Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

NE-20  

Office of Legacy Management (LM)

hi v. !&-2:. hi v. !&-2:. /qL lo 1 OCT 2 9 1984 NE-20 -. Authorization for Remedial Action of the Ashland 2 Site, Tonawanda, New York f! Joe LaGrone, Manager Oak Ridge Operations Office Based on the Aerial Radiological Survey (Attachment 1) and a "walk-on" radiologlcal survey (Attachment 2 , excerpted from the ORNL draft report "Ground-Level Investigation of Anomalous Gamma Radiation Levels in the Tonawanda, New York, Area," January 1980), the property identified as Ashland 2 is authorized for remedial action. It should be noted that the attached survey data are for designation purposes only and Bechtel National, Inc. (EM), should conduct appropriate comprehensive characterization surveys to determine the extent and magnitude of the

2

NE-23,  

Office of Legacy Management (LM)

t:"'. ? - ' t:"'. ? - ' y5 NE-23, wk$& Dr. Joseph A. Warburton Chainnan, Radiological and Toxicological Safety Board University of Nevada System DRI/ASC, P.O. Box 60220 Reno, Nevada 89506 Dear Dr. Warburton: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSRAP), has reviewed information on the Mackay School of M ines facility at the University of Nevada, Reno, Nevada, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Atomic Energy Commission (a predecessor to DOE). A radiological survey indicated that the radiation levels at the involved portion of the facility are at or near background levtrls. Therefore, no remedial action is required, and DGE is eliminating

3

NE-24  

Office of Legacy Management (LM)

VW- VW- 50 "id AU6 3 1983 NE-24 .' . _ : ' : R&D Decontamination Projects Under the Formerly Utilized Sites Remedial Actlon Program (FUSRAP) '_ F .- ,: 'J,.LaGrone, Manager . Oak Ridge Operations Office As a result of the House-Senate Conference Report and the Energy and Water Appropriations Act for FY 1984, and based on the data in the attached reports indicating radioactive contamination in excess of acceptable guidelines, the sites listed in the attachment and their respective vicinity properties (contaminated with radioactive materials from these sites) are being designated as decontamination research and development projects under the FUSRAP. Each site and the associated vicinity properties should be treated as a separate project. The objective of each project is to decontaminate the vicinity properties

4

NE Blog Archive  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ne/blog-archive 1000 Independence Ave. SWWashington DC ne/blog-archive 1000 Independence Ave. SWWashington DC 20585202-586-5000 en Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration http://energy.gov/ne/articles/generation-iv-international-forum-updates-technology-roadmap-and-builds-future ne/articles/generation-iv-international-forum-updates-technology-roadmap-and-builds-future" class="title-link">Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration

5

MHK Projects/Ocean Trials Ver 2 | Open Energy Information  

Open Energy Info (EERE)

Ocean Trials Ver 2 Ocean Trials Ver 2 < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

6

ProMoVer: modular verification of temporal safety properties  

Science Conference Proceedings (OSTI)

This paper describes ProMoVer, a tool for fully automated procedure-modular verification of Java programs equipped with method-local and global assertions that specify safety properties of sequences of method invocations. Modularity at the procedure-level ...

Siavash Soleimanifard; Dilian Gurov; Marieke Huisman

2011-11-01T23:59:59.000Z

7

MiniBooNE  

SciTech Connect

To begin, we examine the relationship between MiniBooNE and the neutrino beam geometry at Fermilab. In Figure 1, a schematic representation is shown of the plan view of the location of MiniBooNE relative to SciBooNE and the NuMI target, where it can be seen that SciBooNE and MiniBooNE share the same beamline and neutrino flux, and therefore share some of the same systematic effects -- A combined analysis between the two experimental groups could yield a superior result compared to segregated individual analysis. MiniBooNE makes an angle of 6.3 degrees with the NuMI beamline, an off-axis measurement if you will, that provides a relatively high yield of electron neutrinos from kaon decay. Furthermore, the proton beam incident on the MiniBooNE target possesses a 53 MHz structure that will be important in timing studies related to the low energy excess. Let's review of the results of the MiniBooNE: As is well known, MiniBooNE, a test of the LSND effect [1], adds experimental inspiration to the possible existence of new phenomena; although two neutrino-family oscillations were shown to be an unlikely candidate to explain the LSND effect, a low energy excess of 3.0 sigma in the neutrino sector at energies between 200 to 475 MeV [2] - an effect that appears to have no counterpart in the antineutrino sector [3], combined with the 3.8 sigma LSND result - at roughly 50 MeV - strains phenomenology for insight. Miniboones continues to run and collect antineutrino data; will combine disappearance analysis with SciBooNE; take data from the NuMI target, an unusual source with a potentially new look at the low energy anomaly; and use beam timing techniques to further constrain phenomenological models. In this paper we will review current topics related to MiniBooNE and other associated experiments and phenomenology.

Stefanski, Ray; /Fermilab

2009-10-01T23:59:59.000Z

8

Actes JFPC 2005 Une autre conversion de SAT vers CSP  

E-Print Network (OSTI)

Actes JFPC 2005 Une autre conversion de SAT vers CSP Olivier ROUSSEL CRIL - CNRS FRE 2499 rue de l tour, peut être di- rectement transformée en un problème CSP binaire. Cette transformation est basée. Nous montrons également que le maintien de la k-consistance sur le problème CSP est équivalent à l

Paris-Sud XI, Université de

9

Eliyahu Ne'eman  

NLE Websites -- All DOE Office Websites (Extended Search)

Eliyahu Ne'eman Eliyahu Ne'eman Consulting Engineer on Lighting and Daylighting Lawrence Berkeley National Laboratory This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. Eliyahu Ne'eman is a leading international expert on lighting and daylighting. He has been involved in education, research and practice for over 40 years while working in Israel, UK, Germany and the US(LBNL). He has worked extensively in the area of occupant response in luminous spaces and he has been leading the CIE Task Group that has revised the CIE Museum Lighting Guide. This Speaker's Seminars Control of Damage to Museum Objects by Optical Radiation

10

Synthse et ractivit des disilanes : applications vers la synthse de la 10-silatestostrone.  

E-Print Network (OSTI)

??Les travaux rapports dans ce mmoire concernent la synthse et la ractivit des disilanes, en vue de leur application vers la synthse de la 10-silatestostrone. (more)

Giros, Audrey

2012-01-01T23:59:59.000Z

11

Workforce Statistics - NA SH | National Nuclear Security Administratio...  

National Nuclear Security Administration (NNSA)

Blog Workforce Statistics - NA SH Home > About Us > Our Operations > Management and Budget > Office of Civil Rights > Workforce Statistics > Workforce Statistics - NA SH...

12

SH Coatings LP | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SH Coatings SH Coatings LP America's Next Top Energy Innovator Challenge 10147 likes SH Coatings LP Oak Ridge National Laboratory SH Coating protects power lines from inclement weather as well as contamination from salt deposits that often cause flashovers in coastal environments. The coating can be applied to existing power lines and equipment in any field condition. The most important application is coating power lines in ice storm threatened areas. Power lines coated with SHC prevent the ice build-up that come with ice storms by repelling the rain that ordinarily falls on power lines and freezes there forming a wing on the leeward side of the line and causing the lines to gallop during wind events. This action destroys the poles carrying the lines as well as cause lines to short

13

SH Coatings LP | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SH Coatings SH Coatings LP America's Next Top Energy Innovator Challenge 10147 likes SH Coatings LP Oak Ridge National Laboratory SH Coating protects power lines from inclement weather as well as contamination from salt deposits that often cause flashovers in coastal environments. The coating can be applied to existing power lines and equipment in any field condition. The most important application is coating power lines in ice storm threatened areas. Power lines coated with SHC prevent the ice build-up that come with ice storms by repelling the rain that ordinarily falls on power lines and freezes there forming a wing on the leeward side of the line and causing the lines to gallop during wind events. This action destroys the poles carrying the lines as well as cause lines to short

14

SH Coatings LP | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SH Coatings SH Coatings LP America's Next Top Energy Innovator Challenge 10147 likes SH Coatings LP Oak Ridge National Laboratory SH Coating protects power lines from inclement weather as well as contamination from salt deposits that often cause flashovers in coastal environments. The coating can be applied to existing power lines and equipment in any field condition. The most important application is coating power lines in ice storm threatened areas. Power lines coated with SHC prevent the ice build-up that come with ice storms by repelling the rain that ordinarily falls on power lines and freezes there forming a wing on the leeward side of the line and causing the lines to gallop during wind events. This action destroys the poles carrying the lines as well as cause lines to short

15

Category:Omaha, NE | Open Energy Information  

Open Energy Info (EERE)

Omaha, NE Omaha, NE Jump to: navigation, search Go Back to PV Economics By Location Media in category "Omaha, NE" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Omaha NE Omaha Public Power District.png SVFullServiceRestauran... 63 KB SVHospital Omaha NE Omaha Public Power District.png SVHospital Omaha NE Om... 61 KB SVLargeHotel Omaha NE Omaha Public Power District.png SVLargeHotel Omaha NE ... 61 KB SVLargeOffice Omaha NE Omaha Public Power District.png SVLargeOffice Omaha NE... 63 KB SVMediumOffice Omaha NE Omaha Public Power District.png SVMediumOffice Omaha N... 65 KB SVMidriseApartment Omaha NE Omaha Public Power District.png SVMidriseApartment Oma... 62 KB SVOutPatient Omaha NE Omaha Public Power District.png SVOutPatient Omaha NE ...

16

NE-23 W  

Office of Legacy Management (LM)

>:-1. ,- '"CC3 >:-1. ,- '"CC3 . ' NE-23 .+ W h itm~ l-l& Mr. Victor 3. Canilov, Director Museum of Science and Industry East 57th Street and Lake Shore Drive Chicago, Illinois 60037 Dear kr. Danilov: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSPSIP), has reviewed information on the Museum cf Science and Industry, Chicago, Illinois, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Manhattan Engineer District or the Atomic Energy C o m m ission (predecessors to DOE). A radiological survey indicated that the radiation levels are equal to natural background. Therefore, no remedial action is required, ant DOE is eliminating the Museum of Science and Industry from further

17

tude exprimentale de l'coulement gaz-liquide dans un canal ouvert vers le bas.  

E-Print Network (OSTI)

??Les travaux prsents ici ont pour objet l'tude fondamentale de l'coulement gaz-liquide dans un canal ouvert vers le bas. Cette tude permettra de mieux comprendre (more)

Toulouse, Dominic

2007-01-01T23:59:59.000Z

18

SH3 interactome conserves general function over specific form  

E-Print Network (OSTI)

Src homology 3 (SH3) domains bind peptides to mediate proteinprotein interactions that assemble and regulate dynamic biological processes. We surveyed the repertoire of SH3 binding specificity using peptide phage display ...

Xin, Xiaofeng

19

US NE MA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher

20

US NE MA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

TESLA Report 2005-05 Software Layer for SIMCON ver. 1.1.  

E-Print Network (OSTI)

TESLA Report 2005-05 Software Layer for SIMCON ver. 1.1. FPGA-based TESLA Cavity Control System to control FPGA-based LLRF electronic equipment for TESLA. There is presented a universal solution (SIMCON) for TESLA experiment (Test Facility) in DESY. The examples of the build and tested software

22

Overview of NE Research Programs  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Research Programs NE Research Programs Sue Lesica Office of Nuclear Energy U.S. Department of Energy July 31, 2013 2 R&D Budgets FY 2013 FY 2014 Congressional Request House Mark Senate Mark SMR Licensing Technical Support 62,999 70,000 110,000 70,000 Small Modular Reactor R&D 23,958 20,000 20,000 20,000 Next Generation Nuclear Plant 38,720 0 0 0 LWR Sustainability 24,218 21,500 21,500 21,500 Advanced Reactor Concepts 21,178 31,000 45,000 21,000 Reactor Concepts RD&D 108,075 72,500 86,500 62,500 Modeling and Simulation Hub 24,588 24,300 24,300 24,300 Crosscutting Technology Development 17,242 13,901 27,885 25,437 NEAMS 13,646 9,536 National Scientific Users Facility 14,563 14,563 14,563 14,563 Nuclear Energy Enabling Technologies 70,040 62,300 66,748 62,300

23

Optimisation de Smart Grid: d'un modle intgratif vers une simulation multi-agents autonomique  

E-Print Network (OSTI)

Optimisation de Smart Grid: d'un modèle intégratif vers une simulation multi-agents autonomique-agents intégrative de Smart Grid pour répondre aux besoins de simulation, d'analyse et d'optimisa- tion de tels systèmes. Mots-clés : Modélisation, simulation, multi- agents, smart grid Abstract Multi

24

UCR Chemical Hygiene Plan, ver 2012.09.10 page 1 of 55 UCR Chemistry Department Chemical Hygiene Plan  

E-Print Network (OSTI)

UCR Chemical Hygiene Plan, ver 2012.09.10 page 1 of 55 UCR Chemistry Department Chemical Hygiene Plan UCR CHEMISTRY DEPARTMENT CHEMICAL HYGIENE PLAN.................................... 4 Responsibilities of All Personnel Who Handle Hazardous Chemicals

Reed, Christopher A.

25

NE - Nuclear Energy - Energy Conservation Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NUCLEAR ENERGY (NE) NUCLEAR ENERGY (NE) ENERGY CONSERVATION PLAN NE has heavily emphasized the use of flexiplace, both regular and situational. Since approximately 56 percent of NE staff use flexiplace, our plan is based on the Forrestal/Germantown (FORS/GTN) office spaces, and flexiplace office space. There are other common sense actions and policies that will be used to improve energy efficiency in the offices at both FORS and GTN. In the FORS/GTN office space: 1. Use flexiplace to the maximum extent possible. Saving an average of 1.5 gallons of gasoline per day per person (e.g., 13 miles per work x 2 = 26 miles, an average of 17 mpg), on a normal workday, NE employees save (56 percent of 145 = 71 times 1.2 days per pay period = 85.2 workdays x 1.5 gals = 127.8 gallons/pay

26

MeSH Database Articles are indexed using a powerful vocabulary,  

E-Print Network (OSTI)

the Enter key. Combine search terms with connector words: "AND", "OR" or "NOT". Type connector wordsSH). The MeSH Database provides the option of identifying appropriate MeSH terms for searches. Click on the MeSH Database link on the blue sidebar to search for a particular term or concept. After finding a term, click

Wood, James B.

27

PubMed advanced exercise: MeSH Searching  

E-Print Network (OSTI)

achilles tendon and click Search. With MeSH searches, you enter only one search term at a time and you don can remove the need to enter multiple alternative terms to describe the same concept. For the following exercise, please search PubMed using: a) search terms that feature within the following

Rzepa, Henry S.

28

Interatomic Coulombic decay following Ne 1s Auger decay in NeAr  

SciTech Connect

Using momentum-resolved electron-ion multicoincidence spectroscopy, we have investigated interatomic Coulombic decay (ICD) in the heteronuclear NeAr dimer following Ne 1s Auger decay. The measured intensity ratio for the three ICD transitions Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 1}S)-Ar{sup +}(3p{sup -1}), Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 1}D)-Ar{sup +}(3p{sup -1}), and Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 3}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 3}P)-Ar{sup +}(3p{sup -1}) reasonably agree with predictions. The kinetic energy release distribution for the fragmentation to Ne{sup 2+}(2p{sup -2} {sup 1}D)-Ar{sup +}(3p{sup -1}) after the ICD transition from singlet Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar state, which is a mirror image of the kinetic energy distribution of the emitted ICD electrons, suggests that the corresponding ICD rate is roughly two times lower than predicted by ab initio calculations.

Ouchi, T.; Sakai, K.; Fukuzawa, H.; Ueda, K. [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Higuchi, I.; Tamenori, Y. [Japan Synchrotron Radiation Research Institute, Sayo, Hyogo 679-5198 (Japan); Demekhin, Ph. V.; Chiang, Y.-C.; Stoychev, S. D.; Kuleff, A. I. [Theoretische Chemie, Universitaet Heidelberg, D-69120 Heidelberg (Germany); Mazza, T. [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Cimaina and Dipartimento di Fisica, Universita degli Studi di Milano, via Celoria 16, I-20133 Milano (Italy); Schoeffler, M. [Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Nagaya, K.; Yao, M. [Department of Physics, Kyoto University, Kyoto 606-8502 (Japan); Saito, N. [National Institute of Advanced Industrial Science and Technology, National Meteorology Institute of Japan, Tsukuba 305-8568 (Japan)

2011-05-15T23:59:59.000Z

29

Preprint Lawrence Berkeley Laboratory U N I VERS ITY 0 F CALI FOR N I A  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 LBL-2378 1 Preprint Lawrence Berkeley Laboratory U N I VERS ITY 0 F CALI FOR N I A Physics Division Submitted to Astrophysical Journal SEP e 8 1987 An Analysis of Recent Measurements of the Temperature of the Cosmic Microwave Background Radiation G. Smoot, S.M Levin, C. Witebsky, G. De Amici, and Y. Rephaeli July 1987 TWO-WEEK LOAN COPY t This is a Library Circulating Copy which may be borrowed for two weeks, Prepared for the U.S. Department of Energy under Contract DE-AC03-76SF00098 An Analysis of Recent Measurements of the Temperature of the Cosmic Microwave Background Radiation George Smoot, Steven M. Levin, Chris Witebsky, Giovanni De Amici Space Sciences and Lawrence Berkeley Laboratories University of California, Berkeley Yoel Rephaeli

30

NE SARE Arbuscular Mycorrhiza Research following canola  

E-Print Network (OSTI)

NE SARE Arbuscular Mycorrhiza Research Corn grown following canola Corn grown following soybeans The planting of canola, a non-mycorrhizal crop, has been shown to reduce arbuscular mycorrhizal fungi following canola. To address this problem, we intercropped canola with oats, a mycorrhizal crop

Kaye, Jason P.

31

Activation of the S-H Group in Fe(2-SH)Fe Clusters: S-H Bond Strengths and Free Radical Reactivity of the Fe(2-SH)Fe Cluster  

DOE Green Energy (OSTI)

Absolute rate constants were determined for the abstraction of hydrogen atom from (OC)3Fe(?-SH)2Fe(CO)3 (Fe2S2H2) and (OC)3Fe(?-SCH3)(?-SH)Fe(CO)3 (Fe2S2MeH) by benzyl radical in benzene. From the temperature dependent rate data for Fe2S2H2, ?H and ?S were determined to be 2.03 ? 0.56 kcal/mol and 19.3 ? 1.7 cal/mol K, respectively, giving kabs = 1.2 ? 107 M 1 s 1 at 25?C. For Fe2S2MeH, ?H and ?S were determined to be 1.97 ? 0.46 kcal/mol and 18.1 ? 1.5 cal/mol K, respectively, giving kabs = 2.3 ? 107 M 1 s 1 at 25?C. Temperature dependent rate data are also reported for hydrogen atom abstraction by benzyl radical from thiophenol (?H = 3.62 ? 0.43 kcal/mol, ?S = 21.7 ? 1.3 cal/mol K) and H2S (?H = 5.13 ? 0.99 kcal/mol, ?S = 24.8 ? 3.2 cal/mol K), giving kabs at 25?C of 2.5 ? 105 and 4.2 ? 103 M 1 s 1, respectively. DFT calculations predict S-H bond strengths of 73.1 and 73.2 kcal/mol for Fe2S2H2 and Fe2S2MeH, respectively. Free energy and NMR chemical shift calculations confirm the NMR assignments and populations of Fe2S2H2 and Fe2S2MeH isomers. Derived radicals Fe2S2H and Fe2S2Me exhibit singly occupied HOMOs with unpaired spin density distributed between the two Fe atoms, a bridging sulfur, and d?-bonding between Fe centers. The S-H solution bond dissociation free energy (SBDFE) of Fe2S2MeH was found to be 69.4 1.7 kcal/mol by determination of its pKa (16.0 0.4) and the potential for the oxidation of the anion, Fe2S2Me- of 0.26 0.05 V vs. ferrocene in acetonitrile (corrected for dimerization of Fe2S2Me). This SBDFE for Fe2S2MeH corresponds to a gas phase bond dissociation enthalpy (BDE) of 74.2 kcal/mol, in satisfactory agreement with the DFT value of 73.2 kcal/mol. Replacement of the Fe-Fe bond in Fe2S2MeH with bridging ?-S (Fe2S3MeH) or ?-CO (Fe2S2(CO)MeH) groups leads to (DFT) BDEs of 72.8 and 66.2 kcal/mol, the latter indicating dramatic effects of choice of bridge structure on S-H bond strengths. These results provide a model for the reactivity of hydrosulfido sites of low-valent heterogeneous FeS catalysts. This work was supported by the US Department of Energy's Office of Basic Energy Sciences, Chemical Sciences program. Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.

Franz, James A.; Lee, Suh-Jane; Bowden, Thomas A.; Alnajjar, Mikhail S.; Appel, Aaron M.; Birnbaum, Jerome C.; Bitterwolf, Thomas E.; Dupuis, Michel

2009-10-28T23:59:59.000Z

32

Table SH7. Average Consumption for Space Heating by Main Space ...  

U.S. Energy Information Administration (EIA)

Fuel Oil (gallons) Main Space Heating Fuel Used (physical units of consumption per household using the fuel as a main heating source) Table SH7.

33

Table SH8. Average Consumption for Space Heating by Main Space ...  

U.S. Energy Information Administration (EIA)

Fuel Oil Main Space Heating Fuel Used (million Btu of consumption per household using the fuel as a main heating source) Any Major Fuel 4 Table SH8.

34

Table SH3. Total Consumption for Space Heating by Major Fuels Used ...  

U.S. Energy Information Administration (EIA)

Natural Gas (billion cf) Major Fuels Used 4 (physical units) Table SH3. Total Consumption for Space Heating by Major Fuels Used, 2005 Physical Units

35

Bifurcation vers l'etat d'Abrikosov et diagramme des phases  

E-Print Network (OSTI)

Nous \\'etudions dans cette th\\`ese la fonctionnelle de Ginzburg-Landau dans $\\R^3$ sur des couples de fonctions $(\\phi, \\overrightarrow{A})$ qui v\\'erifient des conditions de p\\'eriodicit\\'e de jauge en $x_3$ et selon un r\\'eseau discret de $(x_1,x_2)$. Nous montrons que le probl\\`eme variationnel est \\'equivalent au probl\\`eme de la minimisation d'une autre fonctionnelle sur un tore. Dans le cadre de la d\\'emonstration, un fibr\\'e vectoriel non trivial appara\\^it. On se limite alors pour la suite \\`a une quantification de 1. On montre ensuite que la fonctionnelle admet un minimum sur l'espace fonctionnel $H^{1}$ qui v\\'erifie un syst\\`eme d'\\'equations aux d\\'eriv\\'ees partielles appel\\'e syst\\`eme de Ginzburg-Landau. Le minimum est $C^{\\infty}$ par l'ellipticit\\'e du syst\\`eme d'\\'equations de Ginzburg-Landau. On montre qu'il y a une bifurcation du couple $(0,0)$ pour le champ critique $H_{ext}=k$ o\\`u $k$ est un param\\`etre caract\\'eristique du syst\\`eme. On \\'etudie alors la stabilit\\'e de la solution bifurqu\\'ee. On \\'etudie la d\\'ependance de l'\\'energie minimale \\`a l'\\'egard de la g\\'eom\\'etrie du tore. Enfin nous d\\'ecrivons toutes les solutions du syst\\`eme d'\\'equations de Ginzburg-Landau dans la limite $k$ tend vers l'infini. Dans le dernier chapitre, nous donnons pour notre mod\\`ele la structure du diagramme des phases en pr\\'ecisant quelles r\\'egions sont normales, supraconductrices pure, mixte.

Mathieu Dutour

1999-12-15T23:59:59.000Z

36

NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Blog Archive Blog Archive NE Blog Archive RSS December 31, 2013 GIF Policy Group Meeting in Brussels, Belgium, November 2013 Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration The Generation IV International Forum (GIF) held its 36th Policy Group (PG) meeting on November 21-22 in Brussels, Belgium. The PG reviewed progress on a number of on-going actions and received progress reports from the GIF Experts Group (EG) and the GIF Senior Industry Advisory Panel (SIAP). December 12, 2013 The basics of small modular reactor technology explained. | Infographic by Sarah Gerrity, Energy Department. Advancing Small Modular Reactors: How We're Supporting Next-Gen Nuclear

37

Microsoft PowerPoint - NE- Milton  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

University University Program (NEUP) Presentation to Vice Presidents of Research and Development of Historically Black Colleges and Universities Ingrid M. Milton Department of Energy Office of Nuclear Energy July 9, 2009 195725 (2) Overview The Office of Nuclear Energy (NE) is committed to strengthening the Nation's educational programs in nuclear science and engineering. * Established the Nuclear Energy University Program (NEUP). * Award grants and contracts through competitive selection process. NEUP enables universities to maintain and expand their nuclear science curriculum and programs to ensure future availability of technical experts for U.S. nuclear programs. * NEUP is managed by the Center for Advanced Energy Studies (CAES). 2 195725 (3) Nuclear Energy University Program -

38

Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

9% L'Enfam Plaza, S, W.. Warhin@on, D.C. 2002ijl74j Tekphow (202) 488ddO 9% L'Enfam Plaza, S, W.. Warhin@on, D.C. 2002ijl74j Tekphow (202) 488ddO 7117-03.87.cdy.'i3 23 September 1967 ~ s ~ Mr. Andrew Wallo, III, NE-23 Oivision of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND IJNIVFRSITIES , The attached elimination reconnnendation was prepar!ad in accordance with your suggestion during our meeting on 22 September! The recommendation includes 26 colleges and universities identified,in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated 27 May 1987; three institutions (Tufts College, University of Virginia, and the University of Washington) currently identified!on ithe FUSRAP list of sites under consideration; and six institutions recently iden-

39

REPLY TO ATTN OF NE-301  

Office of Legacy Management (LM)

N\I&?' d,' g N\I&?' d,' g 4 DATE. fdov 2 5 1980 REPLY TO ATTN OF NE-301 .* - memoraadu SUBJECT Remedial Action for Linde Air Products Plant, Tonawanda, New York TO W. E. Mott, EV In view of the General Counsel's reconsideration of the authority to proceed with remedial action on this site and your determination that remedial action is needed to protect the public health and safety, we will include this site in our program for remedial action. of this memorandum. Oak Ridge is requested to do so by copy I am somewhat surprised at the urgency of remedial action which you implied in your memorandum since your previous memorandum designating this site stated that it has a low priority. The site radiological survey report DOE/EV-005/5 concludes that air and water contamination were below the non-occupational

40

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Press Releases Press Releases NE Press Releases RSS December 12, 2013 Energy Department Announces New Investment in Innovative Small Modular Reactor The Energy Department tannounced an award to NuScale Power LLC to support a new project to design, certify and help commercialize innovative small modular reactors in the United States. November 12, 2013 Public Invited to Comment on Draft Environmental Assessment for the Resumption of Transient Testing of Nuclear Fuels and Materials The U.S. Department of Energy invites the public to read and comment on a draft environmental assessment it has prepared for a proposal to resume transient testing of nuclear fuels and materials at either Idaho National Laboratory (INL) or Sandia National Laboratories (SNL). November 4, 2013 Factsheet: Second Meeting of the United States-Japan Bilateral Commission

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Notices 888 First Street, NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 Federal Register 11 Federal Register / Vol. 76, No. 122 / Friday, June 24, 2011 / Notices 888 First Street, NE., Washington, DC 20426. The filings in the above-referenced proceeding are accessible in the Commission's eLibrary system by clicking on the appropriate link in the above list. They are also available for review in the Commission's Public Reference Room in Washington, DC. There is an eSubscription link on the Web site that enables subscribers to receive e-mail notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please e-mail FERCOnlineSupport@ferc.gov or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Dated: June 20, 2011. Kimberly D. Bose, Secretary. [FR Doc. 2011-15859 Filed 6-23-11; 8:45 am]

42

Notices 888 First Street NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

53 Federal Register 53 Federal Register / Vol. 78, No. 56 / Friday, March 22, 2013 / Notices 888 First Street NE., Washington, DC 20426. This filing is accessible on-line at http://www.ferc.gov, using the ''eLibrary'' link and is available for review in the Commission's Public Reference Room in Washington, DC. There is an ''eSubscription'' link on the Web site that enables subscribers to receive email notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please email FERCOnlineSupport@ferc.gov, or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Comment Date: 5:00 p.m. Eastern Time on April 2, 2013. Dated: March 15, 2013. Kimberly D. Bose, Secretary. [FR Doc. 2013-06602 Filed 3-21-13; 8:45 am] BILLING CODE 6717-01-P

43

Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

suite 7900,955 L%l/onr Plaza, S. W., Washingion, D.C. 20024.?174,, Telephone: (202) 488.~ suite 7900,955 L%l/onr Plaza, S. W., Washingion, D.C. 20024.?174,, Telephone: (202) 488.~ Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 7117~03.87.dy.43 23 September 1987 I j / Dear Mr. Wallo: I ELIMINATION RECOMMENDATION -- COLLEGES AND UN&ITIES I . The attached elimination recommendation was prepared in accordance with your suggestion during our meeting on 22 September!. The recommend includes 26 colleges and universities identified,in Enclosure 4 to Aerospace letter subject: Status of Actions 27 May 1987; three institutions (Tufts and the University of Washington) currently list of sites under consideration; and six institutions tified during a search of Hanford records.

44

M r. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

300.955 L*Enfom Plaza, S. Iv.. Washrhington. D.C. 200242174, Tekphonc (202) 300.955 L*Enfom Plaza, S. Iv.. Washrhington. D.C. 200242174, Tekphonc (202) 7117-03.87.cdy.43 23 September 1987 M r. Andrew Wallo, III, NE-23 Division of Facility & Site Deconnnissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear M r. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES The attached elimination recommendation was prepared in accordi with your suggestion during our meeting on 22 September. The reconu includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Sites List, da: 27 May 1987; three institutions.(Tufts College, University of Virgil and the University of Washington) currently identified'on the FUSFN list of sites under consideration; and six.institutions recently idI

45

MiniBooNE Oscillation Results 2011  

SciTech Connect

The MiniBooNE neutrino oscillation search experiment at Fermilab has recently updated results from a search for {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations, using a data sample corresponding to 8.58 x 10{sup 20} protons on target in anti-neutrino mode. This high statistics result represent an increase in statistics of 52% compared to result published in 2010. An excess of 57.7 {+-} 28.5 events is observed in the energy range 200 MeV < E{sub {nu}} < 3000 MeV. The data favor LSND-like {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations over a background only hypothesis at 91.1% confidence level in the energy range 475 < E{sub {nu}} < 3000 MeV.

Djurcic, Zelimir

2012-01-01T23:59:59.000Z

46

NE-23 List of California Sites NE-23 Hattie Car-well, SAN/NSQA Division  

Office of Legacy Management (LM)

NE-23 NE-23 Hattie Car-well, SAN/NSQA Division Attached for your information is the list of California sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action Program (FUSRAP). None of the facilities listed qualified"fbr'FUSRAP:'~- The only site in California,that was included in FUSRAP was Gilman Hall on the University of California-Berkeley Campus. All California sites that are in our Surplus Facilities Management Prcgram are under San Francisco Operations and are at the Santa Susana Field Laboratory or the University of California-Davis. If you have questions on any of the sites on the list, please call me at FTS 233-5439. /ct( Andrew Walls III. Desiynation and Certification Manager

47

Version 1.0 Lithium hyper ne splitting  

E-Print Network (OSTI)

Version 1.0 Lithium hyper#12;ne splitting Krzysztof Pachucki #3; Institute of Theoretical Physics approach for the calculation of relativistic m#11; 6 corrections to the lithium ground state hyper#12;ne problem. We will concentrate on lithium as the simplest alkali-metal atom, for which several precise

Pachucki, Krzysztof

48

Traffic Flow Measurement: Experiences with NeTraMet  

Science Conference Proceedings (OSTI)

This memo records experiences in implementing and using the Traffic Flow Measurement Architecture and Meter MIB. It discusses the implementation of NeTraMet (a traffic meter) and NeMaC (a combined manager and meter reader), considers the writing of ...

N. Brownlee

1997-03-01T23:59:59.000Z

49

HYBRID UNDULATORS AND WIGGLERS LS-18 S.H. Kim  

NLE Websites -- All DOE Office Websites (Extended Search)

HYBRID UNDULATORS AND WIGGLERS HYBRID UNDULATORS AND WIGGLERS LS-18 S.H. Kim March 22, 1985 FOR. THE ALADDIN SYNCHROTRON LIGHT SOURCE In this note, design parameters of two hybrid undulators and one hybrid wiggler are considered with a minimum gap of 1.25 cm. The length of the insertion devices considered here is 3.5 m. The magnetic field along the axis of the hybrid devices of samarium-cobalt permanent magnets and vanadium per- mendur pole tips is expressed as: -f- (5.47 - 1.80 g/A u ) B 3.3 x 0.90 e u where Au and g are the undulator period and gap, and a filling or assembly factor of 90% is assumed. Figure 1 shows the deflection parameter K vs gap for three insertion devices (see the names). The parameters used in this note are marked as " 1 circles in Fig. * In Figs. 2 and 3, the first few harmonics of the spectral brilliance of

50

Nuclear deformation of {sup 20}Ne from {sup 20}Ne(105 MeV)+{sup 208}Pb scattering  

Science Conference Proceedings (OSTI)

We have measured differential cross section for quasielastic scattering of {sup 20}Ne+{sup 208}Pb at a lab energy of 105 MeV. The data are analyzed by a rotational-model coupled-channels calculation including the 0{sup +} ground state, 2{sup +} and 4{sup +} states of {sup 20}Ne.

