National Library of Energy BETA

Sample records for visualizing lignin coalescence

  1. Coalescence preference in densely packed microbubbles

    SciTech Connect (OSTI)

    Kim, Yeseul; Lim, Su Jin; Gim, Bopil; Weon, Byung Mook

    2015-01-13

    A bubble merged from two parent bubbles with different size tends to be placed closer to the larger parent. This phenomenon is known as the coalescence preference. Here we demonstrate that the coalescence preference can be blocked inside a densely packed cluster of bubbles. We utilized high-speed high-resolution X-ray microscopy to clearly visualize individual coalescence events inside densely packed microbubbles with a local packing fraction of ~40%. Thus, the surface energy release theory predicts an exponent of 5 in a relation between the relative coalescence position and the parent size ratio, whereas our observation for coalescence in densely packed microbubbles shows a different exponent of 2. We believe that this result would be important to understand the reality of coalescence dynamics in a variety of packing situations of soft matter.

  2. Coalescence preference in densely packed microbubbles

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kim, Yeseul; Lim, Su Jin; Gim, Bopil; Weon, Byung Mook

    2015-01-13

    A bubble merged from two parent bubbles with different size tends to be placed closer to the larger parent. This phenomenon is known as the coalescence preference. Here we demonstrate that the coalescence preference can be blocked inside a densely packed cluster of bubbles. We utilized high-speed high-resolution X-ray microscopy to clearly visualize individual coalescence events inside densely packed microbubbles with a local packing fraction of ~40%. Thus, the surface energy release theory predicts an exponent of 5 in a relation between the relative coalescence position and the parent size ratio, whereas our observation for coalescence in densely packed microbubblesmore » shows a different exponent of 2. We believe that this result would be important to understand the reality of coalescence dynamics in a variety of packing situations of soft matter.« less

  3. Lignin | Open Energy Information

    Open Energy Info (EERE)

    Lignin Jump to: navigation, search Lignin.jpg What is Lignin? Lignin is the fiber in our food, the thing that makes vegetables crunchy and firm. It is a polymer found extensively...

  4. Bacterial extracellular lignin peroxidase

    DOE Patents [OSTI]

    Crawford, Donald L. (Moscow, ID); Ramachandra, Muralidhara (Moscow, ID)

    1993-01-01

    A newly discovered lignin peroxidase enzyme is provided. The enzyme is obtained from a bacterial source and is capable of degrading the lignin portion of lignocellulose in the presence of hydrogen peroxide. The enzyme is extracellular, oxidative, inducible by lignin, larch wood xylan, or related substrates and capable of attacking certain lignin substructure chemical bonds that are not degradable by fungal lignin peroxidases.

  5. Bacterial extracellular lignin peroxidase

    DOE Patents [OSTI]

    Crawford, D.L.; Ramachandra, M.

    1993-08-03

    DNA constructs are provided for the production of Streptomyces lignin peroxidase. The enzyme finds use in the degradation of lignin and oxidation of organic substrates.

  6. Lignin nanoparticle synthesis

    DOE Patents [OSTI]

    Dirk, Shawn M.; Cicotte, Kirsten Nicole; Wheeler, David R.; Benko, David A.

    2015-08-11

    A method including reducing a particle size of lignin particles to an average particle size less than 40 nanometers; after reducing the particle size, combining the lignin particles with a polymeric material; and forming a structure of the combination. A method including exposing lignin to a diazonium precursor including a functional group; modifying the lignin by introducing the functional group to the lignin; and combining the modified lignin with a polymeric material to form a composite. An apparatus including a composite of a polymer and lignin wherein the lignin has an average particle size less than 100 micrometers.

  7. Bacterial extracellular lignin peroxidase

    DOE Patents [OSTI]

    Crawford, Donald L. (Moscow, ID); Ramachandra, Muralidhara (Wilmington, DE)

    1993-01-01

    DNA constructs are provided for the production of Streptomyces lignin peroxidase. The enzyme finds use in the degradation of lignin and oxidation of organic substrates.

  8. ULTRAMASSIVE BLACK HOLE COALESCENCE

    SciTech Connect (OSTI)

    Khan, Fazeel Mahmood; Holley-Bockelmann, Kelly; Berczik, Peter E-mail: k.holley@vanderbilt.edu

    2015-01-10

    Although supermassive black holes (SMBHs) correlate well with their host galaxies, there is an emerging view that outliers exist. Henize 2-10, NGC4889, and NGC1277 are examples of SMBHs at least an order of magnitude more massive than their host galaxy suggests. The dynamical effects of such ultramassive central black holes is unclear. Here, we perform direct N-body simulations of mergers of galactic nuclei where one black hole is ultramassive to study the evolution of the remnant and the black hole dynamics in this extreme regime. We find that the merger remnant is axisymmetric near the center, while near the large SMBH influence radius, the galaxy is triaxial. The SMBH separation shrinks rapidly due to dynamical friction, and quickly forms a binary black hole; if we scale our model to the most massive estimate for the NGC1277 black hole, for example, the timescale for the SMBH separation to shrink from nearly a kiloparsec to less than a parsec is roughly 10Myr. By the time the SMBHs form a hard binary, gravitational wave emission dominates, and the black holes coalesce in a mere few Myr. Curiously, these extremely massive binaries appear to nearly bypass the three-body scattering evolutionary phase. Our study suggests that in this extreme case, SMBH coalescence is governed by dynamical friction followed nearly directly by gravitational wave emission, resulting in a rapid and efficient SMBH coalescence timescale. We discuss the implications for gravitational wave event rates and hypervelocity star production.

  9. Modulating lignin in plants

    DOE Patents [OSTI]

    Apuya, Nestor; Bobzin, Steven Craig; Okamuro, Jack; Zhang, Ke

    2013-01-29

    Materials and methods for modulating (e.g., increasing or decreasing) lignin content in plants are disclosed. For example, nucleic acids encoding lignin-modulating polypeptides are disclosed as well as methods for using such nucleic acids to generate transgenic plants having a modulated lignin content.

  10. Lignin Valorization-final-sm

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Discovering effective methods of depolymerizing lignin will improve economics of biorefineries and create a renewable resource for chemicals Biofuels: Increasing the Value of Lignin Lignin Valorization Current lignocellulose biomass conversion to biofuels requires the breakdown of lignin to liberate sugars that can be converted into advanced fuels. The process results in a significant amount of lignin waste product that could be utilized for other byproducts improving the economics for

  11. Fluorescence analyzer for lignin

    DOE Patents [OSTI]

    Berthold, John W.; Malito, Michael L.; Jeffers, Larry

    1993-01-01

    A method and apparatus for measuring lignin concentration in a sample of wood pulp or black liquor comprises a light emitting arrangement for emitting an excitation light through optical fiber bundles into a probe which has an undiluted sensing end facing the sample. The excitation light causes the lignin concentration to produce fluorescent emission light which is then conveyed through the probe to analyzing equipment which measures the intensity of the emission light. Measures a This invention was made with Government support under Contract Number DOE: DE-FC05-90CE40905 awarded by the Department of Energy (DOE). The Government has certain rights in this invention.

  12. Lignin blockers and uses thereof

    DOE Patents [OSTI]

    Yang, Bin; Wyman, Charles E.

    2011-01-25

    Disclosed is a method for converting cellulose in a lignocellulosic biomass. The method provides for a lignin-blocking polypeptide and/or protein treatment of high lignin solids. The treatment enhances cellulase availability in cellulose conversion and allows for the determination of optimized pretreatment conditions. Additionally, ethanol yields from a Simultaneous Saccharification and Fermentation process are improved 5-25% by treatment with a lignin-blocking polypeptide and/or protein. Thus, a more efficient and economical method of processing lignin containing biomass materials utilizes a polypeptide/protein treatment step that effectively blocks lignin binding of cellulase.

  13. Lignin blockers and uses thereof

    SciTech Connect (OSTI)

    Yang, Bin; Wyman, Charles E

    2013-11-12

    Disclosed is a method for converting cellulose in a lignocellulosic biomass. The method provides for a lignin-blocking polypeptide and/or protein treatment of high lignin solids. The treatment enhances cellulase availability in cellulose conversion and allows for the determination of optimized pretreatment conditions. Additionally, ethanol yields from a Simultaneous Saccharification and Fermentation process are improved 5-25% by treatment with a lignin-blocking polypeptide and/or protein.

  14. Lignin Valorization-final-sm

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    route that uses a hydrogen donor solvent, rather than gaseous hydrogen for tandem depolymerization and hydrogenation of lignin to smaller molecules. The approach...

  15. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Coalescence and Chemical Equilibrium in Multifragmentation at Intermediate Energies, T. J. Keutgen, ACS Meeting 2001, San Diego, California, (April 2001). * Superallowed Beta ...

  16. Reducing Plant Lignin for Cheaper Biofuels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reducing Plant Lignin for Cheaper Biofuels Reducing Plant Lignin for Cheaper Biofuels Print Wednesday, 04 May 2016 12:11 Lignin is a polymer that permeates plant cell walls. Although beneficial to the plant, the lignin must be chemically broken down in a costly pretreatment step before the sugars inside can be released and fermented into useful chemicals and fuels. Previous attempts to silence lignin-producing genes resulted in weak plants with a lower sugar yield. In this work, researchers

  17. Visualization

    Office of Scientific and Technical Information (OSTI)

    Visualization of Force Fields in Protein Structure Prediction Clark Crawford ∗ Oliver Kreylos † Bernd Hamann ‡ Silvia Crivelli § ABSTRACT The force fields used in molecular computational biology are not mathematically defined in such a way that their representation would facilitate a straightforward application of volume visualiza- tion techniques. To visualize energy, it is necessary to define a spa- tial mapping for these fields. Equipped with such a mapping, we can generate volume

  18. Functionalized lignin, rubber containing functionalized lignin and products containing such rubber composition

    DOE Patents [OSTI]

    Benko, David Andrew; Hahn, Bruce Raymond; Cohen, Martin Paul; Dirk, Shawn Matthew; Cicotte, Kirsten Nicole

    2014-03-04

    The invention relates to functionalized lignin, rubber compositions which contain functionalized lignin and to products which have at least one component comprised of such rubber composition.

  19. Hydrodynamic effects on coalescence. (Technical Report) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Hydrodynamic effects on coalescence. Citation Details In-Document Search Title: Hydrodynamic effects on coalescence. The goal of this project was to design, build and test novel diagnostics to probe the effect of hydrodynamic forces on coalescence dynamics. Our investigation focused on how a drop coalesces onto a flat surface which is analogous to two drops coalescing, but more amenable to precise experimental measurements. We designed and built a flow cell to create an axisymmetric compression

  20. Lignin-assisted coal depolymerization

    SciTech Connect (OSTI)

    Lalvani, S.B.

    1991-01-01

    Previous research has shown that addition of lignin-derived liquids to coal stirred in tetralin under mild reaction conditions (375{degree}C and 300--500 psig) results in a marked enhancement in the rate of coal depolymerization. A mathematical model was developed to study the kinetics of coal depolymerization in the presence of liquid-derived liquids. In the present study, a reaction pathway was formulated to explain the enhancement in coal depolymerization due to lignin (solid) addition. The model postulated assumes that the products of lignin obtained during thermolysis interact with the reactive moieties present in coal while simultaneous depolymerization of coal occurs. A good fit between the experimental data and the kinetic model was found. The results show that in addition to the enhancement in the rate of coal depolymerization, lignin also reacts (and enhances the extent of depolymerization of coal) with those reaction sites in coal that are not susceptible to depolymerization when coal alone is reacted in tetralin under identical reaction conditions. Additional work is being carried out to determine a thorough materials balance on the lignin-assisted coal depolymerization process. A number of liquid samples have been obtained which are being studied for their stability in various environments. 5 refs., 4 figs., 1 tab.

  1. Liquid Fuels from Lignins: Annual Report

    SciTech Connect (OSTI)

    Chum, H. L.; Johnson, D. K.

    1986-01-01

    This task was initiated to assess the conversion of lignins into liquid fuels, primarily of lignins relevant to biomass-to-ethanol conversion processes. The task was composed of a literature review of this area and an experimental part to obtain pertinent data on the conversion of lignins germane to biomass-to-ethanol conversion processes.

  2. Cationic electrodepositable coating composition comprising lignin

    DOE Patents [OSTI]

    Fenn, David; Bowman, Mark P; Zawacky, Steven R; Van Buskirk, Ellor J; Kamarchik, Peter

    2013-07-30

    A cationic electrodepositable coating composition is disclosed. The present invention in directed to a cationic electrodepositable coating composition comprising a lignin-containing cationic salt resin, that comprises (A) the reaction product of: lignin, an amine, and a carbonyl compound; (B) the reaction product of lignin, epichlorohydrin, and an amine; or (C) combinations thereof.

  3. Morphological changes in the cellulose and lignin components of biomass occur at different stages of steam pretreatment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pingali, Sai Venkatesh; O'Neill, Hugh Michael; Nishiyama, Yoshiharu; He, Lilin; Melnichenko, Yuri B.; Urban, Volker S.; Petridis, Loukas; Davison, Brian H.; Langan, Paul

    2014-01-09

    Morphological changes to the different components of lignocellulosic biomass were observed as they occurred during steam pretreatment by placing a pressure reaction cell in a neutron beam and collecting time-resolved neutron scattering data. Changes to cellulose morphology occurred mainly in the heating phase, whereas changes in lignin morphology occurred mainly in the holding and cooling phases. During the heating stage, water is irreversibly expelled from cellulose microfibrils as the elementary fibrils coalesce. During the holding phase lignin aggregates begin to appear and they increase in size most noticeably during the cooling phase. This experiment demonstrates the unique information that inmore » situ small angle neutron scattering studies of pretreatment can provide. This approach is potentially useful in optimizing the heating, holding and cooling stages of pretreatments to allow the exact size and nature of lignin aggregates to be controlled in order to enhance enzyme accessibility to cellulose and therefore the efficiency of biomass conversion.« less

  4. Method of altering lignin in trees

    DOE Patents [OSTI]

    MacKay, J.; O`Malley, D.; Whetten, R.; Sederoff, R.

    1998-10-20

    Methods of providing and breeding trees having more easily extractable lignin due to the presence of a cinnamyl alcohol dehydrogenase (Cad) null gene are presented. 16 figs.

  5. Biological Lignin Depolymerization Presentation for BETO 2015...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    3 | Bioenergy Technologies Office Quad Chart * Start date: October 2014 * End date: ... Lignin Utilization, Biochemical Platform Analysis, Pilot Scale Integration, Enzyme ...

  6. Method of altering lignin in trees

    DOE Patents [OSTI]

    MacKay, John; O'Malley, David; Whetten, Ross; Sederoff, Ronald

    1998-01-01

    Methods of providing and breeding trees having more easily extractable lignin due to the presence of a cinnamyl alcohol dehydrogenase (Cad) null gene are presented.

  7. Modification of Lignin Content of Plant Cell Walls - Energy Innovation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Return to Search Modification of Lignin Content of Plant Cell Walls Brookhaven National ... methyltransferases to reduce the lignin content and cross-linking in plant cell walls. ...

  8. Roles of Small Laccases from Streptomyces in Lignin Degradation...

    Office of Scientific and Technical Information (OSTI)

    Roles of Small Laccases from Streptomyces in Lignin Degradation Citation Details In-Document Search Title: Roles of Small Laccases from Streptomyces in Lignin Degradation Authors: ...

  9. Preparation of lithium-ion battery anodes using lignin (Journal...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Preparation of lithium-ion battery anodes using lignin Citation Details In-Document Search Title: Preparation of lithium-ion battery anodes using lignin Authors:...

  10. Synthetic Metabolic Pathways for Bioconversion of Lignin Derivatives...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Identify a lignin-degrading organism that demonstrates at least 15% greater lignin depolymerization and catabolism * FY16 Q4 (Task 1) demonstrate genetic modification of the top ...

  11. Novel seed coat lignins in the Cactaceae: structure, distribution...

    Office of Scientific and Technical Information (OSTI)

    evolution of lignin diversity Citation Details In-Document Search Title: Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of ...

  12. Method for recovering and using lignin in adhesive resins by extracting demethylated lignin

    DOE Patents [OSTI]

    Schroeder, Herbert A.

    1991-01-01

    Lignin, or a lignin derived material, which has been significantly demethylated (e.g., the demethylated lignin found in the raffinate produced as a by-product of dimethyl sulfide production which can be carried out using the spent liquor from wood pulping operations) can be isolated by a process wherein an organic solvent is added to a lignin-containing aqueous solution. The organic solvent is typically a polar, and at least a partially water-immiscible substance such as, for example, ethyl acetate. The resulting lignin-containing aqueous solution/organic solvent mixture is acidified to produce a water layer which is discarded and an organic solvent layer which contains the demethylated lignin. Upon its recovery, the demethylated lignin is dissolved in an alkaline solution to which an aldehyde source is added to produce a resol-type resin. The aldehyde source may be formaldehyde in solution, paraformaldehyde, hexamethylenetetramine, or other aldehydes including acetaldehyde, furfural, and their derivatives.

  13. Method for recovering and using lignin in adhesive resins by extracting demethylated lignin

    DOE Patents [OSTI]

    Schroeder, Herbert A.

    1991-01-01

    Lignin, or a lignin derived material, which has been significantly demethylated (e.g., the demethylated lignin found in the raffinate produced as a by-product of dimethyl sulfide production which can be carried out using the spent liquor from wood pulping operations) can be isolated by a process wherein an organic solvent is added to a lignin-containing aqueous solution. The organic solvent is typically a polar, and at least a partially water-immiscible substance such as, for example, ethyl acetate. The resulting lignin-containing aqueous solution/organic solvent mixture is acidified to produce a water layer which is discarded and an organic solvent layer which contains the demethylated lignin. Upon its recovery, the demethylated lignin is preferably dried and stored until it is used (along with an alkali, an aldehyde and an adhesive filler) in compounding an adhesive of the type generally used in the manufacture of plywood.

  14. Method for regulation of plant lignin composition

    DOE Patents [OSTI]

    Chapple, Clint (West Lafayette, IN)

    1999-01-01

    A method is disclosed for the regulation of lignin composition in plant tissue. Plants are transformed with a gene encoding an active F5H gene. The expression of the F5H gene results in increased levels of syringyl monomer providing a lignin composition more easily degraded with chemicals and enzymes.

  15. Generalized Coalescents may be Necessary for Modeling Intrahost...

    Office of Scientific and Technical Information (OSTI)

    Modeling Intrahost HIV Evolution Citation Details In-Document Search Title: Generalized Coalescents may be Necessary for Modeling Intrahost HIV Evolution Authors: Wallstrom, ...

  16. Characterization of electrospun lignin based carbon fibers

    SciTech Connect (OSTI)

    Poursorkhabi, Vida; Mohanty, Amar; Misra, Manjusri

    2015-05-22

    The production of lignin fibers has been studied in order to replace the need for petroleum based precursors for carbon fiber production. In addition to its positive environmental effects, it also benefits the economics of the industries which cannot take advantage of carbon fiber properties because of their high price. A large amount of lignin is annually produced as the byproduct of paper and growing cellulosic ethanol industry. Therefore, finding high value applications for this low cost, highly available material is getting more attention. Lignin is a biopolymer making about 15 30 % of the plant cell walls and has a high carbon yield upon carbonization. However, its processing is challenging due to its low molecular weight and also variations based on its origin and the method of separation from cellulose. In this study, alkali solutions of organosolv lignin with less than 1 wt/v% of poly (ethylene oxide) and two types of lignin (hardwood and softwood) were electrospun followed by carbonization. Different heating programs for carbonization were tested. The carbonized fibers had a smooth surface with an average diameter of less than 5?m and the diameter could be controlled by the carbonization process and lignin type. Scanning electron microscopy (SEM) was used to study morphology of the fibers before and after carbonization. Thermal conductivity of a sample with amorphous carbon was 2.31?W/m.K. The electrospun lignin carbon fibers potentially have a large range of application such as in energy storage devices and water or gas purification systems.

  17. Novel seed coat lignins in the Cactaceae: structure, distribution and

    Office of Scientific and Technical Information (OSTI)

    implications for the evolution of lignin diversity (Journal Article) | SciTech Connect Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Citation Details In-Document Search Title: Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Authors: Fang,Chen ; Yuki,Tobimatsu ; Lisa,Jackson ; Jin,Nakashima ; John,Ralph ; Richard A.,Dixon Publication Date:

  18. Novel seed coat lignins in the Cactaceae: structure, distribution and

    Office of Scientific and Technical Information (OSTI)

    implications for the evolution of lignin diversity (Journal Article) | SciTech Connect Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Citation Details In-Document Search Title: Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Authors: Fang,Chen ; Yuki,Tobimatsu ; Lisa,Jackson ; Jin,Nakashima ; John,Ralph ; Richard A.,Dixon Publication Date:

  19. Biologically produced acid precipitable polymeric lignin

    DOE Patents [OSTI]

    Crawford, Don L.; Pometto, III, Anthony L.

    1984-01-01

    A water soluble, acid precipitable polymeric degraded lignin (APPL), having a molecular weight of at least 12,000 daltons, and comprising, by percentage of total weight, at least three times the number of phenolic hydroxyl groups and carboxylic acid groups present in native lignin. The APPL may be modified by chemical oxidation and reduction to increase its phenolic hydroxyl content and reduce the number of its antioxidant inhibitory side chains, thereby improving antioxidant properties.

  20. SODIUM ALUMINOSILICATE FOULING AND CLEANING OF DECONTAMINATED SALT SOLUTION COALESCERS

    SciTech Connect (OSTI)

    Poirier, M; Thomas Peters, T; Fernando Fondeur, F; Samuel Fink, S

    2008-10-28

    During initial non-radioactive operations at the Modular Caustic Side Solvent Extraction Unit (MCU), the pressure drop across the decontaminated salt solution coalescer reached {approx}10 psi while processing {approx}1250 gallons of salt solution, indicating possible fouling or plugging of the coalescer. An analysis of the feed solution and the 'plugged coalescer' concluded that the plugging was due to sodium aluminosilicate solids. MCU personnel requested Savannah River National Laboratory (SRNL) to investigate the formation of the sodium aluminosilicate solids (NAS) and the impact of the solids on the decontaminated salt solution coalescer. Researchers performed developmental testing of the cleaning protocols with a bench-scale coalescer container 1-inch long segments of a new coalescer element fouled using simulant solution. In addition, the authors obtained a 'plugged' Decontaminated Salt Solution coalescer from non-radioactive testing in the MCU and cleaned it according to the proposed cleaning procedure. Conclusions from this testing include the following: (1) Testing with the bench-scale coalescer showed an increase in pressure drop from solid particles, but the increase was not as large as observed at MCU. (2) Cleaning the bench-scale coalescer with nitric acid reduced the pressure drop and removed a large amount of solid particles (11 g of bayerite if all aluminum is present in that form or 23 g of sodium aluminosilicate if all silicon is present in that form). (3) Based on analysis of the cleaning solutions from bench-scale test, the 'dirt capacity' of a 40 inch coalescer for the NAS solids tested is calculated as 450-950 grams. (4) Cleaning the full-scale coalescer with nitric acid reduced the pressure drop and removed a large amount of solid particles (60 g of aluminum and 5 g of silicon). (5) Piping holdup in the full-scale coalescer system caused the pH to differ from the target value. Comparable hold-up in the facility could lead to less effective cleaning and precipitation of bayerite solid particles. (6) Based on analysis of the cleaning solutions from the full-scale test, the 'dirt capacity' of a 40 inch coalescer for these NAS solids was calculated to be 40-170 grams.

  1. Recent results and persisting problems in modeling flow induced coalescence

    SciTech Connect (OSTI)

    Forteln, I. E-mail: juza@imc.cas.cz; Jza, J. E-mail: juza@imc.cas.cz

    2014-05-15

    The contribution summarizes recent results of description of the flow induced coalescence in immiscible polymer blends and addresses problems that call for which solving. The theory of coalescence based on the switch between equations for matrix drainage between spherical or deformed droplets provides a good agreement with more complicated modeling and available experimental data for probability, P{sub c}, that the collision of droplets will be followed by their fusion. A new equation for description of the matrix drainage between deformed droplets, applicable to the whole range of viscosity ratios, p, of the droplets and matrixes, is proposed. The theory facilitates to consider the effect of the matrix elasticity on coalescence. P{sub c} decreases with the matrix relaxation time but this decrease is not pronounced for relaxation times typical of most commercial polymers. Modeling of the flow induced coalescence in concentrated systems is needed for prediction of the dependence of coalescence rate on volume fraction of droplets. The effect of the droplet anisometry on P{sub c} should be studied for better understanding the coalescence in flow field with high and moderate deformation rates. A reliable description of coalescence in mixing and processing devices requires proper modeling of complex flow fields.

  2. Coalescence-controlled and coalescence-free growth regimes during deposition of pulsed metal vapor fluxes on insulating surfaces

    SciTech Connect (OSTI)

    L, B.; Mnger, E. P.; Sarakinos, K.

    2015-04-07

    The morphology and physical properties of thin films deposited by vapor condensation on solid surfaces are predominantly set by the processes of island nucleation, growth, and coalescence. When deposition is performed using pulsed vapor fluxes, three distinct nucleation regimes are known to exist depending on the temporal profile of the flux. These regimes can be accessed by tuning deposition conditions; however, their effect on film microstructure becomes marginal when coalescence sets in and erases morphological features obtained during nucleation. By preventing coalescence from being completed, these nucleation regimes can be used to control microstructure evolution and thus access a larger palette of film morphological features. Recently, we derived the quantitative criterion to stop coalescence during continuous metal vapor flux deposition on insulating surfaceswhich typically yields 3-dimensional growthby describing analytically the competition between island growth by atomic incorporation and the coalescence rate of islands [L et al., Appl. Phys. Lett. 105, 163107 (2014)]. Here, we develop the analytical framework for entering a coalescence-free growth regime for metal vapor deposition on insulating substrates using pulsed vapor fluxes, showing that there exist three distinct criteria for suppressing coalescence that correspond to the three nucleation regimes of pulsed vapor flux deposition. The theoretical framework developed herein is substantiated by kinetic Monte Carlo growth simulations. Our findings highlight the possibility of using atomistic nucleation theory for pulsed vapor deposition to control morphology of thin films beyond the point of island density saturation.

  3. He bubble coarsening by migration and coalescence in annealed...

    Office of Scientific and Technical Information (OSTI)

    Title: He bubble coarsening by migration and coalescence in annealed Pu-Ga alloys Authors: Jeffries, J R ; Wall, M A ; Moore, K T ; Schwartz, A J Publication Date: 2010-09-29 OSTI ...

  4. Generalized Coalescents may be Necessary for Modeling Intrahost HIV

    Office of Scientific and Technical Information (OSTI)

    Evolution (Conference) | SciTech Connect Conference: Generalized Coalescents may be Necessary for Modeling Intrahost HIV Evolution Citation Details In-Document Search Title: Generalized Coalescents may be Necessary for Modeling Intrahost HIV Evolution Authors: Wallstrom, Timothy Clarke [1] ; Bhattacharya, Tanmoy [1] ; Wilkins, Jon [2] ; Fischer, William Mclean [1] + Show Author Affiliations Los Alamos National Laboratory Ronin Institute Publication Date: 2016-05-04 OSTI Identifier: 1253498

  5. Fuels and Chemicals from Lignocellulosic Biomass: Valorization of Lignin

    Office of Scientific and Technical Information (OSTI)

    9196PE Fuels and Chemicals from Lignocellulosic Biomass: Valorization of Lignin Mike Kent Deconstruction Division Joint BioEnergy Institute Outline 1. Introduction: -fuels and chemicals from Ngnocellulosic biomass -need to derive value from lignin -status of lignin conversion 2. A new highly multiplexed assay for lignin degradation 3. Results -Fenton reaction -P. chrysosporium An Integrated Approach to Renewable Fuels and Chemicals Production Feedstocks Deconstruction Fuels Synthesis Non-Food

  6. Synthetic Design Microorganisms for Lignin Fuels and Chemicals...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... (2) Consolidated Lignin Fermentation (3) Carbon Flux Optimization for ... addresses management issues. * Engaging industrial partners for deliverables relevant to ...

  7. Process for producing phenolic compounds from lignins

    DOE Patents [OSTI]

    Agblevor, Foster A. (Lakewood, CO)

    1998-01-01

    A process for the production of low molecular weight phenolic compounds from lignins through the pyrolysis of the lignins in the presence of a strong base. In a preferred embodiment, potassium hydroxide is present in an amount of from about 0.1% to about 5% by weight, the pyrolysis temperature is from about 400.degree. C. to about 600.degree. C. at atmospheric pressure, and the time period for substantial completion of the reaction is from about 1-3 minutes. Examples of low molecular weight phenolic compounds produced include methoxyphenols, non-methoxylated phenols, and mixtures thereof.

  8. Process for producing phenolic compounds from lignins

    DOE Patents [OSTI]

    Agblevor, F.A.

    1998-09-15

    A process is described for the production of low molecular weight phenolic compounds from lignins through the pyrolysis of the lignins in the presence of a strong base. In a preferred embodiment, potassium hydroxide is present in an amount of from about 0.1% to about 5% by weight, the pyrolysis temperature is from about 400 C to about 600 C at atmospheric pressure, and the time period for substantial completion of the reaction is from about 1--3 minutes. Examples of low molecular weight phenolic compounds produced include methoxyphenols, non-methoxylated phenols, and mixtures thereof. 16 figs.

  9. Separation of Alcohols from Solution by Lignin Gels

    SciTech Connect (OSTI)

    Griffith, William {Bill} L; Compere, A L

    2008-01-01

    Partition relationships of radioisotope labeled ethanol and 1-butanol between aqueous solutions and a hydrated commercial Kraft softwood lignin gel are presented. These initial evaluations indicate that lignin hydrogels preferentially concentrate 1-butanol and, to a lesser extent, ethanol. The process implications and potential use of lignin as an inexpensive extractant are discussed.

  10. Genetic engineering of syringyl-enriched lignin in plants

    DOE Patents [OSTI]

    Chiang, Vincent Lee; Li, Laigeng

    2004-11-02

    The present invention relates to a novel DNA sequence, which encodes a previously unidentified lignin biosynthetic pathway enzyme, sinapyl alcohol dehydrogenase (SAD) that regulates the biosynthesis of syringyl lignin in plants. Also provided are methods for incorporating this novel SAD gene sequence or substantially similar sequences into a plant genome for genetic engineering of syringyl-enriched lignin in plants.

  11. Genetics and chemistry of lignin degradation by Streptomyces

    SciTech Connect (OSTI)

    Crawford, D.L.

    1992-01-01

    Our research goal was to define the involvement of lignin peroxidases and other extracellular enzymes in lignin degradation by Streptomyces. We examined the biochemistry and genetics of lignin degrading enzyme production by several strains of Streptomyces. The lignin peroxidase ALiP-P3 of S. viridosporus was characterized kinetically and its activity optimized for oxidation of 2,4-dichlorophenol and vanillyl-acetone. Sensitive spectrophotometric assays were developed for monitoring oxidation of these substrates. ALiP-P3 reaction chemistry was examined using both spectrophotometric assays and gas chromatography/mass spectroscopy. Results showed that the enzyme oxidizes phenolic lignin substructure models in strong preference to nonphenolic ones. The peroxidase was also shown to depolymerize native lignin. We also cloned the ALip-P3 gene S. lividans in plasmid vector pIJ702. The cloned gene was partially sequenced, We also immunologically characterized the lignin peroxidase of S. viridosporus T7A and showed it to be structurally related to peroxidases produced by other lignin-solubilizing Streptomyces, but not the the H8 lignin peroxidase of P. chrysosporium. Studies with peroxidase deficient mutants of strain T7A showed that lignin peroxidases of S. viridosporus are directly involved in the solubilization of lignin. Additional research showed that other enzymes are also probably involved in lignin solubilization, possibly including extracellular esterases.

  12. Lignin-blocking treatment of biomass and uses thereof

    DOE Patents [OSTI]

    Yang, Bin; Wyman, Charles E.

    2009-10-20

    Disclosed is a method for converting cellulose in a lignocellulosic biomass. The method provides for a lignin-blocking polypeptide and/or protein treatment of high lignin solids. The treatment enhances cellulase availability in cellulose conversion. Cellulase efficiencies are improved by the protein or polypeptide treatment. The treatment may be used in combination with steam explosion and acid prehydrolysis techniques. Hydrolysis yields from lignin containing biomass are enhanced 5-20%, and enzyme utilization is increased from 10% to 50%. Thus, a more efficient and economical method of processing lignin containing biomass materials utilizes a polypeptide/protein treatment step that effectively blocks lignin binding of cellulase.

  13. Flash vacuum pyrolysis of lignin model compounds

    SciTech Connect (OSTI)

    Cooney, M.J.; Britt, P.F.; Buchanan, A.C. III

    1997-03-01

    Despite the extensive research into the pyrolysis of lignin, the underlying chemical reactions that lead to product formation are poorly understood. Detailed mechanistic studies on the pyrolysis of biomass and lignin under conditions relevant to current process conditions could provide insight into utilizing this renewable resource for the production of chemicals and fuel. Currently, flash or fast pyrolysis is the most promising process to maximize the yields of liquid products (up to 80 wt %) from biomass by rapidly heating the substrate to moderate temperatures, typically 500{degrees}C, for short residence times, typically less than two seconds. To provide mechanistic insight into the primary reaction pathways under process relevant conditions, we are investigating the flash vacuum pyrolysis (FVP) of lignin model compounds that contain a {beta}-ether. linkage and {alpha}- or {gamma}-alcohol, which are key structural elements in lignin. The dominant products from the FVP of PhCH{sub 2}CH{sub 2}OPh (PPE), PhC(OH)HCH{sub 2}OPh, and PhCH{sub 2}CH(CH{sub 2}OH)OPh at 500{degrees}C can be attributed to homolysis of the weakest bond in the molecule (C-O bond) or 1,2-elimination. Surprisingly, the hydroxy-substituent dramatically increases the decomposition of PPE. It is proposed that internal hydrogen bonding is accelerating the reaction.

  14. Method for recovering and using lignin in adhesive resins

    DOE Patents [OSTI]

    Schroeder, Herbert A.

    1993-01-01

    Lignin, or a lignin derived material, which has been significantly demethylated (e.g., the demethylated lignin found in the raffinate produced as a by-product of dimethyl sulfide production which can be carried out using the spent liquor from wood pulping operations) can be isolated by a process wherein an organic solvent is added to a lignin-containing aqueous solution. The organic solvent is typically a polar, and at least a partially water-immiscible substance such as, for example, ethyl acetate. The resulting lignin-containing aqueous solution/organic solvent mixture is acidified to produce a water layer which is discarded and an organic solvent layer which contains the demethylated lignin. Upon its recovery, the demethylated lignin is dissolved in an alkaline solution to which an aldehyde source is added to produce a resol-type resin. The aldehyde source may be formaldehyde in solution, paraformaldehyde, hexamethylenetetramine, or other aldehydes including acetaldehyde, furfural, and their derivatives.

  15. Economic contribution of lignins to ethanol production from biomass

    SciTech Connect (OSTI)

    Chum, H.L.; Parker, S.K.; Feinberg, D.A.; Wright, J.D.; Rice, P.A.; Sinclair, S.A.; Glasser, W.G.

    1985-05-01

    Lignin, one of the three major polymeric components of biomass (16% to 33% by weight in wood), has the highest specific heat content. Therefore, it can be burned for process fuel. Compared to coal, its fuel value is 2.2 cents/lb. This report investigates markets for lignin utilization of higher value. After lignin isolation from the process, purchase of replacement fuel (coal was analyzed), lignin sale for the manufacture of solid materials or higher value octane enhancers was evaluated. Polymeric applications evaluated were: surfactants, asphalt, carbon black, adhesives, and lignin plastics; agricultural applications were briefly reviewed. These lignins would generate coproduct credits of 25 cents to 150 cents/gallon of ethanol respectively for 7.5 cents to 60 cents/lb lignin value (isolation and eventual modification costs were taken into account). Overall markets for these polymeric applications were projected at 11 billion lb/year by the year 2000. These projections are intensities of demand and not actual shipments of lignins. In addition, this report investigates the possibility of converting lignins into mixtures of methyls aryl ethers and methyl substituted-aryl ethers which are high value octane enhancers, fully compatible with gasoline. The report intends to show that if fuel ethanol production in the billions of gallons scale occurs lignin markets would not be saturated. 10 refs., 14 figs., 36 tabs.

  16. p-Hydroxyphenyl (H) Units Lower the Degree of Polymerization in Lignin: Chemical Control in Lignin Biosynthesis

    SciTech Connect (OSTI)

    Sangha, A. K.; Parks, J. M.; Davis, M. F.; Smith, J. C.

    2013-01-01

    Lignin, composed predominantly of p-hydroxyphenyl (H), guaiacyl (G) and syringyl (S) subunits, is a major component of plant cell walls that imparts resistance toward chemical and microbial deconstruction of plant biomass, rendering its conversion inefficient and costly. Previous studies have shown that alterating lignin composition, i.e., the relative abundance of H, G and S subunits, promises more efficient extraction of sugars from plant biomass. Smaller and less branched lignin chains are more easily extracted during pretreatment, making cellulose more readily degradable. Here, using density functional theory calculations, we show that the incorporation of H subunits into lignin via b-b and b-5 interunit linkages reduces the degree of polymerization in lignin. Frontier molecular orbital analyses of lignin dimers and trimers show that H as a terminal subunit on a growing lignin polymer linked via b-b and b-5 linkage cannot undergo radical formation, preventing further chain growth by endwise polymerization resulting in lignin polymers with lower degree of polymerization. These results indicate that, for endwise polymerization in lignin synthesis, there exists a chemical control that may lay a significant role in determining the structure of lignin.

  17. Carbohydrate and lignin are simultaneously solubilized from unpretreat...

    Office of Scientific and Technical Information (OSTI)

    Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature Citation Details In-Document Search Title: Carbohydrate ...

  18. Solid Double-Layered Hydroxide Catalysts for Lignin Decomposition...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Biomass and Biofuels Biomass and Biofuels Find More Like This Return to Search Solid Double-Layered Hydroxide Catalysts for Lignin Decomposition National Renewable Energy...

  19. Lignin pyrolysis in heated grid apparatus: Experiment and theory

    SciTech Connect (OSTI)

    Avni, L.; Coughlin, R.W.; King, H.H.; Solomon, P.R.

    1983-01-01

    The study of lignin pyrolysis has a vital importance since all lignin conversion processes, namely; combustion, liquefaction and gasification, are initiated by this step. Lignin, a major component of biomass is a potential source of aromatic chemicals through the pyrolysis process. This paper considers the application of a recently developed pyrolysis model of coal pyrolysis applied to a heated grid as well as an entrained flow reactor, to the pyrolysis of lignin. Flash pyrolysis as well as slow heating rate pyrolysis was carried out in a heated grid, in which on-line, in-situ gas and tar analysis is performed by Fourier Transform Infrared (FT-IR) Spectroscopy. The model has proved to be successful in simulating the results of vacuum flash pyrolysis and slow heating rate pyrolysis for a variety of lignins. The experiments have shown that lignin pyrolysis kinetics are insensitive to lignin source or extracting process. Theory and experiment agree well for both slow and fast heating rates, using the given model parameters. The lignin parameters of the model are related to the functional group composition of the lignin.

  20. Selective aerobic alcohol oxidation method for conversion of lignin into simple aromatic compounds

    DOE Patents [OSTI]

    Stahl, Shannon S; Rahimi, Alireza

    2015-03-03

    Described is a method to oxidize lignin or lignin sub-units. The method includes oxidation of secondary benzylic alcohol in the lignin or lignin sub-unit to a corresponding ketone in the presence of unprotected primarily aliphatic alcohol in the lignin or lignin sub-unit. The optimal catalyst system consists of HNO.sub.3 in combination with another Bronsted acid, in the absence of a metal-containing catalyst, thereby yielding a selectively oxidized lignin or lignin sub-unit. The method may be carried out in the presence or absence of additional reagents including TEMPO and TEMPO derivatives.

  1. Modification of lignin content and composition in plants

    DOE Patents [OSTI]

    Ye, Zheng-Hua

    2002-01-01

    Plants and methods of preparing plants having reduced lignin content and/or altered lignin composition are provided. The activities of caffeoyl-CoA O-methyltransferase and/or caffeic acid O-methyltransferase enzymes in the modified plants are reduced.

  2. Catalytic Hydrolytic Cleavage and Oxy-Cleavage of Lignin Linkages

    SciTech Connect (OSTI)

    Xia, Guanguang; Chen, Baowei; Zhang, Rui; Zhang, Z. Conrad

    2014-07-26

    In this work, new strategies involving organic bases were evaluated to depolymerize lignin to reduced molecular fragments in aqueous medium. NaOH as an inorganic base was also investigated as a reference. Full nature lignin samples are used for the study. As research tools to unravel the complexity of the macro lignin structure and bulky molecular size under this study, size exclusion chromatography and high resolution mass spectrometric analysis, typically used for protein characterizations, were used to follow the progress of lignin depolymerisation by measuring the molecular weight distribution of the products and determining the key molecular fingerprints, respectively. The results show that sodium phenoxide and guanidine carbonate are effective catalysts for lignin depolymerization. It is observed that there exists a synergism between H2O2 and the organic base, which is strongest with guanidine carbonate.

  3. Process for conversion of lignin to reformulated hydrocarbon gasoline

    DOE Patents [OSTI]

    Shabtai, Joseph S. (Salt Lake City, UT); Zmierczak, Wlodzimierz W. (Salt Lake City, UT); Chornet, Esteban (Golden, CO)

    1999-09-28

    A process for converting lignin into high-quality reformulated hydrocarbon gasoline compositions in high yields is disclosed. The process is a two-stage, catalytic reaction process that produces a reformulated hydrocarbon gasoline product with a controlled amount of aromatics. In the first stage, a lignin material is subjected to a base-catalyzed depolymerization reaction in the presence of a supercritical alcohol as a reaction medium, to thereby produce a depolymerized lignin product. In the second stage, the depolymerized lignin product is subjected to a sequential two-step hydroprocessing reaction to produce a reformulated hydrocarbon gasoline product. In the first hydroprocessing step, the depolymerized lignin is contacted with a hydrodeoxygenation catalyst to produce a hydrodeoxygenated intermediate product. In the second hydroprocessing step, the hydrodeoxygenated intermediate product is contacted with a hydrocracking/ring hydrogenation catalyst to produce the reformulated hydrocarbon gasoline product which includes various desirable naphthenic and paraffinic compounds.

  4. Producing a True Lignin Depolymerase for Biobleaching Softwood Kraft Pulp

    SciTech Connect (OSTI)

    Simo Sarkanen

    2002-02-04

    This project constituted an intensive effort devoted to producing, from the white-rot fungus Tramets Cingulata, a lignin degrading enzyme (lignin depolymerase) that is directly able to biobleach or delignify softwood kraft pulp brownstock. To this end, the solutions in which T. cingulata was grown contained dissolved kraft lignin which fulfilled two functions; it behaved as a lignin deploymerase substrate and it also appeared to act as an inducer of enzyme expression. However, the lignin depolymerase isoenzymes (and other extracellular T. cingulata enzymes) interacted very strongly with both the kraft lignin components and the fungal hypae, so the isolating these proteins from the culture solutions proved to be unexpectedly difficult. Even after extensive experimentation with a variety of protein purification techniques, only one approach appeared to be capable of purifying lignin depolymerases to homogeneity. Unfortunately the procedure was extremely laborious; it involved the iso electric focusing of concentrated buffer-exchanged culture solutions followed by electro-elution of the desired protein bands from the appropriate polyacrylamide gel segments

  5. Potential role of lignin in tomorrow's wood utilization technologies

    SciTech Connect (OSTI)

    Glasser, W.G.

    1981-03-01

    Low-grade timber supplies and wood processing residues are presently converted into paper products, used for fuel, or remain totally unused. Competition for this resource will continue to mount, particularly when manufacturers of chemicals and liquid fuels enter the market with new technologies now under development. The type of technology that concentrates on depolymerization of carbohydrates will generate large quantities of lignin-rich residues. The potential of these lignins to contribute to the economic feasibility of new chemical wood process technologies may involve degradative depolymerization to phenols and benzene, or polymer conversion into a wide variety of dispersants, binders, reinforcing and antioxidizing agents, etc. Where lignin's fuel value lies around 3 to 4 cents/lb. (fall of 1979), its raw material value for phenol is reported to be almost 5 cents/lb., and the value of the polymeric materials is estimated to be between 6 and 20 cents/lb. At the lower end of this range of raw material values are ligninsulfonates, which contribute nearly 98 percent to the approximately 1.5 billion lb./yr. U.S. market for lignin products. Kraft lignins are located at the opposite end of this range. Novel bioconversion-type lignins are expected to be more similar in structure and properties to kraft than to sulfite lignins. Whereas application of the dispersant properties of ligninsulfonates in tertiary oil recovery operations is expected to constitute the most significant use of lignin in terms of volume, adhesive and resin applications hold the greatest promise in terms of value. Both utilization schemes seem to require pretreatments in the form of either polymeric fractionation or chemical modification. Potential savings from the use of polymeric lignins in material systems are great.

  6. Electrostatic coalescence system with independent AC and DC hydrophilic electrodes

    DOE Patents [OSTI]

    Hovarongkura, A. David; Henry, Jr., Joseph D.

    1981-01-01

    An improved electrostatic coalescence system is provided in which independent AC and DC hydrophilic electrodes are employed to provide more complete dehydration of an oil emulsion. The AC field is produced between an AC electrode array and the water-oil interface wherein the AC electrode array is positioned parallel to the interface which acts as a grounded electrode. The emulsion is introduced into the AC field in an evenly distributed manner at the interface. The AC field promotes drop-drop and drop-interface coalescence of the water phase in the entering emulsion. The continuous oil phase passes upward through the perforated AC electrode array and enters a strong DC field produced between closely spaced DC electrodes in which small dispersed droplets of water entrained in the continuous phase are removed primarily by collection at hydrophilic DC electrodes. Large droplets of water collected by the electrodes migrate downward through the AC electrode array to the interface. All phase separation mechanisms are utilized to accomplish more complete phase separation.

  7. NREL Overcomes Obstacles in Lignin Valorization (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-01-01

    This NREL Highlight is being produced for the 2015 February Alliance S&T Board meeting, and describes research that shows lignin can be converted into renewable fuels, chemicals, and materials.

  8. Fuels and Chemicals from Lignocellulosic Biomass: Valorization of Lignin.

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Fuels and Chemicals from Lignocellulosic Biomass: Valorization of Lignin. Citation Details In-Document Search Title: Fuels and Chemicals from Lignocellulosic Biomass: Valorization of Lignin. Abstract not provided. Authors: Kent, Michael S. ; Avina, Isaac C ; Rader, Nadeya C ; Turner, Kevin ; George, Anthe ; Timlin, Jerilyn A. ; Polsky, Ronen ; Ricken, James Bryce ; Sale, Kenneth L. ; Simmons, Blake Publication Date: 2014-10-01 OSTI Identifier: 1242073 Report

  9. Lignin Based Carbon Materials for Energy Storage Applications (Book) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Book: Lignin Based Carbon Materials for Energy Storage Applications Citation Details In-Document Search Title: Lignin Based Carbon Materials for Energy Storage Applications The implementation of Li-ion battery technology into electric and hybrid electric vehicles and portable electronic devices such as smart phones, laptops and tablets, creates a demand for efficient, economic and sustainable materials for energy storage. However, the high cost and long processing time

  10. Transgenic Lignin Easier to Break Down for Biofuel - Energy Innovation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Portal Transgenic Lignin Easier to Break Down for Biofuel Great Lakes Bioenergy Research Center Contact GLBRC About This Technology Technology Marketing Summary Lignocellulosic biomass is a very desirable feedstock for biofuel production. If the fermentation process could be optimized, conversion of this biomass could yield 25 to 50 billion gallons of ethanol or other biofuels per year. Yet lignocellulose is composed of tough lignin, cellulose and hemicelluloses that resist breakdown. This

  11. Carbohydrate and lignin are simultaneously solubilized from unpretreated

    Office of Scientific and Technical Information (OSTI)

    switchgrass by microbial action at high temperature (Journal Article) | SciTech Connect Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature Citation Details In-Document Search Title: Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature Authors: Kataeva, Irina [1] ; Foston, Marcus [2] ; Yang, Sung-Jae [1] ; Pattahil, Sivakumar [1] ; Biswal, Ajaya K

  12. Plants with modified lignin content and methods for production thereof

    DOE Patents [OSTI]

    Zhao, Qiao; Chen, Fang; Dixon, Richard A.

    2014-08-05

    The invention provides methods for decreasing lignin content and for increasing the level of fermentable carbohydrates in plants by down-regulation of the NST transcription factor. Nucleic acid constructs for down-regulation of NST are described. Transgenic plants are provided that comprise reduced lignin content. Plants described herein may be used, for example, as improved biofuel feedstock and as highly digestible forage crops. Methods for processing plant tissue and for producing ethanol by utilizing such plants are also provided.

  13. Transcription factors for modification of lignin content in plants

    DOE Patents [OSTI]

    Wang, Huanzhong; Chen, Fang; Dixon, Richard A.

