Powered by Deep Web Technologies
Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Couse/Tenmile Creeks Watershed Project Implementation : 2007 Conservtion Projects. [2007 Habitat Projects Completed].  

DOE Green Energy (OSTI)

The Asotin County Conservation District (ACCD) is the primary entity coordinating habitat projects on private lands within Asotin County watersheds. The Tenmile Creek watershed is a 42 square mile tributary to the Snake River, located between Asotin Creek and the Grande Ronde River. Couse Creek watershed is a 24 square mile tributary to the Snake River, located between Tenmile Creek and the Grande Ronde River. Both watersheds are almost exclusively under private ownership. The Washington Department of Fish and Wildlife has documented wild steelhead and rainbow/redband trout spawning and rearing in Tenmile Creek and Couse Creek. The project also provides Best Management Practice (BMP) implementation throughout Asotin County, but the primary focus is for the Couse and Tenmile Creek watersheds. The ACCD has been working with landowners, Bonneville Power Administration (BPA), Washington State Conservation Commission (WCC), Natural Resource Conservation Service (NRCS), Farm Service Agency (FSA), Salmon Recovery Funding Board (SRFB), Washington Department of Fish and Wildlife (WDFW), U.S. Forest Service, Pomeroy Ranger District (USFS), Nez Perce Tribe (NPT), Washington Department of Ecology (DOE), National Marine Fisheries Service (NOAA Fisheries), and U.S. Fish and Wildlife Service (USFWS) to address habitat projects in Asotin County. The Asotin Subbasin Plan identified priority areas and actions for ESA listed streams within Asotin County. Couse Creek and Tenmile Creek are identified as protection areas in the plan. The Conservation Reserve Enhancement Program (CREP) has been successful in working with landowners to protect riparian areas throughout Asotin County. Funding from BPA and other agencies has also been instrumental in protecting streams throughout Asotin County by utilizing the ridge top to ridge top approach.

Asotin County Conservation District

2008-12-10T23:59:59.000Z

2

Rotary drive mechanism  

Science Conference Proceedings (OSTI)

This patent describes a rotary drive mechanism which includes a rotary solenoid having a stator and multi-poled rotor. A moving member rotates with the rotor and is biased by a biasing device. The biasing device causes a further rotational movement after rotation by the rotary solenoid. Thus, energization of the rotary solenoid moves the member in one direction to one position and biases the biasing device against the member. Subsequently, de- energization of the rotary solenoid causes the biasing device to move the member in the same direction to another position from where the moving member is again movable by energization and de-energization of the rotary solenoid. Preferably, the moving member is a multi-lobed cam having the same number of lobes as the rotor has poles. An anti- overdrive device is also preferably provided for preventing overdrive in the forward direction or a reverse rotation of the moving member and for precisely aligning the moving member.

Kenderdine, E.W.

1991-10-08T23:59:59.000Z

3

Rotary drive mechanism  

Science Conference Proceedings (OSTI)

A rotary drive mechanism includes a rotary solenoid having a stator and multi-poled rotor. A moving member rotates with the rotor and is biased by a biasing device. The biasing device causes a further rotational movement after rotation by the rotary solenoid. Thus, energization of the rotary solenoid moves the member in one direction to one position and biases the biasing device against the member. Subsequently, de-energization of the rotary solenoid causes the biasing device to move the member in the same direction to another position from where the moving member is again movable by energization and de-energization of the rotary solenoid. Preferably, the moving member is a multi-lobed cam having the same number of lobes as the rotor has poles. An anti-overdrive device is also preferably provided for preventing overdrive in the forward direction or a reverse rotation of the moving member and for precisely aligning the moving member.

Kenderdine, Eugene W. (Albuquerque, NM)

1991-01-01T23:59:59.000Z

4

EM Rotary Filter Program  

Electrical Junction Box Motors for Rotary Microfilters Motor Operated Valves Electrical ... savings SMPs Clarified Salt Solution Pumping System Sr-90 and actinides

5

Rotary mechanical latch  

Science Conference Proceedings (OSTI)

A rotary mechanical latch for positive latching and unlatching of a rotary device with a latchable rotating assembly having a latching gear that can be driven to latched and unlatched states by a drive mechanism such as an electric motor. A cam arm affixed to the latching gear interfaces with leading and trailing latch cams affixed to a flange within the drive mechanism. The interaction of the cam arm with leading and trailing latch cams prevents rotation of the rotating assembly by external forces such as those due to vibration or tampering.

Spletzer, Barry L.; Martinez, Michael A.; Marron, Lisa C.

2012-11-13T23:59:59.000Z

6

Solar heated rotary kiln  

SciTech Connect

A solar heated rotary kiln utilized for decomposition of materials, such as zinc sulfate. The rotary kiln has an open end and is enclosed in a sealed container having a window positioned for directing solar energy into the open end of the kiln. The material to be decomposed is directed through the container into the kiln by a feed tube. The container is also provided with an outlet for exhaust gases and an outlet for spent solids, and rests on a tiltable base. The window may be cooled and kept clear of debris by coolant gases.

Shell, Pamela K. (Tracy, CA)

1984-01-01T23:59:59.000Z

7

Rotary shaft sealing assembly  

DOE Patents (OSTI)

A rotary shaft sealing assembly in which a first fluid is partitioned from a second fluid in a housing assembly having a rotary shaft located at least partially within. In one embodiment a lip seal is lubricated and flushed with a pressure-generating seal ring preferably having an angled diverting feature. The pressure-generating seal ring and a hydrodynamic seal may be used to define a lubricant-filled region with each of the seals having hydrodynamic inlets facing the lubricant-filled region. Another aspect of the sealing assembly is having a seal to contain pressurized lubricant while withstanding high rotary speeds. Another rotary shaft sealing assembly embodiment includes a lubricant supply providing a lubricant at an elevated pressure to a region between a lip seal and a hydrodynamic seal with a flow control regulating the flow of lubricant past the lip seal. The hydrodynamic seal may include an energizer element having a modulus of elasticity greater than the modulus of elasticity of a sealing lip of the hydrodynamic seal.

Dietle, Lannie L. (Houston, TX); Schroeder, John E. (Richmond, TX); Kalsi, Manmohan S. (Houston, TX); Alvarez, Patricio D. (Richmond, TX)

2010-09-21T23:59:59.000Z

8

Rotary shaft sealing assembly  

DOE Patents (OSTI)

A rotary shaft sealing assembly in which a first fluid is partitioned from a second fluid in a housing assembly having a rotary shaft located at least partially within. In one embodiment a lip seal is lubricated and flushed with a pressure-generating seal ring preferably having an angled diverting feature. The pressure-generating seal ring and a hydrodynamic seal may be used to define a lubricant-filled region with each of the seals having hydrodynamic inlets facing the lubricant-filled region. Another aspect of the sealing assembly is having a seal to contain pressurized lubricant while withstanding high rotary speeds. Another rotary shaft sealing assembly embodiment includes a lubricant supply providing a lubricant at an elevated pressure to a region between a lip seal and a hydrodynamic seal with a flow control regulating the flow of lubricant past the lip seal. The hydrodynamic seal may include an energizer element having a modulus of elasticity greater than the modulus of elasticity of a sealing lip of the hydrodynamic seal.

Dietle, Lannie L; Schroeder, John E; Kalsi, Manmohan S; Alvarez, Patricio D

2013-08-13T23:59:59.000Z

9

Rotary magnetic heat pump  

DOE Patents (OSTI)

A rotary magnetic heat pump constructed without flow seals or segmented rotor accomplishes recuperation and regeneration by using split flow paths. Heat exchange fluid pumped through heat exchangers and returned to the heat pump splits into two flow components: one flowing counter to the rotor rotation and one flowing with the rotation.

Kirol, Lance D. (Shelly, ID)

1988-01-01T23:59:59.000Z

10

Rotary pneumatic valve  

DOE Patents (OSTI)

A rotary pneumatic valve which is thrust balanced and the pneumatic pressure developed produces only radial loads on the valve cylinder producing negligible resistance and thus minimal torque on the bearings of the valve. The valve is multiplexed such that at least two complete switching cycles occur for each revolution of the cylinder spindle. 4 figs.

Hardee, H.C.

1989-08-02T23:59:59.000Z

11

Rotary Burner Demonstration  

Science Conference Proceedings (OSTI)

The subject technology, the Calcpos Rotary Burner (CRB), is a burner that is proposed to reduce energy consumption and emission levels in comparison to currently available technology. burners are used throughout industry to produce the heat that is required during the refining process. Refineries seek to minimize the use of energy in refining while still meeting EPA regulations for emissions.

Paul Flanagan

2003-04-30T23:59:59.000Z

12

Rotary magnetic heat pump  

DOE Patents (OSTI)

A rotary magnetic heat pump constructed without flow seals or segmented rotor accomplishes recuperation and regeneration by using split flow paths. Heat exchange fluid pumped through heat exchangers and returned to the heat pump splits into two flow components: one flowing counter to the rotor rotation and one flowing with the rotation. 5 figs.

Kirol, L.D.

1987-02-11T23:59:59.000Z

13

Recirculating rotary gas compressor  

DOE Patents (OSTI)

A positive displacement, recirculating Roots-type rotary gas compressor is described which operates on the basis of flow work compression. The compressor includes a pair of large diameter recirculation conduits which return compressed discharge gas to the compressor housing, where it is mixed with low pressure inlet gas, thereby minimizing adiabatic heating of the gas. The compressor includes a pair of involutely lobed impellers and an associated port configuration which together result in uninterrupted flow of recirculation gas. The large diameter recirculation conduits equalize gas flow velocities within the compressor and minimize gas flow losses. The compressor is particularly suited to applications requiring sustained operation at higher gas compression ratios than have previously been feasible with rotary pumps, and is particularly applicable to refrigeration or other applications requiring condensation of a vapor. 12 figs.

Weinbrecht, J.F.

1992-02-25T23:59:59.000Z

14

Recirculating rotary gas compressor  

DOE Patents (OSTI)

A positive displacement, recirculating Roots-type rotary gas compressor which operates on the basis of flow work compression. The compressor includes a pair of large diameter recirculation conduits (24 and 26) which return compressed discharge gas to the compressor housing (14), where it is mixed with low pressure inlet gas, thereby minimizing adiabatic heating of the gas. The compressor includes a pair of involutely lobed impellers (10 and 12) and an associated port configuration which together result in uninterrupted flow of recirculation gas. The large diameter recirculation conduits equalize gas flow velocities within the compressor and minimize gas flow losses. The compressor is particularly suited to applications requiring sustained operation at higher gas compression ratios than have previously been feasible with rotary pumps, and is particularly applicable to refrigeration or other applications requiring condensation of a vapor.

Weinbrecht, John F. (601 Oakwood Loop, NE., Albuquerque, NM 87123)

1992-01-01T23:59:59.000Z

15

Rotary kiln seal  

SciTech Connect

A rotary seal used to prevent the escape of contaminates from a rotating kiln incinerator. The rotating seal combines a rotating disc plate which is attached to the rotating kiln shell and four sets of non-rotating carbon seal bars housed in a primary and secondary housing and which rub on the sides of the disc. A seal air system is used to create a positive pressure in a chamber between the primary and secondary seals to create a positive air flow into the contaminated gas chamber. The seal air system also employs an air inlet located between the secondary and tertiary seals to further insure that no contaminates pass the seal and enter the external environment and to provide makeup air for the air which flows into the contaminated gas chamber. The pressure exerted by the seal bars on the rotating disc is controlled by means of a preload spring. The seal is capable of operating in a thermally changing environment where the both radial expansion and axial movement of the rotating kiln do not result in the failure of the seal.

Drexler, Robert L. (Idaho Falls, ID)

1992-01-01T23:59:59.000Z

16

Rotary kiln seal  

DOE Patents (OSTI)

A rotary seal used to prevent the escape of contaminants from a rotating kiln incinerator. The rotating seal combines a rotating disc plate which is attached to the rotating kiln shell and four sets of non-rotating carbon seal bars housed in a primary and secondary housing and which rub on the sides of the disc. A seal air system is used to create a positive pressure in a chamber between the primary and secondary seals to create a positive air flow into the contaminated gas chamber. The seal air system also employs an air inlet located between the secondary and tertiary seals to further insure that no contaminants pass the seal and enter the external environment and to provide makeup air for the air which flows into the contaminated gas chamber. The pressure exerted by the seal bars on the rotating disc is controlled by means of a preload spring. The seal is capable of operating in a thermally changing environment where the both radial expansion and axial movement of the rotating kiln do not result in the failure of the seal.

Drexler, R.L.

1990-10-17T23:59:59.000Z

17

Performance optimization of rotary dehumidifiers  

SciTech Connect

A rotary dehumidifier consists of a rotating porous matrix made of a desiccant with mechanically supporting materials. The dehumidification performance of a rotary dehumidifier wheel depends on its rotational speed, the sorption properties of the desiccant, the heat and mass transfer characteristics of the matrix, and the size of the dehumidifier. The effect of the rotational speed on the dehumidification performance of a rotary dehumidifier has been investigated by Zheng, Worek, and Novosel (1993). this paper extends that previous work and investigates the effects of desiccant sorption properties, the heat and mass transfer characteristics, and the size of the rotary dehumidifier on the dehumidification performance. The results show that the using desiccant materials in a rotary dehumidifier with different adsorption characteristics results in a wide variation in dehumidification performance. However, the maximum performance of a rotary dehumidifier occurs for a desiccant material having an isotherm shape that can be characterized to have a separation factor of 0.07. Also, as the desiccant moisture uptake increases, the dehumidifier performance also increases. However, the performance improvement for a desiccant matrix having a maximum moisture uptake of larger than 0.25 by weight is not significant. The heat and mass transfer properties and the size of rotary dehumidifier are characterized by the number of transfer units NTU. Generally, the larger the NTU, the better dehumidification performance. However, similar to the maximum moisture uptake, when the NTU is larger than 12, the performance will not improve significantly. Also, the dehumidifier with the most favorable adsorption characteristic has a slower rotational speed, which results in lower power requirements to rotate the desiccant wheel and smaller carry-over losses.

Zheng, W.; Worek, W.M. [Univ. of Chicago, IL (United States). Dept. of Mechanical Engineering; Novosel, D. [Gas Research Inst., Chicago, IL (United States)

1995-02-01T23:59:59.000Z

18

Solar-heated rotary kiln  

DOE Patents (OSTI)

A solar heated rotary kiln utilized for decomposition of materials, such as zinc sulfate is disclosed. The rotary kiln has an open end and is enclosed in a sealed container having a window positioned for directing solar energy into the open end of the kiln. The material to be decomposed is directed through the container into the kiln by a feed tube. The container is also provided with an outlet for exhaust gases and an outlet for spent solids, and rests on a tiltable base. The window may be cooled and kept clear of debris by coolant gases.

Shell, P.K.

1982-04-14T23:59:59.000Z

19

Rotary actuator utilizing a shape memory alloy  

SciTech Connect

An apparatus is described comprising; (a) rotary accumulator means for accumulating a length of a shape memory alloy wire; (b) the shape memory alloy wire attached at one end to a point fixed with respect to the rotary accumulator means and attached at a second end to the rotary accumulator means; (c) biasing means for biasing the rotary accumulator means to a first position; and (d) means for heating the shape memory alloy wire to cause the shape memory alloy wire to contract, thereby rotating the rotary accumulator means from the first position to a second position.

Bloch, J.T.

1988-08-09T23:59:59.000Z

20

High bandwidth rotary fast tool servos and a hybrid rotary/linear electromagnetic actuator  

E-Print Network (OSTI)

This thesis describes the development of two high bandwidth short-stroke rotary fast tool servos and the hybrid rotary/linear electromagnetic actuator developed for one of them. Design insights, trade-off methodologies, ...

Montesanti, Richard Clement

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Rotary kilns - transport phenomena and transport processes  

Science Conference Proceedings (OSTI)

Rotary kilns and rotating industrial drying ovens are used for a wide variety of applications including processing raw minerals and feedstocks as well as heat-treating hazardous wastes. They are particularly critical in the manufacture of Portland cement. Their design and operation is critical to their efficient usage, which if done incorrectly can result in improperly treated materials and excessive, high fuel costs. This book treats all engineering aspects of rotary kilns, including thermal and fluid principles involved in their operation, as well as how to properly design an engineering process that uses rotary kilns. Chapter 1: The Rotary Kiln Evolution and Phenomenon Chapter 2: Basic Description of Rotary Kiln Operation Chapter 3: Freeboard Aerodynamic Phenomena Chapter 4: Granular Flows in Rotary Kilns Chapter 5: Mixing and Segregation Chapter 6: Combustion and Flame - includes section on types of fuels used in rotary kilns, coal types, ranking and analysis, petroleum coke combustion, scrap tire combustion, pulverized fuel (coal/coke) firing in kilns, pulverized fuel delivery and firing systems. Chapter 7: Freeboard Heat Transfer Chapter 8: Heat Transfer Processes in the Rotary Kiln Bed Chapter 9: Mass and Energy Balance Chapter 10: Rotary Kiln Minerals Process Applications.

Boateng, A.

2008-01-15T23:59:59.000Z

22

VisVIP: Installation Instructions for Windows  

Science Conference Proceedings (OSTI)

... The Windows version of VisVIP comes with three sets of sample data, which ... sites using the "Load Site" button at the bottom of the control window. ...

23

VisIOn: an interactive visualization ontology  

Science Conference Proceedings (OSTI)

VisIOn (Interactive Visualization Ontology) is a web application designed to categorize and store information about Software Visualization (SV) systems, in a way that can be easily searched and used for comparison. VisIOn will allow users and developers ... Keywords: algorithm animation, effectiveness, ontology, program visualization, repository, software visualization, taxonomy

Philippa Rhodes; Eileen Kraemer; Bina Reed

2006-03-01T23:59:59.000Z

24

VisIt Now Available On Franklin  

NLE Websites -- All DOE Office Websites (Extended Search)

VisIt Supported on VisIt Supported on Cray Systems VisIt Supported on Cray Systems May 26, 2009 franklin-16b.jpg NERSC's Cray XT4 System, Franklin Scientists computing on NERSC's Cray XT4 system, called Franklin, can have it all. Now that VisIt, one of the most popular frameworks for scientific visualization, is available on Franklin, users can run their simulations on the machine and visualize the output there too. "VisIt is a very useful tool for interpreting scientific data; researchers can use this to explore data from a variety of perspectives," says Gunther Weber of the CRD Visualization Group and the NERSC Analytics Team. He notes that the tool can be used to visualize scalar and vector fields defined on two- and three-dimensional structured and unstructured meshes.

25

Floating seal system for rotary devices  

DOE Patents (OSTI)

This invention relates to a floating seal system for rotary devices to reduce gas leakage around the rotary device in a duct and across the face of the rotary device to an adjacent duct. The peripheral seal bodies are made of resilient material having a generally U-shaped cross section wherein one of the legs is secured to a support member and the other of the legs forms a contacting seal against the rotary device. The legs of the peripheral seal form an extended angle of intersection of about 10.degree. to about 30.degree. in the unloaded condition to provide even sealing forces around the periphery of the rotary device. The peripheral seal extends around the periphery of the support member except where intersected by radial seals which reduce gas leakage across the face of the rotary device and between adjacent duct portions. The radial seal assembly is fabricated from channel bars, the smaller channel bar being secured to the divider of the support member and a larger inverted rigid floating channel bar having its legs freely movable over the legs of the smaller channel bar forming therewith a tubular channel. A resilient flexible tube is positioned within the tubular channel for substantially its full length to reduce gas leakage across the tubular channel. A spacer extends beyond the face of the floating channel near each end of the floating channel a distance to provide desired clearance between the floating channel and the face of the rotary device.

Banasiuk, Hubert A. (Chicago, IL)

1983-01-01T23:59:59.000Z

26

Floating seal system for rotary devices  

DOE Patents (OSTI)

This invention relates to a floating seal system for rotary devices to reduce gas leakage around the rotary device in a duct and across the face of the rotary device to an adjacent duct. The peripheral seal bodies are made of resilient material having a generally U-shaped cross section wherein one of the legs is secured to a support member and the other of the legs forms a contacting seal against the rotary device. The legs of the peripheral seal form an extended angle of intersection of about 10[degree] to about 30[degree] in the unloaded condition to provide even sealing forces around the periphery of the rotary device. The peripheral seal extends around the periphery of the support member except where intersected by radial seals which reduce gas leakage across the face of the rotary device and between adjacent duct portions. The radial seal assembly is fabricated from channel bars, the smaller channel bar being secured to the divider of the support member and a larger inverted rigid floating channel bar having its legs freely movable over the legs of the smaller channel bar forming therewith a tubular channel. A resilient flexible tube is positioned within the tubular channel for substantially its full length to reduce gas leakage across the tubular channel. A spacer extends beyond the face of the floating channel near each end of the floating channel a distance to provide desired clearance between the floating channel and the face of the rotary device. 5 figs.

Banasiuk, H.A.

1983-08-23T23:59:59.000Z

27

Enclosed rotary disc air pulser  

DOE Patents (OSTI)

An enclosed rotary disc air pulser for use with a solvent extraction pulse olumn includes a housing having inlet, exhaust and pulse leg ports, a shaft mounted in the housing and adapted for axial rotation therein, first and second disc members secured to the shaft within the housing in spaced relation to each other to define a chamber therebetween, the chamber being in communication with the pulse leg port, the first disc member located adjacent the inlet port, the second disc member being located adjacent the exhaust port, each disc member having a milled out portion, the disc members positioned on the shaft so that as the shaft rotates, the milled out portions permit alternative cyclical communication between the inlet port and the chamber and the exhaust port and the chamber.

Olson, A. L. (Idaho Falls, ID); Batcheller, Tom A. (Idaho Falls, ID); Rindfleisch, J. A. (Arco, ID); Morgan, John M. (Arco, ID)

1989-01-01T23:59:59.000Z

28

Enclosed rotary disc air pulser  

DOE Patents (OSTI)

This invention is comprised of an enclosed rotary disc air pulser for use with a solvent extraction pulse column includes a housing having inlet, exhaust and pulse leg ports, a shaft mounted in the housing and adapted for axial rotation therein, first and second disc members secured to the shaft within the housing in spaced relation to each other to define a chamber there between, the chamber being in communication with the pulse leg port, and first disc member located adjacent the inlet port, the second disc member being located adjacent the exhaust port, each disc member having a milled out portion, the disc members positioned on the shaft so that as the shaft rotates, the milled out portions permit alternative cyclical communication between the inlet port and the chamber and the exhaust port and chamber. 5 figs.

Olson, A.L.; Batcheller, T.A.; Rindfleisch, J.A.; Morgan, J.M.

1988-08-12T23:59:59.000Z

29

Experimental Results on Advanced Rotary Desiccant Dehumidifiers  

E-Print Network (OSTI)

The Solar Energy Research Institute (SERI) has developed the Cyclic Test Facility (CTF) to develop and validate analytical methods for evaluating and predicting the performance of advanced rotary dehumidifiers. This paper describes the CTF, the dehumidifiers tested at the CTF, and the analytical methods used. The results reported provide an engineering data base and a design tool for evaluating rotary dehumidifiers for desiccant cooling applications.

Barathan, D.; Parsons, J. M.; MaClaine-Cross, I.

1986-01-01T23:59:59.000Z

30

Experimental results on advanced rotary desiccant dehumidifiers  

DOE Green Energy (OSTI)

The Solar Energy Research Institute (SERI) has developed the Cyclic Test Facility (CTF) to develop and validate analytical methods for evaluating and predicting the performance of advanced rotary dehumidifiers. This paper describes the CTF, the dehumidifiers tested at the CTF, and the analytical methods used. The results reported provide an engineering data base and a design tool for evaluating rotary dehumidifiers for desiccant cooling applications.

Bharathan, D.; Parsons, J.; Maclaine-cross, I.

1986-08-01T23:59:59.000Z

31

Coal desulfurization in a rotary kiln combustor  

Science Conference Proceedings (OSTI)

The purpose of this project was to demonstrate the combustion of coal and coal wastes in a rotary kiln reactor with limestone addition for sulfur control. The rationale for the project was the perception that rotary systems could bring several advantages to combustion of these fuels, and may thus offer an alternative to fluid-bed boilers. Towards this end, an existing wood pyrolysis kiln (the Humphrey Charcoal kiln) was to be suitably refurbished and retrofitted with a specially designed version of a patented air distributor provided by Universal Energy, Inc. (UEI). As the project progressed beyond the initial stages, a number of issues were raised regarding the feasibility and the possible advantages of burning coals in a rotary kiln combustor and, in particular, the suitability of the Humphrey Charcoal kiln as a combustor. Instead, an opportunity arose to conduct combustion tests in the PEDCO Rotary Cascading-Bed Boiler (RCBB) commercial demonstration unit at the North American Rayon CO. (NARCO) in Elizabethton, TN. The tests focused on anthracite culm and had two objectives: (a) determine the feasibility of burning anthracite culms in a rotary kiln boiler and (b) obtain input for any further work involving the Humphrey Charcoal kiln combustor. A number of tests were conducted at the PEDCO unit. The last one was conducted on anthracite culm procured directly from the feed bin of a commercial circulating fluid-bed boiler. The results were disappointing; it was difficult to maintain sustained combustion even when large quantities of supplemental fuel were used. Combustion efficiency was poor, around 60 percent. The results suggest that the rotary kiln boiler, as designed, is ill-suited with respect to low-grade, hard to burn solid fuels, such as anthracite culm. Indeed, data from combustion of bituminous coal in the PEDCO unit suggest that with respect to coal in general, the rotary kiln boiler appears inferior to the circulating fluid bed boiler.

Cobb, J.T. Jr.

1992-09-11T23:59:59.000Z

32

VisIt at NERSC - 3D Scientific Visualization  

NLE Websites -- All DOE Office Websites (Extended Search)

allowing users to add data loaders or additional analysis tools to VisIt. The NERSC Analytics Group has developed extensions to VisIt to support NERSC user applications,...

33

Compact fast analyzer of rotary cuvette type  

DOE Patents (OSTI)

A compact fast analyzer of the rotary cuvette type is provided for simultaneously determining concentrations in a multiplicity of discrete samples using either absorbance or fluorescence measurement techniques. A rigid, generally rectangular frame defines optical passageways for the absorbance and fluorescence measurement systems. The frame also serves as a mounting structure for various optical components as well as for the cuvette rotor mount and drive system. A single light source and photodetector are used in making both absorbance and fluorescence measurements. Rotor removal and insertion are facilitated by a swing-out drive motor and rotor mount. BACKGROUND OF THE INVENTION The invention relates generally to concentration measuring instruments and more specifically to a compact fast analyzer of the rotary cuvette type which is suitable for making either absorbance or fluorescence measurements. It was made in the course of, or under, a contract with the U.S. Atomic Energy Commission.

Thacker, Louis H. (Knoxville, TN)

1976-01-01T23:59:59.000Z

34

Rotary Mode Core Sample System availability improvement  

SciTech Connect

The Rotary Mode Core Sample System (RMCSS) is used to obtain stratified samples of the waste deposits in single-shell and double-shell waste tanks at the Hanford Site. The samples are used to characterize the waste in support of ongoing and future waste remediation efforts. Four sampling trucks have been developed to obtain these samples. Truck I was the first in operation and is currently being used to obtain samples where the push mode is appropriate (i.e., no rotation of drill). Truck 2 is similar to truck 1, except for added safety features, and is in operation to obtain samples using either a push mode or rotary drill mode. Trucks 3 and 4 are now being fabricated to be essentially identical to truck 2.

Jenkins, W.W.; Bennett, K.L.; Potter, J.D. [Westinghouse Hanford Co., Richland, WA (United States); Cross, B.T.; Burkes, J.M.; Rogers, A.C. [Southwest Research Institute (United States)

1995-02-28T23:59:59.000Z

35

High Pressure Rotary Shaft Sealing Mechanism  

DOE Patents (OSTI)

A laterally translatable pressure staged rotary shaft sealing mechanism having a seal housing with a shaft passage therein being exposed to a fluid pressure P1 and with a rotary shaft being located within the shaft passage. At least one annular laterally translatable seal carrier is provided. First and second annular resilient sealing elements are supported in axially spaced relation by the annular seal carriers and have sealing relation with the rotary shaft. The seal housing and at least one seal carrier define a first pressure staging chamber exposed to the first annular resilient sealing element and a second pressure staging chamber located between and exposed to the first and second annular resilient sealing elements. A first fluid is circulated to the first pressure chamber at a pressure P1, and a second staging pressure fluid is circulated to the second pressure chamber at a fraction of pressure P1 to achieve pressure staging, cooling of the seals. Seal placement provides hydraulic force balancing of the annular seal carriers.

Dietle, Lannie (Sugar Land, TX); Gobeli, Jeffrey D. (Houston, TX)

2001-05-08T23:59:59.000Z

36

Coal desulfurization in a rotary kiln combustor  

Science Conference Proceedings (OSTI)

BCR National Laboratory (BCRNL) has initiated a project aimed at evaluating the technical and economic feasibility of using a rotary kiln, suitably modified, to burn Pennsylvania anthracite wastes, co-fired with high-sulfur bituminous coal. Limestone will be injected into the kiln for sulfur control, to determine whether high sulfur capture levels can be achieved with high sorbent utilization. The principal objectives of this work are: (1) to prove the feasibility of burning anthracite refuse, with co-firing of high-sulfur bituminous coal and with limestone injection for sulfur emissions control, in a rotary kiln fitted with a Universal Energy International (UEI) air injector system; (2) to determine the emissions levels of SO{sub x} and NO{sub x} and specifically to identify the Ca/S ratios that are required to meet New Source Performance Standards; (3) to evaluate the technical and economic merits of a commercial rotary kiln combustor in comparison to fluidized bed combustors; and, (4) to ascertain the need for further work, including additional combustion tests, prior to commercial application, and to recommend accordingly a detailed program towards this end.

Cobb, J.T. Jr.

1990-08-15T23:59:59.000Z

37

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on...

38

A unidirectional rotary solenoid as applied to stronglinks  

Science Conference Proceedings (OSTI)

This paper describes the design goals and results of an advanced development stronglink project with special emphasis on a new rotary solenoid concept. 10 figs.

Kenderdine, E.W.

1988-01-01T23:59:59.000Z

39

NIH-BNL SpaltVis SplatVis: a Data Analysis and Visualization Tool  

E-Print Network (OSTI)

the VTK library, and the GUI is done in Tcl/Tk. We use a "splatting" technique to interactively visualize mentioned. The user interface is implemented in Tcl/Tk. Figure 2, Left gives the control panel for the vi/non-cancer decision trees based 1 #12;NIH-BNL SpaltVis Figure 2: Tcl/TK GUI. Left: the control panel. Right: .schema

Tennessee, University of

40

SteelVis (CIS/2 to VRML and IFC Translator)  

Science Conference Proceedings (OSTI)

... IFC files generated by SteelVis can be imported to Google Sketchup with the IFC2SKP plugin. An IFC File Analyzer is also available. ...

2013-05-07T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Coal desulfurization in a rotary kiln combustor  

Science Conference Proceedings (OSTI)

Several issues that could have an impact on the capability to burn anthracite culm in a rotary bed boiler were identified; specifically, questions were raised concerning the specifications of the anthracite culm itself and some relating to the equipment. The anthracite culm delivered was wet, (with more than 10 percent moisture), and coarser than feed material for fluidized boilers. It was felt that using finer fuel, ensuring that it is largely dry, would aid the combustion of anthracite culm. It also appeared that if provisions were made for more efficient internal and external recycle of ash, this would also enhance the combustion of this fuel. Accordingly, the decision was made to conduct an additional campaign of tests that would incorporate these changes. The tests, conducted on July 15 and 16, 1991, involved an anthracite culm that was, in fact, obtained from a fluidized bed a heating value of 3,000 Btu/lb and came with a top size of 1/4-inch. Despite these changes, sustained combustion could not be achieved without the use of large quantities of supplemental fuel. Based on these tests, we tend to conclude that the rotary kiln is ill suited for the combustion of hard-to-burn, low-grade solid fuels like anthracite culm.

Cobb, J.T. Jr.

1991-08-29T23:59:59.000Z

42

Results of the 1000 Hour Rotary Microfilter Endurance Test  

Stellite on Nitronic 60. 8 SRNL-L3100-2010-00229 Rotary Microfilter 1000 Hour Test Flux Data for 1000 Hour Test 0 1 2 3 4 5 6 0 100 200 300 400 500 ...

43

TESTING OF THE DUAL ROTARY FILTER SYSTEM  

SciTech Connect

The Savannah River National Laboratory (SRNL) installed and tested two hydraulically connected SpinTek rotary microfilter (RMF) units to determine the behavior of a multiple filter system. Both units were successfully controlled by a control scheme written in DELTA-V architecture by Savannah River Remediation (SRR) Process Control Engineering personnel. The control system was tuned to provide satisfactory response to changing conditions during the operation of the multi-filter system. Stability was maintained through the startup and shutdown of one of the filter units while the second was still in operation. The installation configuration originally proposed by the Small Colum Ion Exchange (SCIX) project of independent filter and motor mountings may be susceptible to vibration. Significant stiffening of the filter and motor mounts was required to minimize the vibration. Alignment of the motor to the filter was a challenge in this test configuration. The deployment configuration must be easy to manipulate and allow for fine adjustment. An analysis of the vibration signature of the test system identified critical speeds. Whether it corresponds to the resonance frequency of a rotor radial vibration mode that was excited by rotor unbalance is uncertain based upon the measurements. A relative motion series should be completed on the filter with the final shaft configuration to determine if the resonances exist in the final filter design. The instrumentation selected for deployment, including the concentrate discharge control valve and flow meters, performed well. Automation of the valve control integrated well with the control scheme and when used in concert with the other control variables, allowed automated control of the dual RMF system. The one area of concern with the instrumentation was the condition resulting when the filtrate flow meter operated with less than three gpm. This low flow was at the lower range of performance for the flow meter. This should not be an issue in deployment where the desired flow rate will be within the normal operating range of the meter. Testing demonstrated that the use of a flexible line for the filtrate discharge is highly desired at the outlet of the rotary union to transition to the system piping. Isolating the vibration from the rotary union will significantly improve the lifetime of the seals. Methods to monitor and isolate individual filters should be considered during deployment. The ability to diagnose issues and isolate individual filters would allow isolation prior to failure. Thus, filters may be cleaned or repaired instead of requiring complete replacement if the condition were to continue unnoticed. Isolating the filtrate line of each filter during startup will minimize the premature buildup of solids on the filter disks. Several tests have shown that the method of filter startup can improve performance lifetime of the filters. The installation must factor in an air inlet for the draining of a filter that does not involve a reverse flow through the filter disks. The reverse flow may cause deformation of the disks or may damage other components of the filters themselves.

Herman, D.; Fowley, M.; Stefanko, D.

2011-08-29T23:59:59.000Z

44

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Wednesday, 28 April 2010 00:00 Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

45

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Wednesday, 28 April 2010 00:00 Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

46

Microwave lamp with multi-purpose rotary motor  

DOE Patents (OSTI)

In a microwave powered electrodeless lamp, a single rotary motor is used to (a) rotate the bulb and (b) provide rotary motion to a blower or pump means for providing cooling fluid to the magnetron and/or to a forced gas cooler for providing cooling gas to the bulb. The blower may consist of only of an impeller without the usual blower housing. The motor, bulb stem and bulb, or motor, bulb stem, bulb and blower may be formed as an integral unit so as to facilitate replacement. 8 figs.

Ury, M.G.; Turner, B.; Wooten, R.D.

1999-02-02T23:59:59.000Z

47

Microwave lamp with multi-purpose rotary motor  

DOE Patents (OSTI)

In a microwave powered electrodeless lamp, a single rotary motor is used to a) rotate the bulb and b) provide rotary motion to a blower or pump means for providing cooling fluid to the magnetron and/or to a forced gas cooling for providing cooler gas to the bulb. The blower may consist of only of an impeller without the usual blower housing. The motor, bulb stem and bulb, or motor, bulb stem, bulb and blower may be formed as an integral unit so as to facilitate replacement.

Ury, Michael G. (Bethesda, MD); Turner, Brian (Myersville, MD); Wooten, Robert D. (Rockville, MD)

1999-01-01T23:59:59.000Z

48

BACKPRESSURE TESTING OF ROTARY MICROFILTER DISKS  

Science Conference Proceedings (OSTI)

The Savannah River National Laboratory (SRNL), under the Department of Energy (DOE) Office of Environmental Management (EM), is modifying and testing the SpinTek{trademark} rotary microfilter (RMF) for radioactive filtration service in the Department of Energy (DOE) complex. The RMF has been shown to improve filtration throughput when compared to other conventional methods such as cross-flow filtration. A concern with the RMF was that backpressure, or reverse flow through the disk, would damage the filter membranes. Reverse flow might happen as a result of an inadvertent valve alignment during flushing. Testing was completed in the Engineering Development Laboratory (EDL) located in SRNL to study the physical effects of backpressure as well as to determine the maximum allowable back-pressure for RMF disks. The RMF disks tested at the EDL were manufactured by SpinTek{trademark} Filtration and used a Pall Corporation PMM050 filter membrane (0.5 micron nominal pore size) made from 316L stainless steel. Early versions of the RMF disks were made from synthetic materials that were incompatible with caustic solutions and radioactive service as well as being susceptible to delaminating when subjected to backpressure. Figure 1-1 shows the essential components of the RMF; 3 rotating disks and 3 stationary turbulence promoters (or shear elements) are shown. Figure 1-2 show the assembly view of a 25 disk RMF proposed for use at the Savannah River Site (SRS) and at the Hanford Facility. The purpose of the testing discussed in this report was to determine the allowable backpressure for RMF disks as well as study the physical effects of backpressure on RMF disks made with the Pall PMM050 membrane. This was accomplished by pressurizing the disks in the reverse flow direction (backpressure) until the test limit was reached or until membrane failure occurred. Backpressure was applied to the disks with air while submerged in deionized (DI) water. This method provided a visual representation of membrane integrity via bubble flow patterns. Membrane failure was defined as the inability to filter effectively at the nominal filter pore size. Effective filtration was determined by turbidity measurements of filtrate that was produced by applying forward-pressure to the disks while submerged in a representative simulant. The representative simulant was Tank 8F simulated sludge produced for SRNL by Optima Chemical. Two disks were tested. Disk 1 was tested primarily to determine approximate levels of backpressure where membrane failure occurred. These levels were then used to define the strategy for testing the Disk 2; a strategy that would better define and quantify the mode of failure.

Fowley, M.; Herman, D.

2011-04-14T23:59:59.000Z

49

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

50

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

51

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

52

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

53

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

54

Micro rotary machine and methods for using same  

SciTech Connect

A micro rotary machine may include a micro actuator and a micro shaft coupled to the micro actuator. The micro shaft comprises a horizontal shaft and is operable to be rotated by the micro actuator. A micro tool is coupled to the micro shaft and is operable to perform work in response to motion of the micro shaft.

Stalford, Harold L. (Norman, OK)

2012-04-17T23:59:59.000Z

55

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Rotary Firing in Ring-Shaped Protein Explains Unidirectionality Print Hexameric motor proteins represent a complex class of molecular machines that variously push and pull on biological molecules using adenosine triphosphate (ATP) as chemical fuel. A specialized class of ring-shaped motor proteins, hexameric helicases, can unwind DNA strands and perform large-scale manipulations of single-stranded nucleic acids in processes such as DNA replication, DNA repair, and gene expression. To understand how certain hexameric helicases walk with directional polarity along single-stranded nucleic acids, Berkeley researchers used x-ray crystallography at the ALS to solve the structure of a hexameric helicase, the Rho transcription termination factor (from E. coli), bound to both ATP mimics and an RNA substrate. The results showed that Rho functions like a rotary engine: as the motor spins, it pulls RNA strands through its interior. Interestingly, the rotary firing order of the motor is biased so that the Rho protein can walk in only one direction along the RNA chain.

56

EVALUATION OF ALTERNATIVE FILTER MEDIA FOR THE ROTARY MICROFILTER  

SciTech Connect

SRS is currently developing and testing several processes to treat high level radioactive liquid waste. These processes include the Integrated Salt Disposition Process (ISDP), the Salt Waste Processing Facility (SWPF), and the Small Column Ion Exchange Process (SCIX). Each of these processes has a solid-liquid separation process that limits its throughput. SRNL researchers identified and tested the rotary microfilter as a technology to increase solid-liquid separation throughput. The testing showed significant improvement in filter flux with the rotary microfilter over the baseline crossflow filter (i.e., 2.5-6.5X during scoping tests, as much as 10X in actual waste tests, and approximately 3X in pilot-scale tests). SRNL received funding from DOE EM-21, and subsequently DOE EM-31 to develop the rotary microfilter for high level radioactive service. The work has included upgrading the rotary microfilter for radioactive service, testing with simulated SRS waste streams, and testing it with simulated Hanford waste streams. While the filtration rate is better than that obtained during testing of crossflow filters, the authors believe the rotary microfilter throughput can be improved by using a better filter membrane. The rotary microfilter membrane is made of stainless steel (Pall PMM050). Previous testing, funded by DOE EM-21, showed that asymmetric filters composed of a ceramic membrane on top of a stainless steel support produced higher filter flux than 100% stainless steel symmetric filters in crossflow filter tests. In that testing, the Pall Accusep and Graver filters produced 13-21% larger filter flux than the baseline 0.1 {micro}m Mott filter. While the improvement in flux is not as dramatic as the improvement of the rotary filter over a crossflow filter, a 13-21% increase could reduce the lifetime of a 30 year process by 4-6 years, with significant cost savings. Subsequent rotary filter testing showed the Pall PMM050 stainless steel filter membrane produced higher flux than the Mott filter media in bench-scale and pilot-scale testing. The Accusep and Graver filter media were not evaluated in that testing, because they are not available as flat sheets. The Accusep filter was developed at ORNL and licensed to Pall Corporation. This filter has a stainless steel support structure with a zirconium oxide ceramic membrane. The pore size is 0.1 {micro}m absolute. The Graver filter has a stainless steel support structure with a titanium dioxide ceramic membrane. The pore size is 0.07 {micro}m absolute. SRNL and ORNL are working together to develop filter media similar to the Accusep and Graver media, and to test them in a bench-scale filtration apparatus to attempt to improve the throughput of the rotary microfilter. This report describes the effort.

Poirier, M.; Herman, D.; Bhave, R.

