a minimum of time. ACRELab was originally conceived as a laboratory for testing remote area power supply and RAPS system components such as inverters. With the growing interest in Grid-connected inverters

305

Rainbow Power Company Ltd | Open Energy Information  

Open Energy Info (EERE)

Rainbow Power Company Ltd Rainbow Power Company Ltd Jump to: navigation, search Name Rainbow Power Company Ltd Place Nimbin, New South Wales, Australia Zip 2480 Sector Hydro, Renewable Energy, Solar, Wind energy Product Manufacturer, distributor and retailer of renewable energy products, including solar, wind and hydro. Website http://www.rpc.com.au/ Coordinates -28.595261°, 153.222794° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-28.595261,"lon":153.222794,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

306

Traffic-related air pollution and health co-benefits of alternative transport in Adelaide, South Australia  

Science Journals Connector (OSTI)

AbstractBackground Motor vehicle emissions contribute nearly a quarter of the world's energy-related greenhouse gases and cause non-negligible air pollution, primarily in urban areas. Changing people's travel behaviour towards alternative transport is an efficient approach to mitigate harmful environmental impacts caused by a large number of vehicles. Such a strategy also provides an opportunity to gain health co-benefits of improved air quality and enhanced physical activities. This study aimed at quantifying co-benefit effects of alternative transport use in Adelaide, South Australia. Method We made projections for a business-as-usual scenario for 2030 with alternative transport scenarios. Separate models including air pollution models and comparative risk assessment health models were developed to link alternative transport scenarios with possible environmental and health benefits. Results In the study region with an estimated population of 1.4 million in 2030, by shifting 40% of vehicle kilometres travelled (VKT) by passenger vehicles to alternative transport, annual average urban PM2.5 would decline by approximately 0.4?g/m3 compared to business-as-usual, resulting in net health benefits of an estimated 13deaths/year prevented and 118 disability-adjusted life years (DALYs) prevented per year due to improved air quality. Further health benefits would be obtained from improved physical fitness through active transport (508deaths/year prevented, 6569DALYs/year prevented), and changes in traffic injuries (21 deaths and, 960 \\{DALYs\\} prevented). Conclusion Although uncertainties remain, our findings suggest that significant environmental and health benefits are possible if alternative transport replaces even a relatively small portion of car trips. The results may provide assistance to various government organisations and relevant service providers and promote collaboration in policy-making, city planning and infrastructure establishment.

Ting Xia; Monika Nitschke; Ying Zhang; Pushan Shah; Shona Crabb; Alana Hansen

2015-01-01T23:59:59.000Z

307

Coal Gasification in Australia  

Science Journals Connector (OSTI)

... P. S. Andrews gave a full account of the Federal project for the pressure gasification of non-coking coals for the combined purpose of town's gas ' and the ... of town's gas ' and the production of synthetic liquid fuel. Work on the gasification of brown coal in. Victoria was commenced in 1931 by the technical staff of ...

1955-06-11T23:59:59.000Z

308

Geophysics in Australia  

Science Journals Connector (OSTI)

......Thyer Introduction This review is restricted to the...1959). The estimated standard error of the Cambridge...a 10x 5 mile grid and plans are under way to survey...mineral ages using the uranium-lead method provided...substantiate and extend the uranium- lead measurements......

J. C. Jaeger; R. F. Thyer

1960-12-01T23:59:59.000Z

309

Deakin University Victoria, Australia  

E-Print Network [OSTI]

Financial Planning Human Resources Management Interactive Marketing International Business International than 4.5 million people from culturally and linguistically diverse backgrounds. Deakin University and Construction Management Architecture Construction Management Design Facilities Management Arts Anthropology

Duchowski, Andrew T.

310

The effect of political cycles on power investment decisions: Expectations over the repeal and reinstatement of carbon policy mechanisms in Australia  

Science Journals Connector (OSTI)

Abstract Political uncertainty over global greenhouse gas (GHG) mitigation policy is likely to defer investment in cleaner technologies. It may also incentivise short-lived, high-cost interim investments while businesses wait for the uncertainty to subside. The range of possible policy responses to the issue has created uncertainty over the future of national mitigation pathways. Given that the electricity sector, globally, is a major emitter of GHGs, this represents a systematic risk to investment in electricity generation assets. This paper uses a real options analysis framework informed by a survey of experts conducted in Australia used as a proxy to model the degree of the uncertainty to investigate the optimal timing for investment in the conversion of a coal plant to a combined cycle gas turbine plant using the American-style option valuation method. The effect of market and political uncertainty is studied for the Clean Energy Act 2011 in Australia. Political uncertainty is addressed bi-modally in terms of: (1) uncertainty over the repeal of the carbon pricing policy, and (2) if it is repealed, uncertainty over the reinstatement of the policy, to represent the effect of electoral cycles and the possibility of more stringent future global mitigation efforts. Results of the analysis show that although political uncertainty with respect to GHG mitigation policy may delay investment in the conversion of the coal plant, expectations over the reinstatement of the carbon pricing reduces the amount of option premium to defer the conversion decision.

Mahdi ShahNazari; Adam McHugh; Bryan Maybee; Jonathan Whale

2014-01-01T23:59:59.000Z

311

Simultaneous observations of Schumann resonances in California and Australia: Evidence for intensity modulation by the local height of the D region  

SciTech Connect (OSTI)

Observations are presented of the horizontal magnetic component of Schumann resonance intensities as simultaneously measured at locations in California and Western Australia during two separate intervals September 2-17, 1989, and April 14-21, 1990. For both intervals, diurnal variations of the average magnetic power over the lowest three modes of the Schumann resonances showed substantially different temporal profiles at the California and Western Australia stations, with interstation correlations of 0.51 and 0.39, respectively. A method is demonstrated for determining from these observations the average local time variation of the height of the D region. A height variation is obtained that is nearly identical for the respective analysis intervals, with a minimum height occurring at approximately 1300-1400 LT and a maximum-to-minimum height difference of roughly 50% of the mean. When corrected for the local D region height, the detailed diurnal intensity profiles over the analysis intervals display a greatly improved similarity, with interstation correlation coefficients increasing from 0.51 to 0.70 and from 0.39 to 0.82, respectively. Substantial agreement between the two stations after correction for D region height suggest that such observations could be used to monitor the global totality and variability of lightning, quantitatively and at time resolutions of the order of 10 min or less, in studies of global change.

Sentman, D.D. (Univ. of California, Los Angeles (United States)); Fraser, B.J. (Univ. of Newcastle, New South Wales (Australia))

1991-09-01T23:59:59.000Z

312

The Journal of the European Association of Studies on Australia, Vol.3. No.2, 2012, ISSN 1988-5946 under the auspices of Coolabah Observatori: Centre d'Estudis  

E-Print Network [OSTI]

, Universitat de Barcelona 2 "Australia's Decision": Uranium Mining and Aboriginal Communities of direct economic rewards. A case in point is that of uranium mining which, well after the Second World War with uranium mining for peaceful purposes at Ranger (Northern Territory), and comparing it with the more recent

Paris-Sud XI, Université de

313

Physical modeling of sedimentation adjacent to diapirs and comparison with late precambrian Oratunga Breccia body in central Flinders Ranges, South Australia  

SciTech Connect (OSTI)

The interaction of sedimentation with the change in shape of a developing diapir is modeled in a series of simple sandbox experiments. This model replicates the pillow, diapir, and postdiapir stages of salt movement. Modeling produced rim synclines, crestal unconformities, and turtle-structure anticlines-all features known to be associated with diapirs. By changing experimental parameters such as diapir shape, sedimentation was simulated around various diapiric situations. One experiment closely matches the sediment distribution around the Oratunga diapir one of the controversial breccia bodies in the late Precambrian-Cambrian Adelaide geosyncline exposed in the Flinders Ranges of South Australia. Rim synclines, unconformities, and bedding attitude around Oratunga resemble those described around salt domes. In addition, the distribution, size, orientation, and lithology of breccia within the Oratunga diapir resemble breccia associated with active salt diapirs in Iran. These data suggest the breccia was emplaced as a salt diapir.

Lemon, N.M.

1985-09-01T23:59:59.000Z

314

Assessment of Uncertainty in Cloud Radiative Effects and Heating Rates through Retrieval Algorithm Differences: Analysis using 3-years of ARM data at Darwin, Australia  

SciTech Connect (OSTI)

Ground-based radar and lidar observations obtained at the Department of Energys Atmospheric Radiation Measurement Programs Tropical Western Pacific site located in Darwin, Australia are used to retrieve ice cloud properties in anvil and cirrus clouds. Cloud microphysical properties derived from four different retrieval algorithms (two radar-lidar and two radar only algorithms) are compared by examining mean profiles and probability density functions of effective radius (Re), ice water content (IWC), extinction, ice number concentration, ice crystal fall speed, and vertical air velocity. Retrieval algorithm uncertainty is quantified using radiative flux closure exercises. The effect of uncertainty in retrieved quantities on the cloud radiative effect and radiative heating rates are presented. Our analysis shows that IWC compares well among algorithms, but Re shows significant discrepancies, which is attributed primarily to assumptions of particle shape. Uncertainty in Re and IWC translates into sometimes-large differences in cloud radiative effect (CRE) though the majority of cases have a CRE difference of roughly 10 W m-2 on average. These differences, which we believe are primarily driven by the uncertainty in Re, can cause up to 2 K/day difference in the radiative heating rates between algorithms.

Comstock, Jennifer M.; Protat, Alain; McFarlane, Sally A.; Delanoe, Julien; Deng, Min

2013-05-22T23:59:59.000Z

315

regional | OpenEI  

Open Energy Info (EERE)

regional regional Dataset Summary Description The UK Department of Energy and Climate Change (DECC) releases annual statistics on domestic and industrial/commercial electricity and gas consumption (and number of meters) at the Middle Layer Super Output Authority (MLSOA) and Intermediate Geography Zone (IGZ) level (there are over 950 of these subregions throughout England, Scotland and Wales). Both MLSOAs (England and Wales) and IGZs (Scotland) include a minimum of approximately 2,000 households. Source UK Department of Energy and Climate Change (DECC) Date Released March 01st, 2008 (6 years ago) Date Updated Unknown Keywords Electricity Consumption gas regional UK Data application/zip icon Guidance document for interpreting data (zip, 1.2 MiB) application/vnd.ms-excel icon Excel file: 2005 MLSOA and IGZ gas and electricity (xls, 10 MiB)

316

Draining the Pool: Electricity Trading in England & Wales  

E-Print Network [OSTI]

stations displaced coal · Pool prices rose while fuel costs fell #12;#12;#12;The Review of Electricity Trading Arrangements · Announced in October 1997 ­ Concern about threatened coal mines ­ Moratorium on gas · All transactions "at your own bid price" #12;What's wrong with marginal pricing? · Stations bidding

California at Berkeley. University of

317

The National Museum of Wales: Department of Industry  

Science Journals Connector (OSTI)

... with the successful attempts of John Budd in adding pre-heating chambers to some anthracite-burning furnaces at Ystalyfera in the Swansea Valley in 1844. Like other contemporary blast furnaces, ... been stripped from steel ingots by hydraulic and steam cranes working alongside the sunken teeming pits. The new stripping machine, hydraulically driven, made it possible for ingots to be ...

1960-02-13T23:59:59.000Z

318

Stocrestr Cymru o Goed Trefol Wales Inventory of Urban Trees  

E-Print Network [OSTI]

& camping sites Disused quarries & mines Golf courses Sewage works 2/3 +: Common land or rough ground +: 20m

319

Wales, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

49683°, -78.5433701° 49683°, -78.5433701° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.7349683,"lon":-78.5433701,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

320

Adapting Diagnosis Related Groups for Use in England and Wales  

Science Journals Connector (OSTI)

In recent years pressures on health service resources in the U.K. have resulted in an increasing interest in monitoring the performance of hospitals and district health services (Sanderson et al 1981; DHSS 198...

