Powered by Deep Web Technologies
Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

New South Wales New South Wales  

E-Print Network [OSTI]

; ¡ ¦ ¥ ¥© £ ¡ £ §£ ¡ ¢¢ © £ § ¦ £© ¤§ ¢ ¥ ¢ ¥ ¥ ¢ Western Australia Northern Territory South Australia Queensland New South Wales Victoria Tasmania; ¡ ¦ ¥ ¥© £ ¡ £ §£ ¡ ¢¢ © £ § ¦ £© ¤§ ¢ ¥ ¢ ¥ ¥ ¢ Western Australia Northern Territory South Australia Queensland New South Wales Victoria Tasmania 7

Rossi, Francesca

2

Tips on Studying Abroad at the University of New South Wales (Semester Program) in Australia  

E-Print Network [OSTI]

Tips on Studying Abroad at the University of New South Wales (Semester Program) in Australia Want have the inside scoop on their host institution and host country. · Australia looked exciting, plus even had to approve some while I was in Australia and it was no problem at all. · UNSW's Study Abroad

Li, Mo

3

Description and crystal structure of nyholmite, a new mineral related to hureaulite, from Broken Hill, New South Wales, Australia  

SciTech Connect (OSTI)

Nyholmite, Cd{sub 3}Zn{sub 2}(AsO{sub 3}OH){sub 2}(AsO{sub 4}){sub 2} {center_dot} 4H{sub 2}O, from the Block 14 Opencut, Broken Hill, New South Wales, Australia, is a new Cd-Zn arsenate species, isostructural with the minerals of the hureaulite group. The mineral occurs in a quartz-garnet-arsenopyrite matrix as white globules, tufted aggregates of fibrous crystals and radiating hemispheres of thin, colourless, bladed crystals. Associated minerals are goldquarryite, lavendulan-sampleite, scorodite-strengite and gypsum. Individual crystals are up to 0.2 mm in length and 0.05 mm across. The mineral is transparent to translucent with a vitreous lustre. It is brittle with an uneven fracture and a white streak. The Mohs hardness is 3-3.5 and the calculated density is 4.23 g cm{sup -3} for the empirical formula. Electron microprobe analyses yielded CdO 34.58, ZnO 9.72, MnO 3.59, CuO 3.39, Al{sub 2}O{sub 3} 0.20, CaO 0.16, PbO 0.37, As{sub 2}O{sub 5} 34.55, P{sub 2}O{sub 5} 6.29 totalling 92.85 wt.%. The empirical formula, based on 20 oxygen atoms, is Ca{sub 0.03}Pb{sub 0.02} Cd{sub 2.80}Al{sub 0.04}Zn{sub 1.24}-Cu{sub 0.44}Mn{sub 0.53}[(AsO{sub 4}){sub 3.13}(PO{sub 4}){sub 0.92}]{Sigma}{sub 4.05}H{sub 1.91} {center_dot} 3.79H{sub 2}O. Nyholmite is monoclinic, C2/c, a = 18.062(4) {angstrom}, b = 9.341(2) {angstrom}, c = 9.844(2) {angstrom}, {beta} = 96.17(3){sup o}, V = 1651.2(6) {angstrom}{sup 3} (single-crystal data, at 123 K). The six strongest lines in the X-ray powder diffraction pattern are [d({angstrom}),I,(hkl)]: 8.985,30,(200); 8.283, 85,(110); 6.169,25,(111); 4.878,25,(002); 3.234,100,(222, 420); 3.079,65,(222, 511); 2.976,45,(113). The crystal structure was solved by Patterson methods and refined using 2045 observed reflections to R1(F) = 3.73%. The structure is characterized by a kinked, five-membered chain of edge-sharing M{phi}{sub 6} ({phi} = unspecified anion) octahedra, or pentamer, that extends in the a direction. The pentamers link by sharing corners to form a sheet in the (001) plane. Pentamers are also linked, via corner-sharing, by (As,P)O{sub 4} groups forming thick slabs in the (001) plane. The slabs link in the c direction by cornersharing between octahedra and tetrahedra to form a dense heteropolyhedral framework. Moderate to weak hydrogen-bonding provides additional linkage between the slabs.

Elliott, P.; Turner, P.; Jensen, P.; Kolitsch, U.; Pring, A.; (Naturhistorisches Museum, Austria); (SA Museum); (Adelaide); (Sydney)

2010-08-12T23:59:59.000Z

4

New species of Mycosphaerella from Myrtaceae in plantations and native forests in eastern Australia  

E-Print Network [OSTI]

New species of Mycosphaerella from Myrtaceae in plantations and native forests in eastern Australia, New South Wales 2119, Australia Treena I. Burgess School of Biological Sciences and Biotechnology, Murdoch University, Perth, WA 6150, Australia Vyrna Beilharz Primary Industries Research Victoria

5

University of Newcastle Newcastle, Australia  

E-Print Network [OSTI]

on a breathtaking stretch of Australia's eastern coastline. The city of Newcastle is located in New South Wales strengths lie in the areas of health, energy and the environment, as well as science and engineering Communication Computer Science Construction Management (Building) Design (Architecture) Engineering (Chemical

Duchowski, Andrew T.

6

POLITICAL SCIENCE Waleed Mebane  

E-Print Network [OSTI]

central european university POLITICAL SCIENCE #12;Waleed Mebane country of origin: united states to CEU based on other places I considered. I also noted that the Department of Political Science and that was something that impressed me. I like that Budapest, although a vibrant and politically and culturally

Takada, Shoji

7

Conservation Plan for Red Squirrels in Wales  

E-Print Network [OSTI]

#12;Conservation Plan for Red Squirrels in Wales Meeting the challenge to keep reds in Wales to enable effective red squir- rel conservation and grey squirrel management in Wales. The Wales Squirrel squirrel conservation and grey squirrel management in Wales. The Forum and Partnership are currently

8

AustrAliA's innovAtive universities in AsiA  

E-Print Network [OSTI]

AustrAliA's innovAtive universities in AsiA #12;­ established 1974 as Darwin Community College 2003 ­ established 1971 ­ established 1965 ­ established 1964 ` Western Australia Queensland New South Wales Victoria South Australia Tasmania · · · · · · · Nhulunbuy Jabiru Darwin (Casuarina) Palmerston

9

Contrasting Regional Responses to Increasing Leaf-Level Atmospheric Carbon Dioxide over Australia  

E-Print Network [OSTI]

Contrasting Regional Responses to Increasing Leaf-Level Atmospheric Carbon Dioxide over Australia, New South Wales, Australia JOHN L. MCGREGOR Centre for Australian Weather and Climate Research, and CSIRO Marine and Atmospheric Research, Aspendale, Victoria, Australia JASON P. EVANS Climate Change

Evans, Jason

10

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

11

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

12

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

22

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

23

Interannual Rainfall Extremes over Southwest Western Australia Linked to Indian Ocean Climate Variability  

E-Print Network [OSTI]

Interannual Rainfall Extremes over Southwest Western Australia Linked to Indian Ocean Climate and Prediction, School of Mathematics, University of New South Wales, Sydney, Australia (Manuscript received 15 December 2004, in final form 24 August 2005) ABSTRACT Interannual rainfall extremes over southwest Western

Ummenhofer, Caroline C.

24

New South Wales, Australia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN) | OpenInc Jump to:JumpNew Result

25

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

26

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

27

Plant Pathology (2009) 58, 642654 Doi: 10.1111/j.1365-3059.2009.02087.x 2009 Dept of Primary Industries & Fisheries, State of Queensland, Australia  

E-Print Network [OSTI]

Industries & Fisheries, State of Queensland, Australia 642 Journal compilation © 2009 BSPP Blackwell Department of Primary Industries, New South Wales 2119, Australia; and d Forestry and Agriculture plantations to meet consumer demands. The hardwood plantation area has expanded rapidly in Australia in recent

28

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

29

Wilson Wong The University of Western Australia, Australia  

E-Print Network [OSTI]

Wilson Wong The University of Western Australia, Australia Wei Liu The University of Western Australia, Australia Mohammed Bennamoun The University of Western Australia, Australia Ontology Learning

Hammerton, James

30

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

31

Natural Resources Wales Standard Terms and Conditions for Services  

E-Print Network [OSTI]

Natural Resources Wales Standard Terms and Conditions for Services Date: April 2013 Page 1 These Conditions may only be varied with the written agreement of Natural Resources Wales. No terms or conditions Natural Resources Wales and the Supplier/Contractor incorporating these Conditions; Environmental Law

32

Applying Scaled Vegetation Greenness Metrics to Constrain Simulated Transpiration Anomalies: A Study over Australia*  

E-Print Network [OSTI]

, Climate Change Research Centre, Level 4 Mathews Building, University of New South Wales, Sydney NSW 2052: A Study over Australia* MARK DECKER, ANDY J. PITMAN, AND JASON EVANS Climate Change Research CentreApplying Scaled Vegetation Greenness Metrics to Constrain Simulated Transpiration Anomalies

Evans, Jason

33

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

34

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

35

Commonwealth of Australia (Geoscience Australia) 2013 Embedding Data Stewardship in Geoscience Australia  

E-Print Network [OSTI]

© Commonwealth of Australia (Geoscience Australia) 2013 Embedding Data Stewardship in Geoscience Australia Geoscience AustraliaIrina Bastrakova, Sue Fyfe For Further Information: Irina Bastrakova Email Steps Toward Implementing Stewardship: the Theory Implementation Timeline Geoscience Australia (GA) Data

Wright, Dawn Jeannine

36

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

37

Stocrestr Cymru o Goed Trefol Wales Inventory of Urban Trees  

E-Print Network [OSTI]

Stocrestr Cymru o Goed Trefol Wales Inventory of Urban Trees #12;31/01/20132 Wales Inventory Inventory of Urban Trees To improve our understanding of distribution and canopy cover of urban trees and woodlands Provide a base-line to monitor change over time Intention is that inventory will also be of use

38

Wales, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformationSEDS data JumpWakulla County, Florida: EnergyWaldoWales is a town

39

Wales, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformationSEDS data JumpWakulla County, Florida: EnergyWaldoWales is aThis

40

Wales Wind Energy Project | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City,Division of OilGuyane8031909°,Wales Wind Energy

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

42

Postgraduate Programs 2014 Australia's  

E-Print Network [OSTI]

Guide to Postgraduate Programs 2014 #12;Studyin Adelaide Australia's educationcity #12;Photo courtesy of Shane Reid 1 #12;Contents 1. Why the University of South Australia is right for you.................................................................................. 85-88 Once again the University of South Australia has been given a 5 star rating for Excellence

Li, Jiuyong "John"

43

Australia NO REGISTRATION NUMBER  

E-Print Network [OSTI]

#12;#12;Australia Austria Belgium Cyprus France Germany Greece Ireland Italy Japan Macedonia Portugal Romania Slovenia Spain Turkey UK USA Australia Austria Belgium Cyprus France Germany Greece Australia 2 2 Austria 1 3 Belgium 1 4 Cyprus 1 5 France 3 6 Germany 1 7 Greece 5 8 Ireland 1 9 Italy 15

44

SUNY Programs: Australia and  

E-Print Network [OSTI]

SUNY Programs: Australia and New Zealand Semester, Academic Year and Short Term #12;1 Table of Contents How to Use this Booklet 1 Choosing a Program in Australia and New Zealand 2 Exchange vs. Study in New Zealand 13 Short-term Programs in Australia and New Zealand 15 Contact Information for other SUNY

Suzuki, Masatsugu

45

Australia and New Zealand Coordinating Lead Authors  

E-Print Network [OSTI]

11 Australia and New Zealand Coordinating Lead Authors: Kevin Hennessy (Australia), Blair Fitzharris (New Zealand) Lead Authors: Bryson C. Bates (Australia), Nick Harvey (Australia), Mark Howden (Australia), Lesley Hughes (Australia), Jim Salinger (New Zealand), Richard Warrick (New Zealand

Green, Donna

46

England and Wales -A Competitive Electricity Richard Green  

E-Print Network [OSTI]

PWP-060 England and Wales - A Competitive Electricity Market? Richard Green September 1998 Electricity Market? Richard Green * Department of Applied Economics, University of Cambridge Department, 1998 The British sometimes exaggerate their own importance. For example, we claim that the electricity

California at Berkeley. University of

47

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

48

Does Australia Have a Constitution?  

E-Print Network [OSTI]

Parliament to legislate for Australia and limited appealsyears. See A.D. Watts, The Australia Act 1986, 36 INT'L &338, 353 (Austl. ). DOES AUSTRALIA HAVE A CONSTITUTION?

Mayer, Kenneth R.; Schweber, Howard H.

2008-01-01T23:59:59.000Z

49

Natural Resources Wales Standard Terms and Conditions for Goods (and related Services)  

E-Print Network [OSTI]

Natural Resources Wales Standard Terms and Conditions for Goods (and related Services) Date: April 2013 Page 1 These Conditions may only be varied with the written agreement of Natural Resources Wales/Services are being performed; Contract - the contract between Natural Resources Wales and the Supplier

50

MURDOCH UNIVERSITY PERTH, WESTERN AUSTRALIA  

E-Print Network [OSTI]

MURDOCH UNIVERSITY PERTH, WESTERN AUSTRALIA INAUGRATION CEREMONY 17TH SEPTEMBER, 1974 #12;ORDER Murdoch University, the second university to be established in Western Australia, and the eighteenth in Australia, was constituted 25 July 1973 by an Act of the Parliament of Western Australia. The initial

51

Forestry Commission Wales Guidance on rental levels for Hydro Power  

E-Print Network [OSTI]

initiated a process to facilitate the development of small- scale hydro-electricity schemes on land ownedForestry Commission Wales Guidance on rental levels for Hydro Power Guidance on rental levels for hydro power projects Tel: 02920 475961 Email: hydrowales@forestry.gsi.gov.uk Version 1.0 Mike Pitcher 17

52

Helping the people of Wales make more of their woodlands  

E-Print Network [OSTI]

to consider how to ensure as many people as possible across your community will know about it and haveHelping the people of Wales make more of their woodlands Woodlands and You PROJECTS, EVENTS communities in many ways ­ they can be used for training and enterprise ventures, health and well

53

KINSHIP, MARRIAGE AND AGE IN ABORIGINAL AUSTRALIA  

E-Print Network [OSTI]

Three tribes of Western Australia. Journal of the RoyalArnhem Land and Western Australia. Analytical methodsthe Kariera of Western Australia, the Wanindiljaugwa of

Denham, Woodrow

2012-01-01T23:59:59.000Z

54

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

55

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

56

Commonwealth of Australia STATUTORY DECLARATION  

E-Print Network [OSTI]

Commonwealth of Australia STATUTORY DECLARATION Statutory Declarations Act 1959 1 Insert the name or Territory, or the High Court of Australia, as a legal practitioner (however described); or (3) a person who or place outside Australia; and (b) authorised under paragraph 3 (d) of the Consular Fees Act 1955; and (c

Chen, Ying

57

ARGENTINA (11) AUSTRALIA (158)  

E-Print Network [OSTI]

ARGENTINA (11) AUSTRALIA (158) BRAZIL (7) CANADA (100) CHILE (8) CHINA (11) COSTA RICA (0) ECUADOR) European Union (36) Netherlands (18) Argentina (11) China (11) Chile (8) New Zealand (9) Norway (7) Brazil MAURITIUS A U S T R A L I A NORWAY U.K. IRELAND SPAIN ARGENTINA CHILE NEW ZEALAND GERMANY FRANCE PACIFIC

Riser, Stephen C.

58

North Wales, Pennsylvania: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(Utility Company) JumpNorth Haven, Maine:Ohio:Pole,NorthNorthWales, Pennsylvania:

59

Geothermal development in Australia  

SciTech Connect (OSTI)

In Australia, natural hot springs and hot artesian bores have been developed for recreational and therapeutic purposes. A district heating system at Portland, in the Otway Basin of western Victoria, has provided uninterrupted service for 12 Sears without significant problems, is servicing a building area of 18 990 m{sup 2}, and has prospects of expansion to manufacturing uses. A geothermal well has provided hot water for paper manufacture at Traralgon, in the Gippsland Basin of eastern Victoria. Power production from hot water aquifers was tested at Mulka in South Australia, and is undergoing a four-year production trial at Birdsville in Queensland. An important Hot Dry Rock resource has been confirmed in the Cooper Basin. It has been proposed to build an HDR experimental facility to test power production from deep conductive resources in the Sydney Basin near Muswellbrook.

Burns, K.L. [Los Alamos National Lab., NM (United States); Creelman, R.A. [Creelman (R.A.) and Associates, Sydney, NSW (Australia); Buckingham, N.W. [Glenelg Shire Council, Portland, VIC (Australia); Harrington, H.J. [Australian National Univ., Canberra, ACT (Australia)]|[Sydney Univ., NSW (Australia)

1995-03-01T23:59:59.000Z

60

Should Australia Copy U.S. Employee Relations Practices?  

E-Print Network [OSTI]

SHOULD AUSTRALIA COPY U.S. EMPLOYEERELATIONS PRACTICES? As Australia debates the possibility ofterm contracts. Given Australia’s history and traditions I

Strauss, George

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

> BUREAU HOME > AUSTRALIA > QUEENSLAND > FORECASTS MARINE SERVICE  

E-Print Network [OSTI]

> BUREAU HOME > AUSTRALIA > QUEENSLAND > FORECASTS MARINE SERVICE IMPROVEMENTS FOR QUEENSLAND across Australia. FURTHER INFORMATION: www.bom.gov.au/NexGenFWS © Commonwealth of Australia, 2013 From © Copyright Commonwealth of Australia 2013, Bureau of Meteorology Queensland Australia Coastal Waters Zones

Greenslade, Diana

62

Grey seal distribution and abundance in North Wales, 2002-2003  

E-Print Network [OSTI]

i Grey seal distribution and abundance in North Wales, 2002-2003 Westcott, S.M. & Stringell, T.B. Stringell Title: "Grey seal distribution and abundance in North Wales, 2002-2003" Authors: Westcott, S Library x1 C. Duck, SMRU x1 Joe Breen EHS x1 PML, Library, Plymouth x1 S. Westcott x5 M. Baines x1 S

Bearhop, Stuart

63

Grey seal pup production for North Wales, Westcott, S.M. & Stringell, T.B.  

E-Print Network [OSTI]

Grey seal pup production for North Wales, 2002 Westcott, S.M. & Stringell, T.B. Marine Monitoring.B. Stringell Title: "Grey seal pup production for North Wales, 2002" Authors: Westcott, S.M. & Stringell, T S. Westcott x5 M. Baines x1 S. Stansfield, Bardsey Bird Observatory x1 A. Moralee, RSPB South Stack

Bearhop, Stuart

64

Stone-Wales defects in graphene and other planar sp2 -bonded materials  

E-Print Network [OSTI]

Stone-Wales defects in graphene and other planar sp2 -bonded materials Jie Ma,1,2,3 Dario Alfè,2 that the structure of the Stone-Wales SW defect in graphene is more complex than hitherto appreciated. Rather than of graphene and in so doing modify its chemical re- activity toward adsorbates, and likely impact upon its

Alfè, Dario

65

Wales, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformationSEDS data JumpWakulla County, Florida: EnergyWaldoWales is a

66

Continuous Forcing Data, Darwin, Australia  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

Long term, large scale continuous forcing data set for three complete wet seasons (2004-2005, 2005-2006 and 2006-2007) in Darwin, Australia.

Jakob, Christian

67

KINSHIP, MARRIAGE AND AGE IN ABORIGINAL AUSTRALIA  

E-Print Network [OSTI]

patterns in Aboriginal Australia: a gradient analysis ofStudies, Canberra, ACT, Australia. Denham, W.W. 2001.1988. The Tiwi of North Australia, 3rd ed. New York: Holt,

Denham, Woodrow

2012-01-01T23:59:59.000Z

68

Innovative Research Universities Australia Response to  

E-Print Network [OSTI]

Innovative Research Universities Australia Response to DEST Knowledge Transfer Project Developing Introduction This response builds on the IRU Australia's earlier discussion paper The Third Mission Australia and overseas, this paper contends that engagement1 activity between universities

69

Guide to environmental accounting in Australia  

E-Print Network [OSTI]

Guide to environmental accounting in Australia Contributing to the Australian Government National Plan for Environmental Information initiative #12;Guide to environmental accounting in Australia Library of Australia Cataloguing-in-Publication entry: Title: Guide to environmental accounting

Greenslade, Diana

70

Failure of maximum likelihood methods for chaotic dynamical systems School of Mathematics and Statistics, University of Western Australia, Perth, Australia  

E-Print Network [OSTI]

of Mathematics and Statistics, University of Western Australia, Perth, Australia Received 23 June 2006; revised

Judd, Kevin

71

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

72

St John Ambulance Australia Research Scholarships St John Ambulance Australia ("St John") is Australia's leading provider of first aid training,  

E-Print Network [OSTI]

of first aid kits and equipment. St John runs the ambulance services in Western Australia and the NorthernSt John Ambulance Australia Research Scholarships St John Ambulance Australia ("St John") is Australia's leading provider of first aid training, first aid services at public events and supplier

73

Journal: Sunita Gupta: Australia July 5, 2007  

E-Print Network [OSTI]

Journal: Sunita Gupta: Australia July 5, 2007 This last week in Australia, I am going to the Gold French roommate and some people from Melbourne. The great thing about Australia is that so many people are genuinely friendly, and because of the low crime rate, I feel safe here. I've had a great time in Australia

Farritor, Shane

74

Welcome to the University of South Australia  

E-Print Network [OSTI]

Welcome to the University of South Australia #12;Who we are The University of South Australia is the largest university in South Australia, with over 35,000 students, 2,500 staff and five campuses (four a significant contributor to South Australia's economic growth and prosperity. Our University The University

Li, Jiuyong "John"

75

The wholesale market for electricity in England and Wales : recent developments and future reforms  

E-Print Network [OSTI]

The England and Wales wholesale electricity market is about to undergo major reform (NETA). I describe and analyse the proposed arrangements, contrasting them with those currently in operation. I argue that while NETA will ...