Strojek, I.; Czarnacki, W.; Keeley, N. [Department of Nuclear Reaction, The Andrzej Soltan Institute for Nuclear Studies, 00681 Warsaw (Poland); Kisielinski, M.; Piasecki, E.; Rusek, K. [Department of Nuclear Reaction, The Andrzej Soltan Institute for Nuclear Studies, 00681 Warsaw (Poland); Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Kliczewski, S.; Siudak, R. [Niewodniczanski Institute of Nuclear Physics PAN, 31342 Cracow (Poland); Kordiasz, A.; Trzcinska, A. [Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Koshchiy, E. [V. N. Karazin Kharkiv National University, 61077 Kharkiv (Ukraine); Kowalczyk, M. [Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Faculty of Physics, Warsaw University, 00681 Warsaw (Poland); Piorkowska, A.; Stuad, A. [University of Silesia, 40007 Katowice (Poland)

2010-04-26T23:59:59.000Z

51

CA Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

?9OQ, 95.5 L'E&nt Plaza, SW.. W.ashin@.m, D.C. 20024.2174, Tekphone: (202) 488AQOO ?9OQ, 95.5 L'E&nt Plaza, SW.. W.ashin@.m, D.C. 20024.2174, Tekphone: (202) 488AQOO 7117-03.B7.cdy.43 23 September 1987 CA Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Oepartment of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES zh/ ! o-01 lM!tl5 ML)!o-05 PI 77!0> The attached elimination recoannendation was prepared in accordance . -1 rlL.0~ with your suggestion during our meeting on 22 September. The recommendation flD.o-02 includes 26 colleges and universities identified~in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated MO.07. 27 May 1987; three institutions (Tufts College, University of Virginia, UCIIOJ and the University of Washington) currently identified on the FUSRAP

52

Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

300, 955 L'E~~MI Phm.SW.:. Washin@on. LX. 200242174, T~kphonc(202)48ll. 5 300, 955 L'E~~MI Phm.SW.:. Washin@on. LX. 200242174, T~kphonc(202)48ll. 5 7117-03.87.cdy.43 23 September 1987 cA Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES M/).0-05 pl 0.0% The attached elimination recommendation was prepared in accordance ML.05 with your suggestion during our meeting on 22 September. The recommendation flD.o-02 includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated NO.03. 27 May 1987; three institutions (Tufts College, University of Virginia, rJc..of and the University of Washington) currently identified on the FUSRAP

53

Pion inelastic scattering from sup 20 Ne  

SciTech Connect

Angular distributions for {sup 20}Ne({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime}) were measured on the Energetic Pion Channel and Spectrometer (EPICS) at the Clinton P. Anderson Meson Physics Facility (LAMPF). Data were taken with both {pi}{sup {plus}} and {pi}{sup {minus}} over an angular range of 12{degree} to 90{degree} for T{sub {pi}}=180 MeV and with {pi}{sup +} from 15{degree} to 90{degree} for T{sub {pi}}=120 MeV. The data were analyzed using both the distorted-wave impulse approximation (DWIA) and the coupled-channels impulse approximation (CCIA) with collective transition densities. In addition, microscopic transition densities were used in the DWIA analysis for states in the lowest rotational bands. The transitions to the 6.73-MeV 0{sup +} and several 1{sup {minus}} states, including the states at 5.79 MeV and 8.71 MeV, were studied using several models for the transition density. Strong evidence for the importance of two-step routes in pion inelastic scattering was seen in several angular distributions, including the 5.79-MeV 1{sup {minus}}, the first three 4{sup +} states, and the 8.78-MeV 6{sup +}. 100 refs., 81 figs., 33 tabs.

Burlein, M. (Pennsylvania Univ., Philadelphia, PA (USA). Dept. of Physics)

1989-12-01T23:59:59.000Z

54

Property:EIA/861/IsoNe | Open Energy Information  

Open Energy Info (EERE)

IsoNe IsoNe Jump to: navigation, search Property Name ISO_NE Property Type Boolean Description Indicates that the organization conducts operations in the New England ISO region [1] References ↑ "EIA Form EIA-861 Final Data File for 2010 - 861 Webfile Layout for 2010.doc" Pages using the property "EIA/861/IsoNe" Showing 25 pages using this property. (previous 25) (next 25) B Bangor Hydro-Electric Co + true + Barton Village, Inc (Utility Company) + true + Bozrah Light & Power Company + true + C Central Maine Power Co + true + Central Vermont Pub Serv Corp + true + CinCap IV, LLC + true + CinCap V LLC + true + Cinergy Capital & Trading, Inc + true + City of Chicopee, Massachusetts (Utility Company) + true + City of Holyoke, Massachusetts (Utility Company) + true +

55

Neutral Current Elastic Interactions in MiniBooNE  

SciTech Connect

Neutral Current Elastic (NCE) interactions in MiniBooNE are discussed. In the neutrino mode MiniBooNE reported: the flux averaged NCE differential cross section as a function of four-momentum transferred squared, an axial mass (M{sub A}) measurement, and a measurement of the strange quark spin content of the nucleon, {Delta}s. In the antineutrino mode we present the background-subtracted data which is compared with the Monte Carlo predictions.

Dharmapalan, Ranjan; /Alabama U.

2011-10-01T23:59:59.000Z

56

D:\NE WEB Sites\NE\nerac\nov2001minutes.wpd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 5-6, 2001, DoubleTree Hotel, Arlington, Virginia November 5-6, 2001, DoubleTree Hotel, Arlington, Virginia NERAC members present: John Ahearne Robert Long Joseph Comfort Warren F. Miller, Jr. Michael L. Corradini Benjamin F. Montoya Jose Luis Cortez Sekazi Mtingwa Allen Croff Lura Powell James Duderstadt (Chair) Richard Reba Marvin Fertel Joy Rempe Beverly Hartline John Taylor Andrew Klein Charles E. Till Dale Klein (Monday only) Neil Todreas NERAC members absent: Thomas Cochran Allen Sessoms Maureen S. Crandall Daniel C. Sullivan Steve Fetter C. Bruce Tarter Leslie Hartz Ashok Thadani (ad hoc) J. Bennett Johnston Joan Woodard Linda C. Knight Also present: Robert Card, Under Secretary, USDOE Nancy Carder, NERAC Staff Charles Forsberg, Researcher, Oak Ridge National Laboratory Norton Haberman, Senior Technical Advisor, NE, USDOE

57

Coincident P and Sh reflections from basement rocks at Coso geothermal  

Open Energy Info (EERE)

Coincident P and Sh reflections from basement rocks at Coso geothermal Coincident P and Sh reflections from basement rocks at Coso geothermal field Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Coincident P and Sh reflections from basement rocks at Coso geothermal field Details Activities (2) Areas (1) Regions (0) Abstract: In mid-1989 the authors designed and collected four seismic reflection/refraction profiles that addressed the crustal structure of the Coso geothermal field. The two main east-west and north-south profiles crossed at the southeasternmost base of Sugar Loaf Mountain. Both in-line and cross-line Vibroseis and explosion data were recorded on each of these approximately 12-mi lines. This was accomplished with the simultaneous operation of two 1024-channel sign bit recording systems while four

58

An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne  

Open Energy Info (EERE)

Page Page Edit History Facebook icon Twitter icon » An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne Portugal) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne Portugal) Details Activities (0) Areas (0) Regions (0) Abstract: In an attempt to define the resistivity model of the Chaves geothermal field in NE Portugal, a detailed survey with scalar audiomagnetotelluric measurements was performed. The soundings were made in the frequency range from 2300 to 4.1 Hz. Electrical resistivity models were derived from the application of 1-D inversion, 2-D trial and error modeling and 2-D inversion procedures. The resistivities inside the geothermal field are low, reaching not more than 30 Ωm and increasing up to 60-150 Ωm

59

Municipal Energy Agency of NE | Open Energy Information  

Open Energy Info (EERE)

Municipal Energy Agency of NE Municipal Energy Agency of NE Jump to: navigation, search Name Municipal Energy Agency of NE Place Nebraska Utility Id 21352 Utility Location Yes Ownership P NERC Location MRO NERC MRO Yes NERC SPP Yes NERC WECC Yes RTO SPP Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from

60

_QL\\b[mkD***0*BfX^SH+*****SYJTC4#%$-5**?T ...  

Science Conference Proceedings (OSTI)

_QL\\b[mkD***0*BfX^SH+*****SYJTC4#%$-5**?T@68GSFKksnp{nN&**> PXC

2002-03-26T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

19Ne levels studied with the 18F(d,n)19Ne*(18F+p) reaction  

Science Conference Proceedings (OSTI)

A good understanding of the level structure of 19Ne around the proton threshold is critical to estimating the destruction of long-lived 18F in novae. Here we report the properties of levels in 19Ne in the excitation energy range of 6.9 Ex 8.4 MeV studied via the proton-transfer 18F(d, n)Ne reaction at the Holifield Radioactive Ion Beam Facility. The populated 19Ne levels decay by breakup into p + 18F and + 15O particles. The results presented in this manuscript are those of levels that are simultaneously observed from the breakup into both channels. An s-wave state is observed at 1468 keV above the proton threshold, which is a potential candidate for a predicted broad J = 1/2+ state. The proton and partial widths are deduced to be p = 228 50 keV and = 130 30 keV for this state.

Adekola, A. S. [Ohio University, Athens; Brune, C. R. [Ohio University; Bardayan, Daniel W [ORNL; Blackmon, Jeffery C [Louisiana State University; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Cizewski, J. A. [Rutgers University; Jones, K. L. [University of Tennessee, Knoxville (UTK); Kozub, R. L. [Tennessee Technological University; Massey, T. [Ohio University; Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; ShrinerJr., J. F. [Tennessee Technological University; Smith, Michael Scott [ORNL; Thomas, J. S. [Rutgers University

2012-01-01T23:59:59.000Z

62

High-resolution MAS NMR analysis of PI3-SH3 amyloid fibrils: Backbone conformation and implications for protofilament assembly and structure  

E-Print Network (OSTI)

The SH3 domain of the PI3 kinase (PI3-SH3 or PI3K-SH3) readily aggregates into fibrils in vitro and has served as an important model system in the investigation of the molecular properties and mechanism of formation of ...

Bayro, Marvin J.

63

File:EIA-Williston-NE-Gas.pdf | Open Energy Information  

Open Energy Info (EERE)

Williston-NE-Gas.pdf Williston-NE-Gas.pdf Jump to: navigation, search File File history File usage Williston Basin, Northeast Part By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.95 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

64

MiniBooNE "Windows on the Universe"  

Science Conference Proceedings (OSTI)

Progress in the last few decades has left neutrino physics with several vexing issues. Among them are the following questions: (1) Why are lepton mixing angles so different from those in the quark sector? (2) What is the most probable range of the reactor mixing angle? (3) Is the atmospheric mixing angle maximal? (4) What is the number of fermion generations? These are some of the issues that neutrino science hopes to study; this article will explore these questions as part of a more general scientific landscape, and will discuss the part MiniBooNE might play in this exploration. We discuss the current state of measurements taken by MiniBooNE, and emphasize the uniqueness of neutrino oscillations as an important probe into the 'Windows on the Universe.'

Stefanski, Ray; /Fermilab

2010-12-09T23:59:59.000Z

65

Overview of DOE-NE Proliferation and Terrorism Risk Assessment  

SciTech Connect

Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism. The goal is to enable the use of risk information to inform NE R&D program planning. The PTRA program supports DOE-NE's goal of using risk information to inform R&D program planning. The FY12 PTRA program is focused on terrorism risk. The program includes a mix of innovative methods that support the general practice of risk assessments, and selected applications.

Sadasivan, Pratap [Los Alamos National Laboratory

2012-08-24T23:59:59.000Z

66

Neutrino and Antineutrino Cross sections at MiniBooNE  

SciTech Connect

The MiniBooNE experiment has reported a number of high statistics neutrino and anti-neutrino cross sections -among which are the charged current quasi-elastic (CCQE) and neutral current elastic (NCE) neutrino scattering on mineral oil (CH2). Recently a study of the neutrino contamination of the anti-neutrino beam has concluded and the analysis of the anti-neutrino CCQE and NCE scattering is ongoing.

Dharmapalan, Ranjan; /Alabama U.

2011-10-01T23:59:59.000Z

67

Ne IX emission-line ratios in solar active regions  

Science Conference Proceedings (OSTI)

Emission-line ratios for Ne IX are derived and compared with observational data for solar active regions obtained with the SOLEX B spectrometer on the P78-1 satellite. Excellent agreement is obtained, providing support for the atomic data adopted in the calculations and resolving discrepancies between existing theoretical calculations and solar data. The calculated R-ratio for the low-density limit agrees well with the SOLEX observations. 47 references.

Keenan, F.P.; Mccann, S.M.; Kingston, A.E.; Mckenzie, D.L.

1987-07-01T23:59:59.000Z

68

Generic Model of SH-LED for Mid-infrared (2-5m) Applications  

Science Conference Proceedings (OSTI)

In this paper, we present a physics based model of a P+-InAs0.36Sb0.20P0.44/ n0-InAs/n+-InAs single heterostructure light emitting diode (SH-LED) suitable for use as source in gas detection and futuristic optical fiber communication systems in the mid-infrared ... Keywords: Gas instrumentation, Optical fiber communication, Light emitting diode, Mid-infrared, Single heterostructure

Sanjeev; P. Chakrabarti

2008-07-01T23:59:59.000Z

69

Vanishing N=20 Shell Gap: Study of Excited States in {sup 27,28}Ne  

Science Conference Proceedings (OSTI)

This Letter reports on the {sup 1}H({sup 28}Ne,{sup 28}Ne) and {sup 1}H({sup 28}Ne,{sup 27}Ne) reactions studied at intermediate energy using a liquid hydrogen target. From the cross section populating the first 2{sup +} excited state of {sup 28}Ne, and using the previously determined B(E2) value, the neutron quadrupole transition matrix element has been calculated to be M{sub n}=13.8{+-}3.7 fm{sup 2}. In the neutron knockout reaction, two low-lying excited states were populated in {sup 27}Ne. Only one of them can be interpreted by the sd shell model while the additional state may intrude from the fp shell. These experimental observations are consistent with the presence of fp shell configurations at low excitation energy in {sup 27,28}Ne nuclei caused by a vanishing N=20 shell gap at Z=10.

Dombradi, Zs.; Fueloep, Zs. [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, Debrecen, H-4001 (Hungary); Elekes, Z. [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, Debrecen, H-4001 (Hungary); Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Saito, A.; Baba, H.; Demichi, K.; Gomi, T.; Hasegawa, H.; Kanno, S.; Kawai, S.; Kurita, K.; Matsuyama, Y.; Sakai, H.K.; Takeshita, E.; Togano, Y.; Yamada, K. [Rikkyo University, 3 Nishi-Ikebukuro, Toshima, Tokyo 171 (Japan); Aoi, N.; Ishihara, M.; Kishida, T.; Kubo, T. [Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)] (and others)

2006-05-12T23:59:59.000Z

70

Complete genome sequence of Halopiger xanaduensis type strain (SH6T)  

SciTech Connect

Halopiger xanaduensis is the type species of the genus Halopiger and belongs to the euryarchaeal family Halobacteriaceae. H. xanaduensis strain SH-6, which is designated as the type strain, was isolated from the sediment of a salt lake in Inner Mongolia, Lake Shangmatala. Like other members of the family Halobacteriaceae, it is an extreme halophile requiring at least 2.5 M salt for growth. We report here the sequencing and annotation of the 4,355,268 bp genome, which includes one chromosome and three plasmids. This genome is part of a Joint Genome Institute (JGI) Community Sequencing Program (CSP) project to sequence diverse haloarchaeal genomes.

Anderson, Iain [U.S. Department of Energy, Joint Genome Institute; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute

2012-01-01T23:59:59.000Z

71

WAT TENBERG SPIN DLE EAT ON BONN Y GREELEY ROGGEN WAVERLY SH  

U.S. Energy Information Administration (EIA) Indexed Site

Liquids Reserve Class Liquids Reserve Class No 2001 liquids reserves 0.1 - 10 Mbbl 10.1 - 100 Mbbl 100.1 - 1,000 Mbbl 1,000.1 - 10,000 Mbbl 10,000.1 - 100,000 Mbbl Denver Basin Outline 0 20 40 10 30 Miles ± CO 2001 Reserve Summary for All Denver Basin Fields KS NE CO NE WY KS SD Index Map For 3 Denver Basin Panels The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and

72

2013 Annual DOE-NE Materials Research Coordination Meeting | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting The Reactor Materials element of the Nuclear Energy Enabling Technologies (NEET) program conducted its FY 2013 coordination meeting as a series of four web-conferences to act as a forum for the nuclear materials research community. The purpose of this meeting was to report on current and planned nuclear materials research, identify new areas of collaboration and promote greater coordination among the various Office of Nuclear Energy (NE) programs. Currently, materials research is performed in several NE programs, including NE Advanced Modeling and Simulation (NEAMS), Fuel Cycle Research and Development (FCRD), Advanced Reactor Technologies

73

2013 Annual DOE-NE Materials Research Coordination Meeting | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting The Reactor Materials element of the Nuclear Energy Enabling Technologies (NEET) program conducted its FY 2013 coordination meeting as a series of four web-conferences to act as a forum for the nuclear materials research community. The purpose of this meeting was to report on current and planned nuclear materials research, identify new areas of collaboration and promote greater coordination among the various Office of Nuclear Energy (NE) programs. Currently, materials research is performed in several NE programs, including NE Advanced Modeling and Simulation (NEAMS), Fuel Cycle Research and Development (FCRD), Advanced Reactor Technologies

74

R-Process in Collapsing O/Ne/Mg Cores  

E-Print Network (OSTI)

Several circumstantial arguments point to the formation of the third r-process peak at A about 190, near platinum, in stars of mass of about 8-10 solar masses: 1) The delayed production of europium with respect to iron imposes a time scale that restricts the progenitor stars to less than about 10 solar masses; 2) the r-process demands a dominant robust mechanism at least for barium and above, since the relative abundance pattern of those r-process elements in low-metallicity stars is consistent with the solar pattern; 3) stars of about 8-10 solar masses produce nearly identical degenerate O/Ne/Mg cores that collapse due to electron capture; and 4) the resulting low-mass cores may produce both an r-process in a prompt explosion and a subsequent r-process in a neutrino driven wind. The prompt explosion of an O/Ne/Mg core yields low entropy and low electron fraction, and hence may produce a reasonable r-process peak at A about 190 as well as all of the r-process elements with Z greater than 56. The possible diff...

Wheeler, J C; Hillebrandt, W; Cowan, John J.; Hillebrandt, Wolfgang

1997-01-01T23:59:59.000Z

75

R-Process in Collapsing O/Ne/Mg Cores  

E-Print Network (OSTI)

Several circumstantial arguments point to the formation of the third r-process peak at A about 190, near platinum, in stars of mass of about 8-10 solar masses: 1) The delayed production of europium with respect to iron imposes a time scale that restricts the progenitor stars to less than about 10 solar masses; 2) the r-process demands a dominant robust mechanism at least for barium and above, since the relative abundance pattern of those r-process elements in low-metallicity stars is consistent with the solar pattern; 3) stars of about 8-10 solar masses produce nearly identical degenerate O/Ne/Mg cores that collapse due to electron capture; and 4) the resulting low-mass cores may produce both an r-process in a prompt explosion and a subsequent r-process in a neutrino driven wind. The prompt explosion of an O/Ne/Mg core yields low entropy and low electron fraction, and hence may produce a reasonable r-process peak at A about 190 as well as all of the r-process elements with Z greater than 56. The possible differences in the neutrino-driven wind and associated r-process due to the low-mass neutron stars expected in this mass range are also discussed.

J. Craig Wheeler; John J. Cowan; Wolfgang Hillebrandt

1997-11-22T23:59:59.000Z

76

A Case Study For Geothermal Exploration In The Ne German Basin...  

Open Energy Info (EERE)

icon Twitter icon A Case Study For Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And...

77

LAKESHORE AVON BR ANT-EDEN ALD EN-LANC ASTER AU BURN W SH ELDON  

U.S. Energy Information Administration (EIA) Indexed Site

81 81 § ¨ ¦ 81 LAKESHORE AVON BR ANT-EDEN ALD EN-LANC ASTER AU BURN W SH ELDON CALEDONIA HURON C REEK LEIC EST ER COL DEN ASH FORD INDIAN FALLS LAWTONS SAR DINIA RPD-037 -2 GLENWOOD PU LASKI PAVILION CON CORD COL LINS N ELM A ORC HARD PARK-H AMBU RG DANLEY CORNERS ST ILLWAT ER CHAFF EE-ARCAD E FAYETT E-WATERLOO LAKEVIEW JAVA SEN EC A W ELLER Y AU RORA E ZOAR BU FFALO TIOGA SILVER LAKE AKR ON ROM E RAT HBON E ALM A BET HANY WYOMING ULYSSES BR ANCH W SAN DY CREEK COL LINS BLOOMFIELD E LEBANON STATE LINE ALLEN CHUR CHVILLE BATH ATT ICA ELLI COT VILLE ROU LETT E BR ADFORD BU FFALO CREEK PEN N YAN N BEECH HILL-INDEPENDENC E GERRY-CH ARLOTTE STAGECOACH CHIPMUN K HEBRON VIN CENT BALD WI NSVILLE AKELEY OLEAN COWLESVILLE AN NIN SMET HPORT BR ADLEY BR OOK BU STI FIVE MILE BLOOMFIELD W SEN EC A FALLS NILE STAGECOACH LEWIS R UN BR ADFORD CAMDEN VAN ETT EN ROAN OKE SH ARON RICHBU RG FULTON N FINN EGAN H ILL TONAWANDA

78

Idaho National Laboratory DOE-NE's National Nuclear Capability-  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4-2023 4-2023 Idaho National Laboratory DOE-NE's National Nuclear Capability- Developing and Maintaining the INL Infrastructure TEN-YEAR SITE PLAN DOE/ID-11474 Final June 2012 Sustainable INL continues to exceed DOE goals for reduction in the use of petroleum fuels - running its entire bus fleet on biodiesel while converting 75% of its light-duty fleet to E85 fuel. The Energy Systems Laboratory (ESL), slated for completion this year, will be a state-of-the-art laboratory with high-bay lab space where leading bioenergy feedstock processing, advanced battery testing, and hybrid energy systems integration research will be conducted. The Advanced Test Reactor is the world's most advanced nuclear research capability - crucial to (1) the ongoing development of safe, efficient

79

NE-24 Unlverslty of Chicayo Remedial Action Plan  

Office of Legacy Management (LM)

(YJ 4 tlsj .?I2 (YJ 4 tlsj .?I2 416 17 1983 NE-24 Unlverslty of Chicayo Remedial Action Plan 22&d 7 IA +-- E. I.. Keller, Director Technical Services Division Oak Ridge Operations Ufflce In response to your memorandum dated July 29, 1983, the Field Task Proposal/Agreement (FTP/A) received frw Aryonne National Laboratory (ANL) appears to be satisfactory, and this office concurs in the use of ANL to provide the decontamination effort as noted in the FTP/A. The final decontaminatton report should Include the data needed for certiff- cation of the cleanup and any contamination left In place, e.g., sewer lines should be so documented in the permanent records of the University as well as the certification documents and reports. The remedial action to be conducted appears to be clearly InsIgnifIcant from an environmental

80

Microsoft PowerPoint - NEAC Battelle NE Capabilities 062408.ppt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R&D Facility Requirements NEAC Meeting Progress Report June 24, 2008 2 Facilitization of U.S. Nuclear R&D Infrastructure Three-step study process: * First, ASNE requested Battelle Memorial Institute to develop Industry- and-University-supported list of capabilities and facilities necessary to conduct a comprehensive nuclear R&D program. (Draft, June 12, 2008) * Second, INL, using input from all DOE and other sources, will determine current facilities and their condition and availability to support next 20 years of nuclear R&D. (Draft, June 30, 2008) * Third, recommendations will be made on priorities and on existing facilities to be maintained/preserved or otherwise supported by NE regardless of location or ownership. (Executive Team Meeting, July 1, 2008)

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Participants: William Naughton, COHMED Bill Sherman, NE HLRW Task Force  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

conference call May 27, 1998 conference call May 27, 1998 Participants: William Naughton, COHMED Bill Sherman, NE HLRW Task Force Bob Fronczak, AAR Mike Butler, UETC Ray English, DOE-NR George Ruberg, UETC Kevin Blackwell, FRA Markus Popa, DOE-RW Sandy Covi, UP The Rail Topic Group is currently in a transitional mode, moving simultaneously toward closure of the two rail information matrices, Comparison of CVSA Recommended National Procedures and Out-Of-Service Criteria for the Enhanced Safety Inspection of Commercial Highway Vehicles Transporting Transuranics, Spent Nuclear Fuel, and High Level Waste to Rail Inspection Standards, and Rail and Highway Regulations Relative to the Transportation of Radioactive Materials and their Applicability to States, Tribes, Shippers, and Carriers, (both

82

EG&G SURVEY REPORT NE-F-003  

Office of Legacy Management (LM)

EBJG EBJG -ENERGY MEASUREMENTS GROUP EG&G SURVEY REPORT NE-F-003 FEBRUARY 1983 NJT& THE REMOTE SENSING lRtlORlllORY OF THE UNITED STATES DEPARTMENT OF ENERGY AN AERIAL RADIOLOGICAL SURVEY OF AN AREA SURROUNDING THE FORMER M IDDLESEX SAMPLING PLANT IN M IDDLESEX, N E W JERSEY DATE OF SURVEY: M A Y 1978 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or

83

PNM Resources 2401 Aztec NE, MS-Z100  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PNM Resources PNM Resources 2401 Aztec NE, MS-Z100 Albuquerque, NM 87107 505-241-2025 Fax 505 241-2384 PNMResources.com October 29, 2013 Mr. Christopher Lawrence Office of Electricity Delivery and Energy Reliability (OE-20) U.S. Department of Energy 1000 Independence Avenue, SW Washington, DC 20585 Submitted electronically via email to: Christopher.Lawrence@hq.doe.gov Dear Mr. Lawrence: Subject: Department of Energy (DOE)- Improving Performance of Federal Permitting and Review of Infrastructure Projects, Request for Information, 78 Fed. Reg. 53436 (Aug. 29, 2013) PNM Resources (PNMR) is an energy holding company with 2012 consolidated operating revenues of $1.3 billion. Through its regulated utilities, PNM and TNMP, PNMR serves electricity to more than 739,000 homes and businesses in New

84

CA M r. Andrew Wallo, III. NE-23  

Office of Legacy Management (LM)

i5W 95.5 L' i5W 95.5 L' E&nt plom. S. W.:. Washingr on. D.C. ZOOX2i74, Tekphm: (202) 488-6OGb 7II7-03.87.cdy.43 23 September 1987. Ii CA M r. Andrew Wallo, III. NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear M r. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES pqq.0' 05 PI ;p.03- The attached elimination recommendation was prepared in accordance ,I ML.05 with your suggestion during our meeting on 22 September. The recommendation flO.O-02 includes 26 colleges and universities identified in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated 27 May 1987; three institutions (Tufts College, University of Virginia, and the University of Washington) currently identified on the FUSRAP

85

The DA{Phi}NE beam position monitors  

SciTech Connect

The beam diagnostics network of DA{Phi}NE, the Frascati {Phi}-factory, includes more than 110 beam position monitors divided between button monitors and striplines. The shape of the vacuum chamber changes along the accelerator implying several different geometries for these monitors. Moreover, in the two interaction regions of the collider where the electron and positron beams pass into the same chamber, a six-button configuration has been used. A bench calibration of each family of BPMs and striplines is being performed. A polynomial correction function has been derived by fitting the calibration results. An analytical-numerical analysis of the buttons` geometry has been done in order to compare the experimental with the theoretical results. {copyright} {ital 1997 American Institute of Physics.}

Ghigo, A.; Sannibale, F.; Serio, M.; Vaccarezza, C. [INFN Laboratori Nazionali di Frascati-00044 Frascati (Roma)-Italy

1997-01-01T23:59:59.000Z

86

Charged-Current Interaction Measurements in MiniBooNE  

SciTech Connect

Neutrino oscillation is the only known phenomenon for physics beyond the standard model. To investigate this phenomenon, the understanding of low energy neutrino scattering (200NE finds that a simple Fermi gas model, with appropriate adjustments, accurately characterizes the CCQE events on carbon. The extracted parameters include an effective axial mass, MA=1.23 {+-} 0.20 GeV, and a Pauli-blocking parameter, kappa = 1.019 {+-} 0.011.

Katori, Teppei; /Indiana U.

2007-09-01T23:59:59.000Z

87

STAR FORMATION ACTIVITY IN THE GALACTIC H II REGION Sh2-297  

SciTech Connect

We present a multiwavelength study of the Galactic H II region Sh2-297, located in the Canis Major OB1 complex. Optical spectroscopic observations are used to constrain the spectral type of ionizing star HD 53623 as B0V. The classical nature of this H II region is affirmed by the low values of electron density and emission measure, which are calculated to be 756 cm{sup -3} and 9.15 Multiplication-Sign 10{sup 5} cm{sup -6} pc using the radio continuum observations at 610 and 1280 MHz, and Very Large Array archival data at 1420 MHz. To understand local star formation, we identified the young stellar object (YSO) candidates in a region of area {approx}7.'5 Multiplication-Sign 7.'5 centered on Sh2-297 using grism slitless spectroscopy (to identify the H{alpha} emission line stars), and near infrared (NIR) observations. NIR YSO candidates are further classified into various evolutionary stages using color-color and color-magnitude (CM) diagrams, giving 50 red sources (H - K > 0.6) and 26 Class II-like sources. The mass and age range of the YSOs are estimated to be {approx}0.1-2 M {sub Sun} and 0.5-2 Myr using optical (V/V-I) and NIR (J/J-H) CM diagrams. The mean age of the YSOs is found to be {approx}1 Myr, which is of the order of dynamical age of 1.07 Myr of the H II region. Using the estimated range of visual extinction (1.1-25 mag) from literature and NIR data for the region, spectral energy distribution models have been implemented for selected YSOs which show masses and ages to be consistent with estimated values. The spatial distribution of YSOs shows an evolutionary sequence, suggesting triggered star formation in the region. The star formation seems to have propagated from the ionizing star toward the cold dark cloud LDN1657A located west of Sh2-297.

Mallick, K. K.; Ojha, D. K.; Dewangan, L. K. [Department of Astronomy and Astrophysics, Tata Institute of Fundamental Research, Homi Bhabha Road, Colaba, Mumbai (Bombay) 400005 (India); Samal, M. R. [Laboratoire d'Astrophysique de Marseille (UMR 6110 CNRS and Universite de Provence), 38 rue F. Joliot-Curie, F-13388 Marseille Cedex 13 (France); Pandey, A. K. [Aryabhatta Research Institute of Observational Sciences, Manora Peak, Nainital 263129 (India); Bhatt, B. C. [Indian Institute of Astrophysics, Koramangala, Bangalore 560034 (India); Ghosh, S. K. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune 411007 (India); Tamura, M., E-mail: kshitiz@tifr.res.in [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan)

2012-11-01T23:59:59.000Z

88

EA-1909: South Table Wind Project, Kimball County, NE | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

09: South Table Wind Project, Kimball County, NE 09: South Table Wind Project, Kimball County, NE EA-1909: South Table Wind Project, Kimball County, NE Summary DOE's Western Area Power Administration is preparing this EA to evaluate the environmental impacts of interconnecting the proposed South Table Wind Project, which would generate approximately 60 megawatts from about 40 turbines, to Western's existing Archer-Sidney 115-kV Transmission Line in Kimball County, Nebraska. Public Comment Opportunities None available at this time. Documents Available for Download August 28, 2012 EA-1909: Finding of No Significant Impact South Table Wind Project, Kimball County, NE July 16, 2012 EA-1909: Final Environmental Assessment South Table Wind Project, Kimball County, NE February 29, 2012 EA-1909: Draft Environmental Assessment

89

WAT TENBERG SPIN DLE EAT ON BONN Y GREELEY ROGGEN WAVERLY SH  

U.S. Energy Information Administration (EIA) Indexed Site

BOE Reserve Class BOE Reserve Class No 2001 reserves 0.1 - 10 MBOE 10.1 - 100 MBOE 100.1 - 1,000 MBOE 1,000.1 - 10,000 MBOE 10,000.1 - 100,000 MBOE > 100,000 MBOE Denver Basin Outline 0 20 40 10 30 Miles ± CO 2001 Reserve Summary for All Denver Basin Fields KS NE CO NE WY KS SD Index Map For 3 Denver Basin Panels The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and

90

WAT TENBERG SPIN DLE EAT ON BONN Y GREELEY ROGGEN WAVERLY SH  

U.S. Energy Information Administration (EIA) Indexed Site

Gas Reserve Class Gas Reserve Class No 2001 gas reserves 0.1 - 10 MMCF 10.1 - 100 MMCF 100.1 - 1,000 MMCF 1,000.1 - 10,000 MMCF 10,000.1 - 100,000 MMCF > 100,000 MMCF Denver Basin Outline 0 20 40 10 30 Miles ± CO 2001 Reserve Summary for All Denver Basin Fields KS NE CO NE WY KS SD 1 3 2 Index Map For 3 Denver Basin Panels The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and

91

The MiniBooNE detector technical design report  

SciTech Connect

The MiniBooNE experiment [1] is motivated by the LSND observation, [2] which has been interpreted as {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, and by the atmospheric neutrino deficit, [3,4,5] which may be ascribed to {nu}{sub {mu}} oscillations into another type of neutrino. MiniBooNE is a single-detector experiment designed to: obtain {approx} 1000 {nu}{sub {mu}} {yields} {nu}{sub e} events if the LSND signal is due to {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, establishing the oscillation signal at the > 5{sigma} level as shown in Fig. 1.1; extend the search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations significantly beyond what has been studied previously if no signal is observed; search for {nu}{sub {mu}} disappearance to address the atmospheric neutrino deficit with a signal that is a suppression of the rate of {nu}{sub {mu}}C {yields} {mu}N events from the expected 600,000 per year; measure the oscillation parameters as shown in Fig. 1.2 if oscillations are observed; and test CP conservation in the lepton sector if oscillations are observed by running with separate {nu}{sub {mu}} and {bar {nu}}{sub {mu}} beams. The detector will consist of a spherical tank 6.1 m (20 feet) in radius, as shown in Fig. 1.3, that stands in a 45-foot diameter cylindrical vault. An inner tank structure at 5.75 m radius will support 1280 8-inch phototubes (10% coverage) pointed inward and optically isolated from the outer region of the tank. The tank will be filled with 807 t of mineral oil, resulting in a 445 t fiducial volume. The outer tank volume will serve as a veto shield for identifying particles both entering and leaving the detector with 240 phototubes mounted on the tank wall. Above the detector tank will be an electronics enclosure that houses the fast electronics and data acquisition system and a utilities enclosure that houses the plumbing, overflow tank, and calibration laser. The detector will be located {approx} 550 m from the Booster neutrino source. The neutrino beam, produced using 8 GeV protons from the Booster at FNAL, will consist of a target within a focusing system, followed by a {approx}50 m long pion decay volume. The low energy, high intensity and 1 {micro}s time-structure of a neutrino beam produced from the Booster beam are ideal for this experiment. We assume that the Booster can reliably deliver protons for a typical run which is two-thirds of a calendar year. The sensitivities discussed above assume the experiment receives 5 x 10{sup 20} protons per year. This Booster experiment is compatible with the Fermilab collider and MI programs. The Booster must run at 7.5 Hz to accommodate the MiniBooNE and collider programs simultaneously. The current schedule calls for data-taking to begin by the end of calendar year 2001.