H. F. Sanderson

1984-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

A qualitative study of innovations implemented to improve transition of care from maternity to child and family health (CFH) services in Australia  

Science Journals Connector (OSTI)

AbstractBackground The transition of care (ToC) from maternity services, particularly from midwifery care to child and family health (CFH) nursing services, is a critical time in the support of women as they transition into early parenting. However significant issues in service provision exist, particularly meeting the needs of women with social and emotional health risk factors. These include insufficient resources, poor communication and information transfer, limited interface between private and public health systems and tension around role boundaries. In response some services are implementing strategies to improve the transition of care from maternity to CFH services. Aim This paper describes a range of innovations developed to improve transition of care between maternity and child and family health services and identifies the characteristics common to all innovations. Methods Data reported were collected in phase three of a mixed methods study investigating the feasibility of implementing a national approach to child and family health services in Australia (CHoRUS study). Data were collected from 33 professionals including midwives, child and family health nurses, allied health staff and managers, at seven sites across four Australian states. Data were analysed thematically, guided by Braun and Clarke's six-step process of thematic analysis. Findings The range of innovations implemented included those which addressed; information sharing, the efficient use of funding and resources, development of new roles to improve co-ordination of care, the co-location of services and working together. Four of the seven sites implemented innovations that specifically targeted families with additional needs. Successful implementation was dependent on the preliminary work undertaken which required professionals and/or organisations to work collaboratively. Conclusion Improving the transition of care requires co-ordination and collaboration to ensure families are adequately supported. Collaboration between professionals and services facilitated innovative practice and was core to successful change.

Kim Psaila; Cathrine Fowler; Sue Kruske; Virginia Schmied

2014-01-01T23:59:59.000Z

322

Reconciling Ground-Based and Space-Based Estimates of the Frequency of Occurrence and Radiative Effect of Clouds around Darwin, Australia  

SciTech Connect (OSTI)

The objective of this paper is to investigate whether estimates of the cloud frequency of occurrence and associated cloud radiative forcing as derived from ground-based and satellite active remote sensing and radiative transfer calculations can be reconciled over a well instrumented active remote sensing site located in Darwin, Australia, despite the very different viewing geometry and instrument characteristics. It is found that the ground-based radar-lidar combination at Darwin does not detect most of the cirrus clouds above 10 km (due to limited lidar detection capability and signal obscuration by low-level clouds) and that the CloudSat radar - Cloud-Aerosol Lidar with Orthogonal Polarization (CALIOP) combination underreports the hydrometeor frequency of occurrence below 2 km height, due to instrument limitations at these heights. The radiative impact associated with these differences in cloud frequency of occurrence is large on the surface downwelling shortwave fluxes (ground and satellite) and the top-of atmosphere upwelling shortwave and longwave fluxes (ground). Good agreement is found for other radiative fluxes. Large differences in radiative heating rate as derived from ground and satellite radar-lidar instruments and RT calculations are also found above 10 km (up to 0.35 Kday-1 for the shortwave and 0.8 Kday-1 for the longwave). Given that the ground-based and satellite estimates of cloud frequency of occurrence and radiative impact cannot be fully reconciled over Darwin, caution should be exercised when evaluating the representation of clouds and cloud-radiation interactions in large-scale models and limitations of each set of instrumentation should be considered when interpreting model-observations differences.

Protat, Alain; Young, Stuart; McFarlane, Sally A.; L'Ecuyer, Tristan; Mace, Gerald G.; Comstock, Jennifer M.; Long, Charles N.; Berry, Elizabeth; Delanoe, Julien

2014-02-01T23:59:59.000Z

323

Polycyclic aromatic hydrocarbons in road-deposited sediments, water sediments, and soils in Sydney, Australia: Comparisons of concentration distribution, sources and potential toxicity  

Science Journals Connector (OSTI)

Abstract Sixteen polycyclic aromatic hydrocarbons (PAHs) considered as priority environmental pollutants were analysed in surface natural soils (NS), road-deposited sediments (RDS), and water sediments (WS) at Kogarah in Sydney, Australia. Comparisons were made of their concentration distributions, likely sources and potential toxicities. The concentrations (mg/kg) in NS, RDS, and WS ranged from 0.40 to 7.49 (mean 2.80), 1.65 to 4.00 (mean 2.91), and 0.49 to 5.19 (mean 1.76), respectively. \\{PAHs\\} were dominated by relatively high molecular weight compounds with more than three fused benzene rings, indicating that high temperature combustion processes were their predominant sources. The proportions of high molecular weight \\{PAHs\\} with five or six fused benzene rings were higher in NS than in RDS, whereas the low molecular weight \\{PAHs\\} were higher in RDS. Concentrations of all \\{PAHs\\} compounds were observed to be the lowest in WS. The concentrations of most of the high molecular weight \\{PAHs\\} significantly correlated with each other in RDS and WS. All \\{PAHs\\} (except naphthalene) were significantly correlated in NS suggesting a common PAH source. Ratios for individual diagnostic \\{PAHs\\} demonstrated that the primary source of \\{PAHs\\} in WS and NS was of pyrogenic origin (combustion of petroleum (vehicle exhaust), grass, and wood) while in RDS it was petrogenic (i.e. unburned or leaked fuel and oil, road asphalt, and tyre particles) as well as pyrogenic. The potential toxicities of \\{PAHs\\} calculated using a toxicity equivalent quotient (TEQ) were all low but higher for NS compared to WS and RDS.

Thuy Chung Nguyen; Paripurnanda Loganathan; Tien Vinh Nguyen; Saravanamuthu Vigneswaran; Jaya Kandasamy; Danny Slee; Gavin Stevenson; Ravi Naidu

2014-01-01T23:59:59.000Z

324

The tropical time machine: Past changes, future challenges  

E-Print Network [OSTI]

Centre University of New South Wales Australia #12;Why does marine science matter? Image courtesy. Am. Meteorol. Soc. #12;Future challenges · Extend the temporal and spatial coverage of the marine about the future, as well as the past, of the Earth's climate. #12;The Past's So Bright, I Gotta Wear

Phipps, Steven J.

325

VOLUME 78, NUMBER 22 P H Y S I C A L R E V I E W L E T T E R S 2 JUNE 1997 Stability Ordering of Cycle Expansions  

E-Print Network [OSTI]

· · · Lk . (1) The sum is over all distinct nonrepeating combinations of prime cycles, t is the period of Cycle Expansions C. P. Dettmann and G. P. Morriss School of Physics, University of New South Wales, Sydney 2052, Australia (Received 3 December 1996) We propose that cycle expansions be ordered

Dettmann, Carl

326

WS-Policy4MASC Version 0.8 Vladimir Tosic, Abdelkarim Erradi, Piyush Maheshwari  

E-Print Network [OSTI]

WS-Policy4MASC Version 0.8 Vladimir Tosic, Abdelkarim Erradi, Piyush Maheshwari vladat Science and Engineering The University of New South Wales NSW 2052, Australia #12;WS-Policy4MASC v0.8 Page 2 of 114 Abstract WS-Policy4MASC is a new XML language that we have developed for policy

New South Wales, University of

327

10.1101/lm.028183.112Access the most recent version at doi: 2013 20: 97-102Learn. Mem.  

E-Print Network [OSTI]

10.1101/lm.028183.112Access the most recent version at doi: 2013 20: 97-102Learn. Mem. E. James South Wales, Sydney 2052, Australia; 2 Department of Mechanical and Aerospace Engineering and Princeton Sciences, University of Alberta, Edmonton, T6G 2E8, Canada Rabbits were classically conditioned using

Sutton, Richard S.

328

The contribution of Indian Ocean sea surface temperature anomalies on Australian summer rainfall  

E-Print Network [OSTI]

in the Indian Ocean extratropics that induces an anomalous anticyclone in the Great Australian Bight. #12 1 The contribution of Indian Ocean sea surface temperature anomalies on Australian Wales, NSW, Australia Harry H. Hendon Centre for Australian Weather and Climate Research, Bureau

England, Matthew

329

Human Activity Recognition for Indoor Positioning using Smartphone Accelerometer  

E-Print Network [OSTI]

in the map without any external aid. Human activity recognition (HAR), therefore, could become a potential techniques [24]. However, to realize the positioning potential of HAR, we have to address several practical South Wales, Australia {sarak,mahbub}@cse.unsw.edu.au 2 School of Electrical and Telecommunication

New South Wales, University of

330

Preprints, 5th Australian Severe Thunderstorm Conference Bureau of Meteorology, 29 July -2 August, 1996  

E-Print Network [OSTI]

process. In this age when numeri- cal weather prediction (NWP) models and their associated statistical, 1996 Avoca Beach, New South Wales, Australia Science, Numerical Models, and Forecasting An Overview: numerical modeling has come to the point where it too must consider revolutionary change. New numerical

Doswell III, Charles A.

331

Bubble Contact Angle Method for Evaluating Substratum Interfacial Characteristics and Its Relevance to Bacterial Attachment  

Science Journals Connector (OSTI)

...research-article General Microbial Ecology Bubble Contact Angle Method for Evaluating Substratum...New South Wales 2033, Australia. A bubble contact angle method was used to determine...hydrophilic, giving an angle of 29 or less. Bubble contact angles at the surfaces exposed...

Madilyn Fletcher; K. C. Marshall

1982-07-01T23:59:59.000Z

332

A MAXIMAL THEOREM FOR HOLOMORPHIC SEMIGROUPS by GORDON BLOWER  

E-Print Network [OSTI]

of New South Wales, NSW, 2052, Australia) [3 April 2004] Abstract Let X be a closed linear subspace of the Lebesgue space Lp (, µ) for some 1 invertible operator that is the generator norm f D(V ) = f Lp + V f Lp . For 0 power A such that D

Doust, Ian

333

A MAXIMAL THEOREM FOR HOLOMORPHIC SEMIGROUPS by GORDON BLOWER +  

E-Print Network [OSTI]

of New South Wales, NSW, 2052, Australia) [3 April 2004] Abstract Let X be a closed linear subspace of the Lebesgue space L p(# , µ) for some 1 invertible operator that is the generator a fractional power A # such that D(A # ) contains D(A), and A -# is bounded whenever A has bounded inverse; see

Doust, Ian

334

Cowal Wind Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Cowal Wind Energy Ltd Cowal Wind Energy Ltd Jump to: navigation, search Name Cowal Wind Energy Ltd Place Flintshire, Wales, United Kingdom Zip CH7 4EW Sector Wind energy Product Wind Farm developer with its office in north Wales. References Cowal Wind Energy Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Cowal Wind Energy Ltd is a company located in Flintshire, Wales, United Kingdom . References ↑ "Cowal Wind Energy Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Cowal_Wind_Energy_Ltd&oldid=343949" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties

335

Australias Millennium Drought: Impacts and Responses  

Science Journals Connector (OSTI)

The National Rainwater and Graywater Initiative promotes these technologies and provides financial incentives to residents. Rebates can range from $150 to $1,500 for the installation of a rainwater tank, ... , ye...