Sweeting, Andrew

2000-01-01T23:59:59.000Z

76

Market power in the England and Wales wholesale electricity [market, 1995-2000  

E-Print Network [OSTI]

This paper shows that generators exercised increasing market power in the England and Wales wholesale electricity market in the second half of the 1990s despite declining market concentration. It examines whether this was ...

Sweeting, Andrew

2004-01-01T23:59:59.000Z

77

Market Power in the England and Wales Wholesale Electricity Market 1995-2000  

E-Print Network [OSTI]

This paper shows that generators exercised increasing market power in the England and Wales wholesale electricity market in the second half of the 1990s despite declining market concentration. It examines whether this was consistent with static, non...

Sweeting, Andrew

2006-03-14T23:59:59.000Z

78

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

79

Conservation Management of Historic Road Reserves in Australia  

E-Print Network [OSTI]

s land. Kilmore, Victoria, Australia: Lowden. Jeans, D. N.The long paddock : Australia’s travelling stock routes.and its development in Australia: 1788-1938 (Pt 1 & 2).

Spooner, Peter

2007-01-01T23:59:59.000Z

80

(formerly known as the Autism Council of Australia) The Prevalence of Autism in Australia  

E-Print Network [OSTI]

(formerly known as the Autism Council of Australia) The Prevalence of Autism in Australia Can in Australia An Overview of the Report commissioned by the Australian Advisory Board on Autism Spectrum [formerly the Autism Council of Australia] with funding from the Commonwealth Department of Family

Peters, Richard

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

> BUREAU HOME > AUSTRALIA > QUEENSLAND > FORECASTS DISTRICT FORECASTS  

E-Print Network [OSTI]

> BUREAU HOME > AUSTRALIA > QUEENSLAND > FORECASTS DISTRICT FORECASTS IMPROVEMENTS FOR QUEENSLAND across Australia From October 2013, new and improved district forecasts will be introduced in Queensland Protection times FURTHER INFORMATION : www.bom.gov.au/NexGenFWS © Commonwealth of Australia, 2013 PTO> Wind

Greenslade, Diana

82

Engagement with Australia Active Partnership Agreements  

E-Print Network [OSTI]

Engagement with Australia Active Partnership Agreements: Expired Partnership Agreements: University of Southern Queensland University of Queensland University of Western Australia University of Western Sydney&M University 58 Texas A&M University students studying in Australia Internship ­ 1 Research ­ 1 Short Term

Behmer, Spencer T.

83

AIRBORNE RESEARCH AUSTRALIA Annual Report 2004  

E-Print Network [OSTI]

AIRBORNE RESEARCH AUSTRALIA Annual Report 2004 http://www.AirborneResearch.org.au #12;Annual Report 2004 Airborne Research Australia - MNRF The images on the front cover show: Top: Mosaic of aerial images of the `Hector' thunderstorm over the Tiwi Islands (to the north of Darwin/Australia) taken from

84

> BUREAU HOME > AUSTRALIA > QUEENSLAND > FORECASTS FORECAST IMPROVEMENTS  

E-Print Network [OSTI]

> BUREAU HOME > AUSTRALIA > QUEENSLAND > FORECASTS BRISBANE FORECAST IMPROVEMENTS The Bureau of Meteorology is progressively upgrading its forecast system to provide more detailed forecasts across Australia and Sunshine Coast. FURTHER INFORMATION : www.bom.gov.au/NexGenFWS © Commonwealth of Australia, 2013 Links

Greenslade, Diana

85

UNDEREMPLOYMENT AMONG MATURE AGE WORKERS IN AUSTRALIA  

E-Print Network [OSTI]

1 UNDEREMPLOYMENT AMONG MATURE AGE WORKERS IN AUSTRALIA * Jinjing Li1 , Alan Duncan2 and Riyana Miranti1 1 NATSEM, University of Canberra, Australia 2 Bankwest Curtin Economics Centre, Curtin University of underemployment for mature aged workers in Australia, and seeks in particular to determine the principal factors

86

Rural Australia Providing Climate Solutions  

E-Print Network [OSTI]

in three important areas of Australia's low carbon future: providing clean energy and electricity on private land. The paper presents the best available information on the potential supply of each electricity target, such as a renewable energy target of 25% by 2020 appears challenging but feasible

Queensland, University of

87

The Dynamics of Irrigated Perennial Crop Production With Applications to the Murray-Darling Basin of Australia  

E-Print Network [OSTI]

in South Australia . . . . . . . . . . . . . . . . . . .Diversions for South Australia under alternate waterWater efficiency in South Australia’s vineyards,” http://

Franklin, Bradley

2013-01-01T23:59:59.000Z

88

Topological description of the Stone-Wales defect formation energy in carbon nanotubes and graphene  

E-Print Network [OSTI]

Topological description of the Stone-Wales defect formation energy in carbon nanotubes and graphene,10,12,16,18,26 The reported values for SW defect formation energies both in carbon nanotubes and graphene8 energies depend largely on the nanotube radius, the orientation of the dislocation dipole, and, to a lesser

Daw, Murray S.

89

Response to WAG Consultation on the Alternative Transport Fuels in Wales Action Plan  

E-Print Network [OSTI]

Response to WAG Consultation on the Alternative Transport Fuels in Wales Action Plan Centre of alternative transport fuels in its own policy documents, notably the Sustainable Development Action Plan 2004, the EU Commission has proposed a binding target of 10% for biofuels for vehicle fuel by 2020. While

Martin, Ralph R.

90

Populations of North American bean thrips, Caliothrips fasciatus (Pergande) (Thysanoptera : Thripidae : Panchaetothripinae) not detected in Australia  

E-Print Network [OSTI]

Vic. , Victoria; WA, Western Australia. Journal compilationSouth Australia and Western Australia to determine whetherGordon) at Perth (Western Australia) Domestic Airport, and

Hoddle, M S; Stosic, C D; Mound, L A

2006-01-01T23:59:59.000Z

91

DESALINATION IN AUSTRALIA: THE FACTS By NCEDA CEO Neil Palmer  

E-Print Network [OSTI]

of Western Australia studies of the Kwinana plant in Cockburn Sound. Australia's desal plants continue in Western Australia, and Adelaide's water in South Australia will be supplied by desalination as their newDESALINATION IN AUSTRALIA: THE FACTS By NCEDA CEO Neil Palmer Desalination has an increasingly

92

Australia HEU Removal | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Australia HEU Removal | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the...

93

Electricity Generation from Geothermal Energy in Australia.  

E-Print Network [OSTI]

?? This thesis aims to investigate the economical and technical prerequisites for electricity generation from geothermal energy in Australia. The Australian government has increased the… (more)

Broliden, Caroline

2013-01-01T23:59:59.000Z

94

Australia'smostendangered A team of eminent ecologists from Innovative Research Universities across Australia  

E-Print Network [OSTI]

Protecting Australia'smostendangered landscapes A team of eminent ecologists from Innovative Research Universities across Australia has identified the environments in our continent at greatest risk of catastrophic change ­ and what we can do to save them. #12;Protecting Australia's most endangered landscapes 1

95

HYDROLOGICAL IMPACTS OF CLIMATE CHANGE ON INFLOWS TO PERTH, AUSTRALIA  

E-Print Network [OSTI]

HYDROLOGICAL IMPACTS OF CLIMATE CHANGE ON INFLOWS TO PERTH, AUSTRALIA JASON EVANS1 and SERGEI SCHREIDER2 1Centre for Resource and Environmental Studies, Australian National University, Australia 2Integrated Catchment Assessment and Management Centre, Australian National University, Australia Abstract

Evans, Jason

96

The effect of falling market concentration on prices, generator behaviour and productive efficiency in the England and Wales electricity market  

E-Print Network [OSTI]

A universal prediction of the various oligopoly models used to predict and explain behaviour in the England and Wales (E&W) electricity wholesale market is that divestiture of plants by the two large incumbent generators ...

Sweeting, Andrew

2001-01-01T23:59:59.000Z

97

Favorable conditions noted for Australia shale oil  

SciTech Connect (OSTI)

After brief descriptions of the Rundle, Condor, and Stuart/Kerosene Creek oil shale projects in Queensland, the competitive advantages of oil shale development and the state and federal governments' attitudes towards an oil shale industry in Australia are discussed. It is concluded that Australia is the ideal country in which to start an oil shale industry.

Not Available

1986-09-01T23:59:59.000Z

98

Northwest Australia's Saladin crude assayed  

SciTech Connect (OSTI)

High-quality Saladin crude oil from offshore Western Australia has been assayed. The 48.2[degree] API, 0.02 wt % sulfur crude's characteristics--determined in 1990--are presented here for the first time. The estimated 30--40 million bbl field, south of Barrow Island, is produced from two platforms in 58 ft of water in block TP 3. Production began in late 1989 from three platforms with three wells each and from two wells drilled directionally from Thevenard Island. The paper lists data on the following properties: API gravity, density, sulfur content, pour point, flash point, viscosity, salinity, heat of combustion, ash content, asphaltene content, wax content, and metal content for the whole crude and various fractions.

Rhodes, A.K.

1993-10-18T23:59:59.000Z

99

Visions and Revisions: Gerald of Wales, Authorship, and the Construction of Political, Religious, and Legal Geographies in Twelfth and Thirteenth Century Britain  

E-Print Network [OSTI]

reality it is only the umbra and figura of the authentic,ed. James, 59. and Wales’s umbrae and figurae, concrete,

Sargent, Amelia

2011-01-01T23:59:59.000Z

100

Heroin Users in Australia: Population Trends C. Yalin Kaya1  

E-Print Network [OSTI]

Heroin Users in Australia: Population Trends C. Yalçin Kaya1 , Yuliya Tugai2 , Jerzy A. Filar3 Australia (UniSA), Mawson Lakes, S. A. 5095 Australia. Contact E-mail: yalcin.kaya@unisa.edu.au . 2 Research Australia (DASC, SA). 6 Manager, Evidence-Based Practice Unit, DASC, SA. 7 Senior Evaluation Officer, DASC

Kaya, Yalcin

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

The Sandalwood Industry In Australia: A History1  

E-Print Network [OSTI]

The Sandalwood Industry In Australia: A History1 Pamela Statham2 Abstract: From its inception in Australia's economic development. The history of the industry falls into three major stages: first. Australia, basically a nonuser, has thus become one of the principal suppliers. Australia has several native

Standiford, Richard B.

102

2013 Team UniSA-Australia World class thinking.  

E-Print Network [OSTI]

2013 Team UniSA-Australia guide World class thinking. World class talent. #12;Intoduction A message from Patrick Jonker, Team UniSA-Australia Ambassador Rider Profiles > Bernard Sulzberger > Adam Phelan and contacts 3 4 5 6 7 8 9 10 11 12 Team UniSA-Australia contents #12;3 Team UniSA-Australia A modern, vibrant

Li, Jiuyong "John"

103

VISA -Australia.doc March 2012 StudyAbroad@Exeter  

E-Print Network [OSTI]

VISA - Australia.doc March 2012 StudyAbroad@Exeter Visa info Australia IMMIGRATION INFORMATION ­ AUSTRALIA APPLYING FOR A STUDENT VISA ­ NON-AWARD VISA Who needs one? You will need a student visa if you are going to study in Australia for more than three months. Which visa? You should apply for a Non

Mumby, Peter J.

104

PROGRAM OVERVIEW Australia is the size of continental  

E-Print Network [OSTI]

PROGRAM OVERVIEW Australia is the size of continental USA with about 1/15 of the population. It is the fourth most urban country and yet most Americans know Australia as "outback" and rural country. In a wet year, Australia is dry. Australia exports natural resources. It is "bordered" by the fourth most

Liskiewicz, Maciej

105

Research Excellence in ICT Wealth Creation for Australia  

E-Print Network [OSTI]

Research Excellence in ICT Wealth Creation for Australia From imagination to impact NICTA (National ICT Australia Ltd) is Australia's Information and Communications Technology Research Centre of this research, to create national benefit and wealth for Australia. NICTA aims to be one of the world's top ten

Heiser, Gernot

106

Australia Country report Description of dosimetry services in Australia  

E-Print Network [OSTI]

The Australian Radiation Protection and Nuclear Safety Agency is an agency of the Australian Government with the responsibility of undertaking research and providing advice in relation to radiation protection and nuclear safety. In addition the agency has the responsibility of regulating those radiation practices undertaken by Australian Government organizations. The activities of ARPANSA include monitoring the doses to workers in Australia. Internal dose assessment from the inhalation of insoluble dusts is a significant problem in industries associated with the mining and milling of radioactive ores and in the rehabilitation of sites contaminated by activities associated with the development of nuclear weapons. In order to assess doses to these workers ARPANSA has refurbished its whole body monitor as a lung monitor. The internal dimensions of the shielded room are 2.1 m long x 1.7 m wide x 1.8 m high. The shielding comprises 18 cm of laminated steel sheets, 2 cm of laminated lead sheets and 3 mm of copper. ...

Burns, P

1996-01-01T23:59:59.000Z

107

A New Enigmatic, Tubular Organism From the Ediacara Member, Rawnsley Quartzite, South Australia  

E-Print Network [OSTI]

and tectonics. South Australia Geological Survey BulletinRawnsley Quartzite, South Australia. Precambrian Research,Ediacara biota in South Australia. Earth-Science Reviews,

Joel, Lucas

2013-01-01T23:59:59.000Z

108

The Economic Impact of Extending Marriage to Same-Sex Couples in Australia  

E-Print Network [OSTI]

somewhere  else  in  Australia,  or  it  would  reduce  to  Same-­?Sex  Couples  in   Australia   By M.V. Lee2012 Introduction   If   Australia   grants   same-­?sex  

Badgett, M.V. Lee; Smith, Jennifer

2012-01-01T23:59:59.000Z

109

Melting Ice and Tangled Nets: Litigation and Conservation Policy in the US, Australia, and Canada  

E-Print Network [OSTI]

M. “Environmental Law in Australia and the United States: ACanada, and Australia?13 IV. LegalModel………………………..16 B. Canada, Australia, and Collaborative

Shaffer, Robert

2012-01-01T23:59:59.000Z

110

Populations of North American bean thrips, Caliothrips fasciatus (Pergande) (Thysanoptera : Thripidae : Panchaetothripinae) not detected in Australia  

E-Print Network [OSTI]

host plant table. REFERENCES Australia Phyto Requirements.2005. Country Australia. Commodity Citrus. Available from13 August 2004. Gold Coast, Australia. Morse JG & Hoddle MS.

Hoddle, M S; Stosic, C D; Mound, L A

2006-01-01T23:59:59.000Z

111

Famennian microbial reef facies, Napier and Oscar Ranges, Canning Basin, western Australia  

E-Print Network [OSTI]

Geol. Rundsch. , Western Australia: Geologic Maps of theof the Canning basin, Western Australia. West. Aust. Geol.the Canning Basin, Western Australia. In: Stromatolites (Ed.

Stephens, N P; Sumner, Dawn Y.

2003-01-01T23:59:59.000Z

112

Late devonian carbon isotope stratigraphy and sea level fluctuations, Canning Basin, Western Australia  

E-Print Network [OSTI]

reef, Canning Basin, Western Australia. Palaeontology 43,the Canning Basin, Western Australia. In: Loucks, R.G. ,Canning Basin, Western Australia. Ph.D Thesis, University of

Stephens, N P; Sumner, Dawn Y.

2003-01-01T23:59:59.000Z

113

The analysis of trade liberalisation in Australia using a dynamic computable general equilibrium model.  

E-Print Network [OSTI]

??Trade liberalisation has a central role in Australia due to its significant contributions to the welfare and economic performance throughout Australia??s history. Despite its high… (more)

Nguyen, Viet Ha

2013-01-01T23:59:59.000Z

114

Adapting urban water systems to a changing climate: Lessons from the millennium drought in southeast Australia  

E-Print Network [OSTI]

Conference: Canberra, Australia, 2009. (20) AustralianConfer- ence: Canberra, Australia, 2009a. (21) Finkel, E. ;Basin Authority: Canberra, Australia, 2012; available

2013-01-01T23:59:59.000Z

115

MANAGING AUSTRALIA'S PROTECTED AREAS a review of visitor management models, frameworks and processes  

E-Print Network [OSTI]

MANAGING AUSTRALIA'S PROTECTED AREAS a review of visitor management models, frameworks and processes Greg Brown, Barbara Koth, Glenn Kreag & Delene Weber #12;MANAGING AUSTRALIA'S PROTECTED AREAS ii National Library of Australia Cataloguing in Publication Data Managing Australia's protected areas : review

Brown, Gregory G.

116

Sustainable energy in Australia: an analysis of performance and drivers relative to other OECD countries .  

E-Print Network [OSTI]

??How sustainable is Australia???s pattern of energy supply and use? What are the major factors explaining Australia???s sustainable energy performance relative to other countries? This… (more)

Kinrade, P. A.

2009-01-01T23:59:59.000Z

117

Australia's Carbon Cap-and-Tax Fiasco 24 July 2014  

E-Print Network [OSTI]

Australia's Carbon Cap-and-Tax Fiasco 24 July 2014 James Hansen I have been fortunate to be able as a cap-and-tax. Australia is now the largest carbon polluter per capita among major nations (see Figure 1

Hansen, James E.

118

Australia: Townsville Sexual Assault Support Service (Family Planning Qld. Townsville)  

E-Print Network [OSTI]

Australia: Townsville Sexual Assault Support Service (Family Planning Qld. Townsville) http://www.fpq.com.au/locations/tvillelocations.php Suite 2, 5 Castlemaine St., Kirwan QLD 4817 | Phone: (07) 4723 8184 Australia: Wollongong Urunga House

Amin, S. Massoud

119

Facing Facebook: Australia's Cap-and-Tax 29 July 2014  

E-Print Network [OSTI]

Facing Facebook: Australia's Cap-and-Tax 29 July 2014 James Hansen At least until I finish my in Australia re their cap-and-trade were (1) it would be ineffectual in reducing emissions, and (2) it would

Hansen, James E.

120

The Potential Wind Power Resource in Australia: A New Perspective  

E-Print Network [OSTI]

Australia’s wind resource is considered to be very good, and the utilization of this renewable energy resource is increasing rapidly: wind power installed capacity increased by 35% from 2006 to 2011 and is predicted to ...

Hallgren, Willow

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

E-Print Network 3.0 - area south-eastern australia Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sydney, NSW, Australia 2... , Australia 3 Wildlife and Marine Conservation Section, Biodiversity Conservation Branch, Department Source: Beheregaray, Luciano B. - Department...

122

High-frequency precipitation and stream water quality time series from Plynlimon, Wales: an openly accessible data  

E-Print Network [OSTI]

High-frequency precipitation and stream water quality time series from Plynlimon, Wales: an openly Colin Vincent,6 Kathryn Lehto,6 Simon Grant,2 Jeremy Williams,7 Margaret Neal,1 Heather Wickham,1 Sarah-element high- frequency water quality data set that is openly accessible to the research community. The data

Kirchner, James W.