2011-09-13T23:59:59.000Z

57

Solids transportation model of an industrial rotary dryer  

SciTech Connect

A complete simulation model has been developed for an industrial rotary dryer to account for the heat and mass exchange between the solids and the gas. This simulator is mainly composed of three models: solids transportation model, furnace model, and gas model. The solids transportation model is the modified Cholette-Cloutier model. It consists of a series of interactive reservoirs which are subdivided into an active and dead compartments to account for the characteristic extended tail of the residence time distribution (RTD) curves observed in industrial dryers. To expand the validity of the model, experiments have been performed in an industrial rotary dryer to obtain RTD curves under different mineral concentrate and gas flow rates. This paper describes these experiments and presents the variation of the average residence time and model parameters as function of solids and gas flow rates.

Renaud, M.; Thibault, J.; Trusiak, A.

2000-05-01T23:59:59.000Z

58

Skew and twist resistant hydrodynamic rotary shaft seal  

DOE Patents (OSTI)

A hydrodynamically lubricated squeeze packing type rotary shaft seal suitable for lubricant retention and environmental exclusion which incorporates one or more resilient protuberances which cooperate with the gland walls to hold the seal straight in its installation groove in unpressurized and low pressure lubricant retention applications thereby preventing skew-induced wear caused by impingement of abrasive contaminants present in the environment, and which also serve as radial bearings to prevent tipping of the seal within its installation gland. 14 figs.

Dietle, L.; Kalsi, M.S.

1999-02-23T23:59:59.000Z

59

Skew and twist resistant hydrodynamic rotary shaft seal  

DOE Patents (OSTI)

A hydrodynamically lubricated squeeze packing type rotary shaft seal suitable for lubricant retention and environmental exclusion which incorporates one or more resilient protuberances which and cooperate with the gland walls to hold the seal straight in its installation groove in unpressurized and low pressure lubricant retention applications thereby preventing skew-induced wear caused by impingement of abrasive contaminants present in the environment, and which also serve as radial bearings to prevent tipping of the seal within its installation gland.

Dietle, Lannie (Sugar Land, TX); Kalsi, Manmohan Singh (Houston, TX)

1999-01-01T23:59:59.000Z

60

Rotary union for use with ultrasonic thickness measuring probe  

DOE Patents (OSTI)

A rotary union for rotatably supporting an ultrasonic probe operable to nondestructively measure the thickness of steam generator tubes to determine the amount of corrosion experienced by the tubes includes a stationary body having a bore therethrough and an outlet drain, and a fitting rotatably mounted within the upper end of the body. The fitting has a bore aligned with the bore of the body. An electrical cable positioned within a water supply tube in an annular arrangement passes through the bore of the body and the bore of the fitting. This annular arrangement, in turn, is positioned within a connector element which extends outwardly from the fitting bore and is connected to the ultrasonic probe. An elastomeric lower bushing seals the annular arrangement to the lower end of the rotary union body and an elastomeric upper bushing seals the connector element to the fitting to permit the connector element and the ultrasonic probe connected thereto to rotate with the fitting relative to the body. The lower and upper bushings permit water to be passed through the annular arrangement and into the ultrasonic probe and thereafter discharged between the annular arrangement and the connector element to the outlet drain of the rotary union body. 5 figs.

Nachbar, H.D.

1992-09-15T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Evaluation of Alternative Filter Media for the Rotary Microfilter  

SciTech Connect

The Savannah River Site is currently developing and testing several processes to treat high level radioactive liquid waste. Each of these processes has a solid-liquid separation process that limits its throughput. Savannah River National Laboratory researchers identified and tested the rotary microfilter as a technology to increase solid-liquid separation throughput. The authors believe the rotary microfilter throughput can be improved by using a better filter membrane. Previous testing showed that asymmetric filters composed of a ceramic membrane on top of a stainless steel support produced higher filter flux than 100% stainless steel symmetric filters in crossflow filter tests. Savannah River National Laboratory and Oak Ridge National Laboratory are working together to develop asymmetric ceramic ? stainless steel composite filters and asymmetric 100% stainless steel filters to improve the throughput of the rotary microfilter. The Oak Ridge National Laboratory Inorganic Membrane Group fabricated samples of alternative filter membranes. In addition, Savannah River National Laboratory obtained samples of filter membranes from Pall, Porvair, and SpinTek. They tested these samples in a static test cell with feed slurries containing monosodium titanate and simulated sludge.

Poirier, M. R.; Herman, D. T.; Bhave, R.

2011-11-09T23:59:59.000Z

62

Further Characterization of New NiTi Wire and Rotary Endodontic ...  

Science Conference Proceedings (OSTI)

Presentation Title, Further Characterization of New NiTi Wire and Rotary ... Higher-resolution transmission electron microscopy examination of M-Wire used to ...

63

Table 4.4 Crude Oil and Natural Gas Rotary Rigs in ...  

U.S. Energy Information Administration (EIA)

Table 4.4 Crude Oil and Natural Gas Rotary Rigs in Operation, 1949-2011 (Number of Rigs) Year: By Site : By Type: Total 1: Onshore

64

VisIt: a component based parallel visualization package  

SciTech Connect

We are currently developing a component based, parallel visualization and graphical analysis tool for visualizing and analyzing data on two- and three-dimensional (20, 30) meshes. The tool consists of three primary components: a graphical user interface (GUI), a viewer, and a parallel compute engine. The components are designed to be operated in a distributed fashion with the GUI and viewer typically running on a high performance visualization server and the compute engine running on a large parallel platform. The viewer and compute engine are both based on the Visualization Toolkit (VTK), an open source object oriented data manipulation and visualization library. The compute engine will make use of parallel extensions to VTK, based on MPI, developed by Los Alamos National Laboratory in collaboration with the originators of P K . The compute engine will make use of meta-data so that it only operates on the portions of the data necessary to generate the image. The meta-data can either be created as the post-processing data is generated or as a pre-processing step to using VisIt. VisIt will be integrated with the VIEWS' Tera-Scale Browser, which will provide a high performance visual data browsing capability based on multi-resolution techniques.

Ahern, S; Bonnell, K; Brugger, E; Childs, H; Meredith, J; Whitlock, B

2000-12-18T23:59:59.000Z

65

Power Production from Geothermal Brine with the Rotary Separator Turbine  

SciTech Connect

The rotary separator turbine is a new turbine device that operates with gas-liquid mixtures. This device achieves complete gas-liquid separation, generates power from the liquid and repressurizes the liquid. The use of the rotary separator turbine for geothermal power generation was investigated on this program. A pilot scale unit was designed and tested. Tests were conducted with a clean water/steam mixture and with geothermal brine/steam flows at East Mesa, California; Raft River, Idaho; and Roosevelt Hot Springs, Utah. The test results were used to calculate the performance advantage of a rotary separator turbine power system compared to a flash steam power system and a binary power system. The calculated performance advantages were then used to estimate market potential for wellhead and central station Biphase units. The measured performance in the laboratory and in the field agreed to within {+-} 10% of the predicted values. The design goal of 20 kWe was generated both in the laboratory and from brine. Separated steam quality was measured to be greater than 99.96% at all three geothermal resources and in the laboratory. Brine pressure leaving the test unit was greater than reinjection pressure requirements. Maximum brine outlet pressure of 90 psig was demonstrated. The measured performance values would result in a 34% increase in electric power production above a single stage flash steam system. Increasing the size from the pilot size unit (20kWe) to a wellhead unit (2000 kWe) gave a calculated performance advantage of 40%. Based on these favorable results, design, construction and testing of a full-size well-head unit was initiated.

Cerini, Donald J.; Hays, Lance G.

1980-12-01T23:59:59.000Z

66

A rotary-airlock valve resists abrasive mixtures  

SciTech Connect

Hill and Griffith (H and G, Cincinnati, Ohio) is a leading supplier of custom-blended additives to founderies. Thousands of tons of clay and carbon blends such as bentonite, gilsonite and pulverized coal, pass through the company's rotary-airlock feeding system each month. H and G's original rotary valves had cylinders lined with chrome, and closed-end rotors with tips made from nickel-chromium alloys. These valves remained in service for a maximum of only three months each. During that time, the abrasive mixtures passing through the valves virtually eroded them, increasing tolerances and causing significant air leakage. The leaks caused the pneumatic line to plug up, reducing the velocity of the line below the minimum level needed to carry any material. To overcome the leakage, a second blower was added to the system. This unit supplied an additional 40 brake hp to the pneumatic-conveying line. With constant maintenance of the valve and the continuous operation of both blowers, H and G was able to extend the valve's life by nine months. After 20 years of trying valves with various configuration, H and G installed a Smoot Type 6 rotary-airlock valve in September of 1985. The new valve's internals were made from abrasion-resistant grades of NiHard and Stellite. This combination of alloys prolonged the active life of the valve by improving its abrasion resistance. During its first year, the Smoot valve did not break down, leak air or require use of the secondary blower. After its first year of service no wear was found on the valve's internal surfaces. Another mechanical analysis was performed in 1991, after five additional years of valve operation. The valve, which had now handled more than 250,000 tons of product, showed minimal wear. H and G's capital costs had been reduced from 25[cents]/ton to 3[cents]/ton by the new valve.

Not Available

1993-03-01T23:59:59.000Z

67

VisTool: a Visual Tool for Querying Relational Databases  

E-Print Network (OSTI)

In this paper we describe VisTool, a prototype tool for querying relational databases by means of the visual query language VISIONARY. INTRODUCTION VISIONARY [1] is based on an iconic-diagrammatic paradigm used for both data and query representation. The external data model is called vision and is made up of the visual primitives of concept and association; the external query model is based on the definition of a dynamic and adaptive perspective for accessing data. The internal data model is relational, and the internal query model is SQL. The mapping between the visual and the relational worlds is established through an intermediate graph-based level. VISIONARY is mainly directed to naive and occasional users, who have no experience with data models and only have a general idea about the contents of the database; for this reason, the expressive power of VISIONARY is limited...

Francesca Benzi; Dario Maio; Stefano Rizzi

1998-01-01T23:59:59.000Z

68

Skew And Twist Resistant Hydrodynamic Rotary Shaft Seal  

SciTech Connect

A hydrodynamically lubricated squeeze packing type rotary shaft seal suitable for lubricant retention and environmental exclusion which incorporates one or more resilient protuberances which and cooperate with the gland walls to hold the seal straight in its installation groove in unpressurized and low pressure lubricant retention applications thereby preventing skew-induced wear caused by impingement of abrasive contaminants present in the environment, and which also serve as radial bearings to prevent tipping of the seal within its installation gland. Compared to prior art, this invention provides a dramatic reduction of seal and shaft wear in abrasive environments and provides a significant increase in seal life.

Dietle, Lannie (Sugar Land, TX); Kalsi, Manmohan Singh (Houston, TX)

2000-03-14T23:59:59.000Z

69

System and method for cooling a superconducting rotary machine  

Science Conference Proceedings (OSTI)

A system for cooling a superconducting rotary machine includes a plurality of sealed siphon tubes disposed in balanced locations around a rotor adjacent to a superconducting coil. Each of the sealed siphon tubes includes a tubular body and a heat transfer medium disposed in the tubular body that undergoes a phase change during operation of the machine to extract heat from the superconducting coil. A siphon heat exchanger is thermally coupled to the siphon tubes for extracting heat from the siphon tubes during operation of the machine.

Ackermann, Robert Adolf (Schenectady, NY); Laskaris, Evangelos Trifon (Schenectady, NY); Huang, Xianrui (Clifton Park, NY); Bray, James William (Niskayuna, NY)

2011-08-09T23:59:59.000Z

70

DEVELOPMENT OF A ROTARY MICROFILTER FOR RADIOACTIVE WASTE APPLICATIONS  

Science Conference Proceedings (OSTI)

The processing rate of Savannah River Site (SRS) high-level waste decontamination processes are limited by the flow rate of the solid-liquid separation. The baseline process, using a 0.1 micron cross-flow filter, produces {approx}0.02 gpm/sq. ft. of filtrate under expected operating conditions. Savannah River National Laboratory (SRNL) demonstrated significantly higher filter flux for actual waste samples using a small-scale rotary filter. With funding from the U. S. Department of Energy Office of Cleanup Technology, SRNL personnel are evaluating and developing the rotary microfilter for radioactive service at SRS. The authors improved the design for the disks and filter unit to make them suitable for high-level radioactive service. They procured two units using the new design, tested them with simulated SRS wastes, and evaluated the operation of the units. Work to date provides the following conclusions and program status: (1) The authors modified the design of the filter disks to remove epoxy and Ryton{reg_sign}. The new design includes welding both stainless steel and ceramic coated stainless steel filter media to a stainless steel support plate. The welded disks were tested in the full-scale unit. They showed good reliability and met filtrate quality requirements. (2) The authors modified the design of the unit, making installation and removal easier. The new design uses a modular, one-piece filter stack that is removed simply by disassembly of a flange on the upper (inlet) side of the filter housing. All seals and rotary unions are contained within the removable stack. (3) While it is extremely difficult to predict the life of the seal, the vendor representative indicates a minimum of one year in present service conditions is reasonable. Changing the seal face material from silicon-carbide to a graphite-impregnated silicon-carbide is expected to double the life of the seal. Replacement of the current seal with an air seal could increase the lifetime to 5 years and is undergoing testing in the current work. (4) The bottom bushing showed wear due to a misalignment during the manufacture of the filter tank. Replacing the graphite bushing with a more wear resistant material such as a carbide material will increase the lifetime of the bushing. This replacement requires a more wear resistant part or coating to prevent excessive wear of the shaft. The authors are currently conducting testing with the more wear resistant bushing. (5) The project team plans to use the rotary microfilter as a filter in advance of an ion exchange process under development for potential deployment in SRS waste tank risers.

Poirier, M; David Herman, D; Samuel Fink, S

2008-02-25T23:59:59.000Z

71

Research for the Crane Boom Length Coefficient Considering the Tower Head Flexibility in Rotary Plane  

Science Conference Proceedings (OSTI)

When the crane boom length in rotary plane is determined, the traditional methods only consider support condition, non-uniform, boom end lateral displacement constraint effect of amplitude dragline and hoist rope tensile forces. Ignoring tower head elastic ... Keywords: Equivalent elastic support method, Rotary plane, Tower head flexibility, Non-conservative loading, Length coefficient

Zhang Guangyun; Lan Peng; Lu Nianli

2011-01-01T23:59:59.000Z

72

Comparison of residence time models for cascading rotary dryers  

SciTech Connect

The predictions of the models of Matchett and Baker (1988), Saeman and Mitchell (1954) and Friedman and Marshall (1949) for the solids residence time in rotary dryers have been compared with both pilot-scale and industrial-scale data. A countercurrent pilot-scale dryer of 0.2m diameter and 2m long has been used with air velocities up to 1.5 m to measure the residence times of sorghum grain. The average discrepancy for the solids residence time between the predictions and the experiments that were carried out in the pilot-scale rotary dryer is {minus}10.4%. Compared with the models of Friedman and Marshall (1949) and Saeman and Mitchell (1954) for the pilot-scale data obtained here, the Matchett and Baker model is more satisfactory for predicting the solids residence time in this pilot-scale dryer. It has also been found that the model of Matchett and Baker describes the industrial data of Saeman and Mitchell (1954) than the correlation of Friedman and Marshall (1949).

Cao, W.F.; Langrish, T.A.G. [Univ. of Sydney, New South Wales (Australia). Dept. of Chemical Engineering

1999-04-01T23:59:59.000Z

73

Wear compensating seal means for rotary piston coal feeder  

SciTech Connect

The present invention is directed to a wear compensating seal arrangement for use in a rotary piston feeder utilized for feeding pulverized coal into a gasifier operating at relatively high pressures and elevated temperatures. The rotary piston feeder has a circular casing with a coal loading opening therein diametrically opposed from a coal discharge and contains a rotatable disoidal rotor having a cylinder in which a reciprocatable piston is disposed. The reciprocation of the piston within the cylinder is provided by a stationary conjugate cam whereby pulverized coal from a coal hopper at atmospheric pressure can be introduced into the cylinder and then discharged therefrom into the high pressure gasifier while maintaining minimal losses of producer gas and the expenditure of minimal energy which would detract from the efficiency of the gasification. The seal arrangement of the present invention is disposed between the rotor and the casing about the coal discharge and prevents the high pressure gases from within the gasifier from escaping between these relatively movable parts during operation of the coal feeder. The seal utilizes a primary seal in contact with the rotor and a secondary seal supporting the primary seal. The primary seal is continuously urged towards the rotor by springs and the high pressure producer gas.

Gencsoy, Hasan T. (Morgantown, WV); Gardner, John F. (Morgantown, WV)

1979-01-01T23:59:59.000Z

74

Development of a Low-Cost Rotary Steerable Drilling System  

DOE Green Energy (OSTI)

The project had the goal to develop and commercialize a low-cost rotary steerable system (LCRSS) capable of operating downhole at conventional pressures and temperatures to reduce operating costs by a minimum of 50% and lost-in-hole charges by at least 50% over the currently offered systems. The LCRSS system developed under this project does reduce operating costs by 55% and lost-in-hole charges by at least 50%. The developed product is not commercializable in its current form. The overall objective was to develop and commercialize a low cost rotary steerable system (LCRSS) capable of operating downhole at conventional pressures and temperatures (20,000 psi/150 C) while reducing the operating costs by 50% and the lost-in-hole charges by 50% over the currently available systems. The proposed reduction in costs were to be realized through the significant reduction in tool complexity, a corresponding increase in tool reliability as expressed in the mean-time between failure (MTBF), and a reduction in the time and costs required to service tools after each field operation. Ultimately, the LCRSS system was to be capable of drilling 7 7/8 in. to 9 5/8 in. borehole diameters. The project was divided into three Phases, of which Phases I & II were previously completed and reported on, and are part of the case file. Therefore, the previously reported information is not repeated herein. Phase III included the fabrication of two field ready prototypes that were to be subjected to a series of drilling tests at GTI Catoosa, DOE RMOTC, and at customer partnering wells, if possible, as appropriate in the timing of the field test objectives to fully exercise all elements of the LCRSS. These tests were conducted in an iterative process based on a performance/reliability improvement cycle with the goal of demonstrating the system met all aspects required for commercial viability. These tests were conducted to achieve continuous runs of 100+ hours with well trajectories that fully exercised the tool's build/turn/drop/hold target capabilities and its higher end ratings for bit weight, torque and rotary speed. The tool teardowns were rigorously analyzed at the conclusion of each field run to assess component wear rates and to fully document any detrimental behavior(s) observed.

Roney Nazarian

2012-01-31T23:59:59.000Z

75

High pressure rotary piston coal feeder for coal gasification applications  

DOE Patents (OSTI)

The subject development is directed to an apparatus for feeding pulverized coal into a coal gasifier operating at relatively high pressures and elevated temperatures. This apparatus is a rotary piston feeder which comprises a circular casing having a coal loading opening therein diametrically opposed from a coal discharge and contains a rotatable discoid rotor having a cylinder in which a reciprocateable piston is disposed. The reciprocation of the piston within the cylinder is provided by a stationary conjugate cam arrangement whereby the pulverized coal from a coal hopper at atmospheric pressure can be introduced into the cylinder cavity and then discharged therefrom into the high-pressure gasifier without the loss of high pressure gases from within the latter.

Gencsoy, Hasan T. (Morgantown, WV)

1977-05-24T23:59:59.000Z

76

Rim for rotary inertial energy storage device and method  

DOE Patents (OSTI)

The present invention is directed to an improved rim or a high-performance rotary inertial energy storage device (flywheel). The improved rim is fabricated from resin impregnated filamentary material which is circumferentially wound in a side-by-side relationship to form a plurality of discretely and sequentially formed concentric layers of filamentary material that are bound together in a resin matrix. The improved rim is provided by prestressing the filamentary material in each successive layer to a prescribed tension loading in accordance with a predetermined schedule during the winding thereof and then curing the resin in each layer prior to forming the next layer for providing a prestress distribution within the rim to effect a self-equilibrating compressive prestress within the windings which counterbalances the transverse or radial tensile stresses generated during rotation of the rim for inhibiting deleterious delamination problems.

Knight, Jr., Charles E. (Knoxville, TN); Pollard, Roy E. (Powell, TN)

1980-01-01T23:59:59.000Z

77

TESTING OF THE SECOND GENERATION SPINTEK ROTARY FILTER -11357  

SciTech Connect

The SpinTek rotary microfilter has been developed under the Department of Energy (DOE) Office of Environmental Management (EM) for the purpose of deployment in radioactive service in the DOE complex. The unit that was fabricated and tested is the second generation of the filter that incorporates recommended improvements from previous testing. The completion of this test satisfied a key milestone for the EM technology development program and technology readiness for deployment by Savannah River Remediation in the Small Column Ion Exchange and Sludge Washing processes at the Savannah River Site (SRS). The Savannah River National Laboratory (SRNL) contracted SpinTek Filtration to fabricate a full scale 25 disk rotary filter and perform a 1000 hour endurance test with a simulated SRS sludge. Over 1500 hours of operation have been completed with the filter. SpinTek Filtration fabricated a prototypic 25 disk rotary filter including updates to manufacturing tolerances, an updated design to the rotary joint, improved cooling to the bottom journal, decreases in disk and filter shaft hydraulic resistances. The filter disks were fabricated with 0.5 {micro} pore size, sintered-metal filter media manufactured by Pall Corporation (M050). After fabrication was complete, the filter passed acceptance tests demonstrating rejection of solids and clean water flux with a 50% improvement over the previous filters. Once the acceptance test was complete, a 1000 hour endurance test was initiated simulating a sludge washing process. The test used a simulated SRS Sludge Batch 6 recipe. The insoluble solids started at 5 wt% and were raised to 10 and 15 wt% insoluble solids to simulate the concentration of a large volume tank. The filter system was automated and set up for 24 hour unattended operation. To facilitate this, process control logic was written to operate the filter. During the development it was demonstrated that the method of starting and stopping the filter can affect the build up of filter cake on the disks and therefore the performance of the filter. The filter performed well with the simulant. Very little drop in production was noticed between the 5 and 10 wt% insoluble solids feed. Increasing to 15 wt% had a more pronounced impact due to the rheology of the feed. Acid cleaning was used to clean the filter disks in-situ and restore filtration rate to almost 90% of the initial clean disk rate. Eighty liters of 0.2 M nitric acid in conjunction with water rinses were used to clean the filter in less than 2 hours. Filter testing was completed after 1000 hours of operation were performed on the final filter assembly configuration. The total run time for the testing was over 1500 hours. At the end of the test, the sludge washing was performed successfully from approximately 5.6 M to less than 1 M sodium.

Herman, D.; Poirier, M.; Fowley, M.; Keefer, M.; Huff, T.

2011-02-02T23:59:59.000Z

78

Reflectance Vis/NIR spectroscopy for nondestructive taste characterization of Valencia oranges  

Science Conference Proceedings (OSTI)

The feasibility of reflectance Vis/NIR spectroscopy was investigated for taste characterization of Valencia oranges based on taste attributes including soluble solids content (SSC) and titratable acidity (TA), as well as taste indices including SSC to ... Keywords: BrimA, Nondestructive, Taste, Valencia orange, Vis/NIR spectroscopy

Bahareh Jamshidi; Saeid Minaei; Ezzedin Mohajerani; Hassan Ghassemian

2012-07-01T23:59:59.000Z

79

Visualizations, Screen Shots, and Data Input Files from VisIT  

DOE Data Explorer (OSTI)

VisIt is a free interactive parallel visualization and graphical analysis tool for viewing scientific data on Unix and PC platforms. Users can quickly generate visualizations from their data, animate them through time, manipulate them, and save the resulting images for presentations. VisIt contains a rich set of visualization features so that you can view your data in a variety of ways. It can be used to visualize scalar and vector fields defined on two- and three-dimensional (2D and 3D) structured and unstructured meshes. VisIt was designed to handle very large data set sizes in the terascale range and yet can also handle small data sets in the kilobyte range. The VisIT website provides a gallery of vizualizations, another set of screen shots, and allows downloads of data files for input and source codes and executables for the VisIT software suite.

80

U.S. Offshore Crude Oil and Natural Gas Rotary Rigs in Operation ...  

U.S. Energy Information Administration (EIA)

U.S. Offshore Crude Oil and Natural Gas Rotary Rigs in Operation (Number of Elements) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 1973: 99: 89: 90: 79: 72 ...

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Modeling and simulation of two-leaf semi-rotary VAWT  

Science Conference Proceedings (OSTI)

In this paper, according to the structural characteristics of two-leaf semi-rotary VAWT (vertical axis wind turbine), the microelement method and the coordinate system rotation method are used to establish the mathematical model of wind turbine and, ...

Qian Zhang; Haifeng Chen; Binbin Wang

2010-09-01T23:59:59.000Z

82

Bias in hard disk drive rotary actuator pivot bearings: measurements and lubrication phenomena  

Science Conference Proceedings (OSTI)

Bias in disk drive rotary actuator bearings exhibits complex behavior related to the history of the actuator movement. This paper investigates the hysteresis component of bias present after seeks. Measurements of bias during full stroke actuator movements ...

Daniel Helmick; William Messner; C. Fred Higgs, III

2007-04-01T23:59:59.000Z

83

Generation of Optimal Unit Distance Codes for Rotary Encoders through Simulated Evolution  

Science Conference Proceedings (OSTI)

An evolutionary algorithm is used to generate unit distance codes for absolute rotary encoders. The target is to obtain a code suitable for disk size reduction, or for resolution increase, thus overcoming the limitations of conventional Gray codes. Obtained ...

Stefano Gregori; Roberto Rossi; Guido Torelli; Valentino Liberali

2001-04-01T23:59:59.000Z

84

U.S. Offshore Crude Oil and Natural Gas Rotary Rigs in Operation ...  

U.S. Energy Information Administration (EIA)

U.S. Offshore Crude Oil and Natural Gas Rotary Rigs in Operation (Number of Elements) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 ...

85

GA 200-500 (VSD): Oil-injected rotary screw compressors, 200 ...  

U.S. Energy Information Administration (EIA)

GA 200-500 (VSD): Oil-injected rotary screw compressors, 200-500 kW / 268-670 hp.,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading air ...

86

GA 30+-90 / GA 37-90 VSD: Oil-injected rotary screw ...  

U.S. Energy Information Administration (EIA)

GA 30+-90 / GA 37-90 VSD: Oil-injected rotary screw compressors, 30-90 kW / 40-125 hp,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading air ...

87

GAe11-30 / GAe 18-30 VSD: Oil-injected rotary screw ...  

U.S. Energy Information Administration (EIA)

GAe11-30 / GAe 18-30 VSD: Oil-injected rotary screw compressors, 11-30 kW / 15-40 hp,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading air ...

88

GA 11+-30/GA 15-30 VSD: Oil-injected rotary screw compressors ...  

U.S. Energy Information Administration (EIA)

GA 11+-30/GA 15-30 VSD: Oil-injected rotary screw compressors, 11-30 kW / 15-40 hp,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading air ...

89

GA 90+-160+ / GA 110-160 VSD: Oil-injected rotary screw ...  

U.S. Energy Information Administration (EIA)

GA 90+-160+ / GA 110-160 VSD: Oil-injected rotary screw compressors, 90-160 kW / 125-200 hp.,Kunshan CompAirs Machinery Plant Co.,Ltd is the leading ...

90

U.S. Crude Oil and Natural Gas Rotary Rigs in Operation (Number of ...  

U.S. Energy Information Administration (EIA)

U.S. Crude Oil and Natural Gas Rotary Rigs in Operation (Number of Elements) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 1973: 1,219: 1,126: 1,049: 993 ...

91

Granular Attrition due to Rotary Valve in a Pneumatic Conveying System  

E-Print Network (OSTI)

The rotary valve is a widely used mechanical device in many solids-handling industrial processes. However, it may also be responsible for most of the attrition effects occurring in a typical process. In this study, the ...

Yao, Jun

92

Using the Google Visualisation API with R: googleVis-0.2.4 Package Vignette  

E-Print Network (OSTI)

The googleVis package provides an interface between R and the Google Visualisation API. The Google Visualisation API offers interactive charts which can be embedded into web pages. The best known of these charts is probably the Motion Chart, popularised by Hans Rosling in his TED talks. The functions of the googleVis package allow the user to visualise data stored in R data frames with the Google Visualisation API without uploading their data to Google. The output of a googleVis function is html code that contains the data and references to JavaScript functions hosted by Google and can be displayed via a browser.

Markus Gesmann; Diego De Castillo

2011-01-01T23:59:59.000Z

93

Hydrodynamically Lubricated Rotary Shaft Having Twist Resistant Geometry  

SciTech Connect

A hydrodynamically lubricated squeeze packing type rotary shaft with a cross-sectional geometry suitable for pressurized lubricant retention is provided which, in the preferred embodiment, incorporates a protuberant static sealing interface that, compared to prior art, dramatically improves the exclusionary action of the dynamic sealing interface in low pressure and unpressurized applications by achieving symmetrical deformation of the seal at the static and dynamic sealing interfaces. In abrasive environments, the improved exclusionary action results in a dramatic reduction of seal and shaft wear, compared to prior art, and provides a significant increase in seal life. The invention also increases seal life by making higher levels of initial compression possible, compared to prior art, without compromising hydrodynamic lubrication; this added compression makes the seal more tolerant of compression set, abrasive wear, mechanical misalignment, dynamic runout, and manufacturing tolerances, and also makes hydrodynamic seals with smaller cross-sections more practical. In alternate embodiments, the benefits enumerated above are achieved by cooperative configurations of the seal and the gland which achieve symmetrical deformation of the seal at the static and dynamic sealing interfaces. The seal may also be configured such that predetermined radial compression deforms it to a desired operative configuration, even through symmetrical deformation is lacking.

Dietle, Lannie (Houston, TX); Gobeli, Jeffrey D. (Houston, TX)

1993-07-27T23:59:59.000Z

94

Sway control method and system for rotary cranes  

DOE Patents (OSTI)

Methods and apparatuses for reducing the oscillatory motion of rotary crane payloads during operator-commanded or computer-controlled maneuvers. An Input-shaping filter receives input signals from multiple operator input devices and converts them into output signals readable by the crane controller to dampen the payload tangential and radial sway associated with rotation of the jib. The input signals are characterized by a hub rotation trajectory .gamma.(t), which includes a jib angular acceleration .gamma., a trolley acceleration x, and a load-line length velocity L. The system state variables are characterized by a tangential rotation angle .theta.(t) and a radial rotation angle .phi.(t) of the load-line. The coupled equations of motion governing the filter are non-linear and configuration-dependent. In one embodiment, a filter is provided between the operator and the crane for filtering undesired frequencies from the angular .gamma. and trolley x velocities to suppress payload oscillation. In another embodiment, crane commands are computer generated and controlled to suppress vibration of the payload using a postulated asymmetrical shape for the acceleration profiles of the jib, which profiles are uniquely determined by a set of parameters (including the acceleration pulse amplitude and the duration and coast time between pulses), or a dynamic programming approach.

Robinett, Rush D. (Tijeras, NM); Parker, Gordon G. (Houghton, MI); Feddema, John T. (Albuquerque, NM); Dohrmann, Clark R. (Albuquerque, NM); Petterson, Ben J. (Albuquerque, NM)

1999-01-01T23:59:59.000Z

95

Creating a Parallel Version of VisIt for Microsoft Windows  

Science Conference Proceedings (OSTI)

VisIt is a popular, free interactive parallel visualization and analysis tool for scientific data. Users can quickly generate visualizations from their data, animate them through time, manipulate them, and save the resulting images or movies for presentations. VisIt was designed from the ground up to work on many scales of computers from modest desktops up to massively parallel clusters. VisIt is comprised of a set of cooperating programs. All programs can be run locally or in client/server mode in which some run locally and some run remotely on compute clusters. The VisIt program most able to harness today's computing power is the VisIt compute engine. The compute engine is responsible for reading simulation data from disk, processing it, and sending results or images back to the VisIt viewer program. In a parallel environment, the compute engine runs several processes, coordinating using the Message Passing Interface (MPI) library. Each MPI process reads some subset of the scientific data and filters the data in various ways to create useful visualizations. By using MPI, VisIt has been able to scale well into the thousands of processors on large computers such as dawn and graph at LLNL. The advent of multicore CPU's has made parallelism the 'new' way to achieve increasing performance. With today's computers having at least 2 cores and in many cases up to 8 and beyond, it is more important than ever to deploy parallel software that can use that computing power not only on clusters but also on the desktop. We have created a parallel version of VisIt for Windows that uses Microsoft's MPI implementation (MSMPI) to process data in parallel on the Windows desktop as well as on a Windows HPC cluster running Microsoft Windows Server 2008. Initial desktop parallel support for Windows was deployed in VisIt 2.4.0. Windows HPC cluster support has been completed and will appear in the VisIt 2.5.0 release. We plan to continue supporting parallel VisIt on Windows so our users will be able to take full advantage of their multicore resources.

Whitlock, B J; Biagas, K S; Rawson, P L

2011-12-07T23:59:59.000Z

96

Coal desulfurization in a rotary kiln combustor. Final report, March 15, 1990--July 31, 1991  

Science Conference Proceedings (OSTI)

The purpose of this project was to demonstrate the combustion of coal and coal wastes in a rotary kiln reactor with limestone addition for sulfur control. The rationale for the project was the perception that rotary systems could bring several advantages to combustion of these fuels, and may thus offer an alternative to fluid-bed boilers. Towards this end, an existing wood pyrolysis kiln (the Humphrey Charcoal kiln) was to be suitably refurbished and retrofitted with a specially designed version of a patented air distributor provided by Universal Energy, Inc. (UEI). As the project progressed beyond the initial stages, a number of issues were raised regarding the feasibility and the possible advantages of burning coals in a rotary kiln combustor and, in particular, the suitability of the Humphrey Charcoal kiln as a combustor. Instead, an opportunity arose to conduct combustion tests in the PEDCO Rotary Cascading-Bed Boiler (RCBB) commercial demonstration unit at the North American Rayon CO. (NARCO) in Elizabethton, TN. The tests focused on anthracite culm and had two objectives: (a) determine the feasibility of burning anthracite culms in a rotary kiln boiler and (b) obtain input for any further work involving the Humphrey Charcoal kiln combustor. A number of tests were conducted at the PEDCO unit. The last one was conducted on anthracite culm procured directly from the feed bin of a commercial circulating fluid-bed boiler. The results were disappointing; it was difficult to maintain sustained combustion even when large quantities of supplemental fuel were used. Combustion efficiency was poor, around 60 percent. The results suggest that the rotary kiln boiler, as designed, is ill-suited with respect to low-grade, hard to burn solid fuels, such as anthracite culm. Indeed, data from combustion of bituminous coal in the PEDCO unit suggest that with respect to coal in general, the rotary kiln boiler appears inferior to the circulating fluid bed boiler.

Cobb, J.T. Jr.

1992-09-11T23:59:59.000Z

97

Rotary seal with enhanced lubrication and contaminant flushing  

DOE Patents (OSTI)

A resilient, ring shaped interference-type hydrodynamic rotary seal having waves on the lubricant side which provide increased film thickness and flushing action by creating contact pressure induced angulated restrictions formed by abrupt restrictive diverters. The angulated restrictions are defined by projecting ridges, corners at the trailing edge of the waves, or simply by use of a converging shape at the trailing edge of the waves which is more abrupt than the gently converging hydrodynamic inlet shape at the leading edge of the waves. The abrupt restrictive diverter performs two functions; a restricting function and a diverting function. The angulated restrictions cause a local film thickness restriction which produces a damming effect preventing a portion of the lubricant from leaking out of the dynamic sealing interface at the trailing edge of the wave, and results in a much thicker lubricant film thickness under the waves. This contributes to more film thickness in the remainder of the dynamic sealing interface toward the environment because film thickness tends to decay gradually rather than abruptly due to the relative stiffness of the seal material. Because of the angle of the abrupt restrictive diverter relative to the relative rotation direction, in conjunction with the restriction or damming effect, a strong diverting action is produced which pumps lubricant across the dynamic sealing interface toward the environment. The lubricant diversion is caused by the component of the rotational velocity tangent to the abrupt restrictive diverter. The component of rotational velocity normal to the abrupt restrictive diverter causes a portion of the lubricant film to be pumped past the abrupt restrictive diverter, thereby assuring adequate lubrication thereof.

Dietle, Lannie L. (Sugar Land, TX)

2000-01-01T23:59:59.000Z

98

ROTARY FILTER FINES TESTING FOR SMALL COLUMN ION EXCHANGE  

SciTech Connect

SRNL was requested to quantify the amount of 'fines passage' through the 0.5 micron membranes currently used for the rotary microfilter (RMF). Testing was also completed to determine if there is any additional benefit to utilizing a 0.1 micron filter to reduce the amount of fines that could pass through the filter. Quantifying of the amount of fines that passed through the two sets of membranes that were tested was accomplished by analyzing the filtrate by Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) for titanium. Even with preparations to isolate the titanium, all samples returned results of less than the instrument's detection limit of 0.184 mg/L. Test results show that the 0.5 micron filters produced a significantly higher flux while showing a negligible difference in filtrate clarity measured by turbidity. The first targeted deployment of the RMF is with the Small Column Ion Exchange (SCIX) at the Savannah River Site (SRS). SCIX uses crystalline silicotitanate (CST) to sorb cesium to decontaminate a clarified salt solution. The passage of fine particles through the filter membranes in sufficient quantities has the potential to impact the downstream facilities. To determine the amount of fines passage, a contract was established with SpinTek Filtration to operate a 3-disk pilot scale unit with prototypic filter disk and various feeds and two different filter disk membranes. SpinTek evaluated a set of the baseline 0.5 micron filter disks as well as a set of 0.1 micron filter disks to determine the amount of fine particles that would pass the membrane and to determine the flux each set produced. The membrane on both disk sets is manufactured by the Pall Corporation (PMM 050). Each set of disks was run with three feed combinations: prototypically ground CST, CST plus monosodium titanate (MST), and CST, MST, plus Sludge Batch 6 (SB6) simulant. Throughout the testing, samples of the filtrate were collected, measured for turbidity, and sent back to SRNL for analysis to quantify the amount of fines that passed through the membrane. It should be noted that even though ground CST was tested, it will be transferred to the Defense Waste Processing Facility (DWPF) feed tank and is not expected to require filtration.

Herman, D.

2011-08-03T23:59:59.000Z

99

Burning state recognition of rotary kiln using ELMs with heterogeneous features  

Science Conference Proceedings (OSTI)

Image based burning state recognition plays an important role in sintering process control of rotary kiln. Although many efforts on dealing with this problem have been made over the past years, the recognition performance cannot be satisfactory due to ... Keywords: Burning state, ELM, Eigen-flame image, Latent semantic analysis, Multivariate image analysis

Weitao Li; Dianhui Wang; Tianyou Chai

2013-02-01T23:59:59.000Z

100

Radioactive air emissions program notice of construction, rotary mode core-sampling truck and exhauster  

SciTech Connect

Efforts have been ongoing to obtain core samples from the contents of each of the Hanford Site`s 149 single-shell tanks (SSTs). The SSTs contain various amounts and combinations of liquid, sludge, and saltcake. Existing sampling equipment is unable to retrieve samples of hardened waste within established tank safety restrictions (particularly limits on temperature). A new rotary mode core-sampling system has been designed to sample tanks containing hardened wastes. The prominent feature of this new system is the use of a nitrogen gas purge. The nitrogen gas purge will cool the drill bit and prevent cross contamination of different waste layers in the tank. The nitrogen gas purge will also allow more complete sample recovery, by clearing cuttings that might otherwise obstruct the sampler or drill bit. Nitrogen was chosen over other compressed gases for its inherent safety. Many of the tanks to be sampled with the rotary mode core-sampling system are not actively ventilated, these tanks are operated at atmospheric pressure with passive (breather) high-efficiency particulate air (HEPA) filters. Unless a ventilation system of the proper capacity is used, addition of the nitrogen purge gas to SSTs will cause the tanks to pressurize. Additionally, the use of the rotary mode core-sampling system will generate aerosols and dusts potentially containing radioactive particles in the tank vapor space. Consequently, an exhauster will be required during operation of the rotary mode core-sampling system on SSTs to prevent tank pressurization and to control emissions. This exhauster will be required to be moved from tank farm to tank farm with the rotary mode core-sampling system.

Not Available

1993-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

VisIt: An End-User Tool for Visualizing and Analyzing Very Large Data  

SciTech Connect

VisIt is a popular open source tool for visualizing and analyzing data. It owes its success to its foci of increasing data understanding, large data support, and providing a robust and usable product, as well as its underlying design that fits today's supercomputing landscape. In this short paper, we describe the VisIt project and its accomplishments. The VisIt project's three focal points - understanding data, large data, and delivering a product - together form a powerful environment for analyzing data from HPC simulations. It is used in varied ways: it enables visualization scientists, computational code developers, and the physicists that run these codes to perform a broad range of data understanding activities, including debugging, making movies, and exploring data. The user interface portion of its design provides a powerful paradigm for analyzing data while the data processing portion of its design is well suited for big data. This in turn has led to many successes: in scaling up to high levels of concurrency and large data sizes, in providing a 'home' for large data algorithms, in understanding how to best use supercomputers, and, most importantly, in helping users understand their data. Further, despite significant upcoming changes in supercomputing architecture, VisIt's future appears bright, as it enjoys vibrant user and developer communities.

Childs, Hank [Lawrence Berkeley National Laboratory (LBNL); Brugger, Eric [Lawrence Livermore National Laboratory (LLNL); Whitlock, B. [Lawrence Livermore National Laboratory (LLNL); Meredith, Jeremy S [ORNL; Ahern, Sean [ORNL; Bonnell, Kathleen [Lawrence Livermore National Laboratory (LLNL); Miller, Mark [Lawrence Livermore National Laboratory (LLNL); Weber, G. [Lawrence Berkeley National Laboratory (LBNL); Harrison, Cyrus [Lawrence Livermore National Laboratory (LLNL); Pugmire, Dave [ORNL; Fogal, T. [University of Utah; Garth, Christoph [unknown; Sanderson, Allen [University of Utah; Bethel, E Wes [Lawrence Berkeley National Laboratory (LBNL); Durant, Marc [Tech-X Corporation; Camp, David [Lawrence Berkeley National Laboratory (LBNL); Favre, Jean M. [Swiss National Supercomputing Center; Ruebel, O [unknown; Navratil, Paul [Texas Advanced Computing Center; Wheeler, Matthew [Atomic Weapons Establishment; Selby, Paul [Atomic Weapons Establishment; Vivodtzev, Fabien [CEA, France

2011-01-01T23:59:59.000Z

102

BP neural networks combined with PLS applied to pattern recognition of Vis/NIRs  

Science Conference Proceedings (OSTI)

Vis/NIRs technique can be used in non-destructive measurement of the material internal quality in many fields. In this study, a mixed algorithm combined with back-propagation neural networks (BPNNs) and partial least squares (PLS) method was applied ...