Matthew Heberger

2011-01-01T23:59:59.000Z

336

Influence of riparian vegetation on channel widening and subsequent contraction on a sand-bed stream since European settlement: Widden Brook, Australia  

Science Journals Connector (OSTI)

Widden Brook in the Hunter Valley, Australia, was first settled by Europeans in 1831 and had widened substantially by the 1870s due to frequent floods during a flood-dominated regime impacting on highly disturbed banks whose riparian trees had been either ringbarked or cleared, and whose understorey had been grazed. Catastrophic floods in 1950 (many), two in August 1952 and one in February 1955 effected the final phase of channel widening at the onset of a second flood-dominated regime more than half a century after the initial widening. Contraction has been active since 1963 by a combination of five biogeomorphic processes. Firstly, rapid channel widening, migration and cutoffs totally reworked the pre-European floodplain and were followed by active floodplain formation. Initial bar formation was replaced by sand splay and overbank deposition which constructed a new floodplain and narrower channel. Secondly, overwidened channel segments that were produced by the catastrophic 1955 flood have contracted since 1963 by the formation of up to four bank-attached, discontinuous benches below the floodplain. Each bench has a bar nucleus of pebbly coarse sand overlain by stratified fine-medium sand and mud. Colonisation by River Sheoaks (Casuarina cunninghamiana subsp. cunninghamiana) or grasses (Cynodon dactylon, Paspalum distichum, Pennisetum clandestinum) is important in converting bars to benches. Thirdly, narrower segments which developed since 1963 have contracted by small-scale accretion on both banks. These deposits are steeply dipping, interbedded sand and mud trapped by stoloniferous and rhizomatous grasses (C. dactylon, P. distichum, P. clandestinum) which also rapidly stabilise the deposits. Fourthly, rare laterally migrating, small radius bends have contracted by recent point bar formation greatly exceeding cutbank recession rates. Point bar formation is controlled by secondary currents producing inclined stratified coarse sands without the influence of vegetation. Lastly, rare, overwidened, non-migrating, large radius bends have greatly contracted by the infilling of dissecting chutes across the convex bank. Establishment of stoloniferous and rhizomatous clonal grasses (Phragmites australis, C. dactylon, P. distichum, P. clandestinum) is important in inducing sedimentation of the chutes. Contraction has produced a much narrower channel than the design width between river training fences which were installed progressively between the 1960s and 1990s. The recent flood history of Widden Brook has not included any catastrophic floods of a size similar to February 1955. Our work demonstrates that both trees and grasses can be associated with narrower channel widths and that the causal link between width and vegetation type is more complex than usually acknowledged.

Wayne Erskine; Annabelle Keene; Richard Bush; Michael Cheetham; Anita Chalmers

2012-01-01T23:59:59.000Z

337

Oxley Creek Common Brisbane, Australia  

E-Print Network [OSTI]

right about 100 m after the bridge over Oxley Creek. The gate is always open. Amenities The main and turn left before the bridge crossing Oxley Creek. If approaching from the west (Sherwood side) turn. Both Rainbow and Scaly-breasted Lorikeets fly over in small screeching flocks. Golden-headed Cisticola

Queensland, University of

338

The Geological Development of Australia  

Science Journals Connector (OSTI)

... and of long continuance. The ocean apparently first covered the land near the Great Australian Bight on the south, and Arnheim's Land on the north, as in each of ... drained by much longer streams towards Spencer's Gulf, while a secondary series occupied the basin of the Murray and Darling Rivers. The climate evidently differed greatly from that now ...

1895-05-02T23:59:59.000Z

339

Water conservation behavior in Australia  

Science Journals Connector (OSTI)

Ensuring a nation's long term water supply requires the use of both supply-sided approaches such as water augmentation through water recycling, and demand-sided approaches such as water conservation. Conservation behavior can only be increased if the key drivers of such behavior are understood. The aim of this study is to reveal the main drivers from a comprehensive pool of hypothesized factors. An empirical study was conducted with 3094 Australians. Data was analyzed using multivariate linear regression analysis and decision trees to determine which factors best predict self-reported water conservation behavior. Two key factors emerge: high level of pro-environmental behavior; and pro-actively seeking out information about water. A number of less influential factors are also revealed. Public communication strategy implications are derived.

Sara Dolnicar; Anna Hurlimann; Bettina Grn

2012-01-01T23:59:59.000Z

340

Hugh Outhred  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hugh Outhred Hugh Outhred Assoc. Prof. of Electrical Engineering Centre for Photovoltaic Engineering University of New South Wales, Sydney, Australia This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. Hugh Outhred is in the School of Electrical Engineering & Telecommunications at the University of New South Wales, Sydney, Australia. He is also a member of the National Electricity Tribunal (a quasi-judicial appeal body associated with Australia's National Electricity Market). His research interests are in electricity industry restructuring and sustainability.Expertise: electricity industry restructuring and

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

342

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

343

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

344

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

345

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

346

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

347

The structure and reactivity of a low-sulfur lacustrine oil shale (Colorado U.S.A.) compared with those of a high-sulfur marine oil shale (Julia Creek, Queensland, Australia)  

Science Journals Connector (OSTI)

Abstract Oil shales from two different continents (Australia and North America) of different ages (100 and 40millionyears) and origins (one marine, one lacustrine) have been reacted in the range 355425C under H2 or N2 for 1 or 5h with or without the addition of catalyst. The shales differed in S content, and the nature of the mineral matter, but both had high atomic H/C ratios. The overall reactivity of the two shales was similar and high yields of soluble products could be obtained under relatively mild conditions with only small CO2 yields, but the temperature dependence of reactivity and the effect of potential catalysts differed markedly. Increasing the temperature and time led to increases in conversion but of different extents. Substituting H2 for N2 led to a large increase to conversion for the lower-atomic-H/C ratio marine oil shale. The \\{CH2Cl2\\} solubles from the marine oil shale showed a larger range of compounds than those from the lacustrine oil shale which resembled the \\{CH2Cl2\\} solubles from torbanite, a coal-like material derived from lacustrine algae.

Mohammad W. Amer; Marc Marshall; Yi Fei; W. Roy Jackson; Martin L. Gorbaty; Peter J. Cassidy; Alan L. Chaffee

2014-01-01T23:59:59.000Z

348

Dulas Ltd | Open Energy Information  

Open Energy Info (EERE)

Dulas Ltd Dulas Ltd Jump to: navigation, search Name Dulas Ltd Place Powys, Wales, United Kingdom Zip SY20 8AX Sector Biomass, Hydro, Renewable Energy, Solar, Wind energy Product Renewable energy consultancy encompassing all aspects of the industry from policy, market simulation and resource assessment right through to research, design, training and the implementation of wind, solar, small hydro and biomass projects. References Dulas Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Dulas Ltd is a company located in Powys, Wales, United Kingdom . References ↑ "Dulas Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Dulas_Ltd&oldid=344343

349

Localizing the Biochemical Transformations of Arsenate in a Hyperaccumulating Fern  

Science Journals Connector (OSTI)

Department of Geological Sciences, University of Saskatchewan, 114 Science Place, Saskatoon, Saskatchewan S7N 5E2, Canada, Departments of Botany, Plant Pathology, and Horticulture and Landscape Architecture, Purdue University, West Lafayette, Indiana 47907, School of Chemistry, University of Sydney, New South Wales 2006, Australia, ExxonMobil Biomedical Sciences Incorporated, Annandale, New Jersey 08801, and Hirsch Scientific, Pacifica, California 94044 ... In both cases, cultures were grown at 26 C under 24 h fluorescent lighting. ...

Ingrid J. Pickering; Luke Gumaelius; Hugh H. Harris; Roger C. Prince; Gregory Hirsch; Jo Ann Banks; David E. Salt; Graham N. George

2006-07-12T23:59:59.000Z

350

Sea anemones (Cnidaria: Anthozoa: Actiniaria) of Moreton Bay  

E-Print Network [OSTI]

) and the Australian Museum, Sydney (AM). Previously unpublished occurrence records from else where in Australia come from specimens collected by us and others during 2005 and 2006 from Queens - land, North ern Territory, and around Sydney, New South Wales..., and specimens we examined in the Museum and Art Gallery of the Northern Territory, Darwin (NTM), MTQ, South Australian Museum (SAM), Queen Victoria Mus eum and Art Gallery, Laun ceston (QVM), and Western Australian Museum (WAM). Type spec i mens exam ined...

Fautin, Daphne G.; Crowther, Andrea Louise; Wallace, Carden C.

2008-01-01T23:59:59.000Z

351

Landfill Gas | OpenEI  

Open Energy Info (EERE)

Landfill Gas Landfill Gas Dataset Summary Description The UK Department of Energy and Climate Change (DECC) publishes annual renewable energy generation and capacity by region (9 regions in England, plus Wales, Scotland and Northern Ireland). Data available 2003 to 2009. Data is included in the DECC Energy Trends: September 2010 Report (available: http://www.decc.gov.uk/assets/decc/Statistics/publications/trends/558-tr...) Source UK Department of Energy and Climate Change (DECC) Date Released September 30th, 2010 (4 years ago) Date Updated Unknown Keywords Energy Generation Hydro Landfill Gas Other Biofuels Renewable Energy Consumption Sewage Gas wind Data application/zip icon 2 Excel files, 1 for generation, 1 for capacity (zip, 24.9 KiB) Quality Metrics Level of Review Peer Reviewed

352

Owen, Noel L. (1987) BSc, U. of Wales, 1960; PhD, Cambridge U., England, 1964; DSc, U. of Wales, 1983.  

E-Print Network [OSTI]

engineers design pipeline systems, water treatment plants, dams, flood control structures, waste disposal. Environmental engineers evaluate and reduce pollutants from natural, human, agricultural, and industrial sources to preserve the beauty and quality of air, land, and water. Geotechnical engineers design structures composed

Hart, Gus

353

Au Australia 307 Br Brasil 307  

E-Print Network [OSTI]

307 Ch China, Republic of D ChT China, Taiwan D Cs Czecho Slovakia 307 Fr France 307 Ge Germany (Reich)1945 E Ge.W Germany, Federal Republic of 307 Germany(Reich=1945 E Ge.E Germany, Democratic Republic of 307 Germany(Reich=1945 E Hu Hungry 307 It Italy 307 Ju Jugoslavia 307 Ko Korea 307 Ko

Miyashita, Yasushi

354

ENGINEERS WITHOUT BORDERS AUSTRALIA RECONCILIATION ACTION PLAN  

E-Print Network [OSTI]

sector through small scale, grassroots engineering programs to ensure that innovative, appropriate issues facing the communities we work with include access to drinking water, sanitation, energy, basic students, young graduates, experienced engineers and non engineers as a team to help solve basic, small

Botea, Adi

355

New High Annual Awards in Australia  

Science Journals Connector (OSTI)

... FIVE new Australian annual national awards?in science, medicine, literature, education and art?were presented in Canberra for the ... education and art?were presented in Canberra for the first time on January 21. The awards are among the richest in the world, each consisting of a gold medal and ...

OSCAR A. GUTH

1965-02-27T23:59:59.000Z

356

Damien J. Mannion University of Sydney, Australia  

E-Print Network [OSTI]

visual system. Using functional magnetic resonance imaging (fMRI), we have previously shown of natural images aligned to the gaze of a freely-moving human observer (Schumann, Einhäuser, Vockeroth

König, Peter

357

Cairns Australia 9-12 July, 2007  

E-Print Network [OSTI]

): the hyperbola apex passes midway between receiver A and virtual receiver B and the asymptote is midway between B

Gerstoft, Peter

358

Iceberg water transportation from Antarctica to Australia.  

E-Print Network [OSTI]

??The amount of iceberg water that annually dissolves into the sea corresponds to a substantial part of the worlds annual consumption of freshwater. The Australian (more)

Spandonide, B

2012-01-01T23:59:59.000Z

359

Dispersion of Rayleigh Waves across Australia  

Science Journals Connector (OSTI)

......deformation ; there are considerable sedimentary basins of Paleozoic and Upper Proterozoic age...the wave fronts near the Great Australian Bight. A number of theoretical group velocity...A., 1962. The crust of the Pacific Basin, Geophys. Monograph No. 6, Brune......

B. A. Bolt; M. Niazi

1964-10-01T23:59:59.000Z

360

Marcus Hutter Canberra, ACT, 0200, Australia  

E-Print Network [OSTI]

extend human life-span ideally indefinitely · Transhumanism enhancing humans, H+ · Omega Point Universe

Hutter, Marcus

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Gulf War illness: a view from Australia  

Science Journals Connector (OSTI)

...published (NIH Technology Assessment...recruitment strategy applied equally to...non-participants. This procedure, replicated...prevalences were then applied in order to...these tests to handling procedures, and the time...S0033291704002818 . NIH Technology Assessment...