123

ResearchHighlights The last Ice Age in Australia  

E-Print Network [OSTI]

ResearchHighlights The last Ice Age in Australia Dr Timothy Barrows , Dr Keith Fifield, Accelerator of glaciation and climate change in Australia. By directly dating glacial debris and eroded bedrock, the timing of the glacial history of these regions, which were the only areas in Australia where glaciers existed

Chen, Ying

124

Palm Cove, Australia, 5-10 Aug, 2007 Outrigger in  

E-Print Network [OSTI]

Palm Cove, Australia, 5-10 Aug, 2007 Physics in Space Programme LOFAR Outrigger in Scandinavia EM, Uppsala and LOIS Space Centre, Växjö #12;Bo Thidé IPELS2007., Palm Cove, Australia, 5--10 August, 20072, space physics and lab plasma physics #12;Bo Thidé IPELS2007., Palm Cove, Australia, 5--10 August, 20073

125

.. Polycyclic aromatic hydrocarbons in nearshore marine sediments of Australia*  

E-Print Network [OSTI]

143 . .. Polycyclic aromatic hydrocarbons in nearshore marine sediments of Australia* W.A. Maher and J. Aislabiet Water Research Centre, University of Canberra, PO Box /, Belconnen,ACT 26/6, Australia aromatic hydrocarbons (PAH) in nearshore marine sediments of Australia isdiscussed. Available information

Canberra, University of

126

Media International Australia incorporating Culture and Policy Barbara Glowczewski  

E-Print Network [OSTI]

24 Media International Australia incorporating Culture and Policy Barbara Glowczewski LINES) based on films by Indigenous filmmaker Wayne Barker, juxtaposing four regions of Australia. Both people in Australia map their knowledge and experience of the world in a geographical virtual web

Paris-Sud XI, Université de

127

The History of Oyster Farming in Australia JOHN A. NELL  

E-Print Network [OSTI]

The History of Oyster Farming in Australia JOHN A. NELL Introduction and Sydney rock oysters were collected for consumption byAborigines along the Oyster production in Australia, in- coastal regions of easternAustralia; some volves five species, namely the Sydney of the shell deposits inAboriginal kitchen

128

Opportunities Down Under PostgraduatePostgraduate Study & Research in Australia  

E-Print Network [OSTI]

Opportunities Down Under ­ PostgraduatePostgraduate Study & Research in Australia ·Dr Karen Hussey, The Australian National University ·Dr Pierre Quertenmont, Head, International Office, ULB #12;About AustraliaAbout Australia It's enormous! Island continent = 7.74 million sq km Population 21 million people English speaking

Cerf, Nicolas

129

The Eucalyptus canker pathogen Chrysoporthe cubensis discovered in eastern Australia  

E-Print Network [OSTI]

The Eucalyptus canker pathogen Chrysoporthe cubensis discovered in eastern Australia Geoffrey S Pathology Centre, The University of Queensland/Agri-Science Queensland, Qld 4068, Australia. B Forestry these trees are planted as non-natives. Although the majority of Eucalyptus spp. are native to Australia, Chr

130

TERTIARY INSTITUTIONS SERVICE CENTRE (Incorporated in Western Australia)  

E-Print Network [OSTI]

TERTIARY INSTITUTIONS SERVICE CENTRE (Incorporated in Western Australia) 100 Royal Street East Perth, Western Australia 6004 Telephone (08) 9318 8000 Facsimile (08) 9225 7050 http://www.tisc.edu.au/ Curtin University · Edith Cowan University · Murdoch University · The University of Western Australia

131

Winthrop Professor Lyle Noakes University of Western Australia  

E-Print Network [OSTI]

Winthrop Professor Lyle Noakes University of Western Australia School of Mathematics and Statistics­1970. Sheffield University, UK 1974­1975. University of Western Australia, 1975­2013. Visiting Appointments Perth, WA 6008, Australia. Phone: (+61 8) 6488 3358 Fax: (+61 8) 6488 1028 Email: Lyle

Noakes, Lyle

132

TERTIARY INSTITUTIONS SERVICE CENTRE (Incorporated in Western Australia)  

E-Print Network [OSTI]

TERTIARY INSTITUTIONS SERVICE CENTRE (Incorporated in Western Australia) Level 1, 100 Royal Street East Perth, Western Australia 6004 Telephone (08) 9318 8000 Facsimile (08) 9225 7050 http://www.tisc.edu.au/ Curtin University · Edith Cowan University · Murdoch University · The University of Western Australia

133

Foreign Fishery Developments Australia Reports Growth in  

E-Print Network [OSTI]

." Later studies have also shown both per capita fish and seafood consump- tion and fish prices-76, the last year of the survey. Apparent consumption per person rose another 6 percent in 1976-77 and trendsForeign Fishery Developments Australia Reports Growth in Fish Consumption and Prices Australians

134

Satellite-derived estimates of forest leaf area index in southwest Western Australia are not tightly coupled to  

E-Print Network [OSTI]

Satellite-derived estimates of forest leaf area index in southwest Western Australia Engineering, University of Western Australia, Nedlands, WA 6009, Australia, Department of Forest Ecosystems and Environment, University of Western Australia, Nedlands, WA 6009, Australia, §Numerical Terradynamics

Montana, University of

135

Pb-Pb dating of hydrocarbon migration into a bitumen-bearing ore deposit, North Wales  

SciTech Connect (OSTI)

Previous attempts at U-Pb dating of uraniferous bitumens have had limited significance because of radioelement migration. Pb-Pb dating which can be undertaken regardless of recent lead migration, has been successfully applied to uraniferous solidified bitumen from the Ty Gwyn copper deposit, North Wales. Analyses of five bitumen samples with variable mixtures of radiogenic and common lead yield a {sup 207}Pb/{sup 206}Pb age of 248 {plus minus} 21 Ma (Early Triassic). This age is interpreted as the date of hydrocarbon migration into the deposit and is reasonably consistent with the timing of hydrocarbon generation calculated from the regional burial history. The Pb-Pb dating method could be applied to date uraniferous bitumens representing hydrocarbon migration in diverse geologic environments.

Parnell, J. (Queens's Univ., Belfast (Ireland)); Swainbank, I. (NERC Isotope Geology Centre, Nottingham (England))

1990-10-01T23:59:59.000Z

136

Effects of Stone-Wales and vacancy defects in atomic-scale friction on defective graphite  

SciTech Connect (OSTI)

Graphite is an excellent solid lubricant for surface coating, but its performance is significantly weakened by the vacancy or Stone-Wales (SW) defect. This study uses molecular dynamics simulations to explore the frictional behavior of a diamond tip sliding over a graphite which contains a single defect or stacked defects. Our results suggest that the friction on defective graphite shows a strong dependence on defect location and type. The 5-7-7-5 structure of SW defect results in an effectively negative slope of friction. For defective graphite containing a defect in the surface, adding a single vacancy in the interior layer will decrease the friction coefficients, while setting a SW defect in the interior layer may increase the friction coefficients. Our obtained results may provide useful information for understanding the atomic-scale friction properties of defective graphite.

Sun, Xiao-Yu [Department of Engineering Mechanics, School of Civil Engineering, Wuhan University, Wuhan 430072 (China); Key Laboratory of Hubei Province for Water Jet Theory and New Technology, Wuhan University, Wuhan 430072 (China); Wu, RunNi; Xia, Re [Key Laboratory of Hubei Province for Water Jet Theory and New Technology, Wuhan University, Wuhan 430072 (China); Chu, Xi-Hua; Xu, Yuan-Jie, E-mail: yj-xu@whu.edu.cn [Department of Engineering Mechanics, School of Civil Engineering, Wuhan University, Wuhan 430072 (China)

2014-05-05T23:59:59.000Z

137

D-SPARQ: Distributed, Scalable and Efficient RDF Query Engine  

E-Print Network [OSTI]

of Dammam, Saudi Arabia. University of New South Wales, High Street, Kensington, NSW, Australia 2052. ssakr

Hitzler, Pascal

138

SCHOTT Australia Pty Ltd | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginiaRoosevelt GardensUK-basedRutherfordSCHOTT Australia Pty. Ltd.

139

The Role of Gender, Religion and Friendship in the Perception of the “Other”: An Investigation of Secondary Students in Australia  

E-Print Network [OSTI]

a major contribution to Australia. Muslims have made a majorhave good feelings for Australia and Australians. Mostother migrant groups in Australia. Most migrants are racist.

Ata, Abe

2009-01-01T23:59:59.000Z

140

Perceived neighborhood environmental attributes associated with adults' transport-related walking and cycling: Findings from the USA, Australia and Belgium  

E-Print Network [OSTI]

Findings from the USA, Australia and Belgium. InternationalFindings from the USA, Australia and Belgium Delfien VanBaltimore and Seattle), Australia (Adelaide) and Belgium (

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Constraints on Neoproterozoic paleogeography and Paleozoic orogenesis from paleomagnetic records of the Bitter Springs Formation, Amadeus Basin, central Australia  

E-Print Network [OSTI]

evolution of Proterozoic Australia: Tectonics, v. 15, n. 6,Geological Survey of Australia, Technical Report, 1:Petermann orogeny, central Australia: Lithosphere, v. 1, n.

Swanson-Hysell, N. L; Maloof, A. C; Kirschvink, J. L; Evans, D. A. D; Halverson, G. P; Hurtgen, M. T

2012-01-01T23:59:59.000Z

142

International Conference on Neutron Scattering 2005 Darling Harbour. Sydney. Australia  

E-Print Network [OSTI]

International Conference on Neutron Scattering 2005 Darling Harbour. Sydney. Australia 27 November, Hillerød, Denmark Combined application of small-angle neutron scattering and oscillatory shear

143

australia electronic resource: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

beauty: discourses of cosmetic surgery in popular women's magazines in Australia, Germany and Japan. Open Access Theses and Dissertations Summary: ??This thesis analyses...

144

artesian basin australia: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Justin Timothy 2013-01-01 178 Evolution and tectonic setting of the Paleoproterozoic Granites-Tanami Orogen, Western Australia. Open Access Theses and Dissertations Summary:...

145

Contrasts in restructuring wholesale electric markets: England/Wales, California, and the PJM  

SciTech Connect (OSTI)

The ways in which the British, the Californians, and the members of the Pennsylvania-Jersey-Maryland Pool (PJM) are restructuring their electric industries and designing markets provide fascinating political and technical contrasts with each other, particularly insofar as all three markets are roughly the same size, with energy sales of about 250--300 terawatt hours (TWh) annually. There have been significant differences in the drivers of change, objectives, and leadership, the legacies of the past, and the process of design, which are discussed in the first three sections. The fourth section describes the market designs in England and Wales, California, and the PJM, while the concluding section draws out the lessons of experience. While these lessons include specific principles regarding the objectives and structure of power exchanges, the maintenance of system stability and power transport, and the achieving of generation reliability, they also include several overarching conclusions. Perhaps chief among them, as will be clear from the discussion of the restructuring experience on both sides of the Atlantic, is that major restructurings can only be led by a public authority and will be successful in implementation only if that authority has a clear and realistic vision of where it wants to go.

Henney, A.

1998-08-01T23:59:59.000Z

146

GNSS Futures, Sydney, Australia, 7-8 July 2014GNSS Futures, Sydney, Australia, 7-8 July 2014 School of Civil & Environmental Engineering, UNSW, Sydney,  

E-Print Network [OSTI]

GNSS Futures, Sydney, Australia, 7-8 July 2014GNSS Futures, Sydney, Australia, 7-8 July 2014 School of Civil & Environmental Engineering, UNSW, Sydney, Australia The International Scene: How Precise-15) President International Association of Geodesy (2011-15) #12;GNSS Futures, Sydney, Australia, 7-8 July 2014

Sekercioglu, Y. Ahmet

147

Biodiversity and the Courts: Endangered Species Law in the US, Australia, and Canada  

E-Print Network [OSTI]

1973). [10] Environment Australia. “Recovery Plan for MarineSpecies Law in the US, Australia, and Canada Robert Sha?erSpecies Law in the US, Australia, and Canada. ” As a broader

Shaffer, Robert

2011-01-01T23:59:59.000Z

148

National ICT Australia Inquiry into the role and potential of the National  

E-Print Network [OSTI]

National ICT Australia Submission to the Inquiry into the role and potential of the National;National ICT Australia (NICTA) ­ Submission to the Inquiry into the National Broadband Network March 2011 1-Government ............................................................................................................................7 Centrelink in Australia

Heiser, Gernot

149

Changing Military Dynamics in East Asia: Australia’s Evolving Grand Strategy  

E-Print Network [OSTI]

Force 2030. Canberra: Commonwealth of Australia. Shearer,Canberra’s efforts to strengthen and reinvigorate the Australia–Canberra and Tokyo had been inching forward for two decades but accelerated rapidly after Australia

SHEARER, Andrew

2012-01-01T23:59:59.000Z

150

The Descent of Morgan in Australia: Kinship Representation from the Australian Colonies  

E-Print Network [OSTI]

University Canberra, Australia Patrick.McConvell@anu.edu.auTribes of South-east Australia. Canberra: Aboriginal StudiesCanberra. Lorimer Fison annotated copy of Lewis Henry Morgan ‘Australian Kinship’, National Library of Australia,

McConvell, Patrick; Gardner, Helen

2013-01-01T23:59:59.000Z

151

E-Print Network 3.0 - australia potential sources Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of revenue for Australia and for this reason... resources 12;8 Table 1. WEC and BGR coal resource and reserve estimates for Australia. Data source: Hk et... , Australia *...

152

Pielke Australia ETS 2 December 2009 Discussion Draft  

E-Print Network [OSTI]

and Timetables of the Proposed Australian Emissions Trading Scheme Roger A. Pielke, Jr. Center for Science-0488 pielke@colorado.edu 2 December 2009 Abstract This paper evaluates Australias proposed emissions trading. Australia will implement a comprehensive emissions trading scheme by 2010 to deliver these targets.1 At Bali

Colorado at Boulder, University of

153

The Potential Wind Power Resource in Australia: A New Perspective*  

E-Print Network [OSTI]

The Potential Wind Power Resource in Australia: A New Perspective* Willow Hallgren, Udaya Bhaskar: globalchange@mit.edu Website: http://globalchange.mit.edu/ #12;The Potential Wind Power Resource in Australia density, and analyzes the variation of these characteristics with current and potential wind turbine hub

154

The Potential Wind Power Resource in Australia: A New Perspective  

E-Print Network [OSTI]

The Potential Wind Power Resource in Australia: A New Perspective Willow Hallgren, Udaya Bhaskar;1 The Potential Wind Power Resource in Australia: A New Perspective Willow Hallgren* , Udaya Bhaskar Gunturu intermittency can potentially be mitigated by the aggregation of geographically dispersed wind farms. Our

155

Melting Ice and Tangled Nets: Litigation and Conservation Policy in the US, Australia, and Canada  

E-Print Network [OSTI]

Why the US, Canada, and Australia?13Model………………………..16 B. Canada, Australia, and CollaborativeMaritimus Conservation in  Canada: An Ecological Basis for 

Shaffer, Robert

2012-01-01T23:59:59.000Z

156

E-Print Network 3.0 - australia monitoring prediction Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Australia's 2020 abatement task Summary: obligations.2 In the absence of emissions trading, ABARE predicted that cutting Australia's emissions from... LULUCF offsets and...

157

E-Print Network 3.0 - australia 1916-2004 implications Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 December 2009 Abstract This paper evaluates Australias proposed emissions trading... of new solar thermal plants within the next decade. 12;Pielke - Australia...

158

E-Print Network 3.0 - australia building leaders Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 December 2009 Abstract This paper evaluates Australias proposed emissions trading... of new solar thermal plants within the next decade. 12;Pielke - Australia...

159

E-Print Network 3.0 - argentina australia egypt Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

australia egypt Search Powered by Explorit Topic List Advanced Search Sample search results for: argentina australia egypt Page: << < 1 2 3 4 5 > >> 1 2 VANDERBILT INTERNATIONAL By...

160

Country Report on Building Energy Codes in Australia  

SciTech Connect (OSTI)

This report is part of a series of reports on building energy efficiency codes in countries associated with the Asian Pacific Partnership (APP) - Australia, South Korea, Japan, China, India, and the United States of America (U.S.). This reports gives an overview of the development of building energy codes in Australia, including national energy policies related to building energy codes, history of building energy codes, recent national projects and activities to promote building energy codes. The report also provides a review of current building energy codes (such as building envelope, HVAC, and lighting) for commercial and residential buildings in Australia.

Shui, Bin; Evans, Meredydd; Somasundaram, Sriram

2009-04-02T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

ForPeerReview Wave-cloud lines over northwest Australia  

E-Print Network [OSTI]

ForPeerReview Wave-cloud lines over northwest Australia Journal: QJRMS Manuscript ID: QJ-12-0097.R1 northwest Australia Cathryn E. Birch1 and Michael J. Reeder2 For submission to QJRMS 1 Institute for Climate Sciences, Monash University, Australia and Centre of Excellence for Climate System Science, Australia

Birch, Cathryn

162

Climate Change and Health: Impacts on Remote Indigenous Communities in Northern Australia  

E-Print Network [OSTI]

Climate Change and Health: Impacts on Remote Indigenous Communities in Northern Australia Donna and health : impacts on remote Indigenous communities in northern Australia. ISBN 1 921232 31 5. 1. Climatic changes - Health aspects - Australia, Northern. 2. Aboriginal Australians - Health and hygiene - Australia

Green, Donna

163

Humans and Volcanoes in Australia and New Guinea. Peter Bindon (1)  

E-Print Network [OSTI]

as a resource. 1 1. Anthropology Department, Western Australian Museum, Perth 6000 AUSTRALIA 2. CDRADHumans and Volcanoes in Australia and New Guinea. Peter Bindon (1) and Jean-Paul Raynal (2) ,1 de mythes d'aquisition du feu. FIRST COLONIZATION OF AUSTRALIA The occupation of greater Australia

Boyer, Edmond

164

INTRODUCTION The subduction zones to the north and east of Australia  

E-Print Network [OSTI]

in southeastern Australia and dif- ferent parts of Western Australia (Kennett 2003). Fundamental and higher modeINTRODUCTION The subduction zones to the north and east of Australia provide frequent events over (1996) analysed the data from the SKIPPY stations in eastern Australia using the Partitioned Waveform

165

a contaminant in decline: long-term tbt monitoring at a naval base in Western australia  

E-Print Network [OSTI]

a contaminant in decline: long-term tbt monitoring at a naval base in Western australia john a planulatus) in and around the RAN naval base in Cockburn Sound, WesternAustralia, was initiated and continued, Australia. 2 Current address: ES Link Services Pty Ltd, PO Box 10, Castlemaine, VIC 3450, Australia. 3

Burgman, Mark

166

International Experience Australia 2013 Department of Energy, Environmental  

E-Print Network [OSTI]

International Experience Australia 2013 Department of Energy, Environmental And Chemical in aquatic engineering, solar and geothermal energy, waste water treatment, carbon dioxide sequestration lunch 2:00 PM UQ Energy Research UQ Solar Array Biofuels : Biomass Resourc

Subramanian, Venkat

167

The Potential Wind Power Resource in Australia: A New Perspective  

E-Print Network [OSTI]

Australia is considered to have very good wind resources, and the utilization of this renewable energy resource is increasing. Wind power installed capacity increased by 35% from 2006 to 2011 and is predicted to account ...

Hallgren, Willow

168

DAVID COCKBURN An Introduction to the Philosophy of Mind. Hampshire, Wales: Palgrave Press 2001. Pp. xviii + 157. (cloth: ISBN 0-333-78637-8) (paper: ISBN  

E-Print Network [OSTI]

1 DAVID COCKBURN An Introduction to the Philosophy of Mind. Hampshire, Wales: Palgrave Press 2001 the novice to some of the traditional issues in the philosophy of mind. To this end, the book is structured around discussions of dualism, physicalism, the problem of other minds, mental causation, personal

Barrett, Jeffrey A.

169

Assessing environmental impacts on stream water quality: deforestation in mid-Wales Hydrology and Earth System Sciences, 6(3), 421431 (2002) EGS  

E-Print Network [OSTI]

Assessing environmental impacts on stream water quality: deforestation in mid-Wales 421 Hydrology and Earth System Sciences, 6(3), 421­431 (2002) © EGS Assessing environmental impacts on stream water the environmental sciences, there are major management issues over the impact of man on the water quality

Boyer, Edmond

170

The impact of conifer harvesting on stream water quality: the Afon Hafren, mid-Wales Hydrology and Earth System Sciences, 8(3), 503520 (2004) EGU  

E-Print Network [OSTI]

The impact of conifer harvesting on stream water quality: the Afon Hafren, mid-Wales 503 Hydrology and Earth System Sciences, 8(3), 503520 (2004) © EGU The impact of conifer harvesting on stream water. The results are linked to within-catchment information to describe the influence of conifer harvesting

Paris-Sud XI, Université de

171

charteredaccountantsanz.com Chartered Accountants Australia and New Zealand is a trading name for the Institute of Chartered Accountants in Australia (ABN 50 084 642 571)  

E-Print Network [OSTI]

charteredaccountantsanz.com Chartered Accountants Australia and New Zealand is a trading name for the Institute of Chartered Accountants in Australia (ABN 50 084 642 571) and the New Zealand Institute minds from Australia and New Zealand. This is an opportunity for students to apply the business skills

Hickman, Mark

172

COPYRIGHT: State of Western Australia Copyright in this document is reserved to the Crown in right of the State of Western Australia.  

E-Print Network [OSTI]

COPYRIGHT: © State of Western Australia Copyright in this document is reserved to the Crown in right of the State of Western Australia. This is NOT an official version. It is reproduced with permission of the State of Western Australia, but it does not purport to be the official or authorised

173

Effects of boron-nitride substrates on Stone-Wales defect formation in graphene: An ab initio molecular dynamics study  

SciTech Connect (OSTI)

Ab initio molecular dynamics simulations are performed to investigate the effects of a boron nitride (BN) substrate on Stone-Wales (SW) defect formation and recovery in graphene. It is found that SW defects can be created by an off-plane recoil atom that interacts with the BN substrate. A mechanism with complete bond breakage for formation of SW defects in suspended graphene is also revealed for recoils at large displacement angles. In addition, further irradiation can result in recovery of the SW defects through a bond rotation mechanism in both graphene and graphene/BN, and the substrate has little effect on the recovery process. This study indicates that the BN substrate enhances the irradiation resistance of graphene.

Jin, K.; Xiao, H. Y. [Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Zhang, Y. [Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Weber, W. J., E-mail: wjweber@utk.edu [Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)

2014-05-19T23:59:59.000Z

174

Tolerance of combined salinity and O2 deficiency in Hordeum marinum accessions from the grain-belt of Western Australia  

E-Print Network [OSTI]

grain-belt of Western Australia for tolerance to salinity,in the accessions from Western Australia, as well as K +from the grain-belt of Western Australia. Single heads were

Malik1,2,3, AI; English1,2, JP; Shepherd1,4, KA; Islam2,5, AKMR; Colmer1,2, TD

2009-01-01T23:59:59.000Z

175

A comparative study of Scleractinian coral diversity in Mo'orea, French Polynesia, and the Great Barrier Reef, Australia  

E-Print Network [OSTI]

Center, Townesville, Australia. Pg. 78-90. Mueller-Dombois,Townsville, Queensland, Australia. Wilson, M.V. and Shmida,GREAT BARRIER REEF, AUSTRALIA A LEXANDRA T ITLE Molecular

Title, Alexandra C

2009-01-01T23:59:59.000Z

176

Tolerance of combined salinity and O2 deficiency in Hordeum marinum accessions from the grain-belt of Western Australia  

E-Print Network [OSTI]

from the grain-belt of Western Australia for tolerance toin the accessions from Western Australia, as well as K +from the grain-belt of Western Australia. Single heads were

Malik1,2,3, AI; English1,2, JP; Shepherd1,4, KA; Islam2,5, AKMR; Colmer1,2, TD

2009-01-01T23:59:59.000Z

177

Australia-EU Linkage Story Policy evolution tied to domestic political landscape abandonment of  

E-Print Network [OSTI]

· Australia-EU Linkage Story Policy evolution tied to domestic political landscape ­ abandonment on post-AU election results New government in Australia has policy framework of `direct action' - paying

California at Davis, University of

178

E-Print Network 3.0 - australia wind energy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Congress, Sydney, Australia September 5-9, 2004 1 OFFSHORE WIND POWER: EASING... of wind turbines is expected to be between 12;19 th World Energy Congress, Sydney, Australia...