Di Wu; Yong He; Yongni Shao; Shuijuan Feng

2006-09-01T23:59:59.000Z

103

Internal combustion engine with rotary valve assembly having variable intake valve timing  

DOE Patents (OSTI)

An internal combustion engine has rotary valves associated with movable shutters operable to vary the closing of intake air/fuel port sections to obtain peak volumetric efficiency over the entire range of speed of the engine. The shutters are moved automatically by a control mechanism that is responsive to the RPM of the engine. A foot-operated lever associated with the control mechanism is also used to move the shutters between their open and closed positions.

Hansen, Craig N. (Eden Prairie, MN); Cross, Paul C. (Shorewood, MN)

1995-01-01T23:59:59.000Z

104

Mathematical model and the dynamic simulation of an electromechanical rotary device. [SLENOID  

SciTech Connect

A mathematical model of an electro-mechanical rotary device is presented. This device contains a rotor, stator, and two spring-loaded arms which restrict the rotor motion. The desired action is the alignment of the rotor and the consequent movement of the arms. The SLENOID computer program for calculating the magnetic torque, air gap permeance, spring torque, damping effects, and motion of the rotor and arms is described. (LCL)

Emergy, J.D.

1980-02-01T23:59:59.000Z

105

Comparative analysis of core drilling and rotary drilling in volcanic terrane  

DOE Green Energy (OSTI)

Initially, the goal of this report is to compare and contrast penetration rates of rotary-mud drilling and core drilling in young volcanic terranes. It is widely recognized that areas containing an abundance of recent volcanic rocks are excellent targets for geothermal resources. Exploration programs depend heavily upon reliable subsurface information, because surface geophysical methods may be ineffective, inconclusive, or both. Past exploration drilling programs have mainly relied upon rotary-mud rigs for virtually all drilling activity. Core-drilling became popular several years ago, because it could deal effectively with two major problems encountered in young volcanic terranes: very hard, abrasive rock and extreme difficulty in controlling loss of circulation. In addition to overcoming these difficulties, core-drilling produced subsurface samples (core) that defined lithostratigraphy, structure and fractures far better than drill-chips. It seemed that the only negative aspect of core drilling was cost. The cost-per-foot may be two to three times higher than an ''initial quote'' for rotary drilling. In addition, penetration rates for comparable rock-types are often much lower for coring operations. This report also seeks to identify the extent of wireline core drilling (core-drilling using wireline retrieval) as a geothermal exploration tool. 25 refs., 21 figs., 13 tabs.

Flynn, T.; Trexler, D.T.; Wallace, R.H. Jr. (ed.)

1987-04-01T23:59:59.000Z

106

Demonstration of a rotary separator for two-phase brine and steam flows. Final report  

DOE Green Energy (OSTI)

The application of a two-phase rotary separator for geothermal energy conversion was demonstrated. Laboratory tests were conducted with clean water and steam at Biphase Energy Systems, Inc., Santa Monica, California. Field tests were conducted at the Union Oil Co., Tow No. 1 wellsite near Brawley, California. The system tested consisted of the major components of a total flow rotary separator/turbine conversion system. A nozzle converted the brine wellhead enthalpy to two-phase flow kinetic by impinging the nozzle flow tangentially on the inside of the separator. The flow was therefore subjected to the high centrifugal force field in the separator. This caused the liquid phase to collect as a film on the separator drum with very little energy loss. The steam was allowed to flow radially inward to the central steam discharge. Potable water was obtained by condensing the steam exhaust. The brine collection system converted the liquid film kinetic energy to static pressure head. The system was operated for 116 hours in a high salinity environment (115,000 ppM TDS). The system operated properly with no adverse effects from solids precipitation or scale buildup. The rotary separator produced separate flows of pure liquid and steam of greater than 99.5% quality.

Cerini, D.J.

1978-01-01T23:59:59.000Z

107

Modeling of the solids transportation within an industrial rotary dryer: A simple model  

SciTech Connect

To better understand the underlying phenomena taking place in an industrial rotary dryer and to determine the optimum operating conditions, a simulator in which the solids transportation, the gas flow, and the heat and mass transfer are modeled is currently being developed. This paper describes the use of interactive perfect mixers in series to model the solids transportation within an industrial rotary dryer, on the basis of an experimental residence time distribution curve (RTD). Two simple models are proposed: a series of perfect well-mixed interacting tanks and a modified Cholette-Cloutier model. The first model is not able to account for the nonideal behavior of the solids transportation in the rotary dryer. To account for the characteristic extended tail of the RTD curves observed in industrial dryers, in a second model, the solid phase is divided between an active and a dead zone. This model, with 36 cells and 25% of the volume occupied by the dead zones, modeled very well the industrial RTD curve. In addition, the model produces bed depth and axial velocity profiles that are consistent with those reported in the literature.

Duchesne, C.; Thibault, J.; Bazin, C. [Laval Univ., Sainte-Foy, Quebec (Canada)] [Laval Univ., Sainte-Foy, Quebec (Canada)

1996-07-01T23:59:59.000Z

108

Application of hybrid pattern recognition for discriminating paddy seeds of different storage periods based on Vis/NIRS  

Science Conference Proceedings (OSTI)

Hybrid pattern recognition was put forward to discriminate paddy seeds of four different storage periods based on visible/near infrared reflectance spectroscopy (Vis/NIRS). The hybrid pattern recognition included extracting feature and building classifier. ...

Li Xiaoli; Cao Fang; He Yong

2007-05-01T23:59:59.000Z

109

Integrated Status and Effectiveness Monitoring Program - Entiat River Snorkel Surveys and Rotary Screw Trap, 2007.  

DOE Green Energy (OSTI)

The USFWS Mid-Columbia River Fishery Resource Office conducted snorkel surveys at 24 sites during the summer and fall periods of 2006 survey periods as part of the Integrated Status and Effectiveness Monitoring Program in the Entiat River. A total of 37,938 fish from 15 species/genera and an unknown category were enumerated. Chinook salmon were the overall most common fish observed and comprised 15% of fish enumerated followed by rainbow trout (10%) and mountain whitefish (7%). Day surveys were conducted during the summer period 2007 (August), while night surveys were conducted during the fall 2007 (October) surveys. The USFWS Mid-Columbia River Fishery Resource Office (MCFRO) operated two rotary screw traps on the Entiat River as part of the Integrated Status and Effectiveness Monitoring Program (ISEMP) program from August through November of 2007. Along with the smolt traps, juvenile emigrants were also captured at remote locations throughout the Entiat watershed and its major tributary, the Mad River. A total of 999 wild Oncorhynchus mykiss and 5,107 wild run O. tshawytscha were PIT tagged during the study period. Rotary screw trap efficiencies averaged 22.3% for juvenile O. tshawytscha and 9.0% for juvenile O. mykiss. Rotary screw traps operated 7 days a week and remote capture operations were conducted when flow and temperature regimes permitted. This is third annual progress report to Bonneville Power Administration for the snorkel surveys conducted in the Entiat River as related to long-term effectiveness monitoring of restoration programs in this watershed. The objective of this study is to monitor the fish habitat utilization of planned in-stream restoration efforts in the Entiat River by conducting pre- and post-construction snorkel surveys at selected treatment and control sites.

Nelle, R.D.

2008-01-01T23:59:59.000Z

110

Obtaining pressures in the 10?5 Pa range with oil?sealed rotary vacuum pumps  

Science Conference Proceedings (OSTI)

Trapped oil?sealed rotary pumps are usually considered capable of ultimate pressures no lower than about 10?3 Pa. Experiments are described which confirm that most of this residual gas originates from air dissolved in the pump oil. Replacement of the air with a less soluble gas (helium) or an easily trapped gas (carbon dioxide) is shown to give a useful reduction in ultimate pressure and to reduce the oxygen partial pressure to essentially zero. Operation with completely degassed oil is shown to give ultimate pressures in the 10?5 Pa range. The design of pumps based on these principles is discussed.

B. R. F. Kendall

1982-01-01T23:59:59.000Z

111

On the use of the parabolic concentration profile assumption for a rotary desiccant dehumidifier  

SciTech Connect

The current work describes a model for a desiccant dehumidifier which uses a parabolic concentration profile assumption to model the diffusion resistance inside the desiccant particle. The relative merits of the parabolic concentration profile model compared with widely utilized rotary desiccant wheel models are discussed. The periodic steady-state parabolic concentration profile model developed is efficient and can accommodate a variety of materials. These features make it an excellent tool for design studies requiring repetitive desiccant wheel simulations. A quartic concentration profile assumption was also investigated which yielded a 2.8 percent average improvement in prediction error over the parabolic model.

Chant, E.E. [Univ. of Turabo, Gurabo (Puerto Rico); Jeter, S.M. [Georgia Inst. of Technology, Atlanta, GA (United States). George W. Woodruff School of Mechanical Engineering

1995-02-01T23:59:59.000Z

112

Local entropy generation analysis of a rotary magnetic heat pump regenerator  

SciTech Connect

The rotary magnetic heat pump has attractive thermodynamic performance but it is strongly influenced by the effectiveness of the regenerator. This study uses local entropy generation analysis to evaluate the regenerator design and to suggest design improvements. The results show that performance of the proposed design is dominated by heat transfer related entropy generation. This suggests that enhancement concepts that improve heat transfer should be considered, even if the enhancement causes a significant increase in viscous losses (pressure drop). One enhancement technique, the use of flow disrupters, was evaluated and the results showed that flow disrupters can significantly reduce thermodynamic losses.

Drost, M.K.; White, M.D.

1990-04-01T23:59:59.000Z

113

Experimental studies of heat and mass exchange in parallel-passage rotary desiccant dehumidifiers for solar cooling applications  

DOE Green Energy (OSTI)

This report presents results of work done to experimentally characterize the performance of rotary desiccant dehumidifiers and to develop and validate analytical methods for evaluating their performance in air-conditioning systems. A facility, the Cyclic Test Facility, and a test-and-analysis procedure were developed to evaluate the performance of the rotary dehumidifiers. Experiments were performed to develop a basic understanding of the simultaneous heat- and mass-transfer processes in the dehumidifiers. Two test articles were tested under cyclic operation to characterize their performance. Detailed accounts of the Cyclic Test Facility, its hardware and instrumentation, the two test articles, and data reduction and analysis methods are provided. The data provide an engineering data base for evaluating rotary desiccant dehumidifiers for cooling applications. 46 refs., 26 figs., 3 tabs.

Bharathan, D.; Parsons, J.M.; Maclaine-cross, I.L.

1987-11-01T23:59:59.000Z

114

COMPENDIUM OF COMPLETED TESTING IN SUPPORT OF ROTARY MICROFILTRATION AT SAVANNAH RIVER SITE AND HANFORD  

SciTech Connect

This report presents a chronological summary of previous technology development efforts concerning the rotary microfiltration (RMF) unit from SpinTek{trademark}. Rotary microfiltration has been developed for high radiation application over the last decades as one of the optional filtration techniques for supplemental treatment. Supplemental treatment includes a near- or in-tank solids separation and subsequent cesium removal unit, followed by an immobilization technique; this includes options such as steam reforming, bulk vitrification or cast stone (grout). The main difference between RMF and standard cross flow filtration (CFF) is the disconnection of filtrate flux from feed velocity; i.e., filtrate flux is only dependent on transmembrane pressure, filter fouling and temperature. These efforts have been supported by the U.S. Department of Energy (DOE), Office of Cleanup Technologies since the 1990s by their Environmental Management Program (currently EM-31). In order to appropriately address future testing needs, a compilation of the relevant previous testing reports was essential. This compendium does not intend to cover all of the presentations/reports that were produced over the last decades but focuses on those of relevance for developing an RMF unit fit for deployment at the Hanford site. The report is split into three parts: (1) an introductory overview, (2) Figure 1 graphically covering the main development steps and its key players and (3) a more detailed table of the citations and brief descriptions of results and recommendations.

HUBER HJ

2011-05-24T23:59:59.000Z

115

Baseline Design Compliance Matrix for the Rotary Mode Core Sampling System  

SciTech Connect

The purpose of the design compliance matrix (DCM) is to provide a single-source document of all design requirements associated with the fifteen subsystems that make up the rotary mode core sampling (RMCS) system. It is intended to be the baseline requirement document for the RMCS system and to be used in governing all future design and design verification activities associated with it. This document is the DCM for the RMCS system used on Hanford single-shell radioactive waste storage tanks. This includes the Exhauster System, Rotary Mode Core Sample Trucks, Universal Sampling System, Diesel Generator System, Distribution Trailer, X-Ray Cart System, Breathing Air Compressor, Nitrogen Supply Trailer, Casks and Cask Truck, Service Trailer, Core Sampling Riser Equipment, Core Sampling Support Trucks, Foot Clamp, Ramps and Platforms and Purged Camera System. Excluded items are tools such as light plants and light stands. Other items such as the breather inlet filter are covered by a different design baseline. In this case, the inlet breather filter is covered by the Tank Farms Design Compliance Matrix.

LECHELT, J.A.

2000-10-17T23:59:59.000Z

116

Comparison of the performance of open cycle air conditioners utilizing rotary desiccant dehumidifiers  

DOE Green Energy (OSTI)

This paper presents the results of an investigation of open cycle cooling systems using rotary desiccant dehumidifiers. Three systems, the ventilation, recirculation, and Dunkle cycles have been modeled. The performance of these systems coupled with an air-based solar system has been determined using TRNSYS simulations of system operation in four representative US climates. The system COP, fraction of the total cooling load met by the desiccant system, and fraction of the thermal energy provided by solar energy are compared. An assessment of the effect of climate and system parameters on the relative performance of the three system configurations is made. It is shown that in order to meet residential loads of 7 to 11 kW with a COP on the order of unity, systems with high effectiveness must be employed. These systems were also found to perform well when operated solely with a solar thermal input.

Jurinak, J.J.; Beckman, W.A.

1985-01-01T23:59:59.000Z

117

Control schemes for an industrial rotary calciner with a heat shield around the combustion zone  

SciTech Connect

Soda ash (sodium carbonate) is produced by calcining natural trona ore (sodium sesquicarbonate) in rotary calciners. Shell overheating, the consequent deformation of the calciner shell, and heat loss are frequently encountered problems during this operation. Installation of a concentric, metallic heat shield around the calciner`s combustion zone can help to reduce the shell temperature and recover some of the energy that would otherwise be lost. Another problem often encountered is the deterioration of product quality when the system inputs deviate from their design rates. A mathematical model of the calciner with a heat shield is used to design different control schemes in order to maintain the product quality. Performance of the designed control schemes is demonstrated via computer simulation.

Ciftci, S.; Kim, N.K. [Michigan Technological Univ., Houghton, MI (United States). Dept. of Chemical Engineering] [Michigan Technological Univ., Houghton, MI (United States). Dept. of Chemical Engineering

1999-03-01T23:59:59.000Z

118

Method and apparatus for maximizing throughput of indirectly heated rotary kilns  

DOE Patents (OSTI)

An apparatus and method for achieving improved throughput capacity of indirectly heated rotary kilns used to produce pyrolysis products such as shale oils or coal oils that are susceptible to decomposition by high kiln wall temperatures is disclosed. High throughput is achieved by firing the kiln such that optimum wall temperatures are maintained beginning at the point where the materials enter the heating section of the kiln and extending to the point where the materials leave the heated section. Multiple high velocity burners are arranged such that combustion products directly impact on the area of the kiln wall covered internally by the solid material being heated. Firing rates for the burners are controlled to maintain optimum wall temperatures.

Coates, Ralph L; Smoot, L. Douglas; Hatfield, Kent E

2012-10-30T23:59:59.000Z

119

An Advanced Solar-Powered Rotary Solid Adsorption Refrigerator with High Performance  

E-Print Network (OSTI)

In this paper, according to practical consideration, a new solar powered rotary solid adsorption refrigerator system adopting activated carbon fibre + ethanol as its adsorption pair has been designed with higher performance. Moreover, the principle of the refrigeration cycle, different components of the machine, selection of working pairs and feasible theory analysis of the refrigeration system all have been presented in detail. In addition, it shows that the new refrigerator has many great advantages including a simple structure, fast refrigeration, higher thermodynamic coefficient, friendly to the atmospheric environment, etc. This paper explains that the refrigerating process is constant, which has a promising potential for competing the 'intermittent' cycle reported before. Through improving the refrigerant performance of heat and mass transfer in the adsorbent bed, the refrigeration cycle has been advanced from the aspect of utilization of the thermal energy from low-temperature level resources. In addition, it is shown that the commercial solar powered refrigerator will be existent in the near future.

Zheng, A.; Gu, J.

2006-01-01T23:59:59.000Z

120

Stable five axes cryogenic photoemission manipulator without a differentially pumped rotary feedthrough  

Science Conference Proceedings (OSTI)

We report on the design and construction of an ultrahigh vacuum compatible cryogenic manipulator for angle resolved photoemission spectroscopy. Unlike designs that have been used so far, our design allows five motions (three translational and two angular) without a differentially pumped rotary feedthrough. The design greatly reduces the sample motion upon rotation, which is crucial in automatic data acquisition over a large area in the momentum space. The constructed manipulator shows smooth motions in vacuum and the lowest temperature it could reach is about 8 K at the sample position. Angular reproducibilities are found to be about 0.02 deg. for both of the angular motions. The wobbling motion from the rotation around the vertical rotation axis is found to be virtually nonexistent (less than 0.1 mm)

Kim, Bum Joon; Kim, Hyeong-Do; Cho, Deok-Yong; Kim, Myongjin; Oh, S.-J.; Kim, Changyoung [School of Physics and Center for Strongly Correlated Materials Research, Seoul National University, Seoul 151-742 (Korea, Republic of); Pohang Accelerator Laboratory, Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); School of Physics and Center for Strongly Correlated Materials Research, Seoul National University, Seoul 151-742 (Korea, Republic of); Pohang Accelerator Laboratory, Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); School of Physics and Center for Strongly Correlated Materials Research, Seoul National University, Seoul 151-742 (Korea, Republic of); Institute of Physics and Applied Physics, Yonsei University, Seoul 120-749 (Korea, Republic of)

2005-06-15T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Unsteady-state material balance model for a continuous rotary dissolver  

Science Conference Proceedings (OSTI)

The unsteady-state continuous rotary dissolver material balance code (USSCRD) is a useful tool with which to study the performance of the rotary dissolver under a wide variety of operating conditions. The code does stepwise continuous material balance calculations around each dissolver stage and the digester tanks. Output from the code consists of plots and tabular information on the stagewise concentration profiles of UO{sub 2}, PuO{sub 2}, fission products, Pu(NO{sub 3}){sub 4}, UO{sub 2}(NO{sub 3}){sub 2}, fission product nitrates, HNO{sub 3}, H{sub 2}O, stainless steel, total particulate, and total fuel in pins. Other information about material transfers, stagewise liquid volume, material inventory, and dissolution performance is also provided. This report describes the development of the code, its limitations, key operating parameters, usage procedures, and the results of the analysis of several sets of operating conditions. Of primary importance in this work was the estimation of the steady-state heavy metal inventory in a 0.5-t/d dissolver drum. Values ranging from {similar_to}12 to >150 kg of U + Pu were obtained for a variety of operating conditions. Realistically, inventories are expected to be near the lower end of this range. Study of the variation of operating parameters showed significant effects on dissolver product composition from intermittent solids feed. Other observations indicated that the cycle times for the digesters and shear feed should be closely coupled in order to avoid potential problems with off-specification product. 19 references, 14 tables.

Lewis, B.E.

1984-09-01T23:59:59.000Z

122

Mercury + VisIt: Integration of a Real-Time Graphical Analysis Capability into a Monte Carlo Transport Code  

Science Conference Proceedings (OSTI)

Validation of the problem definition and analysis of the results (tallies) produced during a Monte Carlo particle transport calculation can be a complicated, time-intensive processes. The time required for a person to create an accurate, validated combinatorial geometry (CG) or mesh-based representation of a complex problem, free of common errors such as gaps and overlapping cells, can range from days to weeks. The ability to interrogate the internal structure of a complex, three-dimensional (3-D) geometry, prior to running the transport calculation, can improve the user's confidence in the validity of the problem definition. With regard to the analysis of results, the process of extracting tally data from printed tables within a file is laborious and not an intuitive approach to understanding the results. The ability to display tally information overlaid on top of the problem geometry can decrease the time required for analysis and increase the user's understanding of the results. To this end, our team has integrated VisIt, a parallel, production-quality visualization and data analysis tool into Mercury, a massively-parallel Monte Carlo particle transport code. VisIt provides an API for real time visualization of a simulation as it is running. The user may select which plots to display from the VisIt GUI, or by sending VisIt a Python script from Mercury. The frequency at which plots are updated can be set and the user can visualize the simulation results as it is running.

O'Brien, M J; Procassini, R J; Joy, K I

2009-03-09T23:59:59.000Z

123

CourseVis: A graphical student monitoring tool for supporting instructors in web-based distance courses  

Science Conference Proceedings (OSTI)

This paper presents CourseVis, a system that takes a novel approach of using Web log data generated by course management systems (CMSs) to help instructors become aware of what is happening in distance learning classes. Specifically, techniques from ... Keywords: Information visualization, Student tracking, Web-based distance education

Riccardo Mazza; Vania Dimitrova

2007-02-01T23:59:59.000Z

124

DSP-Based Sensor-less Permanent Magnet Synchronous Motor Driver With Quasi-Sine PWM for Air-Conditioner Rotary Compressor.  

E-Print Network (OSTI)

??This thesis presented a sensor-less permanent magnet synchronous motor (PMSM) driver for controlling air-conditioner rotary compressor speed. In this thesis, a quasi-sine pulse-width modulation (PWM)… (more)

Liu, Li-hsiang

2012-01-01T23:59:59.000Z

125

Coal desulfurization in a rotary kiln combustor. Quarterly report No. 1, April 16, 1990--July 15, 1990  

Science Conference Proceedings (OSTI)

BCR National Laboratory (BCRNL) has initiated a project aimed at evaluating the technical and economic feasibility of using a rotary kiln, suitably modified, to burn Pennsylvania anthracite wastes, co-fired with high-sulfur bituminous coal. Limestone will be injected into the kiln for sulfur control, to determine whether high sulfur capture levels can be achieved with high sorbent utilization. The principal objectives of this work are: (1) to prove the feasibility of burning anthracite refuse, with co-firing of high-sulfur bituminous coal and with limestone injection for sulfur emissions control, in a rotary kiln fitted with a Universal Energy International (UEI) air injector system; (2) to determine the emissions levels of SO{sub x} and NO{sub x} and specifically to identify the Ca/S ratios that are required to meet New Source Performance Standards; (3) to evaluate the technical and economic merits of a commercial rotary kiln combustor in comparison to fluidized bed combustors; and, (4) to ascertain the need for further work, including additional combustion tests, prior to commercial application, and to recommend accordingly a detailed program towards this end.

Cobb, J.T. Jr.

1990-08-15T23:59:59.000Z

126

Method and system including a double rotary kiln pyrolysis or gasification of waste material  

DOE Patents (OSTI)

A method of destructively distilling an organic material in particulate form wherein the particulates are introduced through an inlet into one end of an inner rotating kiln ganged to and coaxial with an outer rotating kiln. The inner and outer kilns define a cylindrical annular space with the inlet being positioned in registry with the axis of rotation of the ganged kilns. During operation, the temperature of the wall of the inner rotary kiln at the inlet is not less than about 500.degree. C. to heat the particulate material to a temperature in the range of from about 200.degree. C. to about 900.degree. C. in a pyrolyzing atmosphere to reduce the particulate material as it moves from the one end toward the other end. The reduced particulates including char are transferred to the annular space between the inner and the outer rotating kilns near the other end of the inner rotating kiln and moved longitudinally in the annular space from near the other end toward the one end in the presence of oxygen to combust the char at an elevated temperature to produce a waste material including ash. Also, heat is provided which is transferred to the inner kiln. The waste material including ash leaves the outer rotating kiln near the one end and the pyrolysis vapor leaves through the particulate material inlet.

McIntosh, Michael J. (Bolingbrook, IL); Arzoumanidis, Gregory G. (Naperville, IL)

1997-01-01T23:59:59.000Z

127

Method and system including a double rotary kiln pyrolysis or gasification of waste material  

DOE Patents (OSTI)

A method is described for destructively distilling an organic material in particulate form wherein the particulates are introduced through an inlet into one end of an inner rotating kiln ganged to and coaxial with an outer rotating kiln. The inner and outer kilns define a cylindrical annular space with the inlet being positioned in registry with the axis of rotation of the ganged kilns. During operation, the temperature of the wall of the inner rotary kiln at the inlet is not less than about 500 C to heat the particulate material to a temperature in the range of from about 200 C to about 900 C in a pyrolyzing atmosphere to reduce the particulate material as it moves from the one end toward the other end. The reduced particulates including char are transferred to the annular space between the inner and the outer rotating kilns near the other end of the inner rotating kiln and moved longitudinally in the annular space from near the other end toward the one end in the presence of oxygen to combust the char at an elevated temperature to produce a waste material including ash. Also, heat is provided which is transferred to the inner kiln. The waste material including ash leaves the outer rotating kiln near the one end and the pyrolysis vapor leaves through the particulate material inlet. 5 figs.

McIntosh, M.J.; Arzoumanidis, G.G.

1997-09-02T23:59:59.000Z

128

Apparatus and methods for cooling and sealing rotary helical screw compressors  

DOE Patents (OSTI)

In a compression system which incorporates a rotary helical screw compressor, and for any type of gas or refrigerant, the working liquid oil is atomized through nozzles suspended in, and parallel to, the suction gas flow, or alternatively the nozzles are mounted on the suction piping. In either case, the aim is to create positively a homogeneous mixture of oil droplets to maximize the effectiveness of the working liquid oil in improving the isothermal and volumetric efficiencies. The oil stream to be atomized may first be degassed at compressor discharge pressure by heating within a pressure vessel and recovering the energy added by using the outgoing oil stream to heat the incoming oil stream. The stripped gas is typically returned to the compressor discharge flow. In the preferred case, the compressor rotors both contain a hollow cavity through which working liquid oil is injected into channels along the edges of the rotors, thereby forming a continuous and positive seal between the rotor edges and the compressor casing. In the alternative method, working liquid oil is injected either in the same direction as the rotor rotation or counter to rotor rotation through channels in the compressor casing which are tangential to the rotor edges and parallel to the rotor center lines or alternatively the channel paths coincide with the helical path of the rotor edges. 14 figs.

Fresco, A.N.

1997-08-05T23:59:59.000Z

129

Apparatus and methods for cooling and sealing rotary helical screw compressors  

DOE Patents (OSTI)

In a compression system which incorporates a rotary helical screw compressor, and for any type of gas or refrigerant, the working liquid oil is atomized through nozzles suspended in, and parallel to, the suction gas flow, or alternatively the nozzles are mounted on the suction piping. In either case, the aim is to create positively a homogeneous mixture of oil droplets to maximize the effectiveness of the working liquid oil in improving the isothermal and volumetric efficiencies. The oil stream to be atomized may first be degassed at compressor discharge pressure by heating within a pressure vessel and recovering the energy added by using the outgoing oil stream to heat the incoming oil stream. The stripped gas is typically returned to the compressor discharge flow. In the preferred case, the compressor rotors both contain a hollow cavity through which working liquid oil is injected into channels along the edges of the rotors, thereby forming a continuous and positive seal between the rotor edges and the compressor casing. In the alternative method, working liquid oil is injected either in the same direction as the rotor rotation or counter to rotor rotation through channels in the compressor casing which are tangential to the rotor edges and parallel to the rotor centerlines or alternatively the channel paths coincide with the helical path of the rotor edges.

Fresco, Anthony N. (P.O. Box 734, Upton, NY 11973)

1997-01-01T23:59:59.000Z

130

Independent one-way acting hydraulic jar sections for a rotary drill string  

SciTech Connect

First and second separate one-way acting hydraulic jar sections each include inner and outer telescopically arranged tubular members with means for connecting one end of each the inner and outer tubular members of each jar section in the drill string. Spaced seal means between the inner and outer tubular members form a chamber in each jar section for confining hydraulic operating fluid. Hydraulic jar means are formed by cooperating means on the inner and outer tubular members within each operating fluid chamber. The cooperating means is spaced axially and disengaged in each fluid chamber when the drill string is in tension and compression during rotary drilling operation to inhibit damage and wear thereto. The hydraulic jar means in the first jar section is constructed to deliver an up jar and the jar means in the separate second jar section is constructed to deliver a down jar to the drill string. Drive means in a sealed chamber in each jar section connect the inner and outer tubular members of each jar section to allow relative longitudinal movement while preventing relative rotation therebetween. Means to equalize pressure adjacent one end of each of the chambers with the pressure in the well bore is provided in each jar section, which accommodates relative longitudinal movement of the inner and outer tubular members of each jar section for selectively creating an up or down jarring force independently of the well bore pressure.

Anderson, E.A.; Webb, D.D.

1980-10-07T23:59:59.000Z

131

A method and system including a double rotary kiln pyrolysis or gasification of waste material  

DOE Patents (OSTI)

A method is described for destructively distilling an organic material in particulate form wherein the particulates are introduced through an inlet into one end of an inner rotating kiln ganged to and coaxial with an outer rotating kiln. The inner and outer kilns define a cylindrical annular space with the inlet being positioned in registry with the axis of rotation of the ganged kilns. During operation, the temperature of the wall of the inner rotary kiln at the inlet is not less than about 500 C to heat the particulate material to a temperature in the range of from about 200 C to about 900 C in a pyrolyzing atmosphere to reduce the particulate material as it moves from the one end toward the other end. The reduced particulates including char are transferred to the annular space between the inner and the outer rotating kilns near the other end of the inner rotating kiln and moved longitudinally in the annular space from near the other end toward the one end in the presence of oxygen to combust the char at an elevated temperature to produce a waste material including ash. Also, heat is provided which is transferred to the inner kiln. The waste material including ash leaves the outer rotating kiln near the one end and the pyrolysis vapor leaves through the particulate material inlet.

McIntosh, M.J.; Arzoumanidis, G.G.

1995-12-31T23:59:59.000Z

132

EVALUATION OF ALTERNATIVE FILTER MEDIA FOR THE ROTARY MICROFILTER, PHASE 2  

SciTech Connect

Testing was conducted at the Savannah River National Laboratory (SRNL) to investigate filter membrane performance in an effort to increase rotary microfilter (RMF) throughput. Membranes were tested in the SpinTek Filtration, Inc. Static Test Cell (STC), which permitted quick and easy testing of several different membranes. Testing consisted of 100 hours tests with two different slurry feeds, based on recommendations from the phase 1 testing. One feed contained Monosodium Titanate (MST) solids in a simulated salt solution. The other feed contained simulated sludge batch 6 (SB6) solids in a simulated salt solution. Five membranes were tested, one each from filter manufactures Pall and Porvair and three from the Oak Ridge National Laboratory (ORNL). The membrane from Pall is the current membrane used on the latest generation RMF. The Porvair membrane performed well in previous STC tests as well as one of the ORNL membranes. The other two membranes from ORNL were recently developed and not available for the previous STC test. The results indicate that the Porvair filter performed best with the MST slurry and the ORNL SVB6-1B filter performed best with the SB6 slurry. Difficulty was encountered with the ORNL filters due to their dimensional thickness, which was greater than the recommended filter thickness for the STC. The STC equipment was modified to complete the testing of the ORNL filters.

Fowley, M.

2012-07-31T23:59:59.000Z

133

Performance investigation on a novel two-stage solar driven rotary desiccant cooling system using composite desiccant materials  

Science Conference Proceedings (OSTI)

In this study, a two-stage solar driven rotary desiccant cooling (TSRDC) system with novel configuration and newly developed silica gel-haloid composite desiccant is proposed aiming to reduce regeneration temperature and to achieve high energy performance. Simulated results show that there also exists an optimal rotation speed for TSRDC system. Compared with one-stage system, it is found that for the similar supply air state, the required regeneration temperature of TSRDC system is lower and for the same regeneration temperature, the cooling capacity of TSRDC is bigger. (author)

Ge, T.S.; Li, Y.; Dai, Y.J.; Wang, R.Z. [Institute of Refrigeration and Cryogenics, Shanghai Jiao Tong University, Shanghai 200240 (China)

2010-02-15T23:59:59.000Z

134

Analysis of the Energy-Saving Potential of a Three-Rotary Wheel Fresh Air-Handling Unit  

E-Print Network (OSTI)

To evaluate the energy-saving potential of a proposed three-rotary wheel fresh air-handling unit (TRWFAHU), it is numerically simulated with weather data of Changsha by using a mathematical model. Compared with a conventional fresh air-handling unit, TRWFAHU can save 10.2% of primary energy and greatly decrease the energy consumption of chiller. If waste heat is available for regenerating the desiccant, the system can achieve greater energy savings. It is feasible to improve indoor air quality (IAQ) by increasing ventilation while without increasing energy consumption.

Hao, X.; Zhang, G.; Zou, S.; Liu, H.

2006-01-01T23:59:59.000Z

135

The ITER VIS/IR wide angle viewing system: Challenges and on-going R and D  

SciTech Connect

The ITER tokamak is the next generation fusion device which will allow studying burning plasma obtained by a Deuterium-Tritium (D-T) fusion reaction during hundreds of seconds. ITER vacuum vessel real-time protection will be mandatory during plasma operation to avoid water leaks and critical plasma facing components degradation. The protection system will be based on a wide angle viewing system (WAVS) composed with 18 visible (VIS) and 18 infrared (IR) cameras covering 80 % of the vacuum vessel which will be one of the major imaging systems of ITER. Compared to protection systems routinely used on current tokamaks and based on imaging (VIS and/or IR), new constraints must be taken into account because of their influence on the system performance: the harsh environment (high neutron flux) and the metallic plasma facing components (both first wall and divertor). In this new demanding context, we have achieved three mandatory R and D studies starting from the understanding of the source of signals by using realistic photonic simulation up to real-time processing strategy taken into account first order optical design constraints to define what type of performance could be reached for ITER vacuum vessel protection. (authors)

Travere, J. M.; Aumeunier, M. H.; Joanny, M.; Jouve, M.; Martin, V.; Moncada, V.; Salasca, S. [CEA DSM, IRFM, F-13018 Saint Paul-Lez-Durance (France); Marot, L. [Univ. of Basel, Dept. of Physics, CH-4056 Basel (Switzerland); Chabaud, D. [OPTIS, ZE de la Farlede, F-83078 Toulon Cedex 9 (France); Ferme, J. J. [SESO, Pole d'Activite d'Aix en Provence, 305 Rue Louis Armand, F-13792 Aix en Provence Cedex 3 (France); Bremond, F.; Thonnat, M. [INRIA, 2004 route des Lucioles, F-06902 Sophia Antipolis Cedex (France)

2011-07-01T23:59:59.000Z

136

EVALUATION OF SUPPLEMENTAL PRE-TREATMENT DEVELOPMENT REQUIREMENTS TO MEET TRL 6 ROTARY MICROFILTRATION  

SciTech Connect

In spring 2011, the Technology Maturation Plan (TMP) for the Supplemental Treatment Project (RPP-PLAN-49827, Rev. 0), Technology Maturation Plan for the Treatment Project (T4S01) was developed. This plan contains all identified actions required to reach technical maturity for a field-deployable waste feed pretreatment system. The supplemental pretreatment system has a filtration and a Cs-removal component. Subsequent to issuance of the TMP, rotary microfiltration (RMF) has been identified as the prime filtration technology for this application. The prime Cs-removal technology is small column ion exchange (ScIX) using spherical resorcinol formaldehyde (sRF) as the exchange resin. During fiscal year 2011 (FY2011) some of the tasks identified in the TMP have been completed. As of September 2011, the conceptual design package has been submitted to DOE as part of the critical decision (CD-1) process. This document describes the remaining tasks identified in the TMP to reach technical maturity and evaluates the validity of the proposed tests to fill the gaps as previously identified in the TMP. The potential vulnerabilities are presented and the completed list of criteria for the DOE guide DOE G 413.3-4 different technology readiness levels are added in an attachment. This evaluation has been conducted from a technology development perspective - all programmatic and manufacturing aspects were excluded from this exercise. Compliance with the DOE G 413.3-4 programmatic and manufacturing requirements will be addressed directly by the Treatment Project during the course of engineering design. The results of this evaluation show that completion of the proposed development tasks in the TMP are sufficient to reach TRL 6 from a technological point of view. The tasks involve actual waste tests using the current baseline configuration (2nd generation disks, 40 psi differential pressure, 30 C feed temperature) and three different simulants - the PEP, an AP-Farm and an S-saltcake. Based on FY2011 dollars used in the TMP, these tests will have ROM costs of $950K and require up to 10 months to complete. Completion of the simulant testing will satisfy the TRL 5 and TRL 6 criteria that are related to system testing with materials that represent the full range of properties in a relevant environment.

HUBER HJ

2011-10-03T23:59:59.000Z

137

Integrated Status and Effectiveness Monitoring Program - Entiat River Rotary Screw Traps,Snorkel Surveys, and Steelhead Redd Surveys, 2008.  

DOE Green Energy (OSTI)

The USFWS Mid-Columbia River Fishery Resource Office (MCRFRO) operated two rotary screw traps on the Entiat River as part of the Integrated Status and Effectiveness Monitoring Program from March through November of 2008. Along with the smolt traps, juvenile emigrants were also captured at remote locations throughout the Entiat watershed and its major tributary, the Mad River. A total of 16,782 wild salmonids were PIT tagged during the study period. Of this, 3,961(23.6%) were wild Oncorhynchus mykiss, 6,987 (41.6%) were wild spring run O. tshawytscha, and 5,591 (33.3%) were identified as wild O. tshawytscha of unknown run. Rotary screw trap efficiencies averaged 40.3% at the upper (Rkm 11.0) trap and 7.8% for the lower (Rkm 2.0) trap. These efficiencies were pooled for emigrant O. tshawytscha and O. mykiss. The MCRFRO conducted effectiveness monitoring snorkel surveys at 24 sites during the winter period and 30 sites during the summer and fall periods of 2008 as part of the Integrated Status and Effectiveness Monitoring Program in the Entiat River. The 2008 steelhead spawning grounds surveys were conducted weekly in the main Entiat River from rkm 1.1 to 44.2. A total of 222 steelhead redds were identified over the period from February 28 to June 16 2008 with April being the peak spawning month. Approximately 80% of the steelhead redds were located downstream of the rkm 26.

Nelle, R.D.; Desgroseiller, Tom; Cotter, Michael (U.S. Fish and Wildlife Service)

2009-02-17T23:59:59.000Z

138

Integrated Status and Effectiveness Monitoring Program - Entiat River Rotary Screw Traps, Snorkel Surveys, and Steelhead Redd Surveys, 2008-2009.  

DOE Green Energy (OSTI)

The USFWS Mid-Columbia River Fishery Resource Office (MCRFRO) operated two rotary screw traps on the Entiat River as part of the Integrated Status and Effectiveness Monitoring Program from March through November of 2008. Along with the smolt traps, juvenile emigrants were also captured at remote locations throughout the Entiat watershed and its major tributary, the Mad River. A total of 16,782 wild salmonids were PIT tagged during the study period. Of this, 3,961(23.6%) were wild Oncorhynchus mykiss, 6,987 (41.6%) were wild spring run O. tshawytscha, and 5,591 (33.3%) were identified as wild O. tshawytscha of unknown run. Rotary screw trap efficiencies averaged 40.3% at the upper (Rkm 11.0) trap and 7.8% for the lower (Rkm 2.0) trap. These efficiencies were pooled for emigrant O. tshawytscha and O. mykiss. The MCRFRO conducted effectiveness monitoring snorkel surveys at 24 sites during the winter period and 30 sites during the summer and fall periods of 2008 as part of the Integrated Status and Effectiveness Monitoring Program in the Entiat River. The 2008 steelhead spawning grounds surveys were conducted weekly in the main Entiat River from rkm 1.1 to 44.2. A total of 222 steelhead redds were identified over the period from February 28 to June 16 2008 with April being the peak spawning month. Approximately 80% of the steelhead redds were located downstream of the rkm 26.

Nelle, R.D.; Desgroseillier, Tom; Cotter, Michael [U.S. Fish and Wildlife Service

2009-04-14T23:59:59.000Z

139

EVALUATION OF AP-FARM SIMULANT COMPOSITION FOR ROTARY MICROFILTER TESTING  

SciTech Connect

This document identifies the feed composition of a Hanford AP tank farm simulant for rotary microfiltration testing. The composition is based on an Hanford Tank Waste Operations Simulator (HTWOS) model run in combination with Tank Waste Information Network (TWINS) data and mineralogical studies of actual waste solids. The feed simulant is intended to be used in test runs at SRNL. The simulant will be prepared in two parts: (1) A supernate, composed of water-soluble salts and (2) The undissolved (actually, undissolvable) solids. Test slurries with distinct solids concentrations (e.g., 0.5, 5 and 10 wt%) are then prepared as needed. The base for the composition of supernate and solids is the modeled feed sequence for a deployment scenario of the Supplemental Pretreatment units within AP-farm. These units comprise a filtration part, the RMF, and a Cesium-removal part, a Small Column Ion Exchange. The primary use of this simulant is for filtration testing - however, in case that it is also used for ion-exchange tests, the amount of Cs-137 that would need to be added is available in Table 1 and Attachment 3. A modified model run (MMR-049) of the Hanford Tank Waste Operations Simulator (HTWOS) system plan 6 case 3 was performed to identify the feed sequence. Case 3 assumed supplemental treatment besides the low activity waste (LAW) melter with supplemental pretreatment supporting the pretreatment facility. The MMR did not cap the duration of supplemental pretreatment to 15 months, but rather used it throughout the entire treatment mission as an add-on option to the pretreatment facility at the Waste Treatment and Immobilization Plant (WTP). Tank 241-AP-105 (AP-105) was chosen as the feed tank to the filtration unit. Other parameters included a fixed minimum of 0.5 wt% solids in the feed and a maximum Na-concentration of 5M in the supernate. The solids rejection from the filtration unit was set to 99.99% and the maximum allowed amount of solids within tank AP-105 was set to 10 wt%. A comprehensive description of the run and the full suite of results were issued as SVF-2364-00. The list of individual feed events including the amounts of liquid and solids transferred for the first five years is added as Attachment 2; the chemical composition of the supernate feed comprises Attachment 3. For the simulant composition, only the first five years of proposed feed delivery were taken into account. The main outcome of MMR-049 was that for the first five years, the feed would come mostly from AP-farms. Multiple delivery campaigns to AP-105 are included in this average feed, while minimizing the amount of contributing tanks to the solids in the feed mix.