2006-01-01T23:59:59.000Z

362

Foreign Fishery Developments Australia Reports Growth in  

E-Print Network [OSTI]

are estimated to have spent almost $200 million on seafood in 1975-76. according to a report in Australian Fisheries. A survey there has shown that some $123 million was spent on seafood for consumption at home." Later studies have also shown both per capita fish and seafood consump- tion and fish prices

363

Coal remains a hot commodity for Australia  

SciTech Connect (OSTI)

Based largely on analyses by the Australian Bureau of Agricultural and Resource Economics in late 2005 and early 2006, the article looks at the recent and near future export market for Australian coal. Demand in Asia is growing; European demand remains steady. Developments existing and new mines in Queensland are summarised in the article. 3 tabs.

Bram, L.

2006-02-15T23:59:59.000Z

364

New Australia-Tasmania Submarine Cable  

Science Journals Connector (OSTI)

... THE new submarine cable which was successfully laid across the Bass Strait last November marks a notable advance in ... across the Bass Strait last November marks a notable advance in the technique of submarine cable transmission. Before laying this ...

1936-03-14T23:59:59.000Z

365

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

366

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

367

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

368

Solco International Ltd formerly Solar Energy Systems | Open Energy  

Open Energy Info (EERE)

International Ltd formerly Solar Energy Systems International Ltd formerly Solar Energy Systems Jump to: navigation, search Name Solco International Ltd (formerly Solar Energy Systems) Place Welshpool, Western Australia, Australia Zip 6016 Sector Solar Product Solar techology company specialising in solar powered energy systems, pumps and reverse osmosis water purification systems. References Solco International Ltd (formerly Solar Energy Systems)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solco International Ltd (formerly Solar Energy Systems) is a company located in Welshpool, Western Australia, Australia . References ↑ "Solco International Ltd (formerly Solar Energy Systems)" Retrieved from

369

A Client-side CardSpace-Liberty Integration Architecture Waleed A. Alrodhan  

E-Print Network [OSTI]

, namely the Liberty Alliance Project scheme (specifically the ID-FF LEC Profile) and the Microsoft Card the Liberty Alliance Project scheme and the Mi- crosoft CardSpace scheme. The remainder of this paper is organised as follows. Sec- tion 2 provides an overview of the Liberty Alliance Project and the Microsoft

Mitchell, Chris

370

NISACs Response to Request for Information from Brandon Wales  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

in Louisiana and centrally located in a large area of the Gulf that is rich in oil and natural gas drilling fields. Shallow water operations are serviced out of many ports along...

371

The seasonal relationship between assault and homicide in England and Wales  

E-Print Network [OSTI]

of Psychiatry and Behavioral Sciences, Stanford University, Palo Alto, CA, United States Accepted 26 March 2008 and homicide in the same population over the same period of time. One group found assault was seasonal, we require the assault and homicide data to come from the same population over the same time period

Judd, Kevin

372

Impacts of climate change on coastal flood risk in England and Wales: 20302100  

Science Journals Connector (OSTI)

...agriculture public services, civil...engineering fossil fuel energy, traditional...warning (including communications technologies) and public response to warning...environmental and conservation goals piecemeal...and to reduce energy insecurity towards...

2006-01-01T23:59:59.000Z

373

University of Wales Swansea U Berger Department of Computer Science 27 February 2004  

E-Print Network [OSTI]

to bottom of the bag. For example, if the list of items is [coke, cake, mug, mug, choc, butter, coke, bread, tissuebox, soap, biscuit, lettuce, coke], then the output could be: bag 1: soap bag 2: biscuit bag 3: bread butter cake coke choc coke coke mug tissuebox mug lettuce [60 marks] Question 3. Use Prolog to solve

Berger, Ulrich

374

The technology of the New South Wales torbanite : including an introduction on oil shale.  

E-Print Network [OSTI]

??Although the nature of the products of thermal decomposition of oil shale has attracted the attention of both scientist and industrialist, oil shale possibly ranks (more)

Cane, Reginald Frank

1946-01-01T23:59:59.000Z

375

Nitrate occurrence and attenuation in the major aquifers of England and Wales  

Science Journals Connector (OSTI)

...Examination of the delta15N composition of infiltrating nitrate relative...L., Zech, W., The composition of dissolved organic matter...Migration and attenuation of agrochemical pollutants: insights from...The nitrogen isotope composition of groundwater nitrates from...

M.O. Rivett; J.W.N. Smith; S.R. Buss; P. Morgan

376

Secretariat: PO Box 7507, Silverwater, NSW 2128, Australia 7 Leeds Street, Rhodes, NSW 2138, Australia  

E-Print Network [OSTI]

, (prior to 1999 ISO Guide 25) rather than be certified (registered) to ISO 9001. The situation became more acute with the publication of ISO 9001:2008, as some customers continually asked laboratories by their accreditation body, stating that an accredited laboratory's management system meets the principles of ISO 9001

377

GENETICS, in press An exploration of the sequence of a 2.9-megabase region of the genome of  

E-Print Network [OSTI]

; Department of Pathology, University of Wales College of Medicine, Cardiff, CF4 4XN, Wales; § Berkeley

378

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

379

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

380

Prime Solar Pty Ltd | Open Energy Information  

Open Energy Info (EERE)

Prime Solar Pty Ltd Prime Solar Pty Ltd Jump to: navigation, search Name Prime Solar Pty Ltd Place Perth, Western Australia, Australia Zip 6151 Sector Solar Product Prime Solar Australia plans to manufacture polycrystalline silicon and wafers. Coordinates -31.95302°, 115.857239° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-31.95302,"lon":115.857239,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Kapundaite, (Na,Ca)[subscript 2]Fe[subscript 4][superscript 3+](PO[subscript 4])[subscript 4](OH)[subscript 3]5H[subscript 2]O, a new phosphate species from Toms quarry, South Australia: Description and structural relationship to mlonjosephite  

SciTech Connect (OSTI)

Kapundaite, ideally (Na,Ca){sub 2}Fe{sub 4}{sup 3+}(PO{sub 4}){sub 4}(OH){sub 3}{center_dot}5H{sub 2}O, is a new mineral (IMA2009-047) from Toms phosphate quarry, Kapunda, South Australia, Australia. The new mineral occurs as cavernous aggregates of fibers up to several centimeters across, associated with leucophosphite, natrodufrenite, and meurigite-Na crystals and amorphous brown, black, and/or greenish coatings. Individual kapundaite crystals are very thin flattened fibers up to a few millimeters in length, but typically no more than a few micrometers in thickness. The main form observed is {l_brace}100{r_brace}; other forms in the [010] zone are present, but cannot be measured. Crystals of kapundaite are pale to golden yellow, transparent to translucent, have a yellow streak and silky luster, and are non-fluorescent. Mohs hardness is estimated to be about 3; no twinning or cleavage was observed. Kapundaite is biaxial (+), with indices of refraction = 1.717(3), {beta} = 1.737(3), and {gamma} = 1.790(3). 2V could not be measured; 2V{sub calc} is 64.7{sup o}. The optical orientation is Z = b, Y {approx} c with weak pleochroism: X = nearly colorless, Y = light brown, Z = pale brown; absorption: Y > Z > X. No dispersion was observed. The empirical chemical formula (mean of seven electron microprobe analyses) calculated on the basis of 24 O is (Ca{sub 1.13}Na{sub 0.95}){sub {Sigma}2.08}(Fe{sub 3.83}{sup 3+}Mn{sub 0.03}Al{sub 0.02}Mg{sub 0.01}){sub {Sigma}3.89}P{sub 3.92}O{sub 16}(OH){sub 3}{center_dot}5H{sub 2.11}O. Kapundaite is triclinic, space group P{sub {bar 1}}, a = 6.317(5), b = 7.698(6), c = 9.768(7) {angstrom}, {alpha} = 105.53(1){sup o}, {beta} = 99.24(2){sup o}, {gamma} = 90.09(2){sup o}, V = 451.2(6) {angstrom}{sup 3}, and Z = 1. The five strongest lines in the powder X-ray diffraction pattern are [d{sub obs} in {angstrom} (I) (hkl)]: 9.338 (100) (001), 2.753 (64) (2{sub {bar 1}}1), 5.173 (52) (011), 2.417 (48) ({sub {ovr 21}}3, 202, 0{sub {bar 1}}4), and 3.828 (45) (0{sub {bar 2}}1). The crystal structure was solved from single-crystal X-ray diffraction data using synchrotron radiation and refined to R{sub 1} = 0.1382 on the basis of 816 unique reflections with F{sub o} > 4{sub {sigma}}F. The structure of kapundaite is based on a unique corrugated octahedral-tetrahedral sheet, which is composed of two types of chains parallel to a. Kapundaite is structurally related to melonjosephite. The mineral is named for the nearest town to the quarry.

Mills, Stuart J.; Birch, William D.; Kampf, Anthony R.; Christy, Andrew G.; Pluth, Joseph J.; Pring, Allan; Raudsepp, Mati; Chen, Yu-Sheng (Museum Vic.); (SA Museum); (NHM-LA); (UC); (UBC); (ANU)

2010-06-22T23:59:59.000Z

382

RWE npower renewables | Open Energy Information  

Open Energy Info (EERE)

npower renewables npower renewables Jump to: navigation, search Name RWE npower renewables Place Wiltshire, England, United Kingdom Zip SN5 6PB Sector Hydro, Wind energy Product Develops wind generating assets in the UK which are then sold to Zephyr Investments. Operates a number of hydro plants in Scotland and Wales. Coordinates 51.324131°, -1.9257° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.324131,"lon":-1.9257,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

383

Tidal Energy Limited | Open Energy Information  

Open Energy Info (EERE)

Tidal Energy Limited (TEL) Tidal Energy Limited (TEL) Place Cardiff, Wales, United Kingdom Zip CF23 8RS Product Tidal stream device developer. Coordinates 51.48125°, -3.180734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.48125,"lon":-3.180734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

384

IQE | Open Energy Information  

Open Energy Info (EERE)

IQE IQE Jump to: navigation, search Name IQE Place Cardiff, Wales, United Kingdom Zip CF3 0LW Sector Solar Product UK-headquartered global supplier of advanced semiconductor wafers. Applications include solar PV cells. Coordinates 51.48125°, -3.180734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.48125,"lon":-3.180734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

385

Excess Group Ltd | Open Energy Information  

Open Energy Info (EERE)

Excess Group Ltd Excess Group Ltd Jump to: navigation, search Name Excess Group Ltd Place Chepstow, Wales, United Kingdom Zip NP16 6HN Sector Hydro, Hydrogen Product The Excess Group has developed and builds novel hydrogen generation systems for fuel cell power plants. Coordinates 39.617315°, -96.900768° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.617315,"lon":-96.900768,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

386

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

387

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

388

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

389

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

390

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

391

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

392

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

393

PRESENTED AT THE 2009 IEEE WORKSHOP ON STATISTICAL SIGNAL PROCESSING, CARDIFF, WALES LOOKING THROUGH WAVELETS TO VIEW THE ISING PROBLEM  

E-Print Network [OSTI]

THROUGH WAVELETS TO VIEW THE ISING PROBLEM Gagan Mirchandani1 , John T. Evans1 , Robert Snapp2 , Richard wavelets to the solution of the simplest of models, the Ising model and evaluate the most fundamental size Ising model. Thermodynamic prop- erties are then calculated to predict, in some sense, potential

Mirchandani, Gagan

394

Seasonal Abundance, Geographical Distribution and Feeding Types of the Copepod Species Dominant in Port Hacking, New South Wales  

Science Journals Connector (OSTI)

Zooplankton samples were collected over a one-year period by net haul and light trap at four locations in Port Hacking Estuary. Copepods accounted for approximately three quarters...Acartia tranteri, Bestiola sim...