179

Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C Information Technology  

E-Print Network [OSTI]

Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University

Albrecht, David

180

E-Print Network 3.0 - australia remote monitoring Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Australia (PIRSA) Level 6, 101 ... Source: Stanford University - Department of Energy Resources Engineering, Reservoir Simulation Research Collection: Fossil Fuels 8...

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Second International Conference on CFD in the Minerals and Process Industries CSIRO, Melbourne, Australia  

E-Print Network [OSTI]

, Australia 6-8 December 1999 1 FINITE VOLUME METHODS APPLIED TO THE COMPUTATIONAL MODELLING OF WELDING

Taylor, Gary

182

Final Conference Papers/Proceedings for the 12th International Congress on Radiation Research, Brisbane, Australia  

SciTech Connect (OSTI)

Proceedings of the 12th International Congress of Radiation Research, Brisbane, Australia, August 17-22, 20003

None

2003-08-22T23:59:59.000Z

183

The Rockefeller University Press $30.00 J. Exp. Med. Vol. 208 No. 11 2305-2320  

E-Print Network [OSTI]

University Medical School, Australian National University, Canberra, Australian Capital Territory 0200, Australia 3Immunology Program, Garvan Institute of Medical Research, Darlinghurst, Sydney, New South Wales 2010, Australia 4St. Vincent's Clinical School, Faculty of Medicine, University of New South Wales

184

The Brooke & Glenn Grindlinger International Experience Award for Study in Australia  

E-Print Network [OSTI]

The Brooke & Glenn Grindlinger International Experience Award for Study in Australia Glenn in Australia. The primary objective of this award is to encourage and enable students to pursue study in Australia regardless of their financial circumstances. The $2,500 award is offered each semester and can

Keinan, Alon

185

UAVs OVER AUSTRALIA -Market And Capabilities Dr. K.C. Wong  

E-Print Network [OSTI]

UAVs OVER AUSTRALIA - Market And Capabilities Dr. K.C. Wong Department of Aeronautical Engineering Building J07 University of Sydney NSW 2006 Australia Tel: +61 2 9351 2347 Fax: +61 2 9351 4841 kc Australia Tel: +61 3 9647 3053 Fax: +61 3 9647 3050 c.bil@rmit.edu.au ABSTRACT It is generally accepted

Wong, K. C.

186

Eroding Australia: rates and processes from Bega Valley to Arnhem Land  

E-Print Network [OSTI]

Eroding Australia: rates and processes from Bega Valley to Arnhem Land ARJUN M. HEIMSATH1*, JOHN, Australia 3 Research School of Physical Sciences and Engineering, Australian National University, Canberra, ACT 0200, Australia *Corresponding author (e-mail: Arjun.Heimsath@asu.edu) Abstract: We report erosion

Heimsath, Arjun M.

187

Towards a `cost of credit' cap in the UK: Lessons from Australia1  

E-Print Network [OSTI]

Towards a `cost of credit' cap in the UK: Lessons from Australia1 Jodi Gardner and Karen Rowlingson Authority) must introduce some limitation on the cost of credit by January 2015. It has cited Australia as an example of a country where such a cap works well. However, Australia only implemented its interest rate

Birmingham, University of

188

Molecular Diversity of Legume Root-Nodule Bacteria in Kakadu National Park, Northern Territory, Australia  

E-Print Network [OSTI]

, Australia Be´ne´dicte Lafay¤ *, Jeremy J. Burdon Commonwealth Scientific and Industrial Research Organisation (CSIRO) Plant Industry, Centre for Plant Biodiversity Research, Canberra, Australia Background. Symbiotic relationships between leguminous plants (family Fabaceae) and nodule-forming bacteria in Australia

Boyer, Edmond

189

OneVentures Pty Ltd Level 2, 18 Bulletin Place, Sydney, NSW 2000 Australia  

E-Print Network [OSTI]

OneVentures Pty Ltd Level 2, 18 Bulletin Place, Sydney, NSW 2000 Australia Office +61 (2) 8205 7379 technologies in Australia and was acquired by a UK publicly listed company returning $30m cash and an excellent, Australia's National ICT centre of excellence. She also has a number of advisory positions with One

Chen, Ying

190

Take a personal tour of Australia's oldest natural history collection... museumPhotographs by Robyn Stacey  

E-Print Network [OSTI]

Take a personal tour of Australia's oldest natural history collection... museumPhotographs by Robyn of Australia's leading photographers, accompanied by an engaging history from an acclaimed essayist and author throughout. Colonial Secretary Alexander Macleay arrived in Australia in 1826. A man with a most singular

Viglas, Anastasios

191

Ophiostoma species (Ophiostomatales, Ascomycota), including two new taxa on eucalypts in Australia  

E-Print Network [OSTI]

Ophiostoma species (Ophiostomatales, Ascomycota), including two new taxa on eucalypts in Australia of Tasmania, GPO Box 252-54, Hobart, Tas. 7001, Australia. C Forest Science Centre, Industry & Investment NSW, PO Box 100, Beecroft, NSW 2119, Australia. D Agric-Science Queensland, Ecosciences Precinct, 41 Boggo

192

Eastern Australia: A possible source of dust in East Antarctica interglacial ice  

E-Print Network [OSTI]

Eastern Australia: A possible source of dust in East Antarctica interglacial ice M. Revel-Rolland a Department of Earth and Marine Sciences, The Australian National University, Canberra ACT 0200, Australia d, Australia f CEREGE Université Aix-Marseille/CNRS/IRD UR161, BP 80, 13545 Aix-en Provence, France g EPOC

Demouchy, Sylvie

193

Distinct Bradyrhizbium communities nodulate legumes native to temperate and tropical monsoon Australia  

E-Print Network [OSTI]

Australia Tomasz Stepkowski a, , Elizabeth Watkin b , Alison McInnes c,1 , Dorota Gurda a , Joanna Gracz, Perth, Australia c School of Natural Sciences, University of Western Sydney, Hawkesbury Campus, Locked Bag 1797, Penrith South DC, NSW 1797, Australia d Department of Microbiology and Plant Pathology

194

ORIGINAL PAPER Wildlife across our borders: a review of the illegal trade in Australia  

E-Print Network [OSTI]

ORIGINAL PAPER Wildlife across our borders: a review of the illegal trade in Australia Erika Alacs* and Arthur Georges Institute for Applied Ecology, University of Canberra, Canberra, Australia Australian flora and fauna are highly sought for the international black market in wildlife. Within Australia

Canberra, University of

195

The impact of marine reserves on nekton diversity and community composition in subtropical eastern Australia  

E-Print Network [OSTI]

Australia Suzanne Pillansa,b, *, Juan-Carlos Ortizb , Richard D. Pillansc , Hugh P. Possinghamd a CRC for Coastal Zone, Estuary and Waterway Management, Australia b Centre for Marine Studies, University of Queensland, St. Lucia, Brisbane 4072, Australia c CSIRO Marine Research, P.O. Box 120, Cleveland, Brisbane

Queensland, University of

196

PROPERTIES OF RESIDUALS FOR SPATIAL POINT PROCESSES A. BADDELEY, # University of Western Australia  

E-Print Network [OSTI]

PROPERTIES OF RESIDUALS FOR SPATIAL POINT PROCESSES A. BADDELEY, # University of Western Australia J. MØLLER, ## University of Aalborg A.G. PAKES, # University of Western Australia Abstract For any address: School of Mathematics & Statistics M019, University of Western Australia, 35 Stirling Highway

Baddeley, Adrian

197

Shallow intraplate earthquakes in Western Australia observed by Interferometric Synthetic Aperture Radar  

E-Print Network [OSTI]

Shallow intraplate earthquakes in Western Australia observed by Interferometric Synthetic Aperture earthquakes in a stable continental region of southwest Western Australia. Both small-magnitude events occur with tectonic processes in this area of Western Australia often initiate in the upper 1 km of crust. Citation

Tregoning, Paul

198

Climate-change induced tropicalisation of marine communities in Western Australia  

E-Print Network [OSTI]

Climate-change induced tropicalisation of marine communities in Western Australia William W. L, The University of British Columbia, BC, Canada, V6T 1Z4. B Ocean Institute, The University of Western Australia and School of Animal Biology, The University of Western Australia, 35 Stirling Highway, Crawley, WA 6009

Pauly, Daniel

199

Western Australian Hub of SiMERR Australia (National Centre of Science, ICT and  

E-Print Network [OSTI]

SiMERR WA Western Australian Hub of SiMERR Australia (National Centre of Science, ICT and Mathematics Education for Rural and Regional Australia) Background Since 2005 SiMERR WA, the Western Australian Hub of SiMERR Australia, has been led by a team of academics from Curtin University. Si

200

A Study of Low Paid Work and Low Paid Workers in Western Australia  

E-Print Network [OSTI]

A Study of Low Paid Work and Low Paid Workers in Western Australia Therese Jefferson Alison Preston University of Technology Perth Western Australia http://www.cbs.curtin.edu/wiser #12;A Study of Low Paid Work and Low Paid Workers in Western Australia ii A Study of Low Paid Work and Low Paid Workers in Western

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

The University of Western Australia Submission to the Senate Education and Employment Legislation Committee  

E-Print Network [OSTI]

The University of Western Australia Submission to the Senate Education and Employment Legislation Bill (2014). The University of Western Australia (UWA) was founded more than 100 years ago as the state efforts. The University of Western Australia shares the Go8's view that the current policy and funding

Tobar, Michael

202

Seven new species of the Botryosphaeriaceae from baobab and other native trees in Western Australia  

E-Print Network [OSTI]

Seven new species of the Botryosphaeriaceae from baobab and other native trees in Western Australia region of north- western Australia. Members of the Botryosphaeria- ceae were predominantly endophytes endemic to Australia and is restricted to the north- western part of the country (Crisp et al 2004

203

Australia's Humanitarian Action Policy and Disaster Risk Reduction Policy  

E-Print Network [OSTI]

to get more information Disaster Risk Reduction Team Disaster Prevention and Risk Reduction Section GrantAustralia's Humanitarian Action Policy and Disaster Risk Reduction Policy A Commitment: · Disaster risk reduction is integrated into the Australian aid program · Capacity of partner governments

Botea, Adi

204

Reprinted from Proceedingsof the Astronomical Society of Australia  

E-Print Network [OSTI]

Reprinted from Proceedingsof the Astronomical Society of Australia Volume 2 Number 4, pages 206 waves - these can be excited by shock waves, as in type I1solar radio bursts: the OH molecules, which must have a normal rather than an inverted energy population, merely scatter the (highly non

Melrose, Don

205

Crawford School Dialogue Australia's Role In Reducing Regional Deforestation  

E-Print Network [OSTI]

Crawford School Dialogue Australia's Role In Reducing Regional Deforestation For more information of deforestation and forest degradation in neighbouring `rainforest nations' - especially Indonesia and Papua New deforestation at the Copenhagen (2009) and Cancun (2010) climate change conferences; and (b) the recent

Botea, Adi

206

swinburne.edu.au/international n Melbourne, Australia  

E-Print Network [OSTI]

. You will require approximately A$23,000 to A$30,000* per year for ongoing living costs (not including with state-of-the-art multimedia lecture theatres, many new and refurbished buildings, well-stocked libraries Unit's Global Liveability Survey, and is known as Australia's cultural, culinary and sporting capital

Liley, David

207

Performance analysis of boron nitride embedded armchair graphene nanoribbon metal–oxide–semiconductor field effect transistor with Stone Wales defects  

SciTech Connect (OSTI)

We study the performance of a hybrid Graphene-Boron Nitride armchair nanoribbon (a-GNR-BN) n-MOSFET at its ballistic transport limit. We consider three geometric configurations 3p, 3p + 1, and 3p + 2 of a-GNR-BN with BN atoms embedded on either side (2, 4, and 6 BN) on the GNR. Material properties like band gap, effective mass, and density of states of these H-passivated structures are evaluated using the Density Functional Theory. Using these material parameters, self-consistent Poisson-Schrodinger simulations are carried out under the Non Equilibrium Green's Function formalism to calculate the ballistic n-MOSFET device characteristics. For a hybrid nanoribbon of width ?5?nm, the simulated ON current is found to be in the range of 265??A–280??A with an ON/OFF ratio 7.1 × 10{sup 6}–7.4 × 10{sup 6} for a V{sub DD}?=?0.68?V corresponding to 10?nm technology node. We further study the impact of randomly distributed Stone Wales (SW) defects in these hybrid structures and only 2.5% degradation of ON current is observed for SW defect density of 3.18%.

Chanana, Anuja; Sengupta, Amretashis; Mahapatra, Santanu [Nano Scale Device Research Laboratory, Department of Electronic Systems Engineering, Indian Institute of Science, Bangalore 560 012 (India)

2014-01-21T23:59:59.000Z

208

Professor, Head of the School, Civil Engineering, Queensland University of Technology, 2 George Street,13 Brisbane 4000 Australia.  

E-Print Network [OSTI]

Street,13 Brisbane 4000 Australia. Professor, Institute for Transportation, Faculty of Civil Engineering

Bertini, Robert L.

209

Spatial patterns of warming off Western Australia during the 2011 Ningaloo Nio: Quantifying impacts of remote and local forcing  

E-Print Network [OSTI]

Spatial patterns of warming off Western Australia during the 2011 Ningaloo Niño: Quantifying and Atmosphere Flagship, Floreat, Western Australia, Australia a r t i c l e i n f o Article history: Received 24 occurred in which a marine heat wave led to extreme warming of Western Australia's coastal waters. The sea

Feng, Ming

210

Beginning of an oil shale industry in Australia  

SciTech Connect (OSTI)

This paper discusses how preparations are being made for the construction and operation of a semi commercial plant to process Australian oil shale. This plant is primarily designed to demonstrate the technical feasibility of processing these shales at low cost. Nevertheless it is expected to generate modest profits even at this demonstration level. This will be the first step in a three staged development of one of the major Australian oil shale deposits which may ultimately provide nearly 10% of Australia's anticipated oil requirements by the end of the century. In turn this development should provide the basis for a full scale oil shale industry in Australia based upon the advantageously disposed oil shale deposits there. New sources of oil are becoming critical since Australian production is declining rapidly while consumption is accelerating.

Wright, B. (Southern Pacific Petroleum NL, 143 Macquarie Street, Sydney (AU))

1989-01-01T23:59:59.000Z

211

Coal exports may make Australia's energy sector among least sustainable  

SciTech Connect (OSTI)

Plentiful coal and cheap energy prices have resulted in an unusually heavy carbon footprint. Clearly, Australia has to rethink how much coal it will use to feed its own growing economy while becoming more conscious of its significant carbon export problem. For a country long used to digging the coal out of the ground and shipping it overseas, climate change will be a game changer.

NONE

2009-11-15T23:59:59.000Z

212

SEARCHING FOR EXTRASOLAR PLANETS FROM UNSW. J. L. Christiansen, M. C. B. Ashley, J. K. Webb, M. G. Hidas, University of New South Wales, Kensington, NSW, 2052, AUSTRALIA (jessiec@phys.unsw.edu.au).  

E-Print Network [OSTI]

time and weather constraints resulted in a failure to capture our candidates in transit with the ANU 40 dwarf companion. Improvements - Hardware With the assistance of an ARC grant a new CCD camera has been are sys- tematics, implementing a period-finding program to hunt for low amplitude transits when

Ashley, Michael C. B.

213

School of Geography Study Abroad Opportunities 2014/15  

E-Print Network [OSTI]

Australia The University of Western Australia Perth Australia The University of British Columbia Vancouver Australia The University of Adelaide Adelaide Australia Monash University Melbourne Australia The University of Melbourne Melbourne Australia The University of New South Wales Sydney Australia The University of Sydney

Hopkins, Gail

214

E-Print Network 3.0 - australia trans-disciplinary research Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

results for: australia trans-disciplinary research Page: << < 1 2 3 4 5 > >> 1 ECOSYSTEM SERVICES AND NRM PRACTICE: WHERE THE Summary: by diffusing knowledge and skills...

215

E-Print Network 3.0 - australia implicate human Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Regional Order in the Asia... framework by inviting Australia, New Zealand and India (ASEAN+6) could be weakened by the dependent nature... a community: human security issues and...

216

E-Print Network 3.0 - australia balancing employment Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

University, Department of Engineering, Solar Energy Program Collection: Renewable Energy ; Engineering 16 THE COSTS OF INTRODUCING NUCLEAR POWER TO AUSTRALIA Summary:...

217

E-Print Network 3.0 - australia adaptive evolution Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

218

E-Print Network 3.0 - australia valitsuse kummuli Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

219

E-Print Network 3.0 - australia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

220

E-Print Network 3.0 - ajavad australia valitsuse Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

E-Print Network 3.0 - aborigeenid ajavad australia Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Australia Queensland University of Technology ARCADIA , College......

222

E-Print Network 3.0 - areas queensland australia Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Queensland, Brisbane, Australia 2009-present Royal Society Of EdinburghLloyds Tsb Foundation For Scotland Personal Summary: 2002 PhD Department of Psychiatry, University of...

223

E-Print Network 3.0 - ai perth australia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Avenue Crawley, W.A., 6009, Australia ... Source: Stanford University - Department of Energy Resources Engineering, Reservoir Simulation Research Collection: Fossil Fuels 44...

224

E-Print Network 3.0 - australia und south Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Ecology 5 NUCLEAR INFORMATION AND RESOURCE SERVICE Summary: South Asia, Kathmandu, Nepal Australia No Waste Alliance, Rapid Creek SEARCH Foundation, Surry Hills... Friends of...

225

E-Print Network 3.0 - australia brazil canada Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Commerce Placement Report -Class of 2010 Summary: Australia International Brazil China Egypt Japan Singapore Taiwan United States United Kingdom... 'sBachelorofCommerceisafour-yea...

226

E-Print Network 3.0 - australia empirical results Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Otago Collection: Biology and Medicine 13 Published in International Journal of Coal Geology Volume 86, Issue 4, 1 June 2011, Pages 329-341 Summary: , Australia * Global...

227

Monophyly of marsupial intraerythrocytic apicomplexan parasites from South America and Australia .  

E-Print Network [OSTI]

??Intraerythrocytic parasites (Apicomplexa: Sarcocystidae) of the South American mouse opossum (Thylamys elegans) from Chile, South America, and of the yellow-bellied glider (Petaurus australis) from Australia… (more)

Merino, Santiago

2010-01-01T23:59:59.000Z

228

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

229

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

230

Secretary Bodman Begins Australia Visit | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of Energy Power.pdf11-161-LNG |September2-SCORECARD-01-24-13 Page 1 ofIBRFComplex" atBegins Australia

231

Gate Reliability Assessment for a Spillway Upgrade Design in Queensland, Australia USSD 2006 Conference Page 1  

E-Print Network [OSTI]

Gate Reliability Assessment for a Spillway Upgrade Design in Queensland, Australia USSD 2006 Conference Page 1 RELIABILITY ASSESSMENT FOR A SPILLWAY GATE UPGRADE DESIGN IN QUEENSLAND, AUSTRALIA Malcolm of reliability analysis, and how the results influenced the spillway system design and overall risk evaluation

Bowles, David S.

232

Gridded Operational Consensus Forecasts of 2-m Temperature over Australia CHERMELLE ENGEL  

E-Print Network [OSTI]

-resolution grid. Local and in- ternational numerical weather prediction model inputs are found to have coarse by numerical weather prediction (NWP) model forecasts. As NWP models improve, public weather forecasting University of Melbourne, Melbourne, Victoria, Australia ELIZABETH E. EBERT Centre for Australia Weather

Ebert, Beth

233

Tectonic geomorphology of Australia MARK C. QUIGLEY1*, DAN CLARK2 & MIKE SANDIFORD3  

E-Print Network [OSTI]

Tectonic geomorphology of Australia MARK C. QUIGLEY1*, DAN CLARK2 & MIKE SANDIFORD3 1 Department, Victoria 3010, Australia *Corresponding author (e-mail: mark.quigley@canterbury.ac.nz) Abstract 2003b; Quigley et al. 2006; Hillis et al. 2008). Thus, although large parts of the Australian landscape

Sandiford, Mike

234

A new species of CrypllOnectria from South Africa and Australia, pathogenic to Eucalyptus  

E-Print Network [OSTI]

A new species of CrypllOnectria from South Africa and Australia, pathogenic to Eucalyptus Marieka (FABI), University of Pretoria, Pretoria 0002, South Africa Venter, M., H. Myburg, B. D. Wingfield, T. A. Coutinho & M. J. Wingfield (2002). A new species of Cryphonectria from South Africa and Australia, patho

235

Effect of Hook Removal on Recapture Rates of 27 Species of Angler-Caught Fish in Australia  

E-Print Network [OSTI]

Effect of Hook Removal on Recapture Rates of 27 Species of Angler-Caught Fish in Australia GENE R, Australia Abstract.--We used data from a cooperative angler tagging program to assess the potential benefit

Wilde, Gene

236

Proceedings of the 55th Session of the International Statistics Institute, 512 April 2005, Sydney, Australia, Paper 116.  