    2015-06-02

    The invention provides methods for modifying lignin, cellulose, xylan, and hemicellulose content in plants, and for achieving ectopic lignification and, for instance, secondary cell wall synthesis in pith cells, by altered regulation of a WRKY transcription factor. Nucleic acid constructs for altered WRKY-TF expression are described. Transgenic plants are provided that comprise modified pith cell walls, and lignin, cellulose, and hemicellulose content. Plants described herein may be used, for example, as improved biofuel feedstock and as highly digestible forage crops.

  14. Treatment of Lignin Precursors to Improve their Suitability for Carbon Fibers: A Literature Review

    SciTech Connect (OSTI)

    Paul, Ryan; Naskar, Amit; Gallego, Nidia; Dai, Xuliang; Hausner, Andrew

    2015-04-17

    Lignin has been investigated as a carbon fiber precursor since the 1960s. Although there have been a number of reports of successful lignin-based carbon fiber production at the lab scale, lignin-based carbon fibers are not currently commercially available. This review will highlight some of the known challenges, and also the reported methods for purifying and modifying lignin to improve it as a precursor. Lignin can come from different sources (e.g. hardwood, softwood, grasses) and extraction methods (e.g. organosolv, kraft), meaning that lignin can be found with a diversity of purity and structure. The implication of these conditions on lignin as carbon fiber precursor is not comprehensively known, especially as the lignin landscape is evolving. The work presented in this review will help guide the direction of a project between GrafTech and ORNL to develop lignin carbon fiber technology, as part of a cooperative agreement with the DOE Advanced Manufacturing Office.

  15. Coalescing at 8 GeV in the Fermilab Main Injector

    SciTech Connect (OSTI)

    Scott, D.J.; Capista, D.; Chase, B.; Dye, J.; Kourbanis, I.; Seiya, K.; Yang, M.-J.; /Fermilab

    2012-05-01

    For Project X, it is planned to inject a beam of 3 10{sup 11} particles per bunch into the Main Injector. To prepare for this by studying the effects of higher intensity bunches in the Main Injector it is necessary to perform coalescing at 8 GeV. The results of a series of experiments and simulations of 8 GeV coalescing are presented. To increase the coalescing efficiency adiabatic reduction of the 53 MHz RF is required. This results in {approx}70% coalescing efficiency of 5 initial bunches. Data using wall current monitors has been taken to compare previous work and new simulations for 53 MHz RF reduction, bunch rotations and coalescing, good agreement between experiment and simulation was found. By increasing the number of bunches to 7 and compressing the bunch energy spread a scheme generating approximately 3 10{sup 11} particles in a bunch has been achieved. These bunches will then be used in further investigations.

  16. Lignin's potential contribution to the feasibility of biomass conversion to ethanol

    SciTech Connect (OSTI)

    Muller, P.C.; Glasser, W.G.

    1983-01-01

    The potential contribution of lignin toward the economic improvement of processes involving the bioconversion of lignocellulosics to liquid fuels such as ethyl alcohol was examined. This improvement in process economics is achieved by the employment of a two-product process scheme whereby lignin-rich residues separated from cellulosics during bioconversion are marketed as polymeric materials. Lignin's utility as a marketable macromolecule was assessed by (a) characterization of structural features in bioconversion lignins with reference to commercial lignin products, (b) by examining lignin in terms of its value as a component in polymer systems such as urethane and phenol-formaldehyde thermosetting adhesives, and (c) by identifying potential high-volume, high-value lignin market categories which could absorb lignin fractions produced in future bioconversion scenarios. 38 references, 7 figures, 4 tables.

  17. NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin...

    Office of Scientific and Technical Information (OSTI)

    NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin Citation Details In-Document Search Title: NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin ...

  18. In situ micro-spectroscopic investigation of lignin in poplar cell walls pretreated by maleic acid

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zeng, Yining; Zhao, Shuai; Wei, Hui; Tucker, Melvin P.; Himmel, Michael E.; Mosier, Nathan S.; Meilan, Richard; Ding, Shi -You

    2015-08-27

    In higher plant cells, lignin provides necessary physical support for plant growth and resistance to attack by microorganisms. For the same reason, lignin is considered to be a major impediment to the process of deconstructing biomass to simple sugars by hydrolytic enzymes. Furthermore, the in situ variation of lignin in plant cell walls is important for better understanding of the roles lignin play in biomass recalcitrance.

  19. Mobility and coalescence of stacking fault tetrahedra in Cu

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Martínez, Enrique; Uberuaga, Blas P.

    2015-03-13

    Stacking fault tetrahedra (SFTs) are ubiquitous defects in face-centered cubic metals. They are produced during cold work plastic deformation, quenching experiments or under irradiation. From a dislocation point of view, the SFTs are comprised of a set of stair-rod dislocations at the (110) edges of a tetrahedron bounding triangular stacking faults. These defects are extremely stable, increasing their energetic stability as they grow in size. At the sizes visible within transmission electron microscope they appear nearly immobile. Contrary to common belief, we show in this report, using a combination of molecular dynamics and temperature accelerated dynamics, how small SFTs canmore » diffuse by temporarily disrupting their structure through activated thermal events. More over, we demonstrate that the diffusivity of defective SFTs is several orders of magnitude higher than perfect SFTs, and can be even higher than isolated vacancies. Finally, we show how SFTs can coalesce, forming a larger defect in what is a new mechanism for the growth of these omnipresent defects.« less

  20. Genetics and chemistry of lignin degradation by Streptomyces. Final technical report

    SciTech Connect (OSTI)

    Crawford, D.L.

    1992-12-31

    Our research goal was to define the involvement of lignin peroxidases and other extracellular enzymes in lignin degradation by Streptomyces. We examined the biochemistry and genetics of lignin degrading enzyme production by several strains of Streptomyces. The lignin peroxidase ALiP-P3 of S. viridosporus was characterized kinetically and its activity optimized for oxidation of 2,4-dichlorophenol and vanillyl-acetone. Sensitive spectrophotometric assays were developed for monitoring oxidation of these substrates. ALiP-P3 reaction chemistry was examined using both spectrophotometric assays and gas chromatography/mass spectroscopy. Results showed that the enzyme oxidizes phenolic lignin substructure models in strong preference to nonphenolic ones. The peroxidase was also shown to depolymerize native lignin. We also cloned the ALip-P3 gene S. lividans in plasmid vector pIJ702. The cloned gene was partially sequenced, We also immunologically characterized the lignin peroxidase of S. viridosporus T7A and showed it to be structurally related to peroxidases produced by other lignin-solubilizing Streptomyces, but not the the H8 lignin peroxidase of P. chrysosporium. Studies with peroxidase deficient mutants of strain T7A showed that lignin peroxidases of S. viridosporus are directly involved in the solubilization of lignin. Additional research showed that other enzymes are also probably involved in lignin solubilization, possibly including extracellular esterases.

  1. Lignin-derived thermoplastic co-polymers and methods of preparation

    SciTech Connect (OSTI)

    Naskar, Amit K.; Saito, Tomonori; Pickel, Joseph M.; Baker, Frederick S.; Eberle, Claude Clifford; Norris, Robert E.; Mielenz, Jonathan Richard

    2014-06-10

    The present invention relates to a crosslinked lignin comprising a lignin structure having methylene or ethylene linking groups therein crosslinking between phenyl ring carbon atoms, wherein said crosslinked lignin is crosslinked to an extent that it has a number-average molecular weight of at least 10,000 g/mol, is melt-processible, and has either a glass transition temperature of at least 100.degree. C., or is substantially soluble in a polar organic solvent or aqueous alkaline solution. Thermoplastic copolymers containing the crosslinked lignin are also described. Methods for producing the crosslinked lignin and thermoplastic copolymers are also described.

  2. Recent Development in Chemical Depolymerization of Lignin: A Review

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Hai; Tucker, Melvin; Ji, Yun

    2013-01-01

    This article reviewed recent development of chemical depolymerization of lignins. There were five types of treatment discussed, including base-catalyzed, acid-catalyzed, metallic catalyzed, ionic liquids-assisted, and supercritical fluids-assisted lignin depolymerizations. The methods employed in this research were described, and the important results were marked. Generally, base-catalyzed and acid-catalyzed methods were straightforward, but the selectivity was low. The severe reaction conditions (high pressure, high temperature, and extreme pH) resulted in requirement of specially designed reactors, which led to high costs of facility and handling. Ionic liquids, and supercritical fluids-assisted lignin depolymerizations had high selectivity, but the high costs of ionic liquids recyclingmore » and supercritical fluid facility limited their applications on commercial scale biomass treatment. Metallic catalyzed depolymerization had great advantages because of its high selectivity to certain monomeric compounds and much milder reaction condition than base-catalyzed or acid-catalyzed depolymerizations. It would be a great contribution to lignin conversion if appropriate catalysts were synthesized.« less

  3. Process for conversion of lignin to reformulated, partially oxygenated gasoline

    DOE Patents [OSTI]

    Shabtai, Joseph S. (Salt Lake City, UT); Zmierczak, Wlodzimierz W. (Salt Lake City, UT); Chornet, Esteban (Golden, CO)

    2001-01-09

    A high-yield process for converting lignin into reformulated, partially oxygenated gasoline compositions of high quality is provided. The process is a two-stage catalytic reaction process that produces a reformulated, partially oxygenated gasoline product with a controlled amount of aromatics. In the first stage of the process, a lignin feed material is subjected to a base-catalyzed depolymerization reaction, followed by a selective hydrocracking reaction which utilizes a superacid catalyst to produce a high oxygen-content depolymerized lignin product mainly composed of alkylated phenols, alkylated alkoxyphenols, and alkylbenzenes. In the second stage of the process, the depolymerized lignin product is subjected to an exhaustive etherification reaction, optionally followed by a partial ring hydrogenation reaction, to produce a reformulated, partially oxygenated/etherified gasoline product, which includes a mixture of substituted phenyl/methyl ethers, cycloalkyl methyl ethers, C.sub.7 -C.sub.10 alkylbenzenes, C.sub.6 -C.sub.10 branched and multibranched paraffins, and alkylated and polyalkylated cycloalkanes.

  4. Graphitic biocarbon from metal-catalyzed hydrothermal carbonization of lignin

    SciTech Connect (OSTI)

    Demir, Muslum; Kahveci, Zafer; Aksoy, Burak; Palapati, Naveen K. R.; Subramanian, Arunkumar; Cullinan, Harry T.; El-Kaderi, Hani M.; Harris, Charles T.; Gupta, Ram B.

    2015-10-09

    Lignin is a high-volume byproduct from the pulp and paper industry and is currently burned to generate electricity and process heat. Moreover, the industry has been searching for high value-added uses of lignin to improve the process economics. In addition, battery manufacturers are seeking nonfossil sources of graphitic carbon for environmental sustainability. In our work, lignin (which is a cross-linked polymer of phenols, a component of biomass) is converted into graphitic porous carbon using a two-step conversion. Lignin is first carbonized in water at 300 °C and 1500 psi to produce biochar, which is then graphitized using a metal nitrate catalyst at 900–1100 °C in an inert gas at 15 psi. Graphitization effectiveness of three different catalysts—iron, cobalt, and manganese nitrates—is examined. The product is analyzed for morphology, thermal stability, surface properties, and electrical conductivity. Both temperature and catalyst type influenced the degree of graphitization. A good quality graphitic carbon was obtained using catalysis by Mn(NO3)2 at 900 °C and Co(NO3)2 at 1100 °C.

  5. Graphitic biocarbon from metal-catalyzed hydrothermal carbonization of lignin

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Demir, Muslum; Kahveci, Zafer; Aksoy, Burak; Palapati, Naveen K. R.; Subramanian, Arunkumar; Cullinan, Harry T.; El-Kaderi, Hani M.; Harris, Charles T.; Gupta, Ram B.

    2015-10-09

    Lignin is a high-volume byproduct from the pulp and paper industry and is currently burned to generate electricity and process heat. Moreover, the industry has been searching for high value-added uses of lignin to improve the process economics. In addition, battery manufacturers are seeking nonfossil sources of graphitic carbon for environmental sustainability. In our work, lignin (which is a cross-linked polymer of phenols, a component of biomass) is converted into graphitic porous carbon using a two-step conversion. Lignin is first carbonized in water at 300 °C and 1500 psi to produce biochar, which is then graphitized using a metal nitratemore » catalyst at 900–1100 °C in an inert gas at 15 psi. Graphitization effectiveness of three different catalysts—iron, cobalt, and manganese nitrates—is examined. The product is analyzed for morphology, thermal stability, surface properties, and electrical conductivity. Both temperature and catalyst type influenced the degree of graphitization. A good quality graphitic carbon was obtained using catalysis by Mn(NO3)2 at 900 °C and Co(NO3)2 at 1100 °C.« less

  6. Hydrotreating Pyrolytic Lignin to Produce a Refinery Feedstock (Poster)

    SciTech Connect (OSTI)

    French, R. J.

    2013-09-01

    Fast pyrolysis of biomass followed by water separation to produce pyrolytic lignin and hydrotreating of the lignin could be used to produce a stable volatile low-oxygen intermediate liquid. Such a liquid could be converted into a finished motor-fuel in a refinery, taking advantage of the existing infrastructure and economies of scale of refineries. Hydrotreating just the lignin would consume less hydrogen while preserving about half of the energy of the original oil. The aqueous by-products could be reformed to produce the needed hydrogen and would contain much of the unwanted acids and unstable oxygenates. To assess such intermediate liquids, several pyrolytic lignins were prepared by mixing pyrolysis oil with water at 1:1 and 3:1 ratios. The carboxylic acidity in the pyrolytic lignin was reduced to 24 and 10 mg-KOH/g-lignin compared to 81 in the whole oil. These lignins were hydrotreated using Ni-Mo(S)/alumina, Pt/char, or Pd/C(activated) in a semi-batch 1 L stirred autoclave. The oil was stabilized under hydrogen at 150-280 degrees C, then water and light organics were removed by partial depressurization. Hydrodeoxygenation was then performed at 340-400 degrees C. Total pressure was controlled at 70 or 170 bar with hydrogen gas. Organic liquid yields of 39-56% were obtained. For many experiments the organic oxygen content was <7%, acidity was < 7 mg-KOH/g-oil, the volatility was greater than or equal to 94% and, on a carbon basis, the total yield of organic products miscible in hydrocarbons at a 1:10 ratio was over 50%. These properties are probably acceptable to a refinery.The residual liquids left in the reactor at the end of the experiment comprised 60-85% of the organic-phase product while the rest was condensate. 13C-NMR of the residual liquids showed that they were 50-80% aliphatic. 13C-NMR coupled with GC-MS identified phenolic compounds as the main oxygenates in most residual liquids.

  7. Gravitational Waves from Coalescing Binary Black Holes: Theoretical and Experimental Challenges

    ScienceCinema (OSTI)

    None

    2011-10-06

    A network of ground-based interferometric gravitational wave detectors (LIGO/VIRGO/GEO/...) is currently taking data near its planned sensitivity. Coalescing black hole binaries are among the most promising, and most exciting, gravitational wave sources for these detectors. The talk will review the theoretical and experimental challenges that must be met in order to successfully detect gravitational waves from coalescing black hole binaries, and to be able to reliably measure the physical parameters of the source (masses, spins, ...).

  8. Bio-inspired MOF-based Catalysts for Lignin Valorization.

    SciTech Connect (OSTI)

    Allendorf, Mark D.; Stavila, Vitalie; Ramakrishnan, Parthasarathi; Davis, Ryan Wesley

    2014-09-01

    Lignin is a potentially plentiful source of renewable organics, with ~50Mtons/yr produced by the pulp/paper industry and 200-300 Mtons/yr projected production by a US biofuels industry. This industry must process approximately 1 billion tons of biomass to meet the US Renewable Fuel goals. However, there are currently no efficient processes for converting lignin to value-added chemicals and drop-in fuels. Lignin is therefore an opportunity for production of valuable renewable chemicals, but presents staggering technical and economic challenges due to the quantities of material involved and the strong chemical bonds comprising this polymer. Aggressive chemistries and high temperatures are required to degrade lignin without catalysts. Moreover, chemical non-uniformity among lignins leads to complex product mixtures that tend to repolymerize. Conventional petrochemical approaches (pyrolysis, catalytic cracking, gasification) are energy intensive (400-800 degC), require complicated separations, and remove valuable chemical functionality. Low-temperature (25-200 degC) alternatives are clearly desirable, but enzymes are thermally fragile and incompatible with liquid organic compounds, making them impractical for large-scale biorefining. Alternatively, homogeneous catalysts, such as recently developed vanadium complexes, must be separated from product mixtures, while many heterogenous catalysts involve costly noble metals. The objective of this project is to demonstrate proof of concept that an entirely new class of biomimetic, efficient, and industrially robust synthetic catalysts based on nanoporous Metal- Organic Frameworks (MOFs) can be developed. Although catalytic MOFs are known, catalysis of bond cleavage reactions needed for lignin degradation is completely unexplored. Thus, fundamental research is required that industry and most sponsoring agencies are currently unwilling to undertake. We introduce MOFs infiltrated with titanium and nickel species as catalysts for the C-O bond hydrogenolysis in model compounds, which mimic the b-O-4, a-O-4, and 4-O-5 linkages of natural lignin. The versatile IRMOF-74(n) series is proposed as a platform for creating efficient hydrogenolysis catalysts as it not only displays tunable pore sizes, but also has the required thermal and chemical stability. The catalytic C-O bond cleavage occurs at 10 bar hydrogen pressure and temperatures as low as 120 degC. The conversion efficiency of the aromatic ether substrates into the corresponding hydrocarbons and phenols varies as PhCH 2 CH 2 OPh > PhCH 2 OPh > PhOPh (Ph = phenyl), while the catalytic activity generally follows the following trend Ni%40IRMOF-74>Ti%40IRMOF-74>IRMOF-74. Conversions as high as 80%, coupled with good selectivity for hydrogenolysis vs. hydrogenation, highlight the potential of MOF-based catalysts for the selective cleavage of recalcitrant aryl-ether bonds found in lignin and other biopolymers. This project supports the DOE Integrated Biorefinery Program goals, the objective of which is to convert biomass to fuels and high-value chemicals, by addressing an important technology gap: the lack of low-temperature catalysts suitable for industrial lignin degradation. Biomass, which is ~30 wt% lignin, constitutes a potentially major source of platform chemicals that could improve overall profitability and productivity of all energy-related products, thereby benefiting consumers and reducing national dependence on imported oil. Additionally, DoD has a strong interest in low-cost drop-in fuels (Navy Biofuel Initiative) and has signed a Memorandum of Understanding with DOE and USDA to develop a sustainable biofuels industry.

  9. Lignin-assisted coal depolymerization. Technical report, December 1, 1991--February 29, 1992

    SciTech Connect (OSTI)

    Lalvani, S.B.

    1992-08-01

    Previous research has shown that addition of lignin and lignin-derived liquids to coal stirred in tetralin under mild reaction conditions (375{degrees}C and 300--500 psig) results in a marked enhancement in the rate of coal depolymerization. In this quarterly report, overall mass balances on experiments conducted with tetralin, coal, lignin and coal-lignin mixture are reported. Overall mass recoveries of 95--99% of the total mass charged to the reactor were obtained. A number of experiments were conducted on coal, lignin and coal-lignin depolymerization. A careful statistical analysis of the data shows that coal depolymerization is enhanced by 10.4%, due to the lignin addition. The liquids obtained are being examined for their elemental composition, and molecular weight determination by size exclusion chromatography. The stability of the liquid products is being examined in various environments. The gaseous product analyses show that the major gases produced during the course of depolymerization are CO, CH{sub 4}, and CO{sub 2}. When coal and lignin are reacted together, the amount of CO and CH{sub 4}produced respectively 12% and 38% greater than the corresponding amount of gases calculated, based on the weighted average of values obtained for coal and lignin alone. The data obtained show that lignin addition to coal is synergistic in that not only is the extent of coal depolymerization increased, but the gas produced contains higher concentrations of more desirable gaseous products.

  10. Data Visualization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualization Data Visualization Scientific Visualization is the process of creating visual imagery from raw scientific data. NERSC supports the VisIt and Paraview tools for visualizing and interacting with generic scientific datasets. NCAR Graphics Library is provided (as a specialized package) for climate data. The field of information visualization deals with rendering datasets that do not necessarily map onto a natural 2D or 3D co-ordinate system. R (ggplot2) and python (matplotlib) provide

  11. Inexpensive, Environmentally Friendly and Highly Permeable Lignin-Based Ion

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Exchangers - Energy Innovation Portal Industrial Technologies Industrial Technologies Find More Like This Return to Search Inexpensive, Environmentally Friendly and Highly Permeable Lignin-Based Ion Exchangers Lawrence Livermore National Laboratory Contact LLNL About This Technology Technology Marketing Summary For more than 10 years, a partnership between Kazakh and US researchers has led to the synthesis and testing of highly permeable ion-exchangers. These materials possess an increased

  12. ionic liquids biological-ly derived from lignin and hemicellulose

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    biological-ly derived from lignin and hemicellulose - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste

  13. Biological and Catalytic Conversion of Sugars and Lignin | Bioenergy | NREL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Biological and Catalytic Conversion of Sugars and Lignin Our research group, comprised of staff scientists, postdoctoral associates, students, and technicians, develops biological and chemical catalysts for cost-effective production of fuels and chemicals from terrestrial biomass. Two side-by-side images. The left figure illustrates the domains of the synthase enzyme, represented as "surfaces" or "blobs," embedded in a lipid bilayer, represented as yellow multi-jointed

  14. Development of a prototype lignin concentration sensor. Final report. Draft

    SciTech Connect (OSTI)

    Jeffers, L.A.

    1994-11-01

    The ultimate objective of the DOE-sponsored program discussed in this report is to commercialize an instrument for real-time, in-situ measurement of lignin in wood pulp at a variety of locations in the pulp process stream. The instrument will be used as a primary sensor for process control in the pulp and paper industry. Work done by B&W prior to the initiation of this program had shown: there is a functional relationship between the fluorescence intensity and the Kappa number as measured at the pulp mill laboratory. Kappa number is a standard wet chemical method for determination of the lignin concentration; the relationship is one of decreasing intensity with Kappa number, indicating operation in the quenched fluorescence regime; a great deal of scatter in the data. Because of the preliminary nature of the study, the origin of the scatter was not identified. This report documents the results of laboratory measurements made on a variety of well defined pulp samples to generate the data necessary to: determine the feasibility of an instrument for on-line lignin concentration measurement using laser fluorescence; identify the preferred measurement strategy; define the range of applicability of the instrument; and to provide background information to guide the design of a field-worthy prototype.

  15. Two-Step Process Converts Lignin into Simple Aromatic Compounds - Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Innovation Portal Two-Step Process Converts Lignin into Simple Aromatic Compounds Great Lakes Bioenergy Research Center Contact GLBRC About This Technology Technology Marketing Summary Lignin is a major component of non-edible biomass. It is a cheap byproduct of pulp and biofuel production and is one of the few naturally occurring sources of valuable aromatic compounds. Converting lignin's complex biopolymer structure into simple organic chemicals has attracted major interest. For example,

  16. On-line measurement of lignin in wood pulp by color shift of fluorescence

    DOE Patents [OSTI]

    Jeffers, Larry A.; Malito, Michael L.

    1996-01-01

    Lignin concentrations from wood pulp samples are measured by applying an excitation light at a selected wavelength to the samples in order to cause the lignin to emit fluorescence. A spectral distribution of the fluorescence emission is then determined. The lignin concentration is then calculated based on the spectral distribution signal. The spectral distribution is quantified by either a wavelength centroid method or a band ratio method.

  17. On-line measurement of lignin in wood pulp by color shift of fluorescence

    DOE Patents [OSTI]

    Jeffers, L.A.; Malito, M.L.

    1996-01-23

    Lignin concentrations from wood pulp samples are measured by applying an excitation light at a selected wavelength to the samples in order to cause the lignin to emit fluorescence. A spectral distribution of the fluorescence emission is then determined. The lignin concentration is then calculated based on the spectral distribution signal. The spectral distribution is quantified by either a wavelength centroid method or a band ratio method. 6 figs.

  18. Characterization of Trapped Lignin-Degrading Microbes in Tropical Forest Soil

    SciTech Connect (OSTI)

    DeAngelis, Kristen; Allgaier, Martin; Chavarria, Yaucin; Fortney, Julian; Hugenholtz, Phillip; Simmons, Blake; Sublette, Kerry; Silver, Whendee; Hazen, Terry

    2011-07-14

    Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in the soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.

  19. Characterization of trapped lignin-degrading microbes in tropical forest soil

    SciTech Connect (OSTI)

    DeAngelis, K.M.; Allgaier, M.; Chavarria, Y.; Fortney, J.L.; Hugenholz, P.; Simmons, B.; Sublette, K.; Silver, W.L.; Hazen, T.C.

    2011-03-01

    Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in the soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.

  20. Structural Transformation of Isolated Poplar and Switchgrass Lignins from Dilute Acid Pretreatment

    SciTech Connect (OSTI)

    Sun, Qining; Pu, Yunqiao; Meng, Xianzhi; Wells, Tyrone; Ragauskas, Arthur J.

    2015-08-27

    A key step in conversion of cellulosic biomass into sustainable fuels and chemicals is thermochemical pretreatment to reduce plant cell wall recalcitrance. Obtaining an improved understanding of the fundamental chemistry of lignin, the most recalcitrant component of biomass, during pretreatment is critical to the continued development of renewable biofuel production. To examine the intrinsic chemistry of lignin during dilute acid pretreatment (DAP), lignin was isolated from poplar and switchgrass using a cellulolytic enzyme system and then treated under DAP conditions. These results highlight that lignin is subjected to depolymerization reactions within the first 2 min of dilute acid pretreatment and these changes are accompanied by increased generation of aliphatic and phenolic hydroxyl groups of lignin. This is followed by a competing set of depolymerization and repolymerization reactions that lead to a decrease in the content of guaiacyl lignin units and an increase in condensed lignin units as the reaction residence time is extended beyond 5 min. Finally, we showed that a detailed comparison of changes in functional groups and molecular weights of cellulolytic enzyme lignins with different structural parameters, related to the recalcitrant properties of lignin, could be successfully altered during DAP conditions.

  1. Structural Transformation of Isolated Poplar and Switchgrass Lignins from Dilute Acid Pretreatment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sun, Qining; Pu, Yunqiao; Meng, Xianzhi; Wells, Tyrone; Ragauskas, Arthur J.

    2015-08-27

    A key step in conversion of cellulosic biomass into sustainable fuels and chemicals is thermochemical pretreatment to reduce plant cell wall recalcitrance. Obtaining an improved understanding of the fundamental chemistry of lignin, the most recalcitrant component of biomass, during pretreatment is critical to the continued development of renewable biofuel production. To examine the intrinsic chemistry of lignin during dilute acid pretreatment (DAP), lignin was isolated from poplar and switchgrass using a cellulolytic enzyme system and then treated under DAP conditions. These results highlight that lignin is subjected to depolymerization reactions within the first 2 min of dilute acid pretreatment andmore » these changes are accompanied by increased generation of aliphatic and phenolic hydroxyl groups of lignin. This is followed by a competing set of depolymerization and repolymerization reactions that lead to a decrease in the content of guaiacyl lignin units and an increase in condensed lignin units as the reaction residence time is extended beyond 5 min. Finally, we showed that a detailed comparison of changes in functional groups and molecular weights of cellulolytic enzyme lignins with different structural parameters, related to the recalcitrant properties of lignin, could be successfully altered during DAP conditions.« less

  2. ReaxFF Study of the Oxidation of Softwood Lignin in View of Carbon Fiber Production

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Beste, Ariana

    2014-01-01

    We investigate the oxidative, thermal conversion of softwood lignin by performing molecular dynamics simulations based on a reactive force field (ReaxFF). The lignin samples are constructed from coniferyl alcohol units, which are connected through linkages that are randomly selected from a natural distribution of linkages in softwood. The goal of this work is to simulate the oxidative stabilization step during carbon fiber production from lignin precursor. We find that at simulation conditions where stabilization reactions occur, the lignin fragments have already undergone extensive degradation. The 5-5 linkage shows the highest reactivity towards cyclization and dehydrogenation.

  3. Final Report: Investigation of Catalytic Pathways for Lignin Breakdown into Monomers and Fuels

    SciTech Connect (OSTI)

    Gluckstein, Jeffrey A; Hu, Michael Z.; Kidder, Michelle; McFarlane, Joanna; Narula, Chaitanya Kumar; Sturgeon, Matthew R

    2010-12-01

    Lignin is a biopolymer that comprises up to 35% of woody biomass by dry weight. It is currently underutilized compared to cellulose and hemicellulose, the other two primary components of woody biomass. Lignin has an irregular structure of methoxylated aromatic groups linked by a suite of ether and alkyl bonds which makes it difficult to degrade selectively. However, the aromatic components of lignin also make it promising as a base material for the production of aromatic fuel additives and cyclic chemical feed stocks such as styrene, benzene, and cyclohexanol. Our laboratory research focused on three methods to selectively cleave and deoxygenate purified lignin under mild conditions: acidolysis, hydrogenation and electrocatalysis. (1) Acidolysis was undertaken in CH2Cl2 at room temperature. (2) Hydrogenation was carried out by dissolving lignin and a rhodium catalyst in 1:1 water:methoxyethanol under a 1 atm H2 environment. (3) Electrocatalysis of lignin involved reacting electrically generated hydrogen atoms at a catalytic palladium cathode with lignin dissolved in a solution of aqueous methanol. In all of the experiments, the lignin degradation products were identified and quantified by gas chromatography mass spectroscopy and flame ionization detection. Yields were low, but this may have reflected the difficulty in recovering the various fractions after conversion. The homogeneous hydrogenation of lignin showed fragmentation into monomers, while the electrocatalytic hydrogenation showed production of polyaromatic hydrocarbons and substituted benzenes. In addition to the experiments, promising pathways for the conversion of lignin were assessed. Three conversion methods were compared based on their material and energy inputs and proposed improvements using better catalyst and process technology. A variety of areas were noted as needing further experimental and theoretical effort to increase the feasibility of lignin conversion to fuels.

  4. Results of Analysis of Macrobatch 3 Decontaminated Salt Solution Coalescer from May 2010

    SciTech Connect (OSTI)

    Peters, T. B.; Fink, S. D.

    2012-12-18

    SRNL analyzed the Decontamination Salt Solution (DSS) coalescer from MCU by several analytical methods. This unit was removed from service in May 2010. The results of these analyses indicate that there is very little evidence of fouling via excessive solids, either from the leaching studies or X-Ray Diffraction (XRD) analysis.

  5. Biomass-derived Lignin to Jet Fuel Range Hydrocarbons via Aqueous Phase Hydrodeoxygenation

    SciTech Connect (OSTI)

    Wang, Hongliang; Ruan, Hao; Pei, Haisheng; Wang, Huamin; Chen, Xiaowen; Tucker, Melvin P.; Cort, John R.; Yang, Bin

    2015-09-14

    A catalytic process, involving the hydrodeoxygenation (HDO) of the dilute alkali extracted corn stover lignin catalysed by noble metal catalyst (Ru/Al2O3) and acidic zeolite (H+-Y), to produce lignin-substructure-based hydrocarbons (C7-C18), primarily C12-C18 cyclic structure hydrocarbons in the jet fuel range, was demonstrated.

  6. HPC Visualization

    SciTech Connect (OSTI)

    Monroe, Laura Marie

    2015-04-28

    A brief overview of the Los Alamos National Laboratory’s visualization capabilities and how projects benefits from these.

  7. The Paleozoic origin of enzymatic mechanisms for lignin degradation reconstructed using 31 fungal genomes

    SciTech Connect (OSTI)

    Floudas, Dimitrios; Binder, Manfred; Riley, Robert; Barry, Kerrie; Blanchette, Robert A; Henrissat, Bernard; Martinez, Angel T.; Otillar, Robert; Spatafora, Joseph W.; Yadav, Jagit S.; Aerts, Andrea; Benoit, Isabelle; Boyd, Alex; Carlson, Alexis; Copeland, Alex; Coutinho, Pedro M.; de Vries, Ronald P.; Ferreira, Patricia; Findley, Keisha; Foster, Brian; Gaskell, Jill; Glotzer, Dylan; Gorecki, Pawel; Heitman, Joseph; Hesse, Cedar; Hori, Chiaki; Igarashi, Kiyohiko; Jurgens, Joel A.; Kallen, Nathan; Kersten, Phil; Kohler, Annegret; Kues, Ursula; Kumar, T. K. Arun; Kuo, Alan; LaButti, Kurt; Larrondo, Luis F.; Lindquist, Erika; Ling, Albee; Lombard, Vincent; Lucas, Susan; Lundell, Taina; Martin, Rachael; McLaughlin, David J.; Morgenstern, Ingo; Morin, Emanuelle; Murat, Claude; Nagy, Laszlo G.; Nolan, Matt; Ohm, Robin A.; Patyshakuliyeva, Aleksandrina; Rokas, Antonis; Ruiz-Duenas, Francisco J.; Sabat, Grzegorz; Salamov, Asaf; Samejima, Masahiro; Schmutz, Jeremy; Slot, Jason C.; St. John, Franz; Stenlid, Jan; Sun, Hui; Sun, Sheng; Syed, Khajamohiddin; Tsang, Adrian; Wiebenga, Ad; Young, Darcy; Pisabarro, Antonio; Eastwood, Daniel C.; Martin, Francis; Cullen, Dan; Grigoriev, Igor V.; Hibbett, David S.

    2012-03-12

    Wood is a major pool of organic carbon that is highly resistant to decay, owing largely to the presence of lignin. The only organisms capable of substantial lignin decay are white rot fungi in the Agaricomycetes, which also contains non?lignin-degrading brown rot and ectomycorrhizal species. Comparative analyses of 31 fungal genomes (12 generated for this study) suggest that lignin-degrading peroxidases expanded in the lineage leading to the ancestor of the Agaricomycetes, which is reconstructed as a white rot species, and then contracted in parallel lineages leading to brown rot and mycorrhizal species. Molecular clock analyses suggest that the origin of lignin degradation might have coincided with the sharp decrease in the rate of organic carbon burial around the end of the Carboniferous period.

  8. A NEW PROCESS DEVELOPED FOR SEPARATION OF LIGNIN FROM AMMONIUM HYDROXIDE PRETREATMENT SOLUTIONS

    SciTech Connect (OSTI)

    Sherman, S.; Gorensek, M.; Milliken, C.

    2010-12-14

    A method is described for separating lignin from liquid solutions resulting from the pretreatment of lignocellulosic materials such as switchgrass with ammonium hydroxide. The method involves a sequence of steps including acidification, evaporation, and precipitation or centrifugation that are performed under defined conditions, and results in a relatively pure, solid lignin product. The method is tested on ammonium hydroxide solutions containing lignin extracted from switchgrass. Experimental results show that the method is capable of recovering between 66-95% of dissolved lignin as a precipitated solid. Cost estimates of pilot-scale and industrial-scale expressions of the process indicate that breakeven lignin prices of $2.36/kg and $0.78/kg, respectively, may be obtainable with this recovery method.

  9. RESULTS OF ANALYSES OF MACROBATCH 3 DECONTAMINATED SALT SOLUTION (DSS) COALESCER AND PRE-FILTERS

    SciTech Connect (OSTI)

    Peters, T.; Fondeur, F.; Fink, S.

    2012-06-13

    SRNL analyzed the pre-filter and Decontamination Salt Solution (DSS) coalescer from MCU by several analytical methods. The results of these analyses indicate that overall there is light to moderate solids fouling of both the coalescer and pre-filter elements. The majority of the solids contain aluminum, sodium, silicon, and titanium, in oxide and/or hydroxide forms that we have noted before. The titanium is presumably precipitated from leached, dissolved monosodium titanate (MST) or fines from MST at ARP, and the quantity we find is significantly greater than in the past. A parallel report discusses potential causes for the increased leaching rate of MST, showing that increases in free hydroxide concentration of the feed solutions and of chemical cleaning solutions lead to faster leaching of titanium.

  10. Effect of ionic liquid treatment on the structures of lignins in solutions

    SciTech Connect (OSTI)

    Cheng, Gang; Kent, Michael S; He, Lilin; Varanasi, Patanjali; Dibble, Dean; Melnichenko, Yuri B; Simmons, Blake; Singh, Seema

    2012-01-01

    The solution structures of three types of isolated lignin - organosolv (OS), Kraft (K), and low sulfonate (LS) - before and after treatment with 1-ethyl-3-methylimidazolium acetate were studied using small-angle neutron scattering (SANS) and dynamic light scattering (DLS) over a concentration range of 0.3-2.4 wt %. The results indicate that each of these lignins is comprised of aggregates of well-defined basal subunits, the shapes and sizes of which, in D{sub 2}O and DMSO-d{sub 6}, are revealed using these techniques. LS lignin contains a substantial amount of nanometer-scale individual subunits. In aqueous solution these subunits have a well-defined elongated shape described well by ellipsoidal and cylindrical models. At low concentration the subunits are highly expanded in alkaline solution, and the effect is screened with increasing concentration. OS lignin dissolved in DMSO was found to consist of a narrow distribution of aggregates with average radius 200 {+-} 30 nm. K lignin in DMSO consists of aggregates with a very broad size distribution. After ionic liquid (IL) treatment, LS lignin subunits in alkaline solution maintained the elongated shape but were reduced in size. IL treatment of OS and K lignins led to the release of nanometer-scale subunits with well-defined size and shape.

  11. Recent Progress in Producing #11;Lignin-Based Carbon Fibers for Functional Applications

    SciTech Connect (OSTI)

    Paul, Ryan; Burwell, Deanna; Dai, Xuliang; Naskar, Amit; Gallego, Nidia; Akato, Kokouvi

    2015-10-29

    Lignin, a biopolymer, has been investigated as a renewable and low-cost carbon fiber precursor since the 1960s. Although successful lab-scale production of lignin-based carbon fibers has been reported, there are currently not any commercial producers. This paper will highlight some of the known challenges with converting lignin-based precursors into carbon fiber, and the reported methods for purifying and modifying lignin to improve it as a precursor. Several of the challenges with lignin are related to its diversity in chemical structure and purity, depending on its biomass source (e.g. hardwood, softwood, grasses) and extraction method (e.g. organosolv, kraft). In order to make progress in this field, GrafTech and Oak Ridge National Laboratory are collaborating to develop lignin-based carbon fiber technology and to demonstrate it in functional applications, as part of a cooperative agreement with the DOE Advanced Manufacturing Office. The progress made to date with producing lignin-based carbon fiber for functional applications, as well as developing and qualifying a supply chain and value proposition, are also highlighted.

  12. Lignin-assisted coal depolymerization. [Final] technical report, September 1, 1991--August 31, 1992

    SciTech Connect (OSTI)

    Lalvani, S.B.; Muchmore, C.B.; Koropchak, J.A.; Kim, Jong Won

    1992-12-31

    Liquefaction of an Illinois bituminous and a caustic lignin was studied in an initial hydrogen pressure of 140 psig. Experiments were conducted in the temperature range of 325-375{degree}C in tetralin. The addition of lignin to coal was found to be synergistic in that it significantly improves the quality and yield of the liquid products obtained. Kinetic data for coal conversion enhancement due to lignin addition were obtained. A mathematical model describing the reaction chemistry, using lignin, has been proposed and developed. The analysis of the results indicates that the intermediates produced from lignin were responsible for enhancement in coal depolymerization rate, however, the intermediates are short-lived as compared to the time needed for a significant coal conversion yield. Coal depolymerization rate was found to be a function of time; compared to processing coal alone, it doubled upon reacting coal with lignin at 375{degree}C and after 67 minutes from the beginning of the experiment. Overall mass recoveries of 95--98% of the total mass charged to the reactor were obtained. A careful statistical analysis of the data shows that coal depolymerization yield is enhanced by 11.9% due to the lignin addition. The liquids obtained were examined for their elemental composition, and molecular weight determination by size exclusion chromatography. The stability of liquid products was characterized by determining their solubility in pentane and benzene, and by evaluating the molecular weight.

  13. Mechanistic Investigation of Acid-Catalyzed Cleavage of Aryl-Ether Linkages: Implications for Lignin Depolymerization

    SciTech Connect (OSTI)

    Sturgeon, M. R.; Kim, S.; Chmely, S. C.; Foust, T. D.; Beckham, G. T.

    2013-01-01

    Carbon-oxygen bonds are the primary inter-monomer linkages lignin polymers in plant cell walls, and as such, catalyst development to cleave these linkages is of paramount importance to deconstruct biomass to its constituent monomers for the production of renewable fuels and chemicals. For many decades, acid catalysis has been used to depolymerize lignin. Lignin is a primary component of plant cell walls, which is connected primarily by aryl-ether linkages, and the mechanism of its deconstruction by acid is not well understood, likely due to its heterogeneous and complex nature compared to cellulose. For effective biomass conversion strategies, utilization of lignin is of significant relevance and as such understanding the mechanisms of catalytic lignin deconstruction to constituent monomers and oligomers is of keen interest. Here, we present a comprehensive experimental and theoretical study of the acid catalysis of a range of dimeric species exhibiting the b-O-4 linkage, the most common inter-monomer linkage in lignin. We demonstrate that the presence of a phenolic species dramatically increases the rate of cleavage in acid at 150 degrees C. Quantum mechanical calculations on dimers with the para-hydroxyl group demonstrate that this acid-catalyzed pathway differs from the nonphenolic dimmers. Importantly, this result implies that depolymerization of native lignin in the plant cell wall will proceed via an unzipping mechanism wherein b-O-4 linkages will be cleaved from the ends of the branched, polymer chains inwards toward the center of the polymer. To test this hypothesis further, we synthesized a homopolymer of b-O-4 with a phenolic hydroxyl group, and demonstrate that it is cleaved in acid from the end containing the phenolic hydroxyl group. This result suggests that genetic modifications to lignin biosynthesis pathways in plants that will enable lower severity processes to fractionate lignin for upgrading and for easier access to the carbohydrate fraction of the plant cell wall.

  14. Expression of a bacterial 3-dehydroshikimate dehydratase reduces lignin content and improves biomass saccharification efficiency

    SciTech Connect (OSTI)

    Eudes, Aymerick; Sathitsuksanoh, Noppadon; Baidoo, Edward E. K.; George, Anthe; Liang, Yan; Yang, Fan; Singh, Seema; Keasling, Jay D.; Simmons, Blake A.; Loqué, Dominique

    2015-01-13

    Lignin confers recalcitrance to plant biomass used as feedstocks in agro-processing industries or as source of renewable sugars for the production of bioproducts. The metabolic steps for the synthesis of lignin building blocks belong to the shikimate and phenylpropanoid pathways. Genetic engineering efforts to reduce lignin content typically employ gene knockout or gene silencing techniques to constitutively repress one of these metabolic pathways. Recently, new strategies have emerged offering better spatiotemporal control of lignin deposition, including the expression of enzymes that interfere with the normal process for cell wall lignification. In this study, we report that expression of a 3-dehydroshikimate dehydratase (QsuB from Corynebacterium glutamicum) reduces lignin deposition in Arabidopsis cell walls. QsuB was targeted to the plastids to convert 3-dehydroshikimate – an intermediate of the shikimate pathway – into protocatechuate. Compared to wild-type plants, lines expressing QsuB contain higher amounts of protocatechuate, p-coumarate, p-coumaraldehyde and p-coumaryl alcohol, and lower amounts of coniferaldehyde, coniferyl alcohol, sinapaldehyde and sinapyl alcohol. 2D-NMR spectroscopy and pyrolysis-gas chromatography/mass spectrometry (pyro-GC/MS) reveal an increase of p-hydroxyphenyl units and a reduction of guaiacyl units in the lignin of QsuB lines. Size-exclusion chromatography indicates a lower degree of lignin polymerization in the transgenic lines. Therefore, our data show that the expression of QsuB primarily affects the lignin biosynthetic pathway. Finally, biomass from these lines exhibits more than a twofold improvement in saccharification efficiency. We conclude that the expression of QsuB in plants, in combination with specific promoters, is a promising gain-of-function strategy for spatiotemporal reduction of lignin in plant biomass.

  15. Expression of a bacterial 3-dehydroshikimate dehydratase reduces lignin content and improves biomass saccharification efficiency

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Eudes, Aymerick; Sathitsuksanoh, Noppadon; Baidoo, Edward E. K.; George, Anthe; Liang, Yan; Yang, Fan; Singh, Seema; Keasling, Jay D.; Simmons, Blake A.; Loqué, Dominique

    2015-01-13

    Lignin confers recalcitrance to plant biomass used as feedstocks in agro-processing industries or as source of renewable sugars for the production of bioproducts. The metabolic steps for the synthesis of lignin building blocks belong to the shikimate and phenylpropanoid pathways. Genetic engineering efforts to reduce lignin content typically employ gene knockout or gene silencing techniques to constitutively repress one of these metabolic pathways. Recently, new strategies have emerged offering better spatiotemporal control of lignin deposition, including the expression of enzymes that interfere with the normal process for cell wall lignification. In this study, we report that expression of a 3-dehydroshikimatemore » dehydratase (QsuB from Corynebacterium glutamicum) reduces lignin deposition in Arabidopsis cell walls. QsuB was targeted to the plastids to convert 3-dehydroshikimate – an intermediate of the shikimate pathway – into protocatechuate. Compared to wild-type plants, lines expressing QsuB contain higher amounts of protocatechuate, p-coumarate, p-coumaraldehyde and p-coumaryl alcohol, and lower amounts of coniferaldehyde, coniferyl alcohol, sinapaldehyde and sinapyl alcohol. 2D-NMR spectroscopy and pyrolysis-gas chromatography/mass spectrometry (pyro-GC/MS) reveal an increase of p-hydroxyphenyl units and a reduction of guaiacyl units in the lignin of QsuB lines. Size-exclusion chromatography indicates a lower degree of lignin polymerization in the transgenic lines. Therefore, our data show that the expression of QsuB primarily affects the lignin biosynthetic pathway. Finally, biomass from these lines exhibits more than a twofold improvement in saccharification efficiency. We conclude that the expression of QsuB in plants, in combination with specific promoters, is a promising gain-of-function strategy for spatiotemporal reduction of lignin in plant biomass.« less

  16. Volume Visualization

    Office of Scientific and Technical Information (OSTI)

    Volume Visualization of Multiple Alignment of Large Genomic DNA Nameeta Shah 1,2 , Scott E. Dillard 1 , Gunther H. Weber 1,2 , and Bernd Hamann 1,2 1 Institute for Data Analysis and Visualization (IDAV), Department of Computer Science, One Shields Avenue, University of California, Davis, CA 95616-8562, U.S.A. {nyshah, sedillard, ghweber, bhamann}@ucdavis.edu 2 Visualization Group, National Energy Research Scientific Computing Center (NERSC), Lawrence Berkeley National Laboratory, One Cyclotron

  17. Matching into the Helical Bunch Coalescing Channel for a High Luminosity Muon Collider

    SciTech Connect (OSTI)

    Sy, Amy; Ankenbrandt, Charles; Derbenev, Yaroslav; Morozov, Vasiliy; Neuffer, David; Yonehara, Katsuya; Yoshikawa, Cary

    2015-09-01

    For high luminosity in a muon collider, muon bunches that have been cooled in the six-dimensional helical cooling channel (HCC) must be merged into a single bunch and further cooled in preparation for acceleration and transport to the collider ring. The helical bunch coalescing channel has been previously simulated and provides the most natural match from helical upstream and downstream subsystems. This work focuses on the matching from the exit of the multiple bunch HCC into the start of the helical bunch coalescing channel. The simulated helical matching section simultaneously matches the helical spatial period lambda in addition to providing the necessary acceleration for efficient bunch coalescing. Previous studies assumed that the acceleration of muon bunches from p=209.15 MeV/c to 286.816 MeV/c and matching of lambda from 0.5 m to 1.0 m could be accomplished with zero particle losses and zero emittance growth in the individual bunches. This study demonstrates nonzero values for both particle loss and emittance growth, and provides considerations for reducing these adverse effects to best preserve high luminosity.

  18. Use and value of reactive lignin. Final report

    SciTech Connect (OSTI)

    Frank, M.E.; Mednick, R.L.; Stern, K.M.

    1988-03-01

    New York State has ample reserves of wood that are not suitable for lumber nor paper making. The Energy Authority has several research projects to utilize wood for the production of fuels and energy intensive chemicals. The Energy Authority and Chem Systems set out to characterize the market potential for lignins derived as by-products of wood-to-ethanol processes. Based on these analyses and subsequent ranking of the potential applications, three end uses (Phenol-Formaldehyde resin adhesives, carbon black substitutes and diesel fuel cetane enhancers) were characterized as having a high potential of commercial success. Epoxies were characterized as having a low potential. The prospects of the remaining end uses (activated carbon replacements, polyurethanes, dietary adsorbents, phenol/benzene and asphalt extenders) were classified as intermediate, along with those of the Urea-Formaldehyde resin portion of the adhesive market.