Dennis J. Tafe; F. Brian Griffiths

1983-01-01T23:59:59.000Z

395

The Architecture of an Alluvial Suite: Rocks Between the Townsend Tuff and Pickard Bay Tuff Beds (Early Devonian), Southwest Wales  

Science Journals Connector (OSTI)

...over an area measuring about 35 km from west to east by 12 km from south to north...relatively deep depressions, probably incised valleys, which they fill to a height less than...muddy sediments, and the shifting and valley-building activities of mixed tidal and...

1982-01-01T23:59:59.000Z

396

A Late Devensian Lateglacial palaeomagnetic record from Llyn Gwernan, North Wales: comparison with other NW European records  

Science Journals Connector (OSTI)

......Widdowson (1975). The specimens were step-wise demagnetized within a low direct field...kindly provided by Richard Gillespie, Alison Fowler, Andrew Haggart, Stephen Lowe...also Drs Tim Atkinson, John Dearing, Alison Fowler, Robert Hedges, Barbara Maher......

T. J. F. Austin; J. J. Lowe

1989-12-01T23:59:59.000Z

397

The adequacy of the regulatory regime of marine protected areas in New South Wales for addressing threats to marine biodiversity.  

E-Print Network [OSTI]

??Marine protected areas (MPAs) have been recognised and endorsed as a holistic, ecosystem-based, spatially-explicit alternative to the conventional sectoralised, species-specific approaches to address the deteriorating (more)

Kuo, Wayne L

2011-01-01T23:59:59.000Z

398

National Assembly for Wales Enterprise, Innovation and Networks Committee and Environment Planning and Countryside Committee Consultation on EU  

E-Print Network [OSTI]

) and of Integrated Coastal Zone Management. In the face of sustainability challenges, an integrated EU maritime generally, and sustainable energy supply). Need: ecological, legal, political and economic factors all: a European Vision for the oceans and seas RESPONSE FROM CENTRE FOR ENERGY AND ENVIRONMENTAL LAW AND ECONOMICS

Martin, Ralph R.

399

48 Florida Entomologist 83(1) March, 2000 INSTABILITY OF SANDY SOIL ON THE LAKE WALES RIDGE  

E-Print Network [OSTI]

were obtained in tests of pit construction by antlion larvae (Myrmeleontidae), which may serve for a list of local wolf spiders). In addition, because all of the study sites had been burned several years that these insects will actively seek out fine grained, stable sands for pit construction and that their pits made

Carrel, James E.

400

Aeromagnetic data in the UK: a study of the information content of baseline and modern surveys across Anglesey, North Wales  

Science Journals Connector (OSTI)

......fluvial succession, as well as Carboniferous limestone and coal measures. Figure 2 A summary of the geology of Anglesey taken...Northern Ireland are held by BGS on behalf of the Department of Economic Development of Northern Ireland. The data sets underlying the......

David Beamish; James C. White

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Bupa Australia Pty Ltd ABN 81 000 057 590  

E-Print Network [OSTI]

Government Rebate on private health insurance. Membership number (if relevant) Surname First name Initial

402

Bupa Australia Pty Ltd ABN 81 000 057 590  

E-Print Network [OSTI]

government Rebate on private health insurance. Membership number (if relevant) Surname First name Initial

403

The feasibility of producing alcohol fuels from biomass in Australia  

Science Journals Connector (OSTI)

Apart from cost, the net production of energy is the most important factor in evaluating the feasibility of producing renewable fuels from woody biomass. Unlike sugar, the effort required to make woody materials fermentable is considerable, and has been a major barrier to the use of such materials to produce renewable fuels. The Energy Profit Ratio (EPR) of fossil fuels is declining rapidly as conventional oil resources decline, but the EPR of biomass fuels is often not as high as commonly thought. I conclude that producing methanol from wood not only has a much higher yield, but is also cheaper than the more popular ethanol.

Chris Mardon

2007-01-01T23:59:59.000Z

404

Seismology in Australia and Around the World - Part II  

Science Journals Connector (OSTI)

...seismoaraphs are in operation at the observatory...Mountain area are fairly cold. In the rugged area...Hallo Lagoon are in operation. Vol. XXI EARTHQUAKE...ionosphere specialists, a weather man, three glaciologists...comfortably at 70 by oil heaters. The men slapt two...every type. Hot and cold running water ware...

Dean S. Carder

405

Seismology in Australia and Around the World - Part I Addenda  

Science Journals Connector (OSTI)

...seismoaraphs are in operation at the observatory...Mountain area are fairly cold. In the rugged area...Hallo Lagoon are in operation. Vol. XXI EARTHQUAKE...ionosphere specialists, a weather man, three glaciologists...comfortably at 70 by oil heaters. The men slapt two...every type. Hot and cold running water ware...

406

Feasibility of Solar-Assisted Refrigerated Transport in Australia  

E-Print Network [OSTI]

systems. Keywords: refrigeration, transport, photovoltaics, economics. 1 #12;B. Elliston, M. Dennis) modules to minimise the use of diesel generation in refrigerated transport. Sub- sequently, UK supermarket. This report investigates the merit of retrofitting a PV system to assist refrigerated trailers in Australian

407

Regulation of naturally occurring radioactive materials in Australia  

Science Journals Connector (OSTI)

......implement those standards. In order to...competency standards, Codes of Practice, Standards and guidance...associated with uranium (and thorium...provision for plans to manage occupational...commissioned a review of operations......

Cameron Jeffries; Riaz Akber; Andrew Johnston; Brad Cassels

2011-07-01T23:59:59.000Z

408

Regulation of naturally occurring radioactive materials in Australia  

Science Journals Connector (OSTI)

......provide an overview of the regulatory approach to managing...been variation in the regulatory approach to implement...makes provision for plans to manage occupational...ARPANSA commissioned a review of operations involving...process to identify when regulatory control is appropriate......

Cameron Jeffries; Riaz Akber; Andrew Johnston; Brad Cassels

2011-07-01T23:59:59.000Z

409

Australia antigen and the biology of hepatitis B  

Science Journals Connector (OSTI)

...20x20-200nm 2Sn Fig. 2. Diagram showing appearance of parti-cles...anti-gen and proposed using this material as a vaccine. To our knowledge...transmitted with the genetic material; that the virus could enter...the surface antigen contains material with antigenic specific-ities...

BS Blumberg

1977-07-01T23:59:59.000Z

410

Study of Marine Protected Areas in Australia and in China.  

E-Print Network [OSTI]

??Marine protected areas are recognized as an important approach to conserve marine ecosystems and biodiversity as well as to manage costal and marine resource. This (more)

Liang, Qun

2009-01-01T23:59:59.000Z

411

Residential Water Conservation in Australia and California Ryan Cahill1  

E-Print Network [OSTI]

of Water Resources Planning and Management, in press 2012 Abstract In much of the Western United States, with a similar climate, economy, and culture. Per-capita usage is compared, and explanations for use differences California. Population, economic development, culture, and hydrologic patterns are similar. The populations

Pasternack, Gregory B.

412

The Australia Telescope 20 GHz Survey: the source catalogue  

Science Journals Connector (OSTI)

......Carole A. Jackson 3 Michael J. Kesteven 3 Emma Lindley 1 Katherine Newton-McGee 1 3 Chris Phillips 3 Paul Roberts 3 Robert J...Y. , Chiueh T. H., Martin R. N. et al., 2001, in Wheeler J. C., Martel H., eds, AIP Conf. Ser. Vol. 586, 20th......

Tara Murphy; Elaine M. Sadler; Ronald D. Ekers; Marcella Massardi; Paul J. Hancock; Elizabeth Mahony; Roberto Ricci; Sarah Burke-Spolaor; Mark Calabretta; Rajan Chhetri; Gianfranco De Zotti; Philip G. Edwards; Jennifer A. Ekers; Carole A. Jackson; Michael J. Kesteven; Emma Lindley; Katherine Newton-McGee; Chris Phillips; Paul Roberts; Robert J. Sault; Lister Staveley-Smith; Ravi Subrahmanyan; Mark A. Walker; Warwick E. Wilson

2010-03-11T23:59:59.000Z

413

November 2011 The University of Georgia in Australia  

E-Print Network [OSTI]

in faculties of Agriculture, Food, and Natural Resources; Architecture, Design, and Planning; Arts and Social for the Global Programs in Sustainability program, a faculty-led study abroad program out of the Warnell School of Forestry of UGA for many years. Along with Queensland, the Global Programs in Sustainability also offers

Hall, Daniel

414

The Palaeomagnetism of the Antrim Plateau Volcanics of Northern Australia  

Science Journals Connector (OSTI)

......unchanged position just south of the Australian Bight from the Upper Carboniferous to the mid-Cretaceous...the southern part of the Bonaparte Gulf Basin, Bur. Miner. Resour. Geol. Geophys...geology of the northern part of the Wiso Basin, Northern Territory, Bull. Bur. Miner......

M. W. McElbinny; G. R. Luck

1970-08-01T23:59:59.000Z

415

The Palaeomagnetism of the Antrim Plateau Volcanics of Northern Australia  

Science Journals Connector (OSTI)

......just south of the Australian Bight from the Upper Carboniferous...1969. North Australian Plateau Volcanics...the Bonaparte Gulf Basin, Bur. Miner. Resour...palaeomagnetism of the Great Dyke of Southern...part of the Wiso Basin, Northern Territory......

M. W. McElbinny; G. R. Luck

1970-08-01T23:59:59.000Z

416

Regulation of naturally occurring radioactive materials in Australia  

Science Journals Connector (OSTI)

......implement those standards. In order to...competency standards, Codes of Practice, Standards and guidance...protection in mining and mineral processing...provision for plans to manage occupational...commissioned a review of operations......

Cameron Jeffries; Riaz Akber; Andrew Johnston; Brad Cassels

2011-07-01T23:59:59.000Z

417

Private nuclear waste plan faces critics in Australia  

Science Journals Connector (OSTI)

... now based in Seattle, Washington State, and is backed by two organizations active in nuclear ...

Peter Pockley

1999-04-22T23:59:59.000Z

418

accepted for publication at IS'2000 University of Wollongong, Australia  

E-Print Network [OSTI]

, drifting, or even stochastically moving target is a necessary condition for successful applications

Zimmer, Uwe

419

Vertical velocity in oceanic convection off tropical Australia  

E-Print Network [OSTI]

. . . . . . . v Vl Vl I I 1 3 6 10 Description of the Data Data Processing . . Event Criteria 10 15 21 III RESULTS . . . 26 Cores. Environment 26 34 IV COMPARISON WITH OTHER STUDIES . . . . . 40 Cores... Variations with altitude of median and strongest 10'/o-level statistics of (a) average vertical velocity, (b) maximum vertical velocity, (c) mass flux per unit length normal to the flight track and (d) diameter 32 Figure Page Reconstructed temperature...

Lucas, Christopher

2012-06-07T23:59:59.000Z

420

Stromatolite reef from the Early Archaean era of Australia  

Science Journals Connector (OSTI)

... . More specifically, a peritidal marine carbonate platform environment is indicated by a suite of interrelated observations (described below) on the facies associations and architecture of M2.

Abigail C. Allwood; Malcolm R. Walter; Balz S. Kamber; Craig P. Marshall; Ian W. Burch

2006-06-08T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Land cover change and water vapour flows: learning from Australia  

Science Journals Connector (OSTI)

...Eucalyptus species in plantations on a saline farm catchment...in a discharge site plantation in the Western Australian...1983 Rice yield, biomass and leaf area related...Conversion of grasslands to plantations: anticipating the negative...Can- berra, ACT. Wood, W. E. 1924 Increase...