E-Print Network [OSTI]

, Australia, Paper 116. Individual Channel Analysis of Two-Colour Microarrays Gordon K. Smyth Walter and Eliza Hall Institute of Medical Research, Bioinformatics 1G Royal Parade, Parkville 3050, Australia smyth

Smyth, Gordon K.

237

Proceedings of the 2011 AAEE Conference, Fremantle, Western Australia, Copyright Authors' names, 2011 Faculty Use of Research Based Instructional Strategies  

E-Print Network [OSTI]

Proceedings of the 2011 AAEE Conference, Fremantle, Western Australia, Copyright © Authors' names Conference, Fremantle, Western Australia, Copyright © Authors' names, 2011 Table 1: Research Based Henderson Western Michigan University, Kalamazoo, USA charles.henderson@wmich.edu Abstract: Over the last 20

Henderson, Charles

238

Australasian Conference on the Mechanics of Structures and Materials (ACMSM 18) Perth, Western Australia 01-03 December 2004  

E-Print Network [OSTI]

, Western Australia 01-03 December 2004 Comparative study of the failure mechanisms in steel and concrete Rizkalla2 1 Monash University, VIC 3800, Australia 2 North Carolina State University, Raleigh, North

239

JOURNAL DE PHYSIQUE Colloque C9, supplkment au 11'12, Tome 48, dkcembre 1987  

E-Print Network [OSTI]

* University of Western Australia, Nedlands, 6009 Western Australia, Australia *university of New South Wales, Kensington, 2033 New South Wales, Australia Resume Les spectres L23de Si dans c-Si, a-Si et a-Si:H montrent-Si, a-Si and a-Si:H show weak structures corresponding to filled states in the energy gap

Paris-Sud XI, Université de

240

Department of German Studies Study Abroad Opportunities 2014/15  

E-Print Network [OSTI]

Australia University of Western Australia Perth Australia University of New South Wales Sydney Australia Semester of 2nd year. Partner University City Country University of Adelaide Adelaide Australia University of Queensland Brisbane Australia Australian National University, Canberra Australia Monash University, Melbourne

Hopkins, Gail

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Plant species of the Central European flora as aliens in Australia Stedoevropsk rostlinn druhy zavlecen do Austrlie  

E-Print Network [OSTI]

Plant species of the Central European flora as aliens in Australia Stedoevropské rostlinné druhy. (2010): Plant spe- cies of the Central European flora as aliens in Australia. ­ Preslia 82: 465 that are currently recognized as alien species in Australia. We explored temporal patterns of introduction

Richner, Heinz

242

Early India-Australia spreading history revealed by newly detected Mesozoic magnetic anomalies in the Perth Abyssal Plain  

E-Print Network [OSTI]

Early India-Australia spreading history revealed by newly detected Mesozoic magnetic anomalies Abyssal Plain (PAP), offshore Western Australia, is the only section of crust that directly records the early spreading history between India and Australia during the Mesozoic breakup of Gondwana. However

Granot, Roi

243

Made in China, Mined in Australia: Interdependency and Business-Cycle Transmission between Chinese and Australian Industries  

E-Print Network [OSTI]

1 Made in China, Mined in Australia: Interdependency and Business- Cycle Transmission between of interdependence between Australia and China due to the transmission of economic shocks between production in the two countries. I analyse two models to ascertain the impact of Chinese development on Australia

244

Cucumber (Cucumis sativus) and melon (C. melo) have numerous wild relatives in Asia and Australia, and the  

E-Print Network [OSTI]

Cucumber (Cucumis sativus) and melon (C. melo) have numerous wild relatives in Asia and Australia, and the sister species of melon is from Australia Patrizia Sebastiana , Hanno Schaeferb , Ian R. H. Telfordc, University of New England, Armidale NSW 2351, Australia Edited* by Barbara A. Schaal, Washington University

Renner, Susanne

245

Monash University AUSTRALIA 1A Real Time DSP Sonar Echo Processor -IROS'2000 A Real Time DSP Sonar Echo  

E-Print Network [OSTI]

Monash University AUSTRALIA 1A Real Time DSP Sonar Echo Processor - IROS'2000 A Real Time DSP Sonar of Electrical and Computer Systems Engineering Monash University, Victoria, AUSTRALIA www.ecse.monash.edu.au/centres/IRRC # Funded by an Australian Research Council Large Grant #12;Monash University AUSTRALIA 2A Real Time DSP

246

Bulletin of the Australian Meteorological and Oceanographic Society Vol.18 page 104 BLUElink> Progress on operational ocean prediction for Australia  

E-Print Network [OSTI]

BLUElink> Progress on operational ocean prediction for Australia Gary B. Brassington1 , Graham Warren1 , Neville Smith1 , Andreas Schiller2 , Peter R. Oke2 1. Bureau of Meteorology, Melbourne Australia. 2. CSIRO Centre, PO Box 1289K, Melbourne, Victoria, Australia. Email: g.brassington@bom.gov.au Introduction "...a

Oke, Peter

247

Prolog-D-Linda : An Embedding of Linda in SICStus Prolog Page 1 The University Of Western Australia  

E-Print Network [OSTI]

Prolog-D-Linda : An Embedding of Linda in SICStus Prolog Page 1 The University Of Western Australia Geoff Sutcliffe and James Pinakis Dep't of Computer Science, The University of Western Australia, Nedlands, 6009, Western Australia Email: geoff@cs.uwa.edu.au ABSTRACT This paper presents an embedding

Sutcliffe, Geoff

248

Climate variability and ocean production in the Leeuwin Current system off the west coast of Western Australia  

E-Print Network [OSTI]

of Western Australia M Feng1 , A M Waite2 , P A Thompson3 1 CSIRO Marine & Atmospheric Research, Floreat, WA 6014 Ming.Feng@csiro.au 2 School of Environmental Systems Engineering, University of Western Australia coast of Western Australia (WA), as well as the upper ocean stratification (mixing) and the nutrient

Feng, Ming

249

Fungal species on baobabs in Western Australia Prepared by: Draginja Pavlic (PhD student working on a project entitled  

E-Print Network [OSTI]

Fungal species on baobabs in Western Australia Prepared by: Draginja Pavlic (PhD student working species endemic in Australia and is restricted to the north-western parts of the country. Baobabs belong is a single species from the family Bombaceae present in Australia. A recent study revealed that A. gibbosa

250

ABOUT THE EDITORS Jenny Gregory AM FRHS is Winthrop Professor of History at The University of Western Australia. She  

E-Print Network [OSTI]

of Western Australia. She has published widely on aspects of urban history, town planning and heritage. She edited the Historical Encyclopedia of Western Australia, 2009, and her recent monograph is City of Light Chetkovich works at the State Library of Western Australia selecting archival material for inclusion

Tobar, Michael

251

Palaeomagnetism of flood basalts in the Pilbara Craton, Western Australia: Late Archaean continental drift and the oldest known  

E-Print Network [OSTI]

Palaeomagnetism of flood basalts in the Pilbara Craton, Western Australia: Late Archaean in the Nullagine Synclinorium (and Meentheena Centrocline) of the East Pilbara Basin, Western Australia, has been. Langereis, Palaeomagnetism of flood basalts in the Pilbara Craton, Western Australia: Late Archaean

Utrecht, Universiteit

252

Perth, WA, 1821 August 2013 West Australian Basins Symposium 2013 1 The southwest margin of Australia is a complex and  

E-Print Network [OSTI]

been developed for all of western Australia (Gibbons et al., 2012) that includes the continental variability of the margin architecture. Integration of a 1 Energy Division, Geoscience Australia, ACT 2601 of Australia is a complex and relatively poorly studied offshore continental region that includes the Perth

Müller, Dietmar

253

HOW CAN A SYSTEM WITH NO PUBLIC EXAMS BE FAIR? Kerry J Thomas, Head of Mathematics, The Southport School, Queensland, Australia.  

E-Print Network [OSTI]

, The Southport School, Queensland, Australia. Abstract: For 25 years, I have worked in a high school education will need to give you a little history and geography of my country, Australia. Australia, a spacious country State of Queensland, which has 20% of Australia's population, and is the fastest growing state, adopted

Spagnolo, Filippo

254

JOURNALOF GEOPRYSICALRESEARCH, VOL. 87, NO. B6, PAGES 4697-4714, JUNE 10, 1982 UNCERTAINTIES IN THE RELATIVE POSITIONS OF THE AUSTRALIA, ANTARCTICA,  

E-Print Network [OSTI]

IN THE RELATIVE POSITIONS OF THE AUSTRALIA, ANTARCTICA, LORD HOWE, AND PACIFIC PLATES SINCE THE LATE CRETACEOUS plates, between Australia and Antarctica, and between the Lord Howe Rise and Australia. We combined these to yield a range of possible finite rotations describing the relative posi- tions of the Pacific, Australia

Goddard III, William A.

255

Plant Pathology (2008) 57, 702714 Doi: 10.1111/j.1365-3059.2008.01840.x 2008 Department of Primary Industries and Fisheries, Queensland, Australia  

E-Print Network [OSTI]

of Primary Industries and Fisheries, Queensland, Australia 702 Journal compilation © 2008 BSPP Blackwell Publishing Ltd Quambalaria species associated with plantation and native eucalypts in Australia G.S. Peggab University, Western Australia 6150, Australia; and e Forestry and Agricultural Biotechnology Institute

256

THIS SALARY PACKAGING AGREEMENT made the ......... day of ......................... 2014 (1) THE UNIVERSITY OF WESTERN AUSTRALIA, a body corporate established under the University of  

E-Print Network [OSTI]

: (1) THE UNIVERSITY OF WESTERN AUSTRALIA, a body corporate established under the University of Western Australia Act 1911, 35 Stirling Highway, Crawley, Western Australia 6009 ("the University"); and (2 of Western Australia Professional and General Staff Agreement 2010 ("the certified agreement"). B

Tobar, Michael

257

E-Print Network 3.0 - australia national telescopy Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Powered by Explorit Topic List Advanced Search Sample search results for: australia national telescopy Page: << < 1 2 3 4 5 > >> 1 Strumenti per telescopi da 8m e non...

258

E-Print Network 3.0 - australia telescope facilities Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Large Area... -NonCommercial-ShareAlike Licence. http:pos.sissa.it 12;PoS(PRA2009)028 ATLAS ... Source: Norris, Ray - Australia Telescope National Facility, CSIRO Collection:...

259

Competition for hydrogen in the rumen CSIRO Division of Animal Production, Floreat Park, 6014, Western Australia  

E-Print Network [OSTI]

, 6014, Western Australia Methane emission (1/h) is greatest soon after feeding (Johnson et al, 1994 which the organism can no longer use hydrogen and the free energy available for the reaction (4G

Paris-Sud XI, Université de

260

Development of an endocrine genomics virtual research environment for Australia: building on success .  

E-Print Network [OSTI]

??The $47m Australian National eResearch Collaboration Tools and Resources (NeCTAR - www.nectar.org.au) project has recently funded an initiative to establish an Australia-wide endocrine genomics virtual… (more)

Sinnott, Richard O.

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Correspondences: A personal photographic journey between past/Iran and present/Australia.  

E-Print Network [OSTI]

??This project is an autobiographical photography series entitled: Correspondences; A personal photographic journey between past/Iran and present/Australia. This series of photographs are partly influenced by… (more)

Javan, Katayoun

2013-01-01T23:59:59.000Z

262

E-Print Network 3.0 - australia position statement Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Collection: Physics 78 Rural Australia Providing Climate Solutions Summary: of emissions trading 6 1.2 Current policy outlook 7 1.3 Carbon price outlook 8 2. Positioning rural...

263

Planning across distance : remote housing and government intervention in Australia's Northern Territory  

E-Print Network [OSTI]

At the time of its inception in 2008, the Strategic Indigenous Housing and Infrastructure Program (SIHIP) was the largest indigenous housing program in Australia's history. SIHIP represented a $672million investment by the ...

Steyer, Matthew August

2012-01-01T23:59:59.000Z

264

Application of solar-powered desalination in a remote town in South Australia   

E-Print Network [OSTI]

Coober Pedy is a remote town in South Australia with abundant solar radiation and scarce and low quality water, where a reverse osmosis plant has been operating since 1967. This paper evaluates the feasibility of powering ...

De Munari, Annalisa; Capão, D.P.S; Richards, B.S.; Schäfer, Andrea

2009-01-01T23:59:59.000Z

265

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada ...

266

Establishing Representative No-Take Areas in the Great Barrier Reef: Large-Scale Implementation of  

E-Print Network [OSTI]

Institute for Regional Development, University of Western Australia, Nedlands, WA 6907, Australia Abstract, Townsville, QLD 4810, Australia b GeoScience Australia, GPO Box 378, Canberra, ACT 2601, Australia c National Street, Brisbane, QLD 4000, Australia e Port Stephens Research Center, New South Wales Fisheries, Taylor

Queensland, University of

267

Department of French and Francophone Studies  

E-Print Network [OSTI]

of Western Australia Perth Australia University of New South Wales Sydney Australia University of Sydney Semester of 2nd year. Partner University City Country University of Adelaide Adelaide Australia University of Queensland Brisbane Australia Australian National University Canberra Australia Monash University Melbourne

Hopkins, Gail

268

Department of Art History Study Abroad Opportunities 2014/15  

E-Print Network [OSTI]

The University of Western Australia Perth Australia The University of British Columbia Vancouver Canada Mc of study. The Australian National University Canberra Australia The University of Melbourne Melbourne Australia The University of New South Wales Sydney Australia The University of Queensland Brisbane Australia

Hopkins, Gail

269

Department of Archaeology Study Abroad Opportunities 2014/15  

E-Print Network [OSTI]

of Western Australia Perth Australia The University of British Columbia Vancouver Canada McGill University National University Canberra Australia The University of Melbourne Melbourne Australia The University of New South Wales Sydney Australia The University of Queensland Brisbane Australia The University

Hopkins, Gail

270

A.W. Blakers, 'Solar and Wind Electricity in Australia', Australian Journal of Environmental Management, Vol 7, pp 223-236, 2000 SOLAR AND WIND ELECTRICITY IN AUSTRALIA  

E-Print Network [OSTI]

environmental impact associated with the construction of what amounts to a coastal hydro scheme. Solar energy.blakers@anu.edu.au Abstract This paper examines the renewable generation of electricity in Australia from photovoltaics (PV environmental impacts even when deployed on very large scales. They are the only fully sustainable technologies

271

Sexual harassment levels 'alarming' in rural Australia http://www.theage.com.au/national/sexual-harassment-levels-alarming-in-rural-australia-20131030-2whaj.html#ixzz2jdxUVnCG[8/11/2013 5:55:19 PM  

E-Print Network [OSTI]

Sexual harassment levels 'alarming' in rural Australia http://www.theage.com.au/national/sexual-harassment-levels-alarming-in-rural-australia done on domestic violence and crime in rural Australia, but little done before now on sexual harassment studies of its kind, has looked at the prevalence of sexual harassment in regional Australia. Based

Botea, Adi

272

Constraints on Neoproterozoic paleogeography and Paleozoic orogenesis from paleomagnetic records of the Bitter Springs Formation, Amadeus Basin, central Australia  

E-Print Network [OSTI]

Chamley, H. , 1989, Clay Sedimentology: Berlin, Springer-north-west Australia: Sedimentology, v. 54, n. 4, p. 871–mid-continent rift, sedimentology and organic geochemical

Swanson-Hysell, N. L; Maloof, A. C; Kirschvink, J. L; Evans, D. A. D; Halverson, G. P; Hurtgen, M. T

2012-01-01T23:59:59.000Z

273

Sedimentology, Stratigraphy and Petrography of the Permian-Triassic Coal-bearing New Lenton Deposit, Bowen Basin, Australia .  

E-Print Network [OSTI]

??The Bowen Basin is one of the most intensely explored sedimentary basins in Australia and hosts one of the world’s largest coking coal deposits. This… (more)

Coffin, Lindsay M.

2013-01-01T23:59:59.000Z

274

The Discovery and History of the Dalgaranga Meteorite Crater, Western Australia  

E-Print Network [OSTI]

The Dalgaranga meteorite crater, 100 km northeast of Yalgoo, Western Australia, was one of the first impact structures identified in Australia, the smallest isolated crater found in Australia, and the only confirmed crater in the world associated with a mesosiderite projectile. 17 years passed before the Dalgaranga meteorites were described in the scientific literature and nearly 40 years passed before a survey of the structure was published. The reasons for the time-gap were never explained and a number of factual errors about the discovery and early history remain uncorrected in the scientific literature. Using historical and archival documents, and discussions with people involved in Dalgaranga research, the reasons for this time gap are explained by a series of minor misidentifications and coincidences. The age of the crater has yet to be determined, but using published data, we estimate the projectile mass to be 500-1000 kg.

Hamacher, Duane W

2013-01-01T23:59:59.000Z

275

Solar2010, the 48th AuSES Annual Conference 1-3 December 2010, Canberra, ACT, Australia  

E-Print Network [OSTI]

Solar2010, the 48th AuSES Annual Conference 1-3 December 2010, Canberra, ACT, Australia ASI funded Energy Technology 10 Murray Dwyer Circuit Mayfield West NSW 2304 Australia Robbie.Mcnaughton@csiro.au 2 of concentrated solar thermal energy for the production of electricity has been achieved commercially

276

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C  

E-Print Network [OSTI]

Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C General; Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia

Albrecht, David

277

The Apparent Polar Wander Path of the Tarim block (NW China) since the Neoproterozoic and its implications for a long-term Tarim-Australia connection  

E-Print Network [OSTI]

implications for a long-term Tarim-Australia connection P. Zhao1,2 , Y. Chen2 , S. Zhan3 , B. Xu1,* and M for the Tarim block. The comparison between the APWPs of Tarim and Australia implies a long-term Australia. The Tarim block probably began to insu-00931952,version1-7Feb2014 #12;break away from northwestern Australia

Paris-Sud XI, Université de

278

Clean Air and Environmental Quality Volume 40 No.2. May 2006 43 POTENTIAL IMPACTS OF AIR POLLUTION AEROSOLS ON PRECIPITATION IN AUSTRALIA  

E-Print Network [OSTI]

AEROSOLS ON PRECIPITATION IN AUSTRALIA Potential impacts of air pollution aerosols on precipitation in Australia D. Rosenfeld, I. M. Lensky, J. Peterson and A. Gingis ABSTRACT It has been known for decades pollution sources in southeastern Australia. These findings prompted climatological studies that quantified

Daniel, Rosenfeld

279

GEOPHYSICAL RESEARCH LETTERS, VOL. 40, 37813785, doi:10.1002/grl.50739, 2013 Spatial trends in synoptic rainfall in southern Australia  

E-Print Network [OSTI]

in synoptic rainfall in southern Australia James S. Risbey,1 Michael J. Pook,1 and Peter C. McIntosh1 Received assesses spatial and temporal changes in rainfall in southern Australia over the period 1990­2009. Rainfall Australia, Geophys. Res. Lett., 40, 3781­3785, doi:10.1002/grl.50739. 1. Introduction [2] Rainfall exhibits

Risbey, James S.

280

APAC'03 on Advanced Computing, Grid Applications and eResearch Gold Coast, Australia, 29th Sep2nd Oct 2003  

E-Print Network [OSTI]

, Hobart, Australia 2 CSIRO Marine Research, Hobart, Australia 1 #12;incoming solar radiation [Ebert et al., 1995] and consequently reduces the absorption of solar energy into the upper ocean. The thermodynamicAPAC'03 on Advanced Computing, Grid Applications and eResearch Gold Coast, Australia, 29th Sep­2nd

Phipps, Steven J.

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

DEPENDANT SCHOOLING INFORMATION In Western Australia, dependants of international students may be enrolled in either government (public) or non-government  

E-Print Network [OSTI]

DEPENDANT SCHOOLING INFORMATION In Western Australia, dependants of international students may students are eligible to attend a public school through the Department of Education of Western Australia schools in Western Australia under the same conditions as local students while studying in Perth, provided

282

Cenozoic uplift of south Western Australia as constrained by river profiles N. Barnett-Moore , N. Flament, C. Heine, N. Butterworth, R.D. Mller  

E-Print Network [OSTI]

Cenozoic uplift of south Western Australia as constrained by river profiles N. Barnett-Moore , N an explanation. Applying an inverse algorithm to river profiles of south Western Australia reveals including preserved shallow-marine sediment outcrops across the Eucla Basin and south Western Australia. We

Müller, Dietmar

283

XXII ICTAM, 2529 August 2008, Adelaide, Australia SPACE-TIME MEASUREMENTS OF BREAKING WAVE KINEMATICS  

E-Print Network [OSTI]

with light intensity. WAVE KINEMATICS Phase average vorticity In order to have a statistical evolutionXXII ICTAM, 25­29 August 2008, Adelaide, Australia SPACE-TIME MEASUREMENTS OF BREAKING WAVE KINEMATICS AND VOID FRACTION IN THE SURF ZONE Olivier Kimmoun1 , 2 Hubert Branger1 1IRPHE, CNRS, Aix

Paris-Sud XI, Université de

284

Determining price differences among different classes of wool from the U.S. and Australia  

E-Print Network [OSTI]

The U.S. wool industry has long received lower prices for comparable wool types than those of Australia. In order to better understand such price differences, economic evaluations of both the U.S. and Australian wool markets were conducted...