HUBER HJ

2011-09-19T23:59:59.000Z

140

Evaluation of rotary drum screens used to protect juvenile salmonids in the Yakima River Basin, Washington, USA  

DOE Green Energy (OSTI)

The purpose of this study is to assess the design and operation of rotary drum screens. Chinook salmon Oncorhynchus tshawytscha and steelhead O. mykiss are the potentially affected fish. Cold-branded fish are released upstream of the screen facilities. For descaling tests, the fish are captured as they exit the facility and are examined for injuries, descaling, and post-test mortalities. For screen passage tests, nets are placed in the irrigation ditch, downstream of the screen facilities, to determine if fish can pass through or over the screens. More than 100 tests have been conducted with almost 35,000 fish. Additionally, nearly 2000 native fish have been evaluated. Usually less than 2% of the test fish are injured or dead, and the condition of test fish does not differ from the controls. Less than 2% of the fish pass through or over the screens when the screen seals are properly installed and maintained.

Neitzel, D.A.; Abernethy, C.S. (Pacific Northwest Lab., Richland, WA (USA)); Clune, T.J. (USDOE Bonneville Power Administration, Yakima, WA (USA))

1990-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

VisIO: enabling interactive visualization of ultra-scale, time-series data via high-bandwidth distributed I/O systems  

Science Conference Proceedings (OSTI)

Petascale simulations compute at resolutions ranging into billions of cells and write terabytes of data for visualization and analysis. Interactive visuaUzation of this time series is a desired step before starting a new run. The I/O subsystem and associated network often are a significant impediment to interactive visualization of time-varying data; as they are not configured or provisioned to provide necessary I/O read rates. In this paper, we propose a new I/O library for visualization applications: VisIO. Visualization applications commonly use N-to-N reads within their parallel enabled readers which provides an incentive for a shared-nothing approach to I/O, similar to other data-intensive approaches such as Hadoop. However, unlike other data-intensive applications, visualization requires: (1) interactive performance for large data volumes, (2) compatibility with MPI and POSIX file system semantics for compatibility with existing infrastructure, and (3) use of existing file formats and their stipulated data partitioning rules. VisIO, provides a mechanism for using a non-POSIX distributed file system to provide linear scaling of 110 bandwidth. In addition, we introduce a novel scheduling algorithm that helps to co-locate visualization processes on nodes with the requested data. Testing using VisIO integrated into Para View was conducted using the Hadoop Distributed File System (HDFS) on TACC's Longhorn cluster. A representative dataset, VPIC, across 128 nodes showed a 64.4% read performance improvement compared to the provided Lustre installation. Also tested, was a dataset representing a global ocean salinity simulation that showed a 51.4% improvement in read performance over Lustre when using our VisIO system. VisIO, provides powerful high-performance I/O services to visualization applications, allowing for interactive performance with ultra-scale, time-series data.

Mitchell, Christopher J [Los Alamos National Laboratory; Ahrens, James P [Los Alamos National Laboratory; Wang, Jun [UCF

2010-10-15T23:59:59.000Z

142

SERI Desiccant Cooling Test Facility. Status report. Preliminary data on the performance of a rotary parallel-passage silica-gel dehumidifier  

DOE Green Energy (OSTI)

This report describes the SERI Desiccant Cooling Test Facility. The facility can test bench-scale rotary dehumidifiers over a wide range of controlled conditions. We constructed and installed in the test loop a prototype parallel-passage rotary dehumidifier that has spirally wound polyester tape coated with silica gel. The initial tests gave satisfactory results indicating that approximately 90% of the silica gel was active and the overall Lewis number of the wheel was near unity. The facility has several minor difficulties including an inability to control humidity satisfactorily and nonuniform and highly turbulent inlet velocities. To completely validate the facility requires a range of dehumidifier designs. Several choices are available including constructing a second parallel-passage dehumidifier with the passage spacing more uniform.

Schultz, K.J.

1986-04-01T23:59:59.000Z

143

Apparatus and method for controlling the rotary airlocks in a coal processing system by reversing the motor current rotating the air lock  

SciTech Connect

An improvement to a coal processing system where hard materials found in the coal may cause jamming of either inflow or outflow rotary airlocks, each driven by a reversible motor. The instantaneous current used by the motor is continually monitored and compared to a predetermined value. If an overcurrent condition occurs, indicating a jamming of the airlock, a controller means starts a "soft" reverse rotation of the motor thereby clearing the jamming. Three patterns of the motor reversal are provided.

Groombridge, Clifton E. (Hardin, MT)

1996-01-01T23:59:59.000Z

144

Investigation of a rotary valving system with variable valve timing for internal combustion engines: Final technical report  

DOE Green Energy (OSTI)

The objective of the program was to provide a functional demonstration of the Hansen Rotary Valving System with Variable Valve timing (HRVS/VVT), capable of throttleless inlet charge control, as an alternative to conventional poppet-valves for use in spark ignited internal combustion engines. The goal of this new technology is to secure benefits in fuel economy, broadened torque band, vibration reduction, and overhaul accessibility. Additionally, use of the variable valve timing capability to vary the effective compression ratio is expected to improve multi-fuel tolerance and efficiency. Efforts directed at the design of HRVS components proved to be far more extensive than had been anticipated, ultimately requiring that proof-trial design/development work be performed. Although both time and funds were exhausted before optical or ion-probe types of in-cylinder investigation could be undertaken, a great deal of laboratory data was acquired during the course of the design/development work. This laboratory data is the basis for the information presented in this Final Report.

Cross, P.C.; Hansen, C.N.

1994-11-18T23:59:59.000Z

145

Enumeration of Juvenile Salmonids in the Okanogan Basin Using Rotary Screw Traps, Performance Period: March 15, 2006 - July 15, 2006.  

DOE Green Energy (OSTI)

The Colville Tribes identified the need for collecting baseline census data on the timing and abundance of juvenile salmonids in the Okanogan River basin for the purpose of documenting local fish populations, augmenting existing fishery data and assessing natural production trends of salmonids. This report documents and assesses the pilot year of rotary trap capture of salmonid smolts on the Okanogan River. The project is a component of the Colville Tribes Okanogan Basin Monitoring and Evaluation Program (OBMEP) which began in 2004. Trapping for outmigrating fish began on 14 March 2006 and continued through 11 July 2006. Anadromous forms of Oncorhynchus, including summer steelhead (O. mykiss), Chinook (O. tshawytscha), and sockeye (O. nerka), were targeted for this study; all have verified, natural production in the Okanogan basin. Both 8-ft and 5-ft rotary screw traps were deployed on the Okanogan River from the Highway 20 Bridge and typically fished during evening hours or 24 hours per day, depending upon trap position and discharge conditions. Juvenile Chinook salmon were the most abundant species trapped in 2006 (10,682 fry and 2,024 smolts), followed by sockeye (205 parr and 3,291 smolts) and steelhead (1 fry and 333 smolts). Of the trapped Chinook, all fry were wild origin and all but five of the smolts were hatchery-reared. All trapped sockeye were wild origin and 88% of the steelhead smolts were hatchery-reared. Mark-recapture experiments were conducted using Chinook fry and hatchery-reared steelhead smolts (sockeye were not used in 2006 because the peak of the juvenile migration occurred prior to the onset of the mark-recapture experiments). A total of 930 chinook fry were marked and released across eight separate release dates (numbers of marked Chinook fry released per day ranged from 34 to 290 fish). A total of 11 chinook fry were recaptured for an overall trap efficiency of 1.18%. A total of 710 hatchery-reared steelhead were marked and released across three separate release dates (numbers of steelhead released per day ranged from 100 to 500 fish). A total of 12 steelhead were recaptured for an overall trap efficiency of 1.69%. A pooled Peterson estimator with a Chapman modification was used to produce population estimates for wild Chinook fry and hatchery-reared steelhead based on the results of the mark-recapture experiments. The 2006 populations for Chinook and steelhead were estimated to be 381,554 (95% confidence intervals: 175,731-587,377) and 14,164 (6,999-21,330), respectively. The population estimates were based on the periods in which mark-recapture experiments were initialized through the end of the trapping season (10 May for steelhead and 1 June for Chinook).

Johnson, Peter N.; Rayton, Michael D.

2007-05-01T23:59:59.000Z

146

A safety assessment of rotary mode core sampling in flammable gas single shell tanks: Hanford Site, Richland, Washington  

SciTech Connect

This safety assessment (SA) addresses each of the required elements associated with the installation, operation, and removal of a rotary-mode core sampling (RMCS) device in flammable-gas single-shell tanks (SSTs). The RMCS operations are needed in order to retrieve waste samples from SSTs with hard layers of waste for which push-mode sampling is not adequate for sampling. In this SA, potential hazards associated with the proposed action were identified and evaluated systematically. Several potential accident cases that could result in radiological or toxicological gas releases were identified and analyzed and their consequences assessed. Administrative controls, procedures and design changes required to eliminate or reduce the potential of hazards were identified. The accidents were analyzed under nine categories, four of which were burn scenarios. In SSTS, burn accidents result in unacceptable consequences because of a potential dome collapse. The accidents in which an aboveground burn propagates into the dome space were shown to be in the ``beyond extremely unlikely`` frequency category. Given the unknown nature of the gas-release behavior in the SSTS, a number of design changes and administrative controls were implemented to achieve these low frequencies. Likewise, drill string fires and dome space fires were shown to be very low frequency accidents by taking credit for the design changes, controls, and available experimental and analytical data. However, a number of Bureau of Mines (BOM) tests must be completed before some of the burn accidents can be dismissed with high confidence. Under the category of waste fires, the possibility of igniting the entrapped gases and the waste itself were analyzed. Experiments are being conducted at the BOM to demonstrate that the drill bit is not capable of igniting the trapped gas in the waste. Laboratory testing and thermal analysis demonstrated that, under normal operating conditions, the drill bit will not create high enough temperatures to initiate a propagating reaction in the waste. However, system failure that coincides in a waste layer with high organic content and low moisture may initiate an exothermic reaction in the waste. Consequently, a conservative approach based on the current state of the knowledge resulted in limiting the drilling process to a subset of the flammable-gas tanks. Accidents from the chemical reactions and criticality category are shown to result in acceptable risk. A number of accidents are shown to potentially result in containment (tank liner) breach below the waste level. Mitigative features are provided for these accidents. Gas-release events without burn also are analyzed, and radiological and toxicological consequences are shown to be within risk guidelines. Finally, the consequences of potential spills are shown to be within the risk guidelines.

Raymond, R.E.

1996-04-15T23:59:59.000Z

147

Development of a cable reel development system using a rotary joint for kilometer lengths of two-fiber multi-mode fiber optic cable  

SciTech Connect

Brookhaven National Laboratory (BNL) recently developed a two-component system for use during remote inspections. The system consists of a mobile unit with television cameras and other equipment and a stationary base station. A variety of signals must be continually transmitted between the two system components as the mobile unit is moved from the location to another. Two channels of broadband (10MHz) NTSC video are transmitted from the mobile unit to the base station, and a bi-directional ``talk set`` provides audio communication between personnel at each location. In addition, several channels of RS-232 are required to support present and future instruments used at the mobile unit and controlled by personnel at the base station. Brookhaven developed a mobile unit which communicated with a base station over a 2-fiber multimode fiber optic cable. One of the design requirements was maintaining constant communication with the base station during the time the mobile unit was moved about. To provide uninterrupted communications, deployment of the 1-km long fiber optic cable was initially performed with a ``spinning reel`` mechanism. The spinning reel mechanism proved to be mechanically unsuitable, and so the cable deployment mechanism was redesigned to spool the cable off the reel. The requirement for uninterrupted communications required a two-channel fiber optic rotary joint in the design. Incorporation of the rotary joint into the design is described, and appropriate reference material is included.

Curtiss, J.A.; Jahelka, J.R.

1995-08-11T23:59:59.000Z

148

Design and experience with the WS/HS assembly movement using labview VIS, national instrument motion controllers, and compumotor electronic drive units and motors  

SciTech Connect

The Low-Energy Demonstration Accelerator (LEDA), designed and built at the Los Alamos National Laboratory, is part of the Accelerator Production of Tritium (APT) program and provides a platform for measuring high-power proton beam-halo formation. The technique used for measuring the beam halo employs nine combination Wire Scanner and Halo Scraper (WS/HS) devices. This paper will focus on the experience gained in the use of National Instrument (NI) LabVIEW VIs and motion controllers, and Compumotor electronic drive units and motors. The base configuration couples a Compumotor motor driven by a Parker-Hannifin Gemini GT Drive unit. The drive unit is controlled by a NI PXI-7344 controller card, which in turn is controlled by a PC running custom built NI LabVIEW VIs. The function of the control VI's is to interpret instructions from the main control system, the Experimental Physics and Industrial Control System (EPICS), and carry out the corresponding motion commands. The main control VI has to run all nineteen WS/HS motor axes used in the accelerator. A basic discussion of the main accelerator control system, EPICs which is hosted on a VXI platform, and its interface with the PC based LabVIEW motion control software will be included.

Day, L. A. (Lisa A.); Gilpatrick, J. D. (John Douglas); Gruchalla, M. (Michael); Martinez, D. G. (Derwin G.); O' Hara, J. F. (James F.); Shurter, R. B. (Robert B.); Stettler, M. W. (Matthew W.); Valdiviez, R. (Robert); Barr, D. S. (Dean S.)

2001-01-01T23:59:59.000Z

149

Rotary bulk solids divider  

DOE Patents (OSTI)

An apparatus for the disbursement of a bulk solid sample comprising, a gravity hopper having a top open end and a bottom discharge end, a feeder positioned beneath the gravity hopper so as to receive a bulk solid sample flowing from the bottom discharge end, and a conveyor receiving the bulk solid sample from the feeder and rotating on an axis that allows the bulk solid sample to disperse the sample to a collection station.

Maronde, Carl P. (McMurray, PA); Killmeyer, Jr., Richard P. (Pittsburgh, PA)

1992-01-01T23:59:59.000Z

150

Rotary drilling jar  

SciTech Connect

This patent describes an improved jar for use in freeing well tools and the like stuck in a well bore. The improvement comprises: tubular, inner mandrel means having a downwardly facing shoulder and having an annular groove in an exterior surface located relatively below the shoulder. The annular groove in the inner mandrel means tapers inwardly from an exterior surface of the inner mandrel means. The inner mandrel means are arranged for connection to a conduit when positioned in the well bore; and tubular, outer mandrel means encircling the inner mandrel means and arranged at a lower end for connection to the well to tool and having an upwardly facing abutment engageable with the downwardly facing shoulder.

Loeb, J.B.; Osborne, A.J.; Miglierini, R.A.

1987-05-05T23:59:59.000Z

151

Rotary slot dog  

SciTech Connect

A clamp or dog is disclosed which preferably comprises a slotted stepped cylindrical body which is inserted into a hole in a workpiece and then fastened to a base or fixture using a screw which is inserted through the slot. The stepped configuration provides an annular clamping surface which securely clamps the workpiece against the base or fixture. The slotted cylindrical configuration permits adjustment of the workpiece and retaining clamp in any direction, i.e., over 360.degree., relative to the mounting position of the screw in the base or fixture.

Cutburth, Ronald W. (Tracy, CA); Smauley, David A. (Livermore, CA)

1987-01-01T23:59:59.000Z

152

Characterization of nickel and vanadium compounds in tar sand bitumen by UV-VIS spectroscopy and size exclusion chromatography coupled with element specific detection  

Science Conference Proceedings (OSTI)

Previously, the authors examined the Ni and V in heavy crude oils, residua, and processed products by several metal speciation techniques to ascertain molecular structure and processing behavior. Two classes of metal compounds were found - metallopetroporphyrins and metallo-nonprophyrins - each having unique reactivity during processing. In efforts to better understand the binding of metals in the oil medium, they now examine NI and V in tar sand bitumens. The bitumen was solvent extracted from the sand matrix and was separated by column chromatography and the petroporphyrin content was quantitated by UV-vis spectroscopy. The petroporphyrin contents ranged from virtually none to over 36% of the total metals. Asphalt Ridge (Utah) has primarily Ni petroporphyrins; Big Clifty (Kentucky) and Athabasca (Canada) have primarily V petroporphyrins; Arroyo Grande and McKittrick (California) have roughly equal amounts of both types; and Sunnyside (Utah) has virtually none of either.

Reynolds, J.G.; Jones, E.L.; Bennett, J.A. (Lawrence Livermore National Lab., CA (USA)); Biggs, W.R. (Chevron Research Co., Richmond, CA (USA))

1989-01-01T23:59:59.000Z

153

Void bounds for fluid transport in sea ice K.M. Golden a,*, A.L. Heaton a  

E-Print Network (OSTI)

cylindrical tubes occupying a volume fraction /, k 6 /hR4 I i 8hR2 I i . ð58� This bound is again optimal the d = 2 void bounds. Consider the steady state flow of a vis- cous fluid through a cylindrical tubeVoid bounds for fluid transport in sea ice K.M. Golden a,*, A.L. Heaton a , H. Eicken b , V

Golden, Kenneth M.

154

VisGreenWorkshop Findings  

NLE Websites -- All DOE Office Websites (Extended Search)

The term "easy to use" encompasses a number of different categories, including a short learning curve, tight integration with computational frameworks, availability on the...

155

Reduction of iron-oxide-carbon composites: part II. Rates of reduction of composite pellets in a rotary hearth furnace simulator  

SciTech Connect

A new ironmaking concept is being proposed that involves the combination of a rotary hearth furnace (RHF) with an iron-bath smelter. The RHF makes use of iron-oxide-carbon composite pellets as the charge material and the final product is direct-reduced iron (DRI) in the solid or molten state. This part of the research includes the development of a reactor that simulated the heat transfer in an RHF. The external heat-transport and high heating rates were simulated by means of infrared (IR) emitting lamps. The reaction rates were measured by analyzing the off-gas and computing both the amount of CO and CO{sub 2} generated and the degree of reduction. The reduction times were found to be comparable to the residence times observed in industrial RHFs. Both artificial ferric oxide (PAH) and naturally occurring hematite and taconite ores were used as the sources of iron oxide. Coal char and devolatilized wood charcoal were the reductants. Wood charcoal appeared to be a faster reductant than coal char. However, in the PAH-containing pellets, the reverse was found to be true because of heat-transfer limitations. For the same type of reductant, hematite-containing pellets were observed to reduce faster than taconite-containing pellets because of the development of internal porosity due to cracking and fissure formation during the Fe2O{sub 3}-to-Fe3O{sub 4} transition. This is, however, absent during the reduction of taconite, which is primarily Fe3O{sub 4}. The PAH-wood-charcoal pellets were found to undergo a significant amount of swelling at low-temperature conditions, which impeded the external heat transport to the lower layers. If the average degree of reduction targeted in an RHF is reduced from 95 to approximately 70 pct by coupling the RHF with a bath smelter, the productivity of the RHF can be enhanced 1.5 to 2 times. The use of a two- or three-layer bed was found to be superior to that of a single layer, for higher productivities.

Halder, S.; Fruehan, R.J. [Praxair Inc., Tonawanda, NY (United States). Praxair Technological Center

2008-12-15T23:59:59.000Z

156

Conveyor with rotary airlock apparatus  

DOE Patents (OSTI)

This invention is comprised of an apparatus for transferring objects from a first region to a second region, the first and second regions having differing atmospheric environments. The apparatus includes a shell having an entrance and an exit, a conveyer belt running through the shell from the entrance to the exit, and a horizontally mounted `revolving door` with at least four vanes revolving about its axis. The inner surface of the shell and the top surface of the conveyer belt act as opposing walls of the `revolving door`. The conveyer belt dips as it passes under but against the revolving vanes so as not to interfere with them but to engage at least two of the vanes and define thereby a moving chamber. Preferably, the conveyer belt has ridges or grooves on its surface that engage the edges of the vanes and act to rotate the vane assembly. Conduits are provided that communicate with the interior of the shell and allow the adjustment of the atmosphere of the moving chamber or recovery of constituents of the atmosphere of the first region from the moving chamber before they escape to the second region.

Kronbert, J.W.

1993-01-01T23:59:59.000Z

157

Rotary powder feed through apparatus  

DOE Patents (OSTI)

A device for increasing the uniformity of solids within a solids fabrication system, such as a direct light fabrication (DLF) system in which gas entrained powders are passed through the focal point of a moving high-power light which fuses the particles in the powder to a surface being built up in layers. The invention provides a feed through interface wherein gas entrained powders input from stationary input lines are coupled to a rotating head of the fabrication system. The invention eliminates the need to provide additional slack in the feed lines to accommodate head rotation, and therefore reduces feed line bending movements which induce non-uniform feeding of gas entrained powder to a rotating head.

Lewis, Gary K. (Los Alamos, NM); Less, Richard M. (Los Alamos, NM)

2001-01-01T23:59:59.000Z

158

PC VisVIP ReadMe  

Science Conference Proceedings (OSTI)

... Requirements: 1) VISVIP requires Tcl/Tk, either version 8.1 or above, or the modified version 8.0 that comes with Cygwin. ...

159

VISVIP paper for WebVIS'99  

Science Conference Proceedings (OSTI)

... In addition to the static display, VISVIP provides animation facilities for the visualization of path traversal. As the animation ...

160

Movement and Injury Rates for Three Life Stages of Spring Chinook Salmon Oncorhynchus Tshawytscha : A Comparison of Submerged Orifices and an Overflow Weir for Fish Bypass in a Modular Rotary Drum Fish Screen : Annual Report 1995.  

DOE Green Energy (OSTI)

The Pacific Northwest National Laboratory (PNNL) evaluated the effectiveness of 6-in. and 2-in. submerged orifices, and an overflow weir for fish bypass at a rotary drum fish screening facility. A modular drum screen built by the Washington Department of Fish and Wildlife (WDFW) was installed at PNNL`s Aquatic Ecology research laboratory in Richland, Washington. Fry, subyearlings, and smolts of spring chinook salmon (Oncorhynchus tshawyacha) were introduced into the test system, and their movement and injury rates were monitored. A total of 33 tests (100 fish per test) that lasted from 24 to 48 hr were completed from 1994 through 1995. Passage rate depended on both fish size and bypass configuration. For fry/fingerling spring chinook salmon, there was no difference in passage rate through the three bypass configurations (2-in. orifice, 6-in. orifice, or overflow weir). Subyearlings moved sooner when the 6-in. orifice was used, with more than 50% exiting through the fish bypass in the first 8 hr. Smolts exited quickly and preferred the 6-in. orifice, with over 90% of the smolts exiting through the bypass in less than 2 hr. Passage was slightly slower when a weir was used, with 90% of the smolts exiting in about 4 hr. When the 2-in. orifice was used in the bypass, 90% of the smolts did not exit until after 8 hr. In addition, about 7% of the smolts failed to migrate from the forebay within 24 hr, indicating that smolts were significantly delayed when the 2-in. orifice was used. Few significant injuries were detected for any of the life stages. However, light descaling occurred on about 15% of chinook salmon smolts passing through the 2-in. orifice. Although a single passage through the orifice did not appear to cause significant scale loss or other damage, passing through several screening facilities with 2-in. orifices could cause cumulative injuries.

Abernethy, C. Scott; Neitzel, Duane A.; Mavros, William V.

1996-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Stabilizing geometry for hydrodynamic rotary seals  

DOE Patents (OSTI)

A hydrodynamic sealing assembly including a first component having first and second walls and a peripheral wall defining a seal groove, a second component having a rotatable surface relative to said first component, and a hydrodynamic seal comprising a seal body of generally ring-shaped configuration having a circumference. The seal body includes hydrodynamic and static sealing lips each having a cross-sectional area that substantially vary in time with each other about the circumference. In an uninstalled condition, the seal body has a length defined between first and second seal body ends which varies in time with the hydrodynamic sealing lip cross-sectional area. The first and second ends generally face the first and second walls, respectively. In the uninstalled condition, the first end is angulated relative to the first wall and the second end is angulated relative to the second wall. The seal body has a twist-limiting surface adjacent the static sealing lip. In the uninstalled condition, the twist-limiting surface is angulated relative to the peripheral wall and varies along the circumference. A seal body discontinuity and a first component discontinuity mate to prevent rotation of the seal body relative to the first component.

Dietle, Lannie L. (Houston, TX); Schroeder, John E. (Richmond, TX)

2010-08-10T23:59:59.000Z

162

Rotary steerable motor system for underground drilling  

Science Conference Proceedings (OSTI)

A preferred embodiment of a system for rotating and guiding a drill bit in an underground bore includes a drilling motor and a drive shaft coupled to drilling motor so that drill bit can be rotated by the drilling motor. The system further includes a guidance module having an actuating arm movable between an extended position wherein the actuating arm can contact a surface of the bore and thereby exert a force on the housing of the guidance module, and a retracted position.

Turner, William E. (Durham, CT); Perry, Carl A. (Middletown, CT); Wassell, Mark E. (Kingwood, TX); Barbely, Jason R. (Middletown, CT); Burgess, Daniel E. (Middletown, CT); Cobern, Martin E. (Cheshire, CT)

2010-07-27T23:59:59.000Z

163

Continuous Flow Differential Pressure Rotary Transport ...  

This patent-pending active material transport system design concept provides solutions to several process challenges associated with moving materials ...

164

34th annual reed rotary rig census  

SciTech Connect

This article reports that the number of rigs active according to the 1986 census is 1052, which represents a decline of 1573 rigs from 1985 figures. This 60 percent decrease is the largest decline of active rigs in the 34-year history of the census. The 1986 census takers found 3993 rigs are available with the capacity to drill deeper than 3000 ft. The count has thus declined by 416 rigs (9 percent) from the 1985 total of 4409. Rig availability declined for the fourth consecutive year following nine straight years of fleet expansion (1974-1982). During the past four years, 1651 rigs have been removed from the drilling fleet representing a 29 percent decline from the record high number of rigs available in 1982. The 1986 decline in the available U.S. fleet is considerably less than what many industry observers had been anticipating. A larger decrease in the rig fleet has not been realized for a number of reasons.

Hutchinson, D.L.; Pastusek, P.E.

1986-10-01T23:59:59.000Z

165

CareVis: Integrated Visualization of Computerized Protocols and Temporal  

E-Print Network (OSTI)

Objects [14], the Time Annotation Glyph [11], and SOPO View [15] were especially developed to represent. The interactive 2D technique SOPO View [15] utilizes Rit's sets of possible occurrences (SOPOs) [17]. The axes duration are the constraining borders parallel to the 45 time flow axis. The area that a SOPO covers

166

VisVIP: Installation Instructions for UNIX Source  

Science Conference Proceedings (OSTI)

... launches a Tcl/Tk process for the control menu. Thus you need a Tcl/Tk implementation installed on your system. exchanges ...

167

VisVIP: Installation Instructions for UNIX Executable  

Science Conference Proceedings (OSTI)

... invokes Xlib for graphic input (mouse, spaceball, keyboard) and exchanges information with the Tcl/Tk menu via generated X events. ...

168

VisFiles: the next surge of visualization research  

Science Conference Proceedings (OSTI)

It has been twenty years since the surge of visualization research following the publication of the report on Visualization in Scientific Computing by the U.S. National Science Foundation (NSF) in 1987. Visualization has become a mature discipline, and ...

Kwan-Liu Ma

2007-08-01T23:59:59.000Z

169

Transport Kinetics vis Electrical Double Layers at Solid–Liquid ...  

Science Conference Proceedings (OSTI)

New Saccharification Process of Cellulosic Biomass by Microwave Irradiation · Novel Lamination Method for Large Armor Panels · Raman Spectroscopy for ...

170

Geospatial Visualization of Global Satellite Images with Vis-EROS  

SciTech Connect

The Earth Resources Observation and Science (EROS) Center of U.S. Geological Survey is currently managing and maintaining the world largest satellite images distribution system, which provides 24/7 free download service for researchers all over the globe in many areas such as Geology, Hydrology, Climate Modeling, and Earth Sciences. A large amount of geospatial data contained in satellite images maintained by EROS is generated every day. However, this data is not well utilized due to the lack of efficient data visualization tools. This software implements a method for visualizing various characteristics of the global satellite image download requests. More specifically, Keyhole Markup Language (KML) files are generated which can be loaded into an earth browser such as Google Earth. Colored rectangles associated with stored satellite scenes are painted onto the earth browser; and the color and opacity of each rectangle is varied as a function of the popularity of the corresponding satellite image. An analysis of the geospatial information obtained relative to specified time constraints provides an ability to relate image download requests to environmental, political, and social events.

Standart, G. D.; Stulken, K. R.; Zhang, Xuesong; Zong, Ziliang

2011-04-13T23:59:59.000Z

171

Pumped oil feed systems for rotary vacuum pumps  

Science Conference Proceedings (OSTI)

Pumped oil feed systems developed by the authors and their colleagues provide positive lubrication under all inlet pressure conditions

H. Wycliffe; B. D. Power

1981-01-01T23:59:59.000Z

172

The Comparison between Vertical Shaft Furnace and Rotary Kiln for ...  

Science Conference Proceedings (OSTI)

Therefore, calcination of coke used for aluminum reduction by vertical shaft furnace is more competitive based on the existing quality of the green petroleum  ...

173

Rotor Design and Process Optimization for Rotary Inert Dgeasser  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, Materials Science & Technology 2012. Symposium, Advances in Metal Casting Technologies. Presentation Title, Rotor Design and ...

174

Analysis and performance of radial flow rotary dessicant dehumidifiers  

SciTech Connect

A model is developed to predict the steady periodic performance of a radial flow desiccant wheel. The model is expressed in terms of the same dimensionless parameters that are commonly used in modeling of the conventional axial flow desiccant wheel. In addition a dimensionless geometrical ratio of the volume of the matrix to the volume of the wheel core is found to affect the performance of the wheel. A finite difference technique on staggered grid is used to discretize the governing dimensionless equations. The discretized equations are solved to predict the performance of the desiccant wheel at given values of operation parameters. A sensitivity study is carried out to investigate the effect of changing any of these parameters on the performance of the wheel. The performance of the radial flow desiccant wheel having the same values of the operation parameters.

Elsayed, M.M.; Chamkha, A.J. [Kuwait Univ., Safat (Kuwait). Mechanical and Industrial Engineering Dept.

1997-02-01T23:59:59.000Z

175

Maintenance cost studies of rotary wing commercial transport aircraft  

E-Print Network (OSTI)

Introduction: The vertical take-off and landing (VTOL) aircraft market has had substantial growth in the period of the last ten years when one considers the overall number of aircraft in use. The military fleet has continued ...

Ausrotas, Raymond A.

1974-01-01T23:59:59.000Z

176

Integrating Coal Gasification into a Rotary Kiln Electric Furnace Plant  

Science Conference Proceedings (OSTI)

Coal gasification is a potential alternative to conventional coal or natural gas- fired power plants ... Fundamentals of Spark-Plasma Sintering: Net-Shaping and Size Effects ... Investigation on a Microwave High-Temperature Air Heat Exchanger.

177

Statistical analysis of a silica gel rotary dehumidifier  

SciTech Connect

A regression analysis was conducted on experimental data obtained during the testing of a solid desiccant dehumidifier at the Solar Energy Research Institute (SERI has since been renamed the National Renewable Energy Laboratory). The data obtained was studied using statistical techniques to determine the regression equation for the temperature and humidity at the processed air outlet of the dehumidifier. These variables determine the cooling capacity and efficiency (Coefficient of Performance) of any desiccant cooling cycle. The analysis is used to determine the relative impact the input parameters have on the outlet temperature and humidity.

Kini, A.; Waugaman, D.G.; Kettleborough, C.F. (Texas A and M Univ., College Station (United States))

1993-01-01T23:59:59.000Z

178

First-order Transition Magnetocaloric Materials in Rotary Magnetic ...  

Science Conference Proceedings (OSTI)

Abstract Scope, Astronautics has designed, constructed, and tested several ... requires accurate modeling of the magnetic refrigerator, accurate layering of a ...

179

Test of a rotary separator turbine with separated feed configuration  

DOE Green Energy (OSTI)

A description of the test system used during the Endurance Tests is presented. Results of the first series of performance tests (10/81 to 10/82), and of the Endurance Test, are briefly discussed in this section. The rationale for the RST power system is presented. Test system changes, and a summary of the test system shakedown are presented. The Upgrade Test series consists of three short (2-3 day) test periods. Test system operations, as well as immediate conclusions and system modifications, are presented. Results and conclusions are presented.

Not Available

1985-03-14T23:59:59.000Z

180

Tidal Current Predictions Using Rotary Empirical Orthogonal Functions  

Science Conference Proceedings (OSTI)

In the conventional point tidal analysis approach, a set of tidal harmonic constituents is derived from each time series of currents. These sets of tidal constituents are then used to predict the tidal currents. For a large database of current ...

Betty Ng

1993-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Effets de deux procédés de traitement des tours aéro réfrigérantes vis-à-vis du développement des biofilms : cas particulier des légionnelles et des amibes.  

E-Print Network (OSTI)

??L'implication des tours aéro-réfrigérantes dites « ouvertes », dans les cas de légionellose, demeure à l'heure actuel un problème de santé public malgré la multitude… (more)

Chaabna, Zineddine

2013-01-01T23:59:59.000Z

182

Treatment and Minimization of Aluminum and Light Metals Industry ...  

Science Conference Proceedings (OSTI)

... reverberatory and rotary aluminum furnaces, reverberatory and rotary lead furnaces, as well as rotary brass furnaces. Representative examples are presented ...

183

CareVis: Integrated Visualization of Computerized Protocols and Temporal Patient Data  

E-Print Network (OSTI)

Objects [7], Paint Strips [6], and SOPOs [12] were developed. These techniques can be used to visualize

184

CareVis: Integrated visualization of computerized protocols and temporal patient data  

Science Conference Proceedings (OSTI)

Objective: Currently, visualization support for patient data analysis is mostly limited to the representation of directly measured data. Contextual information on performed treatment steps is an important source to find reasons and explanations for certain ... Keywords: Clinical guidelines, Information visualization, Patient data, Protocol-based care, Temporal uncertainties, Treatment plans, User-centered design

Wolfgang Aigner; Silvia Miksch

2006-07-01T23:59:59.000Z

185

Int J Comput Vis DOI 10.1007/s11263-008-0188-7  

E-Print Network (OSTI)

@cgv.ics.saitama-u.ac.jp R. Furukawa Faculty of Information Sciences, Hiroshima City University, 3-4-1, Ozuka-higashi, Asaminami-ku, Hiroshima, Japan e-mail: ryo-f@cs.hiroshima-cu.ac.jp 1 Introduction To date, various

Tokyo, University of

186

PortVis: a tool for port-based detection of security events  

Science Conference Proceedings (OSTI)

Most visualizations of security-related network data require large amounts of finely detailed, high-dimensional data. However, in some cases, the data available can only be coarsely detailed because of security concerns or other limitations. How can ... Keywords: information visualization, network security, user interfaces

Jonathan McPherson; Kwan-Liu Ma; Paul Krystosk; Tony Bartoletti; Marvin Christensen

2004-10-01T23:59:59.000Z

187

SciDAC DataVis FAQ | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

News In the News In Focus Presentations & Testimony Recovery Act About Organization Budget Field Offices Federal Advisory Committees History Scientific and Technical...

188

VisKo: Semantic Web Support for Information and Science Visualization  

E-Print Network (OSTI)

, building computer vision Changsong Shen, James J. Little, Sidney S. Fels University of British Columbia systems. A logical image understanding pipeline is introduced to allow parallel processing. We also processes in the log- ical pipelines. The intent of OpenVL is to allow users to quickly and easily recover

Ward, Karen

189

UV-VIS-IR Spectral Responsivity Measurement System for Solar Cells  

DOE Green Energy (OSTI)

NREL's PV Cell and Module Performance Characterization group has built a new spectral responsivity measurement system for solar cells. It uses a xenon arc lamp source, a single, grating monochrometer, and a fiber-optic bundle to couple the monochromatic light to the test device. The system has a spectral bandwidth of 2 nm, minimum spot diameter of 1.6 mm, a spectral range of 280-1330 nm, and uncertainty better than {+-}3% over most of this range. It is capable of incorporating light bias with intensities exceeding one sun. This paper discusses the system's features, capabilities, calibration, and measurement uncertainties.

Field, H.

1998-11-12T23:59:59.000Z

190

Int J Comput Vis DOI 10.1007/s11263-010-0390-2  

E-Print Network (OSTI)

" Rick Rudd, 8:30 a.m., East Union. Call 472-8210. Saturday, Jan. 10 Husker Men's Basketball vs. Mis- souri, 1 p.m., Devaney Center. Husker Women's Basketball vs. Oklahoma, 7:05 p.m., Devaney Center. Monday that led to improved vaccines and diagnostic tests. He was selected as part of AAAS's Agriculture, Food

Black, Michael J.

191

VisPortal: Deploying grid-enabled visualization tools through a web-portal interface  

E-Print Network (OSTI)

c collaboration in the NERSC user community. ReferencesAbstract The LBNL/NERSC Visportal e?ort explores ways toour case we want to provide NERSC (National Energy Research

2003-01-01T23:59:59.000Z

192

VisPortal: Increasing Scientific Productivity by Simplifying Access to and Use of Remote Computational Resources  

E-Print Network (OSTI)

Contact Cristina Siegerist, LBNL/NERSC Visualization Group.510-495- 2520. LBNL/NERSC Visualization Groupresearch prototype. LBNL/NERSC Visualization Group Figure 3.

Siegerist, Cristina; Shalf, John; Bethel, E. Wes

2004-01-01T23:59:59.000Z

193

Vis Comput (2011) 27: 6781 DOI 10.1007/s00371-010-0515-1  

E-Print Network (OSTI)

: the Vertex, the Geometric, and the Fragment Shaders also called Pixel Shaders. These three programs228]). 4.2 Fragment Shaders model As previously stated, the algorithm of the 3D direct square neighbor CA is based on the relationship between a CPU program and shader codes. To make such a software

�öltekin, Arzu

194

UV-Vis Absorption and Luminescence Spectrum of LAS : Tb3+ ...  

Science Conference Proceedings (OSTI)

Synthesis and Characterization of Plasma Polymerized Thin Films Deposited from Benzene and Hexamethyldisiloxane Using (PECVD) Method · Synthesis and ...

195

NIST: Atomic Spectroscopy Group - IR-vis-UV FTS optical path  

Science Conference Proceedings (OSTI)

... The NIST Fourier transform spectrometer consists of a folded Michelson interferometer with the two mirrors replaced by cat's-eye retroreflectors. ...

2010-10-05T23:59:59.000Z

196

monVis4LA.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

The order of presentation follows a traditional presenta-. tion of Linear Algebra .... hence the magnitude of the determinant will not change. This third example is ...

197

Table 4.4 Crude Oil and Natural Gas Rotary Rigs in ...  

U.S. Energy Information Administration (EIA)

1954. na: na: na: na: 2,508: 1955. na: na: na: na: 2,686: 1956. na: na: na: na: 2,620: 1957. na: na: na: na: 2,426: 1958. na: na: na: na: 1,922: 1959. ...

198

U.S. Onshore Crude Oil and Natural Gas Rotary Rigs in ...  

U.S. Energy Information Administration (EIA)

1,954: 1,979: 2,016: 2,066: 2,103: 2,122: 2,127: 2,138: 2,156: 2,169: 2,098: 1979: 1,992: 1,858: 1,768: 1,736: 1,762: 1,794: 1,889: 2,014: 2,069: ...

199

Intermediate coating layer for high temperature rubbing seals for rotary regenerators  

Science Conference Proceedings (OSTI)

A metallic regenerator seal is provided having multi-layer coating comprising a NiCrAlY bond layer, a yttria stabilized zirconia (YSZ) intermediate layer, and a ceramic high temperature solid lubricant surface layer comprising zinc oxide, calcium fluoride, and tin oxide. Because of the YSZ intermediate layer, the coating is thermodynamically stable and resists swelling at high temperatures. 2 figs.

Schienle, J.L.; Strangman, T.E.

1995-03-14T23:59:59.000Z

200

Intermediate coating layer for high temperature rubbing seals for rotary regenerators  

DOE Patents (OSTI)

A metallic regenerator seal is provided having multi-layer coating comprising a NiCrAlY bond layer, a yttria stabilized zirconia (YSZ) intermediate layer, and a ceramic high temperature solid lubricant surface layer comprising zinc oxide, calcium fluoride, and tin oxide. Because of the YSZ intermediate layer, the coating is thermodynamically stable and resists swelling at high temperatures.

Schienle, James L. (Phoenix, AZ); Strangman, Thomas E. (Phoenix, AZ)

1995-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Wavelets for fault diagnosis of rotary machines: A review with applications  

Science Conference Proceedings (OSTI)

Over the last 20 years, particularly in last 10 years, great progress has been made in the theory and applications of wavelets and many publications have been seen in the field of fault diagnosis. This paper attempts to provide a review on recent applications ... Keywords: Classical wavelet transform, Multi-wavelets, Second generation wavelet transform, Wavelet design, Wavelet finite element method, Wavelet selection

Ruqiang Yan, Robert X. Gao, Xuefeng Chen

2014-03-01T23:59:59.000Z

202

Verification of BModes: Rotary Beam and Tower Modal Analysis Code; Preprint  

DOE Green Energy (OSTI)

This paper describes verification of BModes, a finite-element code developed to provide coupled modes for the blades and tower of a wind turbine. The blades, which may be rotating or non-rotating, and the towers, whether onshore or offshore, are modeled using specialized 15-dof beam finite elements. Both blade and tower models allow a tip attachment, which is assumed to be rigid body with six moments of inertia, and a mass centroid that may be offset from the blade or tower axis. Examples of tip attachments are aerodynamic brakes for blades and nacelle-rotor subassembly for towers. BModes modeling allows for tower supports including tension wires, floating platforms, and monopiles on elastic foundations. Coupled modes (implying coupling of flap, lag, axial, and torsional motions) are required for modeling major flexible components in a modal-based, aeroelastic code such as FAST1. These are also required for validation of turbine models using experimental data, modal-based fatigue analysis, controls design, and understanding aeroelastic-stability behavior of turbines. Verification studies began with uniform tower models, with and without tip inertia, and progressed to realistic towers. For the floating turbine, we accounted for the effects of hydrodynamic inertia, hydrostatic restoring, and mooring lines stiffness. For the monopole-supported tower, we accounted for distributed hydrodynamic mass on the submerged part of the tower and for distributed foundation stiffness. Finally, we verified a model of a blade carrying tip mass and rotating at different speeds (verifications of other blade models, rotating or non-rotating, have been reported in another paper.) Verifications were performed by comparing BModes-generated modes with analytical results, if available, or with MSC.ADAMS results. All results in general show excellent agreement.