I. Stancu et al.

2003-04-18T23:59:59.000Z

92

{sup 17}O({alpha},{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne for the weak s process  

Science Conference Proceedings (OSTI)

The ratio of the reaction rates of the competing channels {sup 17}O({alpha}{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne determines the efficiency of {sup 16}O as a neutron poison in the s process in low metallicity rotating stars. It has a large impact on the element production, either producing elements to the mass range of A=90 in case of a significant poisoning effect or extending the mass range up to the region of A=150 if the {gamma} channel is of negligible strength. We present an improved study of the reaction {sup 17}O({alpha},n){sup 20}Ne, including an independent measurement of the {sup 17}O({alpha},n{sub 1}){sup 20}Ne channel. A simultaneous R-Matrix fit to both the n{sub 0} and the n{sub 1} channels has been performed. New reaction rates, including recent data on the {sup 17}O({alpha},{gamma}){sup 21}Ne reaction, have been calculated and used as input for stellar network calculations and their impact on the s process in rotating massive stars is discussed.

Best, A.; Goerres, J.; Beard, M.; Couder, M.; Boer, R. de; Falahat, S.; Gueray, R. T.; Kontos, A.; Kratz, K.-L.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Oezkan, N.; Pignatari, M.; Sonnabend, K.; Talwar, R.; Tan, W.; Uberseder, E.; Wiescher, M. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States) and Department for Biogeochemistry, Max-Planck-Institute for Chemistry, 55020 Mainz (Germany); Department of Physics, Kacaeli University, Umuttepe 41380, Kocaeli (Turkey); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department for Biogeochemistry, Max-Planck-Institute for Chemistry, 55020 Mainz (Germany); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department of Physics, Kacaeli University, Umuttepe 41380, Kocaeli (Turkey); Department of Physics, University of Basel, Basel 4056 (Switzerland); Institute for Applied Physics, Goethe-University Frankfurt, 60325 Frankfurt (Germany); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States)

2012-11-20T23:59:59.000Z

93

Level-resolved R-matrix calculations for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}  

SciTech Connect

Large-scale R-matrix calculations are carried out for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}. For Ne{sup 3+}, a 581-LSJ-level R-matrix intermediate coupling frame transformation calculation is made for excitations up to the n=4 shell. For some transitions, large effective collision strength differences are found with current 23-jKJ-level Breit-Pauli R-matrix and earlier 22-LSJ-level R-matrix jj omega (JAJOM) calculations. For Ne{sup 6+}, a 171-jKJ-level Breit-Pauli R-matrix calculation is made for excitations up to the n=5 shell. For some transitions, large effective collision strength differences are found with current 46-jKJ-level Breit-Pauli R-matrix and earlier 46-LSJ-level R-matrix JAJOM calculations. Together with existing R-matrix calculations for other ion stages, high-quality excitation data are now available for astrophysical and laboratory plasma modeling along the entire Ne isonuclear sequence.

Ludlow, J. A.; Lee, T. G.; Ballance, C. P.; Loch, S. D.; Pindzola, M. S. [Department of Physics, Auburn University, Auburn, Alabama 36849 (United States)

2011-08-15T23:59:59.000Z

94

CA CAIOlf Mr. Andrew Wallo. III, NE-23  

Office of Legacy Management (LM)

kire 7900. 955 L*E,,fa,u PLUG S. W.. Washin@ on. D.C. 20024-2174, Tekphme: (202) 488-6000 kire 7900. 955 L*E,,fa,u PLUG S. W.. Washin@ on. D.C. 20024-2174, Tekphme: (202) 488-6000 7117-03.87.cdy.43 23 September 1987 CA CAIOlf Mr. Andrew Wallo. III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 CT.05 FL .0-o/ lti.Ob id.Or Dear Mr. Wallo: In/. O-01 flA.05 ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES Mbj.o-03 I4 v.o+ The attached elimination recommendation was prepared in accordance ML.o= with your suggestion during our meeting on 22 September. The recommendation nO.O-02 includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated N0.63' 27 May 1987; three institutions (Tufts College, University of Virginia, kfC900

95

STATEM!NT''OF CONSIDEAAT10NS REQUEST n:~!:)lHi/",!!,'fCORPORArIQN FO~ ANADVANClWA1VER OF DOMESTIC AND FOREIGN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STATEM!NT''OF CONSIDEAAT10NS STATEM!NT''OF CONSIDEAAT10NS REQUEST n:~!:)lHi/",!!,'fCORPORArIQN FO~ ANADVANClWA1VER OF DOMESTIC AND FOREIGN DOE PROPOSAL NO.OE-EE0000412 W(A} 2009-:060 The OhlipC1'!ve of this project Is the and comt'nercialization of a two-phase soluttofrfQf USe with The 1 lM,C'l_""""P H'tn(;lPI'" PJJ1'l.nn""". refrig1':'rant tooling solution provides certain improvements compared to conventional air-<:ooling syslems and water-cooling systems, The totalantfetpated cost the is $901,678 with the Petitl(};l)er approximately 19.% cost sm:tre, $262,191. Thiswaive(is contingent upo.n the Petitioner rrH~intaining the foregoing cost over tneCQUfse the grant As in its wai'\l\;f petition, the ~etitfoner isa leading global supplier of air conditioning and

96

A Case Study For Geothermal Exploration In The Ne German Basin- Integrated  

Open Energy Info (EERE)

Geothermal Exploration In The Ne German Basin- Integrated Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And Thermal Structure Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Proceedings: A Case Study For Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And Thermal Structure Details Activities (0) Areas (0) Regions (0) Abstract: Unavailable Author(s): K. Bauer, I. Moeck, B. Norden, A. Schulze, M. H. Weber Published: Publisher Unknown, 2009 Document Number: Unavailable DOI: Unavailable Retrieved from "http://en.openei.org/w/index.php?title=A_Case_Study_For_Geothermal_Exploration_In_The_Ne_German_Basin-_Integrated_Interpretation_Of_Seismic_Tomography,_Litho-Stratigraphy,_Salt_Tectonics,_And_Thermal_Structure&oldid=390106"

97

EcoCAR: The NeXt Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge May 18, 2010 - 7:30am Addthis While most college students' experience with vehicles goes no further than the beater they picked up for a few thousand dollars, students participating in the EcoCAR: The NeXT Challenge competition get to experience the cutting-edge of driving technology. The competition, which was established by the U.S. Department of Energy and General Motors, is a three year advanced vehicle engineering contest. Yesterday, May 17, was the first day of their Year 2 judging sessions. In EcoCAR, students from 16 universities across North America are competing against each other to build the most environmentally sustainable and practical vehicle. This year's teams have adopted a number of advanced

98

Crystal Structures of the S. cerevisiae Spt6 Core and C-terminal Tandem SH2 Domain  

SciTech Connect

The conserved and essential eukaryotic protein Spt6 functions in transcription elongation, chromatin maintenance, and RNA processing. Spt6 has three characterized functions. It is a histone chaperone capable of reassembling nucleosomes, a central component of transcription elongation complexes, and is required for recruitment of RNA processing factors to elongating RNA polymerase II (RNAPII). Here, we report multiple crystal structures of the 168-kDa Spt6 protein from Saccharomyces cerevisiae that together represent essentially all of the ordered sequence. Our two structures of the {approx} 900-residue core region reveal a series of putative nucleic acid and protein-protein interaction domains that fold into an elongated form that resembles the bacterial protein Tex. The similarity to a bacterial transcription factor suggests that the core domain performs nucleosome-independent activities, and as with Tex, we find that Spt6 binds DNA. Unlike Tex, however, the Spt6 S1 domain does not contribute to this activity. Crystal structures of the Spt6 C-terminal region reveal a tandem SH2 domain structure composed of two closely associated SH2 folds. One of these SH2 folds is cryptic, while the other shares striking structural similarity with metazoan SH2 domains and possesses structural features associated with the ability to bind phosphorylated substrates including phosphotyrosine. Binding studies with phosphopeptides that mimic the RNAPII C-terminal domain revealed affinities typical of other RNAPII C-terminal domain-binding proteins but did not indicate a specific interaction. Overall, these findings provide a structural foundation for understanding how Spt6 encodes several distinct functions within a single polypeptide chain.

D Close; S Johnson; M Sdano; S McDonald; H Robinson; T Formosa; C Hill

2011-12-31T23:59:59.000Z

99

Crystal Structures of the S. cerevisiae Spt6 Core and C-Terminal Tandem SH2 Domain  

Science Conference Proceedings (OSTI)

The conserved and essential eukaryotic protein Spt6 functions in transcription elongation, chromatin maintenance, and RNA processing. Spt6 has three characterized functions. It is a histone chaperone capable of reassembling nucleosomes, a central component of transcription elongation complexes, and is required for recruitment of RNA processing factors to elongating RNA polymerase II (RNAPII). Here, we report multiple crystal structures of the 168-kDa Spt6 protein from Saccharomyces cerevisiae that together represent essentially all of the ordered sequence. Our two structures of the {approx} 900-residue core region reveal a series of putative nucleic acid and protein-protein interaction domains that fold into an elongated form that resembles the bacterial protein Tex. The similarity to a bacterial transcription factor suggests that the core domain performs nucleosome-independent activities, and as with Tex, we find that Spt6 binds DNA. Unlike Tex, however, the Spt6 S1 domain does not contribute to this activity. Crystal structures of the Spt6 C-terminal region reveal a tandem SH2 domain structure composed of two closely associated SH2 folds. One of these SH2 folds is cryptic, while the other shares striking structural similarity with metazoan SH2 domains and possesses structural features associated with the ability to bind phosphorylated substrates including phosphotyrosine. Binding studies with phosphopeptides that mimic the RNAPII C-terminal domain revealed affinities typical of other RNAPII C-terminal domain-binding proteins but did not indicate a specific interaction. Overall, these findings provide a structural foundation for understanding how Spt6 encodes several distinct functions within a single polypeptide chain.

Close, D.; Robinson, H.; Johnson, S. J.; Sdano, M. A.; McDonald, S. M.; Formosa, T.; Hill, C. P.

2011-05-13T23:59:59.000Z

100

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook  

U.S. Energy Information Administration (EIA)

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook for Winter Fuels Outlook Conference National Association of State Energy Officials (NASEO)

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Towards a study of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction at LUNA  

SciTech Connect

The {sup 22}Ne(p,{gamma}){sup 23}Na reaction is a part of the hydrogen burning NeNa cycle. In second-generation stars hydrogen burning may proceed via this cycle. The rate of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction depends on the strength of several resonances in the energy range of the LUNA 400 kV accelerator which have never been observed in direct experiments. A related study is under preparation at LUNA.

Cavanna, Francesca; Depalo, Rosanna; Menzel, Marie-Luise [Dipartimento di fisica, Universita di Genova, and INFN Sezione di Genova, Genova (Italy); Dipartimento di fisica, Universita di Padova, and INFN Sezione di Padova, Padova (Italy); Helmholtz Zentrum Dresden-Rossendorf, Dresden (Germany); Collaboration: LUNA Collaboration

2012-11-20T23:59:59.000Z

102

Analysis of ISO NE Balancing Requirements: Uncertainty-based Secure Ranges for ISO New England Dynamic Inerchange Adjustments  

SciTech Connect

The document describes detailed uncertainty quantification (UQ) methodology developed by PNNL to estimate secure ranges of potential dynamic intra-hour interchange adjustments in the ISO-NE system and provides description of the dynamic interchange adjustment (DINA) tool developed under the same contract. The overall system ramping up and down capability, spinning reserve requirements, interchange schedules, load variations and uncertainties from various sources that are relevant to the ISO-NE system are incorporated into the methodology and the tool. The DINA tool has been tested by PNNL and ISO-NE staff engineers using ISO-NE data.

Etingov, Pavel V.; Makarov, Yuri V.; Wu, Di; Hou, Zhangshuan; Sun, Yannan; Maslennikov, S.; Luo, X.; Zheng, T.; George, S.; Knowland, T.; Litvinov, E.; Weaver, S.; Sanchez, E.

2013-01-31T23:59:59.000Z

103

Microsoft PowerPoint - Freeze.NE PA Overview_052511.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Used Fuel Disposition Campaign Used Fuel Disposition Campaign Summary of DOE-NE PA Modeling for Storage and Disposal of Used Nuclear Fuel (UNF), High-Level Radioactive Waste (HLW), and Low-Level Waste (LLW) Geoff Freeze Sandia National Laboratories PA Community of Practice Technical Exchange May 25-26, 2011 Print Close Used Fuel Disposition 2 DOE-Nuclear Energy (NE) - PA Modeling Activities NE Advanced Modeling and Simulation (NEAMS) Waste Integrated Performance and Safety Codes (Waste IPSC) Used Fuel Disposition (UFD) Generic Performance Assessment Model (GPAM) *** Initial modeling focus in both campaigns in on UNF/HLW disposal Print Close Used Fuel Disposition 3  UFD GPAM  Short time horizon (2-3 yrs) - Simplified generic system models (i.e., PA-fidelity using GoldSim) - Current computing capabilities

104

Skåne County, Sweden: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Skåne County, Sweden: Energy Resources Skåne County, Sweden: Energy Resources Jump to: navigation, search Name Skåne County, Sweden Equivalent URI DBpedia GeoNames ID 3337385 Coordinates 55.98333°, 13.5° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.98333,"lon":13.5,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

105

DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE-NE Light Water Reactor Sustainability Program and EPRI DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's

106

DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE-NE Light Water Reactor Sustainability Program and EPRI DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's

107

ARM - Field Campaign - 1996 NARSTO Northeast Field Study (NARSTO-NE)  

NLE Websites -- All DOE Office Websites (Extended Search)

6 NARSTO Northeast Field Study (NARSTO-NE) 6 NARSTO Northeast Field Study (NARSTO-NE) Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : 1996 NARSTO Northeast Field Study (NARSTO-NE) 1996.07.01 - 1996.07.28 Lead Scientist : Larry Kleinman For data sets, see below. Description The DOE G-1 aircraft was deployed in the New York City metropolitan area as part of the North American Research Strategy for Tropospheric Ozone-Northeast effort to determine the causes of elevated ozone levels in the northeastern United States. Measurements of ozone, ozone precursors, and other photochemically active trace gases were made upwind and downwind of New York City with the objective of characterizing the ozone formation process and its dependence on ambient levels of NOx and volatile organic

108

Charged-Current Neutral Pion production at SciBooNE  

SciTech Connect

SciBooNE, located in the Booster Neutrino Beam at Fermilab, collected data from June 2007 to August 2008 to accurately measure muon neutrino and anti-neutrino cross sections on carbon below 1 GeV neutrino energy. SciBooNE is studying charged current interactions. Among them, neutral pion production interactions will be the focus of this poster. The experimental signature of neutrino-induced neutral pion production is constituted by two electromagnetic cascades initiated by the conversion of the {pi}{sup 0} decay photons, with an additional muon in the final state for CC processes. In this poster, I will present how we reconstruct and select charged-current muon neutrino interactions producing {pi}{sup 0}'s in SciBooNE.

Catala-Perez, J.; /Valencia U., IFIC

2009-10-01T23:59:59.000Z

109

First Direct Measurement of the {sup 17}F(p,{gamma}){sup 18}Ne Cross Section  

SciTech Connect

The rate of the {sup 17}F(p,{gamma}){sup 18}Ne reaction is important in various astrophysical events. A previous {sup 17}F(p,p){sup 17}F measurement identified a 3{sup +} state providing the strongest resonance contribution, but the resonance strength was unknown. We have directly measured the {sup 17}F(p,{gamma}){sup 18}Ne reaction using a mixed beam of {sup 17}F and {sup 17}O at ORNL. The resonance strength for the 3{sup +} resonance in {sup 18}Ne was found to be {omega}{gamma}=33{+-}14(stat){+-}17(syst) meV, corresponding to a {gamma} width of {gamma}{sub {gamma}}=56{+-}24(stat){+-}30(syst) meV. An upper limit on the direct capture of S(E){<=}65 keV b was determined at an energy of 800 keV.

Chipps, K. A.; Greife, U. [Colorado School of Mines, Golden, Colorado 80401 (United States); Bardayan, D. W.; Smith, M. S. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Blackmon, J. C. [Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Chae, K. Y.; Moazen, B. H.; Pittman, S. T. [University of Tennessee, Knoxville, Tennessee 37996 (United States); Hatarik, R.; Peters, W. A. [Rutgers University, New Brunswick, New Jersey 08901 (United States); Kozub, R. L.; Shriner, J. F. Jr. [Tennessee Technological University, Cookeville, Tennessee 38505 (United States); Matei, C. [Oak Ridge Associated Universities, Oak Ridge, Tennessee 37830 (United States); Nesaraja, C. D.; Pain, S. D. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); University of Tennessee, Knoxville, Tennessee 37996 (United States)

2009-04-17T23:59:59.000Z

110

apsdpp07_ver1.eps  

NLE Websites -- All DOE Office Websites (Extended Search)

Diagnostics using a Visible Transmission Grating Spectrometer at the Alcator C-Mod Tokamak Diagnostics using a Visible Transmission Grating Spectrometer at the Alcator C-Mod Tokamak 1 A. Graf, 2 M. May, 2 P. Beiersdorfer and 3 D. Whyte, 3 B. Labombard, 3 N. Smick, 3 K. Marr 1 University of California at Davis, One Shields Ave., Davis, CA; 2 Lawrence Livermore National Laboratory, 7000 East Ave., Livermore, CA 3 Plasma Science and Fusion Center, Massachusetts Institute of Technology, 190 Albany Ave. Cambridge, MA Abstract UCRL-POST-203859 Spectrometer Views A high throughput, f/# ~3.5, transmission grating spectrometer for visible light (3450-6700 Å) is being used to make localized measurements of bulk flow velocities and temperatures of impurity ions and deuterium atoms, in the edge and scrape of layer of the Alcator C-Mod tokamak. The flows and temperatures of the

111

N NE EX XT T G GE EN NE ER RA AT TI IO ON N S SA AF FE EG  

NLE Websites -- All DOE Office Websites (Extended Search)

NE NE EX XT T G GE EN NE ER RA AT TI IO ON N S SA AF FE EG GU UA AR RD DS S I IN NI IT TI IA AT TI IV VE E ( (N NG GS SI I) ) O OP PP PO OR RT TU UN NI IT TI IE ES S F FO OR R S ST TU UD DE EN NT TS S A AN ND D Y YO OU UN NG G P PR RO OF FE ES SS SI IO ON NA AL LS S I IN NT TE ER RE ES ST TE ED D I IN N S SA AF FE EG GU UA AR RD DS S/ /N NO ON NP PR RO OL LI IF FE ER RA AT TI IO ON N The Next Generation Safeguards Initiative (NGSI) was launched by the National Nuclear Security Administration (NNSA) in FY 2008 to develop the policies, concepts, technologies, expertise, and infrastructure necessary to strengthen and sustain the international safeguards system as it evolves to meet new challenges over the next 25 years. NGSI's Human Capital Development subprogram 1 aims to revitalize and expand the international safeguards human capital base in the United States by attracting, educating, training, and retaining

112

MiniBooNE as related to Windows on the Universe  

SciTech Connect

The measurement of absolute neutrino and anti-neutrino cross-sections, the observation of a 'low energy anomaly' in the neutrino sector, the constraints placed on the LSND effect by a non-observation of neutrino oscillations, the search for neutrino and anti-neutrino appearance, and for the possible existence of new heavy particles makes MiniBooNE a major contributor to the current view of the Universe. This paper addresses specific model constraints set by the MiniBooNE data, and explores expectations for further remaining analysis of the data.

Stefanski, Ray; /Fermilab

2009-12-01T23:59:59.000Z

113

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY  

E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew

114

Charged current single pion cross section measurement at MiniBooNE  

SciTech Connect

We present MiniBooNE's preliminary {nu}{sub {mu}} CC1{pi}{sup +} cross section measurement, calculated using the ratio of CC1{pi}{sup +} to CCQE events. We find the inclusive CC1{pi}{sup +} measurement to be below the nuance [1] and NEUGEN [2] expectations.

Wascko, M.O.; /Louisiana State U.

2006-02-01T23:59:59.000Z

115

A generic network interface architecture for a networked processor array (NePA)  

Science Conference Proceedings (OSTI)

Recently Network-on-Chip (NoC) technique has been proposed as a promising solution for on-chip interconnection network. However, different interface specification of integrated components raises a considerable difficulty for adopting NoC techniques. ... Keywords: interconnection network, multiprocessor systemon-chip (MPSoC), network interface, network-on-chip (NoC), networked processor array (NePA)

Seung Eun Lee; Jun Ho Bahn; Yoon Seok Yang; Nader Bagherzadeh

2008-02-01T23:59:59.000Z

116

THERMALIZATION OF THE ION KINETIC ENERGY IN A Ne GAS PUFF PINCH MODEL*  

E-Print Network (OSTI)

THERMALIZATION OF THE ION KINETIC ENERGY IN A Ne GAS PUFF PINCH MODEL* J. L. Giuliani, J. W Department of Energy/NNSA, Washington DC USA Full understanding of the dynamics, population kinetics, and energy budget of a K-shell radiating Z-pinch remains a challenging problem in high energy density plasma

117

Km3NeT, a Deep Sea Challenge for Neutrino Astronomy  

Science Conference Proceedings (OSTI)

The groups presently pursuing neutrino telescope projects in the Mediterranean Sea; ANTARES, NEMO, and NESTOR, have formed the new KM3NeT consortium to study the construction of a cubic kilometre-scale neutrino telescope for the Northern hemisphere. ...

Ciro Bigongiari

2007-10-01T23:59:59.000Z

118

Nonuniformity of CBF response to NE-or ANG II-induced hypertension in rabbits  

SciTech Connect

The regional response of brain vasculature to moderate hypertension was investigated using two hypertensive drugs, norepinephrine (NE) and angiotensin II (ANG II), infused intravenously at low concentrations (increase in blood pressure 15-40 mmHg). Regional cerebral blood flow (rCBF) was measured in unanesthetized and anesthetized rabbits using the (/sup 14/C)ethanol saturation technique. (1) In both groups of animals, NE and ANG II induced regional differences in the flow changes as compared with controls, confirming a regional (or segmental) heterogeneity in the regulatory mechanisms to hypertension. (2) The responses to identical rises in blood pressure (BP) in most of the structures analyzed depended on the drug used. In the unanesthetized rabbits, the increase in vascular resistance induced by NE was greater than that induced by ANG II. (3) With the two drugs, there was no correlation between the flow changes in any of the structures considered and either the BP increase or the BP level in unanesthetized animals. However, these flow changes were correlated with the BP increase in anesthetized animals, although differences between the effects of NE and ANG II were again observed. This study suggests that cerebrovascular regulatory mechanisms in hypertension are probably more complex than a simple myogenic reaction. Their heterogeneity and their dependence both on the cause of hypertension and on the presence of anesthetics suggest the intervention of an integrating pathway.

Reynier-Rebuffel, A.M.; Aubineau, P.; Issertial, O.; Seylaz, J.

1987-07-01T23:59:59.000Z

119

NE-Rank: A Novel Graph-Based Keyphrase Extraction in Twitter  

Science Conference Proceedings (OSTI)

The massive growth of the micro-blogging service Twitter has shed the light on the challenging problem of summarizing a collection of large number of tweets. This paper attempts to extract topical key phrases that would represent topics in tweets. Due ... Keywords: Keyphrase Extraction, Graph-based Ranking, Hashtag, Twitter, PageRank, TextRank, NE-Rank

Abdelghani Bellaachia; Mohammed Al-Dhelaan

2012-12-01T23:59:59.000Z

120

Zwischenbericht zum DFG-Forschungsvorhaben NE 902/2-1 SCHR 570/6-1  

E-Print Network (OSTI)

.3 Anwendungsperspektiven. . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 4 Arbeits- und Ergebnisbericht 10 4.3 Wissenschaftliche Mitarbeiter/in Dipl.-Ing. Vera Ebbing Besch¨aftigungszeitraum: seit 1. Oktober 2006 1.4 Fachgebiet;Zwischenbericht zum DFG-Forschungsvorhaben NE 902/2-1 SCHR 570/6-1 10 4 Arbeits- und Ergebnisbericht Basierend auf

Neff, Patrizio

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Searches for New Physics at MiniBooNE: Sterile Neutrinos and Mixing Freedom  

SciTech Connect

The MiniBooNE experiment was designed to perform a search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations in a region of {Delta}m{sup 2} and sin{sup 2} 2{theta} very different from that allowed by standard, three-neutrino oscillations, as determined by solar and atmospheric neutrino experiments. This search was motivated by the LSND experimental observation of an excess of {bar {nu}}{sub e} events in a {bar {nu}}{sub {mu}} beam which was found compatible with two-neutrino oscillations at {Delta}m{sup 2} {approx} 1 eV{sup 2} and sin{sup 2} 2{theta} < 1%. If confirmed, such oscillation signature could be attributed to the existence of a light, mostly-sterile neutrino, containing small admixtures of weak neutrino eigenstates. In addition to a search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, MiniBooNE has also performed a search for {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations, which provides a test of the LSND two-neutrino oscillation interpretation that is independent of CP or CPT violation assumptions. This dissertation presents the MiniBooNE {nu}{sub {mu}} {yields} {nu}{sub e} and {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} analyses and results, with emphasis on the latter. While the neutrino search excludes the two-neutrino oscillation interpretation of LSND at 98% C.L., the antineutrino search shows an excess of events which is in agreement with the two-neutrino {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillation interpretation of LSND, and excludes the no oscillations hypothesis at 96% C.L. Even though the neutrino and antineutrino oscillation results from MiniBooNE disagree under the single sterile neutrino oscillation hypothesis, a simple extension to the model to include additional sterile neutrino states and the possibility of CP violation allows for differences between neutrino and antineutrino oscillation signatures. In view of that, the viability of oscillation models with one or two sterile neutrinos is investigated in global fits to MiniBooNE and LSND data, with and without constraints from other oscillation experiments with similar sensitivities to those models. A general search for new physics scenarios which would lead to effective non-unitarity of the standard 3 x 3 neutrino mixing matrix, or mixing freedom, is also performed using neutrino and antineutrino data available from MiniBooNE.

Karagiorgi, Georgia S.; /MIT

2010-07-01T23:59:59.000Z

122

Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

The Nuclear Energy Computational Fluid Dynamics Advanced Modeling and Simulation (NE-CAMS) system is being developed at the Idaho National Laboratory (INL) in collaboration with Bettis Laboratory, Sandia National Laboratory (SNL), Argonne National Laboratory (ANL), Utah State University (USU), and other interested parties with the objective of developing and implementing a comprehensive and readily accessible data and information management system for computational fluid dynamics (CFD) verification and validation (V&V) in support of nuclear energy systems design and safety analysis. The two key objectives of the NE-CAMS effort are to identify, collect, assess, store and maintain high resolution and high quality experimental data and related expert knowledge (metadata) for use in CFD V&V assessments specific to the nuclear energy field and to establish a working relationship with the U.S. Nuclear Regulatory Commission (NRC) to develop a CFD V&V database, including benchmark cases, that addresses and supports the associated NRC regulations and policies on the use of CFD analysis. In particular, the NE-CAMS system will support the Department of Energy Office of Nuclear Energy Advanced Modeling and Simulation (NEAMS) Program, which aims to develop and deploy advanced modeling and simulation methods and computational tools for reliable numerical simulation of nuclear reactor systems for design and safety analysis. Primary NE-CAMS Elements There are four primary elements of the NE-CAMS knowledge base designed to support computer modeling and simulation in the nuclear energy arena as listed below. Element 1. The database will contain experimental data that can be used for CFD validation that is relevant to nuclear reactor and plant processes, particularly those important to the nuclear industry and the NRC. Element 2. Qualification standards for data evaluation and classification will be incorporated and applied such that validation data sets will result in well-defined, well-characterized data. Element 3. Standards will be established for the design and operation of experiments for the generation of new validation data sets that are to be submitted to NE-CAMS that addresses the completeness and characterization of the dataset. Element 4. Standards will be developed for performing verification and validation (V&V) to establish confidence levels in CFD analyses of nuclear reactor processes; such processes will be acceptable and recognized by both CFD experts and the NRC.

Kimberlyn C. Mousseau

2011-10-01T23:59:59.000Z

123

QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ  

Gasoline and Diesel Fuel Update (EIA)

1 1 2 QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ ECTIO NS ENERGY INFORMA TION ADMINIST RATION May 1991 This publication may be purchased from the Superintendent of Documents, U.S. Government Printing Office. Purchasing in formation for this or other Energy Information Administration (EIA) publications may be obtained from the Government Printing Office or ElA's National Energy Information Center. Questions on energy statistics should be directed to the Center by mail, telephone, or telecommunications device for the hearing impaired. Addresses, telephone numbers, and hours are as follows: National Energy Information Center, El-231 Energy Information Administration Forrestal Building, Room 1F-048 Washington, DC 20585 (202) 586-8800 Telecommunications Device for the

124

ANL/NE-13/9 SHARP Assembly-Scale Multiphysics Demonstration  

NLE Websites -- All DOE Office Websites (Extended Search)

NE-13/9 NE-13/9 SHARP Assembly-Scale Multiphysics Demonstration Simulations Mathematics and Computation Division & Nuclear Engineering Division About Argonne National Laboratory Argonne is a U.S. Department of Energy laboratory managed by UChicago Argonne, LLC under contract DE-AC02-06CH11357. The Laboratory's main facility is outside Chicago, at 9700 South Cass Avenue, Argonne, Illinois 60439. For information about Argonne and its pioneering science and technology programs, see www.anl.gov. Availability of This Report This report is available, at no cost, at http://www.osti.gov/bridge. It is also available on paper to the U.S. Department of Energy and its contractors, for a processing fee, from: U.S. Department of Energy Office of Scientific and Technical Information

125

Ronald E. Gill (NE), Scoville, ID - Level I Curtis Roth (EM), Idaho  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

E. Gill (NE), E. Gill (NE), Scoville, ID - Level I Curtis Roth (EM), Idaho Falls, ID - Level I Jared T. Howerton (NNSA), Oak Ridge, TN - Level I Richard L. Person (NNSA), DOE HQ - Level I Phillip (Tony) A. Polk (EM), Aiken, SC (Savannah River) - Level IV Jane Powell-Dolan (LM), Cincinnati, OH - Level I Eric M. Thompson (NNSA), Oak Ridge, TN - Level II Congratulations to our newly certified FPDs! The Certification Review Board (CRB or 'the Board') convened on Friday, Sep- tember 24 to review certifi- cation candidates and dis- cuss several topics. The Department of Energy (DOE) met the FY2010 tar- gets for the Root Cause Analysis, Corrective Action Plan metrics 7 and 8, as fol- lows: DOE surpassed the target for Metric #7 (95% of pro-

126

DOE-NE-STD-1004-92; Root Cause Analysis Guidance Document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE-STD-1004-92 NE-STD-1004-92 DOE GUIDELINE ROOT CAUSE ANALYSIS GUIDANCE DOCUMENT February 1992 U.S. Department of Energy Office of Nuclear Energy Office of Nuclear Safety Policy and Standards Washington, D.C. 20585 ii ABSTRACT DOE Order 5000.3A, "Occurrence Reporting and Processing of Operations Information," investigation and reporting of occurrences (including the performance of root cause analysis) requires the and the selection, implementation, and follow-up of corrective actions. The level of effort expended should be based on the significance attached to the occurrence. Most off-normal occurrences need only a scaled- down effort while most emergency occurrences should be investigated using one or more of the formal analytical models. A discussion of methodologies, instructions, and worksheets in this document guides

127

File:USDA-CE-Production-GIFmaps-NE.pdf | Open Energy Information  

Open Energy Info (EERE)

NE.pdf NE.pdf Jump to: navigation, search File File history File usage Nebraska Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 278 KB, MIME type: application/pdf) Description Nebraska Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Nebraska External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:18, 27 December 2010 Thumbnail for version as of 16:18, 27 December 2010 1,650 × 1,275 (278 KB) MapBot (Talk | contribs) Automated bot upload

128

NE-23 Disposal of Offsite-Generated Defense Radioactive Waste, Ventron  

Office of Legacy Management (LM)

pi/L +3 pi/L +3 *3L 52. NE-23 Disposal of Offsite-Generated Defense Radioactive Waste, Ventron FUSRAP Site Jill E. Lytle, DP-12 NE-23 The Office of Remedial Action and Waste Technology has received a request from the Technical Services Division, DOE-Oak Ridge Operations Office, for a determination of the appropriate disposal location for the material which will result from remedial action of the Ventron site in Beverly, Massachusetts. The Ventron site was used from 1942 to 1948 under contract to the ME0 and AEC for converting uranium oxide to uranium metal powder, as well as later operations involving recovery of uranium from scrap uranium and turnings from the fuel fabrication plant at Hanford, Washington. Full-scale remedial action, anticipated to result in approximately 5,000

129

Neutron Transfer Studied with a Radioactive beam of 24Ne, using TIARA at SPIRAL  

E-Print Network (OSTI)

A general experimental technique for high resolution studies of nucleon transfer reactions using radioactive beams is briefly described, together with the first new physics results that have been obtained with the new TIARA array. These first results from TIARA are for the reaction 24Ne(d,p)25Ne, studied in inverse kinematics with a pure radioactive beam of 100,000 pps from the SPIRAL facility at GANIL. The reaction probes the energies of neutron orbitals relevant to very neutron rich nuclei in this mass region and the results highlight the emergence of the N=16 magic number for neutrons and the associated disappearance of the N=20 neutron magic number for the very neutron rich neon isotopes.