Hager, Shayla Desha

2004-09-30T23:59:59.000Z

285

University of South Australia Go8 Foundation Studies Programs Entry Equivalences Code Academic Program  

E-Print Network [OSTI]

University of South Australia Go8 Foundation Studies Programs Entry Equivalences Code Academic Studies Program Western Australian Universities Foundation Studies Program University of Queensland.8 55 6 LBIF Bachelor of Engineering (Electrcal and Renewable Energy Systems) Y 75 74 67 285 72 6

Mayer, Wolfgang

286

Proceedings of Acoustics 2012 -Fremantle 21-23 November 2012, Fremantle, Australia Australian Acoustical Society 1  

E-Print Network [OSTI]

Proceedings of Acoustics 2012 - Fremantle 21-23 November 2012, Fremantle, Australia Australian consequently became the one of the dominant styles in Western and other musics. THE VOICE vs. OTHER MUSICAL string is excited by striking--an impulsive and therefore broad-band mechanism for energy input. In bowed

New South Wales, University of

287

he history of collecting art in Australia contains few stories as alluring as Roddy Meagher's. Justice  

E-Print Network [OSTI]

#12;T he history of collecting art in Australia contains few stories as alluring as Roddy Meagher) is a veritable Aladdin's Cave of art. Rare oils and drawings jostle for space with decorative arts: Persian himself. Endowed with an extraordinary memory for names, dates, even prices paid for work, Roddy Meagher

Viglas, Anastasios

288

NCEDA RESEARCH THEMES The National Centre of Excellence in Desalination Australia has adopted a  

E-Print Network [OSTI]

improvement opportunities in pre-treatment: Preheating using waste heat or renewable energy and the use and remote areas relating to seasonal and location variability in feedwater composition Characterisation is particularly interested in identifying and piloting novel technologies for Australia's rural and remote needs

289

Proceedings of the Australian Committee on Large Dams Conference, Melbourne, Victoria, Australia. November 2004  

E-Print Network [OSTI]

Proceedings of the Australian Committee on Large Dams Conference, Melbourne, Victoria, Australia. November 2004 ANCOLD 2004 Conference Page 1 TRANSPORTATION MODEL FOR EVACUATION IN ESTIMATING DAM FAILURE and requiring only a reasonable level of effort to #12;Proceedings of the Australian Committee on Large Dams

Bowles, David S.

290

Energy Consumption and Economic Growth The Case of Australia Hong To a, *  

E-Print Network [OSTI]

;3 depend on imports of crude oil, natural gas, and coal for their industrial and residential energy needs). A decline in energy use does not, under conditions of economic efficiency, result in a reduction in economic1 Energy Consumption and Economic Growth ­ The Case of Australia Hong To a, * , Albert Wijeweera

291

XXII ICTAM, 2529 August 2008, Adelaide, Australia EXPERIMENTAL AND THEORETICAL MODELLING OF ICE SHEETSHELF GROUNDING  

E-Print Network [OSTI]

melting of the polar ice caps due to global warming, a dynamical collapse of the ice sheets has the dynamical stability of shelving ice sheets. INTRODUCTION The Antarctic ice cap contains several tensXXII ICTAM, 25­29 August 2008, Adelaide, Australia EXPERIMENTAL AND THEORETICAL MODELLING OF ICE

Worster, M. Grae

292

Distribution of Polycyclic Aromatic Hydrocarbons in Sediments from Estuaries of South-eastern Australia  

E-Print Network [OSTI]

(PAH) in the environment has increased since the Industrial Revolution, chiefly through the widespread-eastern Australia John Bagg,AJ. David SmithBand William A. MaherB A Department of Industrial Science, University and Suess 1970). Estuarine and river sediments can be contaminated by inputs from domestic and industrial

Canberra, University of

293

REVIEW OF POLYRHACHIS (CYRTOMYRMA) FOREL (HYMENOPTERA: FORMICIDAE: FORMICINAE) OF AUSTRALIA, BORNEO, NEW GUINEA  

E-Print Network [OSTI]

, NEW GUINEA AND THE SOLOMON ISLANDS WITH DESCRIPTIONS OF NEW SPECIES RUDOLF J. KOHOUT Kohout, R.J. 2006. Kohout, Queensland Museum, PO Box 3300, South Brisbane 4101, Australia (email: kohout@powerup.com.au); 22 (Robson & Kohout, 2005). Examination ofAustralian material revealed several new species, particularly

Villemant, Claire

294

Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 19952007 (the  

E-Print Network [OSTI]

1 Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 1995­2007 (the International Cancer Benchmarking Partnership): an analysis of population-based cancer registry data M P Coleman Background Cancer survival is a key measure of the effectiveness of health-care systems. Persistent regional

Maizels, Rick

295

MERCURY CYCLING IN LAKE GORDON AND LAKE PEDDER, TASMANIA (AUSTRALIA). I: IN-LAKE PROCESSES  

E-Print Network [OSTI]

MERCURY CYCLING IN LAKE GORDON AND LAKE PEDDER, TASMANIA (AUSTRALIA). I: IN-LAKE PROCESSES KARL C; accepted 2 December 2002) Abstract. The processes affecting the concentrations of total mercury (total Hg- vestigated. Surface concentrations of total mercury (total Hg) were temporally and spatially uniform in both

Canberra, University of

296

Proceedings World Geothermal Congress 2015 Melbourne, Australia, 19-25 April 2015  

E-Print Network [OSTI]

Proceedings World Geothermal Congress 2015 Melbourne, Australia, 19-25 April 2015 1 TOMO4D: Temporal Changes in Reservoir Structure at Geothermal Areas Bruce R. Julian1 , Gillian R. Foulger1 , Andrew.r.foulger@durham.ac.uk najwa.mhanna@durham.ac.uk 2 Geothermal Program Office, China Lake, CA 93555 andrew

Foulger, G. R.

297

[The Journal of Geology, 2005, volume 113, p. 471493] 2005 by The University of Chicago. All rights reserved. 0022-1376/2005/11304-0006$15.00 Buried Inset-Valleys in the Eastern Yilgarn Craton, Western Australia  

E-Print Network [OSTI]

, Western Australia: Geomorphology, Age, and Allogenic Control Peter de Broekert and Mike Sandiford1 10 Carrick Street, Woodlands, Western Australia 6018, Australia (e-mail: p.deb@optusnet.com.au) A B S T R A C in south- western Australia (Clarke 1993; Kern and Com- mander 1993; Johnson et al. 1999). Previously known

Sandiford, Mike

298

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

299

Our Network Seven world class research intensive universities  

E-Print Network [OSTI]

M urdoch U niversity The U niversity ofN ew castle > 1 #12;Western Australia Queensland New South.....................................................................................................12 4. Environmental Sciences (including climate change, water, energy Wales Victoria South Australia Tasmania Nhulunbuy · Jabiru · Darwin (Casuarina) · Palmerston · Katherine

300

Three new species of shallow water, yellow zoanthids (Hexacorallia: Zoanthidea: Epizoanthidae) from southern California, USA, and southern Australia  

E-Print Network [OSTI]

In southern California and southern Australia, several species of hexacorals that are common at diving depths have been referred to as “Yellow Zoanthids.” We describe three new species of them in the genus Epizoanthus because all have a macrocnemic...

Phillipp, Nicholas A.; Fautin, Daphne G.

2009-03-30T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Environmental factors associated with the distribution and range limits of the malaria vector *Anopheles farauti* in Australia  

E-Print Network [OSTI]

. The distributional hypothesis predicted using ecological niche modeling of these factors included all of the record sites from which An. farauti s.s. was collected in northern Australia and successfully reconstructed its narrow limitation to coastal areas. Omission...

Sweeney, A. W.; Beebe, N. W.; Cooper, R. D.; Bauer, John T.; Peterson, A. Townsend

2006-09-01T23:59:59.000Z

302

8TH INTERNATIONAL SYMPOSIUM ON PARTICLE IMAGE VELOCIMETRY -PIV09 Melbourne, Victoria, Australia, August 25-28, 2009  

E-Print Network [OSTI]

8TH INTERNATIONAL SYMPOSIUM ON PARTICLE IMAGE VELOCIMETRY - PIV09 Melbourne, Victoria, Australia, August 25-28, 2009 High speed PIV applied to aerodynamic noise investigation V. Koschatzky1, B.J. Boersma

Lindken, Ralph

303

Australia can't simply build fences at sea -The Drum (Australian Broadcasting Corporation) http://www.abc.net.au/news/2013-07-29/rothwell-australia-cant-simply-build-fences-at-sea/4849664[29/07/2013 2:53:09 PM  

E-Print Network [OSTI]

Australia can't simply build fences at sea - The Drum (Australian Broadcasting Corporation) http://www.abc.net.au/news/2013-07-29/rothwell-australia-cant-simply-build-fences-at-sea/4849664[29/07/2013 2:53:09 PM] Radio TV Australia's maritime borders for the purposes of implementing 'Operation Sovereign Borders' is challenging

Botea, Adi

304

Neogene uplift of south Western Australia as constrained by river profiles  

E-Print Network [OSTI]

The relative tectonic quiescence of the Australian continent during the Cenozoicmakes it an excellent natural laboratory to study recent large-scale variations insurface topography and the processes influencing these changes. A part of this landscape is a fluvial network that is sensitive to variations in landscape horizontaland vertical motions. The notion that a river acts as a "tape recorder" for vertical perturbations (Pritchard et al., 2009) suggests that one can deduce changes in spatial and temporal characteristics of uplift via the analysis of river "channel-parallel", or longitudinal, profiles. Here we analysed 21 longitudinal river profiles, around the Australian continent. Steady-state concave upward profiles in northeast Australia indicate an absence of recent uplift. In contrast, pronounced convex upward undulations and major knickpoints within longitudinal profiles of rivers in southwest Australia suggest recent landscape uplift. This requires an explanation given the lackof recent, large-scale ...

Barnett-Moore, Nicholas; Flament, Nicolas; Butterworth, Nathaniel; Müller, R Dietmar

2013-01-01T23:59:59.000Z

305

Methods and some implications of beef trade between Australia and the United States  

E-Print Network [OSTI]

marketing chain to the United States, 2) Australian levies and quarantine, 3) United States beef quota system and, 4) some major implications of government regulations. The first section explains the methods of transporting beef from Australia...). An understanding of the United States beef quota system is given in the third section. This system is overseen and operated by the President of the United States, United States Secretary of Agriculture, United States Secretary of Treasury, and the United States...

Rutledge, Mark

1988-01-01T23:59:59.000Z

306

Romania in a post-credit crunch world? A cautionary tale from Australia and America  

E-Print Network [OSTI]

We present data on debt accumulation in Australia and the United States, and tentative data on Romania, to pose the question of whether Romania might experience a credit crunch as a result of the US subprime financial crisis. We develop a model of a credit crunch in a pure credit economy with endogenous money creation, to show how changes in bank lending practices and borrower repayment behaviour can bring about an economic decline.

Carmen Costea; Steve Keen

2008-04-15T23:59:59.000Z

307

report 2013 Front cover image: Greenough River Solar Farm, Western Australia.  

E-Print Network [OSTI]

R heAtinG 59 WinD PoWeR 65 appendiCes 65 APPenDiX 1: toP 10 SolAR PoStCoDeS by StAte 68 APPenDiX 2 #12. From jobs and investment in regional areas to solar panels, solar hot water and high efficiencyClean energy australia report 2013 #12;Front cover image: Greenough River Solar Farm, Western

Green, Donna

308

The National Judicial College of Australia with the ANU College of Law presents a  

E-Print Network [OSTI]

, The Australian National University, Canberra S E N T E N C I N G : F R O M T H E O R Y T O P R A C T I C E C O N F E R E N C E law.anu.edu.au/conferences/sentencing #12;Speakers include: > Dr Stephen AllnuttThe National Judicial College of Australia with the ANU College of Law presents a conference

Botea, Adi

309

World Energy Congress, Sydney, Australia September 5-9, 2004 OFFSHORE WIND POWER: EASING A RENEWABLE  

E-Print Network [OSTI]

of wind energy are discussed. 2. Offshore wind energy potential Le potentiel de l'énergie éolienne When.0 0.2 0.4 0.6 0.8 1.0 1.2 Relativeenergy onshoreoffshore Figure 1: Wind energy potential at height 10019 th World Energy Congress, Sydney, Australia September 5-9, 2004 1 OFFSHORE WIND POWER: EASING

310

Research Summary Wildfires in Wales  

E-Print Network [OSTI]

relating to arson and its motivations, wildfire research and research into the social drivers of wildfires in partnership and to address the wider social drivers of wildfire arson. o There is low public awareness

311

Formulating a VET roadmap for the waste and recycling sector: A case study from Queensland, Australia  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer Existing qualifications do not meet the needs of the sector in Queensland. Black-Right-Pointing-Pointer Businesses may not be best positioned to identify training needs. Black-Right-Pointing-Pointer Companies are developing training internally to meet their own specific needs. Black-Right-Pointing-Pointer Smaller companies lack the resources to develop internal training are disadvantaged. Black-Right-Pointing-Pointer There is industry support for an entry-level, minimum industry qualification. - Abstract: Vocational Education and Training (VET) is an essential tool for providing waste management and recycling workers with the necessary skills and knowledge needed to beneficially influence their own employment and career development; and to also ensure productivity and safe working conditions within the organisations in which they are employed. Current training opportunities within Queensland for the sector are limited and not widely communicated or marketed; with other States, particularly Victoria and New South Wales, realising higher numbers of VET enrollments for waste management courses. This paper presents current VET opportunities and trends for the Queensland waste management sector. Results from a facilitated workshop to identify workforce requirements and future training needs organised by the Waste Contractors and Recyclers Association of Queensland (WCRAQ) are also presented and discussion follows on the future training needs of the industry within Queensland.

Davis, G., E-mail: gudavis@cytanet.com.cy [Dr Georgina Davis, ABN 12 744 598 837, Banksia Beach, Brisbane, QLD 4507 (Australia)

2012-10-15T23:59:59.000Z

312

Evidence of progress. Measurement of impacts of Australia's S and L program from 1990-2010  

SciTech Connect (OSTI)

Australia first put categorical energy efficiency labels on residential appliances in the mid-1980s, and the first Minimum Energy Performance Standards (MEPS) for refrigerators was implemented in 1999. Updated in 2005, these MEPS were aligned with US 2001 levels. Considered together, these actions set Australia apart as having one of the most aggressive appliance efficiency programs in the world. For these reasons, together with good data on product sales over time, Australia represents a potentially fruitful case study for understanding the dynamics energy efficiency standards and labeling (EES and L) programs impacts on appliance markets. This analysis attempts to distinguish between the impacts of labeling alone as opposed to MEPS, and to probe the time-dependency of such impacts. Fortunately, in the Australian case, detailed market sales data and a comprehensive registration system provides a solid basis for the empirical evaluation of these questions. This paper analyzes Australian refrigerator efficiency data covering the years 1993-2009. Sales data was purchased from a commercial market research organization (in this case, the GfK Group) and includes sales and average price in each year for each appliance model – this can be used to understand broader trends by product class and star rating category, even where data is aggregated. Statistical regression analysis is used to model market introduction and adoption of high efficiency refrigerators according to logistic adoption model formalism, and parameterizes the way in which the Australian programs accelerated adoption of high-efficiency products and phased out others. Through this analysis, the paper presents a detailed, robust and quantitative picture of the impacts of EES and L in the Australian case, but also demonstrates a methodology of the evaluation of program impacts that could form the basis of an international evaluation framework for similar programs in other countries.

Lowenthal-Savy; McNeil, Michael; Harrington, Lloyd [Nicholas School of the Environment, Duke University, and Lawrence Berkeley National Lab., CA (United States)] [Nicholas School of the Environment, Duke University, and Lawrence Berkeley National Lab., CA (United States)

2013-10-15T23:59:59.000Z

313

Evidence of Progress - Measurement of Impacts of Australia's S&L Program from 1990-2010  

SciTech Connect (OSTI)

Australia first put categorical energy efficiency labels on residential appliances in the mid-1980s, and the first Minimum Energy Performance Standards (MEPS) for refrigerators was implemented in 1999. Updated in 2005, these MEPS were aligned with US 2001 levels. Considered together, these actions set Australia apart as having one of the most aggressive appliance efficiency programs in the world. For these reasons, together with good data on product sales over time, Australia represents a potentially fruitful case study for understanding the dynamics energy efficiency standards and labeling (EES&L) programs impacts on appliance markets. This analysis attempts to distinguish between the impacts of labeling alone as opposed to MEPS, and to probe the time-dependency of such impacts. Fortunately, in the Australian case, detailed market sales data and a comprehensive registration system provides a solid basis for the empirical evaluation of these questions. This paper analyzes Australian refrigerator efficiency data covering the years 1993-2009. Sales data was purchased from a commercial market research organization (in this case, the GfK Group) and includes sales and average price in each year for each appliance model; this can be used to understand broader trends by product class and star rating category, even where data is aggregated. Statistical regression analysis is used to model market introduction and adoption of high efficiency refrigerators according to logistic adoption model formalism, and parameterizes the way in which the Australian programs accelerated adoption of high-efficiency products and phased out others. Through this analysis, the paper presents a detailed, robust and quantitative picture of the impacts of EES&L in the Australian case, but also demonstrates a methodology of the evaluation of program impacts that could form the basis of an international evaluation framework for similar programs in other countries.

Lowenthal-Savy, Danielle; McNeil, Michael; Harrington, Lloyd

2013-09-11T23:59:59.000Z

314

Late Jurassic-Early Cretaceous evolution of the eastern Indian Ocean adjacent to northwest Australia  

E-Print Network [OSTI]

Australia. (December 1987) Lawrence Gill i am Ful1erton, B. S. , University of South Dakota Chairman of Advisory Committee: Dr. William W. Sager Existing National Geophysical Data Center and Project MAGNET data were utilized along with 9, 700 km of new..., but allows significant refinements to these models. The new data in the Argo Abyssal Plain confirm a complete sequence of magnetic isochrons, trending N70'E, from anomaly M-26 to at least anomaly M-16. The M-26 to M-16 sequence can be extended...

Fullerton, Lawrence Gilliam

1987-01-01T23:59:59.000Z

315

,"U.S. Liquefied Natural Gas Imports From Australia (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: EnergyShale ProvedTexas"Brunei (Dollars perReserves (Billion CubicExpected+IntrastateAustralia

316

I N F O R M A T I O N F O R C A N D I D A T E S F O R T H E P O S I T I O N O F  

E-Print Network [OSTI]

Coonabarabran, western New South Wales) > North Australia Research Unit (Darwin, Northern Territory) > Kioloa plan, ANU by 2020, emphasises the University's role as Australia's national university, and Australia. Partnerships The ANU has strong links with leading research institutions in Australia and overseas

317

Journal o/Ihe Geological Soeien', London, Vol. 159,2002, pp 5"7-575. Printed in Great Britain. Granite production in the Delamerian Orogen, South Australia  

E-Print Network [OSTI]

. Granite production in the Delamerian Orogen, South Australia J. D. FODEN 1 , M. A. ELBURG 1 , S. P. TURNER.Australia Abstract: In ¡he South Australian sector of the Cambro-Ordovieian Ross-Delamerian Orogen. granites range compositions forming a continuum between 1- and S-type granites. After the cessation of convergent deformation

Sandiford, Mike

318

Now, more than ever, the world needs engineers. Especially in Australia, where mining and major development projects like the National Broadband Network rollout continue apace,  

E-Print Network [OSTI]

Architecture 36 Petroleum Engineering 37 Photovoltaics & Solar Energy Engineering 38 Renewable Energy in Australia, where mining and major development projects like the National Broadband Network rollout continue to command record salaries. But as Engineers Australia reported in August, the shortage of skilled engineers

Blennerhassett, Peter

319

C O M M E N T doi: 10.1111/j.1442-8903.2008.00416.x 182 ECOLOGICAL MANAGEMENT & RESTORATION VOL 9 NO 3 DECEMBER 2008 2008 Ecological Society of Australia  

E-Print Network [OSTI]

NO 3 DECEMBER 2008 © 2008 Ecological Society of Australia Blackwell Publishing Asia Some practical University (Building 43, Canberra, ACT 0200, Australia). Charlie Zammit and Margaret Considine, Austral- ian 4072, Australia). Sarah Bekessy, School of Global Studies, Social Science and Planning, RMIT University

Kark, Salit

320

139N.L. Bougher & P.B. Matheny, Two species of Inocybe (fungi)Nuytsia 21(3): 139148 (2011) Two species of Inocybe (fungi) introduced into Western Australia  

E-Print Network [OSTI]

species of Inocybe (fungi) introduced into Western Australia Neale L. Bougher 1 and P. Brandon Matheny 2 1, Western Australia 6983 2 Department of Ecology and Evolutionary Biology, 332 Hesler, University Bougher,N.L.andMatheny,P.B.TwospeciesofInocybe(fungi)introducedintoWesternAustralia. Nuytsia 21(3): 139

Matheny, P. Brandon

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Curtin University Edith Cowan University Murdoch University The University of Western Australia I:\\PA EXOFF\\MEETINGS\\APPLICATIONS COMMITTEE\\Documents 2011\\56. Instructions For Accepting Or Rejecting Offer 11-12.Doc  

E-Print Network [OSTI]

IN WESTERN AUSTRALIA) 100 Royal Street East Perth, Western Australia 6004 Telephone (08) 9318 8000 Facsimile Murdoch University (08) 9360 6538 1300 MURDOCH The University of Western Australia (08) 6488 2477 1800 653Curtin University · Edith Cowan University · Murdoch University · The University of Western

322

Stylobates birtlesi sp. n., a new species of carcinoecium-forming sea anemone (Cnidaria, Actiniaria, Actiniidae) from eastern Australia  

E-Print Network [OSTI]

We describe a new species of carcinoecium-forming sea anemone, Stylobates birtlesi sp. n., from sites 680-960 m deep in the Coral Sea, off the coast of Queensland, Australia. An anemone of this genus settles on a gastropod shell inhabited by a...