2003-01-01T23:59:59.000Z

422

The southern Bonaparte Gulf, northwest Australia - New exploration plays  

SciTech Connect (OSTI)

Integration of regional exploration data with new basin model concepts has generated new exploration plays in the offshore area defined as the Southern Bonaparte Gulf. This area represents a unique hydrocarbon habitat significantly different from adjacent areas. Early exploration (seven wells), targeting structural highs, encountered numerous hydrocarbon shows. Of most recent significance, Turtle-1 (1984) targeted a midbasin MS-I high recovering degraded oils in the MS-III section. Turtle-2 (1989) tested an additional 320-m-thick, MS-II onlap, encountering within fractured intervals significant oil and gas influx accompanied by massive lost circulation. Significant live oil (nondegraded) was produced on test despite formation damage inflicted during the 14-day well control period. Within the MS-III section thin incompetent seals and meteoric waters have resulted in small, degraded, low-GOR (gas/oil ratio) oil accumulations. In contrast the MS-II section has competent seals and exhibits high-GOR live oil. In consequence, given suitable models for porosity development, MS-II is highly prospective, indicating new exploratory plays: (1) MS-II fractured, stratigraphic pinch-outs flanking MS-I structures, (2) MS-II stacked turbidites and basin floor fans deposited in salt withdrawal subbasins, (3) MS-II carbonate banks within the subbasin's marginal carbonate complexes, (4) MS-I reefs localized over early salt structures and onlapped by MS-II sediments, and (5) MS-II structural and stratigraphic traps associated with diapiric salt. By virtue of the stratigraphic and structural relationship of MS-U sediments, generally onlapping the flanks of the structural highs originally targeted, these new plays have not been tested in optimal locations. A new phase of exploration specifically targeted at these plays is planned.

Dauzacker, M.V.; Durrant, J.M.; France, R. (Western Mining Corp., Perth, (Australia)); Nilsen, T. (Cultus Petroleum, Perth (Australia))

1990-05-01T23:59:59.000Z

423

Proceedings of the SUT Annual Conference 2009 Perth, Western Australia  

E-Print Network [OSTI]

on previous data by Hillman et al. (1995). These sites were Rocky Bay, Point Walter, Freshwater Bay, Attadale. Wind speed varied from flat calm to 20kn, at which point measurement quality degraded unacceptably

424

Extreme measures : mechanisms driving changes in climate extremes in Australia.  

E-Print Network [OSTI]

??Changes in the frequency and/or severity of extreme climate events have the potential to have profound societal and ecological impacts and observations suggest that in (more)

Alexander, Lisa Victoria

2009-01-01T23:59:59.000Z

425

The evolution of clinical immunology and allergy in Australia  

E-Print Network [OSTI]

, it is appropriate to reflect in broad terms on the impact Burnet and Fenner's1,2 work has had on Australian

Cai, Long

426

Failure of maximum likelihood methods for chaotic dynamical systems School of Mathematics and Statistics, University of Western Australia, Perth, Australia  

E-Print Network [OSTI]

more infinitely more likely than truth. This failure occurs for unbounded noise and for bounded noise when it is sufficiently large and will almost certainly have consequences for parameter estimation, and hence their likelihood dominates truth. The residuals of these truth-dominating trajectories

Judd, Kevin

427

EnviroMission Ltd | Open Energy Information  

Open Energy Info (EERE)

EnviroMission Ltd EnviroMission Ltd Jump to: navigation, search Name EnviroMission Ltd Place Melbourne, Victoria, Australia Zip 3205 Sector Solar Product Australia-based firm that develops, owns and operates solar thermal convection tower power plants. Coordinates -37.817532°, 144.967148° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-37.817532,"lon":144.967148,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

428

Acquasol Infrastructure Limited | Open Energy Information  

Open Energy Info (EERE)

Acquasol Infrastructure Limited Acquasol Infrastructure Limited Jump to: navigation, search Name Acquasol Infrastructure Limited Place Adelaide, South Australia, Australia Zip 5000 Sector Solar Product Adelaide based solar thermal project and technology developer. Coordinates -34.926102°, 138.599884° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-34.926102,"lon":138.599884,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

429

Advanced Energy Systems Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name Advanced Energy Systems Ltd Place Welshpool, Western Australia, Australia Zip 6016 Sector Solar, Wind energy Product Manufacturer and distributor of micro wind turbines, solar systems, gas generators and balance of plant. Currently undergoing restructuring. Coordinates 38.211449°, -85.574524° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.211449,"lon":-85.574524,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

430

Mid West Energy | Open Energy Information  

Open Energy Info (EERE)

Energy Energy Jump to: navigation, search Name Mid West Energy Place Perth, Western Australia, Australia Zip WA 6005 Sector Solar Product Western Australian-based Mid West Energy is proposing to build a 200MW solar thermal plant near Perenjori. Coordinates -31.95302°, 115.857239° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-31.95302,"lon":115.857239,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

431

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

432

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

433

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

434

An Australian Perspective On Distributed Energy Resources  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

An Australian Perspective On Distributed Energy Resources An Australian Perspective On Distributed Energy Resources Speaker(s): Hugh Outhred Date: December 11, 2003 - 12:00pm Location: Bldg. 90 Seminar Host/Point of Contact: Kristina LaCommare The seminar will describe and critique the Australian approach to incorporating distributed energy resources into its restructured electricity industry, which consists of the National Electricity Market (a wholesale electricity market), retail electricity markets, network regulation and environmental regulation. These arrangements continue to evolve and recent developments will be discussed. Hugh Outhred is in the School of Electrical Engineering & Telecommunications at the University of New South Wales, Sydney, Australia. He is also a member of the National Electricity Tribunal ( a quasi-judicial appeal body associated with

435

Poloidal Flow and Toroidal Particle Ring Formation in a Sessile Drop Driven by Megahertz Order Vibration  

Science Journals Connector (OSTI)

(5) We report the appearance of poloidal flow in a sessile drop via high-frequency acoustic excitation, recirculation about a circular locus with a characteristic length scale defined by the confinement of the fluid, because it is in toroidal tokamaks intended for plasma containment in nuclear fusion,(6) in the mantle between the solid core and flexible crust of the earth,(7) and in immiscible spherical drops(8) within another fluid and transported because of acceleration. ... For the flow experiments, water drops of radii R = 1.5 mm were placed on the substrate and a signal generator (SML01, Rhode & Schwarz Pty. Ltd., North Ryde, New South Wales, Australia) and amplifier (10W1000C, Amplifier Research, Souderton, PA) were used to provide a continuous sinusoidal electrical input at the defined frequency f. ...

Amgad R. Rezk; Leslie Y. Yeo; James R. Friend

2014-09-03T23:59:59.000Z

436

Bonnyrigg solar village: An analysis of annual energy use and comfort  

SciTech Connect (OSTI)

In 1981, 12 solar-efficient houses and 3 standard houses were designed and built for the New South Wales Housing commission near Sydney, Australia. Recently, a pilot study was done to evaluate the energy use and comfort levels in these 15 houses over a two-year period. Heavyweight, well insulated houses, as a group, used the least energy annually, averaging 19,235 MJ in 1983-1984. They are least likely to require winter space heating, which typically contributes 31% of the total energy bill. A trade-off of a well insulated house is less comfort in the summer unless active measures are taken by the residents to open windows in the evenings and close shades in the day for effective cooling. Even so, the four houses with heavyweight wall construction remained in the daytime comfort zone an average of 76% of the time in 1983. The annual energy use in the houses was compared to other studies done in Australia. The average energy consumption of the 12 passive solar homes was 22,687 MJ/year in the two-year period 1983-1984. Bartels (1985) found the average household consumption in New South Wales to be 28,000 MJ. The three control houses used 30,059 MJ/year on average, though the sample size was considerably smaller, and thus more likely to be affected by atypical user behavior. This study provides clear evidence of the effectiveness of solar efficient design in significantly reducing winter heating loads.

Ballinger, J.A.; Di Franco, T.L.; Prasad, D.K. (Univ. of New South Wales, Sydney (Australia))

1993-06-01T23:59:59.000Z

437

Author's personal copy Potent prosody: Comparing the effects of distal prosody, proximal  

E-Print Network [OSTI]

, Pallier, Block, & Mehler, 2004; Gout, Christophe, & Morgan, 2004; Millotte, Rene, Wales, & Christophe

Liu, Taosheng

438

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

439

Visions and Revisions: Gerald of Wales, Authorship, and the Construction of Political, Religious, and Legal Geographies in Twelfth and Thirteenth Century Britain  

E-Print Network [OSTI]

usque ad pascha sequens moram in insula fecit. So when thein Ireland) with his own (moram in insula fecit, he [cum hostibus fidei congrediendi moram communiter accusantia;

Sargent, Amelia

2011-01-01T23:59:59.000Z

440

Dissolved iodine in rainfall,cloud,stream and groundwater in the Plynlimon area of mid-Wales Hydrol. Earth Syst. Sci., 11(1), 283293, 2007  

E-Print Network [OSTI]

). Further, there are issues of radioactive iodine contamination from nuclear weapon testing, nuclear, much higher concentrations can occur in brines associated with oil fields where concentrations can

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Macroscopic Streamer Growths in Acidic, Metal-Rich Mine Waters in North Wales Consist of Novel and Remarkably Simple Bacterial Communities  

Science Journals Connector (OSTI)

...waters and mine wastes: an important role...Said. 1992. Isolation and characterization...isolated from a pilot plant stirred tank bioleaching...Using a modified isolation technique, this...growth & development isolation & purification Copper...

Kevin B. Hallberg; Kris Coupland; Sakurako Kimura; D. Barrie Johnson

2006-03-01T23:59:59.000Z

442

Ingraham Bay, Prince of Wales Island: photo courtesy of the Shorezone Project This report summarizes highlights of Habitat Conservation Division activities during the  

E-Print Network [OSTI]

Power Act, and other directives. HCD has two principal programs: first, the identification, conservation responsibilities, HCD also supports habitat restoration projects in conjunction with the National Oceanic Ocean Service's Office of Response and Restoration, and the NOAA Invasive Species Program. Outside NOAA

443

Wind Energy Resource Atlas of Armenia (CD-ROM)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...