W. N. Catford; C. N. Timis; R. C. Lemmon; M. Labiche; N. A. Orr; L. Caballero; R. Chapman; M. Chartier; M. Rejmund; H. Savajols; for the TIARA Collaboration

2009-12-20T23:59:59.000Z

130

A combined muon-neutrino and electron-neutrino oscillation search at MiniBooNE  

SciTech Connect

MiniBooNE seeks to corroborate or refute the unconfirmed oscillation result from the LSND experiment. If correct, the result implies that a new kind of massive neutrino, with no weak interactions, participates in neutrino oscillations. MiniBooNE searches for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations with the Fermi National Accelerator Laboratory 8 GeV beam line, which produces a {nu}{sub {mu}} beam with an average energy of {approx} 0.8 GeV and an intrinsic {nu}{sub e} content of 0.4%. The neutrino detector is a 6.1 m radius sphere filled with CH{sub 2}, viewed by 1540 photo-multiplier tubes, and located 541 m downstream from the source. This work focuses on the estimation of systematic errors associated with the neutrino flux and neutrino interaction cross section predictions, and in particular, on constraining these uncertainties using in-situ MiniBooNE {nu}{sub {mu}} charged current quasielastic (CCQE) scattering data. A data set with {approx} 100,000 events is identified, with 91% CCQE purity. This data set is used to measure several parameters of the CCQE cross section: the axial mass, the Fermi momentum, the binding energy, and the functional dependence of the axial form factor on four-momentum transfer squared. Constraints on the {nu}{sub {mu}} and {nu}{sub e} fluxes are derived using the {nu}{sub {mu}} CCQE data set. A Monte Carlo study of a combined {nu}{sub {mu}} disappearance and {nu}{sub e} appearance oscillation fit is presented, which improves the {nu}{sub {mu}} {yields} {nu}{sub e} oscillation sensitivity of MiniBooNE with respect to a {nu}{sub e} appearance-only fit by 1.2-1.5{sigma}, depending on the value of {Delta}m{sup 2}.

Monroe, Jocelyn R.; /Columbia U.

2006-07-01T23:59:59.000Z

131

Constraints on electromagnetic properties of sterile neutrinos from MiniBooNE results  

E-Print Network (OSTI)

Among the class of models with small mixing angles between sterile and active neutrinos, we place constraints on the effective muon-to-sterile neutrino magnetic and electric dipole transition moments from the combined MiniBooNE results for the sterile neutrino mass range of $10\\;\\mathrm{MeV}distribution as a function of polar angle. However, good agreement with the anomalous event distribution in reconstructed energy can be achieved for some values of magnetic and electric moments.

Alexander Radionov

2013-03-19T23:59:59.000Z

132

Collapse and expansion in the bright-rimmed cloud SFO 11NE  

E-Print Network (OSTI)

We report the results of a search for the double-peaked blue-skewed infall signature in the bright-rimmed cloud core SFO 11NE SMM1. Observations of the optically thick HCO$^{+}$ and optically thin H$^{13}$CO$^{+}$ J=3--2 lines reveal that there is indeed a characteristic double-peaked line profile, but skewed to the red rather than the blue. Modelling of the dust continuum emission and line profiles show that the motions within SFO 11NE SMM1 are consistent with a collapsing central core surrounded by an expanding outer envelope. We show that the collapse is occurring at a similar rate to that expected onto a single solar-mass protostar and is unlikely to represent the large-scale collapse of gas onto the infrared cluster seen at the heart of SFO 11NE SMM1. The outer envelope is expanding at a much greater rate than that expected for a photoevaporated flow from the cloud surface. The modelled expansion is consistent with the bulk cloud re-expansion phase predicted by radiative-driven implosion models of cometary clouds.

M. A Thompson; G. J. White

2004-02-24T23:59:59.000Z

133

The Sound Emission Board of the KM3NeT Acoustic Positioning System  

E-Print Network (OSTI)

We describe the sound emission board proposed for installation in the acoustic positioning system of the future KM3NeT underwater neutrino telescope. The KM3NeT European consortium aims to build a multi-cubic kilometre underwater neutrino telescope in the deep Mediterranean Sea. In this kind of telescope the mechanical structures holding the optical sensors, which detect the Cherenkov radiation produced by muons emanating from neutrino interactions, are not completely rigid and can move up to dozens of meters in undersea currents. Knowledge of the position of the optical sensors to an accuracy of about 10 cm is needed for adequate muon track reconstruction. A positioning system based on the acoustic triangulation of sound transit time differences between fixed seabed emitters and receiving hydrophones attached to the kilometre-scale vertical flexible structures carrying the optical sensors is being developed. In this paper, we describe the sound emission board developed in the framework of KM3NeT project, whi...

Llorens, C D; Sogorb, T; Bou--Cabo, M; Martnez-Mora, J A; Larosa, G; Adrin-Martnez, S

2012-01-01T23:59:59.000Z

134

Benthic biological and biogeochemical patterns and processes across an oxygen minimum zone (Pakistan margin, NE Arabian Sea)  

E-Print Network (OSTI)

(Pakistan margin, NE Arabian Sea) Gregory L. Cowie a,?, Lisa A. Levin b a The Sir John Murray Laboratories), and organic matter (OM) availability on benthic communities and processes across the Pakistan Margin

Levin, Lisa

135

Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

NE-KAMS knowledge base will assist computational analysts, physics model developers, experimentalists, nuclear reactor designers, and federal regulators by: (1) Establishing accepted standards, requirements and best practices for V&V and UQ of computational models and simulations, (2) Establishing accepted standards and procedures for qualifying and classifying experimental and numerical benchmark data, (3) Providing readily accessible databases for nuclear energy related experimental and numerical benchmark data that can be used in V&V assessments and computational methods development, (4) Providing a searchable knowledge base of information, documents and data on V&V and UQ, and (5) Providing web-enabled applications, tools and utilities for V&V and UQ activities, data assessment and processing, and information and data searches. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the Consortium for Advanced Simulation of Light Water Reactors (CASL), the Nuclear Energy Advanced Modeling and Simulation (NEAMS), the Light Water Reactor Sustainability (LWRS), the Small Modular Reactors (SMR), and the Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve computational modeling and simulation (M&S) of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs. In addition, from the outset, NE-KAMS will support the use of computational M&S in the nuclear industry by developing guidelines and recommended practices aimed at quantifying the uncertainty and assessing the applicability of existing analysis models and methods. The NE-KAMS effort will initially focus on supporting the use of computational fluid dynamics (CFD) and thermal hydraulics (T/H) analysis for M&S of nuclear reactor systems, components and processes, and will later expand to include materials, fuel system performance and other areas of M&S as time and funding allow.

Rich Johnson; Kimberlyn C. Mousseau; Hyung Lee

2011-09-01T23:59:59.000Z

136

Triggered massive-star formation on the borders of Galactic HII regions. III. Star formation at the periphery of Sh2-219  

E-Print Network (OSTI)

Context. Massive-star formation triggered by the expansion of HII regions. Aims. To understand if sequential star formation is taking place at the periphery of the HII region Sh2-219. Methods. We present 12CO(2-1) line observations of this region, obtained at the IRAM 30-m telescope (Pico Veleta, Spain). Results. In the optical, Sh2-219 is spherically symmetric around its exciting star; furthermore it is surrounded along three quarters of its periphery by a ring of atomic hydrogen. This spherical symmetry breaks down at infrared and millimetre wavelengths. A molecular cloud of about 2000\\msol lies at the southwestern border of Sh2-219, in the HI gap. Two molecular condensations, elongated along the ionization front, probably result from the interaction between the expanding HII region and the molecular cloud. In this region of interaction there lies a cluster containing many highly reddened stars, as well as a massive star exciting an ultracompact HII region. More surprisingly, the brightest parts of the molecular cloud form a `chimney', perpendicular to the ionization front. This chimney is closed at its south-west extremity by H-alpha walls, thus forming a cavity. The whole structure is 7.5 pc long. A luminous H-alpha emission-line star, lying at one end of the chimney near the ionization front, may be responsible for this structure. Confrontation of the observations with models of HII region evolution shows that Sh2-219 is probably 10^5 yr old. The age and origin of the near-IR cluster observed on the border of Sh2-219 remain unknown.

L. Deharveng; B. Lefloch; F. Massi; J. Brand; S. Kurtz; A. Zavagno; J. Caplan

2006-08-22T23:59:59.000Z

137

Astrophysically Important 19Ne States Studied with the 2H(18F,alpha+15O)n Reaction  

Science Conference Proceedings (OSTI)

The nuclear structure of {sup 19}Ne near the proton threshold is of interest for understanding the rates of proton-induced reactions on {sup 18}F in novae. Analogues for several states in the mirror nucleus {sup 19}F have not yet been identified in {sup 19}Ne indicating the level structure of {sup 19}Ne in this region is incomplete. The {sup 18}F(d;n){sup 19}Ne and {sup 18}F(d,p){sup 19}F reactions have been measured simultaneously at E{sub c.m.} = 14.9 MeV. The experiments were performed at the Holifield Radioactive Ion Beam Facility (HRIBF) of Oak Ridge National Laboratory (ORNL) by bombarding a 720-mg/cm{sub 2} CD{sub 2} target with a radioactive {sup 18}F beam. The {sup 19}Ne states of interest near the proton threshold decay by breakup into a and {sup 15}O particles. These decay products were detected in coincidence with position-sensitive E-{Delta}E silicon telescopes. The {alpha} and {sup 15}N particles from the break up of the mirror nucleus {sup 19}F were also measured with these detectors. Particle identification, coincidence, and Q-value requirements enable us to distinguish the reaction of interest from other reactions. The reconstruction of relative energy of the detected particles reveals the excited states of {sup 19}Ne and {sup 19}F which are populated. The neutron (proton) angular distributions for states in {sup 19}Ne ({sup 19}F) were extracted using momentum conservation. The observed states in {sup 19}Ne and {sup 19}F will be presented.

Adekola, Aderemi S [ORNL; Bardayan, Daniel W [ORNL; Blackmon, Jeff C [ORNL; Brune, C. [Ohio University; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Champagne, A. E. [University of North Carolina, Chapel Hill; Domizioli, Carlo P [ORNL; Greife, U. [Colorado School of Mines, Golden; Heinen, Z. [Ohio University; Hornish, M. [Ohio University; Johnson, Micah [ORNL; Jones, K. L. [University of Tennessee, Knoxville (UTK); Kapler, R. [University of Tennessee, Knoxville (UTK); Livesay, Jake [ORNL; Ma, Zhanwen [ORNL; Massey, T. [Ohio University; Moazen, Brian [University of Tennessee, Knoxville (UTK); Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; ShrinerJr., J. F. [Tennessee Technological University; Thomas, J. S. [Rutgers University; Smith, Nathan A [ORNL; Smith, Michael Scott [ORNL; Visser, D. W. [University of North Carolina, Chapel Hill; Voinov, A. [Ohio University

2009-01-01T23:59:59.000Z

138

NE-24  

Office of Legacy Management (LM)

the Bureau of Hines Site at Albany, Oregon, for Remedial the Bureau of Hines Site at Albany, Oregon, for Remedial Action Under the Formerly Utilized Sites Remedial Action Program I L@ _I' J.-La&one, Manager Oak Ridge Operations Office Based on the data in the attached draft reports, it has been determined that the subject site is contaminated with residual radioactive material ' as a result of Manhattan Engineer District/Atomic Energy Commission operations P * at this site. The contamination is in excess of the acceptable guidelines and warrants some form of remedial action under the Fornlerly Utilized Sites Reriledial Action Program. It should be noted that the attached reports are draft reports and although subject to change, the changes expected will not effect the designation of the site; therefore, the reports are Suitable for -

139

NE-23  

Office of Legacy Management (LM)

s,' s,' Whidd Pk. Yilljam West West Orange Tennis Club, Inc. 200 Pleasant Valley Way West Orange, New Jersey 07052 Dear Mr. West: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSRAP), has reviewed information on Vitro Laboratories, formerly located on what is now property of the West Orange Tennis Club, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Atomic Energy Commission (a predecessor to DOE). A radiological survey indicated that the radiation levels and radionuclide concentrations are at or near natural background levels. Therefore, no remedial action is required, and DOE is eliminating the former Vitro site from further consideration under FL&RAP.

140

1 Summary: NE cod FSP survey 2003-08 The trawler Abbie Lee was  

E-Print Network (OSTI)

chartered in October/November 2008 to carry out the sixth in a series of FSP surveys of cod and other gadoids off the NE coast of England. Surveys since 2005 have utilised tows spread out over the survey area, with additional tows in defined areas with coarser seabed types (hard ground) where cod abundance is expected to be greatest. As in previous FSP surveys, cod were most abundant on or near the hard ground, whereas haddock were mainly on the softer seabed sediments offshore. Whiting distribution showed no clear relationship with seabed type. 6 5

Jos De Oliveira; Guy Pasco; Mike Armstrong; Peter Randall; Cefas Lowestoft

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Temperature Effects on the Perturber Induced Shift of Dopant Ionization Energies in He and Ne  

SciTech Connect

In this Letter, temperature effects on the perturber induced shift {Delta}{sub D}({rho}{sub P}) [{rho}{sub P} {equivalent_to} perturber number density] of the dopant ionization energy in the repulsive gases Ne and He are investigated at low to medium perturber densities (i.e., {rho}{sub P} {<=} 6.0 x 10{sup 21} cm{sup -3}). We show that these effects arise form changes in the ensemble averaged dopant/perturber polarization energy rather than from changes in the energy of the quasi-free electron.

C Evans; Y Lushtak; X Shi; L Li; G Findley

2011-12-31T23:59:59.000Z

142

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

143

DOE-NE Proliferation and Terrorism Risk Assessment: FY12 Plans Update  

SciTech Connect

This presentation provides background information on FY12 plans for the DOE Office of Nuclear Energy Proliferation and Terrorism Risk Assessment program. Program plans, organization, and individual project elements are described. Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism - Goal is to enable the use of risk information to inform NE R&D program planning.

Sadasivan, Pratap [Los Alamos National Laboratory

2012-06-21T23:59:59.000Z

144

Radiative rates and electron impact excitation rate coefficients for Ne-like selenium, Se XXV  

Science Conference Proceedings (OSTI)

In this article we report calculations of energy levels, radiative rates, electron impact collision strengths, and effective collision strengths for transitions among the 241 fine-structure levels arising from 2l{sup 8} and 2l{sup 7}n{sup '}l{sup '} (n{sup '{241 levels. The effective collision strengths are reported for all 28920 transitions among the 241 levels over a wide temperature range up to 10 keV. To assess the reliability and accuracy of the present collisional data, we have performed a 27-state close-coupling calculation, employing the Dirac R-matrix theory. The results from the close-coupling calculation and the independent-process calculation for the identical target states are found to be in good agreement. - Highlights: {yields} Radiative and collisional atomic data are presented for the lowest 241 fine-structure levels in Ne-like Se. {yields} Calculations are performed using the FAC package. {yields} Resonances enhance significantly a large amount of transitions. {yields} Radiative damping effects are significant for many transitions. {yields} Close-coupling effects are small in Ne-like Se.

Wang, K.; Chen, C.Y., E-mail: chychen@fudan.edu.cn; Huang, M.; Wang, Y.S.; Zou, Y.M.

2011-07-15T23:59:59.000Z

145

Photoionization-pumped, Ne II, x-ray laser studies project. Final report  

SciTech Connect

The energetics of this pumping scheme are shown. Short-pulse (50 to 100 ps) laser irradiation of an appropriate x-ray flashlamp medium generates broad-band emission in the range of 300 to 800 eV which preferentially photoionizes Ne to the /sup 2/S state of Ne II creating an inversion at approximately 27 eV. Although this approach does not depend on precise spectral overlap between the x-ray pump radiation and the medium to be pumped, it does require that the x-ray medium remain un-ionized prior to photoionization by the soft x-ray emission. Well-controlled focus conditions are required to ensure that the x-ray medium is not subjected to electron or x-ray preheat prior to irradiation by the soft x-ray source. The magnitude of the population inversion is predicted to be critically dependent upon rapid photoionization of the two states; therefore, ultra-short pulse irradiation of the laser flashlamps is required.

Richardson, M.C.; Hagelstein, P.L.; Eckart, M.J.; Forsyth, J.M.; Gerrassimenko, M.; Soures, J.M.

1984-01-01T23:59:59.000Z

146

Helioseismic Constraints on the Solar Ne/O Ratio and Heavy Element Abundances  

E-Print Network (OSTI)

We examine the constraints imposed by helioseismic data on the solar heavy element abundances. In prior work we argued that the measured depth of the surface convection zone R_CZ and the surface helium abundance Y_surf were good metallicity indicators which placed separable constraints on light metals (CNONe) and the heavier species with good relative meteoritic abundances. The resulting interiors-based abundance scale was higher than some published studies based on 3D model atmospheres at a highly significant level. In this paper we explore the usage of the solar sound speed in the radiative interior as an additional diagnostic, and find that it is sensitive to changes in the Ne/O ratio even for models constructed to have the same R_CZ and Y_surf. Three distinct helioseismic tests (opacity in the radiative core, ionization in the convection zone, and the core mean molecular weight) yield consistent results. Our preferred O, Ne and Fe abundances are 8.86 +/-0.04, 8.15 +/-0.17 and 7.50 +/-0.05 respectively. Th...

Delahaye, F; Pinsonneault, L; Zeippen, C J

2010-01-01T23:59:59.000Z

147

Light charged particle emission from hot $^{32}$S$^{*}$ formed in $^{20}$Ne + $^{12}$C reaction  

E-Print Network (OSTI)

Inclusive energy distributions for light charged particles ($p, d, t$ and $\\alpha$) have been measured in the $^{20}$Ne (158, 170, 180, 200 MeV) + $^{12}$C reactions in the angular range 10$^{o}$ -- 50$^{o}$. Exclusive light charged particle energy distribution measurements were also done for the same system at 158 MeV bombarding energy by in-plane light charged particle -- fragment coincidence. Pre-equilibrium components have been separated out from proton energy spectra using moving source model considering two sources. The data have been compared with the predictions of the statistical model code CASCADE. It has been observed that significant deformation effects were needed to be introduced in the compound nucleus in order to explain the shape of the evaporated $d, t$ energy spectra. For protons, evaporated energy spectra were rather insensitive to nuclear deformation, though angular distributions could not be explained without deformation. Decay sequence of the hot $^{32}$S nucleus has been investigated through exclusive light charged particle measurements using the $^{20}$Ne (158 MeV) + $^{12}$C reaction. Information on the sequential decay chain has been extracted through comparison of the experimental data with the predictions of the statistical model. It is observed from the present analysis that exclusive light charged particle data may be used as a powerful tool to probe the decay sequence of hot light compound systems.

Aparajita Dey; S. Bhattacharya; C. Bhattacharya; K. Banerjee; T. K. Rana; S. Kundu; S. R. Banerjee; S. Mukhopadhyay; D. Gupta; R. Saha

2008-07-01T23:59:59.000Z

148

Characterization of nonthermal Ne-N{sub 2} mixture radio frequency discharge  

Science Conference Proceedings (OSTI)

This paper deals with optical emission spectroscopic studies of low pressure (p=0.1{yields}0.5 mbar) Ne-N{sub 2} capacitively coupled radio frequency (rf) plasma that can be used for plasma nitriding, etc. It reports the methods to calculate the electron temperature (T{sub e}) in nonthermal plasmas. Since, the selected Ne I lines, used to calculate electron temperature, are found in corona balance; therefore, it allows us to use modified Boltzmann technique to calculate electron temperature. Langmuir probe is also used to calculate electron temperature and electron energy distribution functions (EEDFs). The measurements are worked out for different discharge parameters like neon percentage, filling pressure and RF power. It is found that electron temperature increases with the increase in neon percentage and decreases with the increase in pressure, whereas excitation temperature (T{sub exc}) increases with power, neon percentage, and decreases with pressure. It is also observed that electron temperature measured by Langmuir probe technique is slightly greater than the one measured via modified Boltzmann plot method. The tails of the EEDFs gain height and extend toward the higher energy with the increase in neon percentage in the mixture.

Rehman, N. U.; Zakaullah, M. [Department of Physics, Quaid-i-Azam University, 45320 Islamabad (Pakistan); Khan, F. U. [Department of Physics, Gomal University, 29050 D.I. Khan (Pakistan); Naseer, S. [Department of Physics, Peshawar University, 25120 Peshawar (Pakistan)

2008-12-15T23:59:59.000Z

149

Uranium mill tailings remedial action program. Radiological survey of Shiprock vicinity property SH03, Shiprock, NM, July-November 1982  

Science Conference Proceedings (OSTI)

A comprehensive survey of the vicinity property designated as SH03 was conducted on an intermittent basis from July 26 to November 11, 1982. At the time of the survey, three structures were located on the property - a residential trailer, the main structure, and an old gas pump housing. The lands surrounding the structures were either sparsely covered with arid vegetation or paved. The assessment activities included determination of indoor and outdoor surface radiation levels, for both fixed and removable contamination, through direct instrument and smear (indoor only) surveys; measurement of ambient external penetrating radiation levels at 1-meter heights; and analyses of air, soil, and other material samples. No evidence of radioactive contamination was found inside the trailer. However, the results of the radiological assessment did indicate the occurrence of elevated levels of gamma, surface alpha, and radon daughter radioactivity within the main structure. The short-term radon daughter measurements exceeded the limit of 0.02 Working Level for average annual concentration including background. The assessment also indicated elevated levels of radioactivity in the outdoor environs, encompassing about 32,000 ft/sup 2/ of the grounds adjacent to and surrounding the main structure on the east, south, and west sides. The contamination appeared to be due to the presence of unprocessed uranium ore. Analysis of surface soil samples collected from the environs indicated radium concentrations in excess of the limit of 5 pCi/g above background specified in the EPA Standard. Subsurface soil sampling was not conducted, and thus the vertical extent of the radiological contamination is not known. Since the surface soil contamination levels exceeded the limits specified in the EPA Standard, remedial action for this vicinity site should be considered.

Flynn, K F; Justus, A L; Sholeen, C M; Smith, W H; Wynveen, R A

1984-04-01T23:59:59.000Z

150

Measurement of the nu(mu)-CCQE cross-section in the SciBooNE experiment  

SciTech Connect

SciBooNE is a neutrino and anti-neutrino cross-section experiment at Fermilab, USA. The SciBooNE experiment is summarized and two independent CCQE analyses are described. For one of the analyses, an absolute {nu}{sub {mu}}-CCQE cross section in the neutrino energy region (0.6-1.6) GeV is shown and the technique developed for such a purpose is also explained. The total cross section measured over this energy range agrees well with expectations, based on the NEUT event generator and using a value of 1.21 GeV for the CCQE axial mass.

Alcaraz-Aunion, Jose Luis; /Barcelona, IFAE; Walding, Joseph; /Imperial Coll., London

2009-09-01T23:59:59.000Z

151

New Results from MiniBooNE Charged-Current Quasi-Elastic Anti-Neutrino Data  

SciTech Connect

MiniBooNE anti-neutrino charged-current quasi-elastic (CCQE) data is compared to model predictions. The main background of neutrino-induced events is examined first, where three independent techniques are employed. Results indicate the neutrino flux is consistent with a uniform reduction of {approx}20% relative to the largely uncertain prediction. After background subtraction, the Q{sup 2} shape of {bar v}{sub {mu}} CCQE events is consistent with the model parameter MA = 1.35 GeV determined from MiniBooNE v{sub {mu}} CCQE data, while the normalization is {approx} 20% high compared to the same prediction.

Grange, Joseph

2011-07-01T23:59:59.000Z

152

Laser Rock Drilling on the History Channel - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

Departments > System Technologies & Diagnostics > Videos Departments > System Technologies & Diagnostics > Videos Laser Oil & Gas Well Drilling: Laser Rock Drilling on the History Channel Argonne's Laser Applications Lab and researcher Claude Reed (NE) appeared in the History Channel program "Modern Marvels: Drilling" (May 10, 2006). "Modern Marvels" relates the ingenuity, invention and imagination behind everyday items, technological breakthroughs and man-made wonders. :: Please wait until video loads completely :: Argonne Experts Dr. Claude B. Reed is one of the Experts featured in the Argonne Experts Guide. The video is in mp4 format. Closed Captioning Transcript Live Closed captioning of the video is not available; however -as an alternative- we provide a transcript of the audio portion of this video as a separate web page.

153

Markus Popa, DOE (OCRWM) Bill Sherman, NE HLRW Task Force Robert Holden, NCAI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minutes Monday, November 3rd 2:00-3:00 p.m. (EST) Minutes Monday, November 3rd 2:00-3:00 p.m. (EST) Participants included: Markus Popa, DOE (OCRWM) Bill Sherman, NE HLRW Task Force Robert Holden, NCAI Mike Butler, UETC Bob Fronczak, AAR Kevin Blackwell, FRA Mike Butler (UETC) greeted participants and informed the group of previous notification by Robert Light (Mescalero Apache Tribe), Robert Centracco (FRA), and Mike Calhoun (FRA) that they would be unable to join the call. Mr. Butler began the call with a brief update on the status of Matrix 1, now entitled "Summary of Rail and Highway Regulations and their Applicability to States, Tribes, Shippers, and Carriers." He informed the group that he had completed an initial draft of the matrix, but that he was making substantial revisions to it and therefore he had not distributed it to the entire group for

154

NE-24 R&D Decontamination Projects Under the Formerly Utilized Sites Remedial  

Office of Legacy Management (LM)

" _ ,' ,:.' : " _ ,' ,:.' : NE-24 R&D Decontamination Projects Under the Formerly Utilized Sites Remedial Action Program (FUSRAP) '. * * ,~~'.'J.' L.aGrone, Manager Oak Ridge Operations O fffce As a result of the House-Senate Conference Report and the Energy and W a ter Appropriations Act for FY 1984, and based on the data in the attached reports indicating radioactive contamination In excess of acceptable guidelines, the sites listed In the attachment and their respectfve vicinity properties (contaminated with radioactive materials from these sites) are being designated as decontamination research and development projects under the FUSRAP. Each site and the associated vicinity properties should be treated as a separate project. . . -_ The objectjve of each project is to decontaminate the vicinity properties

155

NE-23 Elimination of the Chupadera Mesa and Los Alamos County Industrial Waste  

Office of Legacy Management (LM)

AM? 2 2 1986 AM? 2 2 1986 NE-23 Elimination of the Chupadera Mesa and Los Alamos County Industrial Waste Line Sites from Further Consideration for FUSRAP Inclusion Carlos E. Garcia, Director Environmental Safety and Health Division Albuquerque Operations Office The enclosed material is being provided to you to document the final actions taken under the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP) for the Chupadera Mesa area and the Los Alamos County Industrial Waste Lines, New Mexico. Copies of designation/ elimination reviews for each of the sites are enclosed for your records. We have determined that neither site warrants inclusion in the remedial action program. Primary sources of data for this determination were two survey reports prepared through your Division, LA-10256-MS, "Radiological

156

K-SHELL PHOTOIONIZATION AND PHOTOABSORPTION OF Ne, Mg, Si, S, Ar, AND Ca  

Science Conference Proceedings (OSTI)

We present extensive computations of photoabsorption and photoionization cross sections across the K-edge of Ne, Mg, Si, S, Ar, and Ca ions with less than 11 electrons. The calculations are performed using the Breit-Pauli R-matrix method and include the effects of radiative and Auger damping by means of an optical potential. The wave functions are constructed from single-electron orbital bases obtained using a Thomas-Fermi-Dirac statistical model potential. Configuration interaction is considered among all fine-structure levels within the n = 2 complex. The damping processes affect the resonances converging to the K thresholds causing them to display symmetric profiles of constant width that smear the otherwise sharp edge at the photoionization thresholds.

Witthoeft, M. C.; Kallman, T. R. [NASA Goddard Space Flight Center, Code 662, Greenbelt, MD 20771 (United States); Bautista, M. A. [Department of Physics, Virginia Polytechnic and State University, Blacksburg, VA 24061 (United States); Mendoza, C. [Centro de Fisica, Instituto Venezolano de Investigaciones CientIficas (IVIC), Caracas 1020A (Venezuela, Bolivarian Republic of); Palmeri, P.; Quinet, P. [Astrophysique et Spectroscopie, Universite de Mons-Hainaut, B-7000 Mons (Belgium)], E-mail: bautista@vt.edu

2009-05-15T23:59:59.000Z

157

Effect of supplementation on vitamin A and zinc nutriture of children in northeast (NE) Thailand  

SciTech Connect

Previous surveys of the nutritional status of young children in NE Thailand suggested that they may benefit from vitamin A (VA) and/or zinc (Zn) supplementation. 140 children, with low plasma retinol concentrations were entered in a double-blind study. They were randomized and supplemented with either VA, Zn, VA + Zn or placebo each weekday for 6 mos. All subjects consumed their usual diet that provided adequate protein, less than recommended calories, fat, Zn and VA. Biochemical indices of VA and Zn status increased significantly. The children had adequate VA liver stores as assessed by relative dose response. Zn supplementation resulted in improvement of vision restoration time in dim light using rapid dark adaptometry. VA and Zn synergistically normalized conjunctival epithelium after a 6 mo supplementation. Data suggest that functional improvements of populations with suboptimal VA and Zn nutriture can be accomplished by supplementation with {lt}2 times of RDA of these nutrients.

Udomkesmalee, E.; Dhanamitta, S.; Charoenklatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Kramer, T.R.; Smith, J.C. Jr. (Mahidol Univ., Nakhon Pathom (Thailand) USDA, Beltsville, MD (United States))

1991-03-11T23:59:59.000Z

158

First direct measurement of resonance strengths in {sup 17}O({alpha},{gamma}){sup 21}Ne  

SciTech Connect

The reaction {sup 17}O({alpha},{gamma}){sup 21}Ne has been measured by in-beam {gamma} spectroscopy for the first time in the energy range E{sub {alpha}=}750-1650 keV using highly enriched anodized Ta{sub 2}({sup 17}O){sub 5} targets. Resonances were found at E{sub {alpha}=} 1002, 1386, and 1619 keV. Their strengths and primary {gamma}-ray branchings are given. The new results exclude the low reaction rate of Descouvemont and support the rate of Caughlan and Fowler. Implications for the neutron poisoning efficiency of {sup 16}O in the weak s-process are discussed.

Best, A.; Goerres, J.; Couder, M.; Boer, R. de; Falahat, S.; Kontos, A.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Sonnabend, K.; Talwar, R.; Uberseder, E.; Wiescher, M. [Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)

2011-05-15T23:59:59.000Z

159

KM3NeT:a large underwater neutrino telescope in the Mediterranean Sea  

E-Print Network (OSTI)

High energy neutrinos produced in astrophysical processes will allow for a new way of studying the universe. In order to detect the expected flux of high energy neutrinos from specific astrophysical sources, neutrino telescopes of a scale of a km^3 of water will be needed. A Northern Hemisphere detector is being proposed to be sited in a deep area of the Mediterranean Sea. This detector will provide complimentary sky coverage to the IceCube detector being built at the South Pole. The three neutrino telescope projects in the Mediterranean (ANTARES, NEMO and NESTOR) are partners in an effort to design, and build such a km^3 size neutrino telescope, the KM3NeT. The EU is funding a 3-year Design Study; the status of the Design Study is presented and some technical issues are discussed.