  19. Controlling porosity in lignin-derived nanoporous carbon for supercapacitor applications

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jeon, Ju-Won; Zhang, Libing; Lutkenhaus, Jodie L.; Laskar, Dhrubojyoti D.; Lemmon, John P.; Choi, Daiwon; Nandasiri, Manjula I.; Hashmi, Ali; Xu, Jie; Motkuri, Radha K.; et al

    2015-02-01

    Low-cost renewable lignin has been used as a precursor to produce porous carbons. However, to date, it has not been easy to obtain high surface area porous carbon without activation processes or templating agents. Here, we demonstrate that low molecular weight lignin yields highly porous carbon (1092 m² g⁻¹) with more graphitization through direct carbonization without additional activation processes or templating agents. We found that molecular weight and oxygen consumption during carbonization are critical factors to obtain high surface area, graphitized porous carbons. This highly porous carbon from low-cost renewable lignin sources is a good candidate for supercapacitor electrode materials.

  20. NREL Refines Method to Convert Lignin to Nylon Precursor - News Releases |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NREL NREL Refines Method to Convert Lignin to Nylon Precursor Recent Findings Published in Energy & Environmental Science February 26, 2015 A new study from the Energy Department's National Renewable Energy Laboratory (NREL) demonstrates the conversion of lignin-derived compounds to adipic acid, an important industrial dicarboxylic acid produced for its use as a precursor to nylon, plasticizers, lubricants, polyesters, and other popular products and chemicals. The demonstration is an

  1. Modification of Lignin by Protein Cross-linking to Facilitate Production of

    Office of Scientific and Technical Information (OSTI)

    Biofuels From Poplar (Technical Report) | SciTech Connect Technical Report: Modification of Lignin by Protein Cross-linking to Facilitate Production of Biofuels From Poplar Citation Details In-Document Search Title: Modification of Lignin by Protein Cross-linking to Facilitate Production of Biofuels From Poplar The limited supply of fossil fuels and the associated environmental issues associated with their utilization has resulted in much effort put forth to promote renewable resources of

  2. Nessus Visualization

    Energy Science and Technology Software Center (OSTI)

    2012-10-01

    NV is a visualization tool for exploring vulnerabilities within a network. The data is created with a vulnerability assessment tool, such as Nessus (http://www.tenable.com/products/nessus).

  3. Visual Breakout

    Broader source: Energy.gov [DOE]

    Visual Breakout of the Cummulative Barrels of Oil Recovered by the Discoverer Enterprise, Q4000 and HP1. Updated through 12:00 AM on July 16, 2010.

  4. RESULTS FROM ANALYSIS OF THE FIRST AND SECOND STRIP EFFLUENT COALESCER ELEMENTS FROM RADIOACTIVE OPERATIONS OF THE MODULAR CAUSTIC-SIDE SOLVENT EXTRACTION UNIT

    SciTech Connect (OSTI)

    Peters, T.; Fondeur, F.; Fink, S.

    2011-06-28

    The coalescer elements for the Strip Effluent (SE) acid within the Modular Caustic-Side Solvent Extraction Unit (MCU) experienced elevated differential pressure drop during radioactive operations. Following the end of operations for the first Macrobatch campaign and soon after start of the second Macrobatch campaign, personnel removed the coalescer media and provided to Savannah River National Laboratory (SRNL) for diagnostic investigation of the causes of reduced flow. This report summarizes those studies. Two Strip Effluent (SE) coalescers were delivered to the Savannah River National Laboratory (SRNL). One was removed from the Modular Caustic-Side Solvent Extraction Unit (MCU) between processing of Macrobatch 1 and 2 (coalescer 'Alpha'), and the second was removed from MCU after processing of {approx}24,000 gallons of salt solution (coalescer 'Beta'). Both coalescers underwent the same general strip acid flush program to reduce the dose and were delivered to SRNL for analysis of potential occluding solids. Analysis of Coalescer Alpha indicates the presence of aluminum hydroxide solids and aluminosilicate solids, while analysis of Coalescer Beta indicates the presence of aluminum hydroxide solids, but no aluminosilicates. Leaching studies on sections of both coalescers were performed. The results indicate that the coalescers had different amounts of solids present on them at the time of removal. Finally, samples of free liquids retrieved from both coalescers indicate no excessive amounts of CSSX solvent present. Given the strip acid flushing that occurred in the SE coalescers, the solids we detected on the coalescers are probably indicative of a larger quantity of these solids present before the strip acid flushing. Under this scenario, the excessive pressure drops are due to the solids and not from organic fouling.

  5. Preliminary Economics for the Production of Pyrolysis Oil from Lignin in a Cellulosic Ethanol Biorefinery

    SciTech Connect (OSTI)

    Jones, Susanne B.; Zhu, Yunhua

    2009-04-01

    Cellulosic ethanol biorefinery economics can be potentially improved by converting by-product lignin into high valued products. Cellulosic biomass is composed mainly of cellulose, hemicellulose and lignin. In a cellulosic ethanol biorefinery, cellulose and hemicellullose are converted to ethanol via fermentation. The raw lignin portion is the partially dewatered stream that is separated from the product ethanol and contains lignin, unconverted feed and other by-products. It can be burned as fuel for the plant or can be diverted into higher-value products. One such higher-valued product is pyrolysis oil, a fuel that can be further upgraded into motor gasoline fuels. While pyrolysis of pure lignin is not a good source of pyrolysis liquids, raw lignin containing unconverted feed and by-products may have potential as a feedstock. This report considers only the production of the pyrolysis oil and does not estimate the cost of upgrading that oil into synthetic crude oil or finished gasoline and diesel. A techno-economic analysis for the production of pyrolysis oil from raw lignin was conducted. comparing two cellulosic ethanol fermentation based biorefineries. The base case is the NREL 2002 cellulosic ethanol design report case where 2000 MTPD of corn stover is fermented to ethanol (NREL 2002). In the base case, lignin is separated from the ethanol product, dewatered, and burned to produce steam and power. The alternate case considered in this report dries the lignin, and then uses fast pyrolysis to generate a bio-oil product. Steam and power are generated in this alternate case by burning some of the corn stover feed, rather than fermenting it. This reduces the annual ethanol production rate from 69 to 54 million gallons/year. Assuming a pyrolysis oil value similar to Btu-adjusted residual oil, the estimated ethanol selling price ranges from $1.40 to $1.48 (2007 $) depending upon the yield of pyrolysis oil. This is considerably above the target minimum ethanol selling price of $1.33 for the 2012 goal case process as reported in the 2007 State of Technology Model (NREL 2008). Hence, pyrolysis oil does not appear to be an economically attractive product in this scenario. Further research regarding fast pyrolysis of raw lignin from a cellulosic plant as an end product is not recommended. Other processes, such as high-pressure liquefaction or wet gasification, and higher value products, such as gasoline and diesel from fast pyrolysis oil should be considered in future studies.

  6. NREL Overcomes Obstacles in Lignin Valorization (Fact Sheet), NREL Highlights in Research & Development, NREL (National Renewable Energy Laboratory)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Using a "funneling" pathway inherent in nature, NREL researchers show that lignin can be converted into renewable fuels, chemicals, and materials. It has long been known how to convert biomass-derived carbohydrates, such as glu- cose, into fuels and chemicals such as ethanol. However, plants also contain a significant amount of lignin, comprising up to 30% of their cell walls. Lignin is a heterogeneous aro- matic polymer that plants use for strength, for defense against pathogens, and

  7. Characterization of Lignin Derived from Water-only and Dilute Acid Flowthrough Pretreatment of Poplar Wood at Elevated Temperatures

    SciTech Connect (OSTI)

    Zhang, Libing; Yan, Lishi; Wang, Zheming; Laskar, Dhrubojyoti D.; Swita, Marie S.; Cort, John R.; Yang, Bin

    2015-12-01

    Background: Flowthrough pretreatment of biomass has high potential to valorize lignin derivatives to high-value products, which is vital to enhance the economy of biorefinery plants. Comprehensive understanding of lignin behaviors and solubilization chemistry in aqueous pretreatment such as water-only and dilute acid flowthrough pretreatment is of fundamental importance to achieve the goal of providing flexible platform for lignin utilization. Results: In this study, the effects of flowthrough pretreatment conditions on lignin separation from poplar wood were reported as well as the characteristics of three sub-sets of lignin produced from the pretreatment, including residual lignin in pretreated solid residues (ReL), recovered insoluble lignin in pretreated liquid (RISL), and recovered soluble lignin in pretreatment liquid (RSL). Both the water-only and 0.05% (w/w) sulfuric acid pretreatments were performed at temperatures from 160 to 270°C on poplar wood in a flowthrough reactor system for 2-10 min. Results showed that water-only flowthrough pretreatment primarily removed syringyl (S units). Increased temperature and/or the addition of sulfuric acid enhanced the removal of guaiacyl (G units) compared to water-only pretreatments at lower temperatures, resulting in nearly complete removal of lignin from the biomass. Results also suggested that more RISL was recovered than ReL and RSL in both dilute acid and water-only flowthrough pretreatment at elevated temperatures. NMR spectra of the RISL revealed significant β-O-4 cleavage, α-β deoxygenation to form cinnamyl-like end groups, and slight β-5 repolymerization in both water-only and dilute acid flowthrough pretreatments. Conclusions: Elevated temperature and/or dilute acid greatly enhanced lignin removal to almost 100% by improving G unit removal besides S unit removal in flowthrough system. A new lignin chemistry transformation pathway was proposed and revealed the complexity of lignin structural change during hot water and dilute acid flowthrough pretreatment.

  8. Characterization of lignin derived from water-only and dilute acid flowthrough pretreatment of poplar wood at elevated temperatures

    SciTech Connect (OSTI)

    Zhang, Libing; Yan, Lishi; Wang, Zheming; Laskar, Dhrubojyoti D.; Swita, Marie S.; Cort, John R.; Yang, Bin

    2015-12-01

    In this study, flowthrough pretreatment of biomass has high potential to valorize lignin derivatives to high-value products, which is vital to enhance the economy of biorefinery plants. Comprehensive understanding of lignin behaviors and solubilization chemistry in aqueous pretreatment such as water-only and dilute acid flowthrough pretreatment is of fundamental importance to achieve the goal of providing flexible platform for lignin utilization. In this study, the effects of flowthrough pretreatment conditions on lignin separation from poplar wood were reported as well as the characteristics of three sub-sets of lignin produced from the pretreatment, including residual lignin in pretreated solid residues (ReL), recovered insoluble lignin in pretreated liquid (RISL), and recovered soluble lignin in pretreatment liquid (RSL). Both the water-only and 0.05% (w/w) sulfuric acid pretreatments were performed at temperatures from 160 to 270°C on poplar wood in a flowthrough reactor system for 2-10 min. Results showed that water-only flowthrough pretreatment primarily removed syringyl (S units). Increased temperature and/or the addition of sulfuric acid enhanced the removal of guaiacyl (G units) compared to water-only pretreatments at lower temperatures, resulting in nearly complete removal of lignin from the biomass. Results also suggested that more RISL was recovered than ReL and RSL in both dilute acid and water-only flowthrough pretreatment at elevated temperatures. NMR spectra of the RISL revealed significant β-O-4 cleavage, α-β deoxygenation to form cinnamyl-like end groups, and slight β-5 repolymerization in both water-only and dilute acid flowthrough pretreatments. In conclusion, elevated temperature and/or dilute acid greatly enhanced lignin removal to almost 100% by improving G unit removal besides S unit removal in flowthrough system. A new lignin chemistry transformation pathway was proposed and revealed the complexity of lignin structural change during hot water and dilute acid flowthrough pretreatment.

  9. General coalescence conditions for the exact wave functions. II. Higher-order relations for many-particle systems

    SciTech Connect (OSTI)

    Kurokawa, Yusaku I. E-mail: h.nakatsuji@qcri.or.jp; Nakashima, Hiroyuki; Nakatsuji, Hiroshi E-mail: h.nakatsuji@qcri.or.jp

    2014-06-07

    We derived the necessary conditions that must be satisfied by the non-relativistic time-independent exact wave functions for many-particle systems at a two-particle coalescence (or cusp) point. Some simple conditions are known to be Kato's cusp condition (CC) and Rassolov and Chipman's CC. In a previous study, we derived an infinite number of necessary conditions that two-particle wave functions must satisfy at a coalescence point. In the present study, we extend these conditions to many-particle systems. They are called general coalescence conditions (GCCs), and Kato's CC and Rassolov and Chipman's CC are included as special conditions. GCCs can be applied not only to Coulombic systems but also to any system in which the interaction between two particles is represented in a power series of inter-particle distances. We confirmed the correctness of our derivation of the GCCs by applying the exact wave function of a harmonium in electron-electron and electron-nucleus coalescence situations. In addition, we applied the free complement (FC) wave functions of a helium atom to the GCCs to examine the accuracy of the FC wave function in the context of a coalescence situation.

  10. Lipid-Based Nanodiscs as Models for Studying Mesoscale Coalescence A Transport Limited Case

    SciTech Connect (OSTI)

    Hu, Andrew; Fan, Tai-Hsi; Katsaras, John; Xia, Yan; Li, Ming; Nieh, Mu-Ping

    2014-01-01

    Lipid-based nanodiscs (bicelles) are able to form in mixtures of long- and short-chain lipids. Initially, they are of uniform size but grow upon dilution. Previously, nanodisc growth kinetics have been studied using time-resolved small angle neutron scattering (SANS), a technique which is not well suited for probing their change in size immediately after dilution. To address this, we have used dynamic light scattering (DLS), a technique which permits the collection of useful data in a short span of time after dilution of the system. The DLS data indicate that the negatively charged lipids in nanodiscs play a significant role in disc stability and growth. Specifically, the charged lipids are most likely drawn out from the nanodiscs into solution, thereby reducing interparticle repulsion and enabling the discs to grow. We describe a population balance model, which takes into account Coulombic interactions and adequately predicts the initial growth of nanodiscs with a single parameter i.e., surface potential. The results presented here strongly support the notion that the disc coalescence rate strongly depends on nanoparticle charge density. The present system containing low-polydispersity lipid nanodiscs serves as a good model for understanding how charged discoidal micelles coalesce.

  11. A new class of renewable thermoplastics with extraordinary performance from nanostructured lignin-elastomers

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chen, Jihua D.; Keum, Jong Kahk; Naskar, Amit K.; Tran, Chau D.

    2016-03-22

    In this study, a new class of thermoplastic elastomers has been created by introducing nanoscale-dispersed lignin (a biomass-derived phenolic oligomer) into nitrile rubber. Temperature-induced controlled miscibility between the lignin and the rubber during high shear melt-phase synthesis allows tuning the material s morphology and performance. The sustainable product has unprecedented yield stress (15–45 MPa), strain hardens at large deformation, and has outstanding recyclability. The multiphase polymers developed from an equal-mass mixture of a melt-stable lignin fraction and nitrile rubber with optimal acrylonitrile content, using the method described here, show 5–100 nm lignin lamellae with a high-modulus rubbery interphase. Molded ormore » printed elastomeric products prepared from the lignin-nitrile material offer an additional revenue stream to pulping mills and biorefineries. Research was sponsored by the Technology Innovation Program of Oak Ridge National Laboratory, managed by UT-Battelle, LLC, for the U.S. Department of Energy. TEM (J.C. and C.D.T.) and SAXS (J.K.K.) experiments were conducted at the Center for Nanophase Materials Sciences, which is a DOE Office of Science User Facility.« less

  12. Lignin-assisted coal depolymerization. [Quarterly] report, March 1, 1992--May 31, 1992

    SciTech Connect (OSTI)

    Lalvani, S.B.; Muchmore, C.B.; Koropchak, J.A.; Kim, Jong Won

    1992-10-01

    In the last report, it was shown that when lignin is added to coal, the rate of coal depolymerization is enhanced. The results,-reported were based upon a number of experiments conducted for the following three reasons: (i) to generate enough quantities of liquid products so that their stability in various environments can be ascertained, (ii) to closely characterize the reaction products, so that individual atomic mass balances can be performed, and (iii) to determine the reproducibility of the experiments conducted. The stability of liquid products was characterized by determining their solubility in pentane and benzene. Exposure of the coal- and coal+lignin-derived liquids to air at 40 and 80{degrees}C led to a decrease in the pentane-soluble and asphaltene fractions with a concomitant enhancement in the benzene insoluble fraction. However, relatively no degradation was observed for the liquid samples exposed to an inert (N{sub 2}) atmosphere. Preliminary data show that the coal+lignin-derived liquids are more stable than that obtained by coal liquefaction. In this quarterly report, individual atomic mass balances on various experiments conducted with coal, lignin and coal+lignin mixtures are also reported. Although the overall mass recoveries of 95--98% of the total mass charged to the reactor were obtained, the atomic mass balance data are somewhat difficult to interpret due to the possible incorporation of tetralin (solvent) in the reaction products.

  13. Lignin-assisted coal depolymerization. Technical report, September 1, 1991--November 30, 1991

    SciTech Connect (OSTI)

    Lalvani, S.B.

    1991-12-31

    Previous research has shown that addition of lignin-derived liquids to coal stirred in tetralin under mild reaction conditions (375{degree}C and 300--500 psig) results in a marked enhancement in the rate of coal depolymerization. A mathematical model was developed to study the kinetics of coal depolymerization in the presence of liquid-derived liquids. In the present study, a reaction pathway was formulated to explain the enhancement in coal depolymerization due to lignin (solid) addition. The model postulated assumes that the products of lignin obtained during thermolysis interact with the reactive moieties present in coal while simultaneous depolymerization of coal occurs. A good fit between the experimental data and the kinetic model was found. The results show that in addition to the enhancement in the rate of coal depolymerization, lignin also reacts (and enhances the extent of depolymerization of coal) with those reaction sites in coal that are not susceptible to depolymerization when coal alone is reacted in tetralin under identical reaction conditions. Additional work is being carried out to determine a thorough materials balance on the lignin-assisted coal depolymerization process. A number of liquid samples have been obtained which are being studied for their stability in various environments. 5 refs., 4 figs., 1 tab.

  14. Manipulation of lignin composition in plants using a tissue-specific promoter

    DOE Patents [OSTI]

    Chapple, Clinton C. S.

    2003-08-26

    The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

  15. Engineering a monolignol 4-O-methyltransferase with high selectivity for the condensed lignin precursor coniferyl alchohol

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cai, Yuanheng; Shanklin, John; Mohammad -Wadud Bhuiya; Liu, Chang -Jun

    2015-09-16

    Lignin, a rigid biopolymer in plant cell walls, is derived from the oxidative polymerization of three monolignols. The composition of monolignol monomers dictates the degree of lignin condensation, reactivity, and thus the degradability of plant cell walls. Guaiacyl lignin is regarded as the condensed structural unit. Polymerization of lignin is initiated through the deprotonation of the para-hydroxyl group of monolignols. Therefore, preferentially modifying the para-hydroxyl of a specific monolignol to deprive its dehydrogenation propensity would disturb the formation of particular lignin subunits. Here, we test the hypothesis that specific remodeling the active site of a monolignol 4-O-methyltransferase would create anmore » enzyme that specifically methylates the condensed guaiacyl lignin precursor coniferyl alcohol. Combining crystal structural information with combinatorial active site saturation mutagenesis and starting with the engineered promiscuous enzyme, MOMT5 (T133L/E165I/F175I/F166W/H169F), we incrementally remodeled its substrate binding pocket by the addition of four substitutions, i.e. M26H, S30R, V33S, and T319M, yielding a mutant enzyme capable of discriminately etherifying the para-hydroxyl of coniferyl alcohol even in the presence of excess sinapyl alcohol. The engineered enzyme variant has a substantially reduced substrate binding pocket that imposes a clear steric hindrance thereby excluding bulkier lignin precursors. Lastly, the resulting enzyme variant represents an excellent candidate for modulating lignin composition and/or structure in planta.« less

  16. Engineering a monolignol 4-O-methyltransferase with high selectivity for the condensed lignin precursor coniferyl alchohol

    SciTech Connect (OSTI)

    Cai, Yuanheng; Shanklin, John; Mohammad -Wadud Bhuiya; Liu, Chang -Jun

    2015-09-16

    Lignin, a rigid biopolymer in plant cell walls, is derived from the oxidative polymerization of three monolignols. The composition of monolignol monomers dictates the degree of lignin condensation, reactivity, and thus the degradability of plant cell walls. Guaiacyl lignin is regarded as the condensed structural unit. Polymerization of lignin is initiated through the deprotonation of the para-hydroxyl group of monolignols. Therefore, preferentially modifying the para-hydroxyl of a specific monolignol to deprive its dehydrogenation propensity would disturb the formation of particular lignin subunits. Here, we test the hypothesis that specific remodeling the active site of a monolignol 4-O-methyltransferase would create an enzyme that specifically methylates the condensed guaiacyl lignin precursor coniferyl alcohol. Combining crystal structural information with combinatorial active site saturation mutagenesis and starting with the engineered promiscuous enzyme, MOMT5 (T133L/E165I/F175I/F166W/H169F), we incrementally remodeled its substrate binding pocket by the addition of four substitutions, i.e. M26H, S30R, V33S, and T319M, yielding a mutant enzyme capable of discriminately etherifying the para-hydroxyl of coniferyl alcohol even in the presence of excess sinapyl alcohol. The engineered enzyme variant has a substantially reduced substrate binding pocket that imposes a clear steric hindrance thereby excluding bulkier lignin precursors. Lastly, the resulting enzyme variant represents an excellent candidate for modulating lignin composition and/or structure in planta.

  17. Top Value-Added Chemicals from Biomass - Volume IIResults of Screening for Potential Candidates from Biorefinery Lignin

    SciTech Connect (OSTI)

    Holladay, John E.; White, James F.; Bozell, Joseph J.; Johnson, David

    2007-10-01

    This report evaluates lignins role as a renewable raw material resource. Opportunities that arise from utilizing lignin fit into one of three categories: 1)power, fuel and syngas (generally near-term opportunities) 2) macromolecules (generally medium-term opportunities) 3) aromatics and miscellaneous monomers (long-term opportunities). Biorefineries will receive and process massive amounts of lignin. For this reason, how lignin can be best used to support the economic health of the biorefinery must be defined. An approach that only considers process heat would be shortsighted. Higher value products present economic opportunities and the potential to significantly increase the amount of liquid transportation fuel available from biomass. In this analysis a list of potential uses of lignin was compiled and sorted into product types which are broad classifications (listed above as powerfuelsyngas; macromolecules; and aromatics). In the first product type (powerfuelgasification) lignin is used purely as a carbon source and aggressive means are employed to break down its polymeric structure. In the second product type (macromolecules) the opposite extreme is considered and advantage of the macromolecular structure imparted by nature is retained in high-molecular weight applications. The third product type (aromatics) lies somewhere between the two extremes and employs technologies that would break up lignins macromolecular structure but maintain the aromatic nature of the building block molecules. The individual opportunities were evaluated based on their technical difficulty, market, market risk, building block utility, and whether a pure material or a mixture would be produced. Unlike the Sugars Top 10 report it was difficult to identify the ten best opportunities, however, the potential opportunities fell nicely into near-, medium- and long-term opportunities. Furthermore, the near-, medium- and long-term opportunities roughly align with the three product types. From this analysis a list of technical barriers was developed which can be used to identify research needs. Lignin presents many challenges for use in the biorefinery. Chemically it differs from sugars having a complex aromatic substructure. Unlike cellulose, which has a relatively simple substructure of glucose subunits, lignin has a high degree of variability in its structure which differs both from biomass source and from the recovery process used. In addition to its variability lignin is also reactive and to some degree less stable thermally and oxidatively to other biomass streams. What this means is that integrating a lignin process stream within the biorefinery will require identifying the best method to separate lignin from biomass cost-effectively.

  18. NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin (Journal

    Office of Scientific and Technical Information (OSTI)

    Article) | SciTech Connect NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin Citation Details In-Document Search Title: NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin Authors: Yunqiao,Pu ; Fang,Chen ; Angela,Ziebell ; Brian H.,Davison ; Arthur J.,Ragauskas ; , Publication Date: 2009-12-01 OSTI Identifier: 1151964 Resource Type: Journal Article Resource Relation: Journal Name: BioEnergy Research; Journal Volume: 2; Journal Issue: 4 Research Org: BioEnergy

  19. Manipulation Of Lignin Biosynthesis To Maximize Ethanol Production From Populus Feedstocks

    SciTech Connect (OSTI)

    Dr. Clint Chapple; Dr. Rick Lindroth; Dr. Burce Dien; Dr. Glen Stanosz; Dr. Alex Wiedenhoeft; Dr. Fu Zhao; Dr. Duane Wegener; Dr. Janice Kelly; Dr. Leigh Raymond; Dr. Wallace Tyner

    2012-05-15

    Our research focuses on transgenic strategies for modifying lignification to improve biomass quality, without leading to deleterious effects on plant performance. In order to accomplish this objective, we designed molecular strategies and selected appropriate transgenes for manipulating the expression of lignification-associated genes; we generated poplar engineered for altered lignin content and/or monomer composition, and field-tested them for fitness; we analyzed the impact of these transgenic strategies on metabolism in general and lignin biosynthesis in particular; and evaluated the ease with which cell wall deconstruction can be accomplished using both chemical and enzymatic means using wild-type and high syringyl poplar.

  20. Method of separating lignocellulosic material into lignin, cellulose and dissolved sugars

    DOE Patents [OSTI]

    Black, S.K.; Hames, B.R.; Myers, M.D.

    1998-03-24

    A method is described for separating lignocellulosic material into (a) lignin, (b) cellulose, and (c) hemicellulose and dissolved sugars. Wood or herbaceous biomass is digested at elevated temperature in a single-phase mixture of alcohol, water and a water-immiscible organic solvent (e.g., a ketone). After digestion, the amount of water or organic solvent is adjusted so that there is phase separation. The lignin is present in the organic solvent, the cellulose is present in a solid pulp phase, and the aqueous phase includes hemicellulose and any dissolved sugars.

  1. Flash Vacuum Pyrolysis of Lignin Model Compounds: Reaction Pathways of Aromatic Methoxy Groups

    SciTech Connect (OSTI)

    Britt, P.F.; Buchanan, A.C., III; Martineau, D.R.

    1999-03-21

    Currently, there is interest in utilizing lignin, a major constituent of biomass, as a renewable source of chemicals and fuels. High yields of liquid products can be obtained from the flash or fast pyrolysis of biomass, but the reaction pathways that lead to product formation are not understood. To provide insight into the primary reaction pathways under process relevant conditions, we are investigating the flash vacuum pyrolysis (FVP) of lignin model compounds at 500 C. This presentation will focus on the FVP of {beta}-ether linkages containing aromatic methoxy groups and the reaction pathways of methoxy-substituted phenoxy radicals.

  2. New perspective on glycoside hydrolase binding to lignin from pretreated corn stover

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Yarbrough, John M.; Mittal, Ashutosh; Mansfield, Elisabeth; Taylor, II, Larry E.; Hobdey, Sarah E.; Sammond, Deanne W.; Bomble, Yannick J.; Crowley, Michael F.; Decker, Stephen R.; Himmel, Michael E.; et al

    2015-12-18

    In this study, non-specific binding of cellulases to lignin has been implicated as a major factor in the loss of cellulase activity during biomass conversion to sugars. It is believed that this binding may strongly impact process economics through loss of enzyme activities during hydrolysis and enzyme recycling scenarios. The current model suggests glycoside hydrolase activities are lost though non-specific/non-productive binding of carbohydrate-binding domains to lignin, limiting catalytic site access to the carbohydrate components of the cell wall.

  3. Method of separating lignocellulosic material into lignin, cellulose and dissolved sugars

    DOE Patents [OSTI]

    Black, Stuart K.; Hames, Bonnie R.; Myers, Michele D.

    1998-01-01

    A method for separating lignocellulosic material into (a) lignin, (b) cellulose, and (c) hemicellulose and dissolved sugars. Wood or herbaceous biomass is digested at elevated temperature in a single-phase mixture of alcohol, water and a water-immiscible organic solvent (e.g., a ketone). After digestion, the amount of water or organic solvent is adjusted so that there is phase separation. The lignin is present in the organic solvent, the cellulose is present in a solid pulp phase, and the aqueous phase includes hemicellulose and any dissolved sugars.

  4. Cellulose and lignin: biodegradation. January 1978-May 1987 (Citations from the Life Sciences Collection data base). Report for January 1978-May 1987

    SciTech Connect (OSTI)

    Not Available

    1988-09-01

    This bibliography contains citations concerning the biodegradation of waste cellulose, cellulose-containing substances, lignin, and lignin-containing substances. Attention is given to the organisms that decompose cellulose and lignin, and the processes by which this takes place. (This updated bibliography contains 379 citations, none of which are new entries to the previous edition.)

  5. Cellulose and lignin: biodegradation. June 1987-September 1988 (Citations from the Life Sciences Collection data base). Report for June 1987-September 1988

    SciTech Connect (OSTI)

    Not Available

    1988-09-01

    This bibliography contains citations concerning the biodegradation of waste cellulose, cellulose-containing substances, lignin, and lignin-containing substances. Attention is given to the organisms that decompose cellulose and lignin, and the processes by which this takes place. (This updated bibliography contains 65 citations, all of which are new entries to the previous edition.)

  6. Cellulose and lignin: Biodegradation. June 1987-September 1989 (Citations from the Life Sciences Collection data base). Report for June 1987-September 1989

    SciTech Connect (OSTI)

    Not Available

    1989-09-01

    This bibliography contains citations concerning the biodegradation of waste cellulose, cellulose-containing substances, lignin, and lignin-containing substances. Attention is given to the organisms that decompose cellulose and lignin, and the processes by which this takes place. (This updated bibliography contains 120 citations, 46 of which are new entries to the previous edition.)

  7. Integration of air separation membrane and coalescing filter for use on an inlet air system of an engine

    DOE Patents [OSTI]

    Moncelle, Michael E.

    2003-01-01

    An intake air separation system suitable for combustion air of an internal combustion engine. An air separation device of the system includes a plurality of fibers, each fiber having a tube with a permeation barrier layer on the outer surface thereof and a coalescing layer on the inner surface thereof, to restrict fluid droplets from contacting the permeation barrier layer.

  8. VISUAL-SOLAR

    Energy Science and Technology Software Center (OSTI)

    003661IBMPC00 Visual-SOLAR: Modeling and Visualization of Solar Radiation Potential on Individual Building Rooftops

  9. Lignin-Derived Carbon Fiber as a Co-Product of Refining Cellulosic Biomass

    SciTech Connect (OSTI)

    Langholtz, Matthew H.; Downing, Mark; Graham, Robin Lambert; Baker, Fred S.; Compere, Alicia L.; William L. Griffith; Boeman, Raymond G.; Keller, Martin

    2014-01-15

    Lignin by-products from biorefineries has the potential to provide a low-cost alternative to petroleum-based precursors to manufacture carbon fiber, which can be combined with a binding matrix to produce a structural material with much greater specific strength and specific stiffness than conventional materials such as steel and aluminum. The market for carbon fiber is universally projected to grow exponentially to fill the needs of clean energy technologies such as wind turbines and to improve the fuel economies in vehicles through lightweighting. In addition to cellulosic biofuel production, lignin-based carbon fiber production coupled with biorefineries may provide $2,400 to $3,600 added value dry Mg-1 of biomass for vehicle applications. Compared to producing ethanol alone, the addition of lignin-derived carbon fiber could increase biorefinery gross revenue by 30% to 300%. Using lignin-derived carbon fiber in 15 million vehicles per year in the US could reduce fossil fuel consumption by 2-5 billion liters year-1, reduce CO2 emissions by about 6.7 million Mg year-1, and realize fuel savings through vehicle lightweighting of $700 to $1,600 per Mg biomass processed. The value of fuel savings from vehicle lightweighting becomes economical at carbon fiber price of $6.60 kg-1 under current fuel prices, or $13.20 kg-1 under fuel prices of about $1.16 l-1.

  10. Reductive deconstruction of organosolv lignin catalyzed by zeolite supported nickel nanoparticles

    SciTech Connect (OSTI)

    Kasakov, Stanislav; Shi, Hui; Camaioni, Donald M.; Zhao, Chen; Barath, Eszter; Jentys, Andreas; Lercher, Johannes A.

    2015-11-01

    Mechanistic aspects of deconstruction and hydrodeoxygenation of organosolv lignin using supported Ni catalysts with (Ni/HZSM-5 and Ni/HBEA) and without Brønsted acid sites (Ni/SiO2) are reported. Lignin was deconstructed and converted to saturated cyclic hydrocarbons ranging from C5 to C14. In the one-stage reaction, full conversion with total yield of 70 ± 5 wt.% saturated hydrocarbons was achieved at 593 K and 20 bar H2. The organosolv lignin used consists of seven to eight monolignol subunits and has an average molecular weight of ca. 1200 g mol-1. The monolignols were mainly guaiacyl, syringyl and phenylcoumaran, randomly interconnected through β-O-4, 4-O-5, β-1, 5-5’ and β-β ether bonds. In situ IR spectroscopy was used to follow the changes in lignin constituents during reaction. The proposed reaction pathways for the catalytic transformation of this organosolv lignin to alkanes start with the hydrogenolysis of aryl alkyl ether bonds, followed by hydrogenation of the aromatic compounds on Ni to cyclic alcohols. Oxygen is removed from the alcohols via dehydration on Brønsted acid sites to yield cyclic alkenes that are further hydrogenated to alkanes. Formation of condensation products may occur via intermolecular recombination of aromatic monomers or alkylation of aromatic compounds by alkenes. The financial support from TUM-PNNL cooperation project “Development of new methods for in situ characterization in liquid phase reactions” (CN-177939) is highly appreciated. The work by S.K., H.S., and J.A.L was partially supported by the US Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences.

  11. Adsorption of Clostridium thermocellum cellulases onto pretreated mixed hardwood, avicel, and lignin

    SciTech Connect (OSTI)

    Bernardez, T.D.; Lyford, K.; Hogsett, D.A.; Lynd, L.R. . Thayer School of Engineering)

    1993-09-20

    Adsorption of Avicel-hydrolyzing activity was examined with respect to: mixed hardwood flour pretreated with 1% sulfuric acid for 9 s at 220C (PTW220), lignin prepared from PTW220 by either acid or enzymatic hydrolysis, and Avicel. Experiments were conducted at 60C for all materials, and also at 25C for PTW220. Based on transient adsorption results and reaction rates, times were selected at which to characterize adsorption at 60C as follows: PTW220, 1 min; lignin, 30 min; and Avicel, 45 min. Similar results were obtained for adsorption of cellulase activity to PTW220 at 25 and 60C, and for lignin prepared by enzymatic and acid hydrolysis. For all materials, adsorption was described well by a Langmuir equation, although the reversibility of adsorption was not investigated. Langmuir affinity constants (L/g) were: PTW220, 109; lignin, 17.9; Avicel, 4.3; cellulose from PTW220, [ge]187. Langmuir capacity constants were 760 for PTW220 and 42 for Avicel; the cellulase binding capacity of lignin appeared to be very high under the conditions examined, and could not be determined. At low and moderate cellulase loadings at least, the majority of cellulase activity adsorbed to PTVV220 is bound to the cellulosic component. The results indicate that PTW220, and its cellulose component in particular, differ radically from Avicel with respect to adsorption. Avicel-hydrolyzing activity and CMC-hydrolyzing activities were found to bind to Avicel with a constant ratio of essentially one, consistent with adsorption of a multi-activity complex.

  12. Characterization of lignin derived from water-only and dilute acid flowthrough pretreatment of poplar wood at elevated temperatures

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Libing; Yan, Lishi; Wang, Zheming; Laskar, Dhrubojyoti D.; Swita, Marie S.; Cort, John R.; Yang, Bin

    2015-12-01

    In this study, flowthrough pretreatment of biomass has high potential to valorize lignin derivatives to high-value products, which is vital to enhance the economy of biorefinery plants. Comprehensive understanding of lignin behaviors and solubilization chemistry in aqueous pretreatment such as water-only and dilute acid flowthrough pretreatment is of fundamental importance to achieve the goal of providing flexible platform for lignin utilization. In this study, the effects of flowthrough pretreatment conditions on lignin separation from poplar wood were reported as well as the characteristics of three sub-sets of lignin produced from the pretreatment, including residual lignin in pretreated solid residues (ReL),more » recovered insoluble lignin in pretreated liquid (RISL), and recovered soluble lignin in pretreatment liquid (RSL). Both the water-only and 0.05% (w/w) sulfuric acid pretreatments were performed at temperatures from 160 to 270°C on poplar wood in a flowthrough reactor system for 2-10 min. Results showed that water-only flowthrough pretreatment primarily removed syringyl (S units). Increased temperature and/or the addition of sulfuric acid enhanced the removal of guaiacyl (G units) compared to water-only pretreatments at lower temperatures, resulting in nearly complete removal of lignin from the biomass. Results also suggested that more RISL was recovered than ReL and RSL in both dilute acid and water-only flowthrough pretreatment at elevated temperatures. NMR spectra of the RISL revealed significant β-O-4 cleavage, α-β deoxygenation to form cinnamyl-like end groups, and slight β-5 repolymerization in both water-only and dilute acid flowthrough pretreatments. In conclusion, elevated temperature and/or dilute acid greatly enhanced lignin removal to almost 100% by improving G unit removal besides S unit removal in flowthrough system. A new lignin chemistry transformation pathway was proposed and revealed the complexity of lignin structural change during hot water and dilute acid flowthrough pretreatment.« less

  13. Cellulose and lignin: Biodegradation. January 1985-May 1989 (Citations from the Biobusiness data base). Report for January 1985-May 1989

    SciTech Connect (OSTI)

    Not Available

    1989-06-01

    This bibliography contains citations concerning the biodegradation of materials containing cellulose and lignin components. Natural wood decay and sludge digestion are considered. Detailed chemical and physical mechanisms of degradation and research on microorganisms involved are discussed for a variety of cellulose and lignin containing materials including straw, municipal wastes, living trees, paper, lumber, and grasses. Genetic engineering studies regarding the isolation, preparation, and characterization of suitable microorganisms for cellulose and lignin degradation are included. (Contains 87 citations fully indexed and including a title list.)

  14. Genetic manipulation of lignin reduces recalcitrance and improves biomass ethanol production from switchgrass

    SciTech Connect (OSTI)

    Hamilton, Choo Yieng; Fu, Chunxiang; Xiao, Xirong; Ge, Yaxin; Chen, Fang; Bouton, Joseph; Foston, Marcus; Dixon, Richard A; Wang, Zeng-Yu; Mielenz, Jonathan R

    2011-01-01

    Switchgrass is a leading dedicated bioenergy feedstock because it is a native, high yielding, perennial prairie grass with broad cultivation range and low agronomic input requirements. Biomass conversion research has developed pilot scale processes for production of ethanol and other alcohols but they remain costly primarily due to the intrinsic recalcitrance of biomass. We show here that switchgrass genetic modification can produce normal plants that have reduced thermochemical and enzymatic recalcitrance. Downregulation of the switchgrass caffeic O-methyltransferase gene decreases lignin content modestly, reduces the syringyl to guaiacyl lignin monomer ratio and increases the ethanol yield by up to a third using conventional biomass fermentation processes. The downregulated lines have wild-type biomass yields but require reduced pretreatment severity and 300-400% lower cellulase dosages for equivalent product yields significantly lowering processing costs. Alternately, our modified transgenic switchgrass lines should yield significantly more fermentation chemicals per hectare under identical process conditions.

  15. Characterization of solids deposited on the modular caustic-side solvent extraction unit (MCU) coalescer media removed in May and October 2014

    SciTech Connect (OSTI)

    Fondeur, F. F.

    2015-10-01

    During routine maintenance, the coalescers utilized in the Modular Caustic-Side Solvent Extraction Unit (MCU) processing of Salt Batch 6 and a portion of Salt Batch 7 were sampled and submitted to the Savannah River National Laboratory (SRNL) for characterization, for the purpose of identifying solid phase constituents that may be accumulating in these coalescers. Specifically, two samples were received and characterized: A decontaminated salt solution (DSS) coalescer sample and a strip effluent (SE) coalescer sample. Aliquots of the samples were analyzed by XRD, Fourier Transform Infrared (FTIR) Spectroscopy, SEM, and EDS. Other aliquots of the samples were leached in acid solution, and the leachates were analyzed by ICP-AES. In addition, modeling was performed to provide a basis for comparison of the analytical results.

  16. "Bionic" Liquids from Lignin: Joint BioEnergy Institute Results Pave

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the Way for Closed-Loop Biofuel Refineries Bionic" Liquids from Lignin: Joint BioEnergy Institute Results Pave the Way for Closed-Loop Biofuel Refineries - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure

  17. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    SciTech Connect (OSTI)

    D Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  18. Notes for Visualization Requirememnts

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Notes for Visualization Requirememnts Notes from June 5, 2002, Visualization Requirements for DOE-Sponsored Computational Science and Engineering Applications A DOE Workshop to Be ...

  19. Computational Study of Bond Dissociation Enthalpies for Substituted $\\beta$-O-4 Lignin Model Compounds

    SciTech Connect (OSTI)

    Younker, Jarod M; Beste, Ariana; Buchanan III, A C

    2011-01-01

    The biopolymer lignin is a potential source of valuable chemicals. Phenethyl phenyl ether (PPE) is representative of the dominant $\\beta$-O-4 ether linkage. Density functional theory (DFT) is used to calculate the Boltzmann-weighted carbon-oxygen and carbon-carbon bond dissociation enthalpies (BDEs) of substituted PPE. These values are important in order to understand lignin decomposition. Exclusion of all conformers that have distributions of less than 5\\% at 298 K impacts the BDE by less than 1 kcal mol$^{-1}$. We find that aliphatic hydroxyl/methylhydroxyl substituents introduce only small changes to the BDEs (0-3 kcal mol$^{-1}$). Substitution on the phenyl ring at the $ortho$ position substantially lowers the C-O BDE, except in combination with the hydroxyl/methylhydroxyl substituents, where the effect of methoxy substitution is reduced by hydrogen bonding. Hydrogen bonding between the aliphatic substituents and the ether oxygen in the PPE derivatives has a significant influence on the BDE. CCSD(T)-calculated BDEs and hydrogen bond strengths of $ortho$-substituted anisoles when compared with M06-2X values confirm that the latter method is sufficient to describe the molecules studied and provide an important benchmark for lignin model compounds.

  20. Differential Expression in Phanerochaete chrysosporium of Membrane-Associated Proteins Relevant to Lignin Degradation

    SciTech Connect (OSTI)

    Shary, Semarjit; Kapich, Alexander N.; Panisko, Ellen A.; Magnuson, Jon K.; Cullen, Dan; Hammel, Ken

    2008-10-02

    Fungal lignin-degrading systems must include membrane-associated proteins that participate in diverse processes such as uptake and oxidation of lignin fragments, secretion of ligninolytic secondary metabolites, and defense of the mycelium against ligninolytic oxidants. Despite their importance, little is known about the nature or regulation of these membrane-associated components. We grew the white rot basidiomycete Phanerochaete chrysosporium on cellulose or glucose as the carbon source and monitored the mineralization of a 14C-labeled synthetic lignin by these cultures to assess their ligninolytic competence. The results showed that the cellulose-grown cultures were ligninolytic, whereas the glucose-grown ones were not. We isolated microsomal membrane fractions from both types of culture and analyzed tryptic digests of them by shotgun liquid chromatography/tandem mass spectrometry. Comparison of the results against the predicted P. chrysosporium proteome showed that a catalase (Joint Genome Institute P. chrysosporium protein I.D. 124398), an alcohol oxidase (126879), two transporters (137220 and 132234), and two cytochrome P450s (5011 and 8912) were up-regulated under ligninolytic conditions. Real time reverse transcription polymerase chain reaction assays showed that RNA transcripts encoding all of these proteins were also up-regulated in ligninolytic cultures. Catalase 124398, alcohol oxidase 126879, and transporter 137220 were found in a proteomic analysis of partially purified plasma membranes from ligninolytic P. chrysosporium, and are therefore most likely associated with the outer envelope of the fungus.

  1. Radical Coupling Reactions in Lignin Synthesis: A Density Functional Theory Study

    SciTech Connect (OSTI)

    Sangha, A. K.; Parks, J. M.; Standaert, R. F.; Ziebell, A.; Davis, M.; Smith, J. C.

    2012-04-26

    Lignin is a complex, heterogeneous polymer in plant cell walls that provides mechanical strength to the plant stem and confers resistance to degrading microbes, enzymes, and chemicals. Lignin synthesis initiates through oxidative radical-radical coupling of monolignols, the most common of which are p-coumaryl, coniferyl, and sinapyl alcohols. Here, we use density functional theory to characterize radical-radical coupling reactions involved in monolignol dimerization. We compute reaction enthalpies for the initial self- and cross-coupling reactions of these monolignol radicals to form dimeric intermediates via six major linkages observed in natural lignin. The 8-O-4, 8-8, and 8-5 coupling are computed to be the most favorable, whereas the 5-O-4, 5-5, and 8-1 linkages are less favorable. Overall, p-coumaryl self- and cross-coupling reactions are calculated to be the most favorable. For cross-coupling reactions, in which each radical can couple via either of the two sites involved in dimer formation, the more reactive of the two radicals is found to undergo coupling at its site with the highest spin density.

  2. Effect of Lignin Removal by Alkaline Peroxide Pretreatment on the Susceptibility of Corn Stover to Purified Cellulolytic and Xylanolytic Enzymes

    SciTech Connect (OSTI)

    Selig, M. J.; Vinzant, T. B.; Himmel, M. E.; Decker, S. R.

    2009-01-01

    Pretreatment of corn stover with alkaline peroxide (AP) at pH 11.5 resulted in reduction of lignin content in the residual solids as a function of increasing batch temperature. Scanning electron microscopy of these materials revealed notably more textured surfaces on the plant cell walls as a result of the delignifying pretreatment. As expected, digestion of the delignified samples with commercial cellulase preparations showed an inverse relationship between the content of lignin present in the residual solids after pretreatment and the extent of both glucan and xylan conversion achievable. Digestions with purified enzymes revealed that decreased lignin content in the pretreated solids did not significantly impact the extent of glucan conversion achievable by cellulases alone. Not until purified xylanolytic activities were included with the cellulases were significant improvements in glucan conversion realized. In addition, an inverse relationship was observed between lignin content after pretreatment and the extent of xylan conversion achievable in a 24-h period with the xylanolytic enzymes in the absence of the cellulases. This observation, coupled with the direct relationship between enzymatic xylan and glucan conversion observed in a number of cases, suggests that the presence of lignins may not directly occlude cellulose present in lignocelluloses but rather impact cellulase action indirectly by its association with xylan.

  3. Catalytic Hydrothermal Gasification of Lignin-Rich Biorefinery Residues and Algae Final Report

    SciTech Connect (OSTI)

    Elliott, Douglas C.; Neuenschwander, Gary G.; Hart, Todd R.; Rotness, Leslie J.; Zacher, Alan H.; Santosa, Daniel M.; Valkenburt, Corinne; Jones, Susanne B.; Tjokro Rahardjo, Sandra A.

    2009-11-03

    This report describes the results of the work performed by PNNL using feedstock materials provided by the National Renewable Energy Laboratory, KL Energy and Lignol lignocellulosic ethanol pilot plants. Test results with algae feedstocks provided by Genifuel, which provided in-kind cost share to the project, are also included. The work conducted during this project involved developing and demonstrating on the bench-scale process technology at PNNL for catalytic hydrothermal gasification of lignin-rich biorefinery residues and algae. A technoeconomic assessment evaluated the use of the technology for energy recovery in a lignocellulosic ethanol plant.

  4. Restricting lignin and enhancing sugar deposition in secondary cell walls enhances monomeric sugar release after low temperature ionic liquid pretreatment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Scullin, Chessa; Cruz, Alejandro G.; Chuang, Yi -De; Simmons, Blake A.; Loque, Dominique; Singh, Seema

    2015-07-04

    Lignocellulosic biomass has the potential to be a major source of renewable sugar for biofuel production. Before enzymatic hydrolysis, biomass must first undergo a pretreatment step in order to be more susceptible to saccharification and generate high yields of fermentable sugars. Lignin, a complex, interlinked, phenolic polymer, associates with secondary cell wall polysaccharides, rendering them less accessible to enzymatic hydrolysis. Herein, we describe the analysis of engineered Arabidopsis lines where lignin biosynthesis was repressed in fiber tissues but retained in the vessels, and polysaccharide deposition was enhanced in fiber cells with little to no apparent negative impact on growth phenotype.

  5. Restricting lignin and enhancing sugar deposition in secondary cell walls enhances monomeric sugar release after low temperature ionic liquid pretreatment

    SciTech Connect (OSTI)

    Scullin, Chessa; Cruz, Alejandro G.; Chuang, Yi -De; Simmons, Blake A.; Loque, Dominique; Singh, Seema

    2015-07-04

    Lignocellulosic biomass has the potential to be a major source of renewable sugar for biofuel production. Before enzymatic hydrolysis, biomass must first undergo a pretreatment step in order to be more susceptible to saccharification and generate high yields of fermentable sugars. Lignin, a complex, interlinked, phenolic polymer, associates with secondary cell wall polysaccharides, rendering them less accessible to enzymatic hydrolysis. Herein, we describe the analysis of engineered Arabidopsis lines where lignin biosynthesis was repressed in fiber tissues but retained in the vessels, and polysaccharide deposition was enhanced in fiber cells with little to no apparent negative impact on growth phenotype.

  6. ESnet Visualization Widgets

    Energy Science and Technology Software Center (OSTI)

    2012-07-01

    The ESnet Visualization widgets are various data visualization widgets for use in web browsers to aid in the visualization of computer networks. In particular the widgets are targetted at displaying timeseries and topology data. They were developed for use in the MyESnet portal but are general enough to be used other places. The widgets are built using the d3.js library.