444

Wizard Power Pty Ltd | Open Energy Information  

Open Energy Info (EERE)

Wizard Power Pty Ltd Wizard Power Pty Ltd Jump to: navigation, search Name Wizard Power Pty Ltd Place Canberra, Australia Zip ACT 2601 Sector Solar Product Canberra-based company that combines big dish solar energy collection systems with industrial, domestic and agricultural technologies. Coordinates -35.306541°, 149.126556° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-35.306541,"lon":149.126556,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

445

Carnegie Wave Energy Limited | Open Energy Information  

Open Energy Info (EERE)

Carnegie Wave Energy Limited Carnegie Wave Energy Limited Jump to: navigation, search Name Carnegie Wave Energy Limited Address 1 124 Stirling Highway Place North Fremantle Zip 6159 Sector Marine and Hydrokinetic Year founded 1993 Number of employees 25 Website http://www.carnegiewave.com Region Australia LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: CETO La Reunion CETO3 Garden Island Perth Wave Energy Project PWEP This company is involved in the following MHK Technologies: CETO Wave Energy Technology This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=Carnegie_Wave_Energy_Limited&oldid=678263

446

Allco Renewable Energy Group Limited LLC | Open Energy Information  

Open Energy Info (EERE)

Allco Renewable Energy Group Limited LLC Allco Renewable Energy Group Limited LLC Jump to: navigation, search Name Allco Renewable Energy Group Limited, LLC Place New York, New York Zip 10005 Sector Biomass, Solar, Wind energy Product A New York City-based wind, solar, and biomass project developer that no longer has any direct ties to Allco Finance Group of Australia or its subsidiaries. References Allco Renewable Energy Group Limited, LLC[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Allco Renewable Energy Group Limited, LLC is a company located in New York, New York . References ↑ "Allco Renewable Energy Group Limited, LLC" Retrieved from "http://en.openei.org/w/index.php?title=Allco_Renewable_Energy_Group_Limited_LLC&oldid=3420

447

SeaPower Pacific subsidiary of Renewable Energy Holdings Plc Carnegie  

Open Energy Info (EERE)

SeaPower Pacific subsidiary of Renewable Energy Holdings Plc Carnegie SeaPower Pacific subsidiary of Renewable Energy Holdings Plc Carnegie Corporation Ltd Jump to: navigation, search Name SeaPower Pacific subsidiary of Renewable Energy Holdings Plc Carnegie Corporation Ltd Address 1 16 Ord Street PO Box 1902 Place West Perth Zip 6872 Sector Marine and Hydrokinetic Phone number 61 8 9486 4466 Website http://www.carnegiecorp.com.au Region Australia LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: CETO Precommercial Pilot Project This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=SeaPower_Pacific_subsidiary_of_Renewable_Energy_Holdings_Plc_Carnegie_Corporation_Ltd&oldid=67845

448

Oceanlinx | Open Energy Information  

Open Energy Info (EERE)

Oceanlinx Oceanlinx Jump to: navigation, search Name Oceanlinx Address PO Box 116 Place Botany Zip 1455 Sector Marine and Hydrokinetic Phone number 61 (0) 2 9549 6300 Website http://www.oceanlinx.com Region Australia LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: GPP Namibia Greenwave Rhode Island Ocean Wave Energy Project Hawaii Oceanlinx Maui Port Kembla Portland This company is involved in the following MHK Technologies: Denniss Auld Turbine Oceanlinx Mark 3 Wave Energy Converter This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=Oceanlinx&oldid=678407

449

Diamond Energy Pty Ltd | Open Energy Information  

Open Energy Info (EERE)

Diamond Energy Pty Ltd Diamond Energy Pty Ltd Jump to: navigation, search Name Diamond Energy Pty Ltd Place Melbourne, Australia Zip 3124 Product Victoria based clean energy project developer. Coordinates -37.817532°, 144.967148° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-37.817532,"lon":144.967148,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

450

BioPower Systems Pty Ltd | Open Energy Information  

Open Energy Info (EERE)

Systems Pty Ltd Systems Pty Ltd Jump to: navigation, search Name BioPower Systems Pty Ltd Address Suite 145 National Innovation Centre Australian Technology Park Place Eveleigh Zip 1430 Sector Marine and Hydrokinetic Phone number +61 2 9209 4237 Website http://www.biopowersystems.com Region Australia LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: BioSTREAM Pilot Plant bioWAVE Pilot Plant This company is involved in the following MHK Technologies: bioBase bioSTREAM bioWave This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=BioPower_Systems_Pty_Ltd&oldid=678254

451

ActewAGL | Open Energy Information  

Open Energy Info (EERE)

ActewAGL ActewAGL Jump to: navigation, search Name ActewAGL Place Canberra, Australian Capital Territory, Australia Zip 2600 Sector Services Product Utility providing electricity, natural gas, water and wastewater services in the Australian Capital Territory. Coordinates -35.306541°, 149.126556° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-35.306541,"lon":149.126556,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

452

Wind Prospect Ltd | Open Energy Information  

Open Energy Info (EERE)

Solihull, United Kingdom Solihull, United Kingdom Zip B91 2PQ Sector Renewable Energy, Wind energy Product Developer, engineer, operator, and advisor on renewable energy, especially wind projects in the UK, Ireland and Australia. Coordinates 52.415065°, -1.777849° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.415065,"lon":-1.777849,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

453

Mynnydd y Gwynt Defunct | Open Energy Information  

Open Energy Info (EERE)

Mynnydd y Gwynt Defunct Mynnydd y Gwynt Defunct Jump to: navigation, search Name Mynnydd y Gwynt (Defunct) Place Ceredigion, Wales, United Kingdom Zip SY23 1PG Sector Wind energy Product Mynydd y Gwynt Ltd is a company established by a group of local land owners and entrepreneurs to address energy needs through the development of a wind farm. Coordinates 52.2939°, -3.73148° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.2939,"lon":-3.73148,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

454

Anomalous Rainfall over Southwest Western Australia Forced by Indian Ocean Sea Surface Temperatures  

E-Print Network [OSTI]

with observed "dry year" (PDRY) and "wet year" (PWET) signatures are shown to induce precipitation changes and annual rainfall frequency with the distribution becoming skewed toward less (more) rainfall for the PDRY-scale stable precipitation. Convective precipitation actually increases in the PDRY case over SWWA forced

England, Matthew

455

Skill of Direct Solar Radiation Predicted by the ECMWF Global Atmospheric Model over Australia  

Science Journals Connector (OSTI)

Prediction of direct solar radiation is key in sectors such as solar power and agriculture; for instance, it can enable more efficient production of energy from concentrating solar power plants. An assessment of the quality of the direct solar ...

Alberto Troccoli; Jean-Jacques Morcrette

2014-11-01T23:59:59.000Z

456

Footing the bill: the introduction of Medicare Benefits Schedule rebates for podiatry services in Australia  

Science Journals Connector (OSTI)

The introduction of Medicare Benefits Schedule items for allied health professionals in 2004 was a pivotal event in the public funding of non-medical primary care services. This commentary seeks to provide sup...

Anthony J Short

2009-12-01T23:59:59.000Z

457

Carbon Flow within the South West Arm of Port Hacking (N.S.W., Australia)  

Science Journals Connector (OSTI)

In August 1973 some 15 scientists from CSIROs Division of Fisheries and Oceanography, and from several other organizations, began a study aimed at understanding the flow of carbon through various biological and ...

W. Cuff; R. Sinclair; R. R. Parker

1980-01-01T23:59:59.000Z

458

Measuring and mapping the night sky brightness of Perth, Western Australia  

Science Journals Connector (OSTI)

......global affects of non-renewable energy use through the efforts...city light abatement, energy conservation and the...those involved in the mitigation of light pollution as...pollution and the cost of energy mentioned in Section......

James D. Biggs; Tiffany Fouch; Frank Bilki; Marjan G. Zadnik

2012-04-01T23:59:59.000Z

459

Wind Run Changes: The Dominant Factor Affecting Pan Evaporation Trends in Australia  

Science Journals Connector (OSTI)

The Class A pan evaporation rates at many Australian observing stations have reportedly decreased between 1970 and 2002. That pan evaporation rates have decreased at the same time that temperatures have increased has become known as the pan ...

D. P. Rayner

2007-07-01T23:59:59.000Z

460

Early Archean silicate spherules of probable impact origin, South Africa and Western Australia  

Science Journals Connector (OSTI)

...melt droplets formed during meteorite or comet impacts. If so, these spherules are...melt droplets formed during meteorite or comet impacts. If so, these spherules are...valley of Taurus-Littrow (Apollo 17 landing site): Lunar and Planetary Science Conference...

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

E-Print Network 3.0 - artesian basin australia Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences, University of California at Santa Barbara Collection: Geosciences 95 World Shale Gas Resources: An Initial Assessment of 14 Regions Summary: on this and related...

462

XXII ICTAM, 2529 August 2008, Adelaide, Australia EQUILIBRIUM AND STABILITY IN RELAXED MAGNETOHYDRODYNAMICS OF TOROIDAL  

E-Print Network [OSTI]

confinement designs for fusion energy experiments using magnetohydrodynamics (MHD) as a first approximation. Figure 1. Left: A schematic showing the NCSX plasma (red), and the toroidal conductors (green) in which on implementing it. PARTIALLY CONSTRAINED ENERGY MINIMIZATION The variational principle on which we base our

Hudson, Stuart

463

E-Print Network 3.0 - area western australia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on introduced freshwater fishes in Western ... Source: Murdoch University, Centre for Fish and Fisheries Research Collection: Environmental Sciences and Ecology 2 8th...

464

Measuring and mapping the night sky brightness of Perth, Western Australia  

Science Journals Connector (OSTI)

......wasteful and ineffective lighting practices will be reduced...economic and environmental costs continue to rise (Crawford...Characteristics of the street lighting in the general vicinity...societies is the economic cost of light pollution...are linked with several medical disorders including depression......

James D. Biggs; Tiffany Fouch; Frank Bilki; Marjan G. Zadnik

2012-04-01T23:59:59.000Z

465

Niche construction and Dreaming logic: aboriginal patch mosaic burning and varanid lizards (Varanus gouldii) in Australia  

Science Journals Connector (OSTI)

...between invasive species and mid-century removal of Aboriginal niche...water, and moving on to new camps when hunting returns declined...began to burn small fires near camps and along tracks, paths and...from communities and hunting camps and tracks, lightening is still...

2013-01-01T23:59:59.000Z

466

SURVEY OF RESIDENTIAL POWER-FREQUENCY MAGNETIC FIELDS IN MELBOURNE, AUSTRALIA  

Science Journals Connector (OSTI)

......methodology described by Karipidis(9). Instrumentation Magnetic fields were measured using calibrated EMDEX II triaxial meters (Enertech Consultants, CA, USA). The EMDEX meters were calibrated before and after the survey using a Helmholtz coil facility, and......

Ken K Karipidis

2014-04-01T23:59:59.000Z

467

FRPRCS-9 Sydney, Australia Monday 13 Wednesday 15 July 2009 FIBRE REINFORCED POLYMERS STRENGTHS, WEAKNESSES,  

E-Print Network [OSTI]

expensive, polyester because it has too low a modulus, and HMPE because of creep, but all are very. So they are not going to give us expanding rust that bursts the cover and leads to staining

Burgoyne, Chris

468

Timing and dynamics of Late Pleistocene mammal extinctions in southwestern Australia  

Science Journals Connector (OSTI)

...according to unit using standard paleontological...Field JH ( 2006 ) A review of the evidence for a human...sea-level timing from uranium/thorium...region Figure S1. Plan...according to unit using standard paleontological...ZZQQhyS4). Figure S1. Plan view of excavation...

Gavin J. Prideaux; Grant A. Gully; Aidan M. C. Couzens; Linda K. Ayliffe; Nathan R. Jankowski; Zenobia Jacobs; Richard G. Roberts; John C. Hellstrom; Michael K. Gagan; Lindsay M. Hatcher

2010-01-01T23:59:59.000Z

469

High-resolution, unstructured meshes for hydrodynamic models of the Great Barrier Reef, Australia  

E-Print Network [OSTI]

and dynamical features like tidal jets and recirculation eddies in the wake of islands. A new strategy is suggested to refine the mesh in areas of interest taking into account the bathymetric field about 10% of the along-shelf length. The complex topography, the wind, the tides, and the circu- lation

Frey, Pascal

470

Demand response: a strategy to address residential air-conditioning peak load in Australia  

Science Journals Connector (OSTI)

Rapid growth in electricity network peak demand is increasing pressure for new investment which may be used for only a few hours a year. Residential air-conditioning is widely believed to be the prime cause of...

Robert Smith; Ke Meng; Zhaoyang Dong

2013-12-01T23:59:59.000Z

471

Tide Gauge Observations of 20042007 Indian Ocean Tsunamis from Sri Lanka and Western Australia  

Science Journals Connector (OSTI)

Tide gauge data collected from Sri Lanka (three ... the local and regional topography. At all tide gauges, the spectral energy corresponding to periods between 20 and 85...

Charitha B. Pattiaratchi; E. M. Sarath Wijeratne

2009-02-01T23:59:59.000Z

472

Palaeozoic Intraplate Crustal Anatexis in the Mount Painter Province, South Australia  

E-Print Network [OSTI]

-dependent crustal processes including the exploitation of geothermal energy resources. KEY WORDS: geothermal energy

Sandiford, Mike

473

E-Print Network 3.0 - australia exploration significance Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Institute of Technology Collection: Geosciences 36 Published in International Journal of Coal Geology Volume 86, Issue 4, 1 June 2011, Pages 329-341 Summary: the current coal...