P. A. Rapidis; for the KM3NeT consortium

2008-03-17T23:59:59.000Z

160

The bipyridyl herbicide paraquat-induced toxicity in human neuroblastoma SH-SY5Y cells: relevance to dopaminergic pathogenesis  

E-Print Network (OSTI)

Paraquat (PQ) is a cationic non-selective bipyridyl herbicide widely used in agriculture to control weeds and grasses. Epidemiologic studies indicate that exposure to pesticides can be a risk factor in the incidence of Parkinson`s disease (PD). A strong correlation has been reported between exposure to paraquat and PD incidence in Canada, Taiwan, and United States. This correlation is supported by animal studies showing that paraquat produces toxicity in dopaminergic neurons of the rat and mouse brain. However, it is unclear how paraquat triggers toxicity in dopaminergic neurons. Based on the previous reports, it was hypothesized that paraquat may induce oxidative stress and proteasomal dysfunction-mediated toxicity in dopaminergic neurons. To explore this possibility, dopaminergic SH-SY5Y human neuroblastoma cells were treated with paraquat, and several biomarkers of oxidative stress or proteasomal dysfunction were investigated. First, a specific dopamine transporter inhibitor GBR12909 significantly protected SY5Y cells against the toxicity of paraquat, indicating that paraquat exerts its toxicity by a mechanism involving the dopamine transporter (DAT). Second, paraquat increased the levels of reactive oxygen species (ROS) in SY5Y cells, but decreased the levels of glutathione. Third, paraquat inhibited glutathione peroxidase activity, but did not affect glutathione reductase activity. On the other hand, paraquat increased GST activity by 24 hr, after which GST activity returned to the control value at 48 hr. Fourth, paraquat decreased mitochondrial transmembrane potential (MTP). Fifth, paraquat produced the increases in malondialdehyde (MDA) and protein carbonyls, as well as DNA fragmentation, indicating oxidative damage to major cellular components. Sixth, paraquat decreased proteasomal activity, the activities of mitochondrial complex I and V, and intracellular ATP levels, but increased the activities of caspase 3 and 9, indicating that proteasomal inhibition is linked to mitochondrial dysfunction accompanied by the activation of apoptotic signaling pathway. Seventh, paraquat increased the protein levels of heme oxygenase-1 (HO-1), p53, Bax, ?±-synuclein and ubiquitinated proteins. Eighth, paraquat induced nuclear condensation. Taken together, these findings support the hypothesis that paraquat produces oxidative stress and proteasomal dysfunctionmediated toxicity in SY5Y cells. Thus, current findings suggest that paraquat may induce the pathogenesis of dopaminergic neurons through oxidative stress and proteasomal dysfunction.

Yang, Wonsuk

2005-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

BP Studentship* in the Department of Earth Sciences of the University of Oxford Tectonic evolution of the Parnaiba cratonic basin, NE Brazil  

E-Print Network (OSTI)

of the Parnaiba cratonic basin, NE Brazil Supervisors: Prof. A. B. Watts and Dr. M. Daly (BP) * Subject to funding structure and petroleum play. The focus will be on the Parnaiba basin in NE Brazil, one of the world in Brazil and the UK, will involve the acquisition of seismic reflection and refraction profile data along

162

Using MiniBooNE neutral current elastic cross section results to constrain 3+1 sterile neutrino models  

E-Print Network (OSTI)

The MiniBooNE Neutral Current Elastic (NCEL) cross section results are used to extract limits in the $\\Delta m^{2}-\\sin^{2}\\vartheta_{\\mu s}$ plane for a 3+1 sterile neutrino model with a mass splitting $0.1 \\leq \\Delta m^{2} \\leq 10.0$ eV$^{2}$. GENIE is used with a cross section model close to the one employed by MiniBooNE to make event rate predictions using simulations on the MiniBooNE target material CH$_{2}$. The axial mass is a free parameter in all fits. Sterile modifications to the flux and changes to the cross section in the simulation relate the two and allow limits to be set on sterile neutrino mixing using cross section results. The large axial mass problem makes it necessary for experiments to perform their own axial mass fits, but a prior fit to the same dataset could mask a sterile oscillation signal. Results are given with and without a penalty term on the axial mass from a prior fit. We find that a simultaneous fit to the axial mass and the sterile neutrino parameters favours very high axial mass values. The general problems that the current uncertainty on charged-current quasi-elastic (CCQE) cross sections at MiniBooNE energies pose for sterile neutrino measurements are discussed.

Callum Wilkinson; Susan Cartwright; Lee Thompson

2013-09-04T23:59:59.000Z

163

Measurements of nuclear $?$-ray line emission in interactions of protons and $?$ particles with N, O, Ne and Si  

E-Print Network (OSTI)

$\\gamma$-ray production cross sections have been measured in proton irradiations of N, Ne and Si and $\\alpha$-particle irradiations of N and Ne. In the same experiment we extracted also line shapes for strong $\\gamma$-ray lines of $^{16}$O produced in proton and $\\alpha$-particle irradiations of O. For the measurements gas targets were used for N, O and Ne and a thick foil was used for Si. All targets were of natural isotopic composition. Beams in the energy range up to 26 MeV for protons and 39 MeV for $\\alpha$-particles have been delivered by the IPN-Orsay tandem accelerator. The $\\gamma$ rays have been detected with four HP-Ge detectors in the angular range 30$^{\\circ}$ to 135$^{\\circ}$. We extracted 36 cross section excitation functions for proton reactions and 14 for $\\alpha$-particle reactions. For the majority of the excitation functions no other data exist to our knowledge. Where comparison with existing data was possible usually a very good agreement was found. It is shown that these data are very interesting for constraining nuclear reaction models. In particular the agreement of cross section calculations in the nuclear reaction code TALYS with the measured data could be improved by adjusting the coupling schemes of collective levels in the target nuclei $^{14}$N, $^{20,22}$Ne and $^{28}$Si. The importance of these results for the modeling of nuclear $\\gamma$-ray line emission in astrophysical sites is discussed.

H. Benhabiles-Mezhoud; J. Kiener; J. -P. Thibaud; V. Tatischeff; I. Deloncle; A. Coc; J. Duprat; C. Hamadache; A. Lefebvre-Schuhl; J. -C. Dalouzy; F. De Grancey; F. De Oliveira; F. Dayras; N. De Srville; M. -G. Pellegriti; L. Lamia; S. Ouichaoui

2010-11-11T23:59:59.000Z

164

First Direct Measurement of the 17F(p,gamma)18Ne Cross Section  

SciTech Connect

The rate of the 17F(p,gamma)18Ne reaction is of significant importance in astrophysical events like novae and x-ray bursts. A previous 17F(p,p)17F measurement identified the 3+ state in 18Ne predicted to dominate the rate above 0.2 GK at a center of mass energy of 599.8 keV, but the resonance strength for proton capture was unknown. We have directly measured the 17F(p,gamma)18Ne reaction with the Daresbury Recoil Separator, using a mixed beam of radioactive 17F and stable 17O from the HRIBF at ORNL. The resonance strength for the 599.8 keV resonance in 18Ne was found to be = 33 14(stat) 17(sys) meV, corresponding to a width of = 56 24(stat) 30(sys) meV. Additionally, an upper limit on the direct capture S factor of S(E) < 65 keV b was determined at an intermediate energy of 800 keV.

Chipps, K. [Colorado School of Mines, Golden; Bardayan, Daniel W [ORNL; Blackmon, Jeff C [ORNL; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Greife, U. [Colorado School of Mines, Golden; Hatarik, Robert [Rutgers University; Kozub, R. L. [Tennessee Technological University; Matei, Catalin [Oak Ridge Associated Universities (ORAU); Moazen, Brian [University of Tennessee, Knoxville (UTK); Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; Peters, W. A. [Rutgers University; Pittman, S. T. [University of Tennessee, Knoxville (UTK); ShrinerJr., J. F. [Tennessee Technological University; Smith, Michael Scott [ORNL

2008-01-01T23:59:59.000Z

165

Demonstration Assessment of LED Roadway Lighting: NE Cully Boulevard Portland, OR  

Science Conference Proceedings (OSTI)

A new roadway lighting demonstration project was initiated in late 2010, which was planned in conjunction with other upgrades to NE Cully Boulevard, a residential collector road in the northeast area of Portland, OR. With the NE Cully Boulevard project, the Portland Bureau of Transportation hoped to demonstrate different light source technologies and different luminaires side-by-side. This report documents the initial performance of six different newly installed luminaires, including three LED products, one induction product, one ceramic metal halide product, and one high-pressure sodium (HPS) product that represented the baseline solution. It includes reported, calculated, and measured performance; evaluates the economic feasibility of each of the alternative luminaires; and documents user feedback collected from a group of local Illuminating Engineering Society (IES) members that toured the site. This report does not contain any long-term performance evaluations or laboratory measurements of luminaire performance. Although not all of the installed products performed equally, the alternative luminaires generally offered higher efficacy, more appropriate luminous intensity distributions, and favorable color quality when compared to the baseline HPS luminaire. However, some products did not provide sufficient illumination to all areasvehicular drive lanes, bicycle lanes, and sidewalksor would likely fail to meet design criteria over the life of the installation due to expected depreciation in lumen output. While the overall performance of the alternative luminaires was generally better than the baseline HPS luminaire, cost remains a significant barrier to widespread adoption. Based on the cost of the small quantity of luminaires purchased for this demonstration, the shortest calculated payback period for one of the alternative luminaire types was 17.3 years. The luminaire prices were notably higher than typical prices for currently available luminaires purchased in larger quantities. At prices that are more typical, the payback would be less than 10 years. In addition to the demonstration luminaires, a networked control system was installed for additional evaluation and demonstration purposes. The capability of control system to measure luminaire input power was explored in this study. A more exhaustive demonstration and evaluation of the control system will be the subject of future GATEWAY report(s).

Royer, Michael P.; Poplawski, Michael E.; Tuenge, Jason R.

2012-06-29T23:59:59.000Z

166

Fine structure collision strengths and line ratios for [Ne V] in infrared and optical sources  

E-Print Network (OSTI)

Improved collisions strengths for the mid-infrared and optical transitions in Ne V are presented. Breit-Pauli R-Matrix calculations for electron impact excitation are carried out with fully resolved near-threshold resonances at very low energies. In particular, the fine structure lines at 14 micron and 24 micron due to transitions among the ground state levels 1s^22s^22p^3 (^3P_{0,1,2}), and the optical/near-UV lines at 2973, 3346 and 3426 Angstrom transitions among the ^3P_{0,1,2}, ^1D_2, ^1S_0 levels are described. Maxwellian averaged collision strengths are tabulated for all forbidden transistion within the ground configuration. Significant differences are found in the low temperature range Te < 10000 K for both the FIR and the opitcal transitions compared to previous results. An analysis of the 14/24 line ratio in low-energy-density (LED) plasma conditions reveals considerable variation; the effective rate coefficient may be dominated by the very low-energy behaviour rather than the maxwellian averaged...

Dance, Michael; Nahar, Sultana N; Pradhan, Anil K

2013-01-01T23:59:59.000Z

167

Particle decay branching ratios for states of astrophysical importance in 19Ne  

E-Print Network (OSTI)

We have measured proton and alpha-particle branching ratios of excited states in 19Ne formed using the 19F(3He,t) reaction at a beam energy of 25 MeV. These ratios have a large impact on the astrophysical reaction rates of 15O(alpha,gamma), 18F(p,gamma) and 18F(p,alpha), which are of interest in understanding energy generation in x-ray bursts and in interpreting anticipated gamma-ray observations of novae. We detect decay protons and alpha-particles using a silicon detector array in coincidence with tritons measured in the focal plane detector of our Enge split-pole spectrograph. The silicon array consists of five strip detectors of the type used in the Louvain-Edinburgh Detector Array, subtending angles from 130 degrees to 165 degrees with approximately 14% lab efficiency. The correlation angular distributions give additional confidence in some prior spin-parity assignments that were based on gamma branchings. We measure Gamma_p/Gamma=0.387+-0.016 for the 665 keV proton resonance, which agrees well with the direct measurement of Bardayan et al.

D. W. Visser; J. A. Caggiano; R. Lewis; W. B. Handler; A. Parikh; P. D. Parker

2003-08-08T23:59:59.000Z

168

Color transparency after the NE18 and E665 experiments: Outllok and perspectives at CEBAF  

E-Print Network (OSTI)

CEBAF is a high-luminocity factory of virtual photons with variable virtuality $Q^{2}$ and transverse size. This makes CEBAF, in particular after the energy upgrade to (8-12)GeV, an ideal facility for uncovering new phenomena, and opening new windows, at the interface of the perturbative and nonperturbative QCD. We discuss color transparency as the case for a broad program on electroproduction of vector mesons $\\rho^{0},\\,\\omega^{0},\\,\\phi^{0}$ and their radial excitations $\\rho',\\,\\omega',\\,\\phi'$ at CEBAF. We also comment on the second generation of experiments on color transparency in $^{4}He(e,e'p)$ scattering, which are also feasible at CEBAF. In 1994, we can make more reliable projections into future because our understanding of the onset of color transparency has greatly been augmented by two experiments completed in 1993:\\\\ i) no effect of CT was seen in the SLAC NE18 experiment on $A(e,e'p)$ scattering at virtualities of the exchanged photon $Q^{2} \\lsim 7$ GeV$^{2}$, \\\\ ii) strong signal of CT was observed in the FNAL E665 experiment on exclusive $\\rho^{0}$- meson production in deep inelastic scattering in the same range of $Q^{2}$. \\\\ We discuss the impact of these observations on the CEBAF experimental program. We argue they both are good news, both were anticipated theoretically, and both rule in the correct QCD mechanism of the onset of CT.

J. Nemchik; N. N. Nikolaev; B. G. Zakharov

1994-06-06T23:59:59.000Z

169

An intensity-modulated dual-wavelength He-Ne laser for remote sensing of methane  

SciTech Connect

The differential absorption laser radar for methane sensing detects a leakage of methane gas by emitting into the atmosphere the light of a wavelength absorbable by methane, receiving the light returning after being reflected or scattered on a road or wall surface, etc., and measuring the light intensity lost during the travel. This methane detection system is highly practicable as it makes an instantaneous remote detection possible. The authors have developed a new He-Ne laser that could be used as the light source for the above system. This device emits a two-wavelength laser beam (one wavelength absorbable by methane and the other not absorbable by methane but used for referential purposes) from a single plasma tube, and there is no possibility of the axes of the two-wavelength component deviating from each other. Further, using this laser, they have developed a vehicle-mounted type differential absorption laser radar system which has successfully detected low density methane leakage while the vehicle was moving.

Ueki, T.; Tanaka, H.; Uehara, K.

1988-01-01T23:59:59.000Z

170

Controlling the nonlinear intracavity dynamics of large He-Ne laser gyroscopes  

E-Print Network (OSTI)

A model based on Lamb's theory of gas lasers is applied to a He-Ne ring laser gyroscope in order to estimate and remove the laser dynamics contribution from the rotation measurements. The intensities of the counter-propagating laser beams exiting one cavity mirror are continuously observed together with a monitor of the laser population inversion. These observables, once properly calibrated with a dedicated procedure, allow us to estimate cold cavity and active medium parameters driving the main part of the nonlinearities of the system. The parameters identification and noise subtraction procedure has been verified by means of a Monte Carlo study of the system, and experimentally tested on the G-Pisa ring laser oriented with the normal to the ring plane almost parallel to the Earth rotation axis. In this configuration the Earth rotation-rate provides the maximum Sagnac effect while the contribution of the orientation error is reduced at minimum. After the subtraction of laser dynamics by a Kalman filter, the ...

Cuccato, Davide; Belfi, Jacopo; Beverini, Nicol; Ortolan, Antonello; Di Virgilio, Angela

2013-01-01T23:59:59.000Z

171

A Measurement of the Neutrino Neutral Current Pi0 Cross Section at MiniBooNE  

SciTech Connect

The MiniBooNE neutrino beam and detector at Fermilab are used to study the production of neutral current {pi}{sup 0} events. The cross sections for neutrino interactions with mineral oil (CH{sub 2}) are reported for resonantly produced and coherently produced single {pi}{sup 0} events. We measure a resonant single {pi}{sup 0} cross section of {sigma}({nu}{sub {mu}} N {pi}{sup 0}) = (0.0129 {+-} 0.0011(stat.) {+-} 0.0043(syst.)) x 10{sup -36} cm{sup 2}/CH{sub 2} at a mean neutrino energy of 1.26 GeV. We measure a coherent single {pi}{sup 0} cross section of {sigma}({nu}{sub {mu}} A {yields} {nu}{sub {mu}} A {pi}{sup 0}) = (0.00077 {+-} 0.00016 (stat.) {+-} 0.00036 (syst.)) x 10{sup -36} cm{sup 2}/CH{sub 2} at mean neutrino energy 1.12 GeV.

Raaf, Jennifer Lynne; /Cincinnati U.

2005-05-01T23:59:59.000Z

172

High Level Requirements for the Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

Science Conference Proceedings (OSTI)

The US Department of Energy, Office of Nuclear Energy (DOE-NE), has been tasked with the important mission of ensuring that nuclear energy remains a compelling and viable energy source in the U.S. The motivations behind this mission include cost-effectively meeting the expected increases in the power needs of the country, reducing carbon emissions and reducing dependence on foreign energy sources. In the near term, to ensure that nuclear power remains a key element of U.S. energy strategy and portfolio, the DOE-NE will be working with the nuclear industry to support safe and efficient operations of existing nuclear power plants. In the long term, to meet the increasing energy needs of the U.S., the DOE-NE will be investing in research and development (R&D) and working in concert with the nuclear industry to build and deploy new, safer and more efficient nuclear power plants. The safe and efficient operations of existing nuclear power plants and designing, licensing and deploying new reactor designs, however, will require focused R&D programs as well as the extensive use and leveraging of advanced modeling and simulation (M&S). M&S will play a key role in ensuring safe and efficient operations of existing and new nuclear reactors. The DOE-NE has been actively developing and promoting the use of advanced M&S in reactor design and analysis through its R&D programs, e.g., the Nuclear Energy Advanced Modeling and Simulation (NEAMS) and Consortium for Advanced Simulation of Light Water Reactors (CASL) programs. Also, nuclear reactor vendors are already using CFD and CSM, for design, analysis, and licensing. However, these M&S tools cannot be used with confidence for nuclear reactor applications unless accompanied and supported by verification and validation (V&V) and uncertainty quantification (UQ) processes and procedures which provide quantitative measures of uncertainty for specific applications. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base that will provide technical services and resources for V&V and UQ of M&S in nuclear energy sciences and engineering. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear reactor design, analysis and licensing. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the CASL, NEAMS, Light Water Reactor Sustainability (LWRS), Small Modular Reactors (SMR), and Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve M&S of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs.

Rich Johnson; Hyung Lee; Kimberlyn C. Mousseau

2011-09-01T23:59:59.000Z

173

The Search for Meterorites with Complex Exposure Histories Amoung Ordinary Chondrites with Low 3HE/21NE Ratios  

DOE Green Energy (OSTI)

In calculating cosmic-ray exposure ages of meteorites it is generally assumed that the meteoroids were expelled from a shielded position within their parent body and then experienced a single stage exposure before colliding with Earth. The combination of noble gas and radionuclide measurements in several large meteorites, such as Jilin and Bur Ghelaui, have revealed complex exposure histories: i.e. an initial exposure on the surface of an asteroid (or within meter-sized meteoroid), followed by a second exposure as a smaller object. In fact, orbital dynamics calculations predicted that at least 30% of the meteorites arriving on Earth experienced two- or multiple-stage exposure histories [1]. More recently, after the recognition that the Yarkovsky effect plays an important role in delivering meteorites from the asteroid belt to Earth-crossing orbits, it was confirmed that complex exposure histories should be common [2]. Nevertheless, despite the ability to measure a wide range of radionuclides with accelerator mass spectrometry (AMS), only a few meteorites with complex exposure histories have been identified [e.g. 3,4]. The question is whether the relatively paucity of complex exposure histories is real or have we simply overlooked complex-exposure histories. In this work we focus on meteorites with low {sup 3}He/{sup 21}Ne ratios, since it is known that most meteorites with complex exposure histories have relatively low {sup 3}He/{sup 21}Ne ratios, i.e. the {sup 3}He/{sup 21}Ne ratio is below the ''Bern-line''. Several hypotheses have been suggested for these low {sup 3}He/{sup 21}Ne ratios, including solar heating in low-perihelion orbits, shock-related diffusion of He during the collision that ejected the meteoroid, or an artifact of high shielding conditions [4]. The first two hypotheses seem to be supported by low radiogenic {sup 4}He concentrations in samples with low {sup 3}He, whereas Monte Carlo calculations have shown that some of the low {sup 3}He/{sup 21}Ne ratios may be due to high shielding conditions in objects with radii > 1m [5]. To elucidate these issues, we selected 15 samples with known noble gas concentrations [6] for radionuclide studies and obtained aliquots of the samples adjacent to those measured for noble gases. The specific goal is the identification of complex exposure histories among samples having low {sup 3}He/{sup 21}Ne ratios. All samples have {sup 3}He deficiencies of >20% relative to the ''Bern-line'' (Table 1). Most of the selected samples also have low {sup 22}Ne/{sup 21}Ne ratios ({le}1.1), indicative of high shielding during most of their cosmic-ray exposure (Table 1), whereas one sample (Suizhou) was selected because of its relatively low {sup 81}Kr concentration [7]. In addition, we selected QUE 93021, for which initial radionuclide results suggested a short exposure age. Here we present cosmogenic {sup 10}Be, {sup 26}Al and {sup 36}Cl in stone and metal fractions for the 16 ordinary chondrites listed in Table 1.

Welton, K C; Nishiizumi, K; Caffee, M W

2001-04-30T23:59:59.000Z

174

A measurement of the neutral current neutrino-nucleon elastic cross section at MiniBooNE  

SciTech Connect

The neutral current neutrino-nucleon elastic interaction {nu} N {yields} {nu} N is a fundamental process of the weak interaction ideally suited for characterizing the structure of the nucleon neutral weak current. This process comprises {approx}18% of neutrino events in the neutrino oscillation experiment, MiniBooNE, ranking it as the experiment's third largest process. Using {approx}10% of MiniBooNE's available neutrino data, a sample of these events were identified and analyzed to determine the differential cross section as a function of the momentum transfer of the interaction, Q{sup 2}. This is the first measurement of a differential cross section with MiniBooNE data. From this analysis, a value for the nucleon axial mass M{sub A} was extracted to be 1.34 {+-} 0.25 GeV consistent with previous measurements. The integrated cross section for the Q{sup 2} range 0.189 {yields} 1.13 GeV{sup 2} was calculated to be (8.8 {+-} 0.6(stat) {+-} 0.2(syst)) x 10{sup -40} cm{sup 2}.

Cox, David Christopher; /Indiana U.

2008-02-01T23:59:59.000Z

175

C:\DOCS\NEW-VER.FRM  

NLE Websites -- All DOE Office Websites (Extended Search)

Verification Report Verification Report This form, or a similar form, is used to maintain quality assurance over the Statistical Analysis System (SAS ) or comparable program used to calculate excess cancer risks or hazard quotients for the ® Department of Energy Oak Ridge Operations (DOE-ORO) Environmental Management (EM) Program. Specifically, this form verifies the use of correct exposure equations, exposure parameters, and toxicity values (or ecotoxicological benchmarks) and verifies the correct calculation of exposures, excess cancer risks, and hazard quotients for all human health or ecological risk assessments that involve risk calculations or the development of Preliminary Remediation Goals (PRGs). In addition, this form presents issues identified during the verification and their resolutions.

176

aps2007posterVer6_dgw  

NLE Websites -- All DOE Office Websites (Extended Search)

Hall coefficient ~ 2 Hall coefficient ~ 2 throughput ~ 0.4 Pa*m 3 /s EXPERIMENT Surface Science Station (S 3 ): a real-time diagnostic of boronization in Alcator C-Mod R. Ochoukov 1), B. Lipschultz 1), D.G. Whyte 1) N. Gierse 2), S. Harrison 3) 1) MIT Plasma Science and Fusion Center, Cambridge, MA, 02139, USA 2) University of Cologne, Cologne, Germany 3) University of Wisconsin - Madison, WI 53711, USA Figure 2: Deposition rate profile as a function of the gas throughput. Figure 3: Deposition rate and I sat profile as a function of the radial distance to EC resonance. Figure 7: MC simulation results of boron deposition as a function of the surface orientation to the B field and comparison with the experiment. (a) MC simulation and (b) experimental results. Figure 6: MC simulation results of boron deposition on

177

real_property_asset_ver_10.indd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management, Budget and Evaluation. The point of contact for this document is Eduard A. Dailide, P Management, Budget and Evaluation. The point of contact for this document is Eduard A. Dailide, P .E. who can be reached at (202) 586-5422 or by e-mail to ed.dailide@hq.doe.gov. Cover Photo: Night, in the form of a crescent moon, overtakes the fading light of day beyond Wilson Hall at Fermi National Accelerator Laboratory. i DEPUTY SECRETARY'S MESSAGE I am proud to present the Department of Energy's 2005 Real Property Asset Management Plan. The success of the Department of Energy in meet- ing its mission is directly linked to the effi cient and effective management of its real property portfolio. The portfolio is comprised of diverse, technically complex, and one-of-a-kind facilities with a value of over $77 billion. It is a mission enabler not only

178

2011 Workshop Agenda_Ver_9.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2011 DOE Project Management Workshop 2011 DOE Project Management Workshop Aligning Success: Contract and Project Management START STOP DUR. (min.) TOPIC SPEAKER Tuesday, March 15, General Session 7:00 AM 8:00 AM 60 Workshop Registration Day #1 8:00 AM 8:05 AM 5 Welcome and Workshop Logistics John Makepeace, Office of Engineering and Construction Management (OECM) 8:05 AM 8:20 AM 15 Opening Remarks Ingrid Kolb, Director, Office of Management (MA) 8:20 AM 8:50 AM 30 Project Management Sucesses Daniel Poneman, Deputy Secretary of Energy (pending) 8:50 AM 9:20 AM 30 Project Management Challenges Ms. Madelyn R. Creedon, Senate Staff (Pending) 9:20 AM 9:35 AM 15 Break 9:35 AM 10:25 AM 50 The New DOE O 413.3B Paul Bosco, Director, Office of Engineering & Construction Management (OECM) 10:25 AM 10:55 AM 30 EERE's new LEED "Platinum" Facility

179

2001 IG Report WEB Ver..pub  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department Department of Energy Office of Inspector General Semiannual Report to Congress October 1, 2000 to March 31, 2001 Inspector General's Message Inspector General Testifies on Top 10 Management Challenges Management Challenges and Significant Accomplishments Reports Statistical Data Page 1 Page 1 Page 3 Page 31 Page 35 DOE/IG-0022 April 2001 Did You Know? "The Department of Energy has installed two low-sulfur light bulbs as a test at its Forrestal building headquarters in Washington, D.C." (See front cover) Source: National Energy Policy, Report of the National Energy Policy Group, May 2001. 43 Dear Secretary Abraham: I am pleased to submit the Office of Inspector General's (OIG) Semiannual Report to Congress. The Report summarizes significant OIG activities and accomplishments during the 6-month period ending March 31, 2001. The Inspector General Act, as amended, requires you to forward

180

2012 Workshop Agenda_Ver_25.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tuesday, April 3 Tuesday, April 3 7:00 AM 8:00 AM 60 Workshop Registration 8:00 AM 8:05 AM 5 Welcome and Workshop Logistics John Makepeace, Office of Engineering and Construction Management 8:05 AM 8:20 AM 15 Opening Remarks Ingrid Kolb, Director, Office of Management 8:20 AM 8:40 AM 20 Achieving Management and Operational Excellence Melvin G. Williams, Associate Deputy Secretary 8:40 AM 8:55 AM 15 Break 8:55 AM 9:45 AM 50 Project Management Success: Are We There Yet? Paul Bosco, Director, Office of Procurement and Assistance Management & Acting Director, Office of Engineering and Construction Management 9:45 AM 10:35 AM 50 Building an Owner's Cost Engineering Organizational Capability Tim Mitchell, Cost Engineering Manager, Chevron Project Resources Company 10:35 AM 10:50 AM 15 Break 10:50 AM

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

2011 Workshop Agenda_Ver_19.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

& Construction Management 11:15 AM 11:30 AM 15 Break 11:30 AM 12:00 PM 30 EERE's new LEED "Platinum" Facility Jeff Baker, Director, Office of Laboratory Operations, Office of...

182

real_property_asset_ver_10.indd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOEME-0060 Editors Notes: This Real Property Asset Management Plan covers the Department of Energy including the National Nuclear Security Administration, the Energy Information...

183

2011 Workshop Agenda_Ver_21.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Federal Procurement Policy, Office of Management & Budget 10:25 AM 11:15 AM 50 The New DOE O 413.3B Paul Bosco, Director, Office of Engineering & Construction Management 11:15...

184

Reduction potential of the sulfhydryl radical: Pulse radiolysis and laser flash photolysis studies of the formation and reactions of {sm_bullet}SH and HSSH{sm_bullet}{sup {minus}} in aqueous solutions  

SciTech Connect

H{sub 2}S, which is a very toxic gas, has a large number of natural and anthropogenic sources, and the safe removal of this substance has been a matter of ongoing industrial concern. Formation and reactions of the {sm_bullet}SH/{sm_bullet}S{sup {minus}} and HSSH{sm_bullet}{sup {minus}}/HSS{sm_bullet}{sup 2{minus}} radicals in aqueous solutions have been studied by excimer laser flash photolysis and by pulse radiolysis. Acidic H{sub 2}S solutions can be photolyzed with 193 nm laser pulses and produce a transient species with {lambda}{sub max} at 240 nm, ascribed to the {sm_bullet}SH/{sm_bullet}S{sup {minus}} radical. Solutions of SH{sup {minus}} can be photolyzed also with 248 nm laser pulses to produce the {sm_bullet}SH/{sm_bullet}S{sup {minus}} reacts with SH{sup {minus}} ({kappa}{sub f} = 4 {times} 10{sup 9} L/mol s, {kappa}{sub r} = 5 {times} 10{sup 5} s{sup {minus}1}) to form HSSH{sm_bullet}{sup {minus}}/HSS{sm_bullet}{sup 2{minus}}, with {lambda}{sub max} at 380 nm. Both {sm_bullet}SH/{sm_bullet}S{sup {minus}} and HSSH{sm_bullet}{sup {minus}}/HSS{sm_bullet}{sup 2{minus}} react rapidly with O{sub 2}; the former produces SO{sub 2}{sm_bullet}{sup {minus}} ({kappa} = 5 {times} 10{sup 9} L/mol s), and the latter produces O{sub 2}{sm_bullet} ({kappa} = 4 {times} 10{sup 8} L/mol s). Both radicals react with olefinic compounds. The monomeric radical oxidizes Fe(CN){sub 6}{sup 4{minus}}, SO{sub 3}{sup 2{minus}}, ClO{sub 2}{sup {minus}}, and chlorpromazine. The dimeric radical is a weaker oxidant toward ferrocyanide but reduces N-methylpyridinium compounds. The reduction potential for the dimeric radical at pH 7 was determined from one-electron transfer equilibria with Mo(CN){sub 8}{sup 3{minus}} and with the 4-methoxyaniline radical cation and found to be 0.69 V vs NHE. From the equilibrium constant K = [HSS{sm_bullet}{sup 2{minus}}]/[SH{sup {minus}}][{sm_bullet}S{sup {minus}}] = 8 {times} 10{sup 3} L/mol, the reduction potential for ({sm_bullet}S{sup {minus}},H{sup +}/SH{sup {minus}}) is calculated to be 0.92 V.

Das, T.N.; Huie, R.E.; Neta, P.; Padmaja, S. [National Inst. of Standards and Technology, Gaithersburg, MD (United States). Physical and Chemical Properties Div.

1999-07-08T23:59:59.000Z

185

Determination of the {sup 22}Ne{sub nucl}/{sup 4}He{sub rad} ratio in natural uranium-rich fluorite by mass spectrometry  

Science Conference Proceedings (OSTI)

A determination by noble gas mass spectrometry of {sup 22}Ne production through the combined reactions {sup 19}F({alpha},n){sup 22}Na({beta}{sup +}){sup 22}Ne and {sup 19}F({alpha},p){sup 22}Ne on natural calcium fluoride is made for the first time. Six samples of U-rich fluorite from a fluorspar deposit in Mexico were used to determine the {sup 22}Ne{sub nucl}/{sup 4}He{sub rad} ratio generated by the spontaneous decay of U during the last 32 Ma. The obtained ratio (1.33 {+-} 0.11) x10{sup -5} (95% confidence), is compared to other experimental data on natural uranium oxides and theoretical values.

Sole, Jesus; Pi, Teresa [Instituto de Geologia, Universidad Nacional Autonoma de Mexico, Cd. Universitaria, Coyoacan, 04510 Mexico D.F. (Mexico)

2006-10-15T23:59:59.000Z

186

Measurement of the reaction O-17(?,n)Ne-20 and its impact on the s process in massive stars  

E-Print Network (OSTI)

The ratio between the rates of the reactions O-17(\\alpha,n)Ne-20 and O-17(\\alpha,\\gamma)Ne-21 determines whether O-16 is an efficient neutron poison for the s process in massive stars, or if most of the neutrons captured by O-16(n,\\gamma) are recycled into the stellar environment. This ratio is of particular relevance to constrain the s process yields of fast rotating massive stars at low metallicity. Recent results on the (\\alpha,\\gamma) channel have made it necessary to measure the (\\alpha,n) reaction more precisely and investigate the effect of the new data on s process nucleosynthesis in massive stars. We present a new measurement of the O-17(\\alpha, n) reaction using a moderating neutron detector. In addition, the (\\alpha, n_1) channel has been measured independently by observation of the characteristic 1633 keV \\gamma-transition in Ne-20. The reaction cross section was determined with a simultaneous R-matrix fit to both channels. (\\alpha,n) and (\\alpha, \\gamma) resonance strengths of states lying below the covered energy range were estimated using their known properties from the literature. A new O-17(\\alpha,n) reaction rate was deduced for the temperature range 0.1 GK to 10 GK. It was found that in He burning conditions the (\\alpha,\\gamma) channel is strong enough to compete with the neutron channel. This leads to a less efficient neutron recycling compared to a previous suggestion of a very weak (\\alpha,\\gamma) channel. S process calculations using our rates confirm that massive rotating stars do play a significant role in the production of elements up to Sr, but they strongly reduce the s process contribution to heavier elements.