Bir, G.

2010-04-01T23:59:59.000Z

203

A high-performance drive for the rotary coal breaker application  

Science Conference Proceedings (OSTI)

This paper considers recent advances made within the field of electric drives and how this new technology might be best applied within the mining industry. A case study is presented showing simulated results of the performance of the electric drives in a coal preparation plant. The various starting methodologies (resistance starting, fluid coupling, V/f = const, and vector control) are compared within this application. The merits of each method are then discussed with regard to the specific application and other more generic applications within the mining industry. Application of a rotor flux orientation control drive is substantiated, and its superior performance under start and stall conditions to that of the currently implemented system is confirmed by theoretical analysis and simulations. Experimental results for a scale model of the candidate system are presented, which agree with the main conclusions of this paper.

Mirzaeva, G.; Coates, C. [University of Newcastle, Callaghan, NSW (Australia)

2009-07-15T23:59:59.000Z

204

Rotary bed reactor for chemical-looping combustion with carbon capture  

E-Print Network (OSTI)

Chemical-looping combustion (CLC) is a novel and promising technology for power generation with inherent CO2 capture. Currently almost all the research has been focused on developing CLC based inter-connected fluidized bed ...

Zhao, Zhenlong

2012-01-01T23:59:59.000Z

205

A Pilot-plant Scale Test of Coal-based Rotary Kiln Direct Reduction ...  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, 2014 TMS Annual Meeting & Exhibition. Symposium , 5th International Symposium on High Temperature Metallurgical Processing.

206

Simulation model of a rotary expander of a small cogeneration unit  

Science Conference Proceedings (OSTI)

Today, steam engines are used for special purposes only, for example to reduce steam pressure in pressure reduction stations, where they replace the traditional and inefficient throttling process. Throttling is the most used way to control the pressure ... Keywords: cogeneration, modeling, simulation, steam engine

Evžen Thöndel

2007-10-01T23:59:59.000Z

207

Simulation of Combustion and Thermal-flow Inside a Petroleum Coke Rotary Calcining Kiln.  

E-Print Network (OSTI)

??Calcined coke is the best material for making carbon anodes for smelting of alumina to aluminum. Calcining is an energy intensive industry and a significant… (more)

Zhang, Zexuan

2007-01-01T23:59:59.000Z

208

Photoacoustic optical properties at UV, VIS, and near IR wavelengths for laboratory generated and winter time ambient urban aerosols  

Science Conference Proceedings (OSTI)

We present the laboratory and ambient photoacoustic (PA) measurement of aerosol light absorption coefficients at ultraviolet wavelength (i.e., 355 nm) and compare with measurements at 405, 532, 870, and 1047 nm. Simultaneous measurements of aerosol light scattering coefficients were achieved by the integrating reciprocal nephelometer within the PA's acoustic resonator. Absorption and scattering measurements were carried out for various laboratory generated aerosols, including salt, incense, and kerosene soot to evaluate the instrument calibration and gain insight on the spectral dependence of aerosol light absorption and scattering. Ambient measurements were obtained in Reno, Nevada, between 18 December 2009 and 18 January 2010. The measurement period included days with and without strong ground level temperature inversions, corresponding to highly polluted (freshly emitted aerosols) and relatively clean (aged aerosols) conditions. Particulate matter (PM) concentrations were measured and analyzed with other tracers of traffic emissions. The temperature inversion episodes caused very high concentration of PM{sub 2.5} and PM{sub 10} (particulate matter with aerodynamic diameters less than 2.5 {mu}m and 10 {mu}m, respectively) and gaseous pollutants: carbon monoxide (CO), nitric oxide (NO), and nitrogen dioxide (NO{sub 2}). The diurnal change of absorption and scattering coefficients during the polluted (inversion) days increased approximately by a factor of two for all wavelengths compared to the clean days. The spectral variation in aerosol absorption coefficients indicated a significant amount of absorbing aerosol from traffic emissions and residential wood burning. The analysis of single scattering albedo (SSA), Angstrom exponent of absorption (AEA), and Angstrom exponent of scattering (AES) for clean and polluted days provides evidences that the aerosol aging and coating process is suppressed by strong temperature inversion under cloudy conditions. In general, measured UV absorption coefficients were found to be much larger for biomass burning aerosol than for typical ambient aerosols.

Gyawali, Madhu S.; Arnott, W. Patrick; Zaveri, Rahul A.; Song, Chen; Moosmuller, H.; Liu, Li; Mishchenko, M.; Chen, L-W A.; Green, M.; Watson, J. G.; Chow, J. C.

2012-03-08T23:59:59.000Z

209

Introduction to Renewable Energy Technology  

NLE Websites -- All DOE Office Websites (Extended Search)

to Renewable to Renewable Energy Technology A YEAR-LONG SCIENCE & TECHNOLOGY COURSE by Matthew A. Brown Lakewood High School Lakewood, CO Lakewood High School Red Rocks Community College Smart Energy Living Alliance Metro Denver WIRED Initiative Introduction Page i-i Revision date: 6/1/08 This curriculum is a partnership between: Lakewood High School Matthew Brown, maabrown@jeffco.k12.co.us Suzanne McClung, smcclung@jeffco.k12.co.us 9700 W. 8th Ave., Lakewood, CO 80215 303.982.7096 lakewood-web.jeffco.k12.co.us Red Rocks Community College Cathy Rock, cathy.rock@rrcc.edu 13300 West Sixth Ave., Lakewood, CO 80228 303.914.6513 www.rrcc.edu Smart Energy Living Alliance 21600 W. Colfax Ave, Suite B-450, Lakewood, CO 80215 303.216.2026 www.SmartEnergyLiving.org With funding from: Metro Denver WIRED Initiative

210

Net Energy Billing | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Billing Energy Billing Net Energy Billing < Back Eligibility Agricultural Commercial Industrial Institutional Low-Income Residential Multi-Family Residential Nonprofit Residential Schools Savings Category Bioenergy Commercial Heating & Cooling Manufacturing Buying & Making Electricity Alternative Fuel Vehicles Hydrogen & Fuel Cells Water Solar Home Weatherization Wind Program Info State Maine Program Type Net Metering Provider Maine Public Utilities Commission All of Maine's electric utilities -- investor-owned utilities (IOUs), consumer-owned utilities (COUs), which include municipal utilities and electric cooperatives -- must offer net energy billing for individual customers. Furthermore IOUs are required to offer net metering for shared ownership customers, while COUs may offer net metering to shared ownership

211

Design of a novel rotary compact power pack for the series hybrid electric vehicle. Design and simulation of a compact power pack consisting of a novel rotary engine and outer rotor induction machine for the series hybrid electric vehicle powertrain.  

E-Print Network (OSTI)

??Hybrid electric vehicles significantly reduce exhaust emissions and increase fuel economy. Power packs are the most fundamental components in a series powertrain configuration of a… (more)

Amirian, Hossein

2010-01-01T23:59:59.000Z

212

Model of rotary-actuated flexible beam with notch filter vibration suppression controller and torque feedforward load compensation controller  

Science Conference Proceedings (OSTI)

This paper describes ORNL`s development of an environment for the simulation of robotic manipulators. Simulation includes the modeling of kinematics, dynamics, sensors, actuators, control systems, operators, and environments. Models will be used for manipulator design, proposal evaluation, control system design and analysis, graphical preview of proposed motions, safety system development, and training. Of particular interest is the development of models for robotic manipulators having at least one flexible link. As a first application, models have been developed for the Pacific Northwest Laboratory`s Flexible Beam Test Bed (PNL FBTB), which is a 1-Degree-of-Freedom, flexible arm with a hydraulic base actuator. ORNL transferred control algorithms developed for the PNL FBTB to controlling IGRIP models. A robust notch filter is running in IGRIP controlling a full dynamics model of the PNL test bed. Model results provide a reasonable match to the experimental results (quantitative results are being determined) and can run on ORNL`s Onyx machine in approximately realtime. The flexible beam is modeled as six rigid sections with torsional springs between each segment. The spring constants were adjusted to match the physical response of the flexible beam model to the experimental results. The controller is able to improve performance on the model similar to the improvement seen on the experimental system. Some differences are apparent, most notably because the IGRIP model presently uses a different trajectory planner than the one used by ORNL on the PNL test bed. In the future, the trajectory planner will be modified so that the experiments and models are the same. The successful completion of this work provides the ability to link C code with IGRIP, thus allowing controllers to be developed, tested, and tuned in simulation and then ported directly to hardware systems using the C language.

Bills, K.C.; Kress, R.L.; Kwon, D.S. [Oak Ridge National Lab., TN (United States); Baker, C.P. [Battelle, Richland, WA (United States). Dept. of Automation and Measurement Sciences

1994-12-31T23:59:59.000Z

213

Analysis of hydraulic power transduction in regenerative rotary shock absorbers as function of working fluid kinematic viscosity  

E-Print Network (OSTI)

This investigation seeks to investigate the relationship of kinematic fluid viscosity to the effective power transduction seen by a hydraulic motor. Applications of this research specifically relate to energy recovery from ...

Avadhany, Shakeel N

2009-01-01T23:59:59.000Z

214

A Comparative Study of Rotary Instrumentation of the Maxillary First Premolar Buccal Root Utilizing Cone Beam Computed Tomography.  

E-Print Network (OSTI)

??The study objective was to determine cementum-dentin wall thickness along the furcation groove in maxillary bifurcated first premolars after preparation with three successively larger, 0.04… (more)

Zigo, Stephan

2011-01-01T23:59:59.000Z

215

An RTD study for the flow of lignite particles through a pilot rotary dryer. Part 2: Flighted drum case  

SciTech Connect

In Part 2 of this work a flighted pilot rotating cylindrical drum, intended to be used as either a dryer or calciner (kiln), has been used to investigate the flow, through it, of pulverized moist lignite. Tracer pulse input-response experiments have been performed. Residence Time Distribution (RTD) data have been deduced for three types of flight geometry, namely: Rectangular (RA), Equal Angular Distribution (EAD) and Equal Horizontal Distribution (EHD). For each flight shape, mean residence time {bar t} has been correlated with drum operating conditions. The sequence {bar t}{sub EAD} < {bar t}{sub RA} < {bar t}{sub EHD} has been validated. A comparison between the residence time predictions for the flighted and the bare drum has indicated that {bar t} for the former may be higher by up to 3.5 times than that for the latter. Exceptionally high solids hold-up values (i.e., Z = 0.13--0.42) have been observed and compared to theoretical predictions. Particle size segregation during lignite flow through the flighted drum was not confirmed.

Hatzilyberis, K.S.; Androutsopoulos, G.P. [National Technical Univ. of Athens (Greece). Dept. of Chemical Engineering

1999-04-01T23:59:59.000Z

216

An RTD study for the flow of lignite particles through a pilot rotary dryer. Part 1: Bare drum case  

SciTech Connect

In Part 1 of the present work a pilot rotating cylindrical drum, without an internal lifting flight system (bare), has been employed for the study of lignite motion through it, at ambient temperature. Tracer pulse stimulus-response experiments have been carried out to deduce residence time distribution (RTD) data and relate them to the operating conditions (slope, speed of revolution, etc.). Mean residence time, space-time and solids hold-up have been correlated with the drum operating conditions. Experimental data of mean axial velocity of solids have been compared with theoretical predictions and found to deviate within a {+-}15% margin. A size segregation of particles during their motion through the kiln under a variety of operating conditions has been confirmed and quantified. An average maximum divergence of 20% between the residence time of the smallest and that of the largest nominal particle sizes has been assessed.

Hatzilyberis, K.S.; Androutsopoulos, G.P. [National Technical Univ. of Athens (Greece). Dept. of Chemical Engineering

1999-04-01T23:59:59.000Z

217

Solar energy technical training directory  

DOE Green Energy (OSTI)

Available solar energy offerings in the technical training area are presented. Institutions are listed alphabetically by state. Each listing includes an institution address and phone number, solar programs or curricula offered, and detailed solar couse information. An alphabetical index of institutions in included. (MHR)

Corcoleotes, G; Kramer, K; O'Connor, K

1979-06-01T23:59:59.000Z

218

SURVEY OF THE COLUMBIA RIVER ANDITSTRIBUTARIES-PartV  

E-Print Network (OSTI)

« 37 L. Birch Creek 37 M* Couse Creek · 37 N. North Fork Walla Walla River · 37 0. South Fork Walla. c.f .s, on August 31» 1931« Minimum flows occur during the months of August, September, and October purposes has greatly reduced the sustained flows in the tributary streams* This factor together

219

I ERPO NE 2007 04 a 06 de junho de 2007 Recife / PE AVALIAO E CORREO DE VIS NO MODELO DE REGRESSO DE COX  

E-Print Network (OSTI)

31270-901 - Belo Horizonte ­ MG E-mail: {jangiovani,fcruz,enricoc}@ufmg.br Resumo O modelo de riscos viés de segunda ordem do EMVP. As simulações Monte Carlo indicam viés menor, sem aumento de variância present computational results for second-order bias evaluation and correction of MPLE's. Monte Carlos

Cruz, Frederico

220

Impact of Ge4+ ion as structural dopant of Ti4+ in anatase: crystallographic translation, photocatalytic behavior, and efficiency under UV and VIS irradiation  

Science Conference Proceedings (OSTI)

Nanometric particles of germanium-doped TiO2 were prepared by homogeneous hydrolysis of TiOSO4 and GeCl4 in an aqueous solution using urea as the precipitation agent. Structural evolution during heating of these starting ...

Václav Štengl; Tomáš Matys Grygar; Jana Velická; Ji?í Henych; Snejana Bakardjieva

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Evaluation of a Satellite Multispectral VIS–IR Daytime Statistical Rain-Rate Classifier and Comparison with Passive Microwave Rainfall Estimates  

Science Conference Proceedings (OSTI)

A daytime surface rain-rate classifier, based on artificial neural networks (ANNs), is proposed for the Spinning Enhanced Visible and Infrared Imager (SEVIRI) on board the Meteosat-8 geostationary satellite. It is developed over the British Isles ...

Davide Capacci; Federico Porcù

2009-02-01T23:59:59.000Z

222

Basis for a Rainfall Estimation Technique Using IR–VIS Cloud Classification and Parameters over the Life Cycle of Mesoscale Convective Systems  

Science Conference Proceedings (OSTI)

This paper discusses the basis for a new rainfall estimation method using geostationary infrared and visible data. The precipitation radar on board the Tropical Rainfall Measuring Mission satellite is used to train the algorithm presented (which ...

G. Delgado; Luiz A. T. Machado; Carlos F. Angelis; Marcus J. Bottino; Á. Redaño; J. Lorente; L. Gimeno; R. Nieto

2008-05-01T23:59:59.000Z

223

Survival of retinal pigment epithelium after exposure to prolonged oxidative injury: a detailed gene expression and cellular analysis. Invest Ophthalmol Vis Sci 45  

E-Print Network (OSTI)

PURPOSE. To detail, by DNA microarrays and cellular structure labeling, the in vitro responses of retinal pigment epithelial (RPE) cells to a nonlethal dose of the oxidant agent hydroquinone (HQ). METHODS. The viability of growth-quiescent ARPE-19 cells after treatment with HQ was measured by XTT conversion, 3 H-leucine incorporation, trypan blue exclusion, and the presence of DNA laddering. The effect of a nonlethal dose of HQ on the localization of apoptosis-induced factor (AIF) and phosphorylation of stress-activated kinase-2/p38 (SAPK2/p38) was detected by immunocytochemistry. Actin structures were visualized by phalloidin staining. Cell membrane blebbing was detected using GFP-membrane–labeled RPE cells (ARPE-GFP-c’rRas). Changes in gene expression patterns of RPE cells within 48 hours of prolonged treatment with a nonlethal dose of HQ

Nataly Strunnikova; Connie Zhang; Diane Teichberg; Scott W. Cousins; Judit Baffi; Kevin G. Becker; Karl G. Csaky

2004-01-01T23:59:59.000Z

224

Movement of Fall Chinook Salmon Fry Oncorhynchus Tshawytscha : A Comparison of Approach Angles for Fish Bypass in a Modular Rotary Drum Fish Screen.  

DOE Green Energy (OSTI)

The Pacific Northwest National Laboratory (PNNL) performed tests to determine whether a significant difference in fish passage existed between a 6-ft screening facility built perpendicularly to canal flow and an identical screening facility with the screen mounted at a 45-degree angle to the approach channel. A modular drum screen built by the Washington Department of Fish and Wildlife was installed at PNNL`s Aquatic Ecology research laboratory in Richland, Washington. Fall chinook salmon fry were introduced into the test system, and their movements were monitored. A total of 14 tests (400 fish per test) that lasted 20 hours were completed during April and May, 1996. There was no significant difference in fish passage rate through the two approach configurations. Attraction flow to the bypass across the face of the screen was more evident for the angled approach, although this did not appear to play a significant role in attracting fish to the bypass. Approach velocities at the face of the screen did not exceed the 0.4 fps criteria for either approach configuration and posed not threat to fish. No fish passed over, around, or through the drum screen during any test.

Neitzel, D.A.; Blanton, S.L.; Abernethy, C. Scott; Daly, D.S. [Pacific Northwest National Laboratory, Richland, WA (United States)

1996-08-01T23:59:59.000Z

225

Integrated Status and Effectiveness Monitoring Program, Entiat River Status and Trend Snorkel Surveys and Rotary Smolt Trap Operations in Nason Creek, March 2007 through March 2008.  

DOE Green Energy (OSTI)

The Integrated Status and Effectiveness Monitoring Program (ISEMP-BPA project No.2003-0017) has been created as a cost effective means of developing protocols and new technologies, novel indicators, sample designs, analytical, data management and communication tools and skills, and restoration experiments that support the development of a region-wide Research, Monitoring and Evaluation (RME) program to assess the status of anadromous salmonid populations, their tributary habitat and restoration and management actions. The most straightforward approach to developing a regional-scale monitoring and evaluation program would be to increase standardization among status and trend monitoring programs. However, the diversity of species and their habitat, as well as the overwhelming uncertainty surrounding indicators, metrics, and data interpretation methods, requires the testing of multiple approaches. Thus, the approach ISEMP has adopted is to develop a broad template that may differ in the details among subbasins, but one that will ultimately lead to the formation of a unified RME process for the management of anadromous salmonid populations and habitat across the Columbia River Basin. ISEMP has been initiated in three pilot subbasins, the Wenatchee/Entiat, John Day, and Salmon. To balance replicating experimental approaches with the goal of developing monitoring and evaluation tools that apply as broadly as possible across the Pacific Northwest, these subbasins were chosen as representative of a wide range of potential challenges and conditions, e.g., differing fish species composition and life histories, ecoregions, institutional settings, and existing data. ISEMP has constructed a framework that builds on current status and trend monitoring infrastructures in these pilot subbasins, but challenges current programs by testing alternative monitoring approaches. In addition, the ISEMP is: (1) Collecting information over a hierarchy of spatial scales, allowing for a greater flexibility of data aggregation for multi-scale recovery planning assessments, and (2) Designing methods that: (a) Identify factors limiting fish production in watersheds; (b) Determine restoration actions to address these problems; (c) Implement actions as a large-scale experiment (e.g. Before After Control Impact, or BACI design), and (d) Implement intensive monitoring and research to evaluate the action's success. The intent of the ISEMP project is to design monitoring programs that can efficiently collect information to address multiple management objectives over a broad range of scales. This includes: Evaluating the status of anadromous salmonids and their habitat; Identifying opportunities to restore habitat function and fish performance; and Evaluating the benefits of the actions to the fish populations across the Columbia River Basin. The multi-scale nature of this goal requires the standardization of protocols and sampling designs that are statistically valid and powerful, properties that are currently inconsistent across the multiple monitoring programs in the region. Other aspects of the program will aid in the ability to extrapolate information beyond the study area, such as research to elucidate causal mechanisms, and a classification of watersheds throughout the Columbia River Basin. Obviously, the scale of the problem is immense and the ISEMP does not claim to be the only program working towards this goal. As such, ISEMP relies heavily on the basin's current monitoring infrastructure to test and develop monitoring strategies, while acting as a coordinating body and providing support for key elements such as data management and technical analyses. The ISEMP also ensures that monitoring programs can address large-scale management objectives (resulting largely from the ESA) through these local efforts. While the ISEMP maintains a regional focus it also returns the necessary information to aid in management at the smaller spatial scales (individual projects) where manipulations (e.g., habitat restoration actions) actually occur. The work captured i

Collins, Matthew; Jorgensen, John; Murdock, Keely

2008-03-10T23:59:59.000Z

226

Pneumatic clutch apparatus  

SciTech Connect

A pneumatic clutch apparatus is described comprising: a pneumatic clutch disposed at the rear of a transmission and including a pneumatic actuator for engaging and disengaging the clutch, a rotary passage adapted to rotate together with the clutch and connected to the actuator; a stationary passage stationary with respect to the clutch and connected to a pneumatic pressure control mechanism disposed outside the clutch; and a rotary joint including a connecting passage for connecting the rotary passage and the stationary passage together; the rotary joint having a rotary portion to which the rotary passage is fixed and a stationary portion to which the stationary passage is fixed, and the stationary portion being fixed to a housing of the transmission and rotatably supporting the rotary portion. A cylindrical intermediate member is disposed between the rotary portion and the stationary portion of the rotary joint. Air passages in the stationary portion and the rotary portion are connected together through an air passage in the intermediate member. The intermediate member is rotatably fitted to the rotary portion and the stationary portion through seals which seal the air passage. A connecting mechanism is operable to connect the intermediate member to the rotary portion when the intermediate member and the rotary portion occupy a predetermined relative angular position.

Kamio, T.

1987-03-03T23:59:59.000Z

227

Development of a solar desiccant dehumidifier. Third technical progress report  

DOE Green Energy (OSTI)

This program is aimed at the development of a solar desiccant dehumidifier featuring a rotary bed of granular silica gel and a rotary regenerator. Design, fabrication, performance, commercialization studies, and test stand development are described in detail. (WHK)

Gunderson, M.E.

1979-06-12T23:59:59.000Z

228

NVLAP Program Checklist Template  

Science Conference Proceedings (OSTI)

... 4) magnifying glass; 5) Dremmel 1 “Type” rotary tool (including accessory bits: cutting, grinding, drilling, carving, etc.); 6 ...

2012-04-06T23:59:59.000Z

229

Corn Milling  

Science Conference Proceedings (OSTI)

... facilities include processing and storage tanks, screening and sizing equipment, grind mills, high pressure steam boilers, centrifuges, rotary ...

230

Dimensional Measurement Services  

Science Conference Proceedings (OSTI)

... Figure 1. Measurement of API Rotary Master Gauge on CMM. © Robert Rathe. Lead Organizational Unit: pml. Customers/Contributors/Collaborators ...

2013-04-23T23:59:59.000Z

231

Scientific Papers of the Bureau of Standards Volume 21  

Science Conference Proceedings (OSTI)

... engineering, applied mathematics, statistics, biotechnology, information ... between rotary power and structure ... the light emitted by plants and animals ...

2013-01-23T23:59:59.000Z

232

Development of the fixed-vane revolving vane compressor.  

E-Print Network (OSTI)

??The dissertation deals with the development of a newly introduced positive displacement rotary compressor, named fixed-vane revolving vane compressor. The compressor design is conceived with… (more)

Tan, Kok Ming.

2012-01-01T23:59:59.000Z

233

A study of additives for aquagel/bentonite based drilling fluids in relation to filtration and rheological properties, smectite inhibition and their application to Marcellus Shale.  

E-Print Network (OSTI)

??Since the dawn of rotary drilling, engineers and scholars have persevered, through study and research, to formulate an optimum inhibitive drilling fluid for the shale… (more)

Onuoha, Ike Eleanya .O.

2011-01-01T23:59:59.000Z

234

Technical Developments and Improvements in Xstrata Copper ...  

Science Conference Proceedings (OSTI)

On-Site Speaker (Planned), Pengfu Tan. Abstract Scope, Xstrata Copper Smelter at Mount Isa in Australia has operated one copper Isasmelt furnace, two Rotary ...

235

Minor Element Distributions in Mount Isa Copper Smelter  

Science Conference Proceedings (OSTI)

On-Site Speaker (Planned), Pengfu Tan. Abstract Scope, Xstrata Copper Smelter at Mount Isa in Australia has operated one copper Isasmelt furnace, two Rotary ...

236

Poster Session  

Science Conference Proceedings (OSTI)

Feb 27, 2011 ... Xstrata Copper Smelter at Mount Isa in Australia has operated one copper Isasmelt furnace, two Rotary Holding Furnaces (RHFs), four ...

237

Operation of an Open Type Anode Baking Furnace with a ...  

Science Conference Proceedings (OSTI)

Quality and Process Performance of Rotary Kilns and Shaft Calciners · Real Time Temperature Distribution during Sealing Process and Room Temperature Air ...

238

Effects of Physical Properties of Anode Raw Materials on the Paste ...  

Science Conference Proceedings (OSTI)

Quality and Process Performance of Rotary Kilns and Shaft Calciners · Real Time Temperature Distribution during Sealing Process and Room Temperature Air ...

239

Evaluation of the Thermophysical Properties of Silicon Carbide ...  

Science Conference Proceedings (OSTI)

Quality and Process Performance of Rotary Kilns and Shaft Calciners · Real Time Temperature Distribution during Sealing Process and Room Temperature Air ...

240

Pre-Show Report  

Science Conference Proceedings (OSTI)

Hydro Aluminium Hycast a.s. ........ 835 (8 sp) ..... transfer cars and rotary turntables. • Aluminum ... turnstiles, powered transfer cars, wrapping systems and

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Optimization System of Iron Ores Proportion for Sintering Process  

Science Conference Proceedings (OSTI)

The system sets blending cost as the objective parameter, and uses sinter chemical ... A Pilot-plant Scale Test of Coal-based Rotary Kiln Direct Reduction of

242

Particle Collecting in a 13.56 MHz Radiofrequency Methane Discharge  

E-Print Network (OSTI)

to a residual pressure below 10-3 Pa using a diffusion oil pump connected to a primary rotary pump. The particle

Paris-Sud XI, Université de

243

Wettability of Ti3SiC2 by Ag-Cu and Ag-Cu-Ti O. Dezellus,a*  

E-Print Network (OSTI)

of about 5Ã?10-5 Pa obtained with a rotary vane pump and an oil diffusion pump, each equipped with a liquid

Paris-Sud XI, Université de

244

U.S. Crude Oil, Natural Gas, and Natural Gas Liquids Reserves 2006 ...  

U.S. Energy Information Administration (EIA)

... and the Average Number of Active Rotary Drilling Rigs, 1977-2006: PDF: 4: ... Glossary: A listing of terms used within the Reserves Report, and their ...

245

U.S. Crude Oil, Natural Gas, and Natural Gas Liquids Reserves 2005 ...  

U.S. Energy Information Administration (EIA)

... and the Average Number of Active Rotary Drilling Rigs, 1977-2005: PDF: 4: ... Glossary: A listing of terms used within the Reserves Report, and their ...

246

Pub 16 2009 cover1.ai  

Science Conference Proceedings (OSTI)

... to opening its own office with full-time employees. ... is intended for large pipelines with large flow rates and ... and R 32 “Rotary piston gas meters and ...

2011-10-24T23:59:59.000Z

247

Crude Oil and Natural Gas Drilling Activity  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Rotary rigs in operation ...

248

Industrial SPP/Partner Teaming Profile: tekWorx, Schering-Plough  

NLE Websites -- All DOE Office Websites (Extended Search)

pumping to full variable flow, installing high performance rotary (HPR) valves on air handling unit (AHU) coils, installing the tekWorx Control and Energy Optimization (CEO)...

249

Scanning electron microscopy imaging of hydraulic cement ...  

Science Conference Proceedings (OSTI)

... Cement clinker is manufactured from a finely-ground, homogenized blend of limestone, shale and iron ore sintered in a rotary kiln to temperatures ...

2004-11-23T23:59:59.000Z

250

Shrinkage Mitigation Strategies  

Science Conference Proceedings (OSTI)

... Portions of the normal weight sand were replaced with the same volume of a manufactured rotary kilned expanded shale with a fineness modulus ...

2010-05-26T23:59:59.000Z

251

Application of internal curing for mixtures containing high ...  

Science Conference Proceedings (OSTI)

... Rotary kiln expanded shale (ie, a lightweight fine aggregate) was used with a fineness modulus of 3.97 and a specific gravity (dry) of 1.38. ...

2012-07-27T23:59:59.000Z

252

Fiber-Optic Long-Line Position Sensor - Energy Innovation Portal  

Description Large-scale rotary drilling for oil and gas, minerals, and water wells have a need for measuring the depth of drill bits and pipe segments.

253

2006 TMS Annual Meeting: Lectures  

Science Conference Proceedings (OSTI)

Traditional radiant flames; High velocity flames; Roof fired designs - flat flames and cone-type flames; Alternating pulse regenerators; Rotary regenerators; Low  ...

254

Christian veneer dryer: Forest products fact sheet  

SciTech Connect

Fact sheet written for the Inventions and Innovation Program about a new closed rotary drum dryer for the forest products industry.

NREL

1999-12-14T23:59:59.000Z

255

Reduction Product Separation by Vacuum Distillation in the Process ...  

Science Conference Proceedings (OSTI)

A Pilot-plant Scale Test of Coal-based Rotary Klin Direct Reduction of Laterite ... Influence of Microwave Radiation on Phosphorus-removal Process of Oolitic ...

256

Effects of Reducer and Slag Concentrations in the Iron-carbon ...  

Science Conference Proceedings (OSTI)

A Pilot-plant Scale Test of Coal-based Rotary Klin Direct Reduction of Laterite ... Influence of Microwave Radiation on Phosphorus-removal Process of Oolitic ...

257

Separation of Perovskite Phase from CaO-TiO2-SiO2-Al2O3-MgO ...  

Science Conference Proceedings (OSTI)

A Pilot-plant Scale Test of Coal-based Rotary Klin Direct Reduction of Laterite ... Influence of Microwave Radiation on Phosphorus-removal Process of Oolitic ...

258

Study on the Bond Mechanism of Vanadium Titano-magnetite ...  

Science Conference Proceedings (OSTI)

Abstract Scope, The bond mechanism of vanadium titano-magnetite pellets mixed with coal powder by rotary hearth furnace was studied under the condition of ...

259

Crude Oil and Natural Gas Drilling Activity  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Rotary rigs in ...

260

Improvement of Product Quality in Circulating Fluidized Bed ...  

Science Conference Proceedings (OSTI)

Abstract Scope, Until the introduction of Circulating Fluidized Bed (CFB) Calciners by Outotec (formerly Lurgi) in 1961 rotary kilns were the standard technology ...

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Small Wind Guidebook/What are the Basic Parts of a Small Wind...  

Open Energy Info (EERE)

the kinetic energy of the wind and converts it into rotary motion to drive the generator, which produces either AC or wild AC (variable frequency, variable voltage), which...

262

Dr. Oliver Simpson Metallurgical Laboratory  

Office of Legacy Management (LM)

5000 pound order for regular rotary fired SP beryllium oxide for AC Spark Plug Company, Flint, Michigan,, we have been .busv reviewring our production achodules and have now...

263

Aaron Urbas  

Science Conference Proceedings (OSTI)

... Using a Novel Rotary Switch Spectrometer." Claps R, Guynn R, Serafin W, Virojanapa J, Urbas A, Lodder R. Proceedings of SPIE, 2006, 6078. ...

2012-10-01T23:59:59.000Z

264

Magnesium: Digital Resource Center - ARTICLE: Forming of ...  

Science Conference Proceedings (OSTI)

Sep 20, 2007 ... This paper addresses the formability of magnesium extrusions with respect to rotary-draw bending and hydro-mechanical forming, presenting ...

265

Disciplines | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

to NIST standards in these 29 measurement disciplines. Dimensional Angular: Angle Blocks, Optical Polygons, Rotary and Indexing Tables, Optical Wedges, Autocollimators...

266

Bridge Column Inspection 1  

Science Conference Proceedings (OSTI)

... Concept of an Underwater Bridge Column Inspector RoboCrane. The platform is ballast controlled with a rotary joint and attached sonar sensor. ...

2011-08-25T23:59:59.000Z

267

Energy use and carbon dioxide emissions in energy-intensive industries in key developing countries  

E-Print Network (OSTI)

rotary) Brazil China India Mexico Energy and Carbon Dioxideenergy intensity values for Brazil, China, India, and Mexico,energy intensity values for Brazil, China, India and Mexico,

Price, Lynn; Worrell, Ernst; Phylipsen, Dian

1999-01-01T23:59:59.000Z

268

Egocentric Activity Monitoring and Recovery Ardhendu Behera, David C Hogg and Anthony G Cohn  

E-Print Network (OSTI)

of the art, we have im- plemented a baseline `bag-of-features' (BoF) method using STIP (Space-Time Interest a subset of 100,000 STIP descriptors from the training set and using K-means clustering to generate 4000 Labelling and packaging bottles vis- ion IMU STIP vis- ion IMU vis- ion STIP IMU STIP vis- ion IMU STIP vis

Fisher, Michael

269

Proceedings of IMECE2004 2004 ASME International Mechanical Engineering Congress and RD&D Expo  

E-Print Network (OSTI)

the electrohydrodynamic and electrokinetic pumps do not have moving parts, which increases reliability. However ROTARY SHAFT PUMP (RSP) Daniel B. Blanchard Phillip M. Ligrani Bruce K. Gale Convective Heat Transfer of a novel miniature pump called the rotary shaft pump (RSP) is described. The impeller is made by boring

Utah, University of

270

Directional drilling and equipment for hot granite wells  

DOE Green Energy (OSTI)

The following drilling equipment and experience gained in drilling to date are discussed: positive displacement motors, turbodrills, motor performance experience, rotary-build and rotary-hold results, steering devices and surveying tools, shock absorbers, drilling and fishing jars, drilling bits, control of drill string drag, and control of drill string degradation. (MHR)

Williams, R.E.; Neudecker, J.W.; Rowley, J.C.; Brittenham, T.L.

1981-01-01T23:59:59.000Z

271

Glossary  

Science Conference Proceedings (OSTI)

...Specific forging processes defined in this Glossary include closed-die forging , high-energy-rate forging , hot upset forging , isothermal forging , open-die forging , powder forging , precision forging , radial forging , ring rolling , roll forging , rotary forging , and rotary swaging . forging....

272

Glossary  

Science Conference Proceedings (OSTI)

...Specific forging processes defined in this Glossary include closed-die forging , high-energy-rate forging , hot upset forging , isothermal forging , open-die forging , powder forging , precision839 forging , radial forging , ring rolling , roll forging , rotary forging , and rotary swaging . forging...

273

Study on Matching Strategies and Simulation of Hydro-mechanical Continuously Variable Transmission System of Tractor  

Science Conference Proceedings (OSTI)

In this paper, the engine output torque model and fuel consumption model are established based on engine test results. The engine rotary speed feature denotes the relationship between the engine rotary speed and the throttle opening when engine works ... Keywords: Tractor, Hydro-mechanical continuously variable transmission, Matching strategies, Simulation

Xu Liyou; Zhou Zhili; Cao Qingmei; Zhang Mingzhu

2010-05-01T23:59:59.000Z

274

(DOE/EIS-0265/SA-03): Supplement Analysis for the Watershed Management Program EIS 10/16/02  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3) 3) Dorothy Welch, KEWU-4 TO: Fish and Wildlife Project Manager Proposed Action: Couse/Tenmile Creeks Six-Year Direct Seed Program Project No: 2002-050-00 Watershed Management Techniques or Actions Addressed Under This Supplement Analysis (See App. A of the Watershed Management Program EIS): 3.2 Conservation Cropping Sequence, 3.3 Conservation Tillage, 3.8 Delayed Seed Bed Preparation, 3.9 Grasses and Legumes in Rotation, 3.26 Evaluate Field Limitations, 3.27 Equipment Calibration and Use Location: Various properties in Anatone, Asotin County, Washington Proposed by: Bonneville Power Administration (BPA) and The Asotin County Conservation District (ACCD). Description of the Proposed Action: BPA proposes to fund a six-year direct seed program

275

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

01 - 30310 of 31,917 results. 01 - 30310 of 31,917 results. Rebate Net Energy Billing All of Maine's electric utilities -- investor-owned utilities (IOUs), consumer-owned utilities (COUs), which include municipal utilities and electric cooperatives -- must offer net energy billing... http://energy.gov/savings/net-energy-billing Rebate Net Metering New Jersey's net-metering rules apply to all residential, commercial and industrial customers of the state's investor-owned utilities and energy suppliers (and certain competitive municipal... http://energy.gov/savings/net-metering-24 Rebate RPS Customer-Sited Tier Regional Program Note: The first proposal deadline was recently extended from November 8, 2012 to December 5, 2012. Subsequent proposal deadlines remain unchanged. http://energy.gov/savings/rps-customer-sited-tier-regional-program

276

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 - 2730 of 29,416 results. 21 - 2730 of 29,416 results. Download EIS-0336: Draft Environmental Impact Statement Tucson Electric Power Company Sahuarita-Nogales Transmission Line http://energy.gov/nepa/downloads/eis-0336-draft-environmental-impact-statement Download EIS-0238: Record of Decision Site-Wide Environmental Impact Statement for Continued Operation of the Los Alamos National Laboratory in the State of New Mexico http://energy.gov/nepa/downloads/eis-0238-record-decision Download EIS-0265-SA-93: Supplement Analysis Watershed Management Program - Couse/Tenmile Creeks Six-Year Direct Seed Program http://energy.gov/nepa/downloads/eis-0265-sa-93-supplement-analysis Download EIS-0265-SA-101: Supplement Analysis Watershed Management Program http://energy.gov/nepa/downloads/eis-0265-sa-101-supplement-analysis

277

Walla Walla River Basin Fish Habitat Enhancement Project, 2000-2001 Annual Report.  

Science Conference Proceedings (OSTI)

In 2000, the Confederated Tribes of the Umatilla Indian Reservation (CTUIR) Fisheries Habitat Program implemented stream habitat restoration and protection efforts in the Walla Walla River Basin with funding from Bonneville Power Administration (BPA). The objective of these efforts is to protect and restore habitat critical to the recovery of weak or reintroduced populations of salmonid fish. Six projects, two on Couse Creek, two adjacent properties on Blue Creek, one on Patit Creek, and one property on the mainstem Walla Walla River were part of the exercise. Several thousand native plants as bare-root stock and cuttings were reintroduced to the sites and 18 acres of floodplain corridor was seeded with native grass seed. Pre and post-project monitoring efforts were included for all projects, incorporating methodologies from CTUIR's Draft Monitoring Plan.

Volkman, Jed; Sexton, Amy D. (Confederated Tribes of the Umatilla Indian Reservation, Pendleton, OR)

2001-01-01T23:59:59.000Z

278

Site geotechnical considerations for expansion of the Strategic Petroleum Reserve (SPR) to one billion barrels  

SciTech Connect

Eight Gulf Coast salt domes have emerged as candidate sites for possible expansion of the Strategic Petroleum Reserve (SPR) to one billion barrels. Two existing SPR sites, Big Hill, TX, and Weeks Island, LA, are among the eight that are being considered. To achieve the billion barrel capacity, some 25 new leached caverns would be constructed, and would probably be established in two separate sites in Louisiana and Texas because of distribution requirements. Geotechnical factors involved in siting studies have centered first and foremost on cavern integrity and environmental acceptability, once logistical suitability is realized. Other factors have involved subsidence and flooding potential, loss of coastal marshlands, seismicity, brine injection well utility, and co-use by multiple operators. 5 refs., 11 figs., 2 tabs.

Neal, J.T. (Sandia National Labs., Albuquerque, NM (United States)); Whittington, D.W. (USDOE Strategic Petroleum Reserve Project Management Office, New Orleans, LA (United States)); Magorian, T.R. (Magorian (Thomas R.), Amherst, NY (United States))

1991-01-01T23:59:59.000Z

279

Microsoft PowerPoint - 4-07 Herman _1000 hr test talk  

NLE Websites -- All DOE Office Websites (Extended Search)

L3100-2010-00229 L3100-2010-00229 Results of the 1000 Hour Rotary Microfilter Endurance Test D.T. Herman - SRNL W. Greene, J. Gilmour, T. Ho - SpinTek 11/16/10 EM Waste Processing Technical Exchange 2010 Print Close 2 SRNL-L3100-2010-00229 Rotary Microfilter 1000 Hour Test SpinTek Rotary Microfilter 1 - 25 filter disks ~11 inch diameter ~1 sq ft filter media per disk 1170 rpm 60 ft/s tip speed Turbulence promoters / baffles above and below disks increase shear at the membrane surface and reduce cake buildup 40 psi pressure drop across filter PERMEATE ROTATING MEMBRANES STATIONARY SHEAR ELEMENTS TIE RODS HOLLOW SHAFT Membrane Back plate Epoxy Bead Permeate carrier Print Close 3 SRNL-L3100-2010-00229 Rotary Microfilter 1000 Hour Test Design of the 2 nd Generation 25-Disk Rotary Filter Improvements:

280

This is the title of the presentation on three lines if you need it  

NLE Websites -- All DOE Office Websites (Extended Search)

30 30 Development of the Rotary Microfilter for Radioactive Waste Applications D.T. Herman M.R. Poirier, D.B. Stefanko, S.D. Fink 5/20/09 EM-21 Technology Exchange 2 Development of the Rotary Microfilter for Radioactive Waste Applications Introduction SRS developing processes to treat radioactive liquid waste Crossflow filter testing has shown filtration rates less than desired Funded by EM-21 to investigated methods to improve separation of sludge solids from high level waste salt solution Identified rotary microfilter as a potential alternative to a crossflow filter 3 Development of the Rotary Microfilter for Radioactive Waste Applications SpinTek Rotary Microfilter 1 - 25 filter disks ~11 inch diameter ~1 sq ft filter media per disk 1170 rpm 60 ft/s tip speed

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Section 74  

NLE Websites -- All DOE Office Websites (Extended Search)

" VIS % b 2 " 2 VIS % b 3 ln(1 0 ) Session Papers 317 (1) Narrowband-to-Broadband Conversion: Do Clouds Have Anomalous Absorption in the Visible Band? Z. Li and A. Trishchenko...