  7. PROSPECTS FOR JOINT GRAVITATIONAL-WAVE AND ELECTROMAGNETIC OBSERVATIONS OF NEUTRON-STAR-BLACK-HOLE COALESCING BINARIES

    SciTech Connect (OSTI)

    Pannarale, Francesco; Ohme, Frank E-mail: frank.ohme@ligo.org

    2014-08-10

    Coalescing neutron-star-black-hole (NS-BH) binaries are a promising source of gravitational-wave (GW) signals detectable with large-scale laser interferometers such as the Advanced Laser Interferometer Gravitational-Wave Observatory and Virgo. They are also one of the main short gamma-ray burst (SGRB) progenitor candidates. If the black hole (BH) tidally disrupts its companion, an SGRB may be ignited when a sufficiently massive accretion disk forms around the remnant BH. Detecting an NS-BH coalescence both in the GW and electromagnetic (EM) spectrum offers a wealth of information about the nature of the source. How much can actually be inferred from a joint detection is unclear, however, as a mass/spin degeneracy may reduce the GW measurement accuracy. To shed light on this problem and on the potential of joint EM+GW observations, we here combine recent semi-analytical predictions for the remnant disk mass with estimates of the parameter-space portion that is selected by a GW detection. We identify cases in which an SGRB ignition is supported, others in which it can be excluded, and finally others in which the outcome depends on the chosen model for the currently unknown NS equation of state. We pinpoint a range of systems that would allow us to place lower bounds on the equation of state stiffness if both the GW emission and its EM counterpart are observed. The methods we develop can broaden the scope of existing GW detection and parameter-estimation algorithms and could allow us to disregard about half of the templates in an NS-BH search following an SGRB trigger, increasing its speed and sensitivity.

  8. Visual Resources | Open Energy Information

    Open Energy Info (EERE)

    Visual Resources Jump to: navigation, search Retrieved from "http:en.openei.orgwindex.php?titleVisualResources&oldid612333...

  9. Conceptual design assessment for the co-firing of bio-refinery supplied lignin project. Quarterly report, June 23--July 1, 2000

    SciTech Connect (OSTI)

    Berglund, T.; Ranney, J.T.; Babb, C.L.

    2000-07-27

    The Conceptual Design Assessment for the Co-Firing of Bio-Refinery Supplied Lignin Project was successfully kicked off on July 23, 2000 during a meeting at the TVA-PPI facility in Muscle Shoals, AL. An initial timeline for the study was distributed, issues of concern were identified and a priority actions list was developed. Next steps include meeting with NETL to discuss de-watering and lignin fuel testing, the development of the mass balance model and ethanol facility design criteria, providing TVA-Colbert with preliminary lignin fuel analysis and the procurement of representative feed materials for the pilot and bench scale testing of the hydrolysis process.

  10. Cellulose and lignin: Biodegradation. December 1985-May 1990 (A Bibliography from the Biobusiness data base). Report for December 1985-May 1990

    SciTech Connect (OSTI)

    Not Available

    1990-06-01

    This bibliography contains citations concerning the biodegradation of materials containing cellulose and lignin components. Natural wood decay and sludge digestion are considered. Detailed chemical and physical mechanisms of degradation and research on microorganisms involved are discussed for a variety of cellulose and lignin containing materials including straw, municipal wastes, living trees, paper, lumber, and grasses. Genetic engineering studies regarding the isolation, preparation, and characterization of suitable microorganisms for cellulose and lignin degradation are included. (This updated bibliography contains 135 citations, 48 of which are new entries to the previous edition.)

  11. Base-Catalyzed Depolymerization of Lignin with Heterogeneous Catalysts: Cooperative Research and Development Final Report, CRADA Number CRD-13-513

    SciTech Connect (OSTI)

    Beckham, Gregg T.

    2015-08-04

    We will synthesize and screen solid catalysts for the depolymerization of lignin to monomeric and oligomeric oxygenated species, which could be fractionated and integrated into refinery intermediate streams for selective upgrading, or catalytically upgraded to fuels and chemicals. This work will primarily focus on the synthesis and application of layered double hydroxides (LDHs) as recyclable, heterogeneous catalysts for depolymerization of lignin model compounds and softwood lignin. LDHs have been shown in our group to offer good supports and catalysts to promote base-catalyzed depolymerization of lignin model compounds and in preliminary experiments for the depolymerization of lignin from an Organosolv process. We will also include additional catalyst supports such as silica, alumina, and carbon as identified in ongoing and past efforts at NREL. This work will consist of two tasks. Overall, this work will be synergistic with ongoing efforts at NREL, funded by the DOE Biomass Program, on the development of catalysts for lignin depolymerization in the context of biochemical and thermochemical conversion of corn stover and other biomass feedstocks to advanced fuels and chemicals.

  12. Visualization of electronic density

    SciTech Connect (OSTI)

    Grosso, Bastien; Cooper, Valentino R.; Pine, Polina; Hashibon, Adham; Yaish, Yuval; Adler, Joan

    2015-04-22

    An atoms volume depends on its electronic density. Although this density can only be evaluated exactly for hydrogen-like atoms, there are many excellent numerical algorithms and packages to calculate it for other materials. 3D visualization of charge density is challenging, especially when several molecular/atomic levels are intertwined in space. We explore several approaches to 3D charge density visualization, including the extension of an anaglyphic stereo visualization application based on the AViz package to larger structures such as nanotubes. We will describe motivations and potential applications of these tools for answering interesting questions about nanotube properties.

  13. Visualization of electronic density

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Grosso, Bastien; Cooper, Valentino R.; Pine, Polina; Hashibon, Adham; Yaish, Yuval; Adler, Joan

    2015-04-22

    An atom’s volume depends on its electronic density. Although this density can only be evaluated exactly for hydrogen-like atoms, there are many excellent numerical algorithms and packages to calculate it for other materials. 3D visualization of charge density is challenging, especially when several molecular/atomic levels are intertwined in space. We explore several approaches to 3D charge density visualization, including the extension of an anaglyphic stereo visualization application based on the AViz package to larger structures such as nanotubes. We will describe motivations and potential applications of these tools for answering interesting questions about nanotube properties.

  14. Computational Analysis of the Pyrolysis of ..beta..-O4 Lignin Model Compounds: Concerted vs. Homolytic Fragmentation

    SciTech Connect (OSTI)

    Clark, J. M.; Robichaud, D. J.; Nimlos, M. R.

    2012-01-01

    The thermochemical conversion of biomass to liquid transportation fuels is a very attractive technology for expanding the utilization of carbon neutral processes and reducing dependency on fossil fuel resources. As with all such emerging technologies, biomass conversion through gasification or pyrolysis has a number of obstacles that need to be overcome to make these processes cost competitive with the refining of fossil fuels. Our current efforts have focused on the investigation of the thermochemistry of the linkages between lignin units using ab initio calculations on dimeric lignin model compounds. All calculations were carried out using M062X density functional theory at the 6-311++G(d,p) basis set. The M062X method has been shown to be consistent with the CBS-QB3 method while being significantly less computationally expensive. To date we have only completed the study on the b-O4 compounds. The theoretical calculations performed in the study indicate that concerted elimination pathways dominate over bond homolysis reactions under typical pyrolysis conditions. However, this does not mean that concerted elimination will be the dominant loss process for lignin. Bimolecular radical chemistry could very well dwarf the unimolecular pathways investigated in this study. These concerted pathways tend to form stable, reasonably non-reactive products that would be more suited producing a fungible bio-oil for the production of liquid transportation fuels.

  15. Visualizations Image Gallery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualizations Visualizations Image Gallery Chensantacruz Unusual Death for Ancient Stars chombocrunch2shalehi-res.jpg Resolved Steady-State Flow in Fractured Shale inn-nano-wire-pr-green.png Indium Nitride Nanostructures For More Efficient LEDs combustionmodeling1.jpg Turbulent Combustion Simulations lic-b-427-hr-crop-small.png Turbulence in Solar Wind corecollapserotator2 Explosion Mechanism in Core-Collapse Supernovae OpenMSINERSC.jpg OpenMSI: Mass Spectrometry Images of 3 Lipids Across a

  16. TRANSIMS Visualizations at TRACC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualizations at TRACC TRACC is currently actively developing two separate visualization applications. One of these applications is 'Metropolis', developed by NCSA (the National Center for Supercomputing Applications), targets an interactive model that allows a modeler to navigate in three-dimensional space and time while displaying moving vehicles, dynamic volumes on the links, and many more such dynamic network features. The software is being developed based on OpenGL, and is comparable to

  17. Extreme Scale Visual Analytics

    SciTech Connect (OSTI)

    Steed, Chad A; Potok, Thomas E; Pullum, Laura L; Ramanathan, Arvind; Shipman, Galen M; Thornton, Peter E

    2013-01-01

    Given the scale and complexity of today s data, visual analytics is rapidly becoming a necessity rather than an option for comprehensive exploratory analysis. In this paper, we provide an overview of three applications of visual analytics for addressing the challenges of analyzing climate, text streams, and biosurveilance data. These systems feature varying levels of interaction and high performance computing technology integration to permit exploratory analysis of large and complex data of global significance.

  18. Studies on Supercapacitor Electrode Material from Activated Lignin-Derived Mesoporous Carbon

    SciTech Connect (OSTI)

    Saha, Dipendu; Li, Yunchao; Bi, Zhonghe; Chen, Jihua; Keum, Jong Kahk; Hensley, Dale K; Grappe, Hippolyte A.; Meyer III, Harry M; Dai, Sheng; Paranthaman, Mariappan Parans; Naskar, Amit K

    2014-01-01

    We synthesized mesoporous carbon from pre-cross-linked lignin gel impregnated with a surfactant as the pore-forming agent, and then activated the carbon through physical and chemical methods to obtain activated mesoporous carbon. The activated mesoporous carbons exhibited 1.5- to 6-fold increases in porosity with a maximum BET specific surface area of 1148 m2/g and a pore volume of 1.0 cm3/g. Slow physical activation helped retain dominant mesoporosity; however, aggressive chemical activation caused some loss of the mesopore volume fraction. Plots of cyclic voltammetric data with the capacitor electrode made from these carbons showed an almost rectangular curve depicting the behavior of ideal double-layer capacitance. Although the pristine mesoporous carbon exhibited the same range of surface-area-based capacitance as that of other known carbon-based supercapacitors, activation decreased the surface-area-based specific capacitance and increased the gravimetric-specific capacitance of the mesoporous carbons. Surface activation lowered bulk density and electrical conductivity. Warburg impedance as a vertical tail in the lower frequency domain of Nyquist plots supported good supercapacitor behavior for the activated mesoporous carbons. Our work demonstrated that biomass-derived mesoporous carbon materials continue to show potential for use in specific electrochemical applications.

  19. Advanced Recombinant Manganese Peroxidase for Biosynthesis of Lignin Bioproducts, Phase I Final Report, STTR Grant #: DE-SC0007503.

    SciTech Connect (OSTI)

    Beatty, Christopher; Kitner, Joshua; Lajoie, Curtis; McClain, Sean; Potochnik, Steve

    2012-12-13

    The core purpose of this Phase I STTR was to evaluate the feasibility of a new method of producing a recombinant version of manganese peroxidase (MnP) enzyme. MnP is a potentially valuable enzyme for producing high value lignin products and also for industrial de-coloring operations such as biobleaching of pulp and color removal from textile dye effluents. This lignin-modifying enzyme is produced in small amounts by the native host, a white rot fungus. Previous work by Oregon State University developed a secreted recombinant version of the enzyme in the yeast Pichia pastoris. Unfortunately, the expression is barely moderate and the enzyme is heavily glycosylated, which inhibits purification. In this work, the gene for the enzyme is given a tag which targets production of the enzyme to the peroxisome. This is a promising approach since this location is also where heme and hydrogen peroxide are sequestered, which are both necessary cofactors for MnP. More than ten recombinant strains were constructed, verified, and expressed in the Pichia system. Constitutive (GAP) and methanol-induced promoters (AOX) were tried for peroxisomal targeted, cytosolic, and secreted versions of MnP. Only the secreted strains showed activity. The amount of expression was not significantly changed. The degree of glycosylation was lessened using the AOX (methanol) promotoer, but the resulting enzyme was still not able to be purified using immobilized metal affinity chromatography. Additional work beyond the scope of the defined Phase I project was undertaken to construct, verify, and express Pichia strains that mutated the MnP glycosylation sites to inhibit this process. These strains did not show significant activity. The cause is not known, but it is possible that these sites are important to the structure of the enzyme. Also beyond the scope proposed for our Phase I STTR, the team collaborated with AbSci, a startup with a new E. coli based expression system focused on the production of antibodies and enzymes containing disulfide bonds and requiring folding/post-translational modification. With only limited time remaining in the Phase I schedule, a single construct was made to produce MnP with this system. The enzyme was produced in the soluble fraction of the cell lysate, but no activity was measured. MnP from the existing recombinant source was used to act on lignin. The lignin was from a Kraft process and had a molecular weight of about 10,000 Da. Using 1000 Da dialysis membranes and UV-visible spectroscopy, no modification of either lignin was evident in the dialysate or the retentate. Assays using 2,6 dimethoxy phenol (DMP) as a substrate showed consistent activity throughout the project. In summary, these results fell far short of our expectations. A Phase II proposal was not submitted. Possible reasons for the failure of peroxisomal targeting include destruction by native hydrogen peroxide, native proteases, or unforeseen causes. The AbSci system was only lighted tested and further work may yield a strain with active enzyme. The lack of evidence for lignin modification may be due to the techniques employed. NMR or GC-MS studies may reveal evidence of modification.

  20. Visualization of Solution Gas Drive in Viscous Oil, SUPRI TR-126

    SciTech Connect (OSTI)

    George, D.S.; Kovscek, A.R.

    2001-07-23

    Several experimental studies of solution gas drive are available in this report. Almost all of the studies have used light oil. Solution gas drive behavior, especially in heavy oil reservoirs, is poorly understood. Experiments were performed in which pore-scale solution gas drive phenomena were viewed in water/carbon dioxide and viscous oil/carbon dioxide systems. A new pressure vessel was designed and constructed to house silicon-wafer micromodels that previously operated at low (<3 atm) pressure. The new apparatus is used for the visual studies. Several interesting phenomena were viewed. The repeated nucleation of gas bubbles was observed at a gas-wet site occupied by dirt. Interestingly, the dissolution of a gas bubble into the liquid phase was previously recorded at the same nucleation site. Gas bubbles in both systems grew to span one ore more pore bodies before mobilization. Liquid viscosity affected the ease with which gas bubbles coalesced. More viscous solutions result in slower rates of coalescence. The transport of solid particles on gas-liquid interfaces was also observed.

  1. Robotic Intelligence Kernel: Visualization

    Energy Science and Technology Software Center (OSTI)

    2009-09-16

    The INL Robotic Intelligence Kernel-Visualization is the software that supports the user interface. It uses the RIK-C software to communicate information to and from the robot. The RIK-V illustrates the data in a 3D display and provides an operating picture wherein the user can task the robot.

  2. Effects of fungal degradation on the CuO oxidation products of lignin: A controlled laboratory study

    SciTech Connect (OSTI)

    Hedges, J.I.; Weliky, K.; Devol, A.H. ); Blanchette, R.A. )

    1988-11-01

    Duplicate samples of birch wood were degraded for 0, 4, 8 and 12 weeks by the white-rot fungus, Phlebia tremellosus, and for 12 weeks by 6 other white-rot and brown-rot fungi. P. tremellosus caused progressive weight losses and increased the H/C and O/C of the remnant wood by preferentially degrading the lignin component of the middle lamellae. Total yields of syringyl phenols were decreased 1.5 times as fast as total vanillyl phenol yields. Within both phenol families, aldehyde precursors were degraded faster than precursors of the corresponding ketones, which were obtained in constant proportion to the total phenol yield. Although two other white-rot fungi caused similar lignin compositional trends, a fourth white-rot species, Coriolus versicolor, simultaneously eroded all cell wall components and did not concentrate polysaccharides in the remnant wood. The brown-rot fungi also preferentially attacked syringyl structural units, but degraded all phenol precursors at a much slower rate than the white-rotters and did not produce excess vanillic acid. Degradation by P. tremellosus linearly increased the vanillic acid/vanillin ratio, (Ad/Al)v, of the remnant birch wood throughout the 12 week degradation study and exponentially decreased the absolute yields of total vanillyl phenols, total syringyl phenols and the syringyl/vanillyl phenol ratio, S/V. At the highest (Ad/Al)v of 0.50 total yields of syringyl and vanillyl phenols were decreased by 65% and 80%, respectively, with a resulting reduction of 40% in the original S/V. Many of the diagenetically related compositional trends that have been previously reported for lignins in natural environments can be explained by white-rot fungal degradation.

  3. Consolidated bioprocessing of Populus using Clostridium (Ruminiclostridium) thermocellum: a case study on the impact of lignin composition and structure

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Dumitrache, Alexandru; Akinosho, Hannah; Rodriguez, Miguel; Meng, Xianzhi; Yoo, Chang Geun; Natzke, Jace; Engle, Nancy L.; Sykes, Robert W.; Tschaplinski, Timothy J.; Muchero, Wellington; et al

    2016-02-04

    Background: Higher ratios of syringyl-to-guaiacyl (S/G) lignin components of Populus were shown to improve sugar release by enzymatic hydrolysis using commercial blends. Cellulolytic microbes are often robust biomass hydrolyzers and may offer cost advantages; however, it is unknown whether their activity can also be significantly influenced by the ratio of different monolignol types in Populus biomass. Hydrolysis and fermentation of autoclaved, but otherwise not pretreated Populus trichocarpa by Clostridium thermocellum ATCC 27405 was compared using feedstocks that had similar carbohydrate and total lignin contents but differed in S/G ratios. Results: Populus with an S/G ratio of 2.1 was converted moremore » rapidly and to a greater extent compared to similar biomass that had a ratio of 1.2. For either microbes or commercial enzymes, an approximate 50% relative difference in total solids solubilization was measured for both biomasses, which suggests that the differences and limitations in the microbial breakdown of lignocellulose may be largely from the enzymatic hydrolytic process. Unexpectedly, the reduction in glucan content per gram solid in the residual microbially processed biomass was similar (17–18%) irrespective of S/G ratio, pointing to a similar mechanism of solubilization that proceeded at different rates. Fermentation metabolome testing did not reveal the release of known biomass-derived alcohol and aldehyde inhibitors that could explain observed differences in microbial hydrolytic activity. Biomass-derived p-hydroxybenzoic acid was up to ninefold higher in low S/G ratio biomass fermentations, but was not found to be inhibitory in subsequent test fermentations. Cellulose crystallinity and degree of polymerization did not vary between Populus lines and had minor changes after fermentation. However, lignin molecular weights and cellulose accessibility determined by Simons’ staining were positively correlated to the S/G content. Conclusions: Higher S/G ratios in Populus biomass lead to longer and more linear lignin chains and greater access to surface cellulosic content by microbe-bound enzymatic complexes. Substrate access limitation is suggested as a primary bottleneck in solubilization of minimally processed Populus, which has important implications for microbial deconstruction of lignocellulose biomass. Our findings will allow others to examine different Populus lines and to test if similar observations are possible for other plant species.« less

  4. Visualization | OpenEI Community

    Open Energy Info (EERE)

    Enabling Unique Visualization and Manipulation of Energy Data at Multiple Scales FRED Free Energy Data Map OpenEI Tool Visualization The U.S. Department of Energy, the Pacific...

  5. Visual Engineering | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visual Engineering Visual Engineering At the Ames Laboratory we are working with Iowa State Image University to create an interactive visual engineering environment to design new products, better power plants, or any other engineering products. In addition, Mark Bryden and Doug McCorkle, along with collaborators at NETL and Reaction Engineering International have developed open-source software to look at the physics behind power plant operation within this visual environment. Image Their VE-PSI

  6. Collaboration Topics - Visualization | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    NNSACEA Cooperation in Computer Science Collaboration Topics - Visualization ... to visualize large data sets on small computational resources. 3) In situ visualization ...

  7. Visualization Gallery from the Computational Research Division...

    Office of Scientific and Technical Information (OSTI)

    Visualization and Analysis of 3D Gene Expression Data; 4) Visualization of Quantum ... angular momentum transport; 9) Sunfall: Visual Analytics for Astrophysics; 10) Fast ...

  8. Methods of visualizing graphs

    DOE Patents [OSTI]

    Wong, Pak C.; Mackey, Patrick S.; Perrine, Kenneth A.; Foote, Harlan P.; Thomas, James J.

    2008-12-23

    Methods for visualizing a graph by automatically drawing elements of the graph as labels are disclosed. In one embodiment, the method comprises receiving node information and edge information from an input device and/or communication interface, constructing a graph layout based at least in part on that information, wherein the edges are automatically drawn as labels, and displaying the graph on a display device according to the graph layout. In some embodiments, the nodes are automatically drawn as labels instead of, or in addition to, the label-edges.

  9. Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population

    SciTech Connect (OSTI)

    Penning, Bryan W.; Sykes, Robert W.; Babcock, Nicholas C.; Dugard, Christopher K.; Held, Michael A.; Klimek, John F.; Shreve, Jacob T.; Fowler, Matthew; Ziebell, Angela; Davis, Mark F.; Decker, Stephen R.; Turner, Geoffrey B.; Mosier, Nathan S.; Springer, Nathan M.; Thimmapuram, Jyothi; Weil, Clifford F.; McCann, Maureen C.; Carpita, Nicholas C.

    2014-06-27

    Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 x 3 Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yield was shared. A genome-wide association study for lignin abundance and sugar yield of the 282- member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. Finally, these results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass.

  10. Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Penning, Bryan W.; Sykes, Robert W.; Babcock, Nicholas C.; Dugard, Christopher K.; Held, Michael A.; Klimek, John F.; Shreve, Jacob T.; Fowler, Matthew; Ziebell, Angela; Davis, Mark F.; et al

    2014-06-27

    Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 x 3 Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yieldmore » was shared. A genome-wide association study for lignin abundance and sugar yield of the 282- member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. Finally, these results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass.« less

  11. An Assessment of Visual Testing

    SciTech Connect (OSTI)

    Cumblidge, Stephen E.; Anderson, Michael T.; Doctor, Steven R.

    2004-11-01

    In response to increasing interest from nuclear utilities in replacing some volumetric examinations of nuclear reactor components with remote visual testing, the Pacific Northwest National Laboratory has examined the capabilities of remote visual testing for the Nuclear Regulatory Commission. This report describes visual testing and explores the visual acuities of the camera systems used to examine nuclear reactor components. The types and sizes of cracks typically found in nuclear reactor components are reviewed. The current standards in visual testing are examined critically, and several suggestions for improving these standards are proposed. Also proposed for future work is a round robin test to determine the effectiveness of visual tests and experimental studies to determine the values for magnification and resolution needed to reliably image very tight cracks.

  12. Enhancing muconic acid production from glucose and lignin-derived aromatic compounds via increased protocatechuate decarboxylase activity

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Johnson, Christopher W.; Salvachua, Davinia; Khanna, Payal; Smith, Holly; Peterson, Darren J.; Beckham, Gregg T.

    2016-04-22

    The conversion of biomass-derived sugars and aromatic molecules to cis,cis-muconic acid (referred to hereafter as muconic acid or muconate) has been of recent interest owing to its facile conversion to adipic acid, an important commodity chemical. Metabolic routes to produce muconate from both sugars and many lignin-derived aromatic compounds require the use of a decarboxylase to convert protocatechuate (PCA, 3,4-dihydroxybenzoate) to catechol (1,2-dihydroxybenzene), two central aromatic intermediates in this pathway. Several studies have identified the PCA decarboxylase as a metabolic bottleneck, causing an accumulation of PCA that subsequently reduces muconate production. A recent study showed that activity of the PCAmore » decarboxylase is enhanced by co-expression of two genetically associated proteins, one of which likely produces a flavin-derived cofactor utilized by the decarboxylase. Using entirely genome-integrated gene expression, we have engineered Pseudomonas putida KT2440-derived strains to produce muconate from either aromatic molecules or sugars and demonstrate in both cases that co-expression of these decarboxylase associated proteins reduces PCA accumulation and enhances muconate production relative to strains expressing the PCA decarboxylase alone. In bioreactor experiments, co-expression increased the specific productivity (mg/g cells/h) of muconate from the aromatic lignin monomer p-coumarate by 50% and resulted in a titer of >15 g/L. In strains engineered to produce muconate from glucose, co-expression more than tripled the titer, yield, productivity, and specific productivity, with the best strain producing 4.92+/-0.48 g/L muconate. Furthermore, this study demonstrates that overcoming the PCA decarboxylase bottleneck can increase muconate yields from biomass-derived sugars and aromatic molecules in industrially relevant strains and cultivation conditions.« less

  13. Research into the pyrolysis of pure cellulose, lignin, and birch wood flour in the China Lake entrained-flow reactor

    SciTech Connect (OSTI)

    Diebold, J.

    1980-06-01

    This experimental program used the China Lake entrained-flow pyrolysis reactor to briefly investigate the pyrolysis of pure cellulose, pure lignin, and birch wood flour. The study determined that the cellulose and wood flour do pyrolyze to produce primarily gaseous products containing significant amounts of ethylene and other useful hydrocarbons. During attempts to pyrolyze powdered lignin, the material melted and bubbled to block the reactor entrance. The pure cellulose and wood flour produced C/sub 2/ + yields of 12% to 14% by weight, which were less than yields from an organic feedstock derived from processed municipal trash. The char yields were 0.1% by weight from cellulose and 1.5% from birch wood flour - one to two orders of magnitude less than were produced from the trash-derived feedstock. In scanning electron microscope photographs, most of the wood flour char had a sintered and agglomerated appearance, although some particles retained the gross cell characteristics of the wood flour. The appearance of the char particles indicated that the material had once been molten and possibly vapor before it formed spheroidal particles about 1 ..mu..m diameter which agglomerated to form larger char particles. The ability to completely melt or vaporize lignocellulosic materials under conditions of high heating rates has now been demonstrated in a continuous flow reactor and promises new techniques for fast pyrolysis. This char was unexpectedly attracted by a magnet, presumably because of iron contamination from the pyrolysis reactor tube wall. The production of water-insoluble tars was negligible compared to the tars produced from trash-derived feedstock. The production of water-soluble organic materials was fairly low and qualitatively appeared to vary inversely with temperature. This study was of a preliminary nature and additional studies are necessary to optimize ethylene production from these feedstocks.

  14. Scientific Visualization, Seeing the Unseeable

    ScienceCinema (OSTI)

    LBNL

    2009-09-01

    June 24, 2008 Berkeley Lab lecture: Scientific visualization transforms abstract data into readily comprehensible images, provide a vehicle for "seeing the unseeable," and play a central role in bo... June 24, 2008 Berkeley Lab lecture: Scientific visualization transforms abstract data into readily comprehensible images, provide a vehicle for "seeing the unseeable," and play a central role in both experimental and computational sciences. Wes Bethel, who heads the Scientific Visualization Group in the Computational Research Division, presents an overview of visualization and computer graphics, current research challenges, and future directions for the field.

  15. Data visualization methods, data visualization devices, data visualization apparatuses, and articles of manufacture

    SciTech Connect (OSTI)

    Turner, Alan E.; Crow, Vernon L.; Payne, Deborah A.; Hetzler, Elizabeth G.; Cook, Kristin A.; Cowley, Wendy E.

    2015-06-30

    Data visualization methods, data visualization devices, data visualization apparatuses, and articles of manufacture are described according to some aspects. In one aspect, a data visualization method includes accessing a plurality of initial documents at a first moment in time, first processing the initial documents providing processed initial documents, first identifying a plurality of first associations of the initial documents using the processed initial documents, generating a first visualization depicting the first associations, accessing a plurality of additional documents at a second moment in time after the first moment in time, second processing the additional documents providing processed additional documents, second identifying a plurality of second associations of the additional documents and at least some of the initial documents, wherein the second identifying comprises identifying using the processed initial documents and the processed additional documents, and generating a second visualization depicting the second associations.

  16. Visualization Contest Applications due August 3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualization Contest Applications due August 3 Visualization Contest Applications due August 3 June 22, 2012 by Francesca Verdier In support of the IEEE Symposium on Large-Scale Data Analysis and Visualization (LDAV) 2012's visualization contest, LDAV organizers are offering compute time to participants through a NERSC allocation awarded by ASCR. The LDAV Visualization Contest focuses on the area of visualization of extremely large datasets. The goal is to devise a visualization or a

  17. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect (OSTI)

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

  18. Visual Sample Plan

    Energy Science and Technology Software Center (OSTI)

    2007-10-25

    VSP selects the appropriate number and location of environmental samples to ensure that the results of statistical tests performed to provide input to risk decisions have the required confidence and performance. VSP Version 5.0 provides sample-size equations or algorithms needed by specific statistical tests appropriate for specific environmental sampling objectives. It also provides data quality assessment and statistical analysis functions to support evaluation of the data and determine whether the data support decisions regarding sitesmore » suspected of contamination. The easy-to-use program is highly visual and graphic. VSP runs on personal computers with Microsoft Windows operating systems (98, NT, 2000, Millennium Edition, CE, and XP) Designed primarily for project managers and users without expertise in statistics, VSP is applicable to two- and three-dimensional populations to be sampled (e.g., rooms and buildings, surface soil, a defined layer of subsurface soil, water bodies, and other similar applications) for studies of environmental quality. VSP is also applicable for designing sampling plans for assessing chem./rad/bio threat and hazard identification within rooms and buildings, and for designing geophysical surveys for UXO identification.« less

  19. High-throughput prediction of Acacia and eucalypt lignin syringyl/guaiacyl content using FT-Raman spectroscopy and partial least squares modeling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Lupoi, Jason S.; Healey, Adam; Singh, Seema; Sykes, Robert; Davis, Mark; Lee, David J.; Shepherd, Merv; Simmons, Blake A.; Henry, Robert J.

    2015-01-16

    High-throughput techniques are necessary to efficiently screen potential lignocellulosic feedstocks for the production of renewable fuels, chemicals, and bio-based materials, thereby reducing experimental time and expense while supplanting tedious, destructive methods. The ratio of lignin syringyl (S) to guaiacyl (G) monomers has been routinely quantified as a way to probe biomass recalcitrance. Mid-infrared and Raman spectroscopy have been demonstrated to produce robust partial least squares models for the prediction of lignin S/G ratios in a diverse group of Acacia and eucalypt trees. The most accurate Raman model has now been used to predict the S/G ratio from 269 unknown Acaciamore » and eucalypt feedstocks. This study demonstrates the application of a partial least squares model composed of Raman spectral data and lignin S/G ratios measured using pyrolysis/molecular beam mass spectrometry (pyMBMS) for the prediction of S/G ratios in an unknown data set. The predicted S/G ratios calculated by the model were averaged according to plant species, and the means were not found to differ from the pyMBMS ratios when evaluating the mean values of each method within the 95 % confidence interval. Pairwise comparisons within each data set were employed to assess statistical differences between each biomass species. While some pairwise appraisals failed to differentiate between species, Acacias, in both data sets, clearly display significant differences in their S/G composition which distinguish them from eucalypts. In conclusion, this research shows the power of using Raman spectroscopy to supplant tedious, destructive methods for the evaluation of the lignin S/G ratio of diverse plant biomass materials.« less

  20. Collaboration Topics - Visualization | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration Visualization This collaboration area focuses on visualization and data analysis and centers on the open source development of the Visualization Toolkit (VTK), which forms the basis of our customized visualization and analysis tools (ParaView, VisIt and LOVE). We are partnering on common VTK needs and working on methods for visualizing and analyzing data on advanced architectures that are memory and I/O constrained. Accomplishments 1) Portions of the CEA visualization tool

  1. Pyrolysis reaction networks for lignin model compounds: unraveling thermal deconstruction of β-O-4 and α-O-4 compounds

    SciTech Connect (OSTI)

    Choi, Yong S.; Singh, Rahul; Zhang, Jing; Balasubramanian, Ganesh; Sturgeon, Matthew R.; Katahira, Rui; Chupka, Gina; Beckham, Gregg T.; Shanks, Brent H.

    2016-01-01

    Although lignin is one of the main components of biomass, its pyrolysis chemistry is not well understood due to complex heterogeneity. To gain insights into this chemistry, the pyrolysis of seven lignin model compounds (five ..beta..-O-4 and two ..alpha..-O-4 linked molecules) was investigated in a micropyrolyzer connected to GC-MS/FID. According to quantitative product mole balance for the reaction networks, concerted retro-ene fragmentation and homolytic dissociation were strongly suggested as the initial reaction step for ..beta..-O-4 compounds and ..alpha..-O-4 compounds, respectively. The difference in reaction pathway between compounds with different linkages was believed to result from thermodynamics of the radical initiation. The rate constants for the different reaction pathways were predicted from ab initio density functional theory calculations and pre-exponential literature values. The computational findings were consistent with the experiment results, further supporting the different pyrolysis mechanisms for the ..beta..-ether linked and ..alpha..-ether linked compounds. A combination of the two pathways from the dimeric model compounds was able to describe qualitatively the pyrolysis of a trimeric lignin model compound containing both ..beta..-O-4 and ..alpha..-O-4 linkages.

  2. Visualizing Individual Carbon Nanotubes with Optical Microscopy...

    Office of Scientific and Technical Information (OSTI)

    Published Article: Visualizing Individual Carbon Nanotubes with Optical Microscopy Title: Visualizing Individual Carbon Nanotubes with Optical Microscopy Authors: Novak, Michael A. ...

  3. Visualization of Bacterial Microcompartment Facet Assembly Using...

    Office of Scientific and Technical Information (OSTI)

    Visualization of Bacterial Microcompartment Facet Assembly Using High-Speed Atomic Force Microscopy Prev Next Title: Visualization of Bacterial Microcompartment Facet ...

  4. Visualization Gallery from the Computational Research Division...

    Office of Scientific and Technical Information (OSTI)

    Particle Acceleration Data; 2) Visualization of Microearthquake Data from Enhanced Geothermal Systems; 3) PointCloudXplore: Visualization and Analysis of 3D Gene Expression Data; ...

  5. NREL: Energy Systems Integration Facility - Visualization of...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualization of Electric Power System Information Workshop The Energy Systems Integration Facility workshop, Visualization of Electric Power System Information, was held September...

  6. Visual Design Group | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visual Design Group Ames Laboratory Logos You are here Home Visual Design Group Graphics Services supports the design, printing and production needs of the Ames Laboratory. For...

  7. Ocean Thermal Extractable Energy Visualization: Final Technical...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ocean Thermal Extractable Energy Visualization: Final Technical Report Ocean Thermal Extractable Energy Visualization: Final Technical Report Report about the Ocean Thermal ...

  8. Dynamic visualization of data streams

    DOE Patents [OSTI]

    Wong, Pak Chung (Richalnd, WA); Foote, Harlan P. (Richland, WA); Adams, Daniel R. (Kennewick, WA); Cowley, Wendy E. (Richland, WA); Thomas, James J. (Richland, WA)

    2009-07-07

    One embodiment of the present invention includes a data communication subsystem to receive a data stream, and a data processing subsystem responsive to the data communication subsystem to generate a visualization output based on a group of data vectors corresponding to a first portion of the data stream. The processing subsystem is further responsive to a change in rate of receipt of the data to modify the visualization output with one or more other data vectors corresponding to a second portion of the data stream as a function of eigenspace defined with the group of data vectors. The system further includes a display device responsive to the visualization output to provide a corresponding visualization.

  9. Data mining and visualization techniques

    DOE Patents [OSTI]

    Wong, Pak Chung; Whitney, Paul; Thomas, Jim

    2004-03-23

    Disclosed are association rule identification and visualization methods, systems, and apparatus. An association rule in data mining is an implication of the form X.fwdarw.Y where X is a set of antecedent items and Y is the consequent item. A unique visualization technique that provides multiple antecedent, consequent, confidence, and support information is disclosed to facilitate better presentation of large quantities of complex association rules.

  10. Kinetic analysis of the phenyl-shift reaction in $\\beta$-O-4 lignin model compounds: A computational study.

    SciTech Connect (OSTI)

    Beste, Ariana; Buchanan III, A C

    2011-01-01

    The phenyl-shift reaction in $\\beta$-phenethyl phenyl ether ($\\beta - \\rm PhCH_2CH_2OPh$, $\\beta$-PPE) is an integral step in the pyrolysis of PPE, which is a model compound for the $\\beta$-O-4 linkage in lignin. We investigated the influence of natural occurring substituents (hydroxy, methoxy) on the reaction rate by calculating relative rate constant using density functional theory in combination with transition state theory, including anharmonic correction for low-frequency modes. The phenyl-shift reaction proceeds through an intermediate and the overall rate constants were computed invoking the steady-state approximation (its validity was confirmed). Substituents on the phenethyl group have only little influence on the rate constants. If a methoxy substituent is located in para position of the phenyl ring adjacent to the ether oxygen, the energies of the intermediate and second transition state are lowered, but the overall rate constant is not significantly altered. This is a consequence of the dominating first transition from pre-complex to intermediate in the overall rate constant. {\\it O}- and di-{\\it o}-methoxy substituents accelerate the phenyl-migration rate compared to $\\beta$-PPE.

  11. VCAT: Visual Crosswalk Analysis Tool

    SciTech Connect (OSTI)

    Cleland, Timothy J.; Forslund, David W.; Cleland, Catherine A.

    2012-08-31

    VCAT is a knowledge modeling and analysis tool. It was synthesized from ideas in functional analysis, business process modeling, and complex network science. VCAT discovers synergies by analyzing natural language descriptions. Specifically, it creates visual analytic perspectives that capture intended organization structures, then overlays the serendipitous relationships that point to potential synergies within an organization or across multiple organizations.

  12. Data sonification and sound visualization.

    SciTech Connect (OSTI)

    Kaper, H. G.; Tipei, S.; Wiebel, E.; Mathematics and Computer Science; Univ. of Illinois

    1999-07-01

    Sound can help us explore and analyze complex data sets in scientific computing. The authors describe a digital instrument for additive sound synthesis (Diass) and a program to visualize sounds in a virtual reality environment (M4Cave). Both are part of a comprehensive music composition environment that includes additional software for computer-assisted composition and automatic music notation.

  13. HIV classification using coalescent theory

    SciTech Connect (OSTI)

    Zhang, Ming; Letiner, Thomas K; Korber, Bette T

    2008-01-01

    Algorithms for subtype classification and breakpoint detection of HIV-I sequences are based on a classification system of HIV-l. Hence, their quality highly depend on this system. Due to the history of creation of the current HIV-I nomenclature, the current one contains inconsistencies like: The phylogenetic distance between the subtype B and D is remarkably small compared with other pairs of subtypes. In fact, it is more like the distance of a pair of subsubtypes Robertson et al. (2000); Subtypes E and I do not exist any more since they were discovered to be composed of recombinants Robertson et al. (2000); It is currently discussed whether -- instead of CRF02 being a recombinant of subtype A and G -- subtype G should be designated as a circulating recombination form (CRF) nd CRF02 as a subtype Abecasis et al. (2007); There are 8 complete and over 400 partial HIV genomes in the LANL-database which belong neither to a subtype nor to a CRF (denoted by U). Moreover, the current classification system is somehow arbitrary like all complex classification systems that were created manually. To this end, it is desirable to deduce the classification system of HIV systematically by an algorithm. Of course, this problem is not restricted to HIV, but applies to all fast mutating and recombining viruses. Our work addresses the simpler subproblem to score classifications of given input sequences of some virus species (classification denotes a partition of the input sequences in several subtypes and CRFs). To this end, we reconstruct ancestral recombination graphs (ARG) of the input sequences under restrictions determined by the given classification. These restritions are imposed in order to ensure that the reconstructed ARGs do not contradict the classification under consideration. Then, we find the ARG with maximal probability by means of Markov Chain Monte Carlo methods. The probability of the most probable ARG is interpreted as a score for the classification. To our knowledge, this particular problem was not addressed up to now. The software package Lamarc Kuhner et al. (2000) allows for sampling ARGs, but it assumes that recombination events only involve one breakpoint. However, in HIV recombinants usually have more than one breakpoint. Moreover, Lamarc does not perform an explicit breakpoint detection, but tries to find them by chance. Although this approach is suitable for most situations, it will not lead to satisfying results in case of highly recombining viruses with multiple breakpoints.

  14. Down-regulation of p-coumaroyl quinate/shikimate 3'-hydroxylase (C3'H) and cinnamate 4-hydroxylase (C4H) genes in the lignin biosynthetic pathway of Eucalyptus urophylla x E. grandis leads to improved sugar release

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sykes, Robert W.; Gjersing, Erica L.; Foutz, Kirk; Rottmann, William H.; Kuhn, Sean A.; Foster, Cliff E.; Ziebell, Angela; Turner, Geoffrey B.; Decker, Stephen R.; Hinchee, Maud A. W.; et al

    2015-08-27

    In this study, lignocellulosic materials provide an attractive replacement for food-based crops used to produce ethanol. Understanding the interactions within the cell wall is vital to overcome the highly recalcitrant nature of biomass. One factor imparting plant cell wall recalcitrance is lignin, which can be manipulated by making changes in the lignin biosynthetic pathway. In this study, eucalyptus down-regulated in expression of cinnamate 4-hydroxylase (C4H, EC 1.14.13.11) or p-coumaroyl quinate/shikimate 3'-hydroxylase (C3'H, EC 1.14.13.36) were evaluated for cell wall composition and reduced recalcitrance.

  15. Visualization Contest Applications due August 3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Contest Applications due August 3 June 22, 2012 by Francesca Verdier In support of the IEEE Symposium on Large-Scale Data Analysis and Visualization (LDAV) 2012's visualization...

  16. Visualization Graph | OpenEI Community

    Open Energy Info (EERE)

    8 August, 2012 - 12:37 New Gapminder Visualizations Added EIA Energy data Gapminder OECD OpenEI SEDS Visualization Graph OpenEI now features some cool new Gapminder...

  17. Energy Integration Visualization Room (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-08-01

    This two-page fact sheet describes the new Energy Integration Visualization Room in the ESIF and talks about some of the capabilities and unique visualization features of the the room.

  18. An interpersonal multimedia visualization system

    SciTech Connect (OSTI)

    Phillips, R.L.

    1990-01-01

    Media View is a computer program that provides a generic infrastructure for authoring and interacting with multimedia documents. Among its many applications is the ability to furnish a user with a comprehensive environment for analysis and visualization. With MediaView the user produces a document'' that contains mathematics, datasets and associated visualizations. From the dataset or embedded mathematics animated sequences can be produced in situ. The mathematical content of the document'' can be explored through manipulation with Mathematica {trademark}. Since the document'' is all digital, it can be shared with a co-worker on a local network or mailed electronically to a colleague at a distant site. Animations and any other substructure of the document'' persist through the mailing process and can be awakened at the destination by the recipient. 5 refs., 4 figs.

  19. Cognitive Foundations for Visual Analytics

    SciTech Connect (OSTI)

    Greitzer, Frank L.; Noonan, Christine F.; Franklin, Lyndsey

    2011-02-25

    In this report, we provide an overview of scientific/technical literature on information visualization and VA. Topics discussed include an update and overview of the extensive literature search conducted for this study, the nature and purpose of the field, major research thrusts, and scientific foundations. We review methodologies for evaluating and measuring the impact of VA technologies as well as taxonomies that have been proposed for various purposes to support the VA community. A cognitive science perspective underlies each of these discussions.

  20. MemAxes Visualization Software

    Energy Science and Technology Software Center (OSTI)

    2014-08-28

    Hardware advancements such as Intel's PEBS and AMD's IBS, as well as software developments such as the perf_event API in Linux have made available the acquisition of memory access samples with performance information. MemAxes is a visualization and analysis tool for memory access sample data. By mapping the samples to their associated code, variables, node topology, and application dataset, MemAxes provides intuitive views of the data.

  1. Visualizing Cyber Security: Usable Workspaces

    SciTech Connect (OSTI)

    Fink, Glenn A.; North, Christopher L.; Endert, Alexander; Rose, Stuart J.

    2009-10-11

    An environment that supports cyber analytics work should enable multiple, simultaneous investigations, information foraging, and provide a solution space for organizing data. We describe our study of cyber security professionals and visualizations in a large, high-resolution display work environment. We discuss the tasks and needs of analysts that such an environment can support and present several prototypes designed to support these needs. We conclude with a usability evaluation of the prototypes and additional lessons learned.

  2. Visual Interface for Materials Simulations

    Energy Science and Technology Software Center (OSTI)

    2004-08-01

    VIMES (Visual Inteface for Materials Simulations) is a graphical user interface (GUI) for pre- and post-processing alomistic materials science calculations. The code includes tools for building and visualizing simple crystals, supercells, and surfaces, as well as tools for managing and modifying the input to Sandia materials simulations codes such as Quest (Peter Schultz, SNL 9235) and Towhee (Marcus Martin, SNL 9235). It is often useful to have a graphical interlace to construct input for materialsmore » simulations codes and to analyze the output of these programs. VIMES has been designed not only to build and visualize different materials systems, but also to allow several Sandia codes to be easier to use and analyze. Furthermore. VIMES has been designed to be reasonably easy to extend to new materials programs. We anticipate that users of Sandia materials simulations codes will use VIMCS to simplify the submission and analysis of these simulations. VIMES uses standard OpenGL graphics (as implemented in the Python programming language) to display the molecules. The algorithms used to rotate, zoom, and pan molecules are all standard applications using the OpenGL libraries. VIMES uses the Marching Cubes algorithm for isosurfacing 3D data such as molecular orbitals or electron densities around the molecules.« less

  3. Visual Interface for Materials Simulations

    SciTech Connect (OSTI)

    2004-08-01

    VIMES (Visual Inteface for Materials Simulations) is a graphical user interface (GUI) for pre- and post-processing alomistic materials science calculations. The code includes tools for building and visualizing simple crystals, supercells, and surfaces, as well as tools for managing and modifying the input to Sandia materials simulations codes such as Quest (Peter Schultz, SNL 9235) and Towhee (Marcus Martin, SNL 9235). It is often useful to have a graphical interlace to construct input for materials simulations codes and to analyze the output of these programs. VIMES has been designed not only to build and visualize different materials systems, but also to allow several Sandia codes to be easier to use and analyze. Furthermore. VIMES has been designed to be reasonably easy to extend to new materials programs. We anticipate that users of Sandia materials simulations codes will use VIMCS to simplify the submission and analysis of these simulations. VIMES uses standard OpenGL graphics (as implemented in the Python programming language) to display the molecules. The algorithms used to rotate, zoom, and pan molecules are all standard applications using the OpenGL libraries. VIMES uses the Marching Cubes algorithm for isosurfacing 3D data such as molecular orbitals or electron densities around the molecules.

  4. Visualization Tools for Adaptive Mesh Refinement Data

    SciTech Connect (OSTI)

    Weber, Gunther H.; Beckner, Vincent E.; Childs, Hank; Ligocki,Terry J.; Miller, Mark C.; Van Straalen, Brian; Bethel, E. Wes

    2007-05-09

    Adaptive Mesh Refinement (AMR) is a highly effective method for simulations that span a large range of spatiotemporal scales, such as astrophysical simulations that must accommodate ranges from interstellar to sub-planetary. Most mainstream visualization tools still lack support for AMR as a first class data type and AMR code teams use custom built applications for AMR visualization. The Department of Energy's (DOE's) Science Discovery through Advanced Computing (SciDAC) Visualization and Analytics Center for Enabling Technologies (VACET) is currently working on extending VisIt, which is an open source visualization tool that accommodates AMR as a first-class data type. These efforts will bridge the gap between general-purpose visualization applications and highly specialized AMR visual analysis applications. Here, we give an overview of the state of the art in AMR visualization research and tools and describe how VisIt currently handles AMR data.

  5. Visualization of Scalar Adaptive Mesh Refinement Data

    SciTech Connect (OSTI)

    VACET; Weber, Gunther; Weber, Gunther H.; Beckner, Vince E.; Childs, Hank; Ligocki, Terry J.; Miller, Mark C.; Van Straalen, Brian; Bethel, E. Wes

    2007-12-06

    Adaptive Mesh Refinement (AMR) is a highly effective computation method for simulations that span a large range of spatiotemporal scales, such as astrophysical simulations, which must accommodate ranges from interstellar to sub-planetary. Most mainstream visualization tools still lack support for AMR grids as a first class data type and AMR code teams use custom built applications for AMR visualization. The Department of Energy's (DOE's) Science Discovery through Advanced Computing (SciDAC) Visualization and Analytics Center for Enabling Technologies (VACET) is currently working on extending VisIt, which is an open source visualization tool that accommodates AMR as a first-class data type. These efforts will bridge the gap between general-purpose visualization applications and highly specialized AMR visual analysis applications. Here, we give an overview of the state of the art in AMR scalar data visualization research.

  6. Visual-servoing optical microscopy

    DOE Patents [OSTI]

    Callahan, Daniel E; Parvin, Bahram

    2013-10-01

    The present invention provides methods and devices for the knowledge-based discovery and optimization of differences between cell types. In particular, the present invention provides visual servoing optical microscopy, as well as analysis methods. The present invention provides means for the close monitoring of hundreds of individual, living cells over time; quantification of dynamic physiological responses in multiple channels; real-time digital image segmentation and analysis; intelligent, repetitive computer-applied cell stress and cell stimulation; and the ability to return to the same field of cells for long-term studies and observation. The present invention further provides means to optimize culture conditions for specific subpopulations of cells.