A. Best; M. Beard; J. Grres; M. Couder; R. deBoer; S. Falahat; R. T. Gray; A. Kontos; K. -L. Kratz; P. J. LeBlanc; Q. Li; S. O'Brien; N. zkan; M. Pignatari; K. Sonnabend; R. Talwar; W. Tan; E. Uberseder; M. Wiescher

2013-04-23T23:59:59.000Z

187

A Measurement of the muon neutrino charged current quasielastic interaction and a test of Lorentz violation with the MiniBooNE experiment  

SciTech Connect

The Mini-Booster neutrino experiment (MiniBooNE) at Fermi National Accelerator Laboratory (Fermilab) is designed to search for {nu}{sub {mu}} {yields} {nu}{sub e} appearance neutrino oscillations. Muon neutrino charged-current quasi-elastic (CCQE) interactions ({nu}{sub {mu}} + n {yields} {mu} + p) make up roughly 40% of our data sample, and it is used to constrain the background and cross sections for the oscillation analysis. Using high-statistics MiniBooNE CCQE data, the muon-neutrino CCQE cross section is measured. The nuclear model is tuned precisely using the MiniBooNE data. The measured total cross section is {sigma} = (1.058 {+-} 0.003 (stat) {+-} 0.111 (syst)) x 10{sup -38} cm{sup 2} at the MiniBooNE muon neutrino beam energy (700-800 MeV). {nu}{sub e} appearance candidate data is also used to search for Lorentz violation. Lorentz symmetry is one of the most fundamental symmetries in modern physics. Neutrino oscillations offer a new method to test it. We found that the MiniBooNE result is not well-described using Lorentz violation, however further investigation is required for a more conclusive result.

Katori, Teppei; /Indiana U.

2008-12-01T23:59:59.000Z

188

The Uncertainties in the 22Ne + alpha-capture Reaction Rates and the Production of the Heavy Magnesium Isotopes in Asymptotic Giant Branch Stars of Intermediate Mass  

E-Print Network (OSTI)

We present new rates for the 22Ne(alpha, n)25Mg and 22Ne(alpha,gamma)26Mg reactions, with uncertainties that have been considerably reduced compared to previous estimates, and we study how these new rates affect the production of the heavy magnesium isotopes in models of intermediate mass Asymptotic Giant Branch (AGB) stars of different initial compositions. All the models have deep third dredge-up, hot bottom burning and mass loss. Calculations have been performed using the two most commonly used estimates of the 22Ne + alpha rates as well as the new recommended rates, and with combinations of their upper and lower limits. The main result of the present study is that with the new rates, uncertainties on the production of isotopes from Mg to P coming from the 22Ne + alpha-capture rates have been considerably reduced. We have therefore removed one of the important sources of uncertainty to effect models of AGB stars. We have studied the effects of varying the mass-loss rate on nucleosynthesis and discuss other uncertainties related to the physics employed in the computation of stellar structure, such as the modeling of convection, the inclusion of a partial mixing zone and the definition of convective borders. These uncertainties are found to be much larger than those coming from 22Ne + alpha-capture rates, when using our new estimates. Much effort is needed to improve the situation for AGB models.

A. Karakas; M. Lugaro; M. Wiescher; J. Goerres; C. Ugalde

2006-01-27T23:59:59.000Z

189

SHEAR WAVE SEISMIC STUDY COMPARING 9C3D SV AND SH IMAGES WITH 3C3D C-WAVE IMAGES  

Science Conference Proceedings (OSTI)

The objective of this study was to compare the relative merits of shear-wave (S-wave) seismic data acquired with nine-component (9-C) technology and with three-component (3-C) technology. The original proposal was written as if the investigation would be restricted to a single 9-C seismic survey in southwest Kansas (the Ashland survey), on the basis of the assumption that both 9-C and 3-C S-wave images could be created from that one data set. The Ashland survey was designed as a 9-C seismic program. We found that although the acquisition geometry was adequate for 9-C data analysis, the source-receiver geometry did not allow 3-C data to be extracted on an equitable and competitive basis with 9-C data. To do a fair assessment of the relative value of 9-C and 3-C seismic S-wave data, we expanded the study beyond the Ashland survey and included multicomponent seismic data from surveys done in a variety of basins. These additional data were made available through the Bureau of Economic Geology, our research subcontractor. Bureau scientists have added theoretical analyses to this report that provide valuable insights into several key distinctions between 9-C and 3-C seismic data. These theoretical considerations about distinctions between 3-C and 9-C S-wave data are presented first, followed by a discussion of differences between processing 9-C common-midpoint data and 3-C common-conversion-point data. Examples of 9-C and 3-C data are illustrated and discussed in the last part of the report. The key findings of this study are that each S-wave mode (SH-SH, SV-SV, or PSV) involves a different subsurface illumination pattern and a different reflectivity behavior and that each mode senses a different Earth fabric along its propagation path because of the unique orientation of its particle-displacement vector. As a result of the distinct orientation of each mode's particle-displacement vector, one mode may react to a critical geologic condition in a more optimal way than do the other modes. A conclusion of the study is that 9-C seismic data contain more rock and fluid information and more sequence and facies information than do 3-C seismic data; 9-C data should therefore be acquired in multicomponent seismic programs whenever possible.

John Beecherl; Bob A. Hardage

2004-07-01T23:59:59.000Z

190

Measuring the speed of light using beating longitudinal modes in an open-cavity HeNe laser  

E-Print Network (OSTI)

We describe an undergraduate laboratory that combines an accurate measurement of the speed of light, a fundamental investigation of a basic laser system, and a nontrivial use of statistical analysis. Students grapple with the existence of longitudinal modes in a laser cavity as they change the cavity length of an adjustable-cavity HeNe laser and tune the cavity to produce lasing in the TEM$_{00}$ mode. For appropriate laser cavity lengths, the laser gain curve of a HeNe laser allows simultaneous operation of multiple longitudinal modes. The difference frequency between the modes is measured using a self-heterodyne detection with a diode photodetector and a radio frequency spectrum analyzer. Asymmetric effects due to frequency pushing and frequency pulling, as well as transverse modes, are minimized by simultaneously monitoring and adjusting the mode structure as viewed with a Fabry-Perot interferometer. The frequency spacing of longitudinal modes is proportional to the inverse of the cavity length with a prop...

D'Orazio, Daniel J; Schultz, Justin T; Sidor, Daniel; Best, Micheal; Goodfellow, Kenneth; Scholten, Robert E; White, James D; 10.1119/1.3299281

2010-01-01T23:59:59.000Z

191

Direct Total Cross Section Measurement of the 16O(?,?)20Ne Reaction at Ec.m. = 2.26 MeV  

Science Conference Proceedings (OSTI)

In stellar helium burning, (16)O represents the endpoint of the helium-burning sequence due to the low rate of (16)O(alpha,gamma)(20)Ne. We present a new direct measurement of the total capture reaction rate of (16)O(alpha,gamma)(20)Ne at E(c.m.) = 2.26MeV employing the DRAGON recoil separator. For the first time, the total S factor and its contributing direct capture transitions could be determined in one experiment.

Hager, Ulrike; Brown, James R.; Buchmann, Lothar R.; Carmona-Gallardo, Mariano; Erikson, Luke E.; Fallis, Jennifer S.; Greife, Uwe; Hutcheon, Dave; Ottewell, Dave; Ruiz, Chris; Sjue, Sky; Vockenhuber, Cristof

2011-08-23T23:59:59.000Z

192

35 COFibE, Series A. U. S. ATOXIC ENERGY CCMMISSION r'C Cj NE# YORK OPERATIONS OFFICE  

Office of Legacy Management (LM)

COFibE, Series A. COFibE, Series A. - U. S. ATOXIC ENERGY CCMMISSION r'C Cj NE# YORK OPERATIONS OFFICE HEkLTH AND SAFETY DIVISION (Merril Eicsnbud, Dirsator) MONTHLY REPORT OF FIELD ACTIVITIES (This report%v,rs%~~~nth period) Indusorial Ii~iene Branoh m a . . 0 . . c . . . o W. B. Harris, Chief Radiation Branch . y y e 0e . e . e . . . . e . . . Hanson Blatz, Chief Fi:e and Accident Branch D e a o o . . . ..s . . B. J. Kehoe, Chief Medical Advioer, Dr. J. A. Quiglsy Siometrician, Dr. A. E. Brandt TABLF OF COEpTmS PRODUCTION COWTRACTORS ._ Feed Nabrlals Production Centor '$iiddlcsexSampling Plnnt Harshaw ChuoicalCompa~ Wlin&rodt Chen!icrl Works tie. Ontario Storage Area b Vit*o Mnufacturing CompaW B4ikhem Steel F'lrnt - IpcknuMnr Clifton Roducts CompvIy Drush Bcx@.Uun~ Company - Luckcy

193

REP&V TO ATTNJF: NE-23 SUWECC Commercial Facilities Used by National Lead Company of Ohio in Support  

Office of Legacy Management (LM)

REP&V TO REP&V TO ATTNJF: NE-23 SUWECC Commercial Facilities Used by National Lead Company of Ohio in Support 'of FMPC Operations TO: Robert E. Lynch Procuresnent and CorXracts Division, AD-42 Oak Ridge Operations Office The Division of Facility and Site Decormnissioning Projects (DFSP) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (NED) and Atomic Energy Commission (AEC) which may have been radioactively contaminated as a result of these operations, (2) to determine if the facilities require remedial action, and (3) where DOE has authority, to conduct the remedial action. Authority for remedial action under FUSRAP is

194

REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support  

Office of Legacy Management (LM)

x:Y" x:Y" . .' 3023 I\ \ 'a' '. Unita? -&&s Coverament , ,Q,.l. ),&, ,(>.. Department of Energy riGmorandum / d6a 2/. $3 DATE: JL(L 2 8 ;;$5 co. /3 .-J/ co,/3 REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support of FMPC Operations TO: Robert E. Lynch Procuremnent and Contracts Division, AD-42 Oak Ridge Operations Office The Division of Facility and Site Decommissioning Projects (DFSD) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FuSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (NED) and Atomic Energy Commission (AEC) which may have been radioactively contaminated as a result of these operations, (2) to determine if the

195

Using the X-FEL to photo-pump X-ray laser transitions in He-like Ne  

SciTech Connect

Nearly four decades ago H-like and He-like resonantly photo-pumped laser schemes were proposed for producing X-ray lasers. However, demonstrating these schemes in the laboratory has proved to be elusive because of the difficulty of finding a strong resonant pump line. With the advent of the X-ray free electron laser (X-FEL) at the SLAC Linac Coherent Light Source (LCLS) we now have a tunable X-ray laser source that can be used to replace the pump line in previously proposed laser schemes and allow researchers to study the physics and feasibility of resonantly photo-pumped laser schemes. In this paper we use the X-FEL at 1174 eV to photo-pump the singly excited 1s2p state of He-like Ne to the doubly excited 2p3p state and model gain on the 2p3p-2p2s transition at 175 eV and the 2p3p-1s3p transition at 1017 eV. One motivation for studying this scheme is to explore possible quenching of the gain due to strong non-linear coupling effects from the intense X-FEL beam We compare this scheme with photo-pumping the He-like Ne ground state to the 1s3p singly excited state followed by lasing on the 3p-2s and 3d-2p transitions at 158 and 151 eV. Experiments are being planned at LCLS to study these laser processes and coherent quantum effects.

Nilsen, J; Rohringer, N

2011-08-30T23:59:59.000Z

196

PETROPHYSICAL INVESTIGATION OF THE SECONDARY RECOVERY POTENTIAL IN THE CHERRY CANYON FORMATION NE LEA FIELD LEA COUNTY, NEW MEXICO  

Science Conference Proceedings (OSTI)

Read and Stevens has proposed the evaluation of the waterflood potential from the Cherry Canyon formation in the NE Lea Field in lea County, New Mexico. Much of the development in this area is approaching primary recovery limitations; additional recovery of remaining oil reserves by waterflood needs to be evaluated. The Cherry Canyon formation is composed of fine grained sandstone, containing clay material which results in high water saturation, and also has the tendency to swell and reduce reservoir permeability--the ability of fluid to flow through the rock pores and fractures. There are also abundant organic materials that interfere with obtaining reliable well logs. These complications have limited oil in place calculations and identification of net pay zones, presenting a challenge to the planned waterflood. Core analysis of the Cherry Canyon should improve the understanding of existing well logs and possibly indicate secondary recovery measures, such as waterflood, to enhance field recovery. Lacking truly representative core to provide accurate analyses, Read and Stevens will obtain and preserve fresh core. The consulting firm of T. Scott Hickman and Associates will then collaborate on special core analyses and obtain additional well logs for a more detailed analysis of reservoir properties. The log interpretation will be compared to the core analysis results, and the entire collected data set will be used to assess the potential and economic viability of successfully waterflooding the identified oil zones. Successful results from the project will improve accuracy of log interpretation and establish a methodology for evaluating secondary recovery by waterflood.

T. Scott Hickman

2002-06-01T23:59:59.000Z

197

Measurements of nuclear $\\gamma$-ray line emission in interactions of protons and $\\alpha$ particles with N, O, Ne and Si  

E-Print Network (OSTI)

$\\gamma$-ray production cross sections have been measured in proton irradiations of N, Ne and Si and $\\alpha$-particle irradiations of N and Ne. In the same experiment we extracted also line shapes for strong $\\gamma$-ray lines of $^{16}$O produced in proton and $\\alpha$-particle irradiations of O. For the measurements gas targets were used for N, O and Ne and a thick foil was used for Si. All targets were of natural isotopic composition. Beams in the energy range up to 26 MeV for protons and 39 MeV for $\\alpha$-particles have been delivered by the IPN-Orsay tandem accelerator. The $\\gamma$ rays have been detected with four HP-Ge detectors in the angular range 30$^{\\circ}$ to 135$^{\\circ}$. We extracted 36 cross section excitation functions for proton reactions and 14 for $\\alpha$-particle reactions. For the majority of the excitation functions no other data exist to our knowledge. Where comparison with existing data was possible usually a very good agreement was found. It is shown that these data are very in...

Benhabiles-Mezhoud, H; Thibaud, J -P; Tatischeff, V; Deloncle, I; Coc, A; Duprat, J; Hamadache, C; Lefebvre-Schuhl, A; Dalouzy, J -C; De Grancey, F; De Oliveira, F; Dayras, F; De Srville, N; Pellegriti, M -G; Lamia, L; Ouichaoui, S

2010-01-01T23:59:59.000Z

198

THE INFLUENCE OF UNCERTAINTIES IN THE {sup 15}O({alpha}, {gamma}){sup 19}Ne REACTION RATE ON MODELS OF TYPE I X-RAY BURSTS  

SciTech Connect

We present a Monte Carlo calculation of the astrophysical rate of the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction based on an evaluation of published experimental data. By considering the likelihood distributions of individual resonance parameters derived from measurements, estimates of upper and lower limits on the reaction rate at the 99.73% confidence level are derived in addition to the recommended, median value. These three reaction rates are used as input for three separate calculations of Type I X-ray bursts (XRBs) using spherically symmetric, hydrodynamic simulations of an accreting neutron star. In this way the influence of the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction rate on the peak luminosity, recurrence time, and associated nucleosynthesis in models of Type I XRBs is studied. Contrary to previous findings, no substantial effect on any of these quantities is observed in a sequence of four bursts when varying the reaction rate between its lower and upper limits. Rather, the differences in these quantities are comparable to the burst-to-burst variations with a fixed reaction rate, indicating that uncertainties in the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction rate do not strongly affect the predictions of this Type I XRB model.

Davids, Barry [TRIUMF, Vancouver, BC V6T 2A3 (Canada); Cyburt, Richard H. [Joint Institute for Nuclear Astrophysics and National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI (United States); Jose, Jordi [Departament de Fisica i Enginyeria Nuclear, Universitat Politecnica de Catalunya and Institut d'Estudis Espacials de Catalunya, Barcelona (Spain); Mythili, Subramanian [Physics Department, George Mason University, Fairfax, VA (United States)

2011-07-01T23:59:59.000Z

199

Measurement of Neutrino-Nucleon Neutral-Current Elastic Scattering Cross-section at SciBooNE  

SciTech Connect

In this thesis, results of neutrino-nucleon neutral current (NC) elastic scattering analysis are presented. Neutrinos interact with other particles only with weak force. Measurement of cross-section for neutrino-nucleon reactions at various neutrino energy are important for the study of nucleon structure. It also provides data to be used for beam flux monitor in neutrino oscillation experiments. The cross-section for neutrino-nucleon NC elastic scattering contains the axial vector form factor G{sub A}(Q{sup 2}) as well as electromagnetic form factors unlike electromagnetic interaction. G{sub A} is propotional to strange part of nucleon spin ({Delta}s) in Q{sup 2} {yields} 0 limit. Measurement of NC elastic cross-section with smaller Q{sup 2} enables us to access {Delta}s. NC elastic cross-sections of neutrino-nucleon and antineutrino-nucleon were measured earlier by E734 experiment at Brookheaven National Laboratory (BNL) in 1987. In this experiment, cross-sections were measured in Q{sup 2} > 0.4 GeV{sup 2} region. Result from this experiment was the only published data for NC elastic scattering cross-section published before our experiment. SciBooNE is an experiment for the measurement of neutrino-nucleon scattering cross-secitons using Booster Neutrino Beam (BNB) at FNAL. BNB has energy peak at 0.7 GeV. In this energy region, NC elastic scattering, charged current elastic scattering, charged current pion production, and neutral current pion production are the major reaction branches. SciBar, electromagnetic calorimeter, and Muon Range Detector are the detectors for SciBooNE. The SciBar consists of finely segmented scintillators and 14336 channels of PMTs. It has a capability to reconstruct particle track longer than 8 cm and separate proton from muons and pions using energy deposit information. Signal of NC elastic scattering is a single proton track. In {nu}p {yields} {nu}p process, the recoil proton is detected. On the other hand, most of {nu}n {yields} {nu}n is invisible because there are only neutral particles in final state, but sometimes recoil neutron is scattered by proton and recoil proton is detected. Signal of this event is also single proton track. Event selection for the single proton track events using geometrical and dE/dx information of reconstructed track is performed. After the event selection, NC elastic scattering data sample is obtained. They includes {nu}p {yields} {nu}p and {nu}n {yields} {nu}n is obtained. Absolute cross-section as a function of Q{sup 2} is evaluated from this NC elastic scattering data sample.

Takei, Hideyuki; /Tokyo Inst. Tech.

2009-02-01T23:59:59.000Z

200

A survey of Existing V&V, UQ and M&S Data and Knowledge Bases in Support of the Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

The Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Oak Ridge National Laboratory, Utah State University and others. The objective of this consortium is to establish a comprehensive knowledge base to provide Verification and Validation (V&V) and Uncertainty Quantification (UQ) and other resources for advanced modeling and simulation (M&S) in nuclear reactor design and analysis. NE-KAMS will become a valuable resource for the nuclear industry, the national laboratories, the U.S. NRC and the public to help ensure the safe operation of existing and future nuclear reactors. A survey and evaluation of the state-of-the-art of existing V&V and M&S databases, including the Department of Energy and commercial databases, has been performed to ensure that the NE-KAMS effort will not be duplicating existing resources and capabilities and to assess the scope of the effort required to develop and implement NE-KAMS. The survey and evaluation have indeed highlighted the unique set of value-added functionality and services that NE-KAMS will provide to its users. Additionally, the survey has helped develop a better understanding of the architecture and functionality of these data and knowledge bases that can be used to leverage the development of NE-KAMS.

Hyung Lee; Rich Johnson, Ph.D.; Kimberlyn C. Moussesau

2011-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

NE Press Releases  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

press-releases 1000 Independence Ave. SWWashington DC press-releases 1000 Independence Ave. SWWashington DC 20585202-586-5000 en Energy Department Announces New Investment in Innovative Small Modular Reactor http://energy.gov/articles/energy-department-announces-new-investment-innovative-small-modular-reactor Energy Department Announces New Investment in Innovative Small Modular Reactor

202

NE photo galleries  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis (11) Programs: Advanced Fuel Cycle Initiative (6) Engineering and Structural Mechanics (3) Heat Transfer and Fluid Mechanics (6) Risk Methodology and Evaluation (2)...

203

Research Needs for Magnetic Fusion Energy Sciences. Report of the Research Needs Workshop (ReNeW) Bethesda, Maryland, June 8-12, 2009  

SciTech Connect

Nuclear fusion - the process that powers the sun - offers an environmentally benign, intrinsically safe energy source with an abundant supply of low-cost fuel. It is the focus of an international research program, including the ITE R fusion collaboration, which involves seven parties representing half the world's population. The realization of fusion power would change the economics and ecology of energy production as profoundly as petroleum exploitation did two centuries ago. The 21st century finds fusion research in a transformed landscape. The worldwide fusion community broadly agrees that the science has advanced to the point where an aggressive action plan, aimed at the remaining barriers to practical fusion energy, is warranted. At the same time, and largely because of its scientific advance, the program faces new challenges; above all it is challenged to demonstrate the timeliness of its promised benefits. In response to this changed landscape, the Office of Fusion Energy Sciences (OFES ) in the US Department of Energy commissioned a number of community-based studies of the key scientific and technical foci of magnetic fusion research. The Research Needs Workshop (ReNeW) for Magnetic Fusion Energy Sciences is a capstone to these studies. In the context of magnetic fusion energy, ReNeW surveyed the issues identified in previous studies, and used them as a starting point to define and characterize the research activities that the advance of fusion as a practical energy source will require. Thus, ReNeW's task was to identify (1) the scientific and technological research frontiers of the fusion program, and, especially, (2) a set of activities that will most effectively advance those frontiers. (Note that ReNeW was not charged with developing a strategic plan or timeline for the implementation of fusion power.) This Report presents a portfolio of research activities for US research in magnetic fusion for the next two decades. It is intended to provide a strategic framework for realizing practical fusion energy. The portfolio is the product of ten months of fusion-community study and discussion, culminating in a Workshop held in Bethesda, Maryland, from June 8 to June 12, 2009. The Workshop involved some 200 scientists from Universities, National Laboratories and private industry, including several scientists from outside the US. Largely following the Basic Research Needs model established by the Office of Basic Energy Sciences (BES ), the Report presents a collection of discrete research activities, here called 'thrusts.' Each thrust is based on an explicitly identified question, or coherent set of questions, on the frontier of fusion science. It presents a strategy to find the needed answers, combining the necessary intellectual and hardware tools, experimental facilities, and computational resources into an integrated, focused program. The thrusts should be viewed as building blocks for a fusion program plan whose overall structure will be developed by OFES , using whatever additional community input it requests. Part I of the Report reviews the issues identified in previous fusion-community studies, which systematically identified the key research issues and described them in considerable detail. It then considers in some detail the scientific and technical means that can be used to address these is sues. It ends by showing how these various research requirements are organized into a set of eighteen thrusts. Part II presents a detailed and self-contained discussion of each thrust, including the goals, required facilities and tools for each. This Executive Summary focuses on a survey of the ReNeW thrusts. The following brief review of fusion science is intended to provide context for that survey. A more detailed discussion of fusion science can be found in an Appendix to this Summary, entitled 'A Fusion Primer.'

None

2009-06-08T23:59:59.000Z

204

Research Needs for Magnetic Fusion Energy Sciences. Report of the Research Needs Workshop (ReNeW) Bethesda, Maryland, June 8-12, 2009  

SciTech Connect

Nuclear fusion - the process that powers the sun - offers an environmentally benign, intrinsically safe energy source with an abundant supply of low-cost fuel. It is the focus of an international research program, including the ITE R fusion collaboration, which involves seven parties representing half the world's population. The realization of fusion power would change the economics and ecology of energy production as profoundly as petroleum exploitation did two centuries ago. The 21st century finds fusion research in a transformed landscape. The worldwide fusion community broadly agrees that the science has advanced to the point where an aggressive action plan, aimed at the remaining barriers to practical fusion energy, is warranted. At the same time, and largely because of its scientific advance, the program faces new challenges; above all it is challenged to demonstrate the timeliness of its promised benefits. In response to this changed landscape, the Office of Fusion Energy Sciences (OFES ) in the US Department of Energy commissioned a number of community-based studies of the key scientific and technical foci of magnetic fusion research. The Research Needs Workshop (ReNeW) for Magnetic Fusion Energy Sciences is a capstone to these studies. In the context of magnetic fusion energy, ReNeW surveyed the issues identified in previous studies, and used them as a starting point to define and characterize the research activities that the advance of fusion as a practical energy source will require. Thus, ReNeW's task was to identify (1) the scientific and technological research frontiers of the fusion program, and, especially, (2) a set of activities that will most effectively advance those frontiers. (Note that ReNeW was not charged with developing a strategic plan or timeline for the implementation of fusion power.) This Report presents a portfolio of research activities for US research in magnetic fusion for the next two decades. It is intended to provide a strategic framework for realizing practical fusion energy. The portfolio is the product of ten months of fusion-community study and discussion, culminating in a Workshop held in Bethesda, Maryland, from June 8 to June 12, 2009. The Workshop involved some 200 scientists from Universities, National Laboratories and private industry, including several scientists from outside the US. Largely following the Basic Research Needs model established by the Office of Basic Energy Sciences (BES ), the Report presents a collection of discrete research activities, here called 'thrusts.' Each thrust is based on an explicitly identified question, or coherent set of questions, on the frontier of fusion science. It presents a strategy to find the needed answers, combining the necessary intellectual and hardware tools, experimental facilities, and computational resources into an integrated, focused program. The thrusts should be viewed as building blocks for a fusion program plan whose overall structure will be developed by OFES , using whatever additional community input it requests. Part I of the Report reviews the issues identified in previous fusion-community studies, which systematically identified the key research issues and described them in considerable detail. It then considers in some detail the scientific and technical means that can be used to address these is sues. It ends by showing how these various research requirements are organized into a set of eighteen thrusts. Part II presents a detailed and self-contained discussion of each thrust, including the goals, required facilities and tools for each. This Executive Summary focuses on a survey of the ReNeW thrusts. The following brief review of fusion science is intended to provide context for that survey. A more detailed discussion of fusion science can be found in an Appendix to this Summary, entitled 'A Fusion Primer.'

2009-06-08T23:59:59.000Z

205

Direct total cross section measurement of the {sup 16}O({alpha}, {gamma}){sup 20}Ne reaction at E{sub c.m.}=2.26 MeV  

Science Conference Proceedings (OSTI)

In stellar helium burning, {sup 16}O represents the endpoint of the helium-burning sequence due to the low rate of {sup 16}O({alpha},{gamma}){sup 20}Ne. We present a new direct measurement of the total capture reaction rate of {sup 16}O({alpha},{gamma}){sup 20}Ne at E{sub c.m.}=2.26 MeV employing the DRAGON recoil separator. For the first time, the total S factor and its contributing direct capture transitions could be determined in one experiment.

Hager, U.; Greife, U. [Colorado School of Mines, Golden, Colorado (United States); Brown, J. R. [Department of Physics, University of York, York, YO10 5DD (United Kingdom); Buchmann, L.; Fallis, J.; Hutcheon, D.; Ottewell, D.; Ruiz, C.; Sjue, S. [TRIUMF, Vancouver, Canada V6T 2A3 (Canada); Carmona-Gallardo, M. [Instituto de Estructura de la Materia, CSIC E-28006 Madrid (Spain); Erikson, L. [Pacific Northwest National Laboratory, Richland, WA (United States); Vockenhuber, C. [ETH Zurich, Zurich (Switzerland)

2011-08-15T23:59:59.000Z

206

LCLS-scheduling-run_V_Ver9c.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Tue Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Day Com Com Com Com Com L421 Coffee Night L477 Robinson Gruebel (L304, run 4) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Thur Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Day L498 Yachandra L487 Sokoloswski-Tinten IH Bozek L447 Harmand Night IH Lemke L396 Scherz L396 Scherz L409 Boeglin 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Day L399/433 Fromme/Neutze L467 Madsen Night Com Com Com L467 Mad L399/433 Fromme Com Com 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri

207

Ver. EN2011-06-16 Program description  

E-Print Network (OSTI)

and Systems Biology, Medical Imaging, Medical Technology, Molecular Science and Technology, or Medical Experimental Methods in Molecular Biophysics Biological and Biomedical Physics 7.5 Fiber-optical Communication Physics 10.5 Photonic Materials and Processing Technology Optics and Photonics 10.5 Photo Counting Systems

Haviland, David

208

Secure View 3 (Ver. 3.9.1)  

Science Conference Proceedings (OSTI)

... 1,265938 title Popular plumbing problem solving and remodeling DIY discuss ion advice forum site. visit Count 1 http://www ...

2012-10-24T23:59:59.000Z

209

Market Design Simulations with Variable Energy Resources (VERs) (Presentation)  

Science Conference Proceedings (OSTI)

Presented at the FERC Technical Conference, 29 June 2011, Washington, D.C. This presentation describes NREL research regarding variable generation resources, operating reserves, unit commitment, economic dispatch, and introduces a new and novel modeling tool called 'FESTIV.'

Ela, E.

2011-06-01T23:59:59.000Z

210

UniGuide: vers un guide dynamique pour Unistroke  

Science Conference Proceedings (OSTI)

UniGuide is a support system to use the Unistroke gesture keyboard. It is based on dynamic guides to help the user to perform the gesture associated with the character he wants. To enhance the visual feedback, the guides are spread over several pages ... Keywords: dynamic guides, text entry, unistroke

Jrmy Thimont; Benot Martin

2010-09-01T23:59:59.000Z

211

Microsoft Word - Final AEP EA, October 2010 ver 2  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ASSESSMENT DOE/EA-1727 DEPARTMENT OF ENERGY LOAN GUARANTEE TO AE POLYSILICON CORPORATION FOR CONSTRUCTION AND STARTUP OF THEIR PHASE 2 POLYSILICON PRODUCTION FACILITY IN FAIRLESS HILLS, PENNSYLVANIA U.S. Department of Energy Loan Guarantee Program Office Washington, DC 20585 November, 2010 TABLE OF CONTENTS Section Page November 2010 Final Environmental Assessment i EXECUTIVE SUMMARY ........................................................................................................... ES-1 1. PURPOSE AND NEED 1.1 Purpose and Need ................................................................................................................. 1-1 1.2 Background ............................................................................................................................ 1-1

212

Microsoft Word - US_Japan_REE_agenda_ver7.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agenda
 Agenda
 
 U.S.
-
Japan
Roundtable
on
Rare
Earth
Elements
Research
and
 Development
for
Clean
Energy
Technologies
 
 Thursday-Friday,
November
18-19,
2010
 Building
453,
Black
Diamond
Conference
Room
1012
 
 U.S.
Department
of
Energy
 Lawrence
Livermore
National
Laboratory
 
 THURSDAY,
November
18,
2010
 7:30

 Badging
Westgate
Badge
Office
 
 Met
by
Evelyn
Laurant
 
 8:30
-
9:00
 Welcome
and
Introduction
to
the
Roundtable
 
 Al
Ramponi,
Lawrence
Livermore
National
Laboratory
 
 Kay
Thompson
and
Diana
Bauer,
Department
of
Energy
 
 9:00
-
9:30
 A
Brief
Overview
of
the
Rare
Earths
Crisis


213

DISTRIBUTION - ver2 - Matlock AISI Workshop Feb2012  

Science Conference Proceedings (OSTI)

... (% ) 600 - Conventional HSS First Generation AHSS ISO ... Baosteel's Special Flexible HSS Line Opened March 2009 Multi-purpose processing ...

2012-10-09T23:59:59.000Z

214

NIST: Electron-Impact Cross Section Database - Ver. History  

Science Conference Proceedings (OSTI)

... date]. Version 3.0 August 2004, Electron-impact cross section data has been added for many molecules and atoms. Version ...

215

LCLS-scheduling-run_6_Ver4.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon...

216

University of Calgary Design Standards 2013 Ver. 1.1  

E-Print Network (OSTI)

Sustainability 4.2 Room Acoustics 4.3 Accessibility 4.4 Building & Site Safety 5.0 Product and System Requirements 5.1 Basic Construction Materials & Systems 5.2 Exterior Wall Systems 5.3 Roofing 5.4 Reserved for Future 5.5 Doors & Hardware 5.6 Glazing Systems 5.7 Flooring 5.8 Ceilings 5.9 Interior Wall Types

Maurer, Frank

217

University of Calgary Design Standards 2013 Ver. 1.0  

E-Print Network (OSTI)

Sustainability 4.2 Room Acoustics 4.3 Accessibility 4.4 Building & Site Safety 5.0 Product and System Requirements 5.1 Basic Construction Materials & Systems 5.2 Exterior Wall Systems 5.3 Roofing 5.4 Reserved for Future 5.5 Doors & Hardware 5.6 Glazing Systems 5.7 Flooring 5.8 Ceilings 5.9 Interior Wall Types

Maurer, Frank

218

Clouds, Aerosols and Precipitation in the Marine Boundary Layer (CAP-MBL) AMF Deployment Graciosa Island, Azores, NE Atlantic Ocean May 2009-December 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

the Marine Boundary Layer (CAP-MBL) Graciosa Island, Azores, NE Atlantic Ocean May 2009-December 2010 Rob Wood, University of Washington CAP-MBL Proposal Team AMF Deployment Team Thanks to Mark Miller: AMF Site Scientist Kim Nitschke: AMF Site Manager Importance of Low-Clouds for Climate Imperative that we understand the processes controlling the formation, maintenance and dissipation of low clouds in order to improve their representation in climate models. Which clouds matter for climate sensitivity? Climate Feedbacks Model Intercomparison Project (CFMIP) 12 slab ocean models 2xCO 2 - control Correlation of global mean CRF with local values Mark Webb, Hadley Center 90 N 45 N 0 45 S 90S 0 90 E 180 90 W 0

219

REP&" TO A~NOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio iin Support  

Office of Legacy Management (LM)

tifr'itG!'l' &i&s Coverament tifr'itG!'l' &i&s Coverament --_ , ,&,.i +.&r, ,' ,T.L ' Department of Energy / REP&" TO A~NOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio iin Support of FMPC Operations TO: Robert E. Lynch Procuremnent and Contracts Division, AD-42 Oak Ridge Operations Office , / I I The Division of Facility and Site Oecomnissioning Projects (OF%) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (WED) and Atomic Energy Commission (AEC) which may have been'radioactively contaminated as a result of these operations, (5) to determine if the

220

Enhanced T-lymphocyte blastogenic response to tuberculin (PPD) in children of northeast (NE) Thailand supplemented with vitamin A (VA) and zinc (Zn)  

SciTech Connect

Beneficial effects of Va and/or Zn supplementation of children in NE Thailand are described in a companion abstract. In the same study, blastogenic response (BR) of T-lymphocytes to concanavalin-A (ConA) and PPD were assayed in cultures containing mononuclear cells (MNC) or whole blood (WB). Methods were previously described. Children were previously vaccinated with BCG. BR to ConA of MNC or WB from children supplemented with VA, Zn, VA + Zn or placebo were similar. BR to PPD of MNC was higher in children receiving VA + Zn than placebo, but not in children supplemented with VA or Zn alone. Data indicate that children with suboptimal VA and Zn nutriture supplemented with < 2 times RDA of these nutrients showed enhanced cellular immunity to PPD. This observation is relevant to BCG immunization program and thus may benefit public health.