282

GoGlobal Fall 2006  

E-Print Network (OSTI)

power-politics vis-à-vis Iran and Syria, both of whomcourtesy of Cori Montgomery. Iran the Next War? Panel Reporttudent participation made Iran the Next War? a commendable

2006-01-01T23:59:59.000Z

283

Technical Report Documentation Page 1. Report No.  

E-Print Network (OSTI)

-tissue behavior. The model shown in Fig. 10 corresponds to a vis- coelastic, stip-slick friction model where

284

Increasing the Scalability of PISM for High Resolution Ice Sheet Models Phillip Dickens  

E-Print Network (OSTI)

: Contouring of two trillion cells, visualized with VisIt on Franklin using 32000 cores. (OLCF/ORNL's Jaguar

Dickens, Phillip M.

285

Method for joining metal by solid-state bonding  

DOE Patents (OSTI)

The present development is directed to a method for joining metal at relatively low temperatures by solid-state bonding. Planar surfaces of the metal workpieces are placed in a parallel abutting relationship with one another. A load is applied to at least one of the workpieces for forcing the workpieces together while one of the workpieces is relatively slowly oscillated in a rotary motion over a distance of about 1.degree.. After a preselected number of oscillations, the rotary motion is terminated and the bond between the abutting surfaces is effected. An additional load may be applied to facilitate the bond after terminating the rotary motion.

Burkhart, L. Elkin (Oak Ridge, TN); Fultz, Chester R. (Kingston, TN); Maulden, Kerry A. (Knoxville, TN)

1979-01-01T23:59:59.000Z

286

Machines  

Science Conference Proceedings (OSTI)

...are used to supply electrical energy for the welding operation. The transformer tap switch frequently is a rotary, eight-step, knife-type, fully enclosed locking switch, which provides convenient adjustment of the welding voltage to suit work

287

--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

with two Model VS-50 Gardner Denver variable speed oil flooded rotary screw air compressor rated at 354 scfm at 125 psig. Replacement of Air Compressors - Building 775-A...

288

CX-003957: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

with two Model VS-50 Gardner Denver variable speed oil flooded rotary screw air compressor rated at 354 standard cubic feet per minute at 125 pound-force per square inch...

289

A Study of Coal-Based Direct Reduction of Composite Binder ...  

Science Conference Proceedings (OSTI)

Abstract Scope, A study of the coal-based direct reduction behaviors of composite ... pellets was carried out in a simulating coal-based grate-rotary kiln process.

290

Near-Surface Frontal Zone Trapping and Deep Upward Propagation of Internal Wave Energy in the Japan/East Sea  

Science Conference Proceedings (OSTI)

The full-depth current structure in the Japan/East Sea was investigated using direct velocity measurements performed with lowered and shipboard acoustic current Doppler profilers. Rotary spectral analysis was used to investigate the three-...

Andrey Y. Shcherbina; Lynne D. Talley; Eric Firing; Peter Hacker

2003-04-01T23:59:59.000Z

291

LMRP Containment Pic  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NOTE: Rotary Kelly Bushing (RKB) is 92' above mean sea level LMRP (closed) with slick joint across the annular 2 Bumper Subs (5' of stroke in each) 6-58" OD Drill Pipe Inside...

292

Deep-Flow Variability at Drake Passage  

Science Conference Proceedings (OSTI)

A rotary empirical orthogonal function analysis of the currents measured in central Drake Passage during DRAKE 79 shows that the deep (2500 m) flow has the same spatial and temporal structure as the flow at 500 m, suggesting that current ...

John M. Klinck; Eileen E. Hofmann

1986-07-01T23:59:59.000Z

293

Mechanical high?vacuum pumps with an oil?free swept volume  

Science Conference Proceedings (OSTI)

In both corrosive and clean duties the widely used oil lubricated rotary pump has certain disadvantages. In corrosive applications aggressive vapors and/or abrasive particles tend to contaminate the lubricant of the pump

H. Wycliffe

1987-01-01T23:59:59.000Z

294

JOURNAL DE PHYSIQUE Colloque C5, supplBment au n05, Tome 50, mai 1989  

E-Print Network (OSTI)

1.For the evacuation of the system a rotary vane pump with mechanical oil filtrationin material enters the pump. The pressure in the process tube was conuolled by a baratron pressure sensor

Paris-Sud XI, Université de

295

956 Brazilian Journal of Physics, vol. 36, no. 3B, September, 2006 Surface Roughness of Thin Gold Films and its Effects on the Proton Energy Loss Straggling  

E-Print Network (OSTI)

(QCB). The sputtering system is evacuated using a small turbo molecular pump with an oil free rotary pump, reaching a pres- sure below 10 mTorr. Samples were prepared with three dif- ferent deposition

Vargas, Patricio

296

Southern California Channel Islands Bibliography, through 1992  

E-Print Network (OSTI)

of rotary-separator-turbine rotor materials. The materials,by a fixed pitch wind turbine rotor. The present state-of-Power/Turbines/Wind turbine rotors/wind power/Renewable

Channel Islands National Marine Sanctuary

1992-01-01T23:59:59.000Z

297

Ferrohydrodynamic flows in uniform and non-uniform rotating magnetic fields  

E-Print Network (OSTI)

Ferrofluids are conventionally used in such DC magnetic field applications as rotary and exclusion seals, stepper motor dampers, and heat transfer fluids. Recent research demonstrates ferrofluid use in alternating and ...

He, Xiaowei, Ph. D. Massachusetts Institute of Technology

2006-01-01T23:59:59.000Z

298

Gravity Wave – Fine Structure Interactions, Part 1: Influences of Fine-Structure Form and Orientation on Flow Evolution and Instability  

Science Conference Proceedings (OSTI)

Four idealized direct numerical simulations are performed to examine the dynamics arising from the superposition of a monochromatic gravity wave and sinusoidal linear and rotary fine structure in the velocity field. These simulations are motivated ...

David C. Fritts; Ling Wang; Joseph A. Werne

299

Next Generation Biomaterials  

Science Conference Proceedings (OSTI)

Apr 2, 2012 ... Characterization of Next-Generation Nickel-Titanium Rotary ... Manufacturing of Composite Fibrous Membranes for Biomedical and Energy Storage ... Prediction of the Stress Distribution and the Coating Delamination in ...

300

Recipient: 2003 Champion H. Mathewson Award  

Science Conference Proceedings (OSTI)

Paper: “Coal Pyrolysis in a Rotary Kiln: Part I. Model of the Pyrolysis of a Single Grain” and “Part II. Overall Model of the Furnace” Biography: Fabrice Patisson is ...

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

EOF Analysis of Central Drake Passage Currents from DRAKE 79  

Science Conference Proceedings (OSTI)

A rotary Empirical Orthogonal Function analysis was performed on the current meter observations made dining DRAKE 79 to quantify current variability in central Drake Passage in the vicinity of the Polar Front. Two forms of variability are ...

John M. Klinck

1985-03-01T23:59:59.000Z

302

http://bellview/TeamWorks/TRUTeamWorks.htm  

NLE Websites -- All DOE Office Websites (Extended Search)

in stock. In recent years, the Marietta has trimmed out East 140 and rehabilitated the roof in the northern end of the mine. The DOSCO rotary head (road header) mining machine...

303

Magnetic and Cryogenic Design of the MICE Coupling Solenoid Magnet System  

E-Print Network (OSTI)

magnet, the performances of the pulse tube cooler rotary valve motor,Motor Fig.1. The cross-section of MICE coupling coil assembly R/m Fig.3 The Magnet

Wang, Li

2009-01-01T23:59:59.000Z

304

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

State Energy Program Conductor Optimized Rotary Energy Mega-Watt Scale Direct Wind Generator CX(s) Applied: A9, B5.1 Date: 09292010 Location(s): Ronan, Montana...

305

Upgrading coal plant damper drives  

Science Conference Proceedings (OSTI)

The replacement of damper drives on two coal-fired units at the James H. Miller Jr. electric generating plant by Intelligent Contrac electric rotary actuators is discussed. 2 figs.

Hood, N.R.; Simmons, K. [Alamaba Power (United States)

2009-11-15T23:59:59.000Z

306

Engineering Task Plan for Water Supply for RMCS Spray Wash Trailer  

Science Conference Proceedings (OSTI)

This ETP defines the task and deliverables associated with the design, fabrication and testing of an improved spray wash system for the Rotary Mode Core Sampling (RMCS)Spray Wash Trailer.

BOGER, R.M.

2000-04-20T23:59:59.000Z

307

Engineering Task Plan for Water Supply for Spray Washers on the Support Trucks  

SciTech Connect

This Engineering Task Plan (ETP) defines the task and deliverables associated with the design, fabrication and testing of an improved spray wash system for the Rotary Mode Core Sampling (RMCS) System Support Trucks.

BOGER, R.M.

2000-02-03T23:59:59.000Z

308

Electrochemically Preparing of Ni-Fe Alloys in Molten Sodium ...  

Science Conference Proceedings (OSTI)

A Pilot-plant Scale Test of Coal-based Rotary Kiln Direct Reduction of Laterite Ore for Fe-Ni Production · A Pilot-plant Scale Test on DRI Preparation from ...

309

Increasing Energy Efficiency and Reducing Emissions from China's Cement Kilns: Audit Report of Two Cement Plants in Shandong Province, China  

E-Print Network (OSTI)

Cooling water to cooling towers Steam Turbine GeneratorPrecalciner Condensate – cooling tower etc. Hot air to waterCooling water from cooling towers Exhaust gases/air Rotary

Price, Lynn

2013-01-01T23:59:59.000Z

310

CX-005866: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Rotary Microfilter Demonstration in 786-ACX(s) Applied: B3.6Date: 03/09/2011Location(s): Aiken, South CarolinaOffice(s): Environmental Management, Savannah River Operations Office

311

A Tip Driven Fan Based on SERAPHIM Technology  

SciTech Connect

SERAPHIM technology appears capable of efficiently driving a tip driven fan. If the motor is powered using an inverter and resonant circuit, the size and weight could be considerably below that of a comparable rotary electric motor.

MARDER, BARRY M.

2002-01-01T23:59:59.000Z

312

Global Change Biology  

NLE Websites -- All DOE Office Websites (Extended Search)

2 flow was measured by an electronic flow sensor and throttled by a Kurz rotary ramp metering valve (Model 735, Kurz Instruments, Monterey, CA) that pro- vided a very even, linear...

313

2003 TMS Annual Meeting: Supplier Presentation Sessions  

Science Conference Proceedings (OSTI)

Anthony Osborn, Sales Manager – Worldwide Education Sales, ... including the Rotary Flux/Gas Injectors (RFI/RGI); Degassers including the Alcan Compact in ... Differences between Synthetic and Natural bone ash products will be described.

314

Influence of Parameters on Process Performance during Electro ...  

Science Conference Proceedings (OSTI)

Thus, there is a natural tendency to choose advance non conventional machining process .... Rotary Ultrasonic Drilling of Al2O3 Ceramic Material ... Water Modeling Study on the Behavior of Inclusions in a Gas-Stirred Ladle with Two Tuyere ...

315

Precision contour gage  

DOE Patents (OSTI)

An apparatus for gaging the contour of a machined part includes a rotary slide assembly and a linear probe assembly supported by the rotary slide assembly. The linear probe assembly is comprised of a suspension arm and a tip assembly including a probe tip for contacting the part. The suspension arm is supported by the rotary slide assembly and includes a slider portion which is capable of sliding upon a complementary rail located on a rotating platform at the top of the rotary slide assembly. By engagement of the slider with the rail, the linear probe assembly is capable of being positioned with respect to the rotary slide assembly. Repositioning is required when a concave part to be measured is substituted for a convex part or vice versa. A kinematic mount supports the entire contour gaging apparatus. A motor drives the rotary slide assembly, and the motor is controlled by a numerical control apparatus. The rotation of the rotary slide assembly is measured by a digital encoder. The probe tip provides a measure of linear displacement of the tip on the surface of the part. As the rotary slide assembly rotates and as the probe tip contact the part, a series of actual data points are generated representing the actual contour of the part. In a numerical controller, the actual contour is compared with a stored ideal contour, and a disparity between the two is calculated. In real-time, the settings of the machining apparatus may be adjusted by the numerical controller, and additional machining operations can continue until the actual contour is as close to the ideal contour as desired. 4 figs.

Bieg, L.F.

1989-02-09T23:59:59.000Z

316

Component- and systems-evaluation study of solar desiccant cooling. Semiannual progress report  

DOE Green Energy (OSTI)

Simulation studies of three system configurations in four different climates have been conducted. These studies have determined some necessary limits for various system parameters. The potential of these systems for providing air conditioning using solar energy only has been examined. The simulation studies are proceeding on schedule. The test facility for experimentally evaluating rotary dehumidifiers performance is under construction at CSIRO. A rotary wheel is being built for use in the tests.

Not Available

1980-07-18T23:59:59.000Z

317

Renewal processes and fluctuation analysis of molecular motor stepping  

E-Print Network (OSTI)

We model the dynamics of a processive or rotary molecular motor using a renewal processes, in line with the work initiated by Svoboda, Mitra and Block. We apply a functional technique to compute different types of multiple-time correlation functions of the renewal process, which have applications to bead-assay experiments performed both with processive molecular motors, such as myosin V and kinesin, and rotary motors, such as F1-ATPase.

Jaime E. Santos; Thomas Franosch; Andrea Parmeggiani; Erwin Frey

2005-05-29T23:59:59.000Z

318

Visualization and Analytics Software at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

Analytics Analytics Visualization and Analytics AVS/Express AVS/Express includes functionality for data visualization and analysis, image processing and data display. It uses a graphical application development environment. Read More » VisIt - 3D Scientific Visualization VisIt is a point-and-click 3D scientific visualization application that supports most common visualization techniques (e.g., isocontouring and volume rendering) on structured and unstructured grids. Due to its distributed and parallel architecture, VisIt is able to handle very large datasets interactively. In addition, VisIt is extensible, allowing users to add data loaders or additional analysis tools to VisIt. The NERSC Analytics Group has developed extensions to VisIt to support NERSC user applications,

319

Presented by Visualization at ORNL's  

E-Print Network (OSTI)

- Bioenergy - Material science - Nuclear energy - Astrophysics - Geographic information systems - ... · Focus_LCFViz_0711 #12;· Support MD data analysis for - Bioenergy - Material science - Drug modeling · Vis

320

Dr. Sara Barron  

Science Conference Proceedings (OSTI)

... A, B, and C. Right: Map of the thickness distribution on to the ... to thermochromism, such as transition temperatures, VIS/IR transmission, and thermal ...

2013-03-13T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

davis-99.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

At visible (VIS) wavelengths, incoming solar photons are eventually reflected back to space or absorbed by the ground, so their trajectories are bounded random walks. However,...

322

FOAM:The Fast Ocean Atmosphere Model  

NLE Websites -- All DOE Office Websites (Extended Search)

Models Performance User Resources Publications History Developer's Page FOAM The Fast Ocean Atmosphere Model cup2.jpeg (48474 bytes) Image made by Johan Kellum with Vis5D...

323

109 [Con05].  

E-Print Network (OSTI)

Version 3.258 Title word cross-reference + [Kle06, Wir76]. ?1 [Nah98]. 1.13198824...[Vis00]. = [Wir76]. ? [Gra88].

Nelson H. F. Beebe

2013-01-01T23:59:59.000Z

324

Mechanin?s aktyvacijos ir pried? poveikis ekstrakcinio pushidra?io fosfogipso ir jo gamini? savyb?ms.  

E-Print Network (OSTI)

??Fosfogipso perdirbimas tampa vis aktualesn? problema ne tik Lietuvoje, bet ir visame pasaulyje. Tiek Lietuvos, tiek ir pasaulio mokslininkai jau seniai bando spr?sti fosfogipso perdirbimo… (more)

Gaidu?is, Sergejus

2010-01-01T23:59:59.000Z

325

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

326

Oliver Ruebel  

NLE Websites -- All DOE Office Websites (Extended Search)

Oliver R ubel, Hank Childs, Gunther H. Weber, Prabhat, Kesheng Wu, "A System for Query Based Analysis and Visualization", Third International EuroVis Workshop on Visual...

327

Prabhat  

NLE Websites -- All DOE Office Websites (Extended Search)

Oliver R ubel, Hank Childs, Gunther H. Weber, Prabhat, Kesheng Wu, "A System for Query Based Analysis and Visualization", Third International EuroVis Workshop on Visual...

328

Gunther H. Weber  

NLE Websites -- All DOE Office Websites (Extended Search)

Oliver R ubel, Hank Childs, Gunther H. Weber, Prabhat, Kesheng Wu, "A System for Query Based Analysis and Visualization", Third International EuroVis Workshop on Visual...

329

Program: Fire Risk Reduction in Buildings  

Science Conference Proceedings (OSTI)

... performance, and developed a UV-VIS spectroscopy method to quantify carbon nanotubes at concentrations an order of magnitude lower than any ...

2013-01-02T23:59:59.000Z

330

A Membrane Process for Industrial Water Treatment: From Bench to Pilot Demonstration  

Science Conference Proceedings (OSTI)

A rotary membrane filtration system was used to separate die lubricant from a manufacturing wastewater stream consisting of various oils, hydrocarbons, heavy metals, and silicones. The ultrafiltration membranes reduced organics from initial oil and grease contents by factors of 20 to 25, carbon oxygen demand by 1.5 to 2, and total organic carbon by 0.6, while the biological oxygen demand remained constant. The rotary membranes were not fouled as badly as static membranes, and the rotary membrane flux levels were consistently higher and more stable than those of the static membranes tested. Field testing demonstrated that the rotary ultrafilter can concentrate the die lubricant, remove the glycerin component, and produce a die lubricant suitable for in-plant recycling. The recycling system operated for 6 weeks with only seven cleaning cycles and no mechanical or electrical failures. Test data and quality records indicate that when recycled die lubricant was used, the die casting scrap was reduced from 8.4 to 7.8%. Rotary ultrafiltration presents significant opportunities that can be evaluated further.

Eric S. Peterson; Bill Cleary; Michael Hackett; Jessica Trudeau

2005-01-01T23:59:59.000Z

331

Diffusion in active magnetic colloids  

E-Print Network (OSTI)

Properties of active colloids of circle swimmers are reviewed. As an particular example of active magnetic colloids the magnetotactic bacteria under the action of a rotating magnetic field is considered. The relation for a diffusion coefficient due to the random switching of the direction of rotation of their rotary motors is derived on the basis of the master equation. The obtained relation is confirmed by the direct numerical simulation of random trajectory of a magnetotactic bacterium under the action of the Poisson type internal noise due to the random switching of rotary motors. The results obtained are in qualitative and quantitative agreement with the available experimental results and allows one to determine the characteristic time between the switching events of a rotary motor of the bacterium.

Reinis Taukulis; Andrejs Cebers

2013-10-04T23:59:59.000Z

332

A Simple Continuous Parametrization of the Kasner Indices  

E-Print Network (OSTI)

A parametrization of the Kasner indices in terms of a continuous parameter is constructed by exploiting their representation as trilinear coordinates. This provides a clear picture of their variation through their entire range vis a vis each other. The parameter can be expressed as a function of time.

Alex Harvey

2012-12-12T23:59:59.000Z

333

Acceptability of Four Transformer Top-Oil Thermal Models: Pt. 2: Comparing Metrics  

E-Print Network (OSTI)

1 Acceptability of Four Transformer Top-Oil Thermal Models: Pt. 2: Comparing Metrics Lida Jauregui transformer top-oil thermal models are examined vis-à-vis training with measured data. Acceptability is unacceptable for model identification purposes. The linear top-oil model is acceptable for FOFA transformers

334

Understanding Research Trends in Conferences using Bongshin Lee 1,2  

E-Print Network (OSTI)

broad bibliographical and full-text access to journals and conference proceedings. Users can search (1995-2002) of InfoVis conference proceedings and was then extended to visualize 23 years (1982-up menu showing the list of papers close to the current cursor position. The IEEE InfoVis 2004 Conference

Bederson, Benjamin B.

335

Designing scalable networks with multiple personalities Department of Mathematics and Computer Science,  

E-Print Network (OSTI)

Designing scalable networks with multiple personalities Bilal Khan Department of Mathematics with its own merits vis-a-vis performance metrics. Specifically, in this paper we focus on physical (G) = lZ+ Pl (G). An overlay network is a set of walks Q P (G), which together implement a (multi

Khan, Bilal

336

OPTIMIZATION OF HYBRID GEOTHERMAL HEAT PUMP SYSTEMS Scott Hackel, Graduate Research Assistant; Gregory Nellis, Professor; Sanford Klein,  

E-Print Network (OSTI)

users. Refer to the ASOS Quick Reference Handbook published by the National Weather Service=a wind shift occurred at 1715Z as a result of a frontal passage. TOWER OR SURFACE VISIBILITY: Tower visibility is coded as TWR_VIS_ vvvv and is the visibility reported by tower personnel. For example, TWR VIS

Wisconsin at Madison, University of

337

Presentation 2.2: Biofuels -A Strategic Option for the Global Forest Sector? Michael Obersteiner  

E-Print Network (OSTI)

Presentation 2.2: Biofuels - A Strategic Option for the Global Forest Sector? Michael Obersteiner Generation Biofuels. We will close with a SWOT analysis of the forest sector vis-à-vis the oil industry the emerging big player on the biofuels market. 117 #12;#12;Michael Obersteiner & Sten Nilsson International

338

Early mover advantages: An empirical analysis of European mobile phone markets  

Science Conference Proceedings (OSTI)

This paper analyzes empirically whether and if so to what extent later entrants in the European mobile telephony industry have a disadvantage vis-a-vis incumbents and early mover entrants. To analyze this question a dynamic model of market share development ... Keywords: Early mover advantages, Mobile telecommunication

Govert E. Bijwaard; Maarten C. W. Janssen; Emiel Maasland

2008-04-01T23:59:59.000Z

339

Facial expression recognition from near-infrared videos  

Science Conference Proceedings (OSTI)

Facial expression recognition is to determine the emotional state of the face regardless of its identity. Most of the existing datasets for facial expressions are captured in a visible light spectrum. However, the visible light (VIS) can change with ... Keywords: Component-based facial features, Facial expression recognition, Near-infrared (NIR), Spatiotemporal descriptors, Visible light (VIS)

Guoying Zhao; Xiaohua Huang; Matti Taini; Stan Z. Li; Matti PietikäInen

2011-08-01T23:59:59.000Z

340

Apparatus and method for separating constituents  

DOE Patents (OSTI)

A centrifugal separator apparatus and method for improving the efficiency of the separation of constituents in a fluid stream. A cyclone separator includes an assembly for separately discharging both constituents through the same end of the separator housing. A rotary separator includes a rotary housing having a baffle disposed therein for minimizing the differential rotational velocities of the constituents in the housing, thereby decreasing turbulence, and increasing efficiency. The intensity of the centrifugal force and the time which the constituents reside within the housing can be independently controlled to improve efficiency of separation.

Maronde, Carl P. (McMurray, PA); Killmeyer, Jr., Richard P. (Pittsburgh, PA)

1992-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Cost effectiveness of sonic drilling  

SciTech Connect

Sonic drilling (combination of mechanical vibrations and rotary power) is an innovative environmental technology being developed in cooperation with DOE`s Arid-Site Volatile Organic Compounds Integrated Demonstration at Hanford and the Mixed Waste Landfill Integrated Demonstration at Sandia. This report studies the cost effectiveness of sonic drilling compared with cable-tool and mud rotary drilling. Benefit of sonic drilling is its ability to drill in all types of formations without introducing a circulating medium, thus producing little secondary waste at hazardous sites. Progress has been made in addressing the early problems of failures and downtime.

Masten, D.; Booth, S.R.

1996-03-01T23:59:59.000Z

342

Modeling of Gaussian beam diffraction on volume Bragg gratings in Igor V. Ciapurin,  

E-Print Network (OSTI)

, V. I. Smirnov, G. B. Venus, L. N. Glebova, E. V. Rotari, and L. B. Glebov, 2004 CLEO/IQEC and PhAST. Dergachev, P. F. Moulton, V. I. Smirnov, and L. B. Glebov, 2004 CLEO/IQEC and PhAST Technical Digest, Paper

Glebov, Leon

343

AH-64D main transmission accessory drive spur gear installation fault detections  

Science Conference Proceedings (OSTI)

The US Army has launched an aggressive program to implement condition based maintenance on its rotary wing assets. Condition Based Maintenance takes advantage of technology developments in the areas of machinery monitoring, signal processing and fault ... Keywords: Apache, Clutch, Diagnostic, Rotorcraft, Transmission

Jonathan Keller; Damian Carr; Frances Love; Paul Grabill; Hieu Ngo; Perumal Shanthakumaran

2012-04-01T23:59:59.000Z

344

Pressure Buildup and Brine Migration During CO2 Storage in Multilayered Aquifers  

E-Print Network (OSTI)

have extremely low liquid and gas permeabilities in the hardened state · can be modified to suit of limestone (or chalk) and clay (or shale) in a rotary kiln. The maximum kiln temperature reaches ca.1450o C The Lurgi slagging gasification process has been developed to convert coal into substitute natural gas

Zhou, Quanlin

345

EE 3410 Electric Power Instructor: Ernest Mendrela  

E-Print Network (OSTI)

generator, (d) linear motor 1.2. Rotary system Two-pole machine with a single coil (phase) is shown in Fig.1 salient-pole rotor permanent magnet Single-coil stator winding f e (b) A1 A2 Coil Fig.1.3 Cylindrical have windings. The stator winding is a 3-phase winding and is sometimes called the armature winding

Koppelman, David M.

346

Perceptual consequences of visual performance fields: The case of the line motion illusion  

E-Print Network (OSTI)

alone does not resolve this issue, but McColgin (1960) reported HVAs in threshold for both vertical HVAs for various types of motion. In a detailed examination of motion thresholds across the visual field at eccentricities ranging from 2- to 14-, McColgin (1960) reported HVAs for rotary and linear

Carrasco, Marisa

347

Nitrogen chiller acceptance test procedure  

SciTech Connect

This document includes the inspection and testing requirements for the Nitrogen Chiller unit. The Chiller will support the Rotary Mode core Sampling System during the summer. The Chiller cools the Nitrogen Purge Gas that is used when drilling in tank wastes to cool the drill bit.

Kostelnik, A.J.

1995-03-07T23:59:59.000Z

348

Prof. Sivaram Arepalli joined the Department of Energy Science at Sungkyunkwan University (SKKU) in Suwon, Korea in March 2009 under the World Class University program. He is an Adjunct Professor  

E-Print Network (OSTI)

Program at NASA-Johnson Space Center where he worked for 21 years before moving to Korea. In addition of nanomaterials for energy applications such as fuel cells, solar cells, batteries and supercapacitors. He is also-JSC. In 2007, he received "Rotary National Space Achievement Award" for the accomplishments of the Carbon

Utzinger, Urs

349

Fuzzy vs. "manual" control in a FeNi plant  

Science Conference Proceedings (OSTI)

In this paper the effect on energy consumption and pollution of fuzzy automatic control of a rotary kiln is investigated. The computer-based fuzzy control system is installed at the Larko ferronickel plant in Larymna, Greece, by the Danish firm F.L. ...

A. Pouliezos; D. Papadimitriou; G. Tselentis

2000-08-01T23:59:59.000Z

350

International Conference on Microwave and RF Heating MICROWAVE PHOTOCHEMISTRY: PREPARATION OF THE  

E-Print Network (OSTI)

oil vacuum pump (1) (single-stage, limiting total pressure 10 Pa, type model VR 1,5-12; Lavat, Czech V3 6 7 Ar O2 Fig. 1. The vacuum system for preparation of EDLs: (1) rotary vacuum pump; (2) Hg

Cirkva, Vladimir

351

JOURNAL DE PHYSIQUE Colloque C7, suppl6ment au no 11, Tome 47, Novembre 1986  

E-Print Network (OSTI)

evacuated to 10 mbar with liquid nitrogen trapped oil diffkion pump and rotary pump combination. Article in the image is a dead portion of the screen. It was followed by pumping with sputter ion pump and titanium qtter pump. After a mild bakeout a t about 130°C for six hours, pressure below 2 x 10- mbar w

Paris-Sud XI, Université de

352

Microchannels and Minichannels -2004 June 17-19, 2004, Rochester, New York, USA  

E-Print Network (OSTI)

(positive displacement rotary type pump), oil then flows through a filter and preheating heat exchanger OF WATER IN AN OIL HEATED MINICHANNEL Levi A. Campbell and Satish Kandlikar* *Rochester Institute channel 158.75 mm long. Heat is supplied by heat transfer oil at specified temperatures to a helical

Kandlikar, Satish

353

Rotating electrical machines. Part 2: Methods for determining losses and efficiency of rotating electrical machinery from tests (excluding machines for traction vehicles)  

E-Print Network (OSTI)

Applies to d.c. machines and to a.c. synchronous and induction machines. The principles can be applied to other types of machines such as rotary converters, a.c. commutator motors and single-phase induction motors for which other methods of determining losses are used.

International Electrotechnical Commission. Geneva

1972-01-01T23:59:59.000Z

354

Regenerator seal design  

DOE Patents (OSTI)

A rotary regenerator disc matrix has a face seal with a cross arm and arcuate rim segments joined by prestress clamps to prestrain the arcuate rim seals so as to compensate seal rim twisting or coning and resultant disc face seal leakage as produced by operating thermal gradients across the seal.

Eckart, Francis H. (Bargersville, IN)

1982-01-01T23:59:59.000Z

355

7, 1324313269, 2007 EC fluxes of sea  

E-Print Network (OSTI)

for each residue. The conditioning tower has sixteen spray noz zles to control gas temperature. To give to handle several #12;PACKED TOWER SCRUBBER VISCOUS LIQUIDS/EMULSIONS AFTERBURNER SOLIDS ROTARY KILN they pass into a condi tioning tower mounted on top of the oxixizer. The conditioning tower is approximately

Paris-Sud XI, Université de

356

Materials Engineering Research ColloquiumMaterials Engineering Research Colloquium December 2, 2005December 2, 2005  

E-Print Network (OSTI)

, the configuration of electric arc furnaces (EAF) is not optimal to efficiently utilize hydrocarbon energy inputs-fuel-fired rotary furnace M. Tsui Ceramics Electrochemical deposition of calcium phosphate coating on coronary stent Metals Processing Group; T.R. Meadowcroft and P.V. Barr Frank Forward Building, Room 401 Department

British Columbia, University of

357

A Novel Process for Demulsification of Water-in-Crude Oil Emulsions by Dense Carbon Dioxide  

E-Print Network (OSTI)

using a wide variety of equipments such as centrifuges, rotary vacuum filters, belt presses, and filter concentrations behave as a liquid, with Newtonian flow characteristics. Centrifugal dewater- ing is possible obtained, which was considered acceptable since a dry- ing system followed centrifugation. Pressure filters

Kilpatrick, Peter K.

358

Testing and Error Analysis of Acceleration of Rotating Transformer  

Science Conference Proceedings (OSTI)

From the working principle of rotary transformers, the paper in-depth analyses the relationship between output voltage and rotor angle as well as speed. By using the method of series expansion and discrete, angular acceleration formula which is used ... Keywords: Rotating Transformer, Acceleration, Error of Measurement, slip frequency

Lu Xiuhe; Xue Peng

2010-07-01T23:59:59.000Z

359

Vacuum Induction Melting Unit Induction heating is a process wherein induced eddy currents heat conductive materials. This heating  

E-Print Network (OSTI)

Vacuum Induction Melting Unit Induction heating is a process wherein induced eddy currents heat can be melted at a time. There are three main parts to the system: chiller, power unit and vacuum unit. The vacuum unit with rotary and diffusion pumps can attain a vacuum of 106 m bar. The power can deliver

Subramaniam, Anandh

360

Recycling of Thermoset-Matrix Composites  

Science Conference Proceedings (OSTI)

Table 1   Thermoset composites recycling processes...Ref 14 ) Polyurethane foams, ASR Gas, oil, solid waste Hydrolysis ( Ref 10 , 11 ) Foams, RIM resin, and elastomers Monomers of the input material Fluidized bed combustion ( Ref 14 ) RIM Energy recovery, solid and gaseous wastes Rotary kiln combustion ( Ref 13 ) RIM Energy recovery, solid and gaseous...

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

SPIE 's 4TH Annual Symposium on Smart Structures and Materials, paper 3041 -38, Catamaran Resort Hotel, San Diego,  

E-Print Network (OSTI)

Hotel, San Diego, CA, 2-6 March 97 LARGE-AMPLITUDE ROTARY INDUCED-STRAIN (LARIS) ACTUATOR PROOF-strain material stacks is proposed. The concept utilizes the theory of twist-warping coupling in thin-wall open-amplifier utilizing the warping-torsion coupling of an open tube, is a viable design option, of great constructive

Giurgiutiu, Victor

362

Application on lithology recognition with BP artificial neural network  

Science Conference Proceedings (OSTI)

An Artificial Neural Network (ANN) model is established to recognize the drilled formations' lithologies while drilling. The styles of output and input of ANN are designed. The nerve cells in input layer are weight of bit (WOB), speed of rotary (SOR) ... Keywords: artificial neural network, drilling, formation lithology, recognition

Jinhui Zhou; Jienian Yan; Li Pan

2009-11-01T23:59:59.000Z

363

Mechanical and Hydraulic Press Brakes  

Science Conference Proceedings (OSTI)

...drives, with mechanical linkages from motor to flywheel to clutch to gears to crankshaft to crank arm to ram (Fig. 4). They all have one thing in common: a crankshaft action that converts rotary motion into straight, reciprocating motion (Fig. 5). During a stroke cycle, the crank arm drives the ram down...

364

The extraction of bitumen from western oil sands. Final report, July 1989--September 1993  

Science Conference Proceedings (OSTI)

Research and development of surface extraction and upgrading processes of western tar sands are described. Research areas included modified hot water, fluidized bed, and rotary kiln pyrolysis of tar sands for extraction of bitumen. Bitumen upgrading included solvent extraction of bitumen, and catalytic hydrotreating of bitumen. Characterization of Utah tar sand deposits is also included.

Oblad, A.G.; Bunger, J.W.; Dahlstrom, D.A.; Deo, M.D.; Fletcher, J.V.; Hanson, F.V.; Miller, J.D.; Seader, J.D.

1994-03-01T23:59:59.000Z

365

Graduate Student Achievements 09-10 MECHANICAL ENGINEERING  

E-Print Network (OSTI)

-Stage Piezoelectric-Based Electrical Energy Generators for Low and Variable Speed Rotary Machinery. SPIE 16th Annual XXVIII Conference and Exposition on Structural Dynamics: Structural Dynamics and Renewable Energynd Annual Meeting of the American Physical Society - Division of Fluid Dynamics. Minneapolis, MN

366

Diurnal Shelf Waves in the Southern Weddell Sea  

Science Conference Proceedings (OSTI)

Strong evidence is presented for the existence of barotropic shelf waves at diurnal frequencies in the shelf-break region of the southern Weddell Sea. Rotary spectra from long-term current meter records on the slope, at the shelf break and on the ...

Jason H. Middletton; Theodore D. Foster; Arne Foldvik

1987-06-01T23:59:59.000Z

367

Creep Behavior of Fine Grain, Low Carbon Allvac 718  

Science Conference Proceedings (OSTI)

Production ingots of standard (0.025 wt% C) and low carbon (0.010 wt% C) Allvac 718 were ... fatigue fracture initiation source in test specimens. ... Press Forge Process - Following homogenization, ingot breakdown to rotary ..... Part of the research sponsored by the Department of Energy, Assistant Secretary for Energy.

368

SHIPBOARD SCIENTISTS1 OCEAN DRILLING PROGRAM  

E-Print Network (OSTI)

Personnel 17 1. Laboratory Officer 17 2. Technicians 17 3. Computer System Manager 17 4. Curatorial. Logging Depth Measurements 34 D. Coring and Drilling Equipment and Usage 34 1. Rotary Coring (RCB) System 34 2. Advanced Piston Coring (APC) System 36 3. Extended Core Barrel (XCB) 37 4. Motor-Driven Core

369

Distributed Generation Source Stiffness and Its Impact on Voltage Distortion  

Science Conference Proceedings (OSTI)

Distributed generators with loads that create high harmonics can cause excessive voltage distortion. This report's objective was to evaluate under controlled laboratory conditions voltage distortion resulting from application of nonlinear load for three different types of rotary generators and one inverter-based generator. Test results also were used to verify the analytical model for predicting voltage distortion from nonlinear load application.

2001-11-27T23:59:59.000Z

370

System acceptance and operability test report for the RMCS exhauster C on flammable gas tanks  

DOE Green Energy (OSTI)

This test report documents the completion of acceptance and operability testing of the rotary mode core sampling (RMCS) exhauster C, as modified for use as a major stack (as defined by the Washington State Department of Health) on flammable gas tanks.

Waldo, E.J.

1998-03-11T23:59:59.000Z

371

2000 TMS Annual Meeting: Exhibitors Product and Technology Mini ...  

Science Conference Proceedings (OSTI)

Practical application of automatic guided vehicles; power and free conveyors; heavy-duty ... Natural oils vs synthetic “man-made” casting fluids. ... the most recent applications for the Alcan Compact Degasser and the Rotary Salt/gas Injectors. ... The EMP system, which is easily retrofitted to existing furnace installations, has ...

372

Flammable gas interlock spoolpiece flow response test plan and procedure  

DOE Green Energy (OSTI)

The purpose of this test plan and procedure is to test the Whittaker electrochemical cell and the Sierra Monitor Corp. flammable gas monitors in a simulated field flow configuration. The sensors are used on the Rotary Mode Core Sampling (RMCS) Flammable Gas Interlock (FGI), to detect flammable gases, including hydrogen and teminate the core sampling activity at a predetermined concentration level.

Schneider, T.C., Fluor Daniel Hanford

1997-02-13T23:59:59.000Z

373

Unlocking the smart grid  

Science Conference Proceedings (OSTI)

The country has progressed in a relatively short time from rotary dial phones to computers, cell phones, and iPads. With proper planning and orderly policy implementation, the same will happen with the Smart Grid. Here are some suggestions on how to proceed. (author)

Rokach, Joshua Z.

2010-10-15T23:59:59.000Z

374

Methodology and software to detect viral integration site hot-spots  

E-Print Network (OSTI)

HS/# Total VIS)*100/Mb. Data set names are as in Table 1. 3.17.36 minutes for this 7 data set analysis. The BCP methodspot distributions across data sets and patients, where the

Presson, Angela P; Kim, Namshin; Xiaofei, Yan; Chen, Irvin SY; Kim, Sanggu

2011-01-01T23:59:59.000Z

375

Vicarious Calibration of the Meteosat Visible Channel  

Science Conference Proceedings (OSTI)

Postlaunch calibration of the Meteosat visible (VIS) channel has been performed with Meteosat-1, Meteosat-2, and Meteosat-4. The radiance at the satellite radiometer aperture has been determined by independent means and has been related to the ...

Karl-Theodor Kriebel; Volker Amann

1993-04-01T23:59:59.000Z

376

Study of the reaction rate of gold nanotube synthesis from sacrificial silver nanorods through the galvanic replacement method  

Science Conference Proceedings (OSTI)

An investigation was carried out about the gold nanotube synthesis via a galvanic replacement reaction. The progress of the gold nanotube synthesis was investigated using electron microscopy and UV-Vis spectroscopy. In addition, the reaction rates of ...

Sunil Kwon; Hyunbae Dong; Sang-Yup Lee

2010-01-01T23:59:59.000Z

377

Steam Turbine Materials for Ultra Supercritical Coal Power Plants  

NLE Websites -- All DOE Office Websites (Extended Search)

Robert M. Purgert Principal Investigator Energy Industries of Ohio 6100 Oak Tree Boulevard Park Center One, Suite 200 Independence, OH 44131-6914 216-643-2952 purgert@msn.com Vis...

378

Proceedings of the 2005 ACM symposium on Software visualization  

Science Conference Proceedings (OSTI)

Welcome to SoftVis 05.Welcome to St. Louis for the second bi-annual ACM Symposium on Software Visualization. Software visualization encompasses the development and evaluation of methods for graphically representing different aspects of software, including ...

Tom Naps; Wim De Pauw

2005-05-01T23:59:59.000Z

379

#VRML V2.0 utf8  

Science Conference Proceedings (OSTI)

... Tue Sep 10 15:31:13 EDT 2013 (Command-line/Windows 7 64-bit/Tcl 8.5.14). # SteelVis website: www.nist.gov/el/msid/infotest/steelvis.cfm. ...

380

#VRML V2.0 utf8  

Science Conference Proceedings (OSTI)

... Tue Sep 10 15:34:17 EDT 2013 (Command-line/Windows 7 64-bit/Tcl 8.5.14). # SteelVis website: www.nist.gov/el/msid/infotest/steelvis.cfm. ...

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Probabilistic Parameterizations of Visibility Using Observations of Rain Precipitation Rate, Relative Humidity, and Visibility  

Science Conference Proceedings (OSTI)

This study analyzes the occurrence of the visibility (Vis) versus precipitation rates (PR) for rain and versus relative humidity (RH) from surface observations that were collected during the Fog Remote Sensing and Modeling (FRAM) field project, ...

I. Gultepe; J. A. Milbrandt

2010-01-01T23:59:59.000Z

382

Advanced Technology and Knowledge Transfer  

Science Conference Proceedings (OSTI)

This paper reports on a specific food and agribusiness industry project, employing new technological capabilities to better transfer expert knowledge. Knowledge transfer and technical support are key components of this project. VisIT, which stands for ...

Geetanjali Tandon; Steven T. Sonka

2003-01-01T23:59:59.000Z

383

In P. Kokol, B. Zupan, J. Stare, M. Premik & R. Engelbrecht (Eds), Medical Informatics in Europe (MIE '99), pp. 720-725, IOS Press, Amsterdam  

E-Print Network (OSTI)

(MIE '99), pp. 720-725, IOS Press, Amsterdam TIDE: An Intelligent Home-Based Healthcare Information-à-vis the provision of a continuum of personalised home-based healthcare services that emphasise the role

Abidi, Syed Sibte Raza

384

Tukey | Argonne Leadership Computing Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Compiling and Linking ParaView on Tukey Using Cobalt on Tukey VisIt on Tukey Eureka Gadzooks Policies Documentation Feedback Please provide feedback to help guide us as we...