  7. Visual-servoing optical microscopy

    DOE Patents [OSTI]

    Callahan, Daniel E.; Parvin, Bahram

    2009-06-09

    The present invention provides methods and devices for the knowledge-based discovery and optimization of differences between cell types. In particular, the present invention provides visual servoing optical microscopy, as well as analysis methods. The present invention provides means for the close monitoring of hundreds of individual, living cells over time: quantification of dynamic physiological responses in multiple channels; real-time digital image segmentation and analysis; intelligent, repetitive computer-applied cell stress and cell stimulation; and the ability to return to the same field of cells for long-term studies and observation. The present invention further provides means to optimize culture conditions for specific subpopulations of cells.

  8. Visual-servoing optical microscopy

    DOE Patents [OSTI]

    Callahan, Daniel E.; Parvin, Bahram

    2011-05-24

    The present invention provides methods and devices for the knowledge-based discovery and optimization of differences between cell types. In particular, the present invention provides visual servoing optical microscopy, as well as analysis methods. The present invention provides means for the close monitoring of hundreds of individual, living cells over time; quantification of dynamic physiological responses in multiple channels; real-time digital image segmentation and analysis; intelligent, repetitive computer-applied cell stress and cell stimulation; and the ability to return to the same field of cells for long-term studies and observation. The present invention further provides means to optimize culture conditions for specific subpopulations of cells.

  9. Visualizing Twenty Years of Applications

    SciTech Connect (OSTI)

    Potel, Mike; Wong, Pak C.

    2014-11-01

    This issue of IEEE Computer Graphics and Applications marks the 20th anniversary of the Applications department as a regular feature of the magazine. We thought it might be interesting to look back at the 20 years of Applications department articles to assess its evolution over that time. By aggregating all twenty years of articles and applying a little statistical and visual analytics, we’ve uncovered some interesting characteristics and trends we thought we’d share to mark this 20 year milestone.

  10. Visual Analysis of Weblog Content

    SciTech Connect (OSTI)

    McColgin, David W.; Cramer, Nicholas O.; Gregory, Michelle L.; Payne, Deborah A.; Love, Douglas V.

    2007-03-26

    ABSTRACT In this demo we present an analytic tool that provides a comprehensive approach to weblog analysis. We have combined ingest tools that have been designed to work with the special characteristics of blog data with a mature visual analytic tool designed for in-depth document analysis. Using a subset of the Buzz Metrics data, we demonstrate how this combination of tools provides users with the capability to analyze blogs in multiple languages, investigate changes over time, and investigate the affect of blogs.

  11. Visual Analysis of Weblog Content

    SciTech Connect (OSTI)

    Gregory, Michelle L.; Payne, Deborah A.; McColgin, Dave; Cramer, Nick O.; Love, Douglas V.

    2007-03-26

    In recent years, one of the advances of the World Wide Web is social media and one of the fastest growing aspects of social media is the blogosphere. Blogs make content creation easy and are highly accessible through web pages and syndication. With their growing influence, a need has arisen to be able to monitor the opinions and insight revealed within their content. In this paper we describe a technical approach for analyzing the content of blog data using a visual analytic tool, IN-SPIRE, developed by Pacific Northwest National Laboratory. We highlight the capabilities of this tool that are particularly useful for information gathering from blog data.

  12. Ocean Thermal Extractable Energy Visualization

    SciTech Connect (OSTI)

    Ascari, Matthew

    2012-10-28

    The Ocean Thermal Extractable Energy Visualization (OTEEV) project focuses on assessing the Maximum Practicably Extractable Energy (MPEE) from the world’s ocean thermal resources. MPEE is defined as being sustainable and technically feasible, given today’s state-of-the-art ocean energy technology. Under this project the OTEEV team developed a comprehensive Geospatial Information System (GIS) dataset and software tool, and used the tool to provide a meaningful assessment of MPEE from the global and domestic U.S. ocean thermal resources.

  13. Video-Visuals | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Video-Visuals Video-Visuals See how we can generate clean, renewable energy from hot water sources deep beneath the Earth's surface. The video highlights the basic principles at work in geothermal energy production, and illustrates three different ways the Earth's heat can be converted into electricity. Multimedia resources at the United States Department of Energy help to message geothermal development visually through video, photographs, renderings of the subsurface, and resource maps. Video /

  14. Visualizing Electric Vehicle Sales | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Visualizing Electric Vehicle Sales Visualizing Electric Vehicle Sales July 25, 2013 - 2:48pm Addthis Data compiled by Yan (Joann) Zhou at Argonne National Laboratory. (*) Sales from the second quarter of 2013 for Tesla Model S are based off of estimates provided by the Hybrid Market Dashboard. Data updated 1/20/15. Daniel Wood Daniel Wood Data Visualization and Cartographic Specialist, Office of Public Affairs More on eGallon: Read more about electric vehicle sales and eGallon's continued

  15. Mini-review of Electron Density Visualization

    SciTech Connect (OSTI)

    Adler, Joan; Adler, Omri; Kreif, Meytal; Cohen, Or; Grosso, Bastien; Hashibon, Adham; Cooper, Valentino R

    2015-01-01

    We describe both educational and research oriented examples of electronic density visualization with AViz. Several detailed cases are presented and the procedures for their preparation are described.

  16. Visualizing the Onset of "Heavy Electron" Superconductivity ...

    Office of Science (SC) Website

    Visualizing the Onset of "Heavy Electron" Superconductivity Basic Energy Sciences (BES) BES Home ... Funding DOE Office of Science, Basic Energy Sciences program provided primary ...

  17. Visualizing Electric Vehicle Sales | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Visualizing Electric Vehicle Sales Visualizing Electric Vehicle Sales Data compiled by Yan (Joann) Zhou at Argonne National Laboratory. (*) Sales from the second quarter of 2013 for Tesla Model S are based off of estimates provided by the Hybrid Market Dashboard. Data updated 1/20/15.

  18. Occam's Razor and Petascale Visual Data Analysis

    SciTech Connect (OSTI)

    Bethel, E. Wes; Johnson, Chris; Ahern, Sean; Bell, John; Bremer, Peer-Timo; Childs, Hank; Cormier-Michel, Estelle; Day, Marc; Deines, Eduard; Fogal, Tom; Garth, Christoph; Geddes, Cameron; Hagen, Hans; Hamann, Bernd; Hansen, Charles; Jacobsen, Janet; Joy, Ken; Kruger, Jens; Meredith, Jeremy; Messmer, Peter; Ostrouchov, George; Pascucci, Valerio; Potter, Kristi; Prabhat, D.; Pugmire, David; Rubel, Oliver; Sanderson, Allen; Silva, Claudio; Ushizima, Daniela; Weber, Gunther; Whitlock, Brad; Wu, Kesheng

    2009-06-12

    One of the central challenges facing visualization research is how to effectively enable knowledge discovery. An effective approach will likely combine application architectures that are capable of running on today?s largest platforms to address the challenges posed by large data with visual data analysis techniques that help find, represent, and effectively convey scientifically interesting features and phenomena.

  19. Query-Driven Visualization and Analysis

    SciTech Connect (OSTI)

    Ruebel, Oliver; Bethel, E. Wes; Prabhat, Mr.; Wu, Kesheng

    2012-11-01

    This report focuses on an approach to high performance visualization and analysis, termed query-driven visualization and analysis (QDV). QDV aims to reduce the amount of data that needs to be processed by the visualization, analysis, and rendering pipelines. The goal of the data reduction process is to separate out data that is "scientifically interesting'' and to focus visualization, analysis, and rendering on that interesting subset. The premise is that for any given visualization or analysis task, the data subset of interest is much smaller than the larger, complete data set. This strategy---extracting smaller data subsets of interest and focusing of the visualization processing on these subsets---is complementary to the approach of increasing the capacity of the visualization, analysis, and rendering pipelines through parallelism. This report discusses the fundamental concepts in QDV, their relationship to different stages in the visualization and analysis pipelines, and presents QDV's application to problems in diverse areas, ranging from forensic cybersecurity to high energy physics.

  20. SAMPLES Visualization Tools V1.0

    Energy Science and Technology Software Center (OSTI)

    2000-01-17

    The SAMPLE Visualization Tools CD consists of a 2D Process Visualizer, 3D Visualizer, and integration code for use with AutoCAD uner Windows NT. The tools are intended to be an add-on package to the SAMPLES (Sandia Agile MEMS Prototyping, Layout Tools, Education and Services). Program CD, a previously published Sandia software package. The 2D Process Visualizer creates 2D cross-section slice views of a MEMS (micro-electromechanical)design. Views are created for each step in the MEMS fabricationmore » process. The 2D viewer has capabilities to pan, zoom, step forward and backward to allow the user to inspect the design. The 3D Visualizer creates an extruded-model view of a MEMS design. The 3D viewer has capabilities to pan, zoom, and fly around the model to allow the user to inspect the design.« less

  1. Computer systems and methods for visualizing data

    DOE Patents [OSTI]

    Stolte, Chris; Hanrahan, Patrick

    2010-07-13

    A method for forming a visual plot using a hierarchical structure of a dataset. The dataset comprises a measure and a dimension. The dimension consists of a plurality of levels. The plurality of levels form a dimension hierarchy. The visual plot is constructed based on a specification. A first level from the plurality of levels is represented by a first component of the visual plot. A second level from the plurality of levels is represented by a second component of the visual plot. The dataset is queried to retrieve data in accordance with the specification. The data includes all or a portion of the dimension and all or a portion of the measure. The visual plot is populated with the retrieved data in accordance with the specification.

  2. Multimedia Analysis plus Visual Analytics = Multimedia Analytics

    SciTech Connect (OSTI)

    Chinchor, Nancy; Thomas, James J.; Wong, Pak C.; Christel, Michael; Ribarsky, Martin W.

    2010-10-01

    Multimedia analysis has focused on images, video, and to some extent audio and has made progress in single channels excluding text. Visual analytics has focused on the user interaction with data during the analytic process plus the fundamental mathematics and has continued to treat text as did its precursor, information visualization. The general problem we address in this tutorial is the combining of multimedia analysis and visual analytics to deal with multimedia information gathered from different sources, with different goals or objectives, and containing all media types and combinations in common usage.

  3. Visual inspection reliability for precision manufactured parts

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    See, Judi E.

    2015-09-04

    Sandia National Laboratories conducted an experiment for the National Nuclear Security Administration to determine the reliability of visual inspection of precision manufactured parts used in nuclear weapons. In addition visual inspection has been extensively researched since the early 20th century; however, the reliability of visual inspection for nuclear weapons parts has not been addressed. In addition, the efficacy of using inspector confidence ratings to guide multiple inspections in an effort to improve overall performance accuracy is unknown. Further, the workload associated with inspection has not been documented, and newer measures of stress have not been applied.

  4. Visualization of Fuel Cell Water Transport and Performance Characteriz...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Visualization of Fuel Cell Water Transport and Performance Characterization under Freezing ... More Documents & Publications Visualization of Fuel Cell Water Transport and ...

  5. Visualization and Analysis of 3D Gene Expression Data (Technical...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Visualization and Analysis of 3D Gene Expression Data Citation Details In-Document Search Title: Visualization and Analysis of 3D Gene Expression Data Recent...

  6. John Papanikolas: Visualizing Charge Carrier Motion in Nanowires...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    John Papanikolas: Visualizing Charge Carrier Motion in Nanowires Using Femtosecond Pump-Pr... Visualizing Charge Carrier Motion in Nanowires Using Femtosecond Pump-Probe Microscopy ...

  7. Scalable Run Time Data Collection Analysis and Visualization...

    Office of Scientific and Technical Information (OSTI)

    Data Collection Analysis and Visualization (Presentation). Citation Details In-Document Search Title: Scalable Run Time Data Collection Analysis and Visualization (Presentation). ...

  8. Thematic World Wide Web Visualization System

    Energy Science and Technology Software Center (OSTI)

    1996-10-10

    WebTheme is a system designed to facilitate world wide web information access and retrieval through visualization. It consists of two principal pieces, a WebTheme Server which allows users to enter in a query and automatocally harvest and process information of interest, and a WebTheme browser, which allows users to work with both Galaxies and Themescape visualizations of their data within a JAVA capable world wide web browser. WebTheme is an Internet solution, meaning that accessmore » to the server and the resulting visualizations can all be performed through the use of a WWW browser. This allows users to access and interact with SPIRE (Spatial Paradigm for Information Retrieval and Exploration) based visualizations through a web browser regardless of what computer platforms they are running on. WebTheme is specifically designed to create databases by harvesting and processing WWW home pages available on the Internet.« less

  9. Visualizing Energy Resources Dynamically on Earth (VERDE)

    Energy Science and Technology Software Center (OSTI)

    2009-06-01

    VERDE is a software service that ingests data on real-time eneryg grid status and analyzes the data with models and algorithms presenting the output in a form that can be visualized by client spatio-temporal browsers

  10. Ontology-enriched Visualization of Human Anatomy

    SciTech Connect (OSTI)

    Pouchard, LC

    2005-12-20

    The project focuses on the problem of presenting a human anatomical 3D model associated with other types of human systemic information ranging from physiological to anatomical information while navigating the 3D model. We propose a solution that integrates a visual 3D interface and navigation features with the display of structured information contained in an ontology of anatomy where the structures of the human body are formally and semantically linked. The displayed and annotated anatomy serves as a visual entry point into a patient's anatomy, medical indicators and other information. The ontology of medical information provides labeling to the highlighted anatomical parts in the 3D display. Because of the logical organization and links between anatomical objects found in the ontology and associated 3D model, the analysis of a structure by a physician is greatly enhanced. Navigation within the 3D visualization and between this visualization and objects representing anatomical concepts within the model is also featured.

  11. BPA's Visual Guidelines Quick Guide - 2015

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    35 The Visual Guidelines for BPA's Brand document can be found at www.bpa.govgotoBranding | Updated 2015 RGB 139 91 41 50 58 100 45 RGB 90 72 28 HEX 955300 HEX 5A481C 382 C...

  12. Visual Design Group | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visual Design Group alternative text alternative text alternative text alternative text alternative text alternative text alternative text alternative text The Visual Design Group is a full-service graphics and video/animation studio serving the needs of Ames Laboratory and beyond. We offer a variety of services. Our graphics shop rates are $94/hour. There is no fee currently for our video and animation work. For Graphics Services work, please submit a request form here. For Video/Animation

  13. Finite Element Results Visualization for Unstructured Grids

    Energy Science and Technology Software Center (OSTI)

    1996-07-15

    GRIZ is a general-purpose post-processing application supporting interactive visualization of finite element analysis results on unstructured grids. In addition to basic pseudocolor renderings of state variables over the mesh surface, GRIZ provides modern visualization techniques such as isocontours and isosurfaces, cutting planes, vector field display, and particle traces. GRIZ accepts both command-line and mouse-driven input, and is portable to virtually any UNIX platform which provides Motif and OpenGl libraries.

  14. Building Adoption of Visual Analytics Software

    SciTech Connect (OSTI)

    Chinchor, Nancy; Cook, Kristin A.; Scholtz, Jean

    2012-01-05

    Adoption of technology is always difficult. Issues such as having the infrastructure necessary to support the technology, training for users, integrating the technology into current processes and tools, and having the time, managerial support, and necessary funds need to be addressed. In addition to these issues, the adoption of visual analytics tools presents specific challenges that need to be addressed. This paper discusses technology adoption challenges and approaches for visual analytics technologies.

  15. Visualization and Analysis in Support of Fusion Science

    SciTech Connect (OSTI)

    Sanderson, Allen R.

    2012-10-01

    This report summarizes the results of the award for “Visualization and Analysis in Support of Fusion Science.” With this award our main efforts have been to develop and deploy visualization and analysis tools in three areas 1) magnetic field line analysis 2) query based visualization and 3) comparative visualization.

  16. A Visualization Tool for Meteorological Data

    Energy Science and Technology Software Center (OSTI)

    1999-09-28

    Graphical user interfaces (GUIs) have been buit to visualize surface and upper-meteorology data for any global location and time of interest. The user selects a domain (geographic location and bounding range) and time of interest using the Gui, and a file containing coded observations is accessed and decoded. two styles of the GUI have been built, depending on whether surface or upper air visualization is desired. The former indicates weather conditions near the earth''s surface,more » while the latter illustrates a vertical profile of atmospheric conditions.« less

  17. Framework for an Information Visualization System

    Energy Science and Technology Software Center (OSTI)

    2006-08-11

    The Program is a suite of Windows-based software applications and services for ingesting, storing, and analyzing large quantities of disparate inforamtion. The software supports the ingestion and storage of any information that can be represented in eXtensible Markup Language (XML) format. Stored information can be subsequently retrieved via search operations, then "visualized" in multiple ways using a client application that supports a variety of analytical functions. Visualization capabilities include tools for depicting a variety ofmore » relationships that may be present in the information, including geospatial, temporal, topical, categorical, and network relationships.« less

  18. Navigating nuclear science: Enhancing analysis through visualization

    SciTech Connect (OSTI)

    Irwin, N.H.; Berkel, J. van; Johnson, D.K.; Wylie, B.N.

    1997-09-01

    Data visualization is an emerging technology with high potential for addressing the information overload problem. This project extends the data visualization work of the Navigating Science project by coupling it with more traditional information retrieval methods. A citation-derived landscape was augmented with documents using a text-based similarity measure to show viability of extension into datasets where citation lists do not exist. Landscapes, showing hills where clusters of similar documents occur, can be navigated, manipulated and queried in this environment. The capabilities of this tool provide users with an intuitive explore-by-navigation method not currently available in today`s retrieval systems.

  19. Visual Matrix Clustering of Social Networks

    SciTech Connect (OSTI)

    Wong, Pak C.; Mackey, Patrick S.; Foote, Harlan P.; May, Richard A.

    2013-07-01

    The prevailing choices to graphically represent a social network in todays literature are a node-link graph layout and an adjacency matrix. Both visualization techniques have unique strengths and weaknesses when applied to different domain applications. In this article, we focus our discussion on adjacency matrix and how to turn the matrix-based visualization technique from merely showing pairwise associations among network actors (or graph nodes) to depicting clusters of a social network. We also use node-link layouts to supplement the discussion.

  20. SciDAC Institute for Ultra-Scale Visualization: Activity Recognition for Ultra-Scale Visualization

    SciTech Connect (OSTI)

    Silver, Deborah

    2014-04-30

    Understanding the science behind ultra-scale simulations requires extracting meaning from data sets of hundreds of terabytes or more. Developing scalable parallel visualization algorithms is a key step enabling scientists to interact and visualize their data at this scale. However, at extreme scales, the datasets are so huge, there is not even enough time to view the data, let alone explore it with basic visualization methods. Automated tools are necessary for knowledge discovery -- to help sift through the information and isolate characteristic patterns, thereby enabling the scientist to study local interactions, the origin of features and their evolution in large volumes of data. These tools must be able to operate on data of this scale and work with the visualization process. In this project, we developed a framework for activity detection to allow scientists to model and extract spatio-temporal patterns from time-varying data.

  1. Down-regulation of p-coumaroyl quinate/shikimate 3'-hydroxylase (C3'H) and cinnamate 4-hydroxylase (C4H) genes in the lignin biosynthetic pathway of Eucalyptus urophylla x E. grandis leads to improved sugar release

    SciTech Connect (OSTI)

    Sykes, Robert W.; Gjersing, Erica L.; Foutz, Kirk; Rottmann, William H.; Kuhn, Sean A.; Foster, Cliff E.; Ziebell, Angela; Turner, Geoffrey B.; Decker, Stephen R.; Hinchee, Maud A. W.; Davis, Mark F.

    2015-08-27

    In this study, lignocellulosic materials provide an attractive replacement for food-based crops used to produce ethanol. Understanding the interactions within the cell wall is vital to overcome the highly recalcitrant nature of biomass. One factor imparting plant cell wall recalcitrance is lignin, which can be manipulated by making changes in the lignin biosynthetic pathway. In this study, eucalyptus down-regulated in expression of cinnamate 4-hydroxylase (C4H, EC 1.14.13.11) or p-coumaroyl quinate/shikimate 3'-hydroxylase (C3'H, EC 1.14.13.36) were evaluated for cell wall composition and reduced recalcitrance.

  2. Visualization and Analysis of 3D Gene Expression Data (Technical...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Visualization and Analysis of 3D Gene Expression Data Citation Details In-Document Search Title: Visualization and Analysis of 3D Gene Expression Data You are...

  3. Visualizing OpenEI Data | OpenEI Community

    Open Energy Info (EERE)

    front page? There are several online tools that make organizing and visualizing data free and easy. OpenEI uses Google to visualize data in scatterplots, bar charts, and in the...

  4. File:DIA Visual Development.pdf | Open Energy Information

    Open Energy Info (EERE)

    DIA Visual Development.pdf Jump to: navigation, search File File history File usage File:DIA Visual Development.pdf Size of this preview: 800 600 pixels. Go to page 1 2 3 4 5 6...

  5. 3D Visualization of Water Transport in Ferns

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3D Visualization of Water Transport in Ferns 3D Visualization of Water Transport in Ferns Print Monday, 08 April 2013 00:00 Plants transport water through elongated cells called...

  6. Visualization Gallery from the Computational Research Division at Lawrence

    Office of Scientific and Technical Information (OSTI)

    Berkeley National Laboratory () | Data Explorer Visualization Gallery from the Computational Research Division at Lawrence Berkeley National Laboratory Title: Visualization Gallery from the Computational Research Division at Lawrence Berkeley National Laboratory This excellent collection of visualization vignettes highlights research work done by the LBNL/NERSC Visualization Group and its collaborators from 1993 to the present. Images lead to technical explanations and project details,

  7. Structural Monitoring System (SMS) and Visual System (VS) | Department of

    Energy Savers [EERE]

    Energy Structural Monitoring System (SMS) and Visual System (VS) Structural Monitoring System (SMS) and Visual System (VS) Axis Communications, Inc. has developed network ready, environmentally tolerant, low-light level camera-visual systems (VS) with built-in pan and tilt mechanisms that permit remote monitoring of facilities that are in standby mode. PDF icon Structural Monitoring System (SMS) and Visual System (VS) More Documents & Publications GammaCam Technology Demonstration at

  8. Visualization of United States Renewable Consumption | Open Energy...

    Open Energy Info (EERE)

    Visualization of United States Renewable Consumption AgencyCompany Organization: Energy Information Administration Sector: Energy Resource Type: Softwaremodeling tools User...

  9. Algorithms, Frameworks and Toolsets for High Performance, Remoteand Distributed Visualization

    SciTech Connect (OSTI)

    Bethel, E. Wes; Shalf, John M.

    2005-07-01

    This document is a two-page summary of research accomplishments in the LBNL Visualization program during FY2005.

  10. 7 Key Challenges for Visualization in Cyber Network Defense

    SciTech Connect (OSTI)

    Best, Daniel M.; Endert, Alexander; Kidwell, Dan

    2014-12-02

    In this paper we present seven challenges, informed by two user studies, to be considered when developing a visualization for cyber security purposes. Cyber security visualizations must go beyond isolated solutions and pretty picture visualizations in order to make impact to users. We provide an example prototype that addresses the challenges with a description of how they are met. Our aim is to assist in increasing utility and adoption rates for visualization capabilities in cyber security.

  11. Visualization of Multivariate Data --- Inventor: Eliot Feibush | Princeton

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Berkeley National Laboratory () | Data Explorer Visualization Gallery from the Computational Research Division at Lawrence Berkeley National Laboratory Title: Visualization Gallery from the Computational Research Division at Lawrence Berkeley National Laboratory This excellent collection of visualization vignettes highlights research work done by the LBNL/NERSC Visualization Group and its collaborators from 1993 to the present. Images lead to technical explanations and project details,

  12. Topological Cacti: Visualizing Contour-based Statistics

    SciTech Connect (OSTI)

    Weber, Gunther H.; Bremer, Peer-Timo; Pascucci, Valerio

    2011-05-26

    Contours, the connected components of level sets, play an important role in understanding the global structure of a scalar field. In particular their nestingbehavior and topology-often represented in form of a contour tree-have been used extensively for visualization and analysis. However, traditional contour trees onlyencode structural properties like number of contours or the nesting of contours, but little quantitative information such as volume or other statistics. Here we use thesegmentation implied by a contour tree to compute a large number of per-contour (interval) based statistics of both the function defining the contour tree as well asother co-located functions. We introduce a new visual metaphor for contour trees, called topological cacti, that extends the traditional toporrery display of acontour tree to display additional quantitative information as width of the cactus trunk and length of its spikes. We apply the new technique to scalar fields ofvarying dimension and different measures to demonstrate the effectiveness of the approach.

  13. Geographic Visualization of Power-Grid Dynamics

    SciTech Connect (OSTI)

    Sukumar, Sreenivas R.

    2015-06-18

    The visualization enables the simulation analyst to see changes in the frequency through time and space. With this technology, the analyst has a bird's eye view of the frequency at loads and generators as the simulated power system responds to the loss of a generator, spikes in load, and other contingencies. The significance of a contingency to the operation of an electrical power system depends critically on how the resulting tansients evolve in time and space. Consequently, these dynamic events can only be understood when seen in their proper geographic context. this understanding is indispensable to engineers working on the next generation of distributed sensing and control systems for the smart grid. By making possible a natural and intuitive presentation of dynamic behavior, our new visualization technology is a situational-awareness tool for power-system engineers.

  14. Geographic Visualization of Power-Grid Dynamics

    Energy Science and Technology Software Center (OSTI)

    2015-06-18

    The visualization enables the simulation analyst to see changes in the frequency through time and space. With this technology, the analyst has a bird's eye view of the frequency at loads and generators as the simulated power system responds to the loss of a generator, spikes in load, and other contingencies. The significance of a contingency to the operation of an electrical power system depends critically on how the resulting tansients evolve in time andmore » space. Consequently, these dynamic events can only be understood when seen in their proper geographic context. this understanding is indispensable to engineers working on the next generation of distributed sensing and control systems for the smart grid. By making possible a natural and intuitive presentation of dynamic behavior, our new visualization technology is a situational-awareness tool for power-system engineers.« less

  15. Visualizations for Real-time Pricing Demonstration

    SciTech Connect (OSTI)

    Marinovici, Maria C.; Hammerstrom, Janelle L.; Widergren, Steven E.; Dayley, Greg K.

    2014-10-13

    In this paper, the visualization tools created for monitoring the operations of a real-time pricing demonstration system that runs at a distribution feeder level are presented. The information these tools provide gives insights into demand behavior from automated price responsive devices, distribution feeder characteristics, impact of weather on system’s development, and other significant dynamics. Given the large number of devices that bid into a feeder-level real-time electricity market, new techniques are explored to summarize the present state of the system and contrast that with previous trends as well as future projections. To better understand the system behavior and correctly inform decision-making procedures, effective visualization of the data is imperative.

  16. APPLYING SIMPLE TECHNOLOGY ACCOMPLISHES VISUAL INSPECTION CHALLENGES

    SciTech Connect (OSTI)

    Robinson, C

    2007-07-21

    This paper discusses the successful implementation of simple video technologies at the Savannah River Site (SRS) to perform complex visual inspection, monitoring, and surveillance tasks. Because SRS facilities are similar to those of an industrial plant, the environmental and accessibility considerations for remote viewing are the primary determining factors in the selection of technology. The constraints and challenges associated with remote viewing are discussed, and examples of applications are given.

  17. Introduction to Reading and Visualizing ARM Data

    SciTech Connect (OSTI)

    Mather, James

    2014-02-18

    Atmospheric Radiation Measurement (ARM) Program standard data format is NetCDF 3 (Network Common Data Form). The object of this tutorial is to provide a basic introduction to NetCDF with an emphasis on aspects of the ARM application of NetCDF. The goal is to provide basic instructions for reading and visualizing ARM NetCDF data with the expectation that these examples can then be applied to more complex applications.

  18. Ultrascale visualization capabilities for the ParaView/VTK framework

    Energy Science and Technology Software Center (OSTI)

    2009-06-09

    The software is a set of technologies developed by the SciDAC Institute for Ultrascale Visualization in order to address the visualization needs for petascale computing and beyond. These technologies include improved I/O performance, simulation co-processing, advanced rendering capabilities, and specialized visualization techniques developed for SciDAC applications.

  19. Multidimensional structured data visualization method and apparatus, text visualization method and apparatus, method and apparatus for visualizing and graphically navigating the world wide web, method and apparatus for visualizing hierarchies

    DOE Patents [OSTI]

    Risch, John S.; Dowson, Scott T.

    2012-03-06

    A method of displaying correlations among information objects includes receiving a query against a database; obtaining a query result set; and generating a visualization representing the components of the result set, the visualization including one of a plane and line to represent a data field, nodes representing data values, and links showing correlations among fields and values. Other visualization methods and apparatus are disclosed.

  20. Multidimensional structured data visualization method and apparatus, text visualization method and apparatus, method and apparatus for visualizing and graphically navigating the world wide web, method and apparatus for visualizing hierarchies

    DOE Patents [OSTI]

    Risch, John S.; Dowson, Scott T.; Hart, Michelle L.; Hatley, Wes L.

    2008-05-13

    A method of displaying correlations among information objects comprises receiving a query against a database; obtaining a query result set; and generating a visualization representing the components of the result set, the visualization including one of a plane and line to represent a data field, nodes representing data values, and links showing correlations among fields and values. Other visualization methods and apparatus are disclosed.

  1. Radial velocities of southern visual multiple stars

    SciTech Connect (OSTI)

    Tokovinin, Andrei; Pribulla, Theodor; Fischer, Debra E-mail: pribulla@ta3.sk

    2015-01-01

    High-resolution spectra of visual multiple stars were taken in 20082009 to detect or confirm spectroscopic subsystems and to determine their orbits. Radial velocities of 93 late-type stars belonging to visual multiple systems were measured by numerical cross-correlation. We provide the individual velocities, the width, and the amplitude of the Gaussians that approximate the correlations. The new information on the multiple systems resulting from these data is discussed. We discovered double-lined binaries in HD 41742B, HD 56593C, and HD 122613AB, confirmed several other known subsystems, and constrained the existence of subsystems in some visual binaries where both components turned out to have similar velocities. The orbits of double-lined subsystems with periods of 148 and 13 days are computed for HD 104471 Aa,Ab and HD 210349 Aa,Ab, respectively. We estimate individual magnitudes and masses of the components in these triple systems and update the outer orbit of HD 104471 AB.

  2. Multivariate volume visualization through dynamic projections

    SciTech Connect (OSTI)

    Liu, Shusen; Wang, Bei; Thiagarajan, Jayaraman J.; Bremer, Peer -Timo; Pascucci, Valerio

    2014-11-01

    We propose a multivariate volume visualization framework that tightly couples dynamic projections with a high-dimensional transfer function design for interactive volume visualization. We assume that the complex, high-dimensional data in the attribute space can be well-represented through a collection of low-dimensional linear subspaces, and embed the data points in a variety of 2D views created as projections onto these subspaces. Through dynamic projections, we present animated transitions between different views to help the user navigate and explore the attribute space for effective transfer function design. Our framework not only provides a more intuitive understanding of the attribute space but also allows the design of the transfer function under multiple dynamic views, which is more flexible than being restricted to a single static view of the data. For large volumetric datasets, we maintain interactivity during the transfer function design via intelligent sampling and scalable clustering. As a result, using examples in combustion and climate simulations, we demonstrate how our framework can be used to visualize interesting structures in the volumetric space.

  3. Dependency visualization for complex system understanding

    SciTech Connect (OSTI)

    Smart, J.A.C.

    1994-09-01

    With the volume of software in production use dramatically increasing, the importance of software maintenance has become strikingly apparent. Techniques now sought and developed for reverse engineering and design extraction and recovery. At present, numerous commercial products and research tools exist which are capable of visualizing a variety of programming languages and software constructs. The list of new tools and services continues to grow rapidly. Although the scope of the existing commercial and academic product set is quite broad, these tools still share a common underlying problem. The ability of each tool to visually organize object representations is increasingly impaired as the number of components and component dependencies within systems increases. Regardless of how objects are defined, complex ``spaghetti`` networks result in nearly all large system cases. While this problem is immediately apparent in modem systems analysis involving large software implementations, it is not new. As will be discussed in Chapter 2, related problems involving the theory of graphs were identified long ago. This important theoretical foundation provides a useful vehicle for representing and analyzing complex system structures. While the utility of directed graph based concepts in software tool design has been demonstrated in literature, these tools still lack the capabilities necessary for large system comprehension. This foundation must therefore be expanded with new orgnizational and visualization constructs necessary to meet this challenge. This dissertation addresses this need by constructing a conceptual model and a set of methods for interactively exploring, organizing, and understanding the structure of complex software systems.

  4. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Alchemy of the Universe: Nucleosynthesis of Chemical Elements, A. Banu, Saturday Morning Physics at Texas A&M University, College Station, Texas (February 2008). Determination of ...

  5. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Chemical Society Meeting, Boston (August 2002). Production and Deexcitation of Isotopically Diverse Nuclear Systems near the Fermi Energy, S. J. Yennello, American Chemical ...

  6. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... of Black Chemists and Chemical Engineers, NOBCChE, Atlanta, Georgia (March 2010). ... Talk, American Chemical Society National Meeting, San Francisco, California (March 2010). ...

  7. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... to the Texas A&M Radioactive Beam Upgrade, G.A. Souliotis, Invited talk, 232 nd National Meeting of the American Chemical Society, San Francisco, California, (September 2006). ...

  8. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Chemical Society National Meeting, New Orleans, Louisiana (April 2008). Nuclear Collisions and the Nuclear Equation of State, J.B. Natowitz, Invited Talk, American Chemical ...

  9. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3 - March 31, 2004 Isoscalar Giant Dipole Resonance for Several Nuclei with A 90, Y.-W. Lui, X. Chen, H.L. Clark, B. John, Y. Tokimoto and D.H. Youngblood, International ...

  10. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... C.M. Folden III , 241 st American Chemical Society National Meeting, Anaheim, ... 241 st American Chemical Society National Meeting, Anaheim, California (March 2011). ...

  11. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4 - March 31, 2005 Giant Monopole Resonance in Cd and Sn Isotopes, Y.-W. Lui, D.H. Youngblood, H.L. Clark, Y. Tokimoto and B. John, Invited Talk, International Symposium on Atomic ...

  12. Coalescence and Chemical Equilibrium in Multifragmentation at...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    5 - March 31, 2006 Systematic of Giant Monopole Energy and the Isotopic Dependence, Y.-W. Lui, D.H. Youngblood, H.L. Clark, Y. Tokimoto and B. John, Invited Talk, Workshop on ...

  13. Monodisperse microdroplet generation and stopping without coalescence

    DOE Patents [OSTI]

    Beer, Neil Reginald

    2015-04-21

    A system for monodispersed microdroplet generation and trapping including providing a flow channel in a microchip; producing microdroplets in the flow channel, the microdroplets movable in the flow channel; providing carrier fluid in the flow channel using a pump or pressure source; controlling movement of the microdroplets in the flow channel and trapping the microdroplets in a desired location in the flow channel. The system includes a microchip; a flow channel in the microchip; a droplet maker that generates microdroplets, the droplet maker connected to the flow channel; a carrier fluid in the flow channel, the carrier fluid introduced to the flow channel by a source of carrier fluid, the source of carrier fluid including a pump or pressure source; a valve connected to the carrier fluid that controls flow of the carrier fluid and enables trapping of the microdroplets.

  14. Monodisperse microdroplet generation and stopping without coalescence

    DOE Patents [OSTI]

    Beer, Neil Reginald

    2016-02-23

    A system for monodispersed microdroplet generation and trapping including providing a flow channel in a microchip; producing microdroplets in the flow channel, the microdroplets movable in the flow channel; providing carrier fluid in the flow channel using a pump or pressure source; controlling movement of the microdroplets in the flow channel and trapping the microdroplets in a desired location in the flow channel. The system includes a microchip; a flow channel in the microchip; a droplet maker that generates microdroplets, the droplet maker connected to the flow channel; a carrier fluid in the flow channel, the carrier fluid introduced to the flow channel by a source of carrier fluid, the source of carrier fluid including a pump or pressure source; a valve connected to the carrier fluid that controls flow of the carrier fluid and enables trapping of the microdroplets.

  15. Visualization Dot Com (Journal Article) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Visualization Dot Com Citation Details In-Document Search Title: Visualization Dot Com In this article, we explore the seemingly well-worn subject of distance-based, or remote visualization. Current practices in remote visualization tend to clump into two broad categories. One approach, which we'll call render-remote, is to render an image remotely, then transmit the data to the user. Another option, render-local, transfers raw data to the user, where it is then visualized and rendered on the

  16. Visual probes and methods for placing visual probes into subsurface areas

    DOE Patents [OSTI]

    Clark, Don T.; Erickson, Eugene E.; Casper, William L.; Everett, David M.

    2004-11-23

    Visual probes and methods for placing visual probes into subsurface areas in either contaminated or non-contaminated sites are described. In one implementation, the method includes driving at least a portion of a visual probe into the ground using direct push, sonic drilling, or a combination of direct push and sonic drilling. Such is accomplished without providing an open pathway for contaminants or fugitive gases to reach the surface. According to one implementation, the invention includes an entry segment configured for insertion into the ground or through difficult materials (e.g., concrete, steel, asphalt, metals, or items associated with waste), at least one extension segment configured to selectively couple with the entry segment, at least one push rod, and a pressure cap. Additional implementations are contemplated.

  17. Short gamma-ray burst formation rate from BATSE data using E{sub p} -L{sub p} correlation and the minimum gravitational-wave event rate of a coalescing compact binary

    SciTech Connect (OSTI)

    Yonetoku, Daisuke; Sawano, Tatsuya; Toyanago, Asuka [College of Science and Engineering, School of Mathematics and Physics, Kanazawa University, Kakuma, Kanazawa, Ishikawa 920-1192 (Japan); Nakamura, Takashi [Department of Physics, Kyoto University, Kyoto 606-8502 (Japan); Takahashi, Keitaro, E-mail: yonetoku@astro.s.kanazawa-u.ac.jp, E-mail: takashi@tap.scphys.kyoto-u.ac.jp [Faculty of Science, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)

    2014-07-01

    Using 72 short gamma-ray bursts (SGRBs) with well determined spectral data observed by BATSE, we determine their redshift and luminosity by applying the E{sub p} -L{sub p} correlation for SGRBs found by Tsutsui et al. For 53 SGRBs with an observed flux brighter than 4 10{sup 6} erg cm{sup 2} s{sup 1}, the cumulative redshift distribution up to z = 1 agrees well with that of 22 Swift SGRBs. This suggests that the redshift determination by the E{sub p} -L{sub p} correlation for SGRBs works well. The minimum event rate at z = 0 is estimated as R{sub on?axis}{sup min}=6.3{sub ?3.9}{sup +3.1} 10{sup ?10} events Mpc{sup ?3} yr{sup ?1}, so that the minimum beaming angle is 0.6-7.8 assuming a merging rate of 10{sup 7}- 4 10{sup 6} events Mpc{sup 3} yr{sup 1} suggested from the binary pulsar data. Interestingly, this angle is consistent with that for SGRB 130603B of ?4-8. On the other hand, if we assume a beaming angle of ?6 suggested from four SGRBs with the observed beaming angle value, then the minimum event rate including off-axis SGRBs is estimated as R{sub all}{sup min}=1.15{sub ?0.66}{sup +0.56} 10{sup ?7} events Mpc{sup ?3} yr{sup ?1}. If SGRBs are induced by the coalescence of binary neutron stars (NSs) and/or black holes (BHs), then this event rate leads to a minimum gravitational-wave detection rate of 3.8{sub ?2.2}{sup +1.8} (146{sub ?83}{sup +71}) events yr{sup ?1} for an NS-NS (NS-BH) binary, respectively, by a worldwide network with KAGRA, advanced-LIGO, advanced-VIRGO, and GEO.

  18. Visual examinations of K east fuel elements

    SciTech Connect (OSTI)

    Pitner, A.L., Fluor Daniel Hanford

    1997-02-03

    Selected fuel elements stored in both ``good fuel`` and ``bad fuel`` canisters in K East Basin were extracted and visually examined full length for damage. Lower end damage in the ``bad fuel`` canisters was found to be more severe than expected based on top end appearances. Lower end damage for the ``good fuel`` canisters, however, was less than expected based on top end observations. Since about half of the fuel in K East Basin is contained in ``good fuel`` canisters based on top end assessments, the fraction of fuel projected to be intact with respect to IPS processing considerations remains at 50% based on these examination results.

  19. Visualization of information with an established order

    DOE Patents [OSTI]

    Wong, Pak Chung; Foote, Harlan P.; Thomas, James J.; Wong, Kwong-Kwok

    2007-02-13

    Among the embodiments of the present invention is a system including one or more processors operable to access data representative of a biopolymer sequence of monomer units. The one or more processors are further operable to establish a pattern corresponding to at least one fractal curve and generate one or more output signals corresponding to a number of image elements each representative of one of the monomer units. Also included is a display device responsive to the one or more output signals to visualize the biopolymer sequence by displaying the image elements in accordance with the pattern.

  20. Hydraulic flow visualization method and apparatus

    DOE Patents [OSTI]

    Karidis, P.G.

    1984-01-01

    An apparatus and method for visualizing liquid flow. Pulses of gas bubbles are introduced into a liquid flow stream and a strobe light is operated at a frequency related to the frequency of the gas pulses to shine on the bubbles as they pass through the liquid stream. The gas pulses pass through a probe body having a valve element, and a reciprocating valve stem passes through the probe body to operate the valve element. A stem actuating device comprises a slidable reciprocating member, operated by a crank arm. The actuated member is adjustable to adjust the amount of the valve opening during each pulse.

  1. Visualizing Brain Metals in Health and Disease

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualizing Brain Metals in Health and Disease figure 1 Fig. 1. Rapid-scanning x-ray fluorescence mapping ex perimental setup. Synchrotron x-rays at 11 keV passed through a 50 µm aperture (Ap). The beam intensity was monitored with a N2-filled ion chamber (I0). The brain slice was mounted vertically on a motorized stage (St) at 45° to the incident x-ray beam and raster scanned in the beam. A 13-element Ge detector (Ge) was positioned at a 90° angle to the beam. We all require iron, copper and

  2. Sequential pattern data mining and visualization

    DOE Patents [OSTI]

    Wong, Pak Chung (Richland, WA); Jurrus, Elizabeth R. (Kennewick, WA); Cowley, Wendy E. (Benton City, WA); Foote, Harlan P. (Richland, WA); Thomas, James J. (Richland, WA)

    2011-12-06

    One or more processors (22) are operated to extract a number of different event identifiers therefrom. These processors (22) are further operable to determine a number a display locations each representative of one of the different identifiers and a corresponding time. The display locations are grouped into sets each corresponding to a different one of several event sequences (330a, 330b, 330c. 330d, 330e). An output is generated corresponding to a visualization (320) of the event sequences (330a, 330b, 330c, 330d, 330e).

  3. Sequential pattern data mining and visualization

    DOE Patents [OSTI]

    Wong, Pak Chung (Richland, WA); Jurrus, Elizabeth R. (Kennewick, WA); Cowley, Wendy E. (Benton City, WA); Foote, Harlan P. (Richland, WA); Thomas, James J. (Richland, WA)

    2009-05-26

    One or more processors (22) are operated to extract a number of different event identifiers therefrom. These processors (22) are further operable to determine a number a display locations each representative of one of the different identifiers and a corresponding time. The display locations are grouped into sets each corresponding to a different one of several event sequences (330a, 330b, 330c. 330d, 330e). An output is generated corresponding to a visualization (320) of the event sequences (330a, 330b, 330c, 330d, 330e).

  4. From Question Answering to Visual Exploration

    SciTech Connect (OSTI)

    McColgin, Dave W.; Gregory, Michelle L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2006-08-11

    Research in Question Answering has focused on the quality of information retrieval or extraction using the metrics of precision and recall to judge success; these metrics drive toward finding the specific best answer(s) and are best supportive of a lookup type of search. These do not address the opportunity that users? natural language questions present for exploratory interactions. In this paper, we present an integrated Question Answering environment that combines a visual analytics tool for unstructured text and a state-of-the-art query expansion tool designed to compliment the cognitive processes associated with an information analysts work flow. Analysts are seldom looking for factoid answers to simple questions; their information needs are much more complex in that they may be interested in patterns of answers over time, conflicting information, and even related non-answer data may be critical to learning about a problem or reaching prudent conclusions. In our visual analytics tool, questions result in a comprehensive answer space that allows users to explore the variety within the answers and spot related information in the rest of the data. The exploratory nature of the dialog between the user and this system requires tailored evaluation methods that better address the evolving user goals and counter cognitive biases inherent to exploratory search tasks.

  5. Visual Analytics for Power Grid Contingency Analysis

    SciTech Connect (OSTI)

    Wong, Pak C.; Huang, Zhenyu; Chen, Yousu; Mackey, Patrick S.; Jin, Shuangshuang

    2014-01-20

    Contingency analysis is the process of employing different measures to model scenarios, analyze them, and then derive the best response to remove the threats. This application paper focuses on a class of contingency analysis problems found in the power grid management system. A power grid is a geographically distributed interconnected transmission network that transmits and delivers electricity from generators to end users. The power grid contingency analysis problem is increasingly important because of both the growing size of the underlying raw data that need to be analyzed and the urgency to deliver working solutions in an aggressive timeframe. Failure to do so may bring significant financial, economic, and security impacts to all parties involved and the society at large. The paper presents a scalable visual analytics pipeline that transforms about 100 million contingency scenarios to a manageable size and form for grid operators to examine different scenarios and come up with preventive or mitigation strategies to address the problems in a predictive and timely manner. Great attention is given to the computational scalability, information scalability, visual scalability, and display scalability issues surrounding the data analytics pipeline. Most of the large-scale computation requirements of our work are conducted on a Cray XMT multi-threaded parallel computer. The paper demonstrates a number of examples using western North American power grid models and data.

  6. Web-based Visual Analytics for Extreme Scale Climate Science

    SciTech Connect (OSTI)

    Steed, Chad A; Evans, Katherine J; Harney, John F; Jewell, Brian C; Shipman, Galen M; Smith, Brian E; Thornton, Peter E; Williams, Dean N.

    2014-01-01

    In this paper, we introduce a Web-based visual analytics framework for democratizing advanced visualization and analysis capabilities pertinent to large-scale earth system simulations. We address significant limitations of present climate data analysis tools such as tightly coupled dependencies, ineffi- cient data movements, complex user interfaces, and static visualizations. Our Web-based visual analytics framework removes critical barriers to the widespread accessibility and adoption of advanced scientific techniques. Using distributed connections to back-end diagnostics, we minimize data movements and leverage HPC platforms. We also mitigate system dependency issues by employing a RESTful interface. Our framework embraces the visual analytics paradigm via new visual navigation techniques for hierarchical parameter spaces, multi-scale representations, and interactive spatio-temporal data mining methods that retain details. Although generalizable to other science domains, the current work focuses on improving exploratory analysis of large-scale Community Land Model (CLM) and Community Atmosphere Model (CAM) simulations.

  7. Performance Modeling for 3D Visualization in a Heterogeneous Computing

    Office of Scientific and Technical Information (OSTI)

    Environment (Technical Report) | SciTech Connect Performance Modeling for 3D Visualization in a Heterogeneous Computing Environment Citation Details In-Document Search Title: Performance Modeling for 3D Visualization in a Heterogeneous Computing Environment The visualization of large, remotely located data sets necessitates the development of a distributed computing pipeline in order to reduce the data, in stages, to a manageable size. The required baseline infrastructure for launching such

  8. Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture Series)

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture Series) Citation Details In-Document Search Title: Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture Series) The final Carbon Smackdown match took place Aug. 9, 2010. Juan Meza of the Computational Research Division revealed how scientists use computer visualizations to accelerate climate research and discuss the development of next-generation clean energy technologies such as wind

  9. Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture Series)

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture Series) Citation Details In-Document Search Title: Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture Series) The final Carbon Smackdown match took place Aug. 9, 2010. Juan Meza of the Computational Research Division revealed how scientists use computer visualizations to accelerate climate research and discuss the development of next-generation clean energy technologies

  10. Visualization of Force Fields in Protein Structure Prediction (Conference)

    Office of Scientific and Technical Information (OSTI)

    | SciTech Connect are not mathematically defined in such a way that their mathematical representation would facilitate the straightforward application of volume visualization techniques. To visualize energy, it is necessary to define a spatial mapping for these fields. Equipped with such a mapping, we can generate volume renderings of the internal energy states in a molecule.We describe our force field, the spatial mapping that we used for energy,and the visualizations that we produced from

  11. EGR Cooler Fouling - Visualization of Deposition and Removal...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    EGR Cooler Fouling - Visualization of Deposition and Removal Mechanis Presents experimental data on exhaust gas recirculation(EGR) cooler fouling using new test apparatus that...

  12. Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture...

    Office of Scientific and Technical Information (OSTI)

    use computer visualizations to accelerate climate research and discuss the development of next-generation clean energy technologies such as wind turbines and solar cells. ...