Crowther, Andrea Louise; Fautin, Daphne G.; Wallace, Carden C.

2014-03-11T23:59:59.000Z

323

Solar2010, the 48th AuSES Annual Conference 1-3 December 2010, Canberra, ACT, Australia  

E-Print Network [OSTI]

Concentrating Solar Power, Energy Storage, Molten Salt. INTRODUCTION Concentrating solar power (CSP) can both of the solar field and heat transfer fluid was subcontracted to Flagsol, a joint venture between German firmsSolar2010, the 48th AuSES Annual Conference 1-3 December 2010, Canberra, ACT, Australia A Global

324

Bernhard Grimm, Humboldt University, Berlin, Germany; Robert J. Porra, CSIRO Plant Industry, Canberra, ACT, Australia; Wolfhart Rdiger, Mnchen University, Mnchen,  

E-Print Network [OSTI]

interest in solar energy, this collection on the chlorophylls is most timely, covering the latest aspects the biological process of photosynthesis to include such topics as solar energy conversion, environmental science, Canberra, ACT, Australia; Wolfhart Rüdiger, München University, München, Germany; Hugo Scheer, München

Govindjee "Gov"

325

Institution of Engineers, Australia 2005 Australian Journal of Electrical & Elecronics Engineering, Vol 2, No.1 technical paper  

E-Print Network [OSTI]

on the astronomical qualities of the site. A Stirling engine and a pair of solar panels power the observatory. Command1 © Institution of Engineers, Australia 2005 Australian Journal of Electrical & Elecronics Engineering, Vol 2, No.1 technical paper * Paper E24/528 submitted 28/05/04. Paper accepted for publication 01

Ashley, Michael C. B.

326

World IMACS / MODSIM Congress, Cairns, Australia 13-17 July 2009 http://mssanz.org.au/modsim09  

E-Print Network [OSTI]

. Keywords: Land surface models, evapotranspiration, latent heat flux, satellite remote sensing Comparison of latent heat flux estimates over Australia Matthew F. McCabe1 , Yi Y. Liu1 , Raghuveer Vinukollu from such data do not contribute to model assessment and calibration. This study compares latent heat

Evans, Jason

327

Pesotum australi sp. nov. and Ophiostoma quercus associated with Acacia mearnsii trees in Australia and Uganda, respectively  

E-Print Network [OSTI]

and Uganda, respectively G. Kamgan NkuekamA,C , K. JacobsB , Z. W. de BeerA , M. J. WingfieldA and J. Roux disease surveys in Uganda, as well as studies of fungi infecting wounds on Acacia mearnsii trees in Uganda was the only species collected from multiple collections in Uganda. Collections from Australia represent a new

328

8TH INTERNATIONAL SYMPOSIUM ON PARTICLE IMAGE VELOCIMETRY -PIV09 Melbourne, Victoria, Australia, August 25-28, 2009  

E-Print Network [OSTI]

8TH INTERNATIONAL SYMPOSIUM ON PARTICLE IMAGE VELOCIMETRY - PIV09 Melbourne, Victoria, Australia, August 25-28, 2009 Studying the invariants of the velocity-gradient tensor of a round turbulent jet using Soria2 1 Department of Mechanical Engineering, University of Melbourne, Melbourne, Victoria, 3010

Marusic, Ivan

329

IMPACT OF THE CLIMATE ON THE DESIGN OF LOW-ENERGY BUILDINGS FOR AUSTRALIA AND REUNION ISLAND  

E-Print Network [OSTI]

IMPACT OF THE CLIMATE ON THE DESIGN OF LOW-ENERGY BUILDINGS FOR AUSTRALIA AND REUNION ISLAND B of low energy building. This approach is to perform a real evaluation of the sensation of thermal comfort of targets at low energy, some basic principles can be identical and can be applied around the world

Paris-Sud XI, Université de

330

THE AUSTRALIA TELESCOPE COMPACT ARRAY H I SURVEY OF THE GALACTIC CENTER  

SciTech Connect (OSTI)

We present a survey of atomic hydrogen (H I) emission in the direction of the Galactic Center (GC) conducted with the CSIRO Australia Telescope Compact Array (ATCA). The survey covers the area -5 Degree-Sign {<=} l {<=} +5 Degree-Sign , -5 Degree-Sign {<=} b {<=} +5 Degree-Sign over the velocity range -309 km s{sup -1} {<=} v{sub LSR} {<=} 349 km s{sup -1} with a velocity resolution of 1 km s{sup -1}. The ATCA data are supplemented with data from the Parkes Radio Telescope for sensitivity to all angular scales larger than the 145'' angular resolution of the survey. The mean rms brightness temperature across the field is 0.7 K, except near (l, b) = 0 Degree-Sign , 0 Degree-Sign where it increases to {approx}2 K. This survey complements the Southern Galactic Plane Survey to complete the continuous coverage of the inner Galactic plane in H I at {approx}2' resolution. Here, we describe the observations and analysis of this GC survey and present the final data product. Features such as Bania's Clump 2, the far 3 kpc arm, and small high-velocity clumps are briefly described.

McClure-Griffiths, N. M.; Green, J. A. [Australia Telescope National Facility, CSIRO Astronomy and Space Science, Marsfield, NSW 2122 (Australia); Dickey, J. M. [School of Physics and Mathematics, University of Tasmania, TAS 7001 (Australia); Gaensler, B. M.; Green, A. J. [Sydney Institute for Astronomy, School of Physics, University of Sydney, NSW 2006 (Australia); Haverkorn, M., E-mail: naomi.mcclure-griffiths@csiro.au, E-mail: james.green@csiro.au, E-mail: john.dickey@utas.edu.au, E-mail: bryan.gaensler@sydney.edu.au, E-mail: anne.green@sydney.edu.au, E-mail: m.haverkorn@astro.ru.nl [Department of Astrophysics/IMAPP, Radboud University, Nijmegen, 6500 GL Nijmegen (Netherlands)

2012-03-01T23:59:59.000Z

331

Estimating parameters of coalescing compact binaries with a detector network including LIGO Australia  

E-Print Network [OSTI]

One of the goals of gravitational-wave astronomy is simultaneous detection of gravitational-wave signals from merging compact-object binaries and the electromagnetic transients from these mergers. With the next generation of advanced ground-based gravitational wave detectors under construction, we examine the benefits of the proposed extension of the detector network to include a fourth site in Australia in addition to the network of Hanford, Livingston and Cascina sites. Using Bayesian parameter-estimation analyses of simulated gravitational-wave signals from a range of coalescing-binary locations and orientations, we study the improvement in parameter estimation. We find that an Australian detector can break degeneracies in several parameters; in particular, the localization of the source on the sky is improved by a factor of ~4, with more modest improvements in distance and binary inclination estimates. This enhanced ability to localize sources on the sky will be crucial in any search for electromagnetic counterparts to detected gravitational-wave signals.

Benjamin Aylott; Benjamin Farr; Vassiliki Kalogera; Ilya Mandel; Vivien Raymond; Carl Rodriguez; Marc van der Sluys; Alberto Vecchio; John Veitch

2011-12-29T23:59:59.000Z

332

Changes in airborne lead particulate in Port Pirie, South Australia, 1986-1996  

SciTech Connect (OSTI)

Port Pirie is 230 km north of Adelaide, the capital of South Australia. The major industry in the city is a lead smelter owned by Pasminco. Fume, dust, and fugitive emissions from the smelter have been deposited in and around Port Pirie over the past 100 years. The results presented in this paper are from an air monitoring station situated at the southeast entrance of the smelter, approximately 600 m from the blast furnace. Measurements include total suspended particulate (TSP) and total suspended particulate lead (TSPL) reported as concentrations ({micro}g/m{sup 3}). Data are available from 1986 to 1996 and consist of 548 measurements. Analysis of geometric mean concentration levels by wind direction showed that while for TSP there was little relationship with wind direction, TSPL increased substantially as the wind came from the direction of the smelter. An analysis of geometric mean concentration levels by wind speed showed that TSP was significantly correlated with wind speed for all wind sectors apart from winds coming from the smelter production area.

Esterman, A.J.; Maynard, E.J. [South Australian Health Commission, Adelaide, South Australia (Australia). Environmental Health Branch] [South Australian Health Commission, Adelaide, South Australia (Australia). Environmental Health Branch

1998-11-01T23:59:59.000Z

333

Contributions to the cranial morphology of selected Australian Leptodactylidae (Anura)  

E-Print Network [OSTI]

Mew South Wales, Australia. Adelotus brevis Ogilby, S. V. 36, female, Slevin, Ulong, Australia. ~83 ' Ht 8 1 6 *, HV. 45, f 1, 9 H, 1958, Colac, 98 mi. W. Melbourne, Victoria, Australia. Philoria frosti Spencer, S. V. 50, female, Mt. Baw Baw...

Bassinger, Clarence Alfred

1969-01-01T23:59:59.000Z

334

Resilient Event Detection in Wireless Sensor Networks Angelika Herbold1  

E-Print Network [OSTI]

, Nirupama Bulusu3 and Sanjay Jha4 1 Western Washington University, USA 2 ENSEIRB, France 3 Systems Software University of New South Wales, Australia and National ICT Australia Limited, Randwick, Australia herbola2@cc between nodes is loss prone and a major energy consumer[4], and the networks are tightly coupled

Bulusu, Nirupama

335

Continuously tunable band gap in GaN/AlN (0001) superlattices via built-in electric field X. Y. Cui,1 D. J. Carter,1,2 M. Fuchs,3 B. Delley,4 S. H. Wei,5 A. J. Freeman,6 and C. Stampfl1  

E-Print Network [OSTI]

Institute, Curtin University of Technology, Perth, Western Australia 6845, Australia 3Fritz of Physics, The University of Sydney, Sydney, New South Wales 2006, Australia 2Nanochemistry Research, CH-5232 Villigen PSI, Switzerland 5 National Renewable Energy Laboratory, 1617 Cole Boulevard, Golden

336

Proceedings of the Centre for Mathematical Analysis  

E-Print Network [OSTI]

on CHAOS & ORDER 1­3 February 1990 Canberra, Australia Editors Nalini Joshi Centre for Mathematical University G.P.O. Box 4 Canberra, A.C.T. 2601 AUSTRALIA ABSTRACT In this paper we propose a new optimization of Mathematics University of New South Wales, Australia Robert L. Dewar Department of Theoretical Physics

Dewar, Robert L.

337

Rapid subsurface warming and circulation changes of Antarctic coastal waters  

E-Print Network [OSTI]

5 , and Nicolas C. Jourdain2,6 1 ARC Centre of Excellence for Climate System Science, University of New South Wales, Sydney, New South Wales, Australia, 2 Climate Change Research Centre, University, Princeton, New Jersey, USA, 4 ARC Centre of Excellence for Climate System Science and Research School

England, Matthew

338

On the Persistence of Cold-Season SST Anomalies Associated with the Annular Modes  

E-Print Network [OSTI]

. In the North Atlantic, however, the simple climate model overestimates the persistence of the coldOn the Persistence of Cold-Season SST Anomalies Associated with the Annular Modes LAURA M. CIASTO Climate Change Research Centre, University of New South Wales, Sydney, New South Wales, Australia MICHAEL

England, Matthew

339

Hyperspectral imaging spectroscopy of a Mars analogue environment at the North Pole Dome, Pilbara Craton, Western Australia  

E-Print Network [OSTI]

A visible and near infrared (VNIR) to shortwave infrared (SWIR) hyperspectral dataset of the Early Archaean North Pole Dome, Pilbara Craton, Western Australia, has been analysed for indications of hydrothermal alteration. Occurrence maps of hydrothermal alteration minerals were produced. It was found that using a spatial resolution on the ground of approximately 5 m and spectral coverage from 0.4 to 2.5 mm was sufficient to delineate several hydrothermal alteration zones and associated veins, including phyllic, serpentinitic and chloritic alteration. These results suggest this level of spectral and spatial resolution would be ideal for localising shallow epithermal activity, should such activity have existed, on the surface of Mars.

Brown, Adrian J; Cudahy, Thomas

2014-01-01T23:59:59.000Z

340

Ru-induced loss of long-range magnetic order in a-Fe90 xRuxZr10 Physics Department, McGill University, 3600 University Street, Montreal, Quebec H3A 2T8, Canada  

E-Print Network [OSTI]

, The University of New South Wales, Sydney, NSW 2052, Australia Zin Tun AECL, Chalk River Laboratories, Chalk the DUALSPEC triple-axis spectrometer at AECL, Chalk River. Initial polarizations of 95% at 0.237 nm were

Ryan, Dominic

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Analytica Chimica Acta 642 (2009) 35 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

, University of New South Wales, Sydney, NSW 2052, Australia b Lappeenranta University of Technology, Department of Chemical Technology, P.O. Box 20, FIN-53851 Lappeenranta, Finland c Chemometry Consultancy

Ferreira, Márcia M. C.

342

Composing Services for Third-party Service Delivery Ingo Weber1  

E-Print Network [OSTI]

Composing Services for Third-party Service Delivery Ingo Weber1 , Alistair Barros2 , Norman May3 , J¨org Hoffmann3 , Tomasz Kaczmarek4 1 CSE department, University of New South Wales, Australia, ingo.weber

Hoffmann, Jörg -FR 6.2

343

A Cost-Effective Tag Design for Memory Data Authentication in Embedded Systems  

E-Print Network [OSTI]

-chip memory. We aim to develop a cost effective tag design to counter physical attacks on the insecure off University of New South Wales, Australia {meihong,huig}@cse.unsw.edu.au Technical Report UNSW-CSE-TR-201209

New South Wales, University of

344

AustCham Beijing (China -Australia Chamber of Commerce in Beijing) E Floor, Office Tower, Hong Kong Macau Centre (Swisstel), 2 Chaoyangmenbei Dajie, Beijing 100027, P.R. China  

E-Print Network [OSTI]

AustCham Beijing (China - Australia Chamber of Commerce in Beijing) E Floor, Office Tower, Hong Kong Macau Centre (Swissôtel), 2 Chaoyangmenbei Dajie, Beijing 100027, P.R. China 2 E 100027 E: info inaugural year, the China-Australia Chamber of Commerce Beijing (AustCham Beijing) is pleased to announce

345

The Forestry Commission in Wales 1919 -2013  

E-Print Network [OSTI]

, Forestry Commission, Welsh Government 2012 Esgairgeiliog / Ceinws In Pictures and Words, Past and Present through carbon sequestration and the production of renewable energy. All of these many benefits can

346

UNIVERSITY OF WALES SWANSEA REPORT SERIES  

E-Print Network [OSTI]

and Engineering Research Council of Canada. S.B. Cooper, B. L¨owe, and L. Torenvliet (Eds.): CiE 2005, LNCS 3526

Grant, P. W.

347

Science at NASAScience at NASA Waleed Abdalati  

E-Print Network [OSTI]

, and efficiency of aeronautical and space vehicles; 3) The development and operation of vehicles capable Biological and Physical Processes in the Space Environmentthe Space Environment #12;NASA Organizational Chart #12;NASA Organizational Chart OCSOffice of the d i i OCTAdministrator SMDARMD Centers SMD S0MD

348

Mid Wales Energy Agency | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte GmbH Jump to:Michigan: EnergyChina FinalMicrostaq

349

Global Wind Power Conference September 18-21, 2006, Adelaide, Australia Design and Operation of Power Systems with Large Amounts of Wind Power, first  

E-Print Network [OSTI]

Global Wind Power Conference September 18-21, 2006, Adelaide, Australia Design and Operation of Power Systems with Large Amounts of Wind Power, first results of IEA collaboration Hannele Holttinen1.holttinen@vtt.fi Abstract: An international forum for exchange of knowledge of power system impacts of wind power has been

350

Water Research Centre. School of Applied Science. Canberra C.A.E PO.Box' Be/connen A.C.T. 26/6. Australia.  

E-Print Network [OSTI]

. In a previous report (6) the use of fluorescence spectroscopy to identify petroleum hydrocarbon sources) and flame photometric detectors (FPD) have been used routinely to identify petroleum hydrocarbon sources (7.C.T. 26/6. Australia. Petroleum hydrocarbon pollution of natural waters is a wide spread problem (1

Canberra, University of

351

in: Scott, J.; Dalgarno, B. (eds), Proceedings of OZCHI 99, November 28 -30, 1999, Wagga Wagga, Australia, CSU-Publisher, pp. 105-111  

E-Print Network [OSTI]

in: Scott, J.; Dalgarno, B. (eds), Proceedings of OZCHI ´99, November 28 - 30, 1999, Wagga Wagga Bonn, Germany email: volker@cs.uni-bonn.de http://www.cs.uni-bonn.de/~volker/ #12;in: Scott, J.; Dalgarno, B. (eds), Proceedings of OZCHI ´99, November 28 - 30, 1999, Wagga Wagga, Australia, CSU

352

Bernhard Grimm, Humboldt University, Berlin, Germany; Robert J. Porra, CSIRO Plant Industry, Canberra, ACT, Australia; Wolfhart Rdiger, Mnchen University, Mnchen, Germany; Hugo  

E-Print Network [OSTI]

interest in solar energy, this collection on the chlorophylls is most timely, covering the latest aspects the biological process of photosynthesis to include such topics as solar energy conversion, environmental science, Canberra, ACT, Australia; Wolfhart Rüdiger, München University, München, Germany; Hugo Scheer, München

Govindjee "Gov"

353

The inaugural International Conference on Music Communication Science 5-7 December 2007, Sydney, Australia http://marcs.uws.edu.au/links/ICoMusic  

E-Print Network [OSTI]

, Australia http://marcs.uws.edu.au/links/ICoMusic Proceedings of ICoMCS December 2007 Page 176 SPEECH that the pitch stability of notes so important in Western (and other) music may have come first, not from older information in speech is largely carried by the envelope of the spectrum: how much energy is carried

New South Wales, University of

354

Hydro-climatology: Variability and Change (Proceedings of symposium J-H02 held during IUGG2011 in Melbourne, Australia, July 2011) (IAHS Publ. 344, 2011).  

E-Print Network [OSTI]

Hydro-climatology: Variability and Change (Proceedings of symposium J-H02 held during IUGG2011 in Melbourne, Australia, July 2011) (IAHS Publ. 344, 2011). Copyright © 2011 IAHS Press 195 How could hydro , L. COLLET2 , S. ARDOIN-BARDIN3 & P. ROUCOU4 1 CNRS, 2 UM2, 3 IRD ­ UMR HydroSciences Montpellier

Paris-Sud XI, Université de

355

BIODIVERSITY INVENTORIES: Boletineae (Fungi) in Queensland, Australia The Boletineae (Fungi: Basidiomycetes) is a large suborder (~32 genera) of putrescent mushrooms with  

E-Print Network [OSTI]

BIODIVERSITY INVENTORIES: Boletineae (Fungi) in Queensland, Australia The Boletineae (Fungi in the world. The work outlined in this proposal will provide a first biodiversity inventory of this group this partnership, it will be possible to thoroughly inventory the Boletineae of the rich and varied forests

Hibbett, David S.

356

World Geothermal Congress, Melbourne, Australia, 19-25 April, 2015 TOMO4D: Temporal Changes in Reservoir Structure at Geothermal Areas  

E-Print Network [OSTI]

World Geothermal Congress, Melbourne, Australia, 19-25 April, 2015 TOMO4D: Temporal Changes in Reservoir Structure at Geothermal Areas Bruce Julian, Gillian Foulger, Andrew Sabin, Najwa Mhana Temporal geothermal areas, California, using three-dimensional local-earthquake tomography repeated on a year

Foulger, G. R.

357

NCED Australia Research Update 56th Annual NM Water Conf., New Water New Energy: A Conference Linking Desalination and Renewable Energy  

E-Print Network [OSTI]

Linking Desalination and Renewable Energy 51 NCED Australia Research Update David Furukawa, National New Energy: A Conference Linking Desalination and Renewable Energy 53 9 10 11 12 13 14 #12;December 13 Desalination and Renewable Energy 55 21 22 23 24 25 26 #12;December 13-14, 2011 David Furukawa, National Centre

Johnson, Eric E.

358

Acoustics Australia Vol. 36 April (2008) No. 1 -23 AcoUsTicAl coUPling beTween liP  

E-Print Network [OSTI]

Acoustics Australia Vol. 36 April (2008) No. 1 - 23 AcoUsTicAl coUPling beTween liP vAlves And voc instruments, such as trumpet, tuba, etc, the lips of the player regulate air flow into the instrument which the electrical admittance between one pair of electrodes placed either side of the neck, at the level

New South Wales, University of

359

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

360

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

362

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

363

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

364

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

365

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

366

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

367

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

368

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

369

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

370

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

371

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

372

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

373

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

374

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

375

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

376

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

377

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

378

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

379

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

380

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

382

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

383

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

384

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

385

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

386

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

387

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

388

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

389

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

390

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

391

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

392

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

393

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

394

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

395

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

396

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

397

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

398

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

399

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

400

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

402

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

403

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

404

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

405

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

406

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

407

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

408

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

409

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

410

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

411

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

412

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

413

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

414

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

415

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

416

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

417

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

418

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

419

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

420

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

422

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

423

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

424

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

425

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

426

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

427

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

428

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

429

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

430

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

431

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

432

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

433

Unusual flux-distance relationship for pulsars suggested by analysis of the Australia national telescopy facility pulsar catalogue  

SciTech Connect (OSTI)

We analyze pulsar fluxes at 1400 MHz (S(1400)) and distances d taken from the Australia National Telescope Facility (ATNF) Pulsar Catalogue. Under the assumption that pulsar populations in different parts of the Galaxy are similar, we find that either (a) pulsar fluxes diminish with distance according to a non-standard power law (we suggest S(1400){proportional_to} 1/d rather than {proportional_to} 1/d{sup 2}) or (b) that there are very significant (i.e. order of magnitude) errors in the distance estimates quoted in the ATNF Catalogue. The former conclusion (a) supports a recent model for pulsar emission that has also successfully explained the frequency spectrum of the Crab pulsar over 16 orders of magnitude of frequency, whilst alternative (b) would necessitate a radical re-evaluation of both the dispersion method for estimating pulsar distances and current ideas about the distribution of pulsars within our Galaxy.