385

Ray tracing and volume rendering large molecular data on multi-core and many-core architectures  

Science Conference Proceedings (OSTI)

Visualizing large molecular data requires efficient means of rendering millions of data elements that combine glyphs, geometry and volumetric techniques. The geometric and volumetric loads challenge traditional rasterization-based vis methods. Ray casting ...

Aaron Knoll, Ingo Wald, Paul A. Navrátil, Michael E. Papka, Kelly P. Gaither

2013-11-01T23:59:59.000Z

386

Visualizing geospatial data  

Science Conference Proceedings (OSTI)

This course reviews concepts and highlights new directions in GeoVisualization. We review four levels of integrating geospatial data and geographic information systems (GIS) with scientific and information visualization (VIS) methods. These include:• ...

Theresa Marie Rhyne; Alan MacEachren; Theresa-Marie Rhyne

2004-08-01T23:59:59.000Z

387

Forecasting Convective Initiation by Monitoring the Evolution of Moving Cumulus in Daytime GOES Imagery  

Science Conference Proceedings (OSTI)

This study identifies the precursor signals of convective initiation within sequences of 1-km-resolution visible (VIS) and 4–8-km infrared (IR) imagery from the Geostationary Operational Environmental Satellite (GOES) instrument. Convective ...

John R. Mecikalski; Kristopher M. Bedka

2006-01-01T23:59:59.000Z

388

Spectroscopic studies on the formation of coke on individual Fluid Catalytic Cracking particles: the effect of poisoning metal compounds.  

E-Print Network (OSTI)

??The formation of coke on individual Fluid Catalytic Cracking (FCC) catalyst particles was studied using UV/Vis microspectroscopy and confocal fluorescence microscopy, with n-hexane cracking as… (more)

Goetze, J.G.

2013-01-01T23:59:59.000Z

389

New Generating Resources  

E-Print Network (OSTI)

Terrorist attacks constrain gas and oil imports and leads to global stagnation, and a U.S. recession, which is followed by sustained low economic growth where energy independence away from Middle East Oil and LNG imports is critical. Little competition or retirement of generation capacity, extended recovery from overbuild, and utilities gain vis-à-vis IPPs in a business environment where competition takes a backseat to energy independence. Terrorist attacks on U.S. and Int'l

Irp Stakeholders Group; David Clement; Steve Lush; Marilynn Semro; Seattle City; Power Horizons Scenarios

2006-01-01T23:59:59.000Z

390

Adsorption de disilane sur Si(111) 7 7. Influence de l'hydrogne M. Alaoui, F. Ringeisen, D. Bolmont et J. J. Koulmann  

E-Print Network (OSTI)

931 Adsorption de disilane sur Si(111) 7 7. Influence de l'hydrogène M. Alaoui, F. Ringeisen, D, accepté le 23 mai 1990) Résumé. 2014 L'adsorption de disilane sur Si(111) 7 x 7 dans la gamme de en hydrogène ou disilane à 350 °C, est passivée vis-à-vis du disilane à TA. Pour obtenir la formation

Paris-Sud XI, Université de

391

ROCKY MOUNTAIN OILFIELD TESTING CENTER PROJECT TEST RESULTS  

NLE Websites -- All DOE Office Websites (Extended Search)

06/97DT15 06/97DT15 RMOTC Test Report Rotary Steerable Stabilizer Smith Drilling and Completions 16740 Hardy Street P. 0. Box 60068 Houston, Texas, 77205-0068 281-443-3370 Leo Giangiacorno, Acting Project Manager Rocky Mountain Oilfield Testing Center December 17, 1997 Introduction Directional drilling is more expensive than vertical drilling. This is due to the high maintenance cost of downhole motors and MWD systems required to control hole trajectory. In addition, directional holes have lower penetration rates due to the poor hole cleaning with a non-rotating string. Down time is often spent orienting tool face to obtain the desired trajectory after tile weight is placed on the bit and the reactive torque of the motor is absorbed by the drill string. Holes drilled in this manner often have a tortuous profile compared to holes drilled with a rotary system, increasing the torque

392

CX-006689: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

689: Categorical Exclusion Determination 689: Categorical Exclusion Determination CX-006689: Categorical Exclusion Determination TP Rotary Steerable Tool CX(s) Applied: B3.11, B5.7, B5.12 Date: 08/24/2010 Location(s): Casper, Wyoming Office(s): RMOTC The purpose of this project is to test a new design Rotary Steerable Tool (TP RS) that will drill a vertical hole by detecting hole deviation and correcting back to vertical. This test will coordinate with an ongoing drilling operation to allow the insertion of the TP RS tool downhole to accumulate a few hours of drilling time and footage as allowed in the cost estimate with minimal disruption of operations. Associated operations will be tripping, make up of Partner tools and insertion into bottom hole assembly (BHA), tripping, drilling, tripping, breakdown, laydown, and load

393

 

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sludge simulant is needed for rotary microfliter (RMF) testing. The PEP sludge simulant is a blend of the following five major components: Fe-rich Sludge simulant is needed for rotary microfliter (RMF) testing. The PEP sludge simulant is a blend of the following five major components: Fe-rich sludge simulant, specific supernate simulant, aluminum hydroxide solids, aluminum oxyhydroxide solids, and sodium oxalate solids. The specific supernate simulant has the following components: Sodium oxalate, aluminum nitrate, sodium phosphate, sodium sulfate, sodium nitrate, sodium hydroxide, sodium nitrite, and sodium carbonate. The Fe-rich sludge simulant has the following components: Solid hydroxides of iron, calcium, cerium, lanthanum, neodymium, nickel, strontium, and zirconium; and manganese dioxide solids in a supernate matrix comprising sodium oxalate, sodium phosphate, sodium nitrate, sodium hydroxide, and sodium carbonate. The objective of this work is to prepare approximately 8.5 liters PEP sludge

394

Tuesday, August 24, 2010  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

_;o7 _;o7 Project Information Project Title: TP Rotary Steerable Tool Date: 7-29-10 DOE Code: 71096 Contractor Code: 8067-783 Project Lead: Frank Ingham Project Overview 1. Brief project description [include The purpose of this project is to test a new design Rotary Steerable Tool (TP RS) that will drill a vertical hole anything that could impact the by detecting hole deviation and correcting back to vertical. This test will coordinate with an ongoing drilling environment] operation to allow the insertion of the TP RS tool downhole to accumulate a few hours of drilling time and footage as allowed in the cost estimate with minimal disruption of operations. Associated operations will be 2. Legal location tripping, make up of Partner tools and insertion into BHA, tripping, drilling, tripping, breakdown, laydown, and

395

Renewal processes and fluctuation analysis of molecular motor stepping  

E-Print Network (OSTI)

Abstract. We present a systematic method of analysis of experiments performed with single motors proteins. The use of such a method should allow a more detailed description of the motor’s chemical cycle through the precise fitting of the experimental data. We model the dynamics of a processive or rotary molecular motor using a renewal processes, in line with the work initiated by Svoboda, Mitra and Block. We apply a functional technique to compute different types of multiple-time correlation functions of the renewal process, which have applications to bead-assay experiments performed both with processive molecular motors, such as myosin V and kinesin, and rotary motors, such as F1-ATPase. PACS numbers: 02.50.Ey,05.60.-k,05.40.-a § To whom correspondence should be addressed (frey@lmu.de) Renewal processes and fluctuation analysis of molecular motor stepping 2 1.

Jaime E. Santos; Thomas Franosch; Andrea Parmeggiani

2005-01-01T23:59:59.000Z

396

SRNL - News Room  

NLE Websites -- All DOE Office Websites (Extended Search)

Filter Design Reduces Waste Treatment Costs Filter Design Reduces Waste Treatment Costs ( PDF button Download printer-friendly, PDF version) SRNL Rotary Microfilter AIKEN, S.C. (January 25, 2011) - The redesign of a filtration system by the U.S. Department of Energy's Savannah River National Laboratory (SRNL) is expected to help the DOE Office of Environmental Management drastically reduce cost and infrastructure for the treatment and permanent disposal of its inventory of high level radioactive waste. The U.S. Patent Office has recently allowed a patent on the reconfiguration of a commercial rotary filter, which has also been licensed by the company that produced the original system - two important steps in putting this technology into the marketplace for use by other potential customers.

397

Word Pro - S5  

U.S. Energy Information Administration (EIA) Indexed Site

Crude Oil and Natural Gas Resource Development Indicators Rotary Rigs in Operation by Type, 1949-2012 Rotary Rigs in Operation by Type, Monthly Active Well Service Rig Count, Monthly Total Wells Drilled by Type, 1949-2010 . 76 U.S. Energy Information Administration / Monthly Energy Review November 2013 Total 1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 0 1 2 3 4 Thousand Rigs 1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 0 10 20 30 40 50 Thousand Wells Dry Wells Crude Oil Wells Web Page: http://www.eia.gov/totalenergy/data/monthly/#crude. Sources: Tables 5.1 and 5.2. Crude Oil J FMAMJ J A SOND J FMAMJ J A SOND J FMAMJ J

398

Microsoft PowerPoint - 1-06 Subramanian Sams11-12.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

WP Technical Exchange WP Technical Exchange Hanford/SRS Tank Waste Path Forward Karthik Subramanian, SRR Terry Sams, WRPS 11/16/2010 SRR-MS-2010-00249 Print Close 2 Overview * Technology Deployment Vision * Tank Waste Strategy and Life-Cycle Benefits - Transformational Technology Scenarios * Hanford - Vitrification Technologies - Salt Processing: LAW Pretreatment and Immobilization * Rotary Microfiltration/Small Column Ion Exchange (RMF/SCIX) * Alternate LLW: Fluidized Bed Steam Reforming (FBSR) - Accelerated SST Retrieval * SRS - Vitrification Technologies - Salt Processing * Rotary Microfiltration/Small Column Ion Exchange (RMF/SCIX) * Next Generation Modular Caustic Side Solvent Extraction (MCU) Print Close 3 Technology Deployment * Goal-oriented technology deployment process to integrate and manage resources through collaboration

399

CX-004104: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4: Categorical Exclusion Determination 4: Categorical Exclusion Determination CX-004104: Categorical Exclusion Determination State Energy Program Conductor Optimized Rotary Energy Mega-Watt Scale Direct Wind Generator CX(s) Applied: A9, B5.1 Date: 09/29/2010 Location(s): Ronan, Montana Office(s): Energy Efficiency and Renewable Energy, Golden Field Office The Montana Department of Environmental Quality proposes to provide $500,000 of State Energy Program funds to Core Wind Power in Ronan, Montana to design, fabricate and test a new 3 megawatt, 8-meter wind turbine generator using existing printed circuit board manufacturing techniques and facilities. The Conductor Optimized Rotary Energy (CORE) technology uses a direct drive repeated multiplayer printed circuit board process to replace the old geared drive-train of the generator. This process will allow for

400

Microsoft PowerPoint - 1-09 Herman 2010-11_E1-09 M Tech Exchange presentation_RMF (Dave Herman) 11_14.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Rotary Filter Program Rotary Filter Program D.T. Herman M.R. Poirier S.D. Fink F.M. Pennebaker 11/16/10 EM Waste Processing Technical Exchange 2010 SRNL-L3100-2010-00228 Print Close 2 SRNL-L3100-2010-00228 Drivers Identify and develop a solid-liquid separation technology with a higher filter flux per unit surface area to increase throughput and complete treating the waste stream in a shorter time, with a significant reduction in life-cycle cost. Take advantage of existing facilities Must not negatively impact downstream processes Must be able to integrate into existing systems Must not introduce new hazards/criticality concerns A research program was conducted to identify and evaluate technologies for solids removal from liquid streams for the DOE Complex Print Close 3 SRNL-L3100-2010-00228

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Geothermal drilling and completion technology development  

SciTech Connect

The high cost of drilling and completing geothermal wells is an impediment to the development of geothermal energy resources. Technological deficiencies in rotary drilling techniques are evidenced when drilling geothermal wells. The Division of Geothermal Energy (DGE) of the U.S. Department of Energy has initiated a program aimed at developing new drilling and completion techniques for geothermal wells. The goals of this program are to reduce well costs by 25% by 1982 and by 50% by 1986. Sandia Laboratories has been selected to manage this technology development program, and this paper presents an overview of the program. Program justification which relates well cost to busbar energy cost and to DGE power-on-line goals is presented. Technological deficiencies in current rotary drilling techniques for geothermal wells are discussed. A program for correcting these deficiencies is described.

Varnado, S.G.; Stoller, H.M.

1978-01-01T23:59:59.000Z

402

Borehole Summary Report for Waste Treatment Plant Seismic Borehole C4993  

SciTech Connect

A core hole (C4998) and three boreholes (C4993, C4996, and C4997) were drilled to acquire stratigraphic and downhole seismic data to model potential seismic impacts and to refine design specifications and seismic criteria for the Waste Treatment Plant (WTP) under construction on the Hanford Site. Borehole C4993 was completed through the Saddle Mountains Basalt, the upper portion of the Wanapum Basalt, and associated sedimentary interbeds, to provide a continuous record of the rock penetrated by all four holes and to provide access to the subsurface for geophysical measure¬ment. Presented and compiled in this report are field-generated records for the deep mud rotary borehole C4993 at the WTP site. Material for C4993 includes borehole logs, lithologic summary, and record of rock chip samples collected during drilling through the months of August through early October. The borehole summary report also includes documentation of the mud rotary drilling, borehole logging, and sample collection.

Rust, Colleen F.; Barnett, D. BRENT; Bowles, Nathan A.; Horner, Jake A.

2007-02-28T23:59:59.000Z

403

Development of a solar desiccant dehumidifier. Volume 1. Summary. Volume 2. Detailed technical information. Technical progress report  

DOE Green Energy (OSTI)

Research and development work aimed at the development of a solar desiccant dehumidifier is described in detail. The system features a rotary bed of granular silica gel and a rotary regenerator. The dehumidifier can be used for air conditioning through adiabatic saturation of the process airstream. Detailed technical information is presented in the appendices: (A) management, (B) review of the literature: state-of-the-art survey and SERI meeting, (C) review of the literature: adsorbent survey, (D) design requirements and evaluation criteria, (E) design requirements and evaluation criteria, single-family house model, (F) design requirements and evaluation criteria, economic model, (G) design requirements and evaluation criteria: conventional system models for comparison, (H) candidate cooling subsystems, (I) subsystem computer model, (J) subsystem performance map, and (K) subsystem preliminary design. (WHK)

Gunderson, M.E.; Hwang, K.C.; Railing, S.M.

1978-03-31T23:59:59.000Z

404

Experimental study of an advanced silica gel dehumidifier  

DOE Green Energy (OSTI)

This report contains results of work done to experimentally characterize the performance of an advanced, rotary, desiccant dehumidifier and to develop and validate analytical methods for evaluating its performance in air-conditioning systems. A facility, the Cyclic Test Facility, and a test and analysis procedure were developed to evaluate the performance of the dehumidifier. A series of tests was undertaken to understand the simultaneous heat- and mass-transfer processes. An advanced dehumidifier test article was tested under cyclic operation to fully characterize its performance. Brief accounts of this facility, with its hardware and instrumentation, and detailed accounts of the test data and data reduction and analysis methods are presented. The data provide an engineering data base for evaluating rotary dehumidifiers for cooling applications. The dehumidifier's performance, as measured by the effectiveness, agreed with theory to within plus or minus 10%. 16 refs., 16 figs., 1 tab.

Bharathan, D.; Parsons, J.M.; Maclaine-cross, I.L.

1987-11-01T23:59:59.000Z

405

Geothermal Well Technology Program  

DOE Green Energy (OSTI)

The high cost of drilling and completing geothermal wells is an impediment to the development of geothermal energy resources. Technological deficiencies in rotary drilling techniques are evidenced when drilling geothermal wells. The Division of Geothermal Energy (DGE) of the U.S. Department of Energy has initiated a program aimed at developing new drilling and completion techniques for geothermal wells. The goals of this program are to reduce well costs by 25% by 1982 and by 50% by 1986. An overview of the program is presented. Program justification which relates well cost to busbar energy cost and to DGE power-on-line goals is presented. Technological deficiencies encountered when current rotary drilling techniques are used for geothermal wells are discussed. A program for correcting these deficiencies is described.

Varnado, S.G.

1978-01-01T23:59:59.000Z

406

Applications of Laminar Weak-Link Mechanisms for Ultraprecision Synchrotron Radiation Instruments  

Science Conference Proceedings (OSTI)

Unlike traditional kinematic flexure mechanisms, laminar overconstrained weak-link mechanisms provide much higher structure stiffness and stability. Using a laminar structure configured and manufactured by chemical etching and lithography techniques, we are able to design and build linear and rotary weak-link mechanisms with ultrahigh positioning sensitivity and stability for synchrotron radiation applications. Applications of laminar rotary weak-link mechanism include: high-energy-resolution monochromators for inelastic x-ray scattering and x-ray analyzers for ultra-small-angle scattering and powder-diffraction experiments. Applications of laminar linear weak-link mechanism include high-stiffness piezo-driven stages with subnanometer resolution for an x-ray microscope. In this paper, we summarize the recent designs and applications of the laminar weak-link mechanisms at the Advanced Photon Source.

Shu, D.; Toellner, T. S.; Alp, E. E.; Maser, J.; Ilavsky, J.; Shastri, S. D.; Lee, P. L.; Narayanan, S.; Long, G. G. [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States)

2007-01-19T23:59:59.000Z

407

Program in geothermal well technology directed toward achieving DOE/DGE power-on-line goals  

DOE Green Energy (OSTI)

This document presents the material used in an oral presentation to the DOE/Division of Geothermal Energy, which was designed to illustrate the importance of well technology development in reducing geothermal well costs, and to achieve geothermal power-on-line goals. Examination of recent studies of the economics of geothermal energy leads to the conclusion that the overall sensitivity of geothermal power-on-line to well cost is in the range of one to two. Current data suggest that a vigorous R and D program in rotary drilling technology can reduce geothermal drilling costs by about 20%, but a reduction of 40 to 50% is needed to achieve DOE/DGE goals. Research in advanced drilling systems is needed to satisfy this more stringent requirement. Some critical technological deficiencies that occur when current rotary drilling techniques are used for geothermal drilling are discussed. A broadly based development program directed at correcting these deficiencies is defined.

Polito, J.; Varnado, S.G.

1978-10-01T23:59:59.000Z

408

Futuristic concepts in engines and components  

Science Conference Proceedings (OSTI)

This publication includes papers on two-stroke engines and components, Brayton Stirling and Otto Cycles, alternative cycles, advanced combustion, and other related topics. Contents include: Paving the way to controlled combustion engines (CCE); A new class of stratified-charge internal combustion engine; Internal combustion (IC) engine with minimum number of moving parts; New type of heat engine -- externally heated air engine; A porous media burner for reforming methanol for fuel cell powered electric vehicles; Using a Stirling engine simulation program as a regenerator design aid; In-cylinder regenerated engines; High speed electronic fuel injection for direct injected rotary engine; and The characteristics of fuel consumption and exhaust emissions of the side exhaust port rotary engine.

NONE

1995-12-31T23:59:59.000Z

409

Word Pro - S5  

U.S. Energy Information Administration (EIA) Indexed Site

Crude Oil and Natural Gas Crude Oil and Natural Gas Resource Development Figure 5.1 Crude Oil and Natural Gas Resource Development Indicators Rotary Rigs in Operation by Type, 1949-2012 Rotary Rigs in Operation by Type, Monthly Active Well Service Rig Count, Monthly Total Wells Drilled by Type, 1949-2010 . 76 U.S. Energy Information Administration / Monthly Energy Review November 2013 Total 1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 0 1 2 3 4 Thousand Rigs 1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 0 10 20 30 40 50 Thousand Wells Dry Wells Crude Oil Wells Web Page: http://www.eia.gov/totalenergy/data/monthly/#crude. Sources: Tables 5.1 and 5.2.

410

Centrifugal shot blasting. Innovative technology summary report  

SciTech Connect

At the US Department of Energy (DOE) Fernald Environmental Management Project (FEMP), the Facilities Closure and Demolition Projects Integrated Remedial Design/Remedial Action (RD/RA) work plan calls for the removal of one inch (1 in) depth of concrete surface in areas where contamination with technetium-99 has been identified. This report describes a comparative demonstration between two concrete removal technologies: an innovative system using Centrifugal Shot Blasting (CSB) and a modified baseline technology called a rotary drum planer.

1999-07-01T23:59:59.000Z

411

Electric arc saw apparatus  

DOE Patents (OSTI)

A portable, hand-held electric arc saw apparatus comprising a small frame for supporting an electrically conducting rotary blade which serves as an electrode for generating an electric arc between the blade and a workpiece of opposite polarity. Electrically conducting means are provided on said frame for transmitting current to said blade. A pair of freely movable endless belts in the form of crawler treads are employed to facilitate movement of the apparatus relative to the workpiece.

Deichelbohrer, P.R.

1983-08-08T23:59:59.000Z

412

Use of Downhole Motors in Geothermal Drilling in the Philippines  

SciTech Connect

This paper describes the use of downhole motors in the Tiwi geothermal field in the Philippines, The discussion includes the application Of a Dyna-Drill with insert-type bits for drilling through surface alluvium. The economics of this type of drilling are compared to those of conventional rotary drilling. The paper also describes the use of a turbodrill that drills out scale as the well produces geothermal fluids.

Pyle, D. E.

1981-01-01T23:59:59.000Z

413

Program to develop improved downhole drilling motors. Semiannual report  

DOE Green Energy (OSTI)

The following are described: the history of turbodrill development, positive displacement motor development, the theory of turbodrills, the theory of positive displacement motors, basic motor components, forces on thrust bearings, thrust bearing design, radial bearing design, rotary seal design, sealed lubrication system, lubricants, and project status. Included in appendices are materials on high-temperature lubricants and a progress report on the design of downhole motor seal, bearing, and lubrication test systems. (MHR)

Maurer, W.C.

1976-11-01T23:59:59.000Z

414

Automobile air pollution: new automotive engines and engine improvements. 1978-March, 1981 (Citations from the NTIS data base). Report for 1978-March 1981  

SciTech Connect

This bibliography cites reports on new designs of automobile engines. The engine types include gas turbines, stratified charged engines, steam engines, hybrid engines using electric motors or flywheels, and rotary engines. Many of these studies also cover the problem of improving fuel economy while lowering emissions. Retrofit devices are excluded. (This updated bibliography contains 205 citations, 58 of which are new entries to the previous edition.)

1981-04-01T23:59:59.000Z

415

Automobile air pollution: new automotive engines and engine improvements. Volume 1. 1970-1977 (a bibliography with abstracts). Report for 1970-1977  

SciTech Connect

This bibliography cites reports on new designs of automobile engines. The engine types include gas turbines, stratified charge engines, steam engines, hybrid engines using electric motors or flywheels, and rotary engines. Many of these studies also cover the problem of improving fuel economy while lowering emissions. Retrofit devices are excluded. (This updated bibliography contains 176 abstracts, none of which are new entries to the previous edition.)

Habercom, G.E. Jr

1979-04-01T23:59:59.000Z

416

Automobile air pollution: new automotive engines and engine improvements. Volume 2. 1978-March, 1979 (a bibliography with abstracts). Report for 1978-March 1979  

SciTech Connect

This bibliography cites reports on new designs of automobile engines. The engine types include gas turbines, stratified charged engines, steam engines, hybrid engines using electric motors or flywheels, and rotary engines. Many of these studies also cover the problem of improving fuel economy while lowering emissions. Retrofit devices are excluded. (This updated bibliography contains 100 abstracts, 94 of which are new entries to the previous edition.)

Habercom, G.E. Jr

1979-04-01T23:59:59.000Z

417

Heat exchanger containing a component capable of discontinuous movement  

DOE Patents (OSTI)

Regenerative heat exchangers are described for transferring heat between hot and cold fluids. The heat exchangers have seal-leakage rates significantly less than those of conventional regenerative heat exchangers because the matrix is discontinuously moved and is releasably sealed while in a stationary position. Both rotary and modular heat exchangers are described. Also described are methods for transferring heat between a hot and cold fluid using the discontinuous movement of matrices. 11 figures.

Wilson, D.G.

1993-11-09T23:59:59.000Z

418

Induction machine  

DOE Patents (OSTI)

A polyphase rotary induction machine for use as a motor or generator utilizing a single rotor assembly having two series connected sets of rotor windings, a first stator winding disposed around the first rotor winding and means for controlling the current induced in one set of the rotor windings compared to the current induced in the other set of the rotor windings. The rotor windings may be wound rotor windings or squirrel cage windings.

Owen, Whitney H. (Ogden, UT)

1980-01-01T23:59:59.000Z

419

Assessment of incineration and melting treatment technologies for RWMC buried waste  

SciTech Connect

This report provides an identification, description, and ranking evaluation of the available thermal treatment technologies potentially capable of treating the Idaho National Engineering Laboratory Radioactive Waste Management Complex (RWMC) buried mixed waste. The ranking evaluation focused separately upon incinerators for treatment of combustible wastes and melters for noncombustible wastes. The highest rank incinerators are rotary kilns and controlled air furnaces, while the highest rank melters are the hearth configuration plasma torch, graphite electrode arc, and joule-heated melters. 4 refs.

Geimer, R.; Hertzler, T.; Gillins, R. (Science Applications International Corp., Idaho Falls, ID (United States)); Anderson, G.L. (EG and G Idaho, Inc., Idaho Falls, ID (United States))

1992-02-01T23:59:59.000Z

420

EPRI Clean Water Act 316(b) Fish Protection Technology Workshop Proceedings: September 30, 2004, Holden, Massachusetts  

Science Conference Proceedings (OSTI)

This compact disc (CD) contains presentations made at the EPRI Clean Water Act §316(b) Fish Protection Technology Workshop held at the facilities of Alden Research Laboratory in Holden, Massachusetts on September 30, 2004. The presentations provide engineering and visual information on many types of cooling water intake structure fish protection technologies, including barrier nets, behavioral barriers (strobe lights and acoustic systems), traveling water screens, rotary screens, flat panel and cyli...

2004-12-27T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Low-pressure-ratio regenerative exhaust-heated gas turbine. Final report  

SciTech Connect

A design study of coal-burning gas-turbine engines using the exhaust-heated cycle and state-of-the-art components has been completed. In addition, some initial experiments on a type of rotary ceramic-matrix regenerator that would be used to transfer heat from the products of coal combustion in the hot turbine exhaust to the cool compressed air have been conducted. Highly favorable results have been obtained on all aspects on which definite conclusions could be drawn.

Tampe, L.A.; Frenkel, R.G.; Kowalick, D.J.; Nahatis, H.M.; Silverstein, S.M.; Wilson, D.G.

1991-01-01T23:59:59.000Z

422

Report on Biomass Drying Technology  

DOE Green Energy (OSTI)

Using dry fuel provides significant benefits to combustion boilers, mainly increased boiler efficiency, lower air emissions, and improved boiler operation. The three main choices for drying biomass are rotary dryers, flash dryers, and superheated steam dryers. Which dryer is chosen for a particular application depends very much on the material characteristics of the biomass, the opportunities for integrating the process and dryer, and the environmental controls needed or already available.

Amos, W. A.

1999-01-12T23:59:59.000Z

423

Analysis of drying wood waste fuels with boiler exhaust gases: simulation, performance, and economics  

DOE Green Energy (OSTI)

This study evaluates the feasibility of retrofitting a rotary dryer to a hog fuel boiler, using the boiler exhaust gases as the drying medium. Two simulation models were developed. Each model accurately predicts system performance given site-specific parameters such as boiler steam demand, fue moisture content, boiler exhaust temperature and combustion excess air. Three rotary dryers/hog fuel boilers currently in operation in the forest products industry were analyzed. The data obtained were used to validate te accuracy of the simulation models and to establish the performance of boiler/dryer systems under field conditions. The boiler exhaust temperatures observed ranged from 340 to 500/sup 0/F and indicated that significant drying could be realized at moderate stack temperatures, as substantitated by experimental moisture content data. The simulation models were used to evaluate a general boiler/dryer system's sensitivity to variation in operating conditions. The sensitivity analyses indicated that under moderate conditions (400/sup 0/F boiler exhaust, etc.) the installation of a rotary dryer results in a 15% increase in boiler efficiency and a 13% decrease in fuel consumption. Both the field data and sensitivity analyses indicated that a greater increase in boiler efficiency could be realized at higher stack temperatures, approximately a 30% increase in boiler efficiency for a stack temperature of 600/sup 0/F. The cash flow basis payback periods based on hog fuel savings due to dryer installation ranged from 2.7 years for a used dryer to 3.9 years for a new dryer. The payback periods for equivalent BTU savings of gas and oil ranged from 1.2 to 2.0 for gas and from 1.3 to 2.1 years for oil. This study concludes that retrofitting a rotary dryer to an existing hog fuel boiler is an economically feasible option to the forest products industry. 31 references, 24 figures, 18 tables.

Kirk, R.W.; Wilson, J.B.

1984-09-01T23:59:59.000Z

424

Energy recovery solves hospital's problem  

SciTech Connect

A heat recovery system for a hospital heating-ventilation-air conditioning installation is described. The system design allows for recovery of energy in the laundry exhaust air, distribution of supply air to the patient care wing, easy access for servicing, and economic feasibility. A rotary energy recovery wheel was selected as the energy recovery device because of its performance and economical advantages. The unit work continuously without difficulty during the severe winter of 1976. (PMA)

1977-08-01T23:59:59.000Z

425

Heat exchanger containing a component capable of discontinuous movement  

DOE Patents (OSTI)

Regenerative heat exchangers are described for transferring heat between hot and cold fluids. The heat exchangers have seal-leakage rates significantly less than those of conventional regenerative heat exchangers because the matrix is discontinuously moved and is releasably sealed while in a stationary position. Both rotary and modular heat exchangers are described. Also described are methods for transferring heat between a hot and cold fluid using the discontinuous movement of matrices.

Wilson, David G. (Winchester, MA)

1993-01-01T23:59:59.000Z

426

Heat exchanger containing a component capable of discontinuous movement  

DOE Patents (OSTI)

Regenerative heat exchangers are described for transferring heat between hot and cold fluids. The heat exchangers have seal-leakage rates significantly less than those of conventional regenerative heat exchangers because the matrix is discontinuously moved and is releasably sealed while in a stationary position. Both rotary and modular heat exchangers are described. Also described are methods for transferring heat between a hot and cold fluid using the discontinuous movement of matrices.

Wilson, David Gordon (Winchester, MA)

2002-01-01T23:59:59.000Z

427

Low-pressure-ratio regenerative exhaust-heated gas turbine  

SciTech Connect

A design study of coal-burning gas-turbine engines using the exhaust-heated cycle and state-of-the-art components has been completed. In addition, some initial experiments on a type of rotary ceramic-matrix regenerator that would be used to transfer heat from the products of coal combustion in the hot turbine exhaust to the cool compressed air have been conducted. Highly favorable results have been obtained on all aspects on which definite conclusions could be drawn.

Tampe, L.A.; Frenkel, R.G.; Kowalick, D.J.; Nahatis, H.M.; Silverstein, S.M.; Wilson, D.G.

1991-01-01T23:59:59.000Z

428

Performance characteristics of the Lysholm engine as tested for geothermal power applications  

Science Conference Proceedings (OSTI)

This is a description of the performance tests of the Lysholm engine which have recently been completed at the University of California, Berkeley. The Lysholm engine is a rotary displacement engine which can accept and expand a mixed-phase water-steam mixture. As a thermodynamic process, mixed-phase expansion has the potential for using significantly more of the available energy output per pound of fluid. 6 refs.

Steidel, R.F. Jr.; Pankow, D.; Berger, R.E.

1981-08-01T23:59:59.000Z

429

Proceedings of a Topical Meeting On Small Scale Geothermal Power Plants and Geothermal Power Plant Projects  

Science Conference Proceedings (OSTI)

These proceedings describe the workshop of the Topical Meeting on Small Scale Geothermal Power Plants and Geothermal Power Plant Projects. The projects covered include binary power plants, rotary separator, screw expander power plants, modular wellhead power plants, inflow turbines, and the EPRI hybrid power system. Active projects versus geothermal power projects were described. In addition, a simple approach to estimating effects of fluid deliverability on geothermal power cost is described starting on page 119. (DJE-2005)

None

1986-02-12T23:59:59.000Z

430

Mechanical drive for blood pump  

DOE Patents (OSTI)

This patent relates to a highly efficient blood pump to be used as a replacement for a ventricle of the human heart to restore people disabled by heart disease. The mechanical drive of the present invention is designed to operate in conjunction with a thermoelectric converter power source. The mechanical drive system essentially converts the output of a rotary power into pulsatile motion so that the power demand from the thermoelectric converter remains essentially constant while the blood pump output is pulsed. (auth)

Bifano, N.J.; Pouchot, W.D.

1975-07-29T23:59:59.000Z

431

Rotating sample holder at low temperature  

SciTech Connect

A low temperature rotary device (cryoturbine) for use in extended x-ray-absorption fine structure measurements in fluorescence mode has been designed and manufactured. The instrument works at a temperature close to liquid Nitrogen and can reach frequencies up to 100 Hz with good stability. The rotation speed is measured with a light-emitting diode driven in stroboscopic mode by a simple electronic circuit.

Pasternak, Sebastien; Perrin, Florian; Ciatto, Gianluca; Palancher, Herve; Steinmann, Ricardo [European Synchrotron Radiation Facility, 38043 Grenoble (France)

2007-07-15T23:59:59.000Z

432

Utilization of melting techniques for borehole wall stabilization. [Applied to geothermal well production systems  

DOE Green Energy (OSTI)

A research program on the Subterrene concept based on excavation by melting has been completed. Theoretical and experimental studies were made for a broad range of applications. Most recently, a study of Subterrene deep geothermal well production systems predicted that, compared to rotary-drilled wells, significant cost savings are possible, e.g., 2 and 4 million dollars for 10-km-deep wells and geothermal gradients of 25 and 40 K/km, respectively. It was also concluded that for most wells the rate of penetration of the melting bits should be increased several times over that attained in the Subterrene tests. Subterrene melting penetration tests showed that borehole glass liners can be formed in a wide variety of materials and structural characterization tests showed that tuff glass cylinders can be many times stronger in compression than the parent material. Also, the tests showed that the rock-glass liner permeability decreases rapidly with confining pressure. New melting devices are conceivable that could line rotary-drilled boreholes with rock glass or other materials with resultant improvements in well costs. With emphasis on borehole liners, an overview of Subterrene program results, data on rock-glass liners, and suggestions on how molten materials might be applied to the borehole wall as part of a rotary drilling operation are presented.

Altseimer, J.H.

1977-01-01T23:59:59.000Z

433

Subterrene rock-melting concept applied to the production of deep geothermal wells  

DOE Green Energy (OSTI)

The drilling of wells comprises a large fraction of the costs of geothermal energy-extraction plants, and billions of dollars for wells will be needed before geothermal energy is nationally significant. Technical and cost studies were made of the application of the Subterrene concept, i.e., excavating and penetrating rocks or soils by melting, to deep wells such as may be used for dry-hot-rock or geopressure geothermal energy extraction systems. Technically, it was found that Subterrene requirements are compatible with those of current rotary drilling practices. Certain features of the rock-melting concept such as the glass lining on the borehole wall, and nonrotation, provide opportunities for the development of better well production techniques in hot wells. A typical optimum-cost well would be rotary-drilled in the upper regions and then rock-melted to total depth. Indicated cost-savings are significant: a 33 percent or 4.5 million dollars reduction from rotary drilled well costs are estimated for a 10 km depth well with bottom hole temperatures of 673 K. Even for normal geothermal gradient conditions, the savings for the 10 km depth is estimated as 23 percent or 2 million dollars.

Altseimer, J.H.

1976-01-01T23:59:59.000Z

434

Technical and cost analysis of rock-melting systems for producing geothermal wells. [GEOWELL  

DOE Green Energy (OSTI)

The drilling of wells makes up a large fraction of the costs of geothermal energy-extraction plants, and billions of dollars for wells will be needed before geothermal energy is nationally significant. Technical and economic systems studies are summarized regarding the application of the Subterrene concept, i.e., excavating and penetrating rocks or soils by melting, to the production of deep wells such as may be used for dry hot rock or geopressurized geothermal energy-extraction systems. Technically, it was found that Subterrene features are compatible with those of current rotary drilling practices. In fact, some special features could lead to improved well production techniques. These include the buildup of a glass lining along the borehole wall which provides structural resistance to collapse; close control of hole geometry; the existence of a barrier between the drilling fluids and the formations being penetrated; nonrotation; potentially better bit life; and faster rates of penetration in deep, hard rock. A typical optimum-cost well would be rotary-drilled in the upper regions and then rock-melted to total depth. Indicated cost savings are significant: a 30 percent or 3.9 million dollar (1975 $) reduction from rotary-drilled well costs are estimated for a 10-km depth well with a bottom hole temperature of 673 K. Even for relatively cool normal geothermal gradient conditions, the savings for the 1..pi..-km well are estimated as 23 percent of 2.1 million dollars.

Altseimer, J.H.

1976-11-01T23:59:59.000Z

435

Visualizing the Future of Scientific Discovery - NERSC Science News June  

NLE Websites -- All DOE Office Websites (Extended Search)

Visualizing the Visualizing the Future of Scientific Discovery Visualizing the Future of Scientific Discovery June 11, 2009 snVolRender-3.png A SUPERNOVA'S VOLUME: This volume rendering of supernova simulation data was generated by running the VisIt application on 32,000 processors on Franklin, a Cray XT4 supercomputer at NERSC. As computational scientists are confronted with increasingly massive datasets from supercomputing simulations and experiments, one of the biggest challenges is having the right tools to gain scientific insight from the data. A team of Department of Energy (DOE) researchers recently ran a series of experiments to determine whether VisIt, a leading scientific visualization application, is up to the challenge. Running on some of the world's most powerful supercomputers, VisIt achieved unprecedented levels of performance

436

Ultra-Accelerated Natural Sunlight Exposure Testing Facilities  

DOE Patents (OSTI)

A multi-faceted concentrator apparatus for providing ultra-accelerated natural sunlight exposure testing for sample materials under controlled weathering conditions comprising: facets that receive incident natural sunlight, transmits VIS/NIR and reflects UV/VIS onto a secondary reflector that delivers a uniform flux of UV/VIS onto a sample exposure plane located near a center of a facet array in a chamber that provide concurrent levels of temperature and/or relative humidity at high levels of up to 100.times. of natural sunlight that allow sample materials to be subjected to accelerated irradiance exposure factors for a significant period of time of about 3 to 10 days to provide a corresponding time of about at least a years worth representative weathering of sample materials.

Lewandowski, Allan A. (Evergreen, CO); Jorgensen, Gary J. (Pine, CO)

2004-11-23T23:59:59.000Z

437

Use of a region of the visible and near infrared spectrum to predict mechanical properties of wet wood and standing trees  

DOE Patents (OSTI)

In a method for determining the dry mechanical strength for a green wood, the improvement comprising: (a) illuminating a surface of the wood to be determined with a reduced range of wavelengths in the VIS-NIR spectra 400 to 1150 nm, said wood having a green moisture content; (b) analyzing the surface of the wood using a spectrometric method, the method generating a first spectral data of a reduced range of wavelengths in VIS-NIR spectra; and (c) using a multivariate analysis technique to predict the mechanical strength of green wood when dry by comparing the first spectral data with a calibration model, the calibration model comprising a second spectrometric method of spectral data of a reduced range of wavelengths in VIS-NIR spectra obtained from a reference wood having a green moisture content, the second spectral being correlated with a known mechanical strength analytical result obtained from the reference wood when dried and a having a dry moisture content.

Meglen, Robert R. (Boulder, CO); Kelley, Stephen S. (Evergreen, CO)

2003-01-01T23:59:59.000Z

438

ARM - Publications: Science Team Meeting Documents  

NLE Websites -- All DOE Office Websites (Extended Search)

Spectral Diffuse Irradiance in UV, VIS, and NIR During the 2001 Diffuse IOP Spectral Diffuse Irradiance in UV, VIS, and NIR During the 2001 Diffuse IOP Kiedron, P., Michalsky, J., Berndt, J., Min, Q., and Harrison, L., Atmospheric Sciences Research Center, SUNY Albany, New York Twelfth Atmospheric Radiation Measurement (ARM) Science Team Meeting Two rotating shadowband spectroradiometers (RSS) participated in the 2001 Diffuse IOP. The UV-RSS covered the 300-360 nm range and the VIS-NIR RSS covered 360-1050 nm. Both instruments were calibrated with NIST traceable spectral irradiance. The two instruments were able to measure approximately 95% of total diffuse radiation for clear-sky conditions. The missing shortwave infrared beyond 1050 nm is estimated with a model in order to calculate a total shortwave irradiance. The results are compared with

439

An Anthropological Comparative Study Of The European Oil Sanctions Against Iran  

E-Print Network (OSTI)

Since its inception, the Islamic Republic has faced a steady stream of sanctions, isolation and conflict—and Iranian hardliners perceive this as the environment in which they thrive. To that end, they have defied sanctions for over 30 years, take a certain pride in doing so, and are likely to continue doing both. Iran's ruling elite sees sanctions as the West resorting to a pressure-based formula that history has proved ineffective due to the lack of viable policy alternatives. This reinforces Tehran's self-perception of increasing strength, leverage and power vis-à-vis the West.

Alexander Ghaleb; Reza Marashi

2012-01-01T23:59:59.000Z

440

The impact of instrument choice on investment in abatement technologies: a case study of tax versus trade incentives for CCS and Biomass for electricity  

E-Print Network (OSTI)

varying load factor, this may imply the use of small amounts of fossil fuel input and thus reduce the abatement that is possible vis-à-vis the reference plant. 18 )6.9,6.6(~ )2.3,2.2(~ 3 2 UQ UQ NT NT where the upper bound of abatement... with relatively low uncertainty over the technology involved. There are still large questions, however, over the supply chain for the fuel inputs and the load factor at which such plants could operate.14 We assume that the firm operates the technology...