  13. NREL: Energy Analysis - Data Analysis and Visualization Staff

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    our energy efficiency and renewable energy data warehouse; advanced visualization; and ... Primary research interests Solar resource assessment Conversion of raw geographic ...

  14. Visualization of United States Energy Consumption | Open Energy...

    Open Energy Info (EERE)

    Energy Consumption Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Visualization of United States Energy Consumption AgencyCompany Organization: Energy Information...

  15. Gamification and Visualization of Sensor Data Analysis in Research...

    Office of Scientific and Technical Information (OSTI)

    Title: Gamification and Visualization of Sensor Data Analysis in Research Buildings The use of video game elements in non-gaming systems, or gamification , has potential value in ...

  16. Sunfall: a collaborative visual analytics system for astrophysics...

    Office of Scientific and Technical Information (OSTI)

    visual analytics system developed for the Nearby Supernova Factory, an international astrophysics experiment and the largest data volume supernova search currently in operation. ...

  17. VISMASHUP: streamlining the creation of custom visualization applications

    SciTech Connect (OSTI)

    Ahrens, James P; Santos, Emanuele; Lins, Lauro; Freire, Juliana; Silva, Cl'audio T

    2010-01-01

    Visualization is essential for understanding the increasing volumes of digital data. However, the process required to create insightful visualizations is involved and time consuming. Although several visualization tools are available, including tools with sophisticated visual interfaces, they are out of reach for users who have little or no knowledge of visualization techniques and/or who do not have programming expertise. In this paper, we propose VISMASHUP, a new framework for streamlining the creation of customized visualization applications. Because these applications can be customized for very specific tasks, they can hide much of the complexity in a visualization specification and make it easier for users to explore visualizations by manipulating a small set of parameters. We describe the framework and how it supports the various tasks a designer needs to carry out to develop an application, from mining and exploring a set of visualization specifications (pipelines), to the creation of simplified views of the pipelines, and the automatic generation of the application and its interface. We also describe the implementation of the system and demonstrate its use in two real application scenarios.

  18. Visualization of Electric Power System Information: Workshop Proceedings

    SciTech Connect (OSTI)

    Kroposki, B.; Komomua, C.

    2013-01-01

    This report summarizes the workshop entitled: Visualization of Electric Power System Information. The workshop was held on September 11, 2012 on NREL's campus in Golden, Colorado.

  19. Capturing and Using Knowledge about the Use of Visualization Toolkits

    SciTech Connect (OSTI)

    Del Rio, Nicholas R.; Pinheiro da Silva, Paulo

    2012-11-02

    When constructing visualization pipelines using toolkits such as Visualization Toolkit (VTK) and Generic Mapping Tools (GMT), developers must understand (1) what toolkit operators will transform their data from its raw state to some required view state and (2) what viewers are available to present the generated view. Traditionally, developers learn about how to construct visualization pipelines by reading documentation and inspecting code examples, which can be costly in terms of the time and effort expended. Once an initial pipeline is constructed, developers may still have to undergo a trial and error process before a satisfactory visualization is generated. This paper presents the Visualization Knowledge Project (VisKo) that is built on a knowledge base of visualization toolkit operators and how they can be piped together to form visualization pipelines. Developers may now rely on VisKo to guide them when constructing visualization pipelines and in some cases, when VisKo has complete knowledge about some set of operators (i.e., sequencing and parameter settings), automatically generate a fully functional visualization pipeline.

  20. A Novel Visualization Technique for Electric Power Grid Analytics

    SciTech Connect (OSTI)

    Wong, Pak C.; Schneider, Kevin P.; Mackey, Patrick S.; Foote, Harlan P.; Chin, George; Guttromson, Ross T.; Thomas, James J.

    2009-05-01

    The application of information visualization holds tremendous promise for the electric power industry, and yet its potential has not been sufficiently exploited by the visualization community. Prior work on visualizing electric power systems has been limited to depicting raw or processed information on top of a geographic layout. Little effort has been devoted to maximize the analytical strengths naturally gained by the visualization itself. This paper introduces a visualization system prototype, known as GreenGrid, that explores the planning and monitoring of the North American Electricity Infrastructure. For the purposes of visualization, the power infrastructure can be described as a network of nodes and links. The nodes represent the electrical buses where generators and loads are connected, while the links represent the transmission lines that interconnect the buses. This paper focuses mainly on a customized technique within GreenGrid that is designed to visually identify abnormal characteristics of the electricity infrastructure. In particular, we examine an extreme event that occurred within the Western United States power grid on August 10, 1996. We compare our study results with the conclusion of the post-disturbance analysis and find that many of the disturbance characteristics can be readily identified with the proper form of visualization. The paper includes a lessons learned discussion to evaluate the visualization application.

  1. Visualization of World Energy Supply | Open Energy Information

    Open Energy Info (EERE)

    isualizationofWorldEnergySupply Cost: Free OpenEI Keyword(s): Community Generated Language: English References: OECD1 Motion chart visualization of the world energy supply...

  2. Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture...

    Office of Scientific and Technical Information (OSTI)

    The final Carbon Smackdown match took place Aug. 9, 2010. Juan Meza of the Computational Research Division revealed how scientists use computer visualizations to accelerate climate ...

  3. Ocean Thermal Extractable Energy Visualization: Final Technical Report

    Broader source: Energy.gov [DOE]

    Report about the Ocean Thermal Extractable Energy Visualization project, which focuses on assessing the Maximum Practicably Extractable Energy from the world’s ocean thermal resources.

  4. Visualizing the Behavior of Polar Domains and Screening Charges...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualizing the Behavior of Polar Domains and Screening Charges Under Electric and Mechanical Fields Event Sponsor: Mathematics and Computing Science - LANS Seminar Start Date: Sep...

  5. Sunfall: a collaborative visual analytics system for astrophysics...

    Office of Scientific and Technical Information (OSTI)

    The system combines novel image processing algorithms, statistical analysis, and machine learning with highly interactive visual interfaces to enable collaborative, user-driven ...

  6. Visualizing Assembling Everything (2010 JGI/ANL HPC Workshop)

    ScienceCinema (OSTI)

    Jaffe, David; Gnerre, Sante

    2011-06-08

    David Jaffe and Sante Gnerre of the Broad Institute give a presentation on "Visualizing assembling everything" at the JGI/Argonne HPC Workshop on January 25, 2010.

  7. Abengoa Solar Visual Inspection Tool | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Abengoa Solar Visual Inspection Tool Presented at the PV Module Reliability Workshop, ... Load: Preliminary Report Agenda for the PV Module Reliability Workshop, February 26 - ...

  8. Mirror: Visually reflecting C{sup ++}

    SciTech Connect (OSTI)

    Orosco, R.; Campo, M.; Sole, J.P.

    1995-12-31

    Reflection is the ability of a system to inspect and change a model of itself. This ability allows to transparently control and extend the functionality of an existing system without performing any changes to the system itself. In dynamic object-oriented languages like CLOS or Smalltalk. the reflective ability is supported directly by the language. In C++, in contrast, reflection must be provided by some form of code annotation and pre-processing. In most cases, this approach either requires modification of the system code, or just supports the reflection of entire classes but not the reflection of determined objects. This work presents the Mirror environment that supports C++ reflective programming through visual association of meta-classes to classes. It allows full transparent reflection of objects using three-dimensional presentations of the different architecture levels. The environment adds reflective ability to C++ classes without any code modification visible to the user, as well as dynamically selective reflection of objects.

  9. Spatio-temporal Visualization for Environmental Decision Support

    SciTech Connect (OSTI)

    Bhaduri, Budhendra L.; Shankar, Mallikarjun; Sorokine, Alexandre; Ganguly, Auroop R.

    2009-01-01

    Traditional visualization of earth surface features has been addressed through visual exploration, analysis, synthesis, and presentation of observable geospatial data. However, characterizing the changes in their observable and unobservable properties of geospatial features is critical for planning and policy formulation. Recent approaches are addressing modeling and visualization of the temporal dynamics that describe observed and/or predicted physical and socioeconomic processes using vast volumes of earth observation (imagery and other geophysical) data from remote sensor networks. This paper provides an overview of selected geospatial modeling and simulation, exploratory analysis of earth observation data, and high performance visualization research at Oak Ridge National Laboratory for developing novel data driven approaches for geospatial knowledge discovery and visualization relevant to environmental decision support.

  10. Hypervolume visualization: a challenge in simplicity

    SciTech Connect (OSTI)

    Bajaj, C.L.; Pascucci, V.; Rabbiolo, G.; Schikore, D.R.

    1998-09-22

    Hyper-volume visualization is designed to provide simple and fully explanatory images that give comprehensive insights into the global structure of scalar fields of any dimension. The basic idea is to have a dimension independent viewing system that scales nicely with the geometric dimension of the dataset and that can be combined with classical approaches like isocontouring and animation of slices of n.D data. We completely abandon (for core simplicity) rendering techniques, such as hidden surface removal or lighting or radiosity, that enhance three dimensional realism and concentrate on the real-time display of images that highlight structural (topological) features of the nD dataset (holes, tunnels, cavities, depressions, extrema, etc). Hyper-volume visualization on the one hand is a generalization of direct parallel projection methods in volume rendering. To achieve efficiency (and real-time performance on a graphics workstation) we combine the advantages of (i) a hierarchical representations of the hyper-volume data for multiresolution display and (ii) generalized object space splatting combined with texture-mapped graphics hardware acceleration. The development of a system that implements display techniques for multidimensional datasets requires careful design of both algorithms and user interfaces that scale linearly with the dimension n of the input geometric space. This is a major challenge since straightforward generalizations of standard techniques that are suitable for display of 3D data yield exceedingly intricate interfaces. For example, a view manipulation graphical user interface is usually based on a rotation of the object about Cartesian rotation axes, with possibly unit quaternions internal representations for the rotation group. Unfortunately the number of independent rotation axes grows quadratically with dimension(three in 3D to six in 4D to ten in 5D to fifteen in 6D space). Going back to the basics of parallel projections, we develop an alternative scheme that is very simple to implement and immediately gives a view manipulation graphical user interface that scales linearly with the dimension. One can still utilize matrix or quaternion or higher dimensional rotational group representations, internally for calculations.The main results of our paper are thus both a multi-resolution direct rendering algorithm and scalable graphical user interface that provides insightfull global views of scalar fields in any dimension, while maintaining the fundamental characteristics of ease of use, and quick exploratory u

  11. Theoretical crystallography with the Advanced Visualization System

    SciTech Connect (OSTI)

    Younkin, C.R.; Thornton, E.N.; Nicholas, J.B.; Jones, D.R.; Hess, A.C.

    1993-05-01

    Space is an Application Visualization System (AVS) graphics module designed for crystallographic and molecular research. The program can handle molecules, two-dimensional periodic systems, and three-dimensional periodic systems, all referred to in the paper as models. Using several methods, the user can select atoms, groups of atoms, or entire molecules. Selections can be moved, copied, deleted, and merged. An important feature of Space is the crystallography component. The program allows the user to generate the unit cell from the asymmetric unit, manipulate the unit cell, and replicate it in three dimensions. Space includes the Buerger reduction algorithm which determines the asymmetric unit and the space group of highest symmetry of an input unit cell. Space also allows the user to display planes in the lattice based on Miller indices, and to cleave the crystal to expose the surface. The user can display important precalculated volumetric data in Space, such as electron densities and electrostatic surfaces. With a variety of methods, Space can compute the electrostatic potential of any chemical system based on input point charges.

  12. Guided Text Search Using Adaptive Visual Analytics

    SciTech Connect (OSTI)

    Steed, Chad A; Symons, Christopher T; Senter, James K; DeNap, Frank A

    2012-10-01

    This research demonstrates the promise of augmenting interactive visualizations with semi- supervised machine learning techniques to improve the discovery of significant associations and insights in the search and analysis of textual information. More specifically, we have developed a system called Gryffin that hosts a unique collection of techniques that facilitate individualized investigative search pertaining to an ever-changing set of analytical questions over an indexed collection of open-source documents related to critical national infrastructure. The Gryffin client hosts dynamic displays of the search results via focus+context record listings, temporal timelines, term-frequency views, and multiple coordinate views. Furthermore, as the analyst interacts with the display, the interactions are recorded and used to label the search records. These labeled records are then used to drive semi-supervised machine learning algorithms that re-rank the unlabeled search records such that potentially relevant records are moved to the top of the record listing. Gryffin is described in the context of the daily tasks encountered at the US Department of Homeland Security s Fusion Center, with whom we are collaborating in its development. The resulting system is capable of addressing the analysts information overload that can be directly attributed to the deluge of information that must be addressed in the search and investigative analysis of textual information.

  13. Your Data Analysis & Visualization Needs Mira Performance Boot Camp

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    & Visualization Needs Mira Performance Boot Camp May 20, 2015 Joseph A. Insley Tukey- High Performance Visualization Cluster ¤ 96 AMD Dual Opteron 6128 Compute Nodes ¥ 16 total CPU cores per node ¥ 64 GB RAM ¥ 2 NVIDIA Tesla M2070 GPUs, 6 GB RAM each ¤ 6 terabytes of CPU RAM, 1.1 terabytes of GPU RAM ¤ Peak GPU Performance: Over 98 TeraFLOPS ¤ Cross-Mounted Filesystem with Mira 2 Cooley - Expected June production ¤ Analytics/Visualization cluster ¤ Peak

  14. Ultrafast X-ray Phase-Enhanced Microimaging for Visualizing Fuel...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ultrafast X-ray Phase-Enhanced Microimaging for Visualizing Fuel Injection Process and Diesel Sprays Ultrafast X-ray Phase-Enhanced Microimaging for Visualizing Fuel Injection ...

  15. Eliot Feibush leads new Princeton consortium to visualize Big...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Eliot Feibush leads new Princeton consortium to visualize Big Data By John Greenwald April 22, 2015 Tweet Widget Google Plus One Share on Facebook Eliot Feibush (Photo by Elle ...

  16. Eliot Feibush leads new Princeton consortium to visualize Big...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Eliot Feibush leads new Princeton consortium to visualize Big Data By John Greenwald April 20, 2015 Tweet Widget Google Plus One Share on Facebook Eliot Feibush (Photo by Elle ...

  17. SciDAC Visualization and Analytics Center for Enabling Technologies

    SciTech Connect (OSTI)

    Joy, Kenneth I.

    2014-09-14

    This project focuses on leveraging scientific visualization and analytics software technology as an enabling technology for increasing scientific productivity and insight. Advances in computational technology have resulted in an "information big bang," which in turn has created a significant data understanding challenge. This challenge is widely acknowledged to be one of the primary bottlenecks in contemporary science. The vision for our Center is to respond directly to that challenge by adapting, extending, creating when necessary and deploying visualization and data understanding technologies for our science stakeholders. Using an organizational model as a Visualization and Analytics Center for Enabling Technologies (VACET), we are well positioned to be responsive to the needs of a diverse set of scientific stakeholders in a coordinated fashion using a range of visualization, mathematics, statistics, computer and computational science and data management technologies.

  18. VisPortal: Deploying grid-enabled visualization tools through...

    Office of Scientific and Technical Information (OSTI)

    tools through a web-portal interface Citation Details In-Document Search Title: VisPortal: Deploying grid-enabled visualization tools through a web-portal interface You ...

  19. VisPortal: Deploying grid-enabled visualization tools through...

    Office of Scientific and Technical Information (OSTI)

    tools through a web-portal interface Citation Details In-Document Search Title: VisPortal: Deploying grid-enabled visualization tools through a web-portal interface The ...

  20. The SDAV Software Frameworks for Visualization and Analysis on...

    Office of Scientific and Technical Information (OSTI)

    Conference: The SDAV Software Frameworks for Visualization and Analysis on Next-Generation Multi-Core and Many-Core Architectures Citation Details In-Document Search Title: The ...

  1. Topology-based Visualization and Analysis of High-dimensional...

    Office of Scientific and Technical Information (OSTI)

    Data and Time-varying Data at the Extreme Scale Citation Details In-Document Search Title: Topology-based Visualization and Analysis of High-dimensional Data and Time-varying ...

  2. Exploratory Nuclear Reactor Safety Analysis and Visualization via

    Office of Scientific and Technical Information (OSTI)

    Integrated Topological and Geometric Techniques (Technical Report) | SciTech Connect Technical Report: Exploratory Nuclear Reactor Safety Analysis and Visualization via Integrated Topological and Geometric Techniques Citation Details In-Document Search Title: Exploratory Nuclear Reactor Safety Analysis and Visualization via Integrated Topological and Geometric Techniques A recent trend in the nuclear power engineering field is the implementation of heavily computational and time consuming

  3. Gamification and Visualization of Sensor Data Analysis in Research

    Office of Scientific and Technical Information (OSTI)

    Buildings (Conference) | SciTech Connect Gamification and Visualization of Sensor Data Analysis in Research Buildings Citation Details In-Document Search Title: Gamification and Visualization of Sensor Data Analysis in Research Buildings The use of video game elements in non-gaming systems, or gamification , has potential value in transforming data analysis. Our study focused on creating a web-based videogame that models two physical test buildings, each of which contains hundreds of

  4. Quantification and Visualization of Variation in Anatomical Trees

    SciTech Connect (OSTI)

    Amenta, Nina; Datar, Manasi; Dirksen, Asger; de Bruihne, Marleen; Feragen, Aasa; Ge, Xiaoyin; Holst Pedersen, Jesper; Howard, Marylesa; Owen, Megan; Petersen, Jens; Shi, Jie; Xu, Qiuping

    2015-07-01

    This paper presents two approaches to quantifying and visualizing variation in datasets of trees. The first approach localizes subtrees in which significant population differences are found through hypothesis testing and sparse classifiers on subtree features. The second approach visualizes the global metric structure of datasets through low-distortion embedding into hyperbolic planes in the style of multidimensional scaling. A case study is made on a dataset of airway trees in relation to Chronic Obstructive Pulmonary Disease.

  5. Visualizing Group II Intron Catalysis through the Stages of Splicing

    Office of Scientific and Technical Information (OSTI)

    (Journal Article) | SciTech Connect SciTech Connect Search Results Journal Article: Visualizing Group II Intron Catalysis through the Stages of Splicing Citation Details In-Document Search Title: Visualizing Group II Intron Catalysis through the Stages of Splicing Authors: Marcia, Marco ; Pyle, Anna Marie [1] ; HHMI) [2] + Show Author Affiliations (Yale) ( Publication Date: 2013-01-10 OSTI Identifier: 1054354 Resource Type: Journal Article Resource Relation: Journal Name: Cell; Journal

  6. Ocean Thermal Extractable Energy Visualization: Final Technical Report

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Approved for public release; distribution is unlimited OCEAN THERMAL EXTRACTABLE ENERGY VISUALIZATION Award # DE-EE0002664 October 28, 2012 Final Technical Report Prepared by Lockheed Martin Mission Systems & Sensors (MS2) DE-EE0002664 Ocean Thermal Energy Resource Assessment Final Draft i 10/28/2012 Project Title: Ocean Thermal Extractable Energy Visualization Recipient: Lockheed Martin Corporation Award #: DE-0002664 Working Partners Project Lead: Matthew Ascari - Lockheed Martin

  7. John Papanikolas: Visualizing Charge Carrier Motion in Nanowires Using

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Femtosecond Pump-Probe Microscopy | Center for Energy Efficient Materials John Papanikolas: Visualizing Charge Carrier Motion in Nanowires Using Femtosecond Pump-Probe Microscopy Apr 17, 2014 | 4:00 PM - 5:00 PM John Papanikolas Professor of Chemistry & Deputy Director, EFRC on Solar Fuels University of North Carolina, Chapel Hill Visualizing Charge Carrier Motion in Nanowires Using Femtosecond Pump-Probe Microscopy April 17, 2014 | 4:00pm | ESB 1001 Faculty host: Dan Morse

  8. NREL: Distributed Grid Integration - Data Collection and Visualization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Projects Data Collection and Visualization Projects NREL researchers work with utilities and other organizations, such as the Sacramento Municipal Utility District and the U.S. Army, to create data collection and visualization scenarios that help them to understand and effectively manage distributed energy integration systems. Sacramento Municipal Utility District As part of a larger project with the Sacramento Municipal Utility District (SMUD), NREL is using its data collection and

  9. NREL: Energy Systems Integration - Computational Science and Visualization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Computational Science and Visualization Computational science and visualization capabilities at NREL propel technology innovation as a research tool by which scientists and engineers find new ways to tackle our nation's energy challenges-challenges that cannot be addressed through traditional experimentation alone. These efforts will save time and money, significantly improve the likelihood of breakthroughs and useful advances, and reduce risks and uncertainties that are often barriers to

  10. OVIS: Scalable Run Time Data Collection Analysis and Visualization

    Office of Scientific and Technical Information (OSTI)

    (Abstract). (Conference) | SciTech Connect OVIS: Scalable Run Time Data Collection Analysis and Visualization (Abstract). Citation Details In-Document Search Title: OVIS: Scalable Run Time Data Collection Analysis and Visualization (Abstract). Abstract not provided. Authors: Chen, Frank Xiaoxiao ; Das, Ananya Publication Date: 2009-07-01 OSTI Identifier: 1141424 Report Number(s): SAND2009-4761C 506638 DOE Contract Number: DE-AC04-94AL85000 Resource Type: Conference Resource Relation:

  11. Visual Information for the Desktop, version 1.0

    Energy Science and Technology Software Center (OSTI)

    2006-03-29

    VZIN integrates visual analytics capabilities into popular desktop tools to aid a user in searching and understanding an information space. VZIN allows users to Drag-Drop-Visualize-Explore-Organize information within tools such as Microsoft Office, Windows Explorer, Excel, and Outlook. VZIN is tailorable to specific client or industry requirements. VZIN follows the desktop metaphors so that advanced analytical capabilities are available with minimal user training.

  12. Scalable Run Time Data Collection Analysis and Visualization

    Office of Scientific and Technical Information (OSTI)

    (Presentation). (Conference) | SciTech Connect Scalable Run Time Data Collection Analysis and Visualization (Presentation). Citation Details In-Document Search Title: Scalable Run Time Data Collection Analysis and Visualization (Presentation). Abstract not provided. Authors: Gentile, Ann C. ; Chen, Frank Xiaoxiao [1] ; Das, Ananya + Show Author Affiliations Sandia National Laboratories, Livermore, CA [Sandia National Laboratories, Livermore, CA Publication Date: 2009-07-01 OSTI Identifier:

  13. VERDE: Visualizing Energy Resources Dynamically on Earth - Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Innovation Portal Energy Analysis Energy Analysis Electricity Transmission Electricity Transmission Find More Like This Return to Search VERDE: Visualizing Energy Resources Dynamically on Earth Oak Ridge National Laboratory Contact ORNL About This Technology Technology Marketing SummaryVERDE is a software application utilizing the Google Earth(c) platform to provide real time visualization of the electric power grid.DescriptionVERDE is capable of layering different types of information on

  14. Visapult: A Prototype Remote and Distributed Visualization Application and

    Office of Scientific and Technical Information (OSTI)

    Framework (Conference) | SciTech Connect Conference: Visapult: A Prototype Remote and Distributed Visualization Application and Framework Citation Details In-Document Search Title: Visapult: A Prototype Remote and Distributed Visualization Application and Framework We describe an approach used for implementing a highly efficient and scalable method for direct volume rendering. Our approach uses a pipelined-parallel decomposition composed of parallel computers and commodity desktop hardware.

  15. Visualization of Force Fields in Protein Structure Prediction (Conference)

    Office of Scientific and Technical Information (OSTI)

    | SciTech Connect arenot mathematically defined in such a way that their mathematicalrepresentation would facilitate the straightforward application of volumevisualization techniques. To visualize energy, it is necessary to definea spatial mapping for these fields. Equipped with such a mapping, we cangenerate volume renderings of the internal energy states in a molecule.We describe our force field, the spatial mapping that we used for energy,and the visualizations that we produced from this

  16. Appendix TFIELD Attachment A: Attachment A: TFIELD-2014 Visualization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Attachment A: TFIELD-2014 Visualization United States Department of Energy Waste Isolation Pilot Plant Carlsbad Field Office Carlsbad, New Mexico Compliance Recertification Application 2014 Attachment A: TFIELD-2014 Visualization This attachment contains figures for Appendix TFIELD-2014, related to the Culebra T-Field calibration process, performed as part of the 2009 Compliance Recertification Application (CRA-2009) Performance Assessment Baseline Calculation (PABC). These parameter inputs and

  17. Large Data Visualization on Distributed Memory Mulit-GPU Clusters

    SciTech Connect (OSTI)

    Childs, Henry R.

    2010-03-01

    Data sets of immense size are regularly generated on large scale computing resources. Even among more traditional methods for acquisition of volume data, such as MRI and CT scanners, data which is too large to be effectively visualization on standard workstations is now commonplace. One solution to this problem is to employ a 'visualization cluster,' a small to medium scale cluster dedicated to performing visualization and analysis of massive data sets generated on larger scale supercomputers. These clusters are designed to fit a different need than traditional supercomputers, and therefore their design mandates different hardware choices, such as increased memory, and more recently, graphics processing units (GPUs). While there has been much previous work on distributed memory visualization as well as GPU visualization, there is a relative dearth of algorithms which effectively use GPUs at a large scale in a distributed memory environment. In this work, we study a common visualization technique in a GPU-accelerated, distributed memory setting, and present performance characteristics when scaling to extremely large data sets.

  18. The Ultra-scale Visualization Climate Data Analysis Tools (UV-CDAT): Data Analysis and Visualization for Geoscience Data

    SciTech Connect (OSTI)

    Williams, Dean; Doutriaux, Charles; Patchett, John; Williams, Sean; Shipman, Galen; Miller, Ross; Steed, Chad; Krishnan, Harinarayan; Silva, Claudio; Chaudhary, Aashish; Bremer, Peer-Timo; Pugmire, David; Bethel, E. Wes; Childs, Hank; Prabhat, Mr.; Geveci, Berk; Bauer, Andrew; Pletzer, Alexander; Poco, Jorge; Ellqvist, Tommy; Santos, Emanuele; Potter, Gerald; Smith, Brian; Maxwell, Thomas; Kindig, David; Koop, David

    2013-05-01

    To support interactive visualization and analysis of complex, large-scale climate data sets, UV-CDAT integrates a powerful set of scientific computing libraries and applications to foster more efficient knowledge discovery. Connected through a provenance framework, the UV-CDAT components can be loosely coupled for fast integration or tightly coupled for greater functionality and communication with other components. This framework addresses many challenges in the interactive visual analysis of distributed large-scale data for the climate community.

  19. Visualizations of coherent center domains in local Polyakov loops

    SciTech Connect (OSTI)

    Stokes, Finn M. Kamleh, Waseem; Leinweber, Derek B.

    2014-09-15

    Quantum Chromodynamics exhibits a hadronic confined phase at low to moderate temperatures and, at a critical temperature T{sub C}, undergoes a transition to a deconfined phase known as the quarkgluon plasma. The nature of this deconfinement phase transition is probed through visualizations of the Polyakov loop, a gauge independent order parameter. We produce visualizations that provide novel insights into the structure and evolution of center clusters. Using the HMC algorithm the percolation during the deconfinement transition is observed. Using 3D rendering of the phase and magnitude of the Polyakov loop, the fractal structure and correlations are examined. The evolution of the center clusters as the gauge fields thermalize from below the critical temperature to above it are also exposed. We observe deconfinement proceeding through a competition for the dominance of a particular center phase. We use stout-link smearing to remove small-scale noise in order to observe the large-scale evolution of the center clusters. A correlation between the magnitude of the Polyakov loop and the proximity of its phase to one of the center phases of SU(3) is evident in the visualizations. - Highlights: We produce visualizations of center clusters in Polyakov loops. The evolution of center clusters with HMC simulation time is examined. Visualizations provide novel insights into the percolation of center clusters. The magnitude and phase of the Polyakov loop are studied. A correlation between the magnitude and center phase proximity is evident.

  20. Visual Data Analysis as an Integral Part of Environmental Management

    SciTech Connect (OSTI)

    Meyer, Joerg; Bethel, E. Wes; Horsman, Jennifer L.; Hubbard, Susan S.; Krishnan, Harinarayan; Romosan,, Alexandru; Keating, Elizabeth H.; Monroe, Laura; Strelitz, Richard; Moore, Phil; Taylor, Glenn; Torkian, Ben; Johnson, Timothy C.; Gorton, Ian

    2012-10-01

    The U.S. Department of Energy's (DOE) Office of Environmental Management (DOE/EM) currently supports an effort to understand and predict the fate of nuclear contaminants and their transport in natural and engineered systems. Geologists, hydrologists, physicists and computer scientists are working together to create models of existing nuclear waste sites, to simulate their behavior and to extrapolate it into the future. We use visualization as an integral part in each step of this process. In the first step, visualization is used to verify model setup and to estimate critical parameters. High-performance computing simulations of contaminant transport produces massive amounts of data, which is then analyzed using visualization software specifically designed for parallel processing of large amounts of structured and unstructured data. Finally, simulation results are validated by comparing simulation results to measured current and historical field data. We describe in this article how visual analysis is used as an integral part of the decision-making process in the planning of ongoing and future treatment options for the contaminated nuclear waste sites. Lessons learned from visually analyzing our large-scale simulation runs will also have an impact on deciding on treatment measures for other contaminated sites.

  1. Deploying web-based visual exploration tools on the grid (Journal Article)

    Office of Scientific and Technical Information (OSTI)

    | SciTech Connect Journal Article: Deploying web-based visual exploration tools on the grid Citation Details In-Document Search Title: Deploying web-based visual exploration tools on the grid We discuss a web-based portal for the exploration, encapsulation, and dissemination of visualization results over the Grid. This portal integrates three components: an interface client for structured visualization exploration, a visualization web application to manage the generation and capture of the

  2. High Performance Multivariate Visual Data Exploration for Extremely Large Data

    SciTech Connect (OSTI)

    Rubel, Oliver; Wu, Kesheng; Childs, Hank; Meredith, Jeremy; Geddes, Cameron G.R.; Cormier-Michel, Estelle; Ahern, Sean; Weber, Gunther H.; Messmer, Peter; Hagen, Hans; Hamann, Bernd; Bethel, E. Wes; Prabhat,

    2008-08-22

    One of the central challenges in modern science is the need to quickly derive knowledge and understanding from large, complex collections of data. We present a new approach that deals with this challenge by combining and extending techniques from high performance visual data analysis and scientific data management. This approach is demonstrated within the context of gaining insight from complex, time-varying datasets produced by a laser wakefield accelerator simulation. Our approach leverages histogram-based parallel coordinates for both visual information display as well as a vehicle for guiding a data mining operation. Data extraction and subsetting are implemented with state-of-the-art index/query technology. This approach, while applied here to accelerator science, is generally applicable to a broad set of science applications, and is implemented in a production-quality visual data analysis infrastructure. We conduct a detailed performance analysis and demonstrate good scalability on a distributed memory Cray XT4 system.

  3. Using ParaView for Scientific Data Visualization | Argonne National

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Laboratory Using ParaView for Scientific Data Visualization May 16, 2016 1:00PM to 2:00PM Presenter Joseph Insley (ALCF) Location Building 401, Room A1100 Type Seminar Series APS Scientific Computation Seminar Series Abstract: ParaView is an open-source, multiplatform data analysis and visualization application. ParaView was developed to analyze extremely large datasets using distributed memory computing resources. It can be run on supercomputers to analyze large datasets as well as on

  4. Interactive visualization of particle beams for accelerator design

    SciTech Connect (OSTI)

    Wilson, Brett; Ma, Kwan-Liu; Qiang, Ji; Ryne, Robert

    2002-01-15

    We describe a hybrid data-representation and rendering technique for visualizing large-scale particle data generated from numerical modeling of beam dynamics. The basis of the technique is mixing volume rendering and point rendering according to particle density distribution, visibility, and the user's instruction. A hierarchical representation of the data is created on a parallel computer, allowing real-time partitioning into high-density areas for volume rendering, and low-density areas for point rendering. This allows the beam to be interactively visualized while preserving the fine structure usually visible only with slow point based rendering techniques.

  5. The CommonGround Visual Paradigm for Biosurveillance

    SciTech Connect (OSTI)

    Livnat, Yarden; Jurrus, Elizabeth R.; Gundlapalli, Adi V.; Gestland, Per

    2013-06-14

    Biosurveillance is a critical area in the intelligence community for real-time detection of disease outbreaks. Identifying epidemics enables analysts to detect and monitor disease outbreaks that might be spread from natural causes or from possible biological warfare attacks. Containing these events and disseminating alerts requires the ability to rapidly find, classify and track harmful biological signatures. In this paper, we describe a novel visual paradigm to conduct biosurveillance using an Infectious Disease Weather Map. Our system provides a visual common ground in which users can view, explore and discover emerging concepts and correlations such as symptoms, syndromes, pathogens, and geographic locations.

  6. The SDAV Software Frameworks for Visualization and Analysis on

    Office of Scientific and Technical Information (OSTI)

    Next-Generation Multi-Core and Many-Core Architectures. (Conference) | SciTech Connect Conference: The SDAV Software Frameworks for Visualization and Analysis on Next-Generation Multi-Core and Many-Core Architectures. Citation Details In-Document Search Title: The SDAV Software Frameworks for Visualization and Analysis on Next-Generation Multi-Core and Many-Core Architectures. Authors: Moreland, Kenneth D. ; Sewell, Christopher ; Meredith, Jeremy ; Peterka, Tom ; DeMarle, David ; Lo, Li-Ta ;

  7. Lighting Studies for Fuelling Machine Deployed Visual Inspection Tool

    SciTech Connect (OSTI)

    Stoots, Carl; Griffith, George

    2015-04-01

    Under subcontract to James Fisher Nuclear, Ltd., INL has been reviewing advanced vision systems for inspection of graphite in high radiation, high temperature, and high pressure environments. INL has performed calculations and proof-of-principle measurements of optics and lighting techniques to be considered for visual inspection of graphite fuel channels in AGR reactors in UK.

  8. Carbon Smackdown: Visualizing Clean Energy (LBNL Summer Lecture Series)

    ScienceCinema (OSTI)

    Meza, Juan [LBNL Computational Research Division

    2010-09-01

    The final Carbon Smackdown match took place Aug. 9, 2010. Juan Meza of the Computational Research Division revealed how scientists use computer visualizations to accelerate climate research and discuss the development of next-generation clean energy technologies such as wind turbines and solar cells.

  9. Human Factors Evaluation of Advanced Electric Power Grid Visualization Tools

    SciTech Connect (OSTI)

    Greitzer, Frank L.; Dauenhauer, Peter M.; Wierks, Tamara G.; Podmore, Robin

    2009-04-01

    This report describes initial human factors evaluation of four visualization tools (Graphical Contingency Analysis, Force Directed Graphs, Phasor State Estimator and Mode Meter/ Mode Shapes) developed by PNNL, and proposed test plans that may be implemented to evaluate their utility in scenario-based experiments.

  10. Fuel Cell Backup Power Geographical Visualization Map (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-12-01

    This NREL Hydrogen and Fuel Cell Technical Highlight describes a time-lapse geographical visualization map of early market use of fuel cells for telecommunications backup power. The map synthesizes data being analyzed by NREL's Technology Validation team for the U.S. Department of Energy (DOE) Fuel Cell Technologies Program with DOE's publicly available annual summaries of electric disturbance events.

  11. Ultrascale Visualization Climate Data Analysis Tools (UV-CDAT): Semi-Annual Progress Report

    SciTech Connect (OSTI)

    Williams, D N

    2012-02-29

    This report summarizes work carried out by the Ultrascale Visualization Climate Data Analysis Tools (UV-CDAT) Team for the period of July 1, 2011 through December 31, 2011. It discusses highlights, overall progress, period goals, and collaborations and lists papers and presentations. The UV-CDAT team is positioned to address the following high-level visualization requirements: (1) Alternative parallel streaming statistics and analysis pipelines - Data parallelism, Task parallelism, Visualization parallelism; (2) Optimized parallel input/output (I/O); (3) Remote interactive execution; (4) Advanced intercomparison visualization; (5) Data provenance processing and capture; and (6) Interfaces for scientists - Workflow data analysis and visualization construction tools, Visualization interfaces.

  12. Temporal Stability of Visual Search-Driven Biometrics

    SciTech Connect (OSTI)

    Yoon, Hong-Jun; Carmichael, Tandy; Tourassi, Georgia

    2015-01-01

    Previously, we have shown the potential of using an individual s visual search pattern as a possible biometric. That study focused on viewing images displaying dot-patterns with different spatial relationships to determine which pattern can be more effective in establishing the identity of an individual. In this follow-up study we investigated the temporal stability of this biometric. We performed an experiment with 16 individuals asked to search for a predetermined feature of a random-dot pattern as we tracked their eye movements. Each participant completed four testing sessions consisting of two dot patterns repeated twice. One dot pattern displayed concentric circles shifted to the left or right side of the screen overlaid with visual noise, and participants were asked which side the circles were centered on. The second dot-pattern displayed a number of circles (between 0 and 4) scattered on the screen overlaid with visual noise, and participants were asked how many circles they could identify. Each session contained 5 untracked tutorial questions and 50 tracked test questions (200 total tracked questions per participant). To create each participant s "fingerprint", we constructed a Hidden Markov Model (HMM) from the gaze data representing the underlying visual search and cognitive process. The accuracy of the derived HMM models was evaluated using cross-validation for various time-dependent train-test conditions. Subject identification accuracy ranged from 17.6% to 41.8% for all conditions, which is significantly higher than random guessing (1/16 = 6.25%). The results suggest that visual search pattern is a promising, fairly stable personalized fingerprint of perceptual organization.

  13. Jefferson Lab Dec. 9 Science Lecture Discusses How Visual Illusions Trick

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the Mind | Jefferson Lab Dec. 9 Science Lecture Discusses How Visual Illusions Trick the Mind Jefferson Lab Dec. 9 Science Lecture Discusses How Visual Illusions Trick the Mind NEWPORT NEWS, Va., Nov. 4, 2009 - Jefferson Lab will host an illuminating and educational presentation on Wednesday, Dec. 9, titled How the Mind Tricks Us: Visualizations and Visual Illusions with Dr. Eric Mazur, Harvard University. Mazur is the Balkanski Professor of Physics and Applied Physics at Harvard University.

  14. Computerized fluid movement mapping and 3-D visualization

    SciTech Connect (OSTI)

    Al-Awami, A.A.; Poore, J.W.; Sizer, J.P.

    1995-11-01

    Most of the fieldwide fluid movement monitoring techniques under utilize available computer resources. This paper discusses an approach reservoir management engineers use to monitor fluid movement in reservoirs with a multitude of wells. This approach allows the engineer to maintain up-to-date fluid movement studies and incorporate the latest information from data acquisition programs into the day to day decision-making process. The approach uses several in-house database applications and makes extensive use of commercially available software products to generate and visualize cross-sections, maps, and 3-d models. This paper reviews the computerized procedures to create cross-sections that display the current fluid contacts overlaying the lithology. It also reviews the mapping procedures nd presents examples of water encroachment maps by layer at specific time periods. 3-D geologic modeling software greatly enhances the visualization of the reservoir. This software can also be used to interpret and model fluid movement, given the appropriate engineering constraints.

  15. Big Data Visual Analytics for Exploratory Earth System Simulation Analysis

    SciTech Connect (OSTI)

    Steed, Chad A.; Ricciuto, Daniel M.; Shipman, Galen M.; Smith, Brian E.; Thornton, Peter E.; Wang, Dali; Shi, Xiaoying; Williams, Dean N.

    2013-12-01

    Rapid increases in high performance computing are feeding the development of larger and more complex data sets in climate research, which sets the stage for so-called big data analysis challenges. However, conventional climate analysis techniques are inadequate in dealing with the complexities of today s data. In this paper, we describe and demonstrate a visual analytics system, called the Exploratory Data analysis ENvironment (EDEN), with specific application to the analysis of complex earth system simulation data sets. EDEN represents the type of interactive visual analysis tools that are necessary to transform data into insight, thereby improving critical comprehension of earth system processes. In addition to providing an overview of EDEN, we describe real-world studies using both point ensembles and global Community Land Model Version 4 (CLM4) simulations.

  16. New techniques in 3D scalar and vector field visualization

    SciTech Connect (OSTI)

    Max, N.; Crawfis, R.; Becker, B.

    1993-05-05

    At Lawrence Livermore National Laboratory (LLNL) we have recently developed several techniques for volume visualization of scalar and vector fields, all of which use back-to-front compositing. The first renders volume density clouds by compositing polyhedral volume cells or their faces. The second is a ``splatting`` scheme which composites textures used to reconstruct the scalar or vector fields. One version calculates the necessary texture values in software, and another takes advantage of hardware texture mapping. The next technique renders contour surface polygons using semi-transparent textures, which adjust appropriately when the surfaces deform in a flow, or change topology. The final one renders the ``flow volume`` of smoke or dye tracer swept out by a fluid flowing through a small generating polygon. All of these techniques are applied to a climate model data set, to visualize cloud density and wind velocity.

  17. Visual Modeling for Aqua Ventus I off Monhegan Island, ME

    SciTech Connect (OSTI)

    Hanna, Luke A.; Whiting, Jonathan M.; Copping, Andrea E.

    2013-11-27

    To assist the University of Maine in demonstrating a clear pathway to project completion, PNNL has developed visualization models of the Aqua Ventus I project that accurately depict the Aqua Ventus I turbines from various points on Monhegain Island, ME and the surrounding area. With a hub height of 100 meters, the Aqua Ventus I turbines are large and may be seen from many areas on Monhegan Island, potentially disrupting important viewsheds. By developing these visualization models, which consist of actual photographs taken from Monhegan Island and the surrounding area with the Aqua Ventus I turbines superimposed within each photograph, PNNL intends to support the project’s siting and permitting process by providing the Monhegan Island community and various other stakeholders with a probable glimpse of how the Aqua Ventus I project will appear.

  18. Visually Relating Gene Expression and in vivo DNA Binding Data

    SciTech Connect (OSTI)

    Huang, Min-Yu; Mackey, Lester; Ker?; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  19. A Visual Analytics Approach for Correlation, Classification, and Regression Analysis

    SciTech Connect (OSTI)

    Steed, Chad A; SwanII, J. Edward; Fitzpatrick, Patrick J.; Jankun-Kelly, T.J.

    2012-02-01

    New approaches that combine the strengths of humans and machines are necessary to equip analysts with the proper tools for exploring today's increasing complex, multivariate data sets. In this paper, a novel visual data mining framework, called the Multidimensional Data eXplorer (MDX), is described that addresses the challenges of today's data by combining automated statistical analytics with a highly interactive parallel coordinates based canvas. In addition to several intuitive interaction capabilities, this framework offers a rich set of graphical statistical indicators, interactive regression analysis, visual correlation mining, automated axis arrangements and filtering, and data classification techniques. The current work provides a detailed description of the system as well as a discussion of key design aspects and critical feedback from domain experts.

  20. Visualizing Wind Farm Wake Losses using SCADA Data

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Continuous Reliability Enhancement for Wind Visualizing Wind Farm Wake Losses using SCADA Data Sandia National Laboratories Carsten H. Westergaard, Jonathan White and Shawn Martin IEA Wind TEM#78 on Field Test Instrumentation and Merasurement Best Practices, October 7 and 8, 2014 Acknowledgement: This work has been funded under the Department of Energy's Continuous Reliability Enhancement for Wind (CREW) project. Sandia National Laboratories is a multi-program laboratory managed and operated by

  1. Eliot Feibush leads new Princeton consortium to visualize Big Data |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Princeton Plasma Physics Lab Eliot Feibush leads new Princeton consortium to visualize Big Data By John Greenwald April 22, 2015 Tweet Widget Google Plus One Share on Facebook Eliot Feibush (Photo by Elle Starkman/PPPL Office of Communications) Eliot Feibush Gallery: Cross section of a tokamak plasma with red and blue colors showing direction and structure of plasma flow. (Photo by PPPL) Cross section of a tokamak plasma with red and blue colors showing direction and structure of plasma

  2. Texture splats for 3D vector and scalar field visualization

    SciTech Connect (OSTI)

    Crawfis, R.A.; Max, N.

    1993-04-06

    Volume Visualization is becoming an important tool for understanding large 3D datasets. A popular technique for volume rendering is known as splatting. With new hardware architectures offering substantial improvements in the performance of rendering texture mapped objects, we present textured splats. An ideal reconstruction function for 3D signals is developed which can be used as a texture map for a splat. Extensions to the basic splatting technique are then developed to additionally represent vector fields.

  3. Remote Visualization on Cooley Using VNC | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Facility Changes from Tukey to Cooley Compiling and Linking Using Cobalt on Cooley Visit on Cooley Paraview on Cooley ParaView Tutorial VNC on Cooley Policies Documentation Feedback Please provide feedback to help guide us as we continue to build documentation for our new computing resource. [Feedback Form] Remote Visualization on Cooley Using VNC When running graphics applications on Cooley, it is best to use the client/server mode, when available, where a lightweight client can run on

  4. Visualizing and improving the robustness of phase retrieval algorithms

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Tripathi, Ashish; Leyffer, Sven; Munson, Todd; Wild, Stefan M.

    2015-06-01

    Coherent x-ray diffractive imaging is a novel imaging technique that utilizes phase retrieval and nonlinear optimization methods to image matter at nanometer scales. We explore how the convergence properties of a popular phase retrieval algorithm, Fienup's HIO, behave by introducing a reduced dimensionality problem allowing us to visualize and quantify convergence to local minima and the globally optimal solution. We then introduce generalizations of HIO that improve upon the original algorithm's ability to converge to the globally optimal solution.

  5. UNIVERSITY OF CALIFORNIA The Future of Large Scale Visual Data

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    CALIFORNIA The Future of Large Scale Visual Data Analysis Joint Facilities User Forum on Data Intensive Computing Oakland, CA E. Wes Bethel Lawrence Berkeley National Laboratory 16 June 2014 16 June 2014 The World that Was: Computational Architectures * Machine architectures - Single CPU, single core - Vector, then single-core MPPs - "Large" SMP platforms - Relatively well balanced: memory, FLOPS,I/O 16 June 2014 The World that Was: Software Architecture * Data Analysis and

  6. Visualization of Force Fields in Protein Structure Prediction (Conference)

    Office of Scientific and Technical Information (OSTI)

    | SciTech Connect We describe our force field, the spatial mapping that we used for energy, and the visualizations that we produced from this mapping. We provide images and animations that offer insight into the computational behavior of the energy optimization algorithms that we employ. Authors: Crawford, Clark ; Kreylos, Oliver ; Hamann, Bernd ; Crivelli, Silvia Publication Date: 2005-04-26 OSTI Identifier: 882085 Report Number(s): LBNL--58169 R&D Project: 365963; TRN: US200613%%580

  7. IdentityMap Visualization of the Super Identity Model

    SciTech Connect (OSTI)

    2015-04-15

    The Super Identity Model is a collaboration with six United Kingdom universities to develop use cases used to piece together a person's identity across biological, cyber, psychological, and biographical domains. PNNL visualized the model in a web-based application called IdentityMap. This is the first step in a promising new field of research. Interested future collaborators are welcome to find out more by emailing superid@pnnl.gov.

  8. Scientific Visualization: The Modern Oscilloscope for "Seeing the Unseeable" (LBNL Summer Lecture Series)

    ScienceCinema (OSTI)

    Bethel, E Wes

    2011-04-28

    Summer Lecture Series 2008: Scientific visualization transforms abstract data into readily comprehensible images, provide a vehicle for "seeing the unseeable," and play a central role in both experimental and computational sciences. Wes Bethel, who heads the Scientific Visualization Group in the Computational Research Division, presents an overview of visualization and computer graphics, current research challenges, and future directions for the field.

  9. ASCI visualization tool evaluation, Version 2.0

    SciTech Connect (OSTI)

    Kegelmeyer, P.

    1997-04-01

    The charter of the ASCI Visualization Common Tools subgroup was to investigate and evaluate 3D scientific visualization tools. As part of that effort, a Tri-Lab evaluation effort was launched in February of 1996. The first step was to agree on a thoroughly documented list of 32 features against which all tool candidates would be evaluated. These evaluation criteria were both gleaned from a user survey and determined from informed extrapolation into the future, particularly as concerns the 3D nature and extremely large size of ASCI data sets. The second step was to winnow a field of 41 candidate tools down to 11. The selection principle was to be as inclusive as practical, retaining every tool that seemed to hold any promise of fulfilling all of ASCI`s visualization needs. These 11 tools were then closely investigated by volunteer evaluators distributed across LANL, LLNL, and SNL. This report contains the results of those evaluations, as well as a discussion of the evaluation philosophy and criteria.

  10. GWVis: A Tool for Comparative Ground-Water Data Visualization

    SciTech Connect (OSTI)

    Best, Daniel M.; Lewis, Robert R.