Singleton, John [Los Alamos National Laboratory; Perez, M R [Los Alamos National Laboratory; Singleton, J [Los Alamos National Laboratory; Ardavan, H [UNIV OF CAMBRIDGE; Ardavan, A [UNIV OF OXFORD

2009-01-01T23:59:59.000Z

434

University of South Australia Adelaide, Australia  

E-Print Network [OSTI]

Sustainable Built Environments Structures Contract Administration Building Surveying Science Building and Fire Development Law Building Research Project Building Research Integrated Project Industry Based, a library, music rooms, sporting and laundry facilities Colleges are located in North Adelaide - just a 10

Duchowski, Andrew T.

435

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa  

E-Print Network [OSTI]

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University

Albrecht, David

436

Development of Bioinspired Mn4O4-Cubane Water Oxidation Catalysts: Lessons from Photosynthesis  

E-Print Network [OSTI]

efficient system that uses solar energy to oxidize water is the photosystem II water-oxidizing complex (PSII, Victoria 3800, Australia, § Department of Chemistry, Princeton University, Princeton, New Jersey 08540, Intelligent Polymer Research Institute, University of Wollongong, Wollongong, New South Wales 2522, Australia

Lawson, Catherine L.

437

D-STATCOM Control in Distribution Networks with Composite Loads to Ensure Grid Code Compatible Performance of  

E-Print Network [OSTI]

Recently, distributed generation (DG) based on renewable energy sources such as solar, wind etc of New South Wales Canberra, ACT 2600, Australia E-mail: n.roy@student.unsw.edu.au, h.pota@adfa.edu.au M, Australia E-mail: mdapel.mahmud@nicta.com.au M. J. Hossain Griffith School of Engineering Griffith

Pota, Himanshu Roy

438

Key factors affecting voltage oscillations of distribution networks with distributed generation and induction motor loads  

E-Print Network [OSTI]

of distributed energy sources such as, combined heat and power (CHP), wind, solar, and fuel cells, are expected and IT, The University of New South Wales, Canberra, ACT 2600, Australia b Future Grid Research Centre, The University of Melbourne, Parkville, VIC 3010, Australia c Griffith School of Engineering, Griffith University

Pota, Himanshu Roy

439

Physics of Life Reviews 5 (2008) 225242 www.elsevier.com/locate/plrev  

E-Print Network [OSTI]

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231 2.1. How much entropy is produced and how much free energy can be extracted from a solar photon University, Canberra, ACT Australia b Department of Astrophysics, School of Physics, University of New South Wales, Sydney, NSW Australia Received 14 July 2008; received in revised form 7 August 2008; accepted 8

Lineweaver, Charles H.

440

Integrating Real Time and Power Management in a Real System Martin P. Lawitzky  

E-Print Network [OSTI]

§ Stefan M. Petters§ NICTA Sydney, Australia § University of New South Wales Sydney, Australia ¶ TU M. This enables the use of the dynamic slack caused by the variability of execution time, to reduce energy and other thermal dissipation devices, a limited power supply (e.g. a solar powered system), or simply

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

The effect of nutrition and exercise on the level of glycogen in skeletal muscle of sheep  

E-Print Network [OSTI]

Pethick JB Rowe 'School of Veterinary Studies, Murdoch University, 6150 Western Australia ; 2Dept Animal Science, University of New England, Armidale, 2350 New South Wales, Australia A high level of glycogen % barely grain, 1 % mineral/vitamin premix (13.5 % protein and 10.7 MJ metabolisable energy (ME)/kg as fed

Boyer, Edmond

442

CURRENT TESTING ACTIVITIES AT THE ACRELAB RENEWABLE ENERGY SYSTEMS TEST FACILITY , E S Spooner2  

E-Print Network [OSTI]

, AUSTRALIA 2 University of New South Wales, Kensington, NSW, AUSTRALIA 3 Australian CRC for Renewable Energy in a minimum of time. ACRELab was originally conceived as a laboratory for testing remote area power supply and RAPS system components such as inverters. With the growing interest in Grid-connected inverters

443

Kent J. Bradford Curriculum Vita  

E-Print Network [OSTI]

, CSIRO, Division of Plant Industry, Canberra, ACT, Australia, April-August 1990 (with P.M. Chandler Wales, Australia, September 1990-February 1991 (with E.W.R. Barlow and A.M. Haigh). Visiting scientist - Research School of Biological Sciences, Australian National University, Canberra, 1981-1982 (with G

Bradford, Kent

444

Kent J. Bradford Curriculum Vita  

E-Print Network [OSTI]

of Plant Industry, Canberra, ACT, Australia, April-August 1990. Associate Professor - Department, Richmond, New South Wales, Australia, September 1990-February 1991. Visiting scientist, CSIRO, Division Sciences, Australian National University, Canberra, 1981-1982. Ph.D. advisors, U.C. Davis - T.C. Hsiao

Bradford, Kent

445

XVIII International Conference on Water Resources J. Carrera (Ed)  

E-Print Network [OSTI]

University, Canberra, Australia e-mail: mak110@rsphy1.anu.edu.au Key words: porous media, absolute@uts.cc.utexas.edu School of Petroleum Engineering, University of New South Wales, Sydney NSW 2052, Australia e-mail: c

Torres-Verdín, Carlos

446

Shock compression and dynamic fragmentation of geological materials  

E-Print Network [OSTI]

Granite is a fully dense igneous rock originating from a quarry in Western Australia, Australia, while Gosford Sandstone is a porous sedimentary rock originating from a coal mine in New South Wales, Australia. These two samples were chosen because... , A., “Dynamic fragmentation of Lake Quarry Granite”, Pressure, Energy, Temperature & Extreme Rate Conference, April 2014, London. 2. Kirk, S., Braithwaite, C., Williamson, D. & Jardine, A., “Shock Com- pression of Geological Materials”, Twenty...

Kirk, Simon

2014-11-11T23:59:59.000Z

447

Deakin University Victoria, Australia  

E-Print Network [OSTI]

Financial Planning Human Resources Management Interactive Marketing International Business International than 4.5 million people from culturally and linguistically diverse backgrounds. Deakin University and Construction Management Architecture Construction Management Design Facilities Management Arts Anthropology

Duchowski, Andrew T.

448

Simultaneous observations of Schumann resonances in California and Australia: Evidence for intensity modulation by the local height of the D region  

SciTech Connect (OSTI)

Observations are presented of the horizontal magnetic component of Schumann resonance intensities as simultaneously measured at locations in California and Western Australia during two separate intervals September 2-17, 1989, and April 14-21, 1990. For both intervals, diurnal variations of the average magnetic power over the lowest three modes of the Schumann resonances showed substantially different temporal profiles at the California and Western Australia stations, with interstation correlations of 0.51 and 0.39, respectively. A method is demonstrated for determining from these observations the average local time variation of the height of the D region. A height variation is obtained that is nearly identical for the respective analysis intervals, with a minimum height occurring at approximately 1300-1400 LT and a maximum-to-minimum height difference of roughly 50% of the mean. When corrected for the local D region height, the detailed diurnal intensity profiles over the analysis intervals display a greatly improved similarity, with interstation correlation coefficients increasing from 0.51 to 0.70 and from 0.39 to 0.82, respectively. Substantial agreement between the two stations after correction for D region height suggest that such observations could be used to monitor the global totality and variability of lightning, quantitatively and at time resolutions of the order of 10 min or less, in studies of global change.

Sentman, D.D. (Univ. of California, Los Angeles (United States)); Fraser, B.J. (Univ. of Newcastle, New South Wales (Australia))

1991-09-01T23:59:59.000Z

449

Steven Constable studied geology at the University of Western Australia, graduating with first class Honors in 1979 and the Rex T. Prider Medal, awarded to the geology graduate showing the greatest aptitude for research. In 1983  

E-Print Network [OSTI]

Steven Constable studied geology at the University of Western Australia, graduating with first is currently Professor of Geophysics. Constable is interested in all aspects of electrical conductivity exploration" and the 2007 SEG Distinguished Achievement Award to Scripps. During his career Constable has

Constable, Steve

450

GRACE, Remote Sensing and Ground-based Methods in Multi-Scale Hydrology (Proceedings of Symposium J-H01 held during IUGG2011 in Melbourne, Australia, July 2011) (IAHS Publ. 343, 2011).  

E-Print Network [OSTI]

the Advanced Very High Resolution Radiometer (AVHRR) series of satellites (first launched in 1981 Territory 2601, Australia Abstract Vegetation density plays an important role in the water and energy) and Advanced Microwave Scanning Radiometer ­ Earth Observing System (AMSR-E from middle 2002)) to yield a long

Evans, Jason

451

The Journal of the European Association of Studies on Australia, Vol.3. No.2, 2012, ISSN 1988-5946 under the auspices of Coolabah Observatori: Centre d'Estudis  

E-Print Network [OSTI]

, Universitat de Barcelona 2 "Australia's Decision": Uranium Mining and Aboriginal Communities of direct economic rewards. A case in point is that of uranium mining which, well after the Second World War with uranium mining for peaceful purposes at Ranger (Northern Territory), and comparing it with the more recent

Paris-Sud XI, Université de

452

Draining the Pool: Electricity Trading in England & Wales  

E-Print Network [OSTI]

of reform · Most customers got lower prices · Electricity company profits rose · Large-scale entry by CCGT

California at Berkeley. University of

453

U21 Summer School 2014 University of New South Wales  

E-Print Network [OSTI]

at UNSW from, for example: UNSW, CityFutures Research Centre Climate Change Research Centre issues of suburbanisation, public transport, food systems, metropolitan-scale planning, green building with the City of Sydney Field trips around the city to visit award-winning buildings and urban landscapes

Guo, Zaoyang

454

SCHOOL OF PHYSICS UNIVERSITY OF NEW SOUTH WALES  

E-Print Network [OSTI]

or strain), and at the same time are environmentally friendly (that do not waste energy and are low power to light. More importantly, the recent breakthrough in their industrial scale fabrication is paving the way unprecedented opportunities in transforming the industry with impact in several fundamental areas: energy

Blennerhassett, Peter

455

Assessment of Uncertainty in Cloud Radiative Effects and Heating Rates through Retrieval Algorithm Differences: Analysis using 3-years of ARM data at Darwin, Australia  

SciTech Connect (OSTI)

Ground-based radar and lidar observations obtained at the Department of Energy’s Atmospheric Radiation Measurement Program’s Tropical Western Pacific site located in Darwin, Australia are used to retrieve ice cloud properties in anvil and cirrus clouds. Cloud microphysical properties derived from four different retrieval algorithms (two radar-lidar and two radar only algorithms) are compared by examining mean profiles and probability density functions of effective radius (Re), ice water content (IWC), extinction, ice number concentration, ice crystal fall speed, and vertical air velocity. Retrieval algorithm uncertainty is quantified using radiative flux closure exercises. The effect of uncertainty in retrieved quantities on the cloud radiative effect and radiative heating rates are presented. Our analysis shows that IWC compares well among algorithms, but Re shows significant discrepancies, which is attributed primarily to assumptions of particle shape. Uncertainty in Re and IWC translates into sometimes-large differences in cloud radiative effect (CRE) though the majority of cases have a CRE difference of roughly 10 W m-2 on average. These differences, which we believe are primarily driven by the uncertainty in Re, can cause up to 2 K/day difference in the radiative heating rates between algorithms.

Comstock, Jennifer M.; Protat, Alain; McFarlane, Sally A.; Delanoe, Julien; Deng, Min

2013-05-22T23:59:59.000Z

456

VOLUME 78, NUMBER 22 P H Y S I C A L R E V I E W L E T T E R S 2 JUNE 1997 Stability Ordering of Cycle Expansions  

E-Print Network [OSTI]

· · · Lk . (1) The sum is over all distinct nonrepeating combinations of prime cycles, t is the period of Cycle Expansions C. P. Dettmann and G. P. Morriss School of Physics, University of New South Wales, Sydney 2052, Australia (Received 3 December 1996) We propose that cycle expansions be ordered

Dettmann, Carl

457

Ru--INDUCED LOSS OF LONGRANGE MAGNETIC ORDER IN a\\GammaF e 90\\Gammax Ru x Zr 10  

E-Print Network [OSTI]

School of Physics, The University of New South Wales, Sydney, NSW 2052, Australia Zin Tun AECL, Chalk at AECL, Chalk River. Initial polarisations of ¸95% at â?? =0.237 nm were achieved with Cu 2 MnAl 2 #12

Ryan, Dominic

458

GEOPHYSICAL RESEARCH LETTERS, VOL. ???, NO. , PAGES 114, Mechanisms of the Southern Ocean1  

E-Print Network [OSTI]

meridional heat transport response to2 projected wind changes3 Paul Spence Climate Change Research Centre demonstrating that an33 enhanced eddy heat flux can offset the cooling enduced by changes in Ekman pumping34 (e, University of New South Wales, Sydney,4 NSW, Australia5 Oleg A. Saenko Canadian Centre for Climate Modelling

England, Matthew

459

Human Activity Recognition for Indoor Positioning using Smartphone Accelerometer  

E-Print Network [OSTI]

in the map without any external aid. Human activity recognition (HAR), therefore, could become a potential techniques [24]. However, to realize the positioning potential of HAR, we have to address several practical South Wales, Australia {sarak,mahbub}@cse.unsw.edu.au 2 School of Electrical and Telecommunication

New South Wales, University of

460

A thermo-hydro-mechanical coupled model in local thermal non-equilibrium for fractured HDR reservoir  

E-Print Network [OSTI]

A thermo-hydro-mechanical coupled model in local thermal non-equilibrium for fractured HDR of New South Wales, Sydney 2052, Australia. Abstract The constitutive thermo-hydro-mechanical equations is next applied to simulate circulation tests at the Fenton Hill HDR reservoir. The finer thermo-hydro

Boyer, Edmond

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

NATURE |VOL 404 |9 MARCH 2000 |www.nature.com 145 Cenozoic motion between  

E-Print Network [OSTI]

of Oceanography, La Jolla, California 92093-0215, USA ² California Institute of Technology, Mail Stop 252 Wales 2006, Australia § Geological Survey of Japan, 1-1-3 Higashi, Tsukuba, Ibaraki 305-8567, Japan and magnitude of the plate motions leading to the development of this rift system remain poorly known, because

Müller, Dietmar

462

Preprints, 5th Australian Severe Thunderstorm Conference Bureau of Meteorology, 29 July -2 August, 1996  

E-Print Network [OSTI]

process. In this age when numeri- cal weather prediction (NWP) models and their associated statistical, 1996 Avoca Beach, New South Wales, Australia Science, Numerical Models, and Forecasting An Overview: numerical modeling has come to the point where it too must consider revolutionary change. New numerical

Doswell III, Charles A.

463

Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use.  

E-Print Network [OSTI]

, thin-film filtering, gratings, photonic crystals, lenses, parabolic mirrors, optical fibres, solid-state, University of Sydney, Sydney, New South Wales, Australia We regard Advances in Insect Physiology with the angle of viewing, as measured from the surface normal. The same effects can be achieved, for instance

Giron, David - Institut de Recherche sur la Biologie de l'Insecte, Université François Rabelais

464

WS-Policy4MASC A WS-Policy Extension Used in the Manageable and Adaptable Service Compositions (MASC) Middleware  

E-Print Network [OSTI]

WS-Policy4MASC ­ A WS-Policy Extension Used in the Manageable and Adaptable Service Compositions, University of Western Ontario, London, Ontario, Canada 3 IBM India Research Lab, New Delhi, India vladat of Computer Science and Engineering The University of New South Wales NSW 2052, Australia #12;Abstract WS-Policy

New South Wales, University of

465

A MAXIMAL THEOREM FOR HOLOMORPHIC SEMIGROUPS by GORDON BLOWER  

E-Print Network [OSTI]

of New South Wales, NSW, 2052, Australia) [3 April 2004] Abstract Let X be a closed linear subspace of the Lebesgue space Lp (, µ) for some 1 invertible operator that is the generator norm f D(V ) = f Lp + V f Lp . For 0 power A such that D

Doust, Ian

466

A MAXIMAL THEOREM FOR HOLOMORPHIC SEMIGROUPS by GORDON BLOWER +  

E-Print Network [OSTI]

of New South Wales, NSW, 2052, Australia) [3 April 2004] Abstract Let X be a closed linear subspace of the Lebesgue space L p(# , µ) for some 1 invertible operator that is the generator a fractional power A # such that D(A # ) contains D(A), and A -# is bounded whenever A has bounded inverse; see

Doust, Ian

467

Reconciling Ground-Based and Space-Based Estimates of the Frequency of Occurrence and Radiative Effect of Clouds around Darwin, Australia  

SciTech Connect (OSTI)

The objective of this paper is to investigate whether estimates of the cloud frequency of occurrence and associated cloud radiative forcing as derived from ground-based and satellite active remote sensing and radiative transfer calculations can be reconciled over a well instrumented active remote sensing site located in Darwin, Australia, despite the very different viewing geometry and instrument characteristics. It is found that the ground-based radar-lidar combination at Darwin does not detect most of the cirrus clouds above 10 km (due to limited lidar detection capability and signal obscuration by low-level clouds) and that the CloudSat radar - Cloud-Aerosol Lidar with Orthogonal Polarization (CALIOP) combination underreports the hydrometeor frequency of occurrence below 2 km height, due to instrument limitations at these heights. The radiative impact associated with these differences in cloud frequency of occurrence is large on the surface downwelling shortwave fluxes (ground and satellite) and the top-of atmosphere upwelling shortwave and longwave fluxes (ground). Good agreement is found for other radiative fluxes. Large differences in radiative heating rate as derived from ground and satellite radar-lidar instruments and RT calculations are also found above 10 km (up to 0.35 Kday-1 for the shortwave and 0.8 Kday-1 for the longwave). Given that the ground-based and satellite estimates of cloud frequency of occurrence and radiative impact cannot be fully reconciled over Darwin, caution should be exercised when evaluating the representation of clouds and cloud-radiation interactions in large-scale models and limitations of each set of instrumentation should be considered when interpreting model-observations differences.

Protat, Alain; Young, Stuart; McFarlane, Sally A.; L'Ecuyer, Tristan; Mace, Gerald G.; Comstock, Jennifer M.; Long, Charles N.; Berry, Elizabeth; Delanoe, Julien

2014-02-01T23:59:59.000Z

468

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

469

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

470

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

471

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

472

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

473

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

474

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

475

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

476

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

477

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

478

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

479

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

480

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

Note: This page contains sample records for the topic "wales australia zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

482

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

483

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

484

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

485

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

486

University of Sydney Australie | Australia  

E-Print Network [OSTI]

established in the past two years. However, you are not limited to these courses. We encourage you to perform and Social Protest SCLG2624 POL4189 Arts Media Globalisation MECO3605 CMN2168 Arts Global Political Economy

Petriu, Emil M.

487

Oxley Creek Common Brisbane, Australia  

E-Print Network [OSTI]

right about 100 m after the bridge over Oxley Creek. The gate is always open. Amenities The main and turn left before the bridge crossing Oxley Creek. If approaching from the west (Sherwood side) turn. Both Rainbow and Scaly-breasted Lorikeets fly over in small screeching flocks. Golden-headed Cisticola

Queensland, University of

488

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

489

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

490

Owen, Noel L. (1987) BSc, U. of Wales, 1960; PhD, Cambridge U., England, 1964; DSc, U. of Wales, 1983.  

E-Print Network [OSTI]

engineers design pipeline systems, water treatment plants, dams, flood control structures, waste disposal. Environmental engineers evaluate and reduce pollutants from natural, human, agricultural, and industrial sources to preserve the beauty and quality of air, land, and water. Geotechnical engineers design structures composed

Hart, Gus

491

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

492

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

493

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

494

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

495

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

496

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

497

Innovative Research Universities Australia Discussion Paper  

E-Print Network [OSTI]

funding of Australian universities August 2005 Flinders University h Griffith University h La Trobe Stream funding of Australian universities August 2005 Background to this Paper At the recent National invited the university sector to provide "the basis upon which a third stream funding model might

498

Iceberg water transportation from Antarctica to Australia.  

E-Print Network [OSTI]

??The amount of iceberg water that annually dissolves into the sea corresponds to a substantial part of the world’s annual consumption of freshwater. The Australian… (more)

Spandonide, B

2012-01-01T23:59:59.000Z

499

Coal remains a hot commodity for Australia  

SciTech Connect (OSTI)

Based largely on analyses by the Australian Bureau of Agricultural and Resource Economics in late 2005 and early 2006, the article looks at the recent and near future export market for Australian coal. Demand in Asia is growing; European demand remains steady. Developments existing and new mines in Queensland are summarised in the article. 3 tabs.

Bram, L.

2006-02-15T23:59:59.000Z

500

HIGH COURT OF AUSTRALIA PARKES PLACE  

E-Print Network [OSTI]

19a: 10.15am: Part Heard: Samsung Electronics Aust PL, Lg Electronics Aust PL. Yates J: Ct Rm 19d: 9 Electronics Co. Ltd. Buchanan J: Ct Rm 22a: 9.30am: Directions: Coshott & anor, Coshott & ors. 11am

Peters, Richard