Laing, T; Grubb, Michael

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Smaller Footprint Drilling System for Deep and Hard Rock Environments; Feasibility of Ultra-High-Speed Diamond Drilling  

SciTech Connect

The two phase program addresses long-term developments in deep well and hard rock drilling. TerraTek believes that significant improvements in drilling deep hard rock will be obtained by applying ultra-high rotational speeds (greater than 10,000 rpm). The work includes a feasibility of concept research effort aimed at development that will ultimately result in the ability to reliably drill 'faster and deeper' possibly with smaller, more mobile rigs. The principle focus is on demonstration testing of diamond bits rotating at speeds in excess of 10,000 rpm to achieve high rate of penetration (ROP) rock cutting with substantially lower inputs of energy and loads. The significance of the 'ultra-high rotary speed drilling system' is the ability to drill into rock at very low weights on bit and possibly lower energy levels. The drilling and coring industry today does not practice this technology. The highest rotary speed systems in oil field and mining drilling and coring today run less than 10,000 rpm - usually well below 5,000 rpm. This document provides the progress through two phases of the program entitled 'Smaller Footprint Drilling System for Deep and Hard Rock Environments: Feasibility of Ultra-High-Speed Diamond Drilling' for the period starting 30 June 2003 and concluding 31 March 2009. The accomplishments of Phases 1 and 2 are summarized as follows: (1) TerraTek reviewed applicable literature and documentation and convened a project kick-off meeting with Industry Advisors in attendance (see Black and Judzis); (2) TerraTek designed and planned Phase I bench scale experiments (See Black and Judzis). Improvements were made to the loading mechanism and the rotational speed monitoring instrumentation. New drill bit designs were developed to provided a more consistent product with consistent performance. A test matrix for the final core bit testing program was completed; (3) TerraTek concluded small-scale cutting performance tests; (4) Analysis of Phase 1 data indicated that there is decreased specific energy as the rotational speed increases; (5) Technology transfer, as part of Phase 1, was accomplished with technical presentations to the industry (see Judzis, Boucher, McCammon, and Black); (6) TerraTek prepared a design concept for the high speed drilling test stand, which was planned around the proposed high speed mud motor concept. Alternative drives for the test stand were explored; a high speed hydraulic motor concept was finally used; (7) The high speed system was modified to accommodate larger drill bits than originally planned; (8) Prototype mud turbine motors and the high speed test stand were used to drive the drill bits at high speed; (9) Three different rock types were used during the testing: Sierra White granite, Crab Orchard sandstone, and Colton sandstone. The drill bits used included diamond impregnated bits, a polycrystalline diamond compact (PDC) bit, a thermally stable PDC (TSP) bit, and a hybrid TSP and natural diamond bit; and (10) The drill bits were run at rotary speeds up to 5500 rpm and weight on bit (WOB) to 8000 lbf. During Phase 2, the ROP as measured in depth of cut per bit revolution generally increased with increased WOB. The performance was mixed with increased rotary speed, with the depth cut with the impregnated drill bit generally increasing and the TSP and hybrid TSP drill bits generally decreasing. The ROP in ft/hr generally increased with all bits with increased WOB and rotary speed. The mechanical specific energy generally improved (decreased) with increased WOB and was mixed with increased rotary speed.

TerraTek, A Schlumberger Company

2008-12-31T23:59:59.000Z

442

Limitations for heavy metal release during thermo-chemical treatment of sewage sludge ash  

Science Conference Proceedings (OSTI)

Phosphate recycling from sewage sludge can be achieved by heavy metal removal from sewage sludge ash (SSA) producing a fertilizer product: mixing SSA with chloride and treating this mixture (eventually after granulation) in a rotary kiln at 1000 {+-} 100 deg. C leads to the formation of volatile heavy metal compounds that evaporate and to P-phases with high bio-availability. Due to economical and ecological reasons, it is necessary to reduce the energy consumption of this technology. Generally, fluidized bed reactors are characterized by high heat and mass transfer and thus promise the saving of energy. Therefore, a rotary reactor and a fluidized bed reactor (both laboratory-scale and operated in batch mode) are used for the treatment of granulates containing SSA and CaCl{sub 2}. Treatment temperature, residence time and - in case of the fluidized bed reactor - superficial velocity are varied between 800 and 900 deg. C, 10 and 30 min and 3.4 and 4.6 m s{sup -1}. Cd and Pb can be removed well (>95 %) in all experiments. Cu removal ranges from 25% to 84%, for Zn 75-90% are realized. The amount of heavy metals removed increases with increasing temperature and residence time which is most pronounced for Cu. In the pellet, three major reactions occur: formation of HCl and Cl{sub 2} from CaCl{sub 2}; diffusion and reaction of these gases with heavy metal compounds; side reactions from heavy metal compounds with matrix material. Although, heat and mass transfer are higher in the fluidized bed reactor, Pb and Zn removal is slightly better in the rotary reactor. This is due the accelerated migration of formed HCl and Cl{sub 2} out of the pellets into the reactor atmosphere. Cu is apparently limited by the diffusion of its chloride thus the removal is higher in the fluidized bed unit.

Nowak, Benedikt, E-mail: benedikt.nowak@tuwien.ac.at [Institute of Chemical Engineering, Vienna University of Technology, Getreidemarkt 9/166, A-1060 Vienna (Austria); Perutka, Libor [Institute of Chemical Engineering, Vienna University of Technology, Getreidemarkt 9/166, A-1060 Vienna (Austria); Aschenbrenner, Philipp [Institute for Water Quality, Resource and Waste Management, Vienna University of Technology, Karlsplatz 13/226, A-1040 Vienna (Austria); Kraus, Petra [ASH DEC Umwelt AG, Donaufelderstrasse 101/4/5, A-1210 Vienna (Austria); Rechberger, Helmut [Institute for Water Quality, Resource and Waste Management, Vienna University of Technology, Karlsplatz 13/226, A-1040 Vienna (Austria); Winter, Franz, E-mail: franz.winter@tuwien.ac.at [Institute of Chemical Engineering, Vienna University of Technology, Getreidemarkt 9/166, A-1060 Vienna (Austria)

2011-06-15T23:59:59.000Z

443

The U.S. Department of Energy's Aerial Measuring System (AMS)  

SciTech Connect

For nearly 40 years, aerial radiological search and survey missions have been performed by the United States Department of Energy's (USDOE) Remote Sensing Laboratory (RSL). Originally created in 1967 as Aerial Measurement Operations (AMO), the AMS mission has expanded to include acquiring baseline measurements, performing periodic area monitoring, and responding to radiological emergencies. In an accident scenario, AMS fixed-wing and/or rotary-wing systems can be deployed to map radiological deposition. A fixed-wing system is on standby twenty-fours per day, seven days per week and can be deployed within four hours of notification. It can quickly evaluate high levels of radiation which may constitute immediate health risks. To accomplish its mission the fixed-wing aircraft utilizes the Spectral Aerial Radiological Computer System (SPARCS) which records gross count and spectral information. Data from SPARCS is telemetered to ground stations and secure websites where it can be viewed and evaluated in near-real time. The rotary-wing system deploys following the critical phase of an accident and supports the DOE's Consequence Management Response Team (CMRT) in determining long term consequences of the accident. The rotary wing aircraft utilizes the Radiation and Environmental Data Acquisition and Recording System (REDAR). A 25-liter sodium iodide (NaI) spectral system and precise positioning allow distributed man-made activity of less than 1 {micro}R/hr at ground level to be precisely mapped. This talk will discuss history of the USDOE's AMS program and its current efforts to conduct baseline aerial surveys of some US cities.

Craig Marianno

2008-03-01T23:59:59.000Z

444

Field testing advanced geothermal turbodrill (AGT). Phase 1 final report  

DOE Green Energy (OSTI)

Maurer Engineering developed special high-temperature geothermal turbodrills for LANL in the 1970s to overcome motor temperature limitations. These turbodrills were used to drill the directional portions of LANL`s Hot Dry Rock Geothermal Wells at Fenton Hill, New Mexico. The Hot Dry Rock concept is to drill parallel inclined wells (35-degree inclination), hydraulically fracture between these wells, and then circulate cold water down one well and through the fractures and produce hot water out of the second well. At the time LANL drilled the Fenton Hill wells, the LANL turbodrill was the only motor in the world that would drill at the high temperatures encountered in these wells. It was difficult to operate the turbodrills continuously at low speed due to the low torque output of the LANL turbodrills. The turbodrills would stall frequently and could only be restarted by lifting the bit off bottom. This allowed the bit to rotate at very high speeds, and as a result, there was excessive wear in the bearings and on the gauge of insert roller bits due to these high rotary speeds. In 1998, Maurer Engineering developed an Advanced Geothermal Turbodrill (AGT) for the National Advanced Drilling and Excavation Technology (NADET) at MIT by adding a planetary speed reducer to the LANL turbodrill to increase its torque and reduce its rotary speed. Drilling tests were conducted with the AGT using 12 1/2-inch insert roller bits in Texas Pink Granite. The drilling tests were very successful, with the AGT drilling 94 ft/hr in Texas Pink Granite compared to 45 ft/hr with the LANL turbodrill and 42 ft/hr with a rotary drill. Field tests are currently being planned in Mexico and in geothermal wells in California to demonstrate the ability of the AGT to increase drilling rates and reduce drilling costs.

Maurer, W.C.; Cohen, J.H.

1999-06-01T23:59:59.000Z

445

p s sbasic solid state physics www.pss-b.com  

E-Print Network (OSTI)

the tubes increases both the conductivity and the transparency for visible light.We also discuss/NIR) and a JASCO grating instrument as well as an Ocean Optics fiber-optic spectrometer in the VIS/UV. Spectra were by excita- tions of the entire -electron system. Between regions 1 and 2 the absorption is low

Tanner, David B.

446

2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim p s sbasic solid state physics  

E-Print Network (OSTI)

the conductivity and the transparency for visible light.We also discuss the influence of sample preparation and sub fiber-optic spectrometer in the VIS/UV. Spectra were taken in trans- mission mode. Doping studies were. a broad absorption peaking in the UV, caused by excita- tions of the entire -electron system. Between

Resasco, Daniel

447

CiteWiz: A Tool for the Visualization of Scientific Citation Networks  

E-Print Network (OSTI)

dataset consists of bibliographical data for all of the papers presented at the InfoVis conferences from. Author Keywords citation networks, bibliographic visualization, information visualization, causal for bibliographic visualization of the chronology and influences in networks of scientific articles. The tool

Tsigas, Philippas

448

D-Dupe: An Interactive Tool for Entity Resolution in Social Networks Mustafa Bilgic  

E-Print Network (OSTI)

entity resolution result. We illustrate and evaluate the benefits of D-Dupe on three bibliographic on a portion of the InfoVis data set. (a) shows the initial network before any resolutions have been performed-Dupe on bibliographic collab- oration networks. However D-Dupe's layout and interaction princi- ples are general and can

Shneiderman, Ben

449

Understanding Research Trends in Conferences using Bongshin Lee 1,2  

E-Print Network (OSTI)

libraries such as the ACM Digital Library (DL) [1] provide broad bibliographical and full-text access across papers, authors, and references. PaperLens was developed to visualize 8 years (1995-2002) of Info of CHI? What is the relationship between a given set of researchers? The IEEE InfoVis 2004 Conference

Hunt, Galen

450

Metals Concentrations in Soils Below Decks Made of CCA-Treated Wood  

E-Print Network (OSTI)

the report titled: New Lines of CCA-Treated Wood Research, In-Service and Disposal Issues Which was finalized 13 Street, Suite D Gainesville, FL 32609 Excerpts from Report #00-12 #12;This page left intentionally.S. Environmental Protection Agency UV Ultra Violet UV/Vis Ultra Violet ­ Visible Light Region WET Waste Extraction

Florida, University of

451

112 STERN ET AL. Decontamination and BeneficialUse of Dredged Materials  

E-Print Network (OSTI)

Jersey Maritime Resources Department of Transportation 28 West State Street, Trenton, NJ 08625 USA~ i Synchrotron Light Source (NSLS) (http://nslsweb.nsls.bn1.gov)and the European Synchrotron Radiation Facility. In Proceedings, Vis98 (IEEE Visualization 1998), Research Triangle Park, North Carolina, October 18-23, 1998

Brookhaven National Laboratory

452

Industry-wide information systems standardization as collective action: the case of the U.S. residential mortgage industry  

Science Conference Proceedings (OSTI)

Vertical information systems (VIS) standards are technical specifications designed to promote coordination among the organizations within (or across) vertical industry sectors. Examples include the bar code, electronic data interchange (EDI) standards, ... Keywords: collective action, governance, heterogeneity of resources and interests, institutional support, intellectual property rights, public goods theory, technical design issues, vertical IS standards and standardization

M. Lynne Markus; Charles W. Steinfield; Rolf T. Wigand; Gabe Minton

2006-08-01T23:59:59.000Z

453

Baroclinic Instability and Wave-Wave Interactions in Quasi-geostrophic Error Growth  

Science Conference Proceedings (OSTI)

A two-level quasi-geostrophic beta-plane channel model with a smooth lower surface is used to study the dynamics of the growth of errors, with particular attention paid to the roles of wave-wave interactions via-a-vis those of baroclinic ...

David M. Straus

1989-08-01T23:59:59.000Z

454

The Toyota.de Car Configurator Hermann Hofstetter, Christian Harr, Elmedin Dedovic  

E-Print Network (OSTI)

The Toyota.de Car Configurator Hermann Hofstetter, Christian Harr, Elmedin Dedovic Human configurator on the Toyota Germany homepage has been analyzed and modified to better suit users' needs, Thomas Memmel: Lecture slide - 01_Intro_visRE_WS0607.pdf #12;The Toyota.de Car Configurator 2

Reiterer, Harald

455

Biomimetic synthesis of zinc oxide 3D architectures with gelatin as matrix  

Science Conference Proceedings (OSTI)

Peanut-like and flower-like zinc oxide 3D architectures were synthesized via a facile biomimetic process using gelatin as matrix. Techniques of XRD, SEM, HRTEM, FT-IR, and UV-vis absorption spectra were used to characterize the structure and property ...

Yong Gan; Fubo Gu; Dongmei Han; Zhihua Wang; Guangsheng Guo

2010-01-01T23:59:59.000Z

456

Spatial Texture Analysis: A Comparative Study  

Science Conference Proceedings (OSTI)

In this paper we compare some of the traditional, and some fairly new techniques of texture analysis on the MeasTex and VisTex benchmarks to illustrate their relative abilities. The methods considered include autocorrelation (ACF), co-occurrence matrices ... Keywords: texture, recognition rate, comparison, benchmark

Maneesha Singh; Sameer Singh

2002-08-01T23:59:59.000Z

457

PHYSICAL REVIEW B 84, 245115 (2011) Electronic structure of dye-sensitized TiO2 clusters from many-body perturbation theory  

E-Print Network (OSTI)

Oak Ridge Leadership Computing Facility Annual Report 2010­2011 #12;Science at the OLCF Road to Exascale Inside the OLCF 2 Best at the Petascale, First to the Exascale 4 In a League of Its Own 8 4 Southern California 16 OLCF Vis Team Helps Simulate Japanese Crisis 17 Supercomputers Assist Cleanup

458

The Astrophysical Journal, 740:8 (18pp), 2011 October 10 doi:10.1088/0004-637X/740/1/8 C 2011. The American Astronomical Society. All rights reserved. Printed in the U.S.A.  

E-Print Network (OSTI)

Oak Ridge Leadership Computing Facility Annual Report 2010­2011 #12;Science at the OLCF Road to Exascale Inside the OLCF 2 Best at the Petascale, First to the Exascale 4 In a League of Its Own 8 4 Southern California 16 OLCF Vis Team Helps Simulate Japanese Crisis 17 Supercomputers Assist Cleanup

Bell, John B.

459

UNITED STATES NUCLEAR REGUtiTORY COMMISSION REGION I C31 PARK...  

Office of Legacy Management (LM)

REGUtiTORY COMMISSION REGION I C31 PARK AVENUE KlNt OF PRUSSIC. PENNSYLVANIA 1P4D6 z,: P -. : &J L . . : ; .; 3 Do:ket No. 40-2286 Westinqhouse Electric Company Lamp D1vis-i ons...

460

Intercomparison of Spectroradiometers for Global and Direct Solar Irradiance in the Visible Range  

Science Conference Proceedings (OSTI)

This paper presents the results of the analysis of the spectral, global, and direct solar irradiance measurements in the visible range (400–700 nm) that were made in the framework of the first Iberian UV–visible (VIS) instruments intercomparison. ...

José A. Martínez-Lozano; Maria P. Utrillas; Roberto Pedrós; Fernando Tena; Juan P. Díaz; Francisco J. Expósito; Jerónimo Lorente; Xavier de Cabo; Victoria Cachorro; Ricardo Vergaz; Virgilio Carreño

2003-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Combining geothermal energy capture with geologic carbon dioxide sequestration  

E-Print Network (OSTI)

of disposal, it could also be used as a working fluid in geo- thermal energy capture. CO2's high heat facility, and biofuel plants. Geothermal energy could be used for electricity generation, district heating spacing and higher permeability. [12] Fluid mobility density divided by dynamic vis- cosity (i

Saar, Martin O.

462

Since 1992--the end of the Cold War--Brazil has been slowly and quietly carving a niche for itself in the international community. Under President Fernando Henrique Cardoso, Brazil embarked on a new direc-  

E-Print Network (OSTI)

Since 1992--the end of the Cold War--Brazil has been slowly and quietly carving a niche for itself in the international community. Under President Fernando Henrique Cardoso, Brazil embarked on a new direc- tion vis, positioning Brazil as a spokesperson for the global, using the language of solidarity to open new

Botea, Adi

463

XI Encontro de Qumica da Regio Sul (XI SBQSUL) Pelotas, RS 5 a 7 de Novembro de 2003  

E-Print Network (OSTI)

SBQSUL) QA-09 Pelotas, RS ­ 5 a 7 de Novembro de 2003 Estudo dos complexos de carboximetil celulose e-Vis. Introdução A Carboximetil celulose (CMC) é um polímero linear, que possui grupamentos hidroxilas e

Ferreira, Márcia M. C.

464

Conformational substates in different crystal forms of the photoactive yellow protein--Correlation  

E-Print Network (OSTI)

Conformational substates in different crystal forms of the photoactive yellow protein a description of large concerted motions in the ground state of the yellow protein from NMR data and theoretical transient intermediates. The ground state ~pG! has a UV0VIS absorbance maximum at 446 nm. After absorption

Joshua-Tor, Leemor

465

Radiative Heat Transfer in a Hydrous Mantle Transition Zone Thomas, S.-M.1,2  

E-Print Network (OSTI)

, USA 3 Geophysical Laboratory, Carnegie Institution of Washington, Washington, DC 20015, USA craig spectra reveals an energy transmission "window" in the IR-VIS spectral range, as for both mineral phases-3260 [15] F.C. Marton, T.J. Shankland, D.C. Rubie and Y. Xu (2005) "Effect of variable thermal con

Bina, Craig R.

466

LLNL-JRNL-410333 The Role of the n=1 Column  

E-Print Network (OSTI)

LLNL-JRNL-410333 The Role of the n=1 Column Mode in Spheromak Formation Bruce Cohen, Carlos Romero Livermore National Laboratory under contracts DE-AC52-07NA27344. LLNL-JRNL-410333 #12;2 I. INTRODUCTION to interface NIMROD with VisIt and W. H. Meyer for assistance implementing the Python script at LLNL

467

ECMWF Seminar on Diagnosis of Forecasting and Data Assimilation Systems, 7-10 September 2009 205 The Use of Tracers as Diagnostics for Model Development  

E-Print Network (OSTI)

emissions of CFCs and SF6 are often related to the `electrical power grid distributions); tropospheric #12ECMWF Seminar on Diagnosis of Forecasting and Data Assimilation Systems, 7-10 September 2009 205/sinks and incomplete observational data sets. In addition, the importance of models' transport capabilities vis

468

Microsoft Word - DOE-ID-11-010 Wisconsin - Agasie EC.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 SECTION A. Project Title: NEUP Infrastructure Program: Minor Reactor Upgrades- University of Wisconsin SECTION B. Project Description This project by the University of Wisconsin will: -Upgrade the reactor pool water system with a reverse osmosis system and a capacitance continuous level measurement probe with an associated digital meter display -Upgrade the reactor instrumentation and control systems with a multi-turn rotary absolute encoder along with associated digital readout devise and connecting hardware and a digital recorder. LAN access will provide remote assessment capabilities of the facility. -Upgrade the area radiation monitoring system and upgrade the swipe counter with an automatic low background alpha/beta counting system.

469

A Model of Proton  

E-Print Network (OSTI)

I suggest to consider a proton as a body in a state of free precession. Such approach allows to define a proton as periodic system with two rotary degrees of freedom with corresponding frequency ratio and resonances. In result on a power scale the points corresponding to a birth of leptons are designated. The interrelation between masses of leptons is established through a fine structure constant. The given approach is distributed to a nucleus. Other representation is given on the nature of X-rays which connect with a charge of a nucleus and its mass.

Vladislav Shchegolev

2005-06-14T23:59:59.000Z

470

Design review report for the hydrogen interlock preliminary design  

DOE Green Energy (OSTI)

This report documents the completion of a preliminary design review for the hydrogen interlock. The hydrogen interlock, a proposed addition to the Rotary Mode Core Sampling (RMCS) system portable exhauster, is intended to support core sampling operations in waste tanks requiring flammable gas controls. The objective of this review was to validate basic design assumptions and concepts to support a path forward leading to a final design. The conclusion reached by the review committee was that the design was acceptable and efforts should continue toward a final design review.

Corbett, J.E.

1996-01-01T23:59:59.000Z

471

Technical progress report for the Magnetohydrodynamics Coal-Fired Flow Facility. January 1, 1993--March 31, 1993  

DOE Green Energy (OSTI)

Progress is reported in developing technology for steam bottoming cycle of the coal-fired MHD Steam Combined Cycle Power Plant. During this period, no testing was scheduled in the DOE Coal-Fired Flow Facility. The report covers facilities modification and maintenance in preparation for a 225 hour POC test that is scheduled for early next quarter. The modifications to the dry ESP to replace the electrodes with smaller diameter wires is discussed. Continued work on the rotary vacuum filter, which is designed to separate the more soluble potassium carbonate from the potassium sulfate and fly ash, is reported. Environmental activities for the quarter are summarized.

Not Available

1993-07-01T23:59:59.000Z

472

Off gas film cooler cleaner  

DOE Patents (OSTI)

An apparatus is described for cleaning depositions of particulate matter from the inside of tubular piping while the piping is in use. The apparatus is remotely controlled in order to operate in hazardous environments. A housing containing brush and shaft assemblies is mounted on top of the tubular piping. Pneumatic cylinders provide linear motion. A roller nut bearing provides rotary motion. The combined motion causes the brush assembly to rotate as it travels along the tube dislodging particulate matter. The main application for this invention is to clean the off gas cooler of a radioactive waste vitrification unit.

Dhingra, H.S.; Koch, W.C.; Burns, D.C.

1995-12-31T23:59:59.000Z

473

High ratio recirculating gas compressor  

DOE Patents (OSTI)

A high ratio positive displacement recirculating rotary compressor is disclosed. The compressor includes an integral heat exchanger and recirculation conduits for returning cooled, high pressure discharge gas to the compressor housing to reducing heating of the compressor and enable higher pressure ratios to be sustained. The compressor features a recirculation system which results in continuous and uninterrupted flow of recirculation gas to the compressor with no direct leakage to either the discharge port or the intake port of the compressor, resulting in a capability of higher sustained pressure ratios without overheating of the compressor.

Weinbrecht, John F. (601 Oakwood Pl., NE., Albuquerque, NM 87123)

1989-01-01T23:59:59.000Z

474

High ratio recirculating gas compressor  

DOE Patents (OSTI)

A high ratio positive displacement recirculating rotary compressor is disclosed. The compressor includes an integral heat exchanger and recirculation conduits for returning cooled, high pressure discharge gas to the compressor housing to reducing heating of the compressor and enable higher pressure ratios to be sustained. The compressor features a recirculation system which results in continuous and uninterrupted flow of recirculation gas to the compressor with no direct leakage to either the discharge port or the intake port of the compressor, resulting in a capability of higher sustained pressure ratios without overheating of the compressor. 10 figs.

Weinbrecht, J.F.

1989-08-22T23:59:59.000Z

475

DOE SUNY Cobleskill Final Report Part 4/5  

Science Conference Proceedings (OSTI)

This research evaluated a rotary kiln gasification system utilizing agricultural wastes to generate syn gas. The goal of the project was to develop an efficient methodology for harnessing energy from agricultural waste. Objectives included: installation and cold testing of the gasification system; hot testing the gasification system with two agricultural wastes; development of an operations plan, including a data procurement and analysis plan; development of a predictive model and validation of the model; developing process improvement recommendations; and construction of two deployment pathway models (e.g., institutional and farm).

None

2012-03-31T23:59:59.000Z

476

Electric arc saw apparatus  

DOE Patents (OSTI)

A portable, hand held electric arc saw has a small frame for supporting an electrically conducting rotary blade which serves as an electrode for generating an electric arc to erode a workpiece. Electric current is supplied to the blade by biased brushes and a slip ring which are mounted in the frame. A pair of freely movable endless belts in the form of crawler treads stretched between two pulleys are used to facilitate movement of the electric arc saw. The pulleys are formed of dielectric material to electrically insulate the crawler treads from the frame.

Deichelbohrer, Paul R. (Richland, WA)

1986-01-01T23:59:59.000Z

477

COAXIAL CONTROL ROD DRIVE MECHANISM FOR NEUTRONIC REACTORS  

DOE Patents (OSTI)

A drive mechanism is presented for the control rod or a nuclear reactor. In this device the control rod is coupled to a drive shaft which extends coaxially through the rotor of an electric motor for relative rotation with respect thereto. A gear reduction mehanism is coupled between the rotor and the drive shaft to convert the rotary motion of the motor into linear motion of the shaft with a comparatively great reduction in speed, thereby providing relatively glow linear movement of the shaft and control rod for control purposes.

Fox, R.J.; Oakes, L.C.

1959-04-14T23:59:59.000Z

478

Application of PDC bits in the Kuparuk River Field, Alaska  

SciTech Connect

In soft to medium hard clays and shales, PDC bits have proven to be economically successful in the Kuparuk River Field, Alaska. Through the redesign and modification of PDC bits and rig equipment, the necessary operating parameters have been achieved and the use of PDC bits has become routine. These bits are typically run with a standpipe pressure of 4000 psi, pump rate of 400 to 450 gpm, and a rotary speed of 150 to 200 rpm. Using these high operating parameters, a savings of about $50,000 per PDC bit is being achieved when compared to roller cone bits.

Balkenbush, R.J.; Onisko, J.E.

1983-10-01T23:59:59.000Z

479

IMPROVEMENTS IN OR RELATING TO COMPRESSORS  

SciTech Connect

A compressor for fluids is designed with a rotary driving shaft and a labyrinth sealing gland. The gland incorporates a bleed pipe with a filtering device; any leakage in the gland results in a flow of fluid in the bleed pipe, and any filterable contaminants, e.g., oil or oil vapor, are removed. Easy access is provided to the motors (one of which is auxiliary) for maintenance and overhaul. This compressor design is especially applicable to gas-cooled reactors where coolant contamination must be avoided. (D.L.C.)

Long, E.

1961-01-25T23:59:59.000Z

480

A new gap separation mechanism for APS insertion devices.  

SciTech Connect

A new gap separation mechanism for use with the standard Advanced Photon Source (APS) 3.3-cm-period undulator magnetic structures has been designed and built and the first system has been installed in the APS storage ring. The system allows a minimum magnetic gap of 10 mm for use with the APS 8-mm insertion device vacuum chambers. The mechanism is a bolted steel frame structure with a simple 4-motor mechanical drive train. The control system uses servomotors with incremental rotary encoders and virtual absolute linear encoders.

Trakhtenberg, E. M.; Tcheskidov, V.; Den Hartog, P. K.; Deriy, B.; Erdmann, M.; Makarov, O.; Moog, E. R.

1999-10-25T23:59:59.000Z

Note: This page contains sample records for the topic "vis cous rotary" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Final design review report for the RMCS Flammable Gas Detection Interlock  

DOE Green Energy (OSTI)

This report document the completion of the formal design review for the RMCS (Rotary Mode Core Sampling) flammable gas detector interlock. This hydrogen/flammable gas interlock, a proposed addition to the RMCS system portable exhauster, in intended to support core sampling operations in waste tanks requiring flammable gas controls. The objective of this review was to approve new drawings at the 100% design completion state. The conclusion reached by the review committee was that the design was acceptable and efforts should continue toward fabrication and delivery.

Corbett, J.E., Westinghouse Hanford

1996-08-20T23:59:59.000Z

482

Light beam dynamics in materials with radially-inhomogeneous thermal conductivity  

E-Print Network (OSTI)

We study the properties of bright and vortex solitons in thermal media with nonuniform thermal conductivity and homogeneous refractive index, whereby the local modulation of the thermal conductivity strongly affects the entire refractive index distribution. While regions where the thermal conductivity is increased effectively expel light, self-trapping may occur in the regions with reduced thermal conductivity, even if such regions are located close to the material boundary. As a result, strongly asymmetric self-trapped beams may form inside a ring with reduced thermal conductivity and perform persistent rotary motion. Also, such rings are shown to support stable vortex solitons, which may feature strongly non-canonical shapes.

Kartashov, Yaroslav V; Torner, Lluis

2013-01-01T23:59:59.000Z

483

Inboard seal mounting  

SciTech Connect

A regenerator assembly for a gas turbine engine has a hot side seal assembly formed in part by a cast metal engine block having a seal recess formed therein that is configured to supportingly receive ceramic support blocks including an inboard face thereon having a regenerator seal face bonded thereto. A pressurized leaf seal is interposed between the ceramic support block and the cast metal engine block to bias the seal wear face into sealing engagement with a hot side surface of a rotary regenerator matrix.

Hayes, John R. (Indianapolis, IN)

1983-01-01T23:59:59.000Z

484

DEVELOPMENT AND MANUFACTURE OF COST EFFECTIVE COMPOSITE DRILL PIPE  

SciTech Connect

This technical report presents the engineering research, process development and data accomplishments that have transpired to date in support of the development of Cost Effective Composite Drill Pipe (CDP). The report presents progress made from October 1, 2003 through September 30, 2004 and contains the following discussions: (1) Direct Electrical Connection for Rotary Shoulder Tool Joints; (2) Conductors for inclusion in the pipe wall (ER/DW-CDP); (3) Qualify fibers from Zoltek; (4) Qualify resin from Bakelite; (5) First commercial order for SR-CDP from Integrated Directional Resources (SR-CDP); and (6) Preparation of papers for publication and conference presentations.

James C. Leslie; James C. Leslie II; Lee Truong; James T. Heard; Peter Manekas

2005-03-18T23:59:59.000Z

485

DOE SUNY Cobleskill Final Report 3/5  

DOE Green Energy (OSTI)

This research evaluated a rotary kiln gasification system utilizing agricultural wastes to generate syn gas. The goal of the project was to develop an efficient methodology for harnessing energy from agricultural waste. Objectives included: installation and cold testing of the gasification system; hot testing the gasification system with two agricultural wastes; development of an operations plan, including a data procurement and analysis plan; development of a predictive model and validation of the model; developing process improvement recommendations; and construction of two deployment pathway models (e.g., institutional and farm).

None

2012-03-31T23:59:59.000Z

486

DOE SUNY Cobleskill Final Report Part 2/5  

Science Conference Proceedings (OSTI)

This research evaluated a rotary kiln gasification system utilizing agricultural wastes to generate syn gas. The goal of the project was to develop an efficient methodology for harnessing energy from agricultural waste. Objectives included: installation and cold testing of the gasification system; hot testing the gasification system with two agricultural wastes; development of an operations plan, including a data procurement and analysis plan; development of a predictive model and validation of the model; developing process improvement recommendations; and construction of two deployment pathway models (e.g., institutional and farm).

None

2012-03-31T23:59:59.000Z

487

DOE SUNY Cobleskill Final Report Part 5/5  

Science Conference Proceedings (OSTI)

This research evaluated a rotary kiln gasification system utilizing agricultural wastes to generate syn gas. The goal of the project was to develop an efficient methodology for harnessing energy from agricultural waste. Objectives included: installation and cold testing of the gasification system; hot testing the gasification system with two agricultural wastes; development of an operations plan, including a data procurement and analysis plan; development of a predictive model and validation of the model; developing process improvement recommendations; and construction of two deployment pathway models (e.g., institutional and farm).

None

2012-03-31T23:59:59.000Z

488

DOE SUNY Cobleskill Final Report - Part 1/5  

SciTech Connect

This research evaluated a rotary kiln gasification system utilizing agricultural wastes to generate syn gas. The goal of the project was to develop an efficient methodology for harnessing energy from agricultural waste. Objectives included: installation and cold testing of the gasification system; hot testing the gasification system with two agricultural wastes; development of an operations plan, including a data procurement and analysis plan; development of a predictive model and validation of the model; developing process improvement recommendations; and construction of two deployment pathway models (e.g., institutional and farm).

None

2012-03-31T23:59:59.000Z

489

Offshore underbalanced drilling system could revive field developments. Part 2: Making this valuable reservoir drilling/completion technique work on a conventional offshore drilling platform  

Science Conference Proceedings (OSTI)

Part 1, presented in the July issue, discussed the emerging trend to move underbalanced drilling (UBD) operations into the offshore arena, following its successful application in many onshore areas. This concluding article delves into the details of applying UBD offshore. Starting with advantages the technique offers in many maturing or complex/marginal prospects, the UBD system for offshore platforms use is described. This involves conversion of the conventional rotary system, use of rotating diverters, design of the surface fluid separation system and the necessary gas (nitrogen or natural gas) injection system to lighten the fluid column. Commonly faced operational challenges for offshore UBD are listed along with recommended solutions.

Nessa, D.O.; Tangedahl, M.J.; Saponja, J.

1997-10-01T23:59:59.000Z

490

Wool fiberglass insulation manufacturing industry - background information for proposed standards  

SciTech Connect

A Standard of Performance for the control of emissions from wool fiberglass insulation manufacturing facilities is being proposed under authority of Section 111 of the Clean Air Act. This standard would apply to new, modified, or reconstructed wool fiberglass insulation manufacturing lines that utilize the rotary spin forming process and that commence construction on or after the date of proposal of the regulation. This document contains background information and environmental and economic impact assessments of the regulatory alternatives considered in developing the proposed standard. 79 references, 280 tables.

Not Available

1983-12-01T23:59:59.000Z

491

Dismantling techniques for reactor steel piping  

SciTech Connect

Two cutting techniques have been developed for dismantling the pipes connected to the Japan Power Demonstration Reactor (JPDR) pressure vessel. They are the rotary disk knife cutting system for dismantling relatively large pipes, such as the primary cooling system, and the shaped explosive cutting systems for cutting relatively small pipes in air or water. Basic cutting tests were performed to determine the optimum characteristics of the cutting systems and to conduct a safety evaluation by studying the effects of blasting on surrounding areas. Mock-up tests confirmed the applicability of the newly developed dismantling systems for JPDR dismantlement by successfully cutting test pipes with these systems.

Yanagihara, S.; Hiraga, F.; Nakamura, H. (Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan))

1989-08-01T23:59:59.000Z

492

The extraction of bitumen from western tar sands. Annual report, July 1990--July 1991  

Science Conference Proceedings (OSTI)

Contents of this report include the following: executive summary; characterization of the native bitumen from the Whiterocks oil sand deposit; influence of carboxylic acid content on bitumen viscosity; water based oil sand separation technology; extraction of bitumen from western oil sands by an energy-efficient thermal method; large- diameter fluidized bed reactor studies; rotary kiln pyrolysis of oil sand; catalytic upgrading of bitumen and bitumen derived liquids; ebullieted bed hydrotreating and hydrocracking; super critical fluid extraction; bitumen upgrading; 232 references; Appendix A--Whiterocks tar sand deposit bibliography; Appendix B--Asphalt Ridge tar sand deposit bibliography; and Appendix C--University of Utah tar sands bibliography.

Oblad, A.G.; Bunger, J.W.; Deo, M.D.; Hanson, F.V.; Miller, J.D.; Seader, J.D.

1992-04-01T23:59:59.000Z

493

Dewatering equipment recommendations for the solids/liquid separation project at Waste Area Grouping 6 at Oak Ridge National Laboratory, Oak Ridge, Tennessee  

SciTech Connect

The final closure of Waste Area Grouping (WAG) 6 at Oak Ridge National Laboratory will include the plugging and abandonment of many existing wells and boreholes and the installation of diversion trenches for groundwater control. These activities will generate soil that must be dewatered before it can be disposed of. Three different types of dewatering equipment{emdash}rotary vacuum drum filters, automatic discharge pressure filters, and centrifuges{emdash}have been evaluated to assess their suitability for the WAG 6 project. Because of its lower cost and minimal prescreening requirements, it is recommended that a centrifuge be used to dewater the WAG 6 soils.

Taylor, P.A.

1992-05-01T23:59:59.000Z

494

Dewatering equipment recommendations for the solids/liquid separation project at Waste Area Grouping 6 at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Environmental Restoration Program  

SciTech Connect

The final closure of Waste Area Grouping (WAG) 6 at Oak Ridge National Laboratory will include the plugging and abandonment of many existing wells and boreholes and the installation of diversion trenches for groundwater control. These activities will generate soil that must be dewatered before it can be disposed of. Three different types of dewatering equipment{emdash}rotary vacuum drum filters, automatic discharge pressure filters, and centrifuges{emdash}have been evaluated to assess their suitability for the WAG 6 project. Because of its lower cost and minimal prescreening requirements, it is recommended that a centrifuge be used to dewater the WAG 6 soils.

Taylor, P.A.

1992-05-01T23:59:59.000Z

495

Performance characteristics of the Lysholm engine as tested for geothermal power applications in the Imperial Valley  

Science Conference Proceedings (OSTI)

This paper contains a description of the performance tests of a Lysholm engine completed at the Lawrence Livermore National Laboratory at the University of California. The Lysholm engine is a rotary displacement engine which can accept a low quality (vapor fraction) two-phase mixture. Generally, the well-head condition of geothermal fluids is a mixture of liquid and vapor, with quality up to 40 percent, although for most liquid dominated geothermal resources the vapor fraction is considerably less than 40 percent. 13 refs.

Steidel, R.F. Jr.; Weiss, H.; Flower, J.E.

1982-01-01T23:59:59.000Z

496

Scaleup tests and supporting research for the development of duct injection technology. Topical report No. 1, Literature review  

Science Conference Proceedings (OSTI)

Gilbert Commonwealth, Southern Research Institute and the American Electric Power Service Corporation have embarked on a program to convert DOE`s Duct Injection Test Facility located at the Muskingum River Power Plant of Ohio Power Company to test alternate duct injection technologies. The technologies to be tested include slurry sorbent injection of hydrated lime using dual fluid nozzles, or a rotary atomizer and pneumatic injection of hydrated lime, with flue gas humidification before or after sorbent injection. The literature review and analysis contained in this report is a part of the preparatory effort for the test program.

Gooch, J.P.; Dismukes, E.B.; Dahlin, R.S.; Faulkner, M.G. [Southern Research Inst., Birmingham, AL (United States); Klett, M.G.; Buchanan, T.L.; Hunt, J.E. [Gilbert/Commonwealth, Inc., Reading, PA (United States)

1989-05-01T23:59:59.000Z

497

Scaleup tests and supporting research for the development of duct injection technology  

SciTech Connect

Gilbert Commonwealth, Southern Research Institute and the American Electric Power Service Corporation have embarked on a program to convert DOE's Duct Injection Test Facility located at the Muskingum River Power Plant of Ohio Power Company to test alternate duct injection technologies. The technologies to be tested include slurry sorbent injection of hydrated lime using dual fluid nozzles, or a rotary atomizer and pneumatic injection of hydrated lime, with flue gas humidification before or after sorbent injection. The literature review and analysis contained in this report is a part of the preparatory effort for the test program.

Gooch, J.P.; Dismukes, E.B.; Dahlin, R.S.; Faulkner, M.G. (Southern Research Inst., Birmingham, AL (United States)); Klett, M.G.; Buchanan, T.L.; Hunt, J.E. (Gilbert/Commonwealth, Inc., Reading, PA (United States))

1989-05-01T23:59:59.000Z

498

Near-Term Developments in Geothermal Drilling  

DOE Green Energy (OSTI)

The DOE Hard Rock Penetration program is developing technology to reduce the costs of drilling geothermal wells. Current projects include: R & D in lost circulation control, high temperature instrumentation, underground imaging with a borehole radar insulated drill pipe development for high temperature formations, and new technology for data transmission through drill pipe that can potentially greatly improve data rates for measurement while drilling systems. In addition to this work, projects of the Geothermal Drilling Organization are managed. During 1988, GDO projects include developments in five areas: high temperature acoustic televiewer, pneumatic turbine, urethane foam for lost circulation control, geothermal drill pipe protectors, an improved rotary head seals.

Dunn, James C.

1989-03-21T23:59:59.000Z

499

Microsoft Word - DOE-ID-11-010 Wisconsin - Agasie EC.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 SECTION A. Project Title: NEUP Infrastructure Program: Minor Reactor Upgrades- University of Wisconsin SECTION B. Project Description This project by the University of Wisconsin will: -Upgrade the reactor pool water system with a reverse osmosis system and a capacitance continuous level measurement probe with an associated digital meter display -Upgrade the reactor instrumentation and control systems with a multi-turn rotary absolute encoder along with associated digital readout devise and connecting hardware and a digital recorder. LAN access will provide remote assessment capabilities of the facility. -Upgrade the area radiation monitoring system and upgrade the swipe counter with an automatic low background alpha/beta counting system.

500

Assembly for directional drilling of boreholes  

Science Conference Proceedings (OSTI)

This patent describes a drilling assembly for directional drilling of boreholes in subsurface formations. The assembly comprising a downhole drilling motor. The motor having an output shaft which is suitable to drive a rotary drill bit and a motor housing which is suitable to be arranged at the lower end of a drill string; stabilizing means for stabilizing the assembly; means in the assembly for permanently tilting the central axis of the output shaft with respect to the longitudinal axis of the drill string in the borehole. It is characterized in that the stabilizing means include a lower-most stabilizer which is secured to and rotates with the output shaft.

Steiginga, A.; Worrall, R.N.

1989-11-14T23:59:59.000Z