    2010-11-01

    The Ground-Water Visualization application (GWVis) presents ground-water data visually in order to educate the public on ground-water issues. It is also intended for presentations to government and other funding agencies. Current three dimensional models of ground-water are overly complex, while the two dimensional representations (i.e., on paper) are neither comprehensive, nor engaging. At present, GWVis operates on water head elevation data over a given time span, together with a matching (fixed) underlying geography. Two elevation scenarios are compared with each other, typically a control data set (actual field data) and a simulation. Scenario comparison can be animated for the time span provided. We developed GWVis using the Python programming language, associated libraries, and pyOpenGL extension packages to improve performance and control of attributes of the mode (such as color, positioning, scale, and interpolation). GWVis bridges the gap between two dimensional and dynamic three dimensional research visualizations by providing an intuitive, interactive design that allows participants to view the model from different perspectives and to infer information about scenarios. By incorporating scientific data in an environment that can be easily understood, GWVis allows the information to be presented to a large audience base.

  11. Visual Empirical Region of Influence (VERI) Pattern Recognition Algorithms

    SciTech Connect (OSTI)

    2002-05-01

    We developed new pattern recognition (PR) algorithms based on a human visual perception model. We named these algorithms Visual Empirical Region of Influence (VERI) algorithms. To compare the new algorithm's effectiveness against othe PR algorithms, we benchmarked their clustering capabilities with a standard set of two-dimensional data that is well known in the PR community. The VERI algorithm succeeded in clustering all the data correctly. No existing algorithm had previously clustered all the pattens in the data set successfully. The commands to execute VERI algorithms are quite difficult to master when executed from a DOS command line. The algorithm requires several parameters to operate correctly. From our own experiences we realized that if we wanted to provide a new data analysis tool to the PR community we would have to provide a new data analysis tool to the PR community we would have to make the tool powerful, yet easy and intuitive to use. That was our motivation for developing graphical user interfaces (GUI's) to the VERI algorithms. We developed GUI's to control the VERI algorithm in a single pass mode and in an optimization mode. We also developed a visualization technique that allows users to graphically animate and visually inspect multi-dimensional data after it has been classified by the VERI algorithms. The visualization technique that allows users to graphically animate and visually inspect multi-dimensional data after it has been classified by the VERI algorithms. The visualization package is integrated into the single pass interface. Both the single pass interface and optimization interface are part of the PR software package we have developed and make available to other users. The single pass mode only finds PR results for the sets of features in the data set that are manually requested by the user. The optimization model uses a brute force method of searching through the cominations of features in a data set for features that produce the best pattern recognition results. With a small number of features in a data set an exact solution can be determined. However, the number of possible combinations increases exponentially with the number of features and an alternate means of finding a solution must be found. We developed and implemented a technique for finding solutions in data sets with both small and large numbers of features. The VERI interface tools were written using the Tcl/Tk GUI programming language, version 8.1. Although the Tcl/Tk packages are designed to run on multiple computer platforms, we have concentrated our efforts to develop a user interface for the ubiquitous DOS environment. The VERI algorithms are compiled, executable programs. The interfaces run the VERI algorithms in Leave-One-Out mode using the Euclidean metric.

  12. Visual Empirical Region of Influence (VERI) Pattern Recognition Algorithms

    Energy Science and Technology Software Center (OSTI)

    2002-05-01

    We developed new pattern recognition (PR) algorithms based on a human visual perception model. We named these algorithms Visual Empirical Region of Influence (VERI) algorithms. To compare the new algorithm's effectiveness against othe PR algorithms, we benchmarked their clustering capabilities with a standard set of two-dimensional data that is well known in the PR community. The VERI algorithm succeeded in clustering all the data correctly. No existing algorithm had previously clustered all the pattens inmore » the data set successfully. The commands to execute VERI algorithms are quite difficult to master when executed from a DOS command line. The algorithm requires several parameters to operate correctly. From our own experiences we realized that if we wanted to provide a new data analysis tool to the PR community we would have to provide a new data analysis tool to the PR community we would have to make the tool powerful, yet easy and intuitive to use. That was our motivation for developing graphical user interfaces (GUI's) to the VERI algorithms. We developed GUI's to control the VERI algorithm in a single pass mode and in an optimization mode. We also developed a visualization technique that allows users to graphically animate and visually inspect multi-dimensional data after it has been classified by the VERI algorithms. The visualization technique that allows users to graphically animate and visually inspect multi-dimensional data after it has been classified by the VERI algorithms. The visualization package is integrated into the single pass interface. Both the single pass interface and optimization interface are part of the PR software package we have developed and make available to other users. The single pass mode only finds PR results for the sets of features in the data set that are manually requested by the user. The optimization model uses a brute force method of searching through the cominations of features in a data set for features that produce the best pattern recognition results. With a small number of features in a data set an exact solution can be determined. However, the number of possible combinations increases exponentially with the number of features and an alternate means of finding a solution must be found. We developed and implemented a technique for finding solutions in data sets with both small and large numbers of features. The VERI interface tools were written using the Tcl/Tk GUI programming language, version 8.1. Although the Tcl/Tk packages are designed to run on multiple computer platforms, we have concentrated our efforts to develop a user interface for the ubiquitous DOS environment. The VERI algorithms are compiled, executable programs. The interfaces run the VERI algorithms in Leave-One-Out mode using the Euclidean metric.« less

  13. Process for decomposing lignin in biomass

    DOE Patents [OSTI]

    Rector, Kirk Davin; Lucas, Marcel; Wagner, Gregory Lawrence; Kimball, David Bryan; Hanson, Susan Kloek

    2014-10-28

    A mild inexpensive process for treating lignocellulosic biomass involves oxidative delignification of wood using an aqueous solution prepared by dissolving a catalytic amount of manganese (III) acetate into water and adding hydrogen peroxide. Within 4 days and without agitation, the solution was used to convert poplar wood sections into a fine powder-like delignified, cellulose rich materials that included individual wood cells.

  14. Visualization Gallery from the Computational Research Division at Lawrence Berkeley National Laboratory

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    This excellent collection of visualization vignettes highlights research work done by the LBNL/NERSC Visualization Group and its collaborators from 1993 to the present. Images lead to technical explanations and project details, helping users to branch out to other related sources. Titles of the projects provide clues both to the imaging focus of the research and the scientific discipline for which the visualizations are intended. Only a few of the many titles/images/projects are listed here: 1) Hybrid Parallelism for Volume Rendering at Large Scale Analysis of Laser Wakefield Particle Acceleration Data; 2) Visualization of Microearthquake Data from Enhanced Geothermal Systems; 3) PointCloudXplore: Visualization and Analysis of 3D Gene Expression Data; 4) Visualization of Quantum Monte-Carlo simulations; 5) Global Cloud Resolving Models; 6) Visualization of large-scale GFDL/NOAA climate simulations; 7) Direct Numerical Simulation of Turbulent Flame Quenching by Fine Water Droplets; 8) Visualization of Magneto-rotational instability and turbulent angular momentum transport; 9) Sunfall: Visual Analytics for Astrophysics; 10) Fast Contour Descriptor Algorithm for Supernova Image Classification; 11) Supernova Recognition Using Support Vector Machines; 12) High Performance Visualization - Query-Driven Network Traffic Analysis; 13) Visualization of Magneto-rotational instability and turbulent angular momentum transport; 14) Life Sciences: Cell Division of Caulobacter Crescentus; 15) Electron Cloud Simulations.

  15. Interactive, Internet Delivery of Visualization via Structured,Prerendered multiresolution Imagery

    SciTech Connect (OSTI)

    Bethel, E. Wes; Yoon, Ilmi; Chen, Jerry

    2007-10-25

    One of the fundamental problems in remote visualization --where I/O and data intensive visualization activities take place at acentrally located supercomputer center and resulting imagery is deliveredto a remotely located user -- is reduced interactivity resulting from thecombination of high network latency and relatively low network bandwidth.This research project has produced a novel approach for latency-tolerantdelivery of visualization and rendering results where client-side framerate display performance is independent of source dataset size, imagesize, visualization technique or rendering complexity. As such, it is asuitable solution for remote visualization image delivery for anyvisualization or rendering application that can generate image frames inan ordered fashion. This new capability is suitable for use in addressingmany of ASCR s remote visualization needs, particularly deployment atopen computing facilities to provide remote visualization capabilities toteams of scientific researchers.

  16. Semantic Interaction for Visual Analytics: Toward Coupling Cognition and Computation

    SciTech Connect (OSTI)

    Endert, Alexander

    2014-07-01

    The dissertation discussed in this article [1] was written in the midst of an era of digitization. The world is becoming increasingly instrumented with sensors, monitoring, and other methods for generating data describing social, physical, and natural phenomena. Thus, data exist with the potential of being analyzed to uncover, or discover, the phenomena from which it was created. However, as the analytic models leveraged to analyze these data continue to increase in complexity and computational capability, how can visualizations and user interaction methodologies adapt and evolve to continue to foster discovery and sensemaking?

  17. Basic visual observation skills training course: Appendix B. Final report

    SciTech Connect (OSTI)

    Toquam, J.L.; Morris, F.A.; Griggs, J.R.

    1995-06-01

    The purpose of the basic visual observation skills course is to help safeguards inspectors evaluate and improve their skills in making observations during inspections and in evaluating and interpreting this information. The first 12 hours of the course provide training in five skill areas: perception and recognition; attention to detail; memory; mental imaging, mapping, and modeling skills; and judgment and decision making. Following this training is an integrating exercise involving a simulated safeguards inspection. This report contains the in-class exercises in the five skill areas; pre- and post-course exercises in closure, hidden figures, map memory, and mental rotations; the final examination; a training evaluation form; and the integrating exercise.

  18. Flow visualization study of the MOD-2 wind turbine wake

    SciTech Connect (OSTI)

    Liu H.T.; Waite, J.W.; Hiester, T.R.; Tacheron, P.H.; Srnsky, R.A.

    1983-06-01

    The specific objectives of the study reported were: to determine the geometry of the MOD-2 wind turbine wake in terms of wake height and width as a function of downstream distance under two conditions of atmospheric stability; to estimate the mean velocity deficit at several downstream stations in the turbine wake; and to investigate the behavior of the rotor-generated vortices, particularly their configuration and persistence. The background of the wake problem is briefly examined, including a discussion of the critical issues that the flow visualization study addresses. Experimental techniques and data analysis methods are described in detail. (LEW)

  19. A New Collaborative Tool for Visually Understanding National Health Indicators

    SciTech Connect (OSTI)

    Xu, Songhua; Jewell, Brian C; Steed, Chad A; Schryver, Jack C

    2012-01-01

    The authors propose a new online collaborative tool for visually understanding national health indicators, which facilitates the full spectrum of investigation of indicators, from an overview of all the correlation coefficients between variables, to investigation of subsets of selected variables, and to individual data element analysis. this tool is publicly accessible at http://cda.ornl.gov/heat/heatmap.html. In this paper, they discuss the key issues regarding the interface design and implementation. They also illustrate how to use their interface for analyzing the health indicator dataset by showing some key system views. In the end, they introduce and discuss some ongoing research efforts extending this work.

  20. Visualizing MCNP Tally Segment Geometry and Coupling Results with ABAQUS

    SciTech Connect (OSTI)

    J. R. Parry; J. A. Galbraith

    2007-11-01

    The Advanced Graphite Creep test, AGC-1, is planned for irradiation in the Advanced Test Reactor (ATR) in support of the Next Generation Nuclear Plant program. The experiment requires very detailed neutronics and thermal hydraulics analyses to show compliance with programmatic and ATR safety requirements. The MCNP model used for the neutronics analysis required hundreds of tally regions to provide the desired detail. A method for visualizing the hundreds of tally region geometries and the tally region results in 3 dimensions has been created to support the AGC-1 irradiation. Additionally, a method was created which would allow ABAQUS to access the results directly for the thermal analysis of the AGC-1 experiment.

  1. T.Rex Visual Analytics for Transactional Exploration

    ScienceCinema (OSTI)

    None

    2014-07-16

    T.Rex is PNNL's visual analytics tool that specializes in tabular structured data, like you might open with Excel. It's a client-server application, allowing the server to do a lot of the heavy lifting and the client to open spreadsheets with millions of rows. With datasets of that size, especially if you're unfamiliar with the contents, it's very hard to get a good grasp of what's in it using traditional tools. With T.Rex, the multiple views allow you to see categorical, temporal, numerical, relational, and summary data. The interactivity lets you look across your data and see how things relate to each other.

  2. Visual Sample Plan Version 7.0 User's Guide

    SciTech Connect (OSTI)

    Matzke, Brett D.; Newburn, Lisa LN; Hathaway, John E.; Bramer, Lisa M.; Wilson, John E.; Dowson, Scott T.; Sego, Landon H.; Pulsipher, Brent A.

    2014-03-01

    User's guide for VSP 7.0 This user's guide describes Visual Sample Plan (VSP) Version 7.0 and provides instructions for using the software. VSP selects the appropriate number and location of environmental samples to ensure that the results of statistical tests performed to provide input to risk decisions have the required confidence and performance. VSP Version 7.0 provides sample-size equations or algorithms needed by specific statistical tests appropriate for specific environmental sampling objectives. It also provides data quality assessment and statistical analysis functions to support evaluation of the data and determine whether the data support decisions regarding sites suspected of contamination. The easy-to-use program is highly visual and graphic. VSP runs on personal computers with Microsoft Windows operating systems (XP, Vista, Windows 7, and Windows 8). Designed primarily for project managers and users without expertise in statistics, VSP is applicable to two- and three-dimensional populations to be sampled (e.g., rooms and buildings, surface soil, a defined layer of subsurface soil, water bodies, and other similar applications) for studies of environmental quality. VSP is also applicable for designing sampling plans for assessing chem/rad/bio threat and hazard identification within rooms and buildings, and for designing geophysical surveys for unexploded ordnance (UXO) identification.

  3. Sort-First, Distributed Memory Parallel Visualization and Rendering

    SciTech Connect (OSTI)

    Bethel, E. Wes; Humphreys, Greg; Paul, Brian; Brederson, J. Dean

    2003-07-15

    While commodity computing and graphics hardware has increased in capacity and dropped in cost, it is still quite difficult to make effective use of such systems for general-purpose parallel visualization and graphics. We describe the results of a recent project that provides a software infrastructure suitable for general-purpose use by parallel visualization and graphics applications. Our work combines and extends two technologies: Chromium, a stream-oriented framework that implements the OpenGL programming interface; and OpenRM Scene Graph, a pipelined-parallel scene graph interface for graphics data management. Using this combination, we implement a sort-first, distributed memory, parallel volume rendering application. We describe the performance characteristics in terms of bandwidth requirements and highlight key algorithmic considerations needed to implement the sort-first system. We characterize system performance using a distributed memory parallel volume rendering application, a nd present performance gains realized by using scene specific knowledge to accelerate rendering through reduced network bandwidth. The contribution of this work is an exploration of general-purpose, sort-first architecture performance characteristics as applied to distributed memory, commodity hardware, along with a description of the algorithmic support needed to realize parallel, sort-first implementations.

  4. Coherent Image Layout using an Adaptive Visual Vocabulary

    SciTech Connect (OSTI)

    Dillard, Scott E.; Henry, Michael J.; Bohn, Shawn J.; Gosink, Luke J.

    2013-03-06

    When querying a huge image database containing millions of images, the result of the query may still contain many thousands of images that need to be presented to the user. We consider the problem of arranging such a large set of images into a visually coherent layout, one that places similar images next to each other. Image similarity is determined using a bag-of-features model, and the layout is constructed from a hierarchical clustering of the image set by mapping an in-order traversal of the hierarchy tree into a space-filling curve. This layout method provides strong locality guarantees so we are able to quantitatively evaluate performance using standard image retrieval benchmarks. Performance of the bag-of-features method is best when the vocabulary is learned on the image set being clustered. Because learning a large, discriminative vocabulary is a computationally demanding task, we present a novel method for efficiently adapting a generic visual vocabulary to a particular dataset. We evaluate our clustering and vocabulary adaptation methods on a variety of image datasets and show that adapting a generic vocabulary to a particular set of images improves performance on both hierarchical clustering and image retrieval tasks.

  5. Visualizing Diurnal Population Change in Urban Areas for Emergency Management

    SciTech Connect (OSTI)

    Kobayashi, Tetsuo; Medina, Richard M; Cova, Thomas

    2011-01-01

    There is an increasing need for a quick, simple method to represent diurnal population change in metropolitan areas for effective emergency management and risk analysis. Many geographic studies rely on decennial U.S. Census data that assume that urban populations are static in space and time. This has obvious limitations in the context of dynamic geographic problems. The U.S. Department of Transportation publishes population data at the transportation analysis zone level in fifteen-minute increments. This level of spatial and temporal detail allows for improved dynamic population modeling. This article presents a methodology for visualizing and analyzing diurnal population change for metropolitan areas based on this readily available data. Areal interpolation within a geographic information system is used to create twenty-four (one per hour) population surfaces for the larger metropolitan area of Salt Lake County, Utah. The resulting surfaces represent diurnal population change for an average workday and are easily combined to produce an animation that illustrates population dynamics throughout the day. A case study of using the method to visualize population distributions in an emergency management context is provided using two scenarios: a chemical release and a dirty bomb in Salt Lake County. This methodology can be used to address a wide variety of problems in emergency management.

  6. Perm Web: remote parallel and distributed volume visualization

    SciTech Connect (OSTI)

    Wittenbrink, C.M.; Kim, K.; Story, J.; Pang, A.; Hollerbach, K.; Max, N.

    1997-01-01

    In this paper we present a system for visualizing volume data from remote supercomputers (PermWeb). We have developed both parallel volume rendering algorithms, and the World Wide Web software for accessing the data at the remote sites. The implementation uses Hypertext Markup Language (HTML), Java, and Common Gateway Interface (CGI) scripts to connect World Wide Web (WWW) servers/clients to our volume renderers. The front ends are interactive Java classes for specification of view, shading, and classification inputs. We present performance results, and implementation details for connections to our computing resources at the University of California Santa Cruz including a MasPar MP-2, SGI Reality Engine-RE2, and SGI Challenge machines. We apply the system to the task of visualizing trabecular bone from finite element simulations. Fast volume rendering on remote compute servers through a web interface allows us to increase the accessibility of the results to more users. User interface issues, overviews of parallel algorithm developments, and overall system interfaces and protocols are presented. Access is available through Uniform Resource Locator (URL) http://www.cse.ucsc.edu/research/slvg/. 26 refs., 7 figs.

  7. Web-Based Visual Analytics for Social Media

    SciTech Connect (OSTI)

    Best, Daniel M.; Bruce, Joseph R.; Dowson, Scott T.; Love, Oriana J.; McGrath, Liam R.

    2012-05-20

    Social media provides a rich source of data that reflects current trends and public opinion on a multitude of topics. The data can be harvested from Twitter, Facebook, Blogs, and other social applications. The high rate of adoption of social media has created a domain that has an ever expanding volume of data that make it difficult to use the raw data for analysis. Information visual analytics is key in drawing out features of interest in social media. The Scalable Reasoning System is an application that couples a back end server performing analysis algorithms and an intuitive front end visualization to allow for investigation. We provide a componentized system that can be rapidly adapted to customer needs such that the information they are most interested in is brought to their attention through the application. To this end, we have developed a social media application for use by emergency operations for the city of Seattle to show current weather and traffic trends which is important for their tasks.

  8. Advanced 3D Sensing and Visualization System for Unattended Monitoring

    SciTech Connect (OSTI)

    Carlson, J.J.; Little, C.Q.; Nelson, C.L.

    1999-01-01

    The purpose of this project was to create a reliable, 3D sensing and visualization system for unattended monitoring. The system provides benefits for several of Sandia's initiatives including nonproliferation, treaty verification, national security and critical infrastructure surety. The robust qualities of the system make it suitable for both interior and exterior monitoring applications. The 3D sensing system combines two existing sensor technologies in a new way to continuously maintain accurate 3D models of both static and dynamic components of monitored areas (e.g., portions of buildings, roads, and secured perimeters in addition to real-time estimates of the shape, location, and motion of humans and moving objects). A key strength of this system is the ability to monitor simultaneous activities on a continuous basis, such as several humans working independently within a controlled workspace, while also detecting unauthorized entry into the workspace. Data from the sensing system is used to identi~ activities or conditions that can signi~ potential surety (safety, security, and reliability) threats. The system could alert a security operator of potential threats or could be used to cue other detection, inspection or warning systems. An interactive, Web-based, 3D visualization capability was also developed using the Virtual Reality Modeling Language (VRML). The intex%ace allows remote, interactive inspection of a monitored area (via the Internet or Satellite Links) using a 3D computer model of the area that is rendered from actual sensor data.

  9. Geospatial Visualization of Global Satellite Images with Vis-EROS

    SciTech Connect (OSTI)

    Standart, G. D.; Stulken, K. R.; Zhang, Xuesong; Zong, Ziliang

    2011-04-13

    The Earth Resources Observation and Science (EROS) Center of U.S. Geological Survey is currently managing and maintaining the world largest satellite images distribution system, which provides 24/7 free download service for researchers all over the globe in many areas such as Geology, Hydrology, Climate Modeling, and Earth Sciences. A large amount of geospatial data contained in satellite images maintained by EROS is generated every day. However, this data is not well utilized due to the lack of efficient data visualization tools. This software implements a method for visualizing various characteristics of the global satellite image download requests. More specifically, Keyhole Markup Language (KML) files are generated which can be loaded into an earth browser such as Google Earth. Colored rectangles associated with stored satellite scenes are painted onto the earth browser; and the color and opacity of each rectangle is varied as a function of the popularity of the corresponding satellite image. An analysis of the geospatial information obtained relative to specified time constraints provides an ability to relate image download requests to environmental, political, and social events.

  10. Interaction and Coalescence of Nanovoids and Dynamic Fracture...

    Office of Scientific and Technical Information (OSTI)

    DOE Contract Number: W-7405-ENG-48 Resource Type: Journal Article Resource Relation: Journal Name: Journal of Physics D: Applied Physics, vol. 42, no. 21, November 1, 2009, pp. ...

  11. Interaction and Coalescence of Nanovoids and Dynamic Fracture...

    Office of Scientific and Technical Information (OSTI)

    of Nanovoids and Dynamic Fracture in Silica Glass: Multimiilion-to-Billion Atom Molecular Dynamics Simulations Citation Details In-Document Search Title: Interaction and...

  12. Coalescence and Chemical Equilibrium in Multifragmentation at Intermediate Energies, T

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Coal to Liquids Coal to Liquids Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Located in Charleston, WV, the Yeager facility was constructed and operated with support from the Office of Fossil Energy’s National Energy Technology Laboratory. Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Located in

  13. Hydrodynamic effects on coalescence. (Technical Report) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Authors: Dimiduk, Thomas G. ; Bourdon, Christopher Jay ; Grillet, Anne Mary ; Baer, Thomas A. ; de Boer, Maarten Pieter ; Loewenberg, Michael 1 ; Gorby, Allen D. ; Brooks, ...

  14. The island coalescence problem: Scaling of reconnection in extended...

    Office of Scientific and Technical Information (OSTI)

    Alamos, New Mexico 87545, USA Space Science Center and Physics Department, University of New Hampshire, Durham, New Hampshire 03824, USA Publication Date: 2015-11-01 OSTI...

  15. Visualizing Energy Infrastructure Exposure to Storm Surge and Sea-Level

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Rise | Department of Energy Visualizing Energy Infrastructure Exposure to Storm Surge and Sea-Level Rise Visualizing Energy Infrastructure Exposure to Storm Surge and Sea-Level Rise November 2, 2015 - 11:10am Addthis Alice Lippert Alice Lippert Senior Technical Advisor to the Deputy Assistant Secretary of Energy Infrastructure Modeling and Analysis The Office of Electricity Delivery and Energy Reliability (OE) recently released an innovative, interactive visualization tool to highlight the

  16. Microsoft Word - DOE-ID-14-085 Visual Aids for a Customer B3...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    5 SECTION A. Project Title: Visual Aids for a Customer SECTION B. Project Description The manufacturer will construct two mockup reactor assemblies out of stainless steel to be...

  17. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    As a result, it is critical to have a tool to facilitate the quantitative visualization of differences between transcription factors and the genomic regions they bind to understand ...

  18. OpenGl Visualization Tool and Library Version: 1.0

    Energy Science and Technology Software Center (OSTI)

    2010-06-22

    GLVis is an OpenGL tool for visualization of finite element meshes and functions. When started without any options, GLVis starts a server, which waits for a socket connections and visualizes any recieved data. This way the results of simulations on a remote (parallel) machine can be visualized on the lical user desktop. GLVis can also be used to visualize a mesh with or without a finite element function (solution). It can run a batch sequencemore » of commands (GLVis scripts), or display previously saved socket streams.« less

  19. Highly parallel vector visualization using line integral convolution

    SciTech Connect (OSTI)

    Cabral, B.; Leedom, C.

    1995-12-01

    Line Integral Convolution (LIC) is an effective imaging operator for visualizing large vector fields. It works by blurring an input image along local vector field streamlines yielding an output image. LIC is highly parallelizable because it uses only local read-sharing of input data and no write-sharing of output data. Both coarse- and fine-grained implementations have been developed. The coarse-grained implementation uses a straightforward row-tiling of the vector field to parcel out work to multiple CPUs. The fine-grained implementation uses a series of image warps and sums to compute the LIC algorithm across the entire vector field at once. This is accomplished by novel use of high-performance graphics hardware texture mapping and accumulation buffers.

  20. Remote visual inspection for NDE in power plants

    SciTech Connect (OSTI)

    Samsonov, P. )

    1993-06-01

    Remote visual inspection equipment such as borescopes, and video scopes give power plant nondestructive examination (NDE) groups the necessary tools to establish superior corrective and preventive plant maintenance programs. These scopes allow the user to evaluate the condition of pipes, boilers, turbines, heat exchangers, and other critical machinery without costly and time-consuming disassembly. Overall plant efficiency is increased and the likelihood of catastrophic failure is reduced significantly. Insertion diameters vary from 0.6 mm to 20 mm and come in lengths of just a few inches to as long as 100 ft. (30 m). Ancillary equipment such as video and digital processors provides a permanent record of the inspection and uses sophisticated three-dimensional (3-D) measurement, trend analysis, documentation, and image manipulation.

  1. Visualizing 3D velocity fields near contour surfaces. Revision 1

    SciTech Connect (OSTI)

    Max, N.; Crawfis, R.; Grant, C.

    1994-08-08

    Vector field rendering is difficult in 3D because the vector icons overlap and hide each other. We propose four different techniques for visualizing vector fields only near surfaces. The first uses motion blurred particles in a thickened region around the surface. The second uses a voxel grid to contain integral curves of the vector field. The third uses many antialiased lines through the surface, and the fourth uses hairs sprouting from the surface and then bending in the direction of the vector field. All the methods use the graphics pipeline, allowing real time rotation and interaction, and the first two methods can animate the texture to move in the flow determined by the velocity field.

  2. Human alteration of the rural landscape: Variations in visual perception

    SciTech Connect (OSTI)

    Cloquell-Ballester, Vicente-Agustin Carmen Torres-Sibille, Ana del; Cloquell-Ballester, Victor-Andres; Santamarina-Siurana, Maria Cristina

    2012-01-15

    The objective of this investigation is to evaluate how visual perception varies as the rural landscape is altered by human interventions of varying character. An experiment is carried out using Semantic Differential Analysis to analyse the effect of the character and the type of the intervention on perception. Interventions are divided into elements of 'permanent industrial character', 'elements of permanent rural character' and 'elements of temporary character', and these categories are sub-divided into smaller groups according to the type of development. To increase the reliability of the results, the Intraclass Correlation Coefficient tool, is applied to validate the semantic space of the perceptual responses and to determine the number of subjects required for a reliable evaluation of the scenes.

  3. Final Report for "Analyzing and visualizing next generation climate data"

    SciTech Connect (OSTI)

    Pletzer, Alexander

    2012-11-13

    The project "Analyzing and visualizing next generation climate data" adds block-structured (mosaic) grid support, parallel processing, and 2D/3D curvilinear interpolation to the open-source UV-CDAT climate data analysis tool. Block structured grid support complies to the Gridspec extension submitted to the Climate and Forecast metadata conventions. It contains two parts: aggregation of data spread over multiple mosaic tiles (M-SPEC) and aggregation of temporal data stored in different files (F-SPEC). Together, M-SPEC and F-SPEC allow users to interact with data stored in multiple files as if the data were in a single file. For computational expensive tasks, a flexible, multi-dimensional, multi-type distributed array class allows users to process data in parallel using remote memory access. Both nodal and cell based interpolation is supported; users can choose between different interpolation libraries including ESMF and LibCF depending on the their particular needs.

  4. Wide-area, real-time monitoring and visualization system

    DOE Patents [OSTI]

    Budhraja, Vikram S.; Dyer, James D.; Martinez Morales, Carlos A.

    2011-11-15

    A real-time performance monitoring system for monitoring an electric power grid. The electric power grid has a plurality of grid portions, each grid portion corresponding to one of a plurality of control areas. The real-time performance monitoring system includes a monitor computer for monitoring at least one of reliability metrics, generation metrics, transmission metrics, suppliers metrics, grid infrastructure security metrics, and markets metrics for the electric power grid. The data for metrics being monitored by the monitor computer are stored in a data base, and a visualization of the metrics is displayed on at least one display computer having a monitor. The at least one display computer in one said control area enables an operator to monitor the grid portion corresponding to a different said control area.

  5. Wide-area, real-time monitoring and visualization system

    DOE Patents [OSTI]

    Budhraja, Vikram S.; Dyer, James D.; Martinez Morales, Carlos A.

    2013-03-19

    A real-time performance monitoring system for monitoring an electric power grid. The electric power grid has a plurality of grid portions, each grid portion corresponding to one of a plurality of control areas. The real-time performance monitoring system includes a monitor computer for monitoring at least one of reliability metrics, generation metrics, transmission metrics, suppliers metrics, grid infrastructure security metrics, and markets metrics for the electric power grid. The data for metrics being monitored by the monitor computer are stored in a data base, and a visualization of the metrics is displayed on at least one display computer having a monitor. The at least one display computer in one said control area enables an operator to monitor the grid portion corresponding to a different said control area.

  6. Visualization and analysis of eddies in a global ocean simulation

    SciTech Connect (OSTI)

    Williams, Sean J; Hecht, Matthew W; Petersen, Mark; Strelitz, Richard; Maltrud, Mathew E; Ahrens, James P; Hlawitschka, Mario; Hamann, Bernd

    2010-10-15

    Eddies at a scale of approximately one hundred kilometers have been shown to be surprisingly important to understanding large-scale transport of heat and nutrients in the ocean. Due to difficulties in observing the ocean directly, the behavior of eddies below the surface is not very well understood. To fill this gap, we employ a high-resolution simulation of the ocean developed at Los Alamos National Laboratory. Using large-scale parallel visualization and analysis tools, we produce three-dimensional images of ocean eddies, and also generate a census of eddy distribution and shape averaged over multiple simulation time steps, resulting in a world map of eddy characteristics. As expected from observational studies, our census reveals a higher concentration of eddies at the mid-latitudes than the equator. Our analysis further shows that mid-latitude eddies are thicker, within a range of 1000-2000m, while equatorial eddies are less than 100m thick.

  7. Interactive Visual Analysis of High Throughput Text Streams

    SciTech Connect (OSTI)

    Steed, Chad A; Potok, Thomas E; Patton, Robert M; Goodall, John R; Maness, Christopher S; Senter, James K

    2012-01-01

    The scale, velocity, and dynamic nature of large scale social media systems like Twitter demand a new set of visual analytics techniques that support near real-time situational awareness. Social media systems are credited with escalating social protest during recent large scale riots. Virtual communities form rapidly in these online systems, and they occasionally foster violence and unrest which is conveyed in the users language. Techniques for analyzing broad trends over these networks or reconstructing conversations within small groups have been demonstrated in recent years, but state-of- the-art tools are inadequate at supporting near real-time analysis of these high throughput streams of unstructured information. In this paper, we present an adaptive system to discover and interactively explore these virtual networks, as well as detect sentiment, highlight change, and discover spatio- temporal patterns.

  8. Visualization of Charge Distribution in a Lithium Battery Electrode

    SciTech Connect (OSTI)

    Liu, Jun; Kunz, Martin; Chen, Kai; Tamura, Nobumichi; Richardson, Thomas J.

    2010-07-02

    We describe a method for direct determination and visualization of the distribution of charge in a composite electrode. Using synchrotron X-ray microdiffraction, state-of-charge profiles in-plane and normal to the current collector were measured. In electrodes charged at high rate, the signatures of nonuniform current distribution were evident. The portion of a prismatic cell electrode closest to the current collector tab had the highest state of charge due to electronic resistance in the composite electrode and supporting foil. In a coin cell electrode, the active material at the electrode surface was more fully charged than that close to the current collector because the limiting factor in this case is ion conduction in the electrolyte contained within the porous electrode.

  9. Case Study: The ''Office of Real Soon Now'' for Visualization

    SciTech Connect (OSTI)

    Uselton, S.P.

    2002-03-27

    A variation on the ''Office of Real Soon Now'' has been designed and deployed at Lawrence Livermore National Laboratory (LLNL). The ASCI VIEWS (VIEWS) program [1], the element of the program developing tools for data management and visualization, is investigating a variety of display technologies, motivated in part by the large size, high resolution, and complexity of data sets that ASCI users frequently explore and analyze. While large, tiled displays have been well received at LLNL, availability and ease-of-use problems have motivated exploration of alternatives [2]. The ''Office of Real Soon Now'' Project [3, 4, 5] at the University of North Carolina at Chapel Hill (UNC) has built ''low fidelity'' versions of the ''Office of the Future'' [6, 7] that can be installed in users' offices now. At UNC, the Office of Real Soon Now installations use only a small number of relatively inexpensive projectors,generally two or three, that limit resolution and features. These projectors are connected to Microsoft Windows PCs or Apple computers that are used for daily activities, such as reading email, writing papers, and debugging programs. Even though the UNC faculty involved are predominantly computer graphics researchers, these display systems are used mainly for text-oriented applications [5]. Designing, developing, and deploying an office-based system at LLNL would provide opportunities to adapt the system to our specific uses and to evaluate such systems for a range of tasks beyond those typically found at UNC. The goals of the LLNL display system are to exceed previous UNC versions in resolution, to run Unix-based applications, and to support interactive visualization of simulation data better than can be done via current workstations and monitors.

  10. Computer systems and methods for the query and visualization of multidimensional databases

    DOE Patents [OSTI]

    Stolte, Chris; Tang, Diane L.; Hanrahan, Patrick

    2015-11-10

    A computer displays a graphical user interface on its display. The graphical user interface includes a schema information region and a data visualization region. The schema information region includes a plurality of fields of a multi-dimensional database that includes at least one data hierarchy. The data visualization region includes a columns shelf and a rows shelf. The computer detects user actions to associate one or more first fields with the columns shelf and to associate one or more second fields with the rows shelf. The computer generates a visual table in the data visualization region in accordance with the user actions. The visual table includes one or more panes. Each pane has an x-axis defined based on data for the one or more first fields, and each pane has a y-axis defined based on data for the one or more second fields.

  11. Computer systems and methods for the query and visualization of multidimensional databases

    DOE Patents [OSTI]

    Stolte, Chris; Tang, Diane L.; Hanrahan, Patrick

    2012-03-20

    In response to a user request, a computer generates a graphical user interface on a computer display. A schema information region of the graphical user interface includes multiple operand names, each operand name associated with one or more fields of a multi-dimensional database. A data visualization region of the graphical user interface includes multiple shelves. Upon detecting a user selection of the operand names and a user request to associate each user-selected operand name with a respective shelf in the data visualization region, the computer generates a visual table in the data visualization region in accordance with the associations between the operand names and the corresponding shelves. The visual table includes a plurality of panes, each pane having at least one axis defined based on data for the fields associated with a respective operand name.

  12. Computer systems and methods for the query and visualization of multidimensional databases

    DOE Patents [OSTI]

    Stolte, Chris; Tang, Diane L.; Hanrahan, Patrick

    2011-02-01

    In response to a user request, a computer generates a graphical user interface on a computer display. A schema information region of the graphical user interface includes multiple operand names, each operand name associated with one or more fields of a multi-dimensional database. A data visualization region of the graphical user interface includes multiple shelves. Upon detecting a user selection of the operand names and a user request to associate each user-selected operand name with a respective shelf in the data visualization region, the computer generates a visual table in the data visualization region in accordance with the associations between the operand names and the corresponding shelves. The visual table includes a plurality of panes, each pane having at least one axis defined based on data for the fields associated with a respective operand name.

  13. Computer systems and methods for the query and visualization of multidimensional databases

    DOE Patents [OSTI]

    Stolte, Chris; Tang, Diane L; Hanrahan, Patrick

    2015-03-03

    A computer displays a graphical user interface on its display. The graphical user interface includes a schema information region and a data visualization region. The schema information region includes multiple operand names, each operand corresponding to one or more fields of a multi-dimensional database that includes at least one data hierarchy. The data visualization region includes a columns shelf and a rows shelf. The computer detects user actions to associate one or more first operands with the columns shelf and to associate one or more second operands with the rows shelf. The computer generates a visual table in the data visualization region in accordance with the user actions. The visual table includes one or more panes. Each pane has an x-axis defined based on data for the one or more first operands, and each pane has a y-axis defined based on data for the one or more second operands.

  14. Computer systems and methods for the query and visualization of multidimensional databases

    DOE Patents [OSTI]

    Stolte, Chris; Tang, Diane L; Hanrahan, Patrick

    2014-04-29

    In response to a user request, a computer generates a graphical user interface on a computer display. A schema information region of the graphical user interface includes multiple operand names, each operand name associated with one or more fields of a multi-dimensional database. A data visualization region of the graphical user interface includes multiple shelves. Upon detecting a user selection of the operand names and a user request to associate each user-selected operand name with a respective shelf in the data visualization region, the computer generates a visual table in the data visualization region in accordance with the associations between the operand names and the corresponding shelves. The visual table includes a plurality of panes, each pane having at least one axis defined based on data for the fields associated with a respective operand name.

  15. A 3D Vector/Scalar Visualization and Particle Tracking Package

    Energy Science and Technology Software Center (OSTI)

    1999-08-19

    BOILERMAKER is an interactive visualization system consisting of three components: a visualization component, a particle tracking component, and a communication layer. The software, to date, has been used primarily in the visualization of vector and scalar fields associated with computational fluid dynamics (CFD) models of flue gas flows in industrial boilers and incinerators. Users can interactively request and toggle static vector fields, dynamic streamlines, and flowing vector fields. In addition, the user can interactively placemore » injector nozzles on boiler walls and visualize massed, evaporating sprays emanating from them. Some characteristics of the spray can be adjusted from within the visualization environment including spray shape and particle size. Also included with this release is software that supports 3D menu capabilities, scrollbars, communication and navigation.« less

  16. An Assessment of Remote Visual Testing System Capabilities for the Detection of Service Induced Cracking

    SciTech Connect (OSTI)

    Anderson, Michael T.; Cumblidge, Stephen E.; Doctor, Steven R.

    2005-09-01

    Remote visual testing is typically employed to ascertain the condition of materials in components that are inaccessible for direct examination. In the power and petrochemical industries, remote visual testing is used to assess whether service-related degradation is being manifested that, if left unchecked, may eventually impair the structural reliability of a component. Several codes and standards require that visual examinations be periodically conducted. Many of these inspections must be performed remotely due to harsh environments or design geometries of the subject components. This paper describes the attributes and limitations of remote visual testing, performance demonstration standards for camera systems, typical dimensions for service-induced cracking phenomena, and an assessment of the reliability of remote video camera systems at finding cracks. Because many forms of service-induced cracks have very small crack opening dimensions, the reliability of remote visual testing may not be adequate to ensure component integrity, given the capabilities of current camera systems and application practices.

  17. Different understanding: science through the eyes of visual thinkers

    SciTech Connect (OSTI)

    Sesko, S.C.; Marchant, M.

    1997-09-11

    The objective of this emergent study was to follow the cognitive and creative processes demonstrated by five art student participants as they integrated a developing knowledge of big science, as practiced at the Department of Energy`s Lawrence Livermore National Laboratory, into a personal and idiosyncratic visual, graphical, or multimedia product. The non-scientist participants involved in this process attended design classes sponsored by the Laboratory at the Art Center College of Design in California. The learning experience itself, and how the students arrived at their product, were the focus of the class and the research. The study was emergent in that we found no applicable literature on the use of art to portray a cognitive understanding of science. This lack of literature led us to the foundation literature on creativity and to the corpus of literature on public understanding of science. We believe that this study contributes to the literature on science education, art education, cognitive change, and public understanding of science. 20 refs., 11 figs.

  18. Visualization for Hyper-Heuristics: Back-End Processing

    SciTech Connect (OSTI)

    Simon, Luke

    2015-03-01

    Modern society is faced with increasingly complex problems, many of which can be formulated as generate-and-test optimization problems. Yet, general-purpose optimization algorithms may sometimes require too much computational time. In these instances, hyperheuristics may be used. Hyper-heuristics automate the design of algorithms to create a custom algorithm for a particular scenario, finding the solution significantly faster than its predecessor. However, it may be difficult to understand exactly how a design was derived and why it should be trusted. This project aims to address these issues by creating an easy-to-use graphical user interface (GUI) for hyper-heuristics and an easy-to-understand scientific visualization for the produced solutions. To support the development of this GUI, my portion of the research involved developing algorithms that would allow for parsing of the data produced by the hyper-heuristics. This data would then be sent to the front-end, where it would be displayed to the end user.

  19. Visualizing Safeguards: Software for Conceptualizing and Communicating Safeguards Data

    SciTech Connect (OSTI)

    Gallucci, N.

    2015-07-12

    The nuclear programs of states are complex and varied, comprising a wide range of fuel cycles and facilities. Also varied are the types and terms of states’ safeguards agreements with the IAEA, each placing different limits on the inspectorate’s access to these facilities. Such nuances make it difficult to draw policy significance from the ground-level nuclear activities of states, or to attribute ground-level outcomes to the implementation of specific policies or initiatives. While acquiring a firm understanding of these relationships is critical to evaluating and formulating effective policy, doing so requires collecting and synthesizing large bodies of information. Maintaining a comprehensive working knowledge of the facilities comprising even a single state’s nuclear program poses a challenge, yet marrying this information with relevant safeguards and verification information is more challenging still. To facilitate this task, Brookhaven National Laboratory has developed a means of capturing the development, operation, and safeguards history of all the facilities comprising a state’s nuclear program in a single graphic. The resulting visualization offers a useful reference tool to policymakers and analysts alike, providing a chronology of states’ nuclear development and an easily digestible history of verification activities across their fuel cycles.

  20. Monitoring external beam radiotherapy using real-time beam visualization

    SciTech Connect (OSTI)

    Jenkins, Cesare H.; Naczynski, Dominik J.; Yu, Shu-Jung S.; Xing, Lei

    2015-01-15

    Purpose: To characterize the performance of a novel radiation therapy monitoring technique that utilizes a flexible scintillating film, common optical detectors, and image processing algorithms for real-time beam visualization (RT-BV). Methods: Scintillating films were formed by mixing Gd{sub 2}O{sub 2}S:Tb (GOS) with silicone and casting the mixture at room temperature. The films were placed in the path of therapeutic beams generated by medical linear accelerators (LINAC). The emitted light was subsequently captured using a CMOS digital camera. Image processing algorithms were used to extract the intensity, shape, and location of the radiation field at various beam energies, dose rates, and collimator locations. The measurement results were compared with known collimator settings to validate the performance of the imaging system. Results: The RT-BV system achieved a sufficient contrast-to-noise ratio to enable real-time monitoring of the LINAC beam at 20 fps with normal ambient lighting in the LINAC room. The RT-BV system successfully identified collimator movements with sub-millimeter resolution. Conclusions: The RT-BV system is capable of localizing radiation therapy beams with sub-millimeter precision and tracking beam movement at video-rate exposure.

  1. Experiments at Scale with In-Situ Visualization Using ParaView/Catalyst in RAGE

    SciTech Connect (OSTI)

    Kares, Robert John

    2014-10-31

    In this paper I describe some numerical experiments performed using the ParaView/Catalyst in-situ visualization infrastructure deployed in the Los Alamos RAGE radiation-hydrodynamics code to produce images from a running large scale 3D ICF simulation on the Cielo supercomputer at Los Alamos. The detailed procedures for the creation of the visualizations using ParaView/Catalyst are discussed and several images sequences from the ICF simulation problem produced with the in-situ method are presented. My impressions and conclusions concerning the use of the in-situ visualization method in RAGE are discussed.

  2. Webinar March 14: DetecTape - A Localized Visual Detector for Hydrogen

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Leaks | Department of Energy March 14: DetecTape - A Localized Visual Detector for Hydrogen Leaks Webinar March 14: DetecTape - A Localized Visual Detector for Hydrogen Leaks March 7, 2016 - 11:35am Addthis The Energy Department will present a live webinar titled "DetecTape - A Localized Visual Detector for Hydrogen Leaks" on Monday, March 14, from 12 to 1 p.m. Eastern Daylight Time. DetecTape is a color-changing, self-fusing silicone tape designed to detect hydrogen gas (H2) leaks

  3. Performance, power, and energy of in-situ and post-processing visualization

    SciTech Connect (OSTI)

    Adhinarayanan, Vignesh

    2015-10-05

    The goal of this project was to "study the performance, power, and energy trade-offs among traditional post-processing, modern post-processing, and in-situ visualization pipelines."

  4. Visualizations, Screen Shots, and Data Input Files from VisIT

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    VisIt is a free interactive parallel visualization and graphical analysis tool for viewing scientific data on Unix and PC platforms. Users can quickly generate visualizations from their data, animate them through time, manipulate them, and save the resulting images for presentations. VisIt contains a rich set of visualization features so that you can view your data in a variety of ways. It can be used to visualize scalar and vector fields defined on two- and three-dimensional (2D and 3D) structured and unstructured meshes. VisIt was designed to handle very large data set sizes in the terascale range and yet can also handle small data sets in the kilobyte range. The VisIT website provides a gallery of vizualizations, another set of screen shots, and allows downloads of data files for input and source codes and executables for the VisIT software suite.

  5. vtkPNetCDFPOPReader: a new C++ class for Visualization Toolkit (VTK)

    Energy Science and Technology Software Center (OSTI)

    2011-08-03

    VTK is a software library used for scientific visualization tasks. My specific contribution is a new class that improves the I/O performance when reading certain input files.

  6. DetecTape – A Localized Visual Detector for Hydrogen Leaks Webinar

    Broader source: Energy.gov [DOE]

    Access the recording and download the presentation slides from the Fuel Cell Technologies Office webinar "DetecTape – A Localized Visual Detector for Hydrogen Leaks" held on March 14, 2016.

  7. Building Technologies Program: Tax Deduction Qualified Software- VisualDOE version 4.1 build 0002

    Broader source: Energy.gov [DOE]

    Provides required documentation that VisualDOE version 4.1 build 0002 meets Internal Revenue Code §179D, Notice 2006-52, dated June 2, 2006, for calculating commercial building energy and power cost savings.

  8. A Five-dimensional Visualization of the Pressure-induced Phase...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    A Five-dimensional Visualization of the Pressure-induced Phase Transition in BiNiO3 Friday, February 28, 2014 Figure 1. Illustration of the nanoscopic study of a BiNiO3 particle...

  9. Corridor One: An Integrated Distance Visualization Environment for SSI and ASCI Applications

    SciTech Connect (OSTI)

    Rick Stevens; Jason Leigh

    2002-07-14

    Scenarios describe realistic uses of DVC/Distance technologies in several years. Four scenarios are described: Distributed Decision Making; Remote Interactive Computing; Remote Visualization: (a) Remote Immersive Visualization and (b) Remote Scientific Visualization; Remote Virtual Prototyping. Scenarios serve as drivers for the road maps and enable us to check that the functionality and technology in the road maps match application needs. There are four major DVC/Distance technology areas we cover: Networking and QoS; Remote Computing; Remote Visualization; Remote Data. Each ??road map? consists of two parts, a ??functionality? matrix (what can be done) and a ??technology? matrix (underlying technology). That is, functionality matrices show the desired operational characteristics, while technology matrices show the underlying technology needed. In practice, there isn??t always a clean break between ??functionality? and ??technology,? but it still seems useful to try and separate things this way.

  10. Webinar: DetecTape – A Localized Visual Detector for Hydrogen Leaks

    Broader source: Energy.gov [DOE]

    The Energy Department will present a live webinar titled "DetecTape – A Localized Visual Detector for Hydrogen Leaks" on Monday, March 14, from 12 to 1 p.m. Eastern Daylight Time.

  11. Modification to the Monte Carlo N-Particle (MCNP) Visual Editor...

    Office of Scientific and Technical Information (OSTI)

    of the MCNP Visual Editor to allow it to read in both 2D and 3D Computer Aided Design (CAD) files, allowing the user to electronically generate a valid MCNP input geometry. ...