Kramer, T.R.; Udomkesmalee, E.; Dhanamitta, S.; Sirisinha, S.; Charoenkiatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Smith, J.C. Jr. (Dept. of Agriculture, Beltsville, MD (United States) Mahidol Univ., Nakhon Pathom (Thailand))

1991-03-15T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Idaho National Laboratory Ten-year Site Plan (2012 through 2021) -- DOE-NE's National Nuclear Capability -- Developing and Maintaining the INL Infrastructure  

Science Conference Proceedings (OSTI)

To meet long-term objectives to transform the Idaho National Laboratory (INL), we are providing an integrated, long-term vision of infrastructure requirements that support research, development and demonstration (RD&D) goals outlined in the DOE strategic plans, including the NE Roadmap and reports such as Facilities for the Future of Nuclear Energy Research: A Twenty-year Outlook. The goal of the INL Ten-year Site Plan (TYSP) is to clearly link RD&D mission goals and INL core capabilities with infrastructure requirements (single and multi-program), establish the 10-year end-state vision for INL complexes, identify and prioritize infrastructure and capability gaps, as well as the most efficient and economic approaches to closing those gaps.

Cal Ozaki

2010-06-01T23:59:59.000Z

222

Ne{sup +} ion sputtering effect on amorphous Ga-In-Zn-O thin-film surface investigated by high-resolution XPS  

Science Conference Proceedings (OSTI)

The effect of Ne{sup +} ion sputtering on amorphous Ga-In-Zn-O (a-GIZO) thin films was investigated by using surface-sensitive, synchrotron-radiation-based, high-resolution X-ray photoelectron spectroscopy (XPS). a-GIZO thin films having different compositions (Ga{sub 2}O{sub 3}:In{sub 2}O{sub 3}:ZnO = 1:1:1, 2:2:1, 3:2:1, 4:2:1) were investigated. It was found out that the amounts of the In and Zn contents relative to that of Ga decreased noticeably after sufficient sputtering, and that there occurred a subgap state above the valence band maximum and metallic states at the In 3d and 4d core levels as well as at the Fermi edge.

Kang, Se-Jun; Lee, Mi Ji [Department of Physics, POSTECH, Pohang 790-784 (Korea, Republic of); Baik, Jae Yoon; Kim, Hyeong-Do; Thakur, Anup [Pohang Accelerator Laboratory, POSTECH, Pohang 790-784 (Korea, Republic of); Shin, Hyun-Joon [Department of Physics, POSTECH, Pohang 790-784 (Korea, Republic of); Pohang Accelerator Laboratory, POSTECH, Pohang 790-784 (Korea, Republic of); Chung, JaeGwan; Lee, Eunha; Lee, Jaecheol; Lee, JaeHak [A E Group, Samsung Advanced Institute of Technology, Yongin-si 440-712 (Korea, Republic of)

2011-12-23T23:59:59.000Z

223

Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS) Code Verification and Validation Data Standards and Requirements: Fluid Dynamics Version 1.0  

SciTech Connect

V&V and UQ are the primary means to assess the accuracy and reliability of M&S and, hence, to establish confidence in M&S. Though other industries are establishing standards and requirements for the performance of V&V and UQ, at present, the nuclear industry has not established such standards or requirements. However, the nuclear industry is beginning to recognize that such standards are needed and that the resources needed to support V&V and UQ will be very significant. In fact, no single organization has sufficient resources or expertise required to organize, conduct and maintain a comprehensive V&V and UQ program. What is needed is a systematic and standardized approach to establish and provide V&V and UQ resources at a national or even international level, with a consortium of partners from government, academia and industry. Specifically, what is needed is a structured and cost-effective knowledge base that collects, evaluates and stores verification and validation data, and shows how it can be used to perform V&V and UQ, leveraging collaboration and sharing of resources to support existing engineering and licensing procedures as well as science-based V&V and UQ processes. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base to provide V&V and UQ resources for M&S for nuclear reactor design, analysis and licensing. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear power. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors.

Greg Weirs; Hyung Lee

2011-09-01T23:59:59.000Z

224

A confirmative spin-parity assignment for the key 6.15 MeV state in $^{18}$Ne of astrophysical importance  

E-Print Network (OSTI)

Proton resonant states in $^{18}$Ne have been investigated by the resonant elastic scattering of $^{17}$F+$p$. The $^{17}$F beam was separated by the CNS radioactive ion beam separator (CRIB), and bombarded a thick H$_2$ gas target at 3.6 MeV/nucleon. The recoiled light particles were measured by using three sets of ${\\Delta}$E-E Si telescope at scattering angles of $\\theta$$_{lab}$$\\approx 3^\\circ$, 10$^\\circ$ and 18$^\\circ$, respectively. Four resonances, {\\it i.e.}, at $E_{x}$=6.15, 6.30, 6.85, and 7.05 MeV, were observed clearly. By $R$-matrix analysis of the excitation functions, $J^{\\pi}$=1$^-$ was firmly assigned to the 6.15 MeV state which is a key state in calculating the reaction rate of $^{14}$O($\\alpha$,$p$)$^{17}$F reaction. This reaction was thought to be one of the most probable key reactions for the breakout from the hot-CNO cycle to the $rp$-process in type I x-ray bursts In addition, a new excited state observed at $E_{x}$=6.85 MeV was tentatively assigned as 0$^{-}$, which could be the analog state of 6.880 MeV, 0$^{-}$ in mirror $^{18}$O.

J. Hu; J. J. He; S. W. Xu; H. Yamaguchi; K. David; P. Ma; J. Su; H. W. Wang; T. Nakao; Y. Wakabayashi; T. Teranishi; J. Y. Moon; H. S. Jung; T. Hashimoto; A. Chen; D. Irvine; S. Kubono

2013-06-17T23:59:59.000Z

225

CBRCFactSh10-30-07  

NLE Websites -- All DOE Office Websites (Extended Search)

the CBRC? the CBRC? The Combustion Byproducts Recycling Consortium (CBRC) supports and promotes the commercially viable and environmentally-sound recycling of CCBs (coal combustion byproducts). These materials are left behind after coal is burned to generate electricity. Once viewed as waste, the CBRC recognizes the value of CCBs as a resource and provides seed money for researchers to develop and field test innovative and productive uses for these materials. Why is the CBRC Needed? According to the American Coal Foundation, U.S. coal deposits contain more energy than all of the world's oil reserves. With Americans increasingly concerned about the cost and security of foreign energy supplies, coal will continue to play a key role in supplying the Nation's electrical needs.

226

SH Coatings LP | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Element One, Inc. Element One, Inc. National Renewable Energy Laboratory 191524 likes Element One, based in Boulder, Colorado, has created the only available coatings that change color when detecting hydrogen and other hazardous gas leaks, either reversibly or non-reversibly, to provide both current and historical information about leaks. Element One's patented gas indicators and sensors use catalyzed thin films or nanoparticles of a transition metal oxide to create very low cost sensors for use in industrial and consumer environments, greatly reducing the potential for undetected leaks and their cost and safety implications. This technology is also being integrated for use in refineries, industry gas and fuel cells systems and was developed using technology from the National Renewable Energy Laboratory.

227

CBRCFactSh10-30-07  

NLE Websites -- All DOE Office Websites (Extended Search)

CBRC Needed? According to the American Coal Foundation, U.S. coal deposits contain more energy than all of the world's oil reserves. With Americans increasingly concerned about...

228

SH Coatings LP | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7AC Technologies, Inc. 7AC Technologies, Inc. National Renewable Energy Laboratory 498 likes 7AC Technologies, based in Woburn, Massachusetts, is developing Liquid Desiccant HVAC systems for Commercial and Industrial buildings using technology from the National Renewable Energy Laboratory. These Liquid Desiccant HVAC systems deliver a 50 to 75 percent reduction in energy usage over conventional HVAC units. The system consists of a membrane conditioner responsible for drying and cooling the air and a heat-driven regenerator. The liquid desiccant design allows for the utilization of solar or waste heat sources, paving the way for net-zero energy retrofits to existing buildings with costs comparable to conventional HVAC. Learn More Borla Performance Industries, Inc. Oak Ridge National Laboratory

229

SH Coatings LP | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Integrated Dynamic Electron Solutions, Inc. Integrated Dynamic Electron Solutions, Inc. Lawrence Livermore National Laboratory 333 likes Integrated Dynamic Electron Solutions, Inc., based in Belmont, California, uses Dynamic Transmission Electron Microscopes (DTEM) to enable imaging of nanoscale objects, such as proteins, thin films and nanoparticles at unprecedented time scales and frame rates. By utilizing a laser-driven electron source, DTEMs are able to produce short bursts of electrons that can form an image with nanometer resolution in as little as 10 nanoseconds. This enables observation of dynamics in material systems that play an important role in a wide range of energy technologies, including battery electrodes, petroleum catalysts, solar cell materials, and organisms for bio fuel growth. Integrated Dynamic Electron Solutions uses technology

230

Data Analysis Sheet SH.1.a  

Science Conference Proceedings (OSTI)

... NA. For CMOS chips, which iteration of the test structure where "first" corresponds to the topmost test structure in the column? 6, orient, 0 90. 180. ...

231

Data Analysis Sheet SH.2.a  

Science Conference Proceedings (OSTI)

... For CMOS chips, which iteration of the test structure where "first" corresponds to the topmost test structure in the column? 7, orient =, 0 90 180. ...

232

Plutonium stabilization and handling (PuSH)  

SciTech Connect

This Functional Design Criteria (FDC) addresses construction of a Stabilization and Packaging System (SPS) to oxidize and package for long term storage remaining plutonium-bearing special nuclear materials currently in inventory at the Plutonium Finishing Plant (PFP), and modification of vault equipment to allow storage of resulting packages of stabilized SNM for up to fifty years. The major sections of the project are: site preparation; SPS Procurement, Installation, and Testing; storage vault modification; and characterization equipment additions. The SPS will be procured as part of a Department of Energy nationwide common procurement. Specific design crit1460eria for the SPS have been extracted from that contract and are contained in an appendix to this document.

Weiss, E.V.

1997-01-23T23:59:59.000Z

233

Energy for the future with Ris from nuclear power to sustainable energy Ris NatioNal laboRatoRy foR sustaiNable eNeRgy  

E-Print Network (OSTI)

Energy for the future ­ with Risø from nuclear power to sustainable energy Risø NatioNal laboRatoRy foR sustaiNable eNeRgy edited by MoRteN JastRup #12;Energy for the future #12;Energy for the future ­ with Risø from nuclear power to sustainable energy Translated from 'Energi til fremtiden ­ med Risø fra

234

Research Needs for Fusion-Fission Hybrid Systems. Report of the Research Needs Workshop (ReNeW) Gaithersburg, Maryland, September 30 - October 2, 2009  

Science Conference Proceedings (OSTI)

Largely in anticipation of a possible nuclear renaissance, there has been an enthusiastic renewal of interest in the fusion-fission hybrid concept, driven primarily by some members of the fusion community. A fusion-fission hybrid consists of a neutron-producing fusion core surrounded by a fission blanket. Hybrids are of interest because of their potential to address the main long-term sustainability issues related to nuclear power: fuel supply, energy production, and waste management. As a result of this renewed interest, the U.S. Department of Energy (DOE), with the participation of the Office of Fusion Energy Sciences (OFES), Office of Nuclear Energy (NE), and National Nuclear Security Administration (NNSA), organized a three-day workshop in Gaithersburg, Maryland, from September 30 through October 2, 2009. Participants identified several goals. At the highest level, it was recognized that DOE does not currently support any R&D in the area of fusion-fission hybrids. The question to be addressed was whether or not hybrids offer sufficient promise to motivate DOE to initiate an R&D program in this area. At the next level, the workshop participants were asked to define the research needs and resources required to move the fusion-fission concept forward. The answer to the high-level question was given in two ways. On the one hand, when viewed as a standalone concept, the fusion-fission hybrid does indeed offer the promise of being able to address the sustainability issues associated with conventional nuclear power. On the other hand, when participants were asked whether these hybrid solutions are potentially more attractive than contemplated pure fission solutions (that is, fast burners and fast breeders), there was general consensus that this question could not be quantitatively answered based on the known technical information. Pure fission solutions are based largely on existing both fusion and nuclear technology, thereby prohibiting a fair side-by-side comparison. Another important issue addressed at the conference was the time scale on which long-term sustainability issues must be solved. There was a wide diversity of opinion and no consensus was possible. One group, primarily composed of members of the fission community, argued that the present strategies with respect to waste management (on-site storage) and fuel supply (from natural uranium) would suffice for at least 50 years, with the main short-term problem being the economics of light water reactors (LWRs). Many from the fusion community believed that the problems, particularly waste management, were of a more urgent nature and that we needed to address them sooner rather than later. There was rigorous debate on all the issues before, during, and after the workshop. Based on this debate, the workshop participants developed a set of high-level Findings and Research Needs and a companion set of Technical Findings and Research Needs. In the context of the Executive Summary it is sufficient to focus on the high-level findings which are summarized.

None

2009-09-30T23:59:59.000Z

235

AN AGGREGATED VECTORIAL MODEL OF PETROLEUM FLOW IN THE UNITED STATES  

E-Print Network (OSTI)

FLOV J, EX/:I~S~:~: W " EXXON C DI 10/12/78 J SH/lA/01678 K ' PIPELINE 142 W EXXON LUNIQUE FLOW> C " SHELL OF SH/lA/016 K PIPEllNE 142 W EXXON C SHEll OF 10/25178

Krishnan, V. V.

2011-01-01T23:59:59.000Z

236

Examination and experimental constraints of the stellar reaction rate factor $N_A $ of the $^{18}$Ne($?$,$p$)$^{21}$Na reaction at temperatures of X-Ray Bursts  

E-Print Network (OSTI)

The $^{18}$Ne($\\alpha$,$p$)$^{21}$Na reaction is one key for the break-out from the hot CNO-cycles to the $rp$-process. Recent papers have provided reaction rate factors $N_A $ which are discrepant by at least one order of magnitude. The compatibility of the latest experimental results is tested, and a partial explanation for the discrepant $N_A$ is given. A new rate factor is derived from the combined analysis of all available data. The new rate factor is located slightly below the higher rate factor by Matic {\\it et al.}\\ at low temperatures and significantly below at higher temperatures whereas it is about a factor of five higher than the lower rate factor recently published by Salter {\\it et al.}

P. Mohr; A. Matic

2013-03-06T23:59:59.000Z

237

Heavy isotope production by multinucleon transfer reactions with /sup 254/Es. [101 MeV /sup 16/O, 98 MeV /sup 18/O, 127 MeV /sup 22/Ne  

Science Conference Proceedings (OSTI)

Fast automated on-line and quasi-on-line radiochemical techniques were applied to search for new isotopes, to measure their decay characteristics, and to study the cross sections of the heaviest, most neutron-rich actinide isotopes in reactions of /sup 16,18/O and /sup 22/Ne projectiles with /sup 254/Es as a target. The measured yields for isotopes up to Lr-260 are three or more orders of magnitude higher than in any other reaction used so far. A comparison with data for similar transfers from /sup 248/Cm targets is made. Transfer cross sections are extrapolated for the production of unknown, neutron-rich isotopes of elements 101 through 105, and the unique potential of /sup 254/Es as a target to make these exoctic nuclei accessible is demonstrated. 18 refs., 2 figs., 1 tab.

Schaedel, M.; Bruechle, W.; Bruegger, M.; Gaeggeler, H.; Moody, K.J.; Schardt, D.; Suemmerer, K.; Hulet, E.K.; Douran, A.D.; Dougan, R.J.

1985-01-01T23:59:59.000Z

238

Please cite this article in press as: Gilfillan, S.M.V., et al., He and Ne as tracers of natural CO2 migration up a fault from a deep reservoir. Int. J. Greenhouse Gas Control (2011), doi:10.1016/j.ijggc.2011.08.008  

E-Print Network (OSTI)

of Greenhouse Gas Control journal homepage: www.elsevier.com/locate/ijggc He and Ne as tracers of natural CO22 Noble gases Carbon isotopes Geological storage of CO2 Natural analogues a b s t r a c t Capture that could arise from a diffuse leakage of CO2 from a storage site. This is because there are many natural

239

BASIN VER DE GREAT ER ANETH BU G BAR KER DOME HOR SESH OE UTE DOME  

U.S. Energy Information Administration (EIA) Indexed Site

Liquids Reserve Class Liquids Reserve Class 0 20 40 10 30 Miles ± The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and Nature of Restrictions to Their Development", prepared by the US Departments of Interior, Agriculture and Energy. Unnamed fields and fields generically named "wildcat" were renamed to a concatenate of their basin and state of occurrence,

240

BASIN VER DE GREAT ER ANETH BU G BAR KER DOME HOR SESH OE UTE DOME  

U.S. Energy Information Administration (EIA) Indexed Site

BOE Reserve Class BOE Reserve Class 0 20 40 10 30 Miles ± The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and Nature of Restrictions to Their Development", prepared by the US Departments of Interior, Agriculture and Energy. Unnamed fields and fields generically named "wildcat" were renamed to a concatenate of their basin and state of occurrence,

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Ver. SV2011-06-16 Subject study plan at doctoral level  

E-Print Network (OSTI)

at international accelerator facilities, with the use of large gamma-ray and particle detector system. Detector of phase transitions, critical phenomena and strongly correlated systems. The research aims to provide phase transitions, exotic quantum fluids, complex systems, nano-systems, disordered systems, soft matter

Haviland, David

242

fall/winter 2010 | VOl 27 | no 3 UniVerSitYMaGaZine  

E-Print Network (OSTI)

-setting public-private collaboration that naturally builds on Say yes, we unveiled 2+2 joint admission agreements

Raina, Ramesh

243

Run05 Proton Beam Polarization Measurements by pC-Polarimeter (ver. 1.1)  

DOE Green Energy (OSTI)

The polarization of the proton beams [1, 2] at the Relativistic Heavy Ion Collider (RHIC)[3] RHIC ring. The H-Jet polarimeter is located at the collision point allowing measurements of absolute normalization is provided by the hydrogen polarimeter, which measures over 1 {approx} 2 another measurement rather than measuring the absolute polarization. both beams. Two identical pC-polarimeters are equipped in the yellow and blue rings, where carbon ribbon target, providing fast feedback to beam operations and experiments. The days to obtain {approx} 5% statistical uncertainty (in Run05). Thus, the operation of the carbon is measured using both an atomic beam source hydrogen gas jet (H-Jet)[4, 5] and proton-carbon polarimeters was focused on better control of relative stability between one measurement to statistical accuracy within 20 to 30 seconds using an ultra-thin (typically 6 {approx} 8 {micro}g/cm{sup 2}) the rings are separated. The pC-polarimeter measures relative polarization to a few percent.

Nakagawa,I.; Alekseev, I.; Bazilevsky, A.; Bravar, A.; Bunce, G.; Dhawan, S.; Eyser, K.O.; Gill, R.; Haeberli, W.; Huang, H.; Makdisi, Y.; Nass, A.; Okada, H.; Stephenson, E.; Svirida, D.N.; Wise, T.; Wood, J.; Yip, K.; Zelenski, A.

2008-07-01T23:59:59.000Z

244

BASIN VER DE GREAT ER ANETH BU G BAR KER DOME HOR SESH OE UTE DOME  

U.S. Energy Information Administration (EIA) Indexed Site

Gas Reserve Class Gas Reserve Class 0 20 40 10 30 Miles ± The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and Nature of Restrictions to Their Development", prepared by the US Departments of Interior, Agriculture and Energy. Unnamed fields and fields generically named "wildcat" were renamed to a concatenate of their basin and state of occurrence,

245

Microsoft Word - 802.11i Rec Practices _KM-BL final edit ver 10_.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Securing WLANs Securing WLANs using 802.11i Draft Recommended Practice February 2007 Securing WLANs using 802.11i Draft Author: Ken Masica, Lawrence Livermore National Laboratory February 2007 for Idaho National Laboratory Critical Infrastructure Protection Center Idaho Falls, Idaho 83415 Prepared by Lawrence Livermore National Laboratory Recommended Practices Guide Securing WLANs using 802.11i Ken Masica Vulnerability & Risk Assessment Program (VRAP) Lawrence Livermore National Laboratory (LLNL) for DHS US CERT Control Systems Security Program (CSSP) October 2006 This work was performed under the auspices of the U.S. Department of Energy by University of California, Lawrence Livermore National Laboratory under Contract W- 7405-Eng-48.

246

Microsoft PowerPoint - CERTS OMS Mani June 2013 ver1 [Compatibility Mode]  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

System System Mani V. Venkatasubramanian Washington State University, Pullman, WA mani@eecs.wsu.edu 28 June 2013 Washington, DC DOE/OE Transmission Reliability Program Project Objectives Oscillation Monitoring System for WECC and Entergy Monitoring hundreds of PMUs simultaneously System modes are changing - adaptive engines Interactions with power electronics Damping Monitor Engine - ambient data analysis Event Analysis Engine - detection and analysis of ringdowns and oscillations Real-time engines and off-line engines Project Background for Entergy SGIG project: Damping Monitor Engine - Real-time (DMR) based on FDD. Implemented since July 2011 Can handle up to 30 PMUs simultaneously CERTS project: Extending the capability of real-time DME, Verification of results and follow-up

247

1 BWeb for Modeling the Environment Limnology, March 2012 Ver 5 Andrew Ford Andrew Ford  

E-Print Network (OSTI)

. The simulations show growth in biomass in the lake, and the pattern of growth looks somewhat like the S-shaped growth described in Chapter 7 of the book. Perhaps the dynamics of biomass growth is governed by feedback? If so, label the loop as (+) or (-). biomass P biomass P death detritus P detritus P decay nutrient P

Ford, Andrew

248

Physics 121 Common Exam 1, Spring 2012, Ver A Name (Print): _______________________________ 4 Digit ID:________ Section: ______  

E-Print Network (OSTI)

zlargeforaxisdipoleon z p E 3 0 1 2 ++++ #12;Page of 78 ANSWER KEY: Spring 2012 Physics 121 Common Exam 1, Version A 1 angle does the electric field vector at the center of the square make with the x -axis? The angle. For the square configuration of the preceding problem, find the magnitude of the electric field in the center

Janow, Rich

249

SeisTool Ver. 2.1 User`s Guide  

DOE Green Energy (OSTI)

SeisTool is an interactive graphical tool that allows you to analyse seismograms. It runs under the X window environment. The current version employs an OpenLook graphical user interface. It is designed for convenient display of seismograms and handling of events for routine analysis. It also allows phase picking to be done smoothly. A number of time-series analysis operations have also been implemented. Here, is a brief guide to the operation of SeisTool. The intention of this User`s Guide is not to guide you through SeisTool step by step, (The best way of learning how to use SeisTool is run the program and experiment with it.) but, to present a few basic concepts behind SeisTool to acquaint you with the program. The goal of this prototype is to make analysing seismograms as easy and convenient as browsing a file with a text editor. Think of SeisTool as nothing more than a seismogram data file browser.

Yu, A.K.

1993-08-01T23:59:59.000Z

250

Se trans-corporer Vers une auto-transformation de l'humain ?  

E-Print Network (OSTI)

(contamination OGM, Clonage humain, neurobiologie du comportement). Le risque d'une police totale par les RIFD et Peter 3 Pièces et main d'oeuvre, 2008, RIFD : la police totale. Puces intelligente et mouchardage

Paris-Sud XI, Université de

251

Microsoft PowerPoint - TextVerSPE-ATCE-MHT-FutureAsGivenRev1...  

NLE Websites -- All DOE Office Websites (Extended Search)

Slimhole vs. Microhole: Future of E&P National Energy Technology Laboratory-SCNGO Office of Fossil Energy 2005 SPE ATCE Slimhole Drilling Session Roy Long Oil E&P Technology...

252

Vers une commande sans mod\\`ele pour am\\'enagements hydro\\'electriques en cascade  

E-Print Network (OSTI)

A new concept called "Model-Free Control" is applied to hydroelectric run-of-the river power plants, with severe constraints and operating conditions. Numerous computer simulations display excellent results, which are obtained thanks to simple and robust algorithms.

Join, Cdric; Fliess, Michel

2010-01-01T23:59:59.000Z

253

ver the last few years, the helical mirror or "spinner" has become a popular decora-  

E-Print Network (OSTI)

is a good teaching tool. To facilitate student exploration, we suggest some questions and provide brief is for the convex (concave) cross section. For distant objects (dobj >> f ), the magnitudes of both magnifications in the denominator means that more distant objects are less magnified, which also occurs for other magnifying mirrors

DeWeerd, Alan

254

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

March 23, 2010 March 23, 2010 DOE Announces Cooperative Agreement with USEC for American Centrifuge Demonstration Project The U.S. Department of Energy today announced that it finalized a cost-shared $90 million cooperative agreement with USEC Inc. to provide support for the continued development and demonstration of the American Centrifuge technology. March 17, 2010 U.S. and India hold the Third Meeting of the Indo-United States Civil Nuclear Energy Working Group India hosted the third meeting of the Indo-United States Civil Nuclear Energy Working Group in Mumbai, on Feb. 3-4, 2010. March 17, 2010 INL User Facility welcomes three new experiments The number of universities conducting nuclear energy experiments in Idaho National Laboratory's one-of-a-kind research reactor has now reached an

255

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 17, 2010 February 17, 2010 Deputy Secretary Poneman Addresses Nuclear Deterrence Summit Alexandria, VA - U.S. Deputy Secretary of Energy Daniel Poneman today addressed the opening session of the second annual Nuclear Deterrence Summit and discussed the Department of Energy's commitment to helping achieve the President's goals of reducing nuclear dangers and expanding the use of nuclear energy in a manner that minimizes the risks of proliferation. The Deputy Secretary also spoke about the Department's commitment to management excellence. February 16, 2010 Obama Administration Announces Loan Guarantees to Construct New Nuclear Power Reactors in Georgia President Obama today announced that the Department of Energy has offered conditional commitments for a total of $8.33 billion in loan guarantees for

256

NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

June 1, 2012 June 1, 2012 Navy personnel stationed in Idaho Falls, Idaho, in the mid 1950s learn how to operate the Nautilus S1W, the prototype of the Navy's first nuclear-powered submarine. | Photo courtesy of Idaho National Laboratory Veteran Leadership Strong at Idaho's Laboratory Idaho National Lab has played a large role in building fission reactors for Navy vessels - and then training those military personnel on how to use the equipment. February 15, 2012 Secretary Chu traveled to Waynesboro, Georgia, to visit the Vogtle nuclear power plant, the site of what will be the first new nuclear reactors to be built in the United States in three decades. | Image credit: Southern Company. Secretary Chu Visits Vogtle Nuclear Power Plant Secretary Chu traveled to Waynesboro, Georgia, to visit the Vogtle nuclear

257

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

April 15, 2011 April 15, 2011 Dr. Peter B. Lyons Confirmed as Assistant Secretary for Nuclear Energy Washington, D.C. - Dr. Peter B. Lyons was confirmed by the Senate on Thursday, April 14, as the Department of Energy's Assistant Secretary for Nuclear Energy. February 28, 2011 U.S. Department of Energy Issues Fiscal Year 2011 Funding Opportunity Announcements to Enhance Nuclear Energy Education Infrastructure The U.S. Department of Energy today announced two new fiscal year 2011 Funding Opportunity Announcements to support university and college efforts to build or expand their school's nuclear science and engineering basic research or education capabilities. February 18, 2011 Department of Energy Issues Call for Proposals to U.S. Universities for Nuclear Energy-Related Integrated Research Project Proposals

258

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 27, 2012 Energy Department Announces New Investments in University-Led Nuclear Energy Innovation Three University-Led Projects to Develop Next Generation Technologies,...

259

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

next generation of nuclear scientists and engineers. May 6, 2009 Secretary Chu Announces Funding for 71 University-Led Nuclear Research and Development Projects U.S. Energy...

260

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 20, 2012 January 20, 2012 Energy Department Takes First Step to Spur U.S. Manufacturing of Small Modular Nuclear Reactors Through the draft Funding Opportunity Announcement announced today, the Department will establish cost-shared agreements with private industry to support the design and licensing of SMRs. January 20, 2012 Energy Department Takes First Step to Spur U.S. Manufacturing of Small Modular Nuclear Reactors New Funding Opportunity Announcement Will Support SMR Design and Licensing for Widespread Commercial Use December 22, 2011 Secretary Chu Statement on AP1000 Reactor Design Certification U.S. Energy Secretary Steven Chu issued the following statement today in support of the Nuclear Regulatory Commission's (NRC) decision to certify Westinghouse Electric's AP1000 nuclear reactor design, a significant step

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 8, 2010 July 8, 2010 Department of Energy Announces more than $18 Million to Strengthen Nuclear Education at U.S. Universities and Colleges Awards $5 million for 117 scholarships and fellowships, and $13.2 million for infrastructure upgrades for university nuclear programs June 21, 2010 Global Nuclear Energy Partnership Steering Group Members Approve Transformation to the International Framework for Nuclear Energy Cooperation The Global Nuclear Energy Partnership Steering Group met in Accra, Ghana on June 16-17, 2010, and approved unanimously several transformative changes to reflect global developments that have occurred since the Partnership was established in 2007. June 2, 2010 International Working Group Meeting Focuses on Nuclear Power Infrastructure Development and Needs

262

NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 30, 2008 January 30, 2008 Artist's concept of the New Horizons spacecraft during its planned encounter with Pluto and its moon, Charon. The craft's miniature cameras, radio science experiment, ultraviolet and infrared spectrometers and space plasma experiments are run by the Department of Energy's Radioisotope Thermoelectric Generator (RTG). | Photo courtesy of Johns Hopkins University Applied Physics Laboratory/Southwest Research Institute (JHUAPL/SwRI) New Horizons Mission Powered by Space Radioisotope Power Systems The New Horizons spacecraft utilized a Radioisotope Thermoelectric Generator (RTG) to provide electricity and heat to the science instruments and other spacecraft components. January 29, 2008 Mars Science Laboratory, aka Curiosity, is part of NASA's Mars Exploration Program, a long-term program of robotic exploration of the Red Planet. It's powered by the Multi-Mission Radioisotope Thermoelectric Generator (MMRTG). Photo courtesy of NASA/JPL-Caltech.

263

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 29, 2011 September 29, 2011 United States and Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts PRAGUE, Czech Republic - The U.S. Department of Energy recently joined with the Řež Nuclear Research Institute, the U.S. September 28, 2011 Department of Energy Issues FY 2012 Request for Pre-Applications from U.S. Universities for Nuclear Energy Research and Development Proposals The U.S. Department of Energy today announced that its Nuclear Energy University Programs is now accepting pre-applications from universities interested in conducting nuclear energy research and development projects. September 21, 2011 Department of Energy Announces $17 Million to Bolster University-Led Nuclear Energy Research and Development

264

LLNL's NeMS: Network Mapping System  

High Performance Computing Innovation Center (Building 6475)located in LLNL's Livermore Valley Open Campus (LVOC) Seating is limited, Pre-registration ...

265

BASELINE IE-NE EXPERIMENTSUSING THE SPRACH ...  

Science Conference Proceedings (OSTI)

... Scott"; "Bloomberg News Service", later just "Bloomberg").The broadcast news transcriptions are not segmented into discourse units in any clearly ...

2011-08-22T23:59:59.000Z

266

COURSE NOTES: Nuclear Materials (NE120)  

Science Conference Proceedings (OSTI)

Feb 10, 2007 ... This resource provides PDF lecture notes and readings for an undergraduate course covering materials issues in nuclear power systems.