474

E-Print Network 3.0 - australia qualitative analysis Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Tucson AZ Collection: Geosciences 15 Published in International Journal of Coal Geology Volume 86, Issue 4, 1 June 2011, Pages 329-341 Summary: and Liu, 2010),...

475

Melting Ice and Tangled Nets: Litigation and Conservation Policy in the US, Australia, and Canada  

E-Print Network [OSTI]

Clem and Clevo Wilson. Ecotourism for the Survival of SeaTisdellandClevoWilson,EcotourismfortheSurvivalof

Shaffer, Robert

2012-01-01T23:59:59.000Z

476

E-Print Network 3.0 - algeria australia austria Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Guinea Guinea Bissau Guyana Haiti Afghanistan Albania Algeria Andorra Romania Russia Rwanda Samoa Source: Alechina, Natasha - School of Computer Science, University of...

477

A bizarre new toothed mysticete (Cetacea) from Australia and the early evolution of baleen whales  

Science Journals Connector (OSTI)

...and 2). The pattern of tooth wear (figure 2 c-e), suggests...presence of heavy shear and apical wear facets on its teeth (which...Hydrurga leptonyx and some extinct marine reptiles (e.g. the pliosauroid...leopard seal and pliosauroid marine reptiles. Janjucetus thus probably...

2006-01-01T23:59:59.000Z

478

Laterite geochemistry applied to diamond exploration in the Yilgarn Craton, Western Australia  

Science Journals Connector (OSTI)

...by testing the 180a im fraction of the B soil horizon for Ni...data (Gozzard Tapley 1994); airborne radiometric and hyperspectral...application due to vegetation, fire scars, landform or regolith characteristics...R.J., ROCKCHEM Dataset Release 3. AGSO's national whole...

Matthias Cornelius; Balbir Singh; Stephan Meyer; Raymond E. Smith; Amanda J. Cornelius

479

Environmental and social impacts of ecotourism: a comparative analysis of assessment procedures between Australia and Mexico.  

E-Print Network [OSTI]

??The challenges facing todays human population in tackling environmental and social issues from a sustainable perspective have substantially increased. Ecotourism, as a sustainable development strategy, (more)

Valencia Korosi, Diego Hernan

2013-01-01T23:59:59.000Z

480

Opportunities for thin film photovoltaics in Building Integrated photovoltaics (BIPV)with a focus on Australia.  

E-Print Network [OSTI]

??Building Integrated Photovoltaic (BIPV) products can not only generate electricity but also provide structural stability, thermal insulation, shading, natural lighting, protection from water and other (more)

Tominaga, Miwa

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Competition for hydrogen in the rumen CSIRO Division of Animal Production, Floreat Park, 6014, Western Australia  

E-Print Network [OSTI]

of increasing Fel was to increase digestible organic matter intake (DOMI) (p and by the International Wool Secretariat. #12;

Paris-Sud XI, Université de

482

The origin of modern crocodyliforms: new evidence from the Cretaceous of Australia  

Science Journals Connector (OSTI)

...proatlas; phal, phalanges; proc cost (vert caud I), costal process...prezyg, prezygopophysis; proc cost, costal process; proc spin...angular; bo, basioccipital; bs, basisphenoid; ch sec, secondary...Braun2003True and false gharials: a nuclear gene phylogeny of Crocodylia...

2006-01-01T23:59:59.000Z

483

Radioactive residues associated with water treatment, use and disposal in Australia.  

E-Print Network [OSTI]

??Water resources are known to contain radioactive materials, either from natural or anthropogenic sources. Treatment, including wastewater treatment, of water for drinking, domestic, agricultural and (more)

Kleinschmidt, Ross Ivan

2011-01-01T23:59:59.000Z

484

The Recent Discovery of Fossil Remains at Lake Callabonna, South Australia1 II  

Science Journals Connector (OSTI)

... was covered by a sea which extended from the Gulf of Carpentaria to the Great Bight, and so divided the continent into an eastern and western moiety. Following this, ... littoral sand-banks marking the successive changes in the contraction of the waters. Within its basin the Pliocene sands and loams have yielded further proof of its lacustrine origin in the ...

1894-06-28T23:59:59.000Z

485

Palaeomagnetism of the Early Permian Mount Leyshon Intrusive Complex and Tuckers Igneous Complex, North Queensland, Australia  

Science Journals Connector (OSTI)

......sequences (Sydney and Gunnedah Basins) has defined a dual-polarity...falls in the Great Australian Bight (H. Theveniaut, private communication...Latites of the southern Sydney Basin (Irving Parry 1963). The...Patonga Claystone of the Sydney Basin (Embleton McDonnell 1981......

D. A. Clark; M. A. Lackie

2003-06-01T23:59:59.000Z

486

Cretaceous Vertical Motion of Australia and the AustralianAntarctic Discordance  

Science Journals Connector (OSTI)

...the Surat Basin and the basins on the eastern margin...the Great Australian Bight (GAB), is characterized...then eroded in the Surat Basin and the basins on the eastern margin...the Great Australian Bight...

Michael Gurnis; R. Dietmar Mller; Louis Moresi

1998-03-06T23:59:59.000Z

487

Palaeomagnetism of the Early Permian Mount Leyshon Intrusive Complex and Tuckers Igneous Complex, North Queensland, Australia  

Science Journals Connector (OSTI)

......timescale produced by the Australian Geological Survey Organization...Sydney and Gunnedah Basins) has defined a dual-polarity...corresponding pole falls in the Great Australian Bight (H. Theveniaut, private...the southern Sydney Basin (Irving Parry 1963......

D. A. Clark; M. A. Lackie

2003-06-01T23:59:59.000Z

488

Cretaceous Vertical Motion of Australia and the AustralianAntarctic Discordance  

Science Journals Connector (OSTI)

...Surat Basin and the basins on the eastern margin...E, south of the Great Australian Bight (GAB), is characterized...eroded in the Surat Basin and the basins on the eastern margin...128E, south of the Great Australian Bight (GAB), is...

Michael Gurnis; R. Dietmar Mller; Louis Moresi

1998-03-06T23:59:59.000Z

489

Organic-walled microfossil assemblages from glacial and interglacial Neoproterozoic units of Australia and Svalbard  

Science Journals Connector (OSTI)

...2011a, 2011b, 2012) and sponges (Maloof et al., 2010; Brain et al., 2012; Fig. 3; Table DR1). The biological affinities...Geology, v. 40, p. 67-70, doi:10.1130/G32535.1. Brain, C.K. ., et al.., 2012, The first animals: ca. 760-million-year-old...

Leigh Anne Riedman; Susannah M. Porter; Galen P. Halverson; Matthew T. Hurtgen; Christopher K. Junium

490

SensorWeb 3.0 Software Release Notes March 27, 2009, Melbourne, Australia  

E-Print Network [OSTI]

, query and control of sensors. 1. Observation and Measurement (O&M) ­ Information model and XML encodings to the O&M information model, from a single sensor or a collection of sensors. It is also used to describe

Melbourne, University of

491

SensorWeb 3.1 Software Release Notes May 11, 2009, Melbourne, Australia  

E-Print Network [OSTI]

, query and control of sensors. 1. Observation and Measurement (O&M) ­ Information model and XML encodings to the O&M information model, from a single sensor or a collection of sensors. It is also used to describe

Buyya, Rajkumar

492

Analysis of resource adequacy constructs in the US and Australia and future paths forward.  

E-Print Network [OSTI]

??Deregulation of the electricity industry has altered the investment landscape for new resources. Multiple resource adequacy constructs are in use today around the world and (more)

Thundiyil, Kevin

2011-01-01T23:59:59.000Z

493

Timing and dynamics of Late Pleistocene mammal extinctions in southwestern Australia  

Science Journals Connector (OSTI)

...S Field JH ( 2006 ) A review of the evidence for...Cave region Figure S1. Plan view...according to unit using standard paleontological...missed during the original mining operation. Following...ZZQQhyS4). Figure S1. Plan view of excavation area...

Gavin J. Prideaux; Grant A. Gully; Aidan M. C. Couzens; Linda K. Ayliffe; Nathan R. Jankowski; Zenobia Jacobs; Richard G. Roberts; John C. Hellstrom; Michael K. Gagan; Lindsay M. Hatcher

2010-01-01T23:59:59.000Z

494

Status of Power Generation by Domestic Scale Wind Turbines in Australia  

Science Journals Connector (OSTI)

The world's fossil fuel energy resources are diminishing at a faster rate and most importantly the liquid fossil fuel is expected to be finished by 2060s. Moreover, the fossil fuel is directly related to air pollution, land and water degradation. The danger of climate change due to global warming caused by greenhouse gas emissions compels the policy makers, scientists and researchers globally to explore power generation from renewable sources such as wind. Despite significant progresses have been made in power generation using large scale wind turbines recently, domestic scale wind turbines that have immense potentials for standalone power generation are not explored and adequately researched. Therefore, the primary objective of this study is to review and analyse the potentials for power generation by domestic scale wind turbines for the residential and semi-commercial applications. The study reviews the current status of wind characteristics in built-up areas, economic feasibility, aerodynamic and technological limits, local government planning requirement, local and foreign small scale wind turbine manufacturers.

Firoz Alam; Abdulkadir Ali; Iftekhar Khan; Saleh Mobin

2012-01-01T23:59:59.000Z

495

AFFILIATIONS: EBERT--Bureau of Meteorology Research Centre, Melbourne, Australia; JANOWIAK--NOAA/Climate  

E-Print Network [OSTI]

--NOAA/Climate Prediction Center, Camp Springs, Maryland; KIDD--School of Geography, Earth, and Environmental Sciences, but also to a wide range of decision makers, including hydrologists, agriculturalists, emergency managers and the distribution of the Earth's latent heating, which has direct effects on the planetary circulation

Ebert, Beth

496

APFIS Dec 2013 Asia-Pacific Conference on FRP in Structures Melbourne -Australia  

E-Print Network [OSTI]

foam insulation, as the main shear transfer mechanism for precast concrete sandwich panels flow strength of the CGRID/foam insulation material mechanism, including the type of rigid insulating foam, the spacing between rows of CFRP grids, and the thickness of the foam insulation. A comprehensive

497

"Migrating with Dignity": A Study of the Kiribati-Australia Nursing Initiative (KANI)  

E-Print Network [OSTI]

Due to the effects of extreme climate change and overcrowding, it has been predicted that the Republic of Kiribati, a small island nation in the Pacific, could become completely uninhabitable by 2050. With the country's long-term sustainability...

O'Brien, Lara

2013-12-31T23:59:59.000Z

498

Loss of Cherished Places -- Place Character and Climate Change along Australia's Great Ocean Road  

E-Print Network [OSTI]

to be submerged by sea level rise. Right: The old pier atstorm surges. Right: Sea level rise is likely to submergeelevation as the sea level rises. The appropriate- ness of

Green, Ray

2008-01-01T23:59:59.000Z

499

Globalizations culture consequences of MBA education across Australia and Singapore: sophistry or truth?  

Science Journals Connector (OSTI)

In view of the dominance of Western (Anglo-Saxon) theories on management and leadership, the vital questions confronting educators and managers is whether espoused Western-based management theories (including pri...

Jonathan Wee Pin GOH

2009-08-01T23:59:59.000Z

500

Measuring and mapping the night sky brightness of Perth, Western Australia  

Science Journals Connector (OSTI)

......affects of non-renewable energy use through the...and environmental costs continue to rise...estimate that the energy used to create light pollution cost Japan 20 billion...pollution and the cost of energy mentioned in Section......

James D. Biggs; Tiffany Fouch; Frank Bilki; Marjan G. Zadnik

2012-04-01T23:59:59.000Z