  12. RVA. 3-D Visualization and Analysis Software to Support Management of Oil and Gas Resources

    SciTech Connect (OSTI)

    Keefer, Donald A.; Shaffer, Eric G.; Storsved, Brynne; Vanmoer, Mark; Angrave, Lawrence; Damico, James R.; Grigsby, Nathan

    2015-12-01

    A free software application, RVA, has been developed as a plugin to the US DOE-funded ParaView visualization package, to provide support in the visualization and analysis of complex reservoirs being managed using multi-fluid EOR techniques. RVA, for Reservoir Visualization and Analysis, was developed as an open-source plugin to the 64 bit Windows version of ParaView 3.14. RVA was developed at the University of Illinois at Urbana-Champaign, with contributions from the Illinois State Geological Survey, Department of Computer Science and National Center for Supercomputing Applications. RVA was designed to utilize and enhance the state-of-the-art visualization capabilities within ParaView, readily allowing joint visualization of geologic framework and reservoir fluid simulation model results. Particular emphasis was placed on enabling visualization and analysis of simulation results highlighting multiple fluid phases, multiple properties for each fluid phase (including flow lines), multiple geologic models and multiple time steps. Additional advanced functionality was provided through the development of custom code to implement data mining capabilities. The built-in functionality of ParaView provides the capacity to process and visualize data sets ranging from small models on local desktop systems to extremely large models created and stored on remote supercomputers. The RVA plugin that we developed and the associated User Manual provide improved functionality through new software tools, and instruction in the use of ParaView-RVA, targeted to petroleum engineers and geologists in industry and research. The RVA web site (http://rva.cs.illinois.edu) provides an overview of functions, and the development web site (https://github.com/shaffer1/RVA) provides ready access to the source code, compiled binaries, user manual, and a suite of demonstration data sets. Key functionality has been included to support a range of reservoirs visualization and analysis needs, including: sophisticated connectivity analysis, cross sections through simulation results between selected wells, simplified volumetric calculations, global vertical exaggeration adjustments, ingestion of UTChem simulation results, ingestion of Isatis geostatistical framework models, interrogation of joint geologic and reservoir modeling results, joint visualization and analysis of well history files, location-targeted visualization, advanced correlation analysis, visualization of flow paths, and creation of static images and animations highlighting targeted reservoir features.

  13. Linking Advanced Visualization and MATLAB for the Analysis of 3D Gene

    Office of Scientific and Technical Information (OSTI)

    Expression Data (Conference) | SciTech Connect Linking Advanced Visualization and MATLAB for the Analysis of 3D Gene Expression Data Citation Details In-Document Search Title: Linking Advanced Visualization and MATLAB for the Analysis of 3D Gene Expression Data Three-dimensional gene expression PointCloud data generated by the Berkeley Drosophila Transcription Network Project (BDTNP) provides quantitative information about the spatial and temporal expression of genes in early Drosophila

  14. Dynamic Structural Response and Deformations of Monolayer MoS 2 Visualized

    Office of Scientific and Technical Information (OSTI)

    by Femtosecond Electron Diffraction (Journal Article) | SciTech Connect SciTech Connect Search Results Journal Article: Dynamic Structural Response and Deformations of Monolayer MoS 2 Visualized by Femtosecond Electron Diffraction Citation Details In-Document Search Title: Dynamic Structural Response and Deformations of Monolayer MoS 2 Visualized by Femtosecond Electron Diffraction Authors: Mannebach, Ehren M. ; Li, Renkai ; Duerloo, Karel-Alexander ; Nyby, Clara ; Zalden, Peter ; Vecchione,

  15. Topology-based Visualization and Analysis of High-dimensional Data and

    Office of Scientific and Technical Information (OSTI)

    Time-varying Data at the Extreme Scale (Conference) | SciTech Connect Topology-based Visualization and Analysis of High-dimensional Data and Time-varying Data at the Extreme Scale Citation Details In-Document Search Title: Topology-based Visualization and Analysis of High-dimensional Data and Time-varying Data at the Extreme Scale Authors: Weber, Gunther H. ; Morozov, Dmitriy ; Beketayev, Kenes ; Bell, John ; Bremer, Peer-Timo ; Day, Marc ; Hamann, Bernd ; Heine, Christian ; Haranczyk,

  16. Volume visualization of multiple alignment of large genomicDNA (Book) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Book: Volume visualization of multiple alignment of large genomicDNA Citation Details In-Document Search Title: Volume visualization of multiple alignment of large genomicDNA Genomes of hundreds of species have been sequenced to date, and many more are being sequenced. As more and more sequence data sets become available, and as the challenge of comparing these massive ''billion basepair DNA sequences'' becomes substantial, so does the need for more powerful tools supporting

  17. Visualization at Supercomputing Centers: The Tale of Little Big Iron and the Three Skinny Guys

    SciTech Connect (OSTI)

    Bethel, E. Wes; van Rosendale, John; Southard, Dale; Gaither, Kelly; Childs, Hank; Brugger, Eric; Ahern, Sean

    2010-12-01

    Supercomputing Centers (SC's) are unique resources that aim to enable scientific knowledge discovery through the use of large computational resources, the Big Iron. Design, acquisition, installation, and management of the Big Iron are activities that are carefully planned and monitored. Since these Big Iron systems produce a tsunami of data, it is natural to co-locate visualization and analysis infrastructure as part of the same facility. This infrastructure consists of hardware (Little Iron) and staff (Skinny Guys). Our collective experience suggests that design, acquisition, installation, and management of the Little Iron and Skinny Guys does not receive the same level of treatment as that of the Big Iron. The main focus of this article is to explore different aspects of planning, designing, fielding, and maintaining the visualization and analysis infrastructure at supercomputing centers. Some of the questions we explore in this article include:"How should the Little Iron be sized to adequately support visualization and analysis of data coming off the Big Iron?" What sort of capabilities does it need to have?" Related questions concern the size of visualization support staff:"How big should a visualization program be (number of persons) and what should the staff do?" and"How much of the visualization should be provided as a support service, and how much should applications scientists be expected to do on their own?"

  18. Generalized Framework and Algorithms for Illustrative Visualization of Time-Varying Data on Unstructured Meshes

    SciTech Connect (OSTI)

    Alexander S. Rattner; Donna Post Guillen; Alark Joshi

    2012-12-01

    Photo- and physically-realistic techniques are often insufficient for visualization of simulation results, especially for 3D and time-varying datasets. Substantial research efforts have been dedicated to the development of non-photorealistic and illustration-inspired visualization techniques for compact and intuitive presentation of such complex datasets. While these efforts have yielded valuable visualization results, a great deal of work has been reproduced in studies as individual research groups often develop purpose-built platforms. Additionally, interoperability between illustrative visualization software is limited due to specialized processing and rendering architectures employed in different studies. In this investigation, a generalized framework for illustrative visualization is proposed, and implemented in marmotViz, a ParaView plugin, enabling its use on variety of computing platforms with various data file formats and mesh geometries. Detailed descriptions of the region-of-interest identification and feature-tracking algorithms incorporated into this tool are provided. Additionally, implementations of multiple illustrative effect algorithms are presented to demonstrate the use and flexibility of this framework. By providing a framework and useful underlying functionality, the marmotViz tool can act as a springboard for future research in the field of illustrative visualization.

  19. Collaborative Visualization for Large-Scale Accelerator Electromagnetic Modeling (Final Report)

    SciTech Connect (OSTI)

    William J. Schroeder

    2011-11-13

    This report contains the comprehensive summary of the work performed on the SBIR Phase II, Collaborative Visualization for Large-Scale Accelerator Electromagnetic Modeling at Kitware Inc. in collaboration with Stanford Linear Accelerator Center (SLAC). The goal of the work was to develop collaborative visualization tools for large-scale data as illustrated in the figure below. The solutions we proposed address the typical problems faced by geographicallyand organizationally-separated research and engineering teams, who produce large data (either through simulation or experimental measurement) and wish to work together to analyze and understand their data. Because the data is large, we expect that it cannot be easily transported to each team member's work site, and that the visualization server must reside near the data. Further, we also expect that each work site has heterogeneous resources: some with large computing clients, tiled (or large) displays and high bandwidth; others sites as simple as a team member on a laptop computer. Our solution is based on the open-source, widely used ParaView large-data visualization application. We extended this tool to support multiple collaborative clients who may locally visualize data, and then periodically rejoin and synchronize with the group to discuss their findings. Options for managing session control, adding annotation, and defining the visualization pipeline, among others, were incorporated. We also developed and deployed a Web visualization framework based on ParaView that enables the Web browser to act as a participating client in a collaborative session. The ParaView Web Visualization framework leverages various Web technologies including WebGL, JavaScript, Java and Flash to enable interactive 3D visualization over the web using ParaView as the visualization server. We steered the development of this technology by teaming with the SLAC National Accelerator Laboratory. SLAC has a computationally-intensive problem important to the nations scientific progress as described shortly. Further, SLAC researchers routinely generate massive amounts of data, and frequently collaborate with other researchers located around the world. Thus SLAC is an ideal teammate through which to develop, test and deploy this technology. The nature of the datasets generated by simulations performed at SLAC presented unique visualization challenges especially when dealing with higher-order elements that were addressed during this Phase II. During this Phase II, we have developed a strong platform for collaborative visualization based on ParaView. We have developed and deployed a ParaView Web Visualization framework that can be used for effective collaboration over the Web. Collaborating and visualizing over the Web presents the community with unique opportunities for sharing and accessing visualization and HPC resources that hitherto with either inaccessible or difficult to use. The technology we developed in here will alleviate both these issues as it becomes widely deployed and adopted.

  20. Visualization at Supercomputing Centers: The Tale of Little Big Iron and the Three Skinny Guys

    SciTech Connect (OSTI)

    Bethel, E Wes; Brugger, Eric

    2011-01-01

    Supercomputing centers are unique resources that aim to enable scientific knowledge discovery by employing large computational resources - the 'Big Iron.' Design, acquisition, installation, and management of the Big Iron are carefully planned and monitored. Because these Big Iron systems produce a tsunami of data, it's natural to colocate the visualization and analysis infrastructure. This infrastructure consists of hardware (Little Iron) and staff (Skinny Guys). Our collective experience suggests that design, acquisition, installation, and management of the Little Iron and Skinny Guys doesn't receive the same level of treatment as that of the Big Iron. This article explores the following questions about the Little Iron: How should we size the Little Iron to adequately support visualization and analysis of data coming off the Big Iron? What sort of capabilities must it have? Related questions concern the size of visualization support staff: How big should a visualization program be - that is, how many Skinny Guys should it have? What should the staff do? How much of the visualization should be provided as a support service, and how much should applications scientists be expected to do on their own?

  1. COLLABORATIVE RESEARCH: Parallel Analysis Tools and New Visualization Techniques for Ultra-Large Climate Data Set

    SciTech Connect (OSTI)

    middleton, Don; Haley, Mary

    2014-12-10

    ParVis was a project funded under LAB 10-05: “Earth System Modeling: Advanced Scientific Visualization of Ultra-Large Climate Data Sets”. Argonne was the lead lab with partners at PNNL, SNL, NCAR and UC-Davis. This report covers progress from January 1st, 2013 through Dec 1st, 2014. Two previous reports covered the period from Summer, 2010, through September 2011 and October 2011 through December 2012, respectively. While the project was originally planned to end on April 30, 2013, personnel and priority changes allowed many of the institutions to continue work through FY14 using existing funds. A primary focus of ParVis was introducing parallelism to climate model analysis to greatly reduce the time-to-visualization for ultra-large climate data sets. Work in the first two years was conducted on two tracks with different time horizons: one track to provide immediate help to climate scientists already struggling to apply their analysis to existing large data sets and another focused on building a new data-parallel library and tool for climate analysis and visualization that will give the field a platform for performing analysis and visualization on ultra-large datasets for the foreseeable future. In the final 2 years of the project, we focused mostly on the new data-parallel library and associated tools for climate analysis and visualization.

  2. Immersive Visualization for Materials Science Data Analysis using the Oculus Rift

    SciTech Connect (OSTI)

    Drouhard, Margaret MEG G; Steed, Chad A; Hahn, Steven E; Proffen, Thomas E; Daniel, Jamison R; Matheson, Michael A

    2015-01-01

    In this paper, we propose strategies and objectives for immersive data visualization with applications in materials science using the Oculus Rift virtual reality headset. We provide background on currently available analysis tools for neutron scattering data and other large-scale materials science projects. In the context of the current challenges facing scientists, we discuss immersive virtual reality visualization as a potentially powerful solution. We introduce a prototype immersive visual- ization system, developed in conjunction with materials scientists at the Spallation Neutron Source, which we have used to explore large crystal structures and neutron scattering data. Finally, we offer our perspective on the greatest challenges that must be addressed to build effective and intuitive virtual reality analysis tools that will be useful for scientists in a wide range of fields.

  3. Why High Performance Visual Data Analytics is both Relevant and Difficult

    SciTech Connect (OSTI)

    Bethel, E. Wes; Byna, Suren; Ruebel, Oliver; Wu, K. John; Wehner, Michael

    2012-12-01

    Data visualization, as well as data analysis and data analytics, are all an integral part of the scientific process. Collectively, these technologies provide the means to gain insight into data of ever-increasing size and complexity. Over the past two decades, a substantial amount of visualization, analysis, and analytics R&D has focused on the challenges posed by increasing data size and complexity, as well as on the increasing complexity of a rapidly changing computational platform landscape. While some of this research focuses on solely on technologies, such as indexing and searching or novel analysis or visualization algorithms, other R&D projects focus on applying technological advances to specific application problems. Some of the most interesting and productive results occur when these two activities R&D and application are conducted in a collaborative fashion, where application needs drive R&D, and R&D results are immediately applicable to real world problems.

  4. An open source GIS tool to quantify the visual impact of wind turbines and photovoltaic panels

    SciTech Connect (OSTI)

    Minelli, Annalisa; Marchesini, Ivan; Taylor, Faith E.; De Rosa, Pierluigi; Casagrande, Luca; Cenci, Michele

    2014-11-15

    Although there are clear economic and environmental incentives for producing energy from solar and wind power, there can be local opposition to their installation due to their impact upon the landscape. To date, no international guidelines exist to guide quantitative visual impact assessment of these facilities, making the planning process somewhat subjective. In this paper we demonstrate the development of a method and an Open Source GIS tool to quantitatively assess the visual impact of these facilities using line-of-site techniques. The methods here build upon previous studies by (i) more accurately representing the shape of energy producing facilities, (ii) taking into account the distortion of the perceived shape and size of facilities caused by the location of the observer, (iii) calculating the possible obscuring of facilities caused by terrain morphology and (iv) allowing the combination of various facilities to more accurately represent the landscape. The tool has been applied to real and synthetic case studies and compared to recently published results from other models, and demonstrates an improvement in accuracy of the calculated visual impact of facilities. The tool is named r.wind.sun and is freely available from GRASS GIS AddOns. - Highlights: • We develop a tool to quantify wind turbine and photovoltaic panel visual impact. • The tool is freely available to download and edit as a module of GRASS GIS. • The tool takes into account visual distortion of the shape and size of objects. • The accuracy of calculation of visual impact is improved over previous methods.

  5. Use Of Vitamin B6 To Mitigate Visual Field Deficits Associated With The Use Of Gabaergic Drugs In Mannals

    DOE Patents [OSTI]

    Ashby, Jr., Charles R.

    2004-03-30

    The invention provides a method for treating visual field defects in a mammal in need thereof by administering an effective amount of vitamin B6 to the mammal.

  6. Li electrodeposition dynamics visualized in-situ via a TEM liquid cell.

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Li electrodeposition dynamics visualized in-situ via a TEM liquid cell. Citation Details In-Document Search Title: Li electrodeposition dynamics visualized in-situ via a TEM liquid cell. Abstract not provided. Authors: Leenheer, Andrew Jay ; Jungjohann, Katherine Leigh ; Zavadil, Kevin Robert ; Harris, Charles Thomas Publication Date: 2014-12-01 OSTI Identifier: 1242784 Report Number(s): SAND2014-20286C 547565 DOE Contract Number: AC04-94AL85000 Resource Type:

  7. Deploying web-based visual exploration tools on the grid (Journal Article)

    Office of Scientific and Technical Information (OSTI)

    | SciTech Connect Journal Article: Deploying web-based visual exploration tools on the grid Citation Details In-Document Search Title: Deploying web-based visual exploration tools on the grid × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science and technology. A

  8. Efficient Feature-Driven Visualization of Large-Scale Scientific Data

    SciTech Connect (OSTI)

    Lu, Aidong

    2012-12-12

    Very large, complex scientific data acquired in many research areas creates critical challenges for scientists to understand, analyze, and organize their data. The objective of this project is to expand the feature extraction and analysis capabilities to develop powerful and accurate visualization tools that can assist domain scientists with their requirements in multiple phases of scientific discovery. We have recently developed several feature-driven visualization methods for extracting different data characteristics of volumetric datasets. Our results verify the hypothesis in the proposal and will be used to develop additional prototype systems.

  9. Linking Automated Data Analysis and Visualization with Applications in Developmental Biology and High-Energy Physics

    SciTech Connect (OSTI)

    Ruebel, Oliver

    2009-12-01

    Knowledge discovery from large and complex collections of today's scientific datasets is a challenging task. With the ability to measure and simulate more processes at increasingly finer spatial and temporal scales, the increasing number of data dimensions and data objects is presenting tremendous challenges for data analysis and effective data exploration methods and tools. Researchers are overwhelmed with data and standard tools are often insufficient to enable effective data analysis and knowledge discovery. The main objective of this thesis is to provide important new capabilities to accelerate scientific knowledge discovery form large, complex, and multivariate scientific data. The research covered in this thesis addresses these scientific challenges using a combination of scientific visualization, information visualization, automated data analysis, and other enabling technologies, such as efficient data management. The effectiveness of the proposed analysis methods is demonstrated via applications in two distinct scientific research fields, namely developmental biology and high-energy physics.Advances in microscopy, image analysis, and embryo registration enable for the first time measurement of gene expression at cellular resolution for entire organisms. Analysis of high-dimensional spatial gene expression datasets is a challenging task. By integrating data clustering and visualization, analysis of complex, time-varying, spatial gene expression patterns and their formation becomes possible. The analysis framework MATLAB and the visualization have been integrated, making advanced analysis tools accessible to biologist and enabling bioinformatic researchers to directly integrate their analysis with the visualization. Laser wakefield particle accelerators (LWFAs) promise to be a new compact source of high-energy particles and radiation, with wide applications ranging from medicine to physics. To gain insight into the complex physical processes of particle acceleration, physicists model LWFAs computationally. The datasets produced by LWFA simulations are (i) extremely large, (ii) of varying spatial and temporal resolution, (iii) heterogeneous, and (iv) high-dimensional, making analysis and knowledge discovery from complex LWFA simulation data a challenging task. To address these challenges this thesis describes the integration of the visualization system VisIt and the state-of-the-art index/query system FastBit, enabling interactive visual exploration of extremely large three-dimensional particle datasets. Researchers are especially interested in beams of high-energy particles formed during the course of a simulation. This thesis describes novel methods for automatic detection and analysis of particle beams enabling a more accurate and efficient data analysis process. By integrating these automated analysis methods with visualization, this research enables more accurate, efficient, and effective analysis of LWFA simulation data than previously possible.

  10. Ultra-Scale Visualization: Research and Education. (Conference) | SciTech

    Office of Scientific and Technical Information (OSTI)

    Connect Conference: Ultra-Scale Visualization: Research and Education. Citation Details In-Document Search Title: Ultra-Scale Visualization: Research and Education. Abstract not provided. Authors: Moreland, Kenneth D. ; Ma, Kwan-Liu ; Ross, Robert ; Huang, Jian ; Humphreys, Greg ; Max, Nelson ; Owens, John D. ; Shen, Han-Wei Publication Date: 2007-08-01 OSTI Identifier: 1147497 Report Number(s): SAND2007-4947C 522191 DOE Contract Number: DE-AC04-94AL85000 Resource Type: Conference Resource

  11. Ultrascale Visualization Climate Data Analysis Tools (UV-CDAT) Final Report

    SciTech Connect (OSTI)

    Williams, Dean N.

    2014-05-19

    A partnership across government, academic, and private sectors has created a novel system that enables climate researchers to solve current and emerging data analysis and visualization challenges. The Ultrascale Visualization Climate Data Analysis Tools (UV-CDAT) software project utilizes the Python application programming interface (API) combined with C/C++/Fortran implementations for performance-critical software that offers the best compromise between "scalability" and “ease-of-use.” The UV-CDAT system is highly extensible and customizable for high-performance interactive and batch visualization and analysis for climate science and other disciplines of geosciences. For complex, climate data-intensive computing, UV-CDAT’s inclusive framework supports Message Passing Interface (MPI) parallelism as well as taskfarming and other forms of parallelism. More specifically, the UV-CDAT framework supports the execution of Python scripts running in parallel using the MPI executable commands and leverages Department of Energy (DOE)-funded general-purpose, scalable parallel visualization tools such as ParaView and VisIt. This is the first system to be successfully designed in this way and with these features. The climate community leverages these tools and others, in support of a parallel client-server paradigm, allowing extreme-scale, server-side computing for maximum possible speed-up.

  12. An Application of Multivariate Statistical Analysis for Query-Driven Visualization

    SciTech Connect (OSTI)

    Gosink, Luke J.; Garth, Christoph; Anderson, John C.; Bethel, E. Wes; Joy, Kenneth I.

    2010-03-01

    Abstract?Driven by the ability to generate ever-larger, increasingly complex data, there is an urgent need in the scientific community for scalable analysis methods that can rapidly identify salient trends in scientific data. Query-Driven Visualization (QDV) strategies are among the small subset of techniques that can address both large and highly complex datasets. This paper extends the utility of QDV strategies with a statistics-based framework that integrates non-parametric distribution estimation techniques with a new segmentation strategy to visually identify statistically significant trends and features within the solution space of a query. In this framework, query distribution estimates help users to interactively explore their query's solution and visually identify the regions where the combined behavior of constrained variables is most important, statistically, to their inquiry. Our new segmentation strategy extends the distribution estimation analysis by visually conveying the individual importance of each variable to these regions of high statistical significance. We demonstrate the analysis benefits these two strategies provide and show how they may be used to facilitate the refinement of constraints over variables expressed in a user's query. We apply our method to datasets from two different scientific domains to demonstrate its broad applicability.

  13. Interactive, Internet Delivery of Scientific Visualization viaStructured, Prerendered Multiresolution Imagery

    SciTech Connect (OSTI)

    Chen, Jerry; Yoon, Ilmi; Bethel, E. Wes

    2005-04-20

    We present a novel approach for highly interactive remote delivery of visualization results. Instead of real-time rendering across the internet, our approach, inspired by QuickTime VR's Object Movieconcept, delivers pre-rendered images corresponding to different viewpoints and different time steps to provide the experience of 3D and temporal navigation. We use tiled, multiresolution image streaming to consume minimum bandwidth while providing the maximum resolution that a user can perceive from a given viewpoint. Since image data, a viewpoint and time stamps are the only required inputs, our approach is generally applicable to all visualization and graphics rendering applications capable of generating image files in an ordered fashion. Our design is a form of latency-tolerant remote visualization, where visualization and Rendering time is effectively decoupled from interactive exploration. Our approach trades off increased interactivity, flexible resolution (for individual clients), reduced load and effective reuse of coherent frames between multiple users (from the servers perspective) at the expense of unconstrained exploration. A normal web server is the vehicle for providing on-demand images to the remote client application, which uses client-pull to obtain and cache only those images required to fulfill the interaction needs. This paper presents an architectural description of the system along with a performance characterization for stage of production, delivery and viewing pipeline.

  14. Proof-of-Concept Demonstration Results for Robotic Visual Servo Controllers

    SciTech Connect (OSTI)

    Chawda, P.V.

    2004-09-22

    There is significant motivation to provide robotic systems with improved autonomy as a means to significantly accelerate deactivation and decommissioning operations while also reducing the associated costs, removing human operators from hazardous environments, and reducing the required burden and skill of human operators. To achieve improved autonomy, fundamental research is focused on the challenges of developing visual servo controllers. The challenge in developing these controllers is that a camera provides 2-dimensional image information about the 3-dimensional Euclidean-space through a perspective (range dependent) projection that can be corrupted by uncertainty in the camera calibration matrix. Disturbances in this relationship (i.e., corruption in the sensor information) propagate erroneous information to the feedback controller of the robot, leading to potentially unpredictable task execution. This technical manual describes 3 proof-of-concept demonstrations of visual servo controllers developed from fundamental research aimed at these challenges. Specifically, one section describes the implementation of a cooperative visual servo control scheme with a camera-in-hand and a fixed camera to track a moving target despite uncertainty in the camera calibration and the unknown constant distance from the camera to a target where the camera is mounted on the end-effector of a 6 degrees-of-freedom hydraulic robot manipulator. The next section describes the implementation of 2 homography-based visual servo tracking and regulation controllers for a mobile robot with a calibrated camera despite an unknown time-varying distance from the camera to a target.

  15. Ultra-scale Visualization Climate Data Analysis Tools (UV-CDAT)

    SciTech Connect (OSTI)

    Williams, Dean N.

    2011-07-20

    This report summarizes work carried out by the Ultra-scale Visualization Climate Data Analysis Tools (UV-CDAT) Team for the period of January 1, 2011 through June 30, 2011. It discusses highlights, overall progress, period goals, and collaborations and lists papers and presentations. To learn more about our project, please visit our UV-CDAT website (URL: http://uv-cdat.org). This report will be forwarded to the program manager for the Department of Energy (DOE) Office of Biological and Environmental Research (BER), national and international collaborators and stakeholders, and to researchers working on a wide range of other climate model, reanalysis, and observation evaluation activities. The UV-CDAT executive committee consists of Dean N. Williams of Lawrence Livermore National Laboratory (LLNL); Dave Bader and Galen Shipman of Oak Ridge National Laboratory (ORNL); Phil Jones and James Ahrens of Los Alamos National Laboratory (LANL), Claudio Silva of Polytechnic Institute of New York University (NYU-Poly); and Berk Geveci of Kitware, Inc. The UV-CDAT team consists of researchers and scientists with diverse domain knowledge whose home institutions also include the National Aeronautics and Space Administration (NASA) and the University of Utah. All work is accomplished under DOE open-source guidelines and in close collaboration with the project's stakeholders, domain researchers, and scientists. Working directly with BER climate science analysis projects, this consortium will develop and deploy data and computational resources useful to a wide variety of stakeholders, including scientists, policymakers, and the general public. Members of this consortium already collaborate with other institutions and universities in researching data discovery, management, visualization, workflow analysis, and provenance. The UV-CDAT team will address the following high-level visualization requirements: (1) Alternative parallel streaming statistics and analysis pipelines - Data parallelism, Task parallelism, Visualization parallelism; (2) Optimized parallel input/output (I/O); (3) Remote interactive execution; (4) Advanced intercomparison visualization; (5) Data provenance processing and capture; and (6) Interfaces for scientists - Workflow data analysis and visualization construction tools, and Visualization interfaces.

  16. Discover, Visualize, and Deliver Geospatial Data through OGC Standards-based WebGIS System

    SciTech Connect (OSTI)

    Wei, Yaxing; SanthanaVannan, Suresh K; Cook, Robert B

    2009-01-01

    Geospatial data are important to understand the Earth - ecosystem dynamics, land cover changes, resource management, and human interactions with the Earth to name a few. One of the biggest difficulties users face is to discover, access, and assemble distributed, large volume, heterogeneous geospatial data to conduct geo-analysis. Traditional methods of geospatial data discovery, visualization, and delivery lack the capabilities of resource sharing and automation across systems or organizational boundaries. They require users to download the data ldquoas-isrdquo in their original file format, projection, and extent. Also, discovering data served by traditional methods requires prior knowledge of data location, and processing requires specialized expertise. These drawbacks of traditional methods create additional burden to users, introduce too much overhead to research, and also reduce the potential usage of the data. At the Oak Ridge National Laboratory (ORNL), researchers working on NASA-sponsored projects: Distributed Active Archive Center (DAAC) and Modeling and Synthesis Thematic Data Center (MAST-DC) have tapped into the benefits of Open Geospatial Consortium (OGC) standards to overcome the drawbacks of traditional methods of geospatial data discovery, visualization, and delivery. The OGC standards-based approach facilitates data sharing and interoperability across network, organizational, and geopolitical boundaries. Tools and services based on OGC standards deliver the data in many user defined formats and allow users to visualize the data prior to download. This paper introduces an approach taken to visualize and deliver ORNL DAAC, MAST-DC, and other relevant geospatial data through OGC standards-based Web Services, including Web Map Service (WMS), Web Coverage Service (WCS), and Web Feature Service (WFS). It also introduces a WebGIS system built on top of OGC services that helps users discover, visualize, and access geospatial data.

  17. Cactus and Visapult: A case study of ultra-high performance distributed visualization using connectionless protocols

    SciTech Connect (OSTI)

    Shalf, John; Bethel, E. Wes

    2002-05-07

    This past decade has seen rapid growth in the size, resolution, and complexity of Grand Challenge simulation codes. Many such problems still require interactive visualization tools to make sense of multi-terabyte data stores. Visapult is a parallel volume rendering tool that employs distributed components, latency tolerant algorithms, and high performance network I/O for effective remote visualization of massive datasets. In this paper we discuss using connectionless protocols to accelerate Visapult network I/O and interfacing Visapult to the Cactus General Relativity code to enable scalable remote monitoring and steering capabilities. With these modifications, network utilization has moved from 25 percent of line-rate using tuned multi-streamed TCP to sustaining 88 percent of line rate using the new UDP-based transport protocol.

  18. GRIZ: Finite element analysis results visualization for unstructured grids. User manual

    SciTech Connect (OSTI)

    Dovey, D.J.; Spelce, T.E.

    1993-10-01

    GRIZ supports interactive visualization of finite element analysis results on unstructured grids. GRIZ is a general-purpose post-processing application which is designed to work with a variety of an analysis codes. Currently, GRIZ is capable of calculating and displaying derived variables for the DYNA3D, NIKE3D and TOPAZ3D analysis codes. GRIZ reads in data files in the ``MDG plotfile`` format. GRIZ provides support for modern 3D visualization techniques such as isosurface display, cutting planes and display of vector data. GRIZ also incorporates the ability to animate data over time and to store animation frames to a video disk. GRIZ is designed to utilize the capabilities of modern graphics workstations which provide hardware support for 3D graphics, thereby giving the user as much interactive performance as possible. This should make it easier for analysts to explore and interrogate their analysis results.

  19. Pathways to Identity: Aiding Law Enforcement in Identification Tasks With Visual Analytics

    SciTech Connect (OSTI)

    Bruce, Joseph R.; Scholtz, Jean; Hodges, Duncan; Emanuel, Lia; Stanton-Fraser, Danae; Creese, Sadie; Love, Oriana J.

    2014-09-18

    The nature of identity has changed dramatically in recent years, and has grown in complexity. Identities are defined in multiple domains: biological and psychological elements strongly contribute, but also biographical and cyber elements are necessary to complete the picture. Law enforcement is beginning to adjust to these changes, recognizing its importance in criminal justice. The SuperIdentity project seeks to aid law enforcement officials in their identification tasks through research of techniques for discovering identity traits, generation of statistical models of identity and analysis of identity traits through visualization. We present use cases compiled through user interviews in multiple fields, including law enforcement, as well as the modeling and visualization tools design to aid in those use cases.

  20. Have Green – A Visual Analytics Framework for Large Semantic Graphs

    SciTech Connect (OSTI)

    Wong, Pak C.; Chin, George; Foote, Harlan P.; Mackey, Patrick S.; Thomas, James J.

    2006-10-29

    A semantic graph is a network of heterogeneous nodes and links annotated with a domain ontology. In intelligence analysis, investigators use semantic graphs to organize concepts and relationships as graph nodes and links in hopes of discovering key trends, patterns, and insights. However, as new information continues to arrive from a multitude of sources, the size and complexity of the semantic graphs will soon overwhelm an investigator's cognitive capacity to carry out significant analyses. We introduce a powerful visual analytics framework designed to enhance investigators--natural analytical capabilities to comprehend and analyze large semantic graphs. The paper describes the overall framework design, presents major development accomplishments to date, and discusses future directions of a new visual analytics system known as Have Green.

  1. Text Stream Trend Analysis using Multiscale Visual Analytics with Applications to Social Media Systems

    SciTech Connect (OSTI)

    Steed, Chad A; Beaver, Justin M; BogenII, Paul L.; Drouhard, Margaret MEG G; Pyle, Joshua M

    2015-01-01

    In this paper, we introduce a new visual analytics system, called Matisse, that allows exploration of global trends in textual information streams with specific application to social media platforms. Despite the potential for real-time situational awareness using these services, interactive analysis of such semi-structured textual information is a challenge due to the high-throughput and high-velocity properties. Matisse addresses these challenges through the following contributions: (1) robust stream data management, (2) automated sen- timent/emotion analytics, (3) inferential temporal, geospatial, and term-frequency visualizations, and (4) a flexible drill-down interaction scheme that progresses from macroscale to microscale views. In addition to describing these contributions, our work-in-progress paper concludes with a practical case study focused on the analysis of Twitter 1% sample stream information captured during the week of the Boston Marathon bombings.

  2. iGlobe: an interactive visualization and analysis framework for geospatial data

    SciTech Connect (OSTI)

    Chandola, Varun; Vatsavai, Raju; Bhaduri, Budhendra L

    2011-01-01

    We demonstrate an interactive visualization and analysis system for integrating climate data with other geospatial data sets, such as environmental and demographic data. The \\eviz system is a desktop-based visualization and analysis environment which allows seamless integration of multiple geospatial data sets from varied sources and provides an interface to interactively analyze the different data sets and apply sophisticated data analysis and mining algorithms in a near real time fashion. The framework is highly desirable in domains such as earth and climate sciences where great emphasis is placed on simultaneous analysis of different data sets such as remote sensing images, climate model simulation outputs, and other environmental and demographic databases, to understand weather and climate systems and the impact of climate change on nature and people.

  3. SCIENCE ON SATURDAY-"Visualizing the Atomic World" | Princeton Plasma

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Lab 2, 2013, 9:30am Science On Saturday MBG Auditorium SCIENCE ON SATURDAY-"Visualizing the Atomic World" Professor Udo Schwarz Department of Mechanical Engineering & Materials Science and Department of Chemical & Environmental Engineering, Yale University Presentation: Office presentation icon SOS12JAN2013_UDSchwarz.ppt Abstract: PDF icon U.Schwarz.pdf Science on Saturday is a series of lectures given by scientists, mathematicians, and other professionals involved

  4. Sandia Wins Funding for Programming In Situ Data Analysis/Visualization

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Programming In Situ Data Analysis/Visualization - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste

  5. VisIt: An End-User Tool for Visualizing and Analyzing Very Large Data

    SciTech Connect (OSTI)

    Childs, Hank; Brugger, Eric; Whitlock, Brad; Meredith, Jeremy; Ahern, Sean; Pugmire, David; Biagas, Kathleen; Miller, Mark; Weber, Gunther H.; Krishnan, Hari; Fogal, Thomas; Sanderson, Allen; Garth, Christoph; Bethel, E. Wes; Camp, David; Ruebel, Oliver; Durant, Marc; Favre, Jean; Navratil, Paul

    2012-11-01

    VisIt is a popular open source tool for visualizing and analyzing big data. It owes its success to its foci of increasing data understanding, large data support, and providing a robust and usable product, as well as its underlying design that fits today's supercomputing landscape. This report, which draws heavily from an earlier publication at the SciDAC Conference in 2011 describes the VisIt project and its accomplishments.

  6. An Assessment of Remote Visual Methods to Detect Cracking in Reactor Components

    SciTech Connect (OSTI)

    Cumblidge, Stephen E.; Anderson, Michael T.; Doctor, Steven R.; Simonen, Fredric A.; Elliot, Anthony J.

    2008-01-01

    Recently, the U.S. nuclear industry has proposed replacing current volumetric and/or surface examinations of certain components in commercial nuclear power plants, as required by the American Society of Mechanical Engineers Boiler and Pressure Vessel Code Section XI, “Inservice Inspection of Nuclear Power Plant Components,” with a simpler visual testing (VT) method. The advantages of VT are that these tests generally involve much less radiation exposure and time to perform the examination than do volumetric examinations such as ultrasonic testing. The issues relative to the reliability of VT in determining the structural integrity of reactor components were examined. Some piping and pressure vessel components in a nuclear power station are examined using VT as they are either in high radiation fields or component geometry precludes the use of ultrasonic testing (UT) methodology. Remote VT with radiation-hardened video systems has been used by nuclear utilities to find cracks in pressure vessel cladding in pressurized water reactors, core shrouds in boiling water reactors, and to investigate leaks in piping and reactor components. These visual tests are performed using a wide variety of procedures and equipment. The techniques for remote VT use submersible closed-circuit video cameras to examine reactor components and welds. PNNL conducted a parametric study that examined the important variables influencing the effectiveness of a remote visual test. Tested variables included lighting techniques, camera resolution, camera movement, and magnification. PNNL also conducted a limited laboratory test using a commercial visual testing camera system to experimentally determine the ability of the camera system to detect cracks of various widths under ideal conditions. The results of these studies and their implications are presented in this paper.

  7. MO-E-18C-06: Enriching Medical Physics Education By Visualizing The Invisible

    SciTech Connect (OSTI)

    Sprawls, P

    2014-06-15

    Purpose: To enhance the understanding of medical physics concepts and develop higher levels of learning relating to invisible physics phenomena such as radiation. To provide medical physics educators in all countries of the world with understanding of knowledge structures in the human brain, the different levels of learning, and the types of knowledge required for higher level functions such as problem solving, creative innovations, and applied clinical applications. To provide medical physics educators with an open access resource (tool) that they can use in their teaching activities to enrich and elevate the level of learning for their students, residents, etc. with respect to the invisible realm of medical physics. Methods: An experienced clinical medical physicist and educator has created and provided with open access three complementary web-based resources to achieve the purposes described above. One is a module focusing on the medical physics learning process with respect to mental knowledge structures, how they relate to outcomes and applications, and learning activities that are required to develop the required knowledge structures. The second is an extensive set of visuals that educators can use in their activities (classes, small group discussions, etc.) to visualize the invisible. The third is an interactive online simulation where learners can adjust factors and visually observe changes in x-radiation.These resources are available online at www.BLINDED FOR REVIEW . Results: Medical physics education, especially for non-physicists, is becoming much more interesting and useful especially with respect to invisible radiation. The global impact is that medical imaging professionals can be more effective in optimizing x-ray imaging procedures and risk management when they have knowledge levels that enhance problem solving, innovation, and creativity. Conclusion: Medical physics educators in all institutions can be much more effective and efficient in the sharing of their knowledge and experience when enhanced with high-quality visuals.

  8. Visualization/In-situ Analysis Co-Chairs: Laura Monroe, David Karelitz

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Visualization/In-situ Analysis Co-Chairs: Laura Monroe, David Karelitz Scribe: Prabhat Approved for Unlimited Release: SAND2014-15984O 1 Contributors * Kevin Harms, ANL * Laura Monroe, LANL * Bob Kares, LANL * Ming Jiang, LLNL * Jeff Long, LLNL * Wes Bethel, LBL * Prabhat, LBL * Doug Fuller * David Karelitz, Sandia * Andy Wilson, Sandia 2 Top Findings * Computational Steering * Connecting experiments to simulations * High Fidelity Analysis Opportunities * Domain science involvement * Ability to

  9. Interactive visual comparison of multimedia data through type-specific views

    SciTech Connect (OSTI)

    Burtner, Edwin R.; Bohn, Shawn J.; Payne, Deborah A.

    2013-02-05

    Analysts who work with collections of multimedia to perform information foraging understand how difficult it is to connect information across diverse sets of mixed media. The wealth of information from blogs, social media, and news sites often can provide actionable intelligence; however, many of the tools used on these sources of content are not capable of multimedia analysis because they only analyze a single media type. As such, analysts are taxed to keep a mental model of the relationships among each of the media types when generating the broader content picture. To address this need, we have developed Canopy, a novel visual analytic tool for analyzing multimedia. Canopy provides insight into the multimedia data relationships by exploiting the linkages found in text, images, and video co-occurring in the same document and across the collection. Canopy connects derived and explicit linkages and relationships through multiple connected visualizations to aid analysts in quickly summarizing, searching, and browsing collected information to explore relationships and align content. In this paper, we will discuss the features and capabilities of the Canopy system and walk through a scenario illustrating how this system might be used in an operational environment. Keywords: Multimedia (Image/Video/Music) Visualization.

  10. Cherenkov Video Imaging Allows for the First Visualization of Radiation Therapy in Real Time

    SciTech Connect (OSTI)

    Jarvis, Lesley A.; Zhang, Rongxiao; Gladstone, David J.; Jiang, Shudong; Hitchcock, Whitney; Friedman, Oscar D.; Glaser, Adam K.; Jermyn, Michael; Pogue, Brian W.

    2014-07-01

    Purpose: To determine whether Cherenkov light imaging can visualize radiation therapy in real time during breast radiation therapy. Methods and Materials: An intensified charge-coupled device (CCD) camera was synchronized to the 3.25-μs radiation pulses of the clinical linear accelerator with the intensifier set × 100. Cherenkov images were acquired continuously (2.8 frames/s) during fractionated whole breast irradiation with each frame an accumulation of 100 radiation pulses (approximately 5 monitor units). Results: The first patient images ever created are used to illustrate that Cherenkov emission can be visualized as a video during conditions typical for breast radiation therapy, even with complex treatment plans, mixed energies, and modulated treatment fields. Images were generated correlating to the superficial dose received by the patient and potentially the location of the resulting skin reactions. Major blood vessels are visible in the image, providing the potential to use these as biological landmarks for improved geometric accuracy. The potential for this system to detect radiation therapy misadministrations, which can result from hardware malfunction or patient positioning setup errors during individual fractions, is shown. Conclusions: Cherenkoscopy is a unique method for visualizing surface dose resulting in real-time quality control. We propose that this system could detect radiation therapy errors in everyday clinical practice at a time when these errors can be corrected to result in improved safety and quality of radiation therapy.

  11. Visualizing Life Zone Boundary Sensitivities Across Climate Models and Temporal Spans

    SciTech Connect (OSTI)

    Sisneros, Roberto R; Huang, Jian; Ostrouchov, George; Hoffman, Forrest M

    2011-01-01

    Life zones are a convenient and quantifiable method for delineating areas with similar plant and animal communities based on bioclimatic conditions. Such ecoregionalization techniques have proved useful for defining habitats and for studying how these habitats may shift due to environmental change. The ecological impacts of climate change are of particular interest. Here we show that visualizations of the geographic projection of life zones may be applied to the investigation of potential ecological impacts of climate change using the results of global climate model simulations. Using a multi-factor classification scheme, we show how life zones change over time based on quantitative model results into the next century. Using two straightforward metrics, we identify regions of high sensitivity to climate changes from two global climate simulations under two different greenhouse gas emissions scenarios. Finally, we identify how preferred human habitats may shift under these scenarios. We apply visualization methods developed for the purpose of displaying multivariate relationships within data, especially for situations that involve a large number of concurrent relationships. Our method is based on the concept of multivariate classification, and is implemented directly in VisIt, a production quality visualization package.

  12. Visual language recognition with a feed-forward network of spiking neurons

    SciTech Connect (OSTI)

    Rasmussen, Craig E; Garrett, Kenyan; Sottile, Matthew; Shreyas, Ns

    2010-01-01

    An analogy is made and exploited between the recognition of visual objects and language parsing. A subset of regular languages is used to define a one-dimensional 'visual' language, in which the words are translational and scale invariant. This allows an exploration of the viewpoint invariant languages that can be solved by a network of concurrent, hierarchically connected processors. A language family is defined that is hierarchically tiling system recognizable (HREC). As inspired by nature, an algorithm is presented that constructs a cellular automaton that recognizes strings from a language in the HREC family. It is demonstrated how a language recognizer can be implemented from the cellular automaton using a feed-forward network of spiking neurons. This parser recognizes fixed-length strings from the language in parallel and as the computation is pipelined, a new string can be parsed in each new interval of time. The analogy with formal language theory allows inferences to be drawn regarding what class of objects can be recognized by visual cortex operating in purely feed-forward fashion and what class of objects requires a more complicated network architecture.

  13. Communication library for run-time visualization of distributed, asynchronous data

    SciTech Connect (OSTI)

    Rowlan, J.; Wightman, B.T.

    1994-04-01

    In this paper we present a method for collecting and visualizing data generated by a parallel computational simulation during run time. Data distributed across multiple processes is sent across parallel communication lines to a remote workstation, which sorts and queues the data for visualization. We have implemented our method in a set of tools called PORTAL (for Parallel aRchitecture data-TrAnsfer Library). The tools comprise generic routines for sending data from a parallel program (callable from either C or FORTRAN), a semi-parallel communication scheme currently built upon Unix Sockets, and a real-time connection to the scientific visualization program AVS. Our method is most valuable when used to examine large datasets that can be efficiently generated and do not need to be stored on disk. The PORTAL source libraries, detailed documentation, and a working example can be obtained by anonymous ftp from info.mcs.anl.gov from the file portal.tar.Z from the directory pub/portal.

  14. Matisse: A Visual Analytics System for Exploring Emotion Trends in Social Media Text Streams

    SciTech Connect (OSTI)

    Steed, Chad A; Drouhard, Margaret MEG G; Beaver, Justin M; Pyle, Joshua M; BogenII, Paul L.

    2015-01-01

    Dynamically mining textual information streams to gain real-time situational awareness is especially challenging with social media systems where throughput and velocity properties push the limits of a static analytical approach. In this paper, we describe an interactive visual analytics system, called Matisse, that aids with the discovery and investigation of trends in streaming text. Matisse addresses the challenges inherent to text stream mining through the following technical contributions: (1) robust stream data management, (2) automated sentiment/emotion analytics, (3) interactive coordinated visualizations, and (4) a flexible drill-down interaction scheme that accesses multiple levels of detail. In addition to positive/negative sentiment prediction, Matisse provides fine-grained emotion classification based on Valence, Arousal, and Dominance dimensions and a novel machine learning process. Information from the sentiment/emotion analytics are fused with raw data and summary information to feed temporal, geospatial, term frequency, and scatterplot visualizations using a multi-scale, coordinated interaction model. After describing these techniques, we conclude with a practical case study focused on analyzing the Twitter sample stream during the week of the 2013 Boston Marathon bombings. The case study demonstrates the effectiveness of Matisse at providing guided situational awareness of significant trends in social media streams by orchestrating computational power and human cognition.

  15. An Interactive Visual Analytics Framework for Multi-Field Data in a Geo-Spatial Context

    SciTech Connect (OSTI)

    Zhang, Zhiyuan; Tong, Xiaonan; McDonnell, Kevin T.; Zelenyuk, Alla; Imre, D.; Mueller, Klaus

    2013-04-01

    Climate research produces a wealth of multivariate data. These data often have a geospatial reference and so it is of interest to show them within their geospatial context. One can consider this configuration as a multi field visualization problem, where the geospace provides the expanse of the field. However, there is a limit on the amount of multivariate information that can be fit within a certain spatial location, and the use of linked multivari ate information displays has previously been devised to bridge this gap. In this paper we focus on the interactions in the geographical display, present an implementation that uses Google Earth, and demonstrate it within a tightly linked parallel coordinates display. Several other visual representations, such as pie and bar charts are integrated into the Google Earth display and can be interactively manipulated. Further, we also demonstrate new brushing and visualization techniques for parallel coordinates, such as fixedwindow brushing and correlationenhanced display. We conceived our system with a team of climate researchers, who already made a few important discov eries using it. This demonstrates our system’s great potential to enable scientific discoveries, possibly also in oth er domains where data have a geospatial reference.

  16. A Space-Filling Visualization Technique for Multivariate Small World Graphs

    SciTech Connect (OSTI)

    Wong, Pak C.; Foote, Harlan P.; Mackey, Patrick S.; Chin, George; Huang, Zhenyu; Thomas, James J.

    2012-03-15

    We introduce an information visualization technique, known as GreenCurve, for large sparse graphs that exhibit small world properties. Our fractal-based design approach uses spatial cues to approximate the node connections and thus eliminates the links between the nodes in the visualization. The paper describes a sophisticated algorithm to order the neighboring nodes of a large sparse graph by solving the Fiedler vector of its graph Laplacian, and then fold the graph nodes into a space-filling fractal curve based on the Fiedler vector. The result is a highly compact visualization that gives a succinct overview of the graph with guaranteed visibility of every graph node. We show in the paper that the GreenCurve technology is (1) theoretically sustainable by introducing an error estimation metric to measure the fidelity of the new graph representation, (2) empirically rigorous by conducting a usability study to investigate its strengths and weaknesses against the traditional graph layout, and (3) pragmatically feasible by applying it to analyze stressed conditions of the large scale electric power grid on the west coast.

  17. Structural Analysis of Novel Lignin-derived Carbon Composite...

    Office of Scientific and Technical Information (OSTI)

    and allows for the development of a mapping between the defining characteristics of the PDF and the material properties of interest. Authors: McNutt, Nicholas W 1 ; Rios,...

  18. Lignin from Transgenic Poplar Is Easier to Process - Energy Innovation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Genetically engineering other species to contain this enzyme could lead to more easily ... the gene for FMT, the researchers introduced the nucleic acid sequence into poplar tissue. ...

  19. Modification of Lignin by Protein Cross-linking to Facilitate...

    Office of Scientific and Technical Information (OSTI)

    Switching to renewable fuels for energy will allow us to become carbon neutral by recycling carbon from plants and reduce carbon from dioxide emissions, which could potentially ...

  20. "Bionic" Liquids from Lignin: Joint BioEnergy Institute Results...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Results Pave the Way for Closed-Loop Biofuel Refineries - Sandia Energy Energy Search ... Predictive Simulation of Engines Transportation Energy Consortiums Engine Combustion ...