267

Microsoft Word - Lab call doc TEMPLATE ver 11.3 _may 3rd due date_.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

RESEARCH CALL TO DOE/FEDERAL LABORATORIES RESEARCH CALL TO DOE/FEDERAL LABORATORIES Technical Support for Interconnection-Level Electric Infrastructure Planning RC-BM-2010 CONTACT: Brian Mollohan, Project Manager TELEPHONE NUMBER: (304) 285-1367 FAX NUMBER: (304) 285-4403 E-MAIL: brian.mollohan@netl.doe.gov ISSUING OFFICE: U.S. DEPARTMENT OF ENERGY National Energy Technology Laboratory 3610 Collins Ferry Road, P. O. Box 880 Morgantown, WV 26507-0880 ISSUE DATE: April 1, 2010 DUE DATE: May 3, 2010 This Research Call uses funding from "The American Recovery and Reinvestment Act of 2009" and will be subject to special reporting requirements. The reporting requirements and other details will be provided later. 2 TABLE OF CONTENTS SECTION I - GENERAL INFORMATION

268

Microsoft Word - Lab call doc TEMPLATE ver 11.3 _may 3rd due date_.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RESEARCH CALL TO DOE/FEDERAL LABORATORIES RESEARCH CALL TO DOE/FEDERAL LABORATORIES Technical Support for Interconnection-Level Electric Infrastructure Planning RC-BM-2010 CONTACT: Brian Mollohan, Project Manager TELEPHONE NUMBER: (304) 285-1367 FAX NUMBER: (304) 285-4403 E-MAIL: brian.mollohan@netl.doe.gov ISSUING OFFICE: U.S. DEPARTMENT OF ENERGY National Energy Technology Laboratory 3610 Collins Ferry Road, P. O. Box 880 Morgantown, WV 26507-0880 ISSUE DATE: April 1, 2010 DUE DATE: May 3, 2010 This Research Call uses funding from "The American Recovery and Reinvestment Act of 2009" and will be subject to special reporting requirements. The reporting requirements and other details will be provided later. 2 TABLE OF CONTENTS SECTION I - GENERAL INFORMATION

269

February 20, 2013, 1Q FY2013 Quarterly Report on Federal Technical Capability  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Attachments Attachments cc w/attachments: FTCP Agents D. Chaney, NA-SH-2/FTCP Sr. Advisor P. Parrish, NA-SH-40 J. Yarrington, HS-10 3 Distribution: Deputy Secretary (DS) Under Secretary of Energy (US) Associate Deputy Secretary of Energy (DS) Under Secretary for Science (US) Director, Office of Science (SC-1) Acting Administrator, National Nuclear Security Administration (NA-1) Deputy Administrator for Defense Programs (NA-10) Chief of Nuclear Safety (CNS) Associate and Deputy Associate Administrator for S&H (NA-SH-1/2) Chief, Defense Nuclear Security (NA-70) Assistant Secretary for Environmental Management (EM-1) Assistant Secretary for Nuclear Energy, (NE-1) Chief Human Capital Management Officer (HC-1) Chief Health, Safety and Security Officer (HS-1)

270

Duke RNAi Core: Human shRNA Clone Requests To request clones from the Human shRNA library, please identify the relevant clones, then request through the  

E-Print Network (OSTI)

://katahdin.cshl.org:9331/rnai/repository/scripts/newmain.pl) 1. Enter Search term (gene name, keyword, accession, using RefSeq accession number (search results using other terms or identifiers are variable). 1. Find_ prefix. 2. Enter RefSeq # into query tool. Search by GenBank Accession (Email address is not required

Richardson, David

271

Microsoft Word - 2.8.12 NE Final Testimony  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Peter Lyons Peter Lyons Assistant Secretary for Nuclear Energy U.S. Department of Energy Before the Committee on Science, Space, and Technology U.S. House of Representatives Assessing America's Nuclear Future- A review of the Blue Ribbon Commission's Report to the Secretary of Energy February 8, 2012 Chairman Hall, Ranking Member Johnson, and Members of the Committee, thank you for the opportunity to appear before you today to discuss the Blue Ribbon Commission's (BRC) Report to the Secretary of Energy. The Commissioners worked collaboratively and constructively - through a public, open and transparent process - on recommendations to support a new strategy for the back end of the nuclear fuel cycle. The Administration commends the Commission for its

272

NE-24 Designation of Universal Cyclops, Inc., Titusville Plant  

Office of Legacy Management (LM)

Universal Cyclops, Inc., Titusville Plant Universal Cyclops, Inc., Titusville Plant Pennsylvania, for Remedial iiction under the Formerly Uti Remedial Action Program (FUSRAP) J. LaGrone, Manager Oak Ridge Operations Office Aliquippa, iized Sites pg!. " * 1 ' j---' R , 7. Based on the data in the attached report, it has been determined that the subject site is contaminated with radioactive residues as a result of Manhattan Engineer District/Atomic Energy Commission operations at the site. The contamination is in excess of acceptable guidelines and warrants designation for remedial action under the FUSRAP, Although the contamirta- tion levels exceed guidelines, the risk of exposure and associated health effects are low under current use and/or potential future use of the site; therefore, the site is designated as a low priority site for remedial -

273

Aussie LNG players target NE Asia in expansion bid  

SciTech Connect

Australia's natural gas players, keen to increase their presence in world liquefied natural gas trade, see Asia as their major LNG market in the decades to come. That's despite the fact that two spot cargoes of Australian Northwest Shelf LNG were shipped to Europe during the last 12 months and more are likely in 1994. Opportunities for growth are foreseen within the confines of the existing Northwest Shelf gas project for the rest of the 1990s. But the main focus for potential new grassroots project developers and expansions of the existing LNG plant in Australia is the expected shortfall in contract volumes of LNG to Japan, South Korea, and Taiwan during 2000--2010. Traditionally the price of crude oil has been used as a basis for calculating LNG prices. This means the economics of any new 21st century supply arrangements are delicately poised because of the current low world oil prices, a trend the market believes is likely to continue. In a bid to lessen the effect of high initial capital outlays and still meet projected demand using LNG from new projects and expansion of the existing plant, Australia's gas producers are working toward greater cooperation with prospective Asian buyers.

Not Available

1994-02-28T23:59:59.000Z

274

Nuclear Engineering (NE) and the Energy Engineering and Systems...  

NLE Websites -- All DOE Office Websites (Extended Search)

Achievements Highlights Fact Sheets, Brochures & Other Documents Multimedia Library About Nuclear Energy Nuclear Reactors Designed by Argonne Argonne's Nuclear Science and...

275

Microsoft Word - N01221_NE Site IRAP final.doc  

Office of Legacy Management (LM)

Northeast Site Northeast Site August 2008 Office of Legacy Management LMS/PIN/N01221 Work Performed Under DOE Contract No. for the U.S. Department of Energy Office of Legacy Management. DE-AM01-07LM00060 Approved for public release; distribution is unlimited. Office of Legacy Management Office of Legacy Management Office of Legacy Management U.S. Department of Energy This page intentionally left blank LMS/PIN/N01221 Pinellas Environmental Restoration Project Interim Remedial Action Plan for Source Removal at the Northeast Site August 2008 This page intentionally left blank U.S. Department of Energy Interim Remedial Action Plan for Source Removal at the Northeast Site August 2008 Doc. No. N0122100 Page iii Contents Acronyms and Abbreviations .........................................................................................................

276

NE-20 ACTION: SSDP Project Charter Revision CONCURRENCES RTG SYMBOL  

Office of Legacy Management (LM)

0 0 ACTION: SSDP Project Charter Revision CONCURRENCES RTG SYMBOL James W. Vaughan, Jr. N-923 Acting Assistant Secretary . for Nuclear Energy Murphi Attached for your signature is a revised Project Charter for the 1/ 86 Shippingport Station Decommissioning Project (SSDP). Since our original M determination in July that there was a need to revise the SSDP Charter, we N K23 have been in discussion with the Richland Operations Field Office (RL). INe Significant differences in management philosophy surfaced between RL and DeLaney Headquarters that required discussions up to and including the RL Manager DAE/86 and myself. I now feel that the revised Charter reflects a mutually acceptable working arrangement between the appropriate organizations. The RTGSYMBOL general roles and responsibilities defined in this Charter will facilitate

277

File:EIA-Williston-NE-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Northeast Part By 2001 BOE Reserve Class Northeast Part By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.94 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 18:49, 20 December 2010 Thumbnail for version as of 18:49, 20 December 2010 6,600 × 5,100 (5.94 MB) MapBot (Talk | contribs) Automated bot upload

278

File:EIA-Williston-NE-Liquids.pdf | Open Energy Information  

Open Energy Info (EERE)

Liquids.pdf Liquids.pdf Jump to: navigation, search File File history File usage Williston Basin, Northeast Part By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.95 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

279

NE-24 Gilman Hall, University of California, Certification Documentation  

Office of Legacy Management (LM)

Gilman Hall, University of California, Gilman Hall, University of California, Certification Documentation Berkeley, California, Conditional Verlette Gatlin, MA-232 I am attaching for entry into the Public Document Room, two copies of the subject documentation. These documents are the backup data for the conditional certification that the site is radiologically acceptable for restricted use as noted in the certification statement published in the Federal Register. Inasmuch as the conditional certification is made public through the Federal Register, it is prudent that the attached backup documentation also be available to the public. The docket consists of: 1. Introduction: Introduction to the certification docket for Gilman Hall, University of California, Berkeley, California. 2. Exhibit I: Summary of activities at Gilman Hall, University of

280

Ne?gali? asmen? ?sidarbinimo galimyb?s aptarnavimo sferoje.  

E-Print Network (OSTI)

??There are choice aspects of disabled people, of them profession territory in the post graduate. There are introduced with resolve and possibility of disabled (more)

Ivanauskait?,; Irma

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

CCpi0 Event Reconstruction at MiniBooNE  

SciTech Connect

We describe the development of a fitter to reconstruct {nu}{sub {mu}} induced Charged-Current single {pi}{sup 0} (CC{pi}{sup 0}) events in an oil Cerenkov detector (CH{sub 2}). These events are fit using a generic muon and two photon extended track hypothesis from a common event vertex. The development of ring finding and particle identification are described. Comparisons between data and Monte Carlo are presented for a few kinematic distributions.

Nelson, Robert H.; /Colorado U.

2009-09-01T23:59:59.000Z

282

Microsoft PowerPoint - NEAC Battelle NE Capabilities 062408.ppt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R&D Facility Requirements NEAC Meeting Progress Report June 24, 2008 2 Facilitization of U.S. Nuclear R&D Infrastructure Three-step study process: * First, ASNE requested Battelle...

283

Status of conversion of NE standards to national consensus standards  

SciTech Connect

This report is a summary of the activities that have evolved to effect conversion of nuclear energy standards to national consensus standards, and the status of current conversion activities.

Hudson, R.C.; McKee, R.O.

1989-03-01T23:59:59.000Z

284

Laser glazing of flat steel surface - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

flat steel surface Laser glazing of flat surface of steel parts is shown in the movie clip by moving the required beam over the surface at a constant speed...

285

Laser Rock Drilling Demo - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

Demo A high power pulsed Nd:YAG laser beam at Argonne's Laser Applications Lab is being shown in this movie to drill oil reservoir rock, a potential application in gas and oil well...

286

Laser Rock Perforation Demo - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

rock perforation demo High power laser beam can be used in oil well completion application for perforating oil reservoir rock and increasing rock's permeability for high oil...

287

Microsoft Word - NE Brief#70 Summary (10-12)  

NLE Websites -- All DOE Office Websites (Extended Search)

nuclear engineering or in an option program equivalent to a major. Thirty-two academic programs reported having nuclear engineering programs during 2011, and data was received from...

288

NE researchers win two R&D 100 Awards  

NLE Websites -- All DOE Office Websites (Extended Search)

Nuclear Safety Materials Disposition Decontamination & Decommissioning Nuclear Criticality Safety Nuclear Data Program Nuclear Waste Form Modeling Departments Engineering...

289

Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald

290

2010 Annual Planning Summary for Nuclear Energy (NE) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Annual Planning Summary for National Nuclear Security Administration Service Center (NNSA-SC) 2010 Annual Planning Summary for Defense Nuclear Nonproliferation (NA-20) 2010 Annual...

291

BASELINE IE-NE EXPERIMENTS USING THE SPRACH ...  

Science Conference Proceedings (OSTI)

... in which a limited set of entities is introduced and then re- ferred to in various ways (eg, Winston Scott, later just Scott; Bloomberg News Service ...

2011-08-22T23:59:59.000Z

292

ne Minute Guide to ... COMPENDEX on EiVillage  

E-Print Network (OSTI)

(*), Autostemming AND, OR, NOT (OR inserted between terms by default) "Author Affiliation" searches only the refine results feature. Click on Easy Search tab, enter keyword. * Refine results by clicking on the links under the listed subject headings. Under Search Results click the to delete the term SEARCH

California at Los Angeles, University of

293

CA CAIOlf Mr. Andrew Wallo. III, NE-23  

Office of Legacy Management (LM)

sites under consideration; and six institutions recently iden- q J-05 tified during a search of Hanford records. py&m I ;y. 2 8 The attached was prepared to document the...

294

CA M r. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

sites under consideration; and six institutions recently iden- hy .0-q tified during a search of Hanford records. ply&D r.'y. 2. g The attached was prepared to document the...

295

Confronting mass-varying neutrinos with MiniBooNE  

E-Print Network (OSTI)

We study the proposal that mass-varying neutrinos could provide an explanation for the LSND signal for \\bar\

V. Barger; D. Marfatia; K. Whisnant

2005-09-16T23:59:59.000Z

296

Table SH1. Total Households Using a Space Heating Fuel, 2005 ...  

U.S. Energy Information Administration (EIA)

Rural..... 22.3 21.9 7.4 4.3 2.3 0.4 5.1 2.4 Climate Zone 1 Less than 2,000 CDD and-- Greater than 7,000 HDD..... 10.9 ...

297

Excitation and Ionization in H(1s)-H(1s) Collisions  

DOE Green Energy (OSTI)

Hydrogen atom - hydrogen atom scattering is a prototype for many of the fundamental principles of atomic collisions. In this work we present an approximation to the H+H system for scattering in the intermediate energy regime of 1 to 100 keV. The approximation ignores electron exchange and two-electron excitation by assuming that one of the atoms is frozen in the 1s state. We allow for the evolution of the active electron by numerically solving the 3D Schroedinger equation. The results capture many features of the problem and are in harmony with recent theoretical studies. Excitation and ionization cross sections are computed and compared to other theory and experiment. New insight into the mechanism of excitation and ionization is inferred from the solutions.

Riley, Merle E.; Ritchie, A. Burke

1999-07-15T23:59:59.000Z

298

Coincident P and Sh reflections from basement rocks at Coso geothermal...  

Open Energy Info (EERE)

the steam field, (2) examining the Tertiary sedimentary basins in Rose Valley and Coso Wash, (3) testing the structural relationship of the Mesozoic Sierran basement to the...

299

Table SH9. Average Expenditures for Space Heating by Main Space ...  

U.S. Energy Information Administration (EIA)

A household is assigned to a climate zone according to the 30-year average annual degree-days for an appropriate nearby weather station.

300

Table SH1. Total Households Using a Space Heating Fuel, 2005 ...  

U.S. Energy Information Administration (EIA)

Total Households Using a Space Heating Fuel, 2005 Million U.S. Households Using a Non-Major Fuel 5 ... Space Heating (millions) Energy Information Administration

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Table SH2. Total Households by Space Heating Fuels Used, 2005 ...  

U.S. Energy Information Administration (EIA)

Total Households by Space Heating Fuels Used, 2005 ... 2005 Residential Energy Consumption Survey: ... Electricity Natural Gas Fuel Oil Kerosene LPG Other

302

Table SH5. Total Expenditures for Space Heating by Major Fuels ...  

U.S. Energy Information Administration (EIA)

Space Heating Fuel 4 (millions) Fuel Oil U.S. Households ... 2005 Residential Energy Consumption Survey: Energy Consumption and Expenditures Tables. Natural Gas

303

Isotope-selective laser molecular alignment Sharly Fleischer, I. Sh. Averbukh, and Yehiam Prior*  

E-Print Network (OSTI)

and centrifuge-based separation methods rely on generic mechanical effects caused by small mass differences a wide range of topics to be studied. In the gas phase, molecular alignment follow- ing excitation that of an isotropic gas was monitored as evidence for alignment 14,15 . More recently, these observations have been

Prior, Yehiam

304

Microsoft Word - PARS II CPP Upload Requirements.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U U C (C Pro U.S. D Contrac CPP) U oject A S Phon Depart ctor Pr Upload Assessm System Vers Ap Su Energy E 20440 Cent German ne 301-916- ww tment roject P d Requ ment a m (PAR sion 1.4 Dr pril 9, 2010 ubmitted by nterprise So tury Blvd. S ntown, MD -0050 Fax ww.eesllc.ne t of En Perform uireme and Re RS II) raft 0 : olutions Suite 150 20874 301-916-00 et nergy mance ents for eportin 66 y e r ng ii Title Page Document Name: Contractor Project Performance (CPP) Upload Requirements for PARS II, V1.4 Publication Date: April 9, 2010 Contract Number: DE-AT01-06IM00102 Project Number: 1ME07, CLIN 2 Prepared by: Steven Ducharme, PMC, LLC Lenore Morrison, PMC, LLC Judith Bernsen, PMC, LLC Edited by: Dennis Stoner, EES, LLC Reviewed by: Mark Landry, Dekker, LTD

305

CREATED USING THE RSC REPORT TEMPLATE (VER. 3.1) -SEE WWW.RSC.ORG/ELECTRONICFILES FOR DETAILS [journal], [year], [vol], 0000 | 1  

E-Print Network (OSTI)

not been deposited with the Cambridge Crystallographic Data Center). Experimental and simulated X numbers of reference compounds; and the experimental and simulated X-ray powder diffraction patterns. Heterocycles 1997, 45, 2471­2474. (12) Marti, E. E. Thermochim. Acta 1973, 5, 173­220. (13) Roux, M. V.; Da

Harries, Daniel

306

IEEE Network March/April 201140 0890-8044/11/$25.00 2011 IEEE ver the last two decades, wireless and particu-  

E-Print Network (OSTI)

- tion has a direct impact on cost, embodied energy only has an indirect one depending on the pricing are resulting in increased demand for energy consumption in cel- lular networks. Energy Consumption of Cellular-hour) of the total worldwide electrical energy is consumed by information and communication tech- nology (ICT) [1

Chen, Min

307

Why perform time-lapse seismic monitoring? Is it to ver-ify the reservoir model? No! We should conduct time-lapse  

E-Print Network (OSTI)

, and that this implies that oil is being lost through the spill point, never to be recovered, even if that reservoir technologies, it has evolved into a test of petrophysics and reservoir models as well. The field of most, HORACIO ACEVEDO, JOSHUA I. HAATAJA, and ANASTASIA MINAEVA, Michigan Technological University, Houghton

308

Synoptic Aerial Surveys and Abundance Estimates for Ice-associated Seals in US and Russian Waters Michael Cameron, Peter Boveng, Erin Moreland and Jay Ver Hoef  

E-Print Network (OSTI)

Synoptic Aerial Surveys and Abundance Estimates for Ice-associated Seals in US and Russian Waters synoptic aerial surveys of the eastern Bering Sea in tandem with Russian researchers employed to survey. Testing a ship-based Unmanned Aerial System (UAS) for surveying the Bering Sea pack ice. AFSC Quarterly

309

172 AwA sh in Color: Fren C h And JApAnese prints French Prints  

E-Print Network (OSTI)

. and John T. Hazel, Jr. Endowed Chair Goodings, Deborah Sidney O. Dewberry Endowed Chair for Civil Chair in Economics Wegman, Edward J. Bernard J. Dunn Professor of Information Technology and Applied History Crew, Spencer History D'Andrea, Paul Theatre and English Hazen, Robert Earth Sciences Heclo, Hugh

He, Chuan

310

Computational analysis and prediction of the binding motif and protein interacting partners of the Abl SH3 domain  

E-Print Network (OSTI)

Ken Chen 1,2 , William A. McLaughlin 1,2 , Benzhuo Lu 1,2 ,Citation: Hou T, Chen K, McLaughlin WA, Lu B, Wang W (2006)

Hou, T J; Chen, K; McLaughlin, W A; Lu, B Z; Wang, W

2006-01-01T23:59:59.000Z

311

SachbuchAKTUELL Bitte faxen an: +49 (0)6221/345-4229 -Vielen Dank!  

E-Print Network (OSTI)

gelingen kann, Hochschulkarriere und Familie zu ver- einen. Birgit Piechulla (Hrsg.) Professorin und Mutter

Rostock, Universität

312

Microsoft PowerPoint - NE FY2012 Budget, SMR, and BRC 121311.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Update Update Dr. Peter Lyons Assistant Secretary for Nuclear Energy U.S. Department of Energy Nuclear Energy Advisory Committee Washington, DC December 13, 2011 2 Overview of NEAC Rotation Policy NEAC Statistics * Prior to new members being added in 2009, the average term for the Committee was about 10 years * Reappointed all 16 members with 5 rotating out by September 30 th 2012 * Rotating Members: John Ahearne (Vice-Chair), Marv Fertel, Thomas Cochran, Allen Sessoms, and Neil Todreas * Added Members: Matthew Bunn, Margaret Chu, Susan Eisenhower, Mujid Kazimi, Regis Matzie, Richard Meserve, and Alfred Sattelberger * Disciplines of new members include: Applied Physics, Fuel Element Design, Energy Efficiency, National Security, Advanced Reactor Development, and Nuclear Non-proliferation Issues.

313

6-15-2010_NE_Final_Testimony_R-Shane-Johnson.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R. Shane Johnson R. Shane Johnson Chief Operating Officer for Nuclear Energy U.S. Department of Energy before the Subcommittee on Energy Senate Committee on Energy and Natural Resources on S. 3233, the Surplus Uranium Disposition Act of 2010 June 15, 2010 Introduction Thank you, Madam Chairman, Ranking Member Risch, and Members of the Subcommittee. I appreciate this opportunity to appear before you and comment on legislation under consideration by the Committee, as well as to provide information on the Department of Energy's management and disposition of its excess uranium. The Administration continues to view nuclear power as an important element in its strategy to increase energy security and combat climate change. A strong domestic nuclear industry supports the expansion of clean, carbon-free nuclear energy in the

314

NE-23 List of California Sites Hattie Carwell. SAN/NSQA Division  

Office of Legacy Management (LM)

Hattie Carwell. SAN/NSQA Division Hattie Carwell. SAN/NSQA Division Attached for your information is the list Of Callfornia sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action Program (FUSRAP). None of the facilities listed qualified for FUSRAP. The only site in California that was included in FUSRAP was Gilman Hall on the University of California-Berkeley Campus. All California sites that are in our Surplus Facilities Management Program are under San Francisco Operations and are at the Santa Susana Field Laboratory or the University of California-Davis. If you have questions on any of the sites on th*? list, please call me at FTS 233-5439. Andrew Wallo III, Designation and Certification Manager Division of Facilitv and Site

315

Microsoft Word - N01401_NE and 4-5 Closure Mon Plan.doc  

Office of Legacy Management (LM)

Closure Monitoring Plan for the Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site August 2009 LMS/PIN/N01401 This page intentionally left blank LMS/PIN/N01401 Pinellas Environmental Restoration Project Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site August 2009 This page intentionally left blank U.S. Department of Energy Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site July 2009 Doc. No. N01401 Page i Contents 1.0 Introduction......................................................................................................................... 1 2.0 Summary of Source Removal Activities............................................................................. 1 3.0 Delineation of Contaminant Plumes ...................................................................................

316

Solubility of Gases in Glass. II. He, Ne, and H2 in Fused Silica  

Science Conference Proceedings (OSTI)

The statistical thermodynamics of the gas?in?glass system provides a basic model of both physical and chemical solubility. The physical solubility result is essentially equivalent to that for monatomic solubility. The chemical solubility result is dependent upon the specific system involved. The model was compared with experiment for a variety of systems. Helium and neon in fused silica were examples of the physical solubility of monatomic gases. Variations of the thermal history of the fused silica did not appear to have a measurable effect on physical solubility as evidenced in the helium data. Hydrogen in fused silica was an example of the physical solubility of polyatomic gases. Physical solubility was measured by a modified Seiverts technique and was characterized by a linear dependence on pressure. Binding energies for the physically dissolved species were of the order expected for van der Waals bonding. Vibrational frequencies were on the order of 1013 sec?1 with the heavier species having the lower frequencies. Hydrogen in fused silica was also an example of the chemical solubility of polyatomic gases. The literature gave data for the chemical solution of hydrogen in fused silica

James F. Shackelford; Perry L. Studt; Richard M. Fulrath

1972-01-01T23:59:59.000Z

317

EQUILIBRATION IN THE REACTION OF 175 and 252 MeV~;;20Ne WITH 197Au  

E-Print Network (OSTI)

and J. R. Huizenga, Nuclear Fission, Academic Press, N.Y. ,nuclear properties such as particle emission, and the systematics of fission

Moulton, James Bennett

2011-01-01T23:59:59.000Z

318

Welcome to the second edition of C&W's Energy and Sustainability Task Force Ne  

NLE Websites -- All DOE Office Websites (Extended Search)

second edition of C&W's Energy and Sustainability Task Force Newsletter. This second edition of C&W's Energy and Sustainability Task Force Newsletter. This publication illustrates how C&W is delivering on its commitment to enhance the environmental performance of commercial real estate. C&W Managed Properties Earn LEED Volume Certification In January 2010, 18 properties under C&W management earned LEED (Leadership in Energy and Environmental Design) certification utilizing the U.S. Green Building Council's (USGBC) Portfolio Program and volume certification process. More than half of the properties certified at the Platinum and Gold levels. Working closely with our clients, C&W is

319

Klein-NERAC NE education taskforce report 5-18-04  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department of Department of Nuclear Engineering & Radiation Health Physics Report of the Nuclear Energy Research Advisory Committee Nuclear Power Engineering Curriculum Task Force April 7, 2004 Department of Nuclear Engineering & Radiation Health Physics Task Force Members * Andrew C. Klein, Chair, Oregon State University * James F. Stubbins, University of Illinois, Champaign-Urbana * Gilbert Brown, University of Massachusetts, Lowell * Harold Ray, Southern California Edison * Eugene S. Grecheck, Dominion Energy Department of Nuclear Engineering & Radiation Health Physics Primary Concern Expressed * Nuclear engineering curricula had changed over recent times * No longer producing engineers with training optimal to the needs of the power industry Department of Nuclear Engineering

320

Ne?gali? asmen? sociokult?rinis ugdymas Utenos miesto bendruomen?je.  

E-Print Network (OSTI)

??After Lithuania has entered the world community not equal position of some social groups in society, especially disabled, came to light. Although disabled people are (more)

Treinien?,; Daiva

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Geophysical imaging methods for analysis of the Krafla Geothermal Field, NE Iceland  

E-Print Network (OSTI)

Joint geophysical imaging techniques have the potential to be reliable methods for characterizing geothermal sites and reservoirs while reducing drilling and production risks. In this study, we applied a finite difference ...

Parker, Beatrice Smith

2012-01-01T23:59:59.000Z

322

Magnetostratigraphy and small mammals of the Late Oligocene Banovii basin in NE Bosnia and Herzegovina  

E-Print Network (OSTI)

(AFEM) Berlin 08/14/61 06/01/63 X X X X X Bosnia and Herzegovina (Joint Endeavor) 11/20/95 12/20/96 X X X X X Bosnia and Herzegovina (Joint Guard) 12/20/96 Present X X X X X Cambodia 03/29/73 08/15/73 X X

Utrecht, Universiteit

323

Microsoft Word - N01357_NE Site Final LDA Report.doc  

Office of Legacy Management (LM)

Florida Statutes, and Rule 62-621.300(4), F.A.C., pursuant to FDEP's federally approved National Pollutant Discharge Elimination System storm water regulatory program. An FDEP...

324

NE Scientists Chien, Sheen, Raptis and Wang win R&D 100 Award  

NLE Websites -- All DOE Office Websites (Extended Search)

environment. The Argonne PAS System can also be used for environmental monitoring, crime scene forensics and cargo and food inspections. Photoacoustic Spectroscopy (PAS)...

325

TransForum v8n1 - EcoCAR: The NeXt Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Mike Wahlstrom and DOEs Steven Boyd perform a safety inspection on U. Tennessees vehicle at the Challenge X Winter Workshop in Los Angeles. EcoCAR logo Argonnes Mike...

326

ANL/NE-12/43 Light Water Reactor Sustainability (LWRS)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ANLNE-1243 Light Water Reactor Sustainability (LWRS) Program - R&D Roadmap for Non-Destructive Evaluation (NDE) of Fatigue Damage in Piping ...

327

Overview of DOE-NE Structural Materials Research, Materials Challenges and Operating Conditions  

Science Conference Proceedings (OSTI)

This presentation summarized materials conditions for application of nanomaterials to reactor components. Material performance is essential to reactor performance, economics, and safety. A modern reactor design utilizes many different materials and material systems to achieve safe and reliable performance. Material performance in these harsh environments is very complex and many different forms of degradation may occur (often together in synergistic fashions). New materials science techniques may also help understand degradation modes and develop new manufacturing and fabrication techniques.

Maloy, Stuart A. [Los Alamos National Laboratory; Busby, Jeremy T. [ORNL

2012-06-12T23:59:59.000Z

328

OMAHA, NE, DISTRICT This district comprises portions of Montana, Wyoming, North Dakota, South Dakota, Minnesota, Colorado,  

E-Print Network (OSTI)

operation and maintenance activities continued. In FY09 an ARRA contract was awarded to perform testing

US Army Corps of Engineers

329

EcoCAR: The NeXt Challenge North America's Premier Collegiate...  

NLE Websites -- All DOE Office Websites (Extended Search)

and demonstration of advanced propulsion and alternative fuel technologies and to train the next generation of engineers to lead the industry in the 21st century. A...

330

Synthetic studies toward palau򡭩ne and enantioselective total synthesis of biogenetically related (+)-phakellin and (+)-monobromophakellin  

E-Print Network (OSTI)

Oroidin alkaloids, also known as pyrrole-imidazole alkaloids, have become a hot area of chemical and biological research due to their diverse and intriguing structural features and biological activities. Palau'amine (i), one of the hexacyclic oroidin-derived secondary metabolites, contains a fully substituted chloro-cyclopentane ring, a piperazinone moiety and two cyclic guanidines. With the uniqueness and complexity of its structure, palauamine has been a synthetic challenge and has not yet succumbed to total synthesis. The overall objective of this work was to explore synthetic pathways toward palauamine and biogenetically related congeners. Most of the work was focused on developing a synthetic pathway for the palauamine structure proposed in its isolation report dated back to 1993. Starting from a Diels-Alder adduct (iii), oxidation/chlorination followed by phakellin (ii) annulation afforded an advanced pentacyclic intermediate possessing all the carbon framework and all but one ring system of palauamine. Recently, however, a series of reports questioned the originally proposed palauamine structure and called for a revision of the stereochemistry of two carbon centers (iv). Now palauamine has an identical chlorocyclopentane core with axinellamine (vi). With the target changed, we devised a new biomimetic pathway toward both natural products via a common intermediate (v), which was synthesized in 12 steps from the Diels-Alder adduct (iii).

Wang, Shaohui

2008-05-01T23:59:59.000Z

331

EcoCAR: The NeXt Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

hybrid electric drives. The teams using plug-in hybrid electric and extended-range electric drives have also adapted their vehicles to run on either E85 (85% ethanol, 15%...

332

Does plant richness influence animal richness? the mammals of Catalonia (NE Spain)  

E-Print Network (OSTI)

B.A. & Porter, E.E. (2003) Does herbivore diversity depend247252 BIODIVERSITY RESEARCH Does plant richness influencenot directly causal. This does not mean that plants do not

Hawkins, Bradford A.; Pausas, J G

2004-01-01T23:59:59.000Z

333

NE-23 List of California Sites Hattie Carwell. SAN/NSQA Division  

Office of Legacy Management (LM)

Attached for your information is the list Of Callfornia sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action...

334

Klein-NERAC NE education taskforce report 5-18-04  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of radiation with matter, radiation protection, reactor physics and theory, reactor thermal hydraulics, nuclear engineering design. * Most also include nuclear reactor...

335

DOE-NE Light Water Reactor Sustainability Program and EPRI Long...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Joint Research and Development Plan April 2013 U.S. Department of Energy Office of Nuclear Energy DISCLAIMER This information was prepared as an account of work sponsored by an...

336

VerDate 112000 15:58 May 15, 2001 Jkt 194001 PO 00000 Frm 00001 Fmt 4717 Sfmt 4717 E:\\FR\\FM\\16MYR2.SGM pfrm10 PsN: 16MYR2 May 16, 2001  

E-Print Network (OSTI)

1986. SWSA 6 is currently undergoing process knowledge, and repackaging activities. RCRA/CERCLA closure. A revised Closure Plan 2.2.1.1 RCRA Assessments, Closures, and Corrective Measures The Hazardous and Solid. At the Y-12 Plant, 26 RCRA units have been certified closed by TDEC since the mid-1980s. Closure

337

96 P U R S U I T A N D P R O M O T I O N O F S C I E N C E ver the last half-a-century activity in  

E-Print Network (OSTI)

were neutral particles from interstellar space which enter the solar system, get ionized raining on the earth from outside the solar system. They comprise mostly atomic nuclei from hydrogen of a few power laws with indices of ~ Ð 2.7, Ð3.2, Ð2.8. The electrons constitute about 1% of the nucleonic

Srinivasan, N.

338

6. Impact of smoke and moisture on shortwave radia7ve hea7ng profile Dynamical and Radia7ve Influences of Smoke Transport on the Southeast Atlan7c Atmospheric Ver7cal Structure  

E-Print Network (OSTI)

Office, United Kingdom Email: aadebiyi@rsmas.miami.edu 1. Introduc7on Seasonal of Miami, Rosens=el School of Marine & Atmospheric Science, Miami, FL; 2UK Met over the southeast Atlan:c ocean, with the peak in aerosol loading occurring

Zuidema, Paquita

339

L'opration populaire d'amnagement de Pointe-Saint-Charles : vers une appropriation du quartier par les citoyens sous l'initiative de la table de concertation action-gardien?.  

E-Print Network (OSTI)

??Dans le contexte de mtropolisation, les grands projets de dveloppement urbains se sont imposs comme une stratgie de revitalisation urbaine privilgie pour positionner les villes (more)

Grenier, Genevive

2009-01-01T23:59:59.000Z

340

Le rle de la presse dans la constitution du littraire au Bas-Canada et au Brsil au cours du premier XIXe sicle : vers la formation d'une culture nationale dans les collectivits neuves des Amriques.  

E-Print Network (OSTI)

??Cette thse envisage la formation des cultures nationales au sein de deux collectivits neuves des Amriques, alors que s'enclenche, au toumant du XIXe sicle, un (more)

Doyon, Nova

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

The Concept of Comonotonicity in Actuarial Science and Finance: Applications  

E-Print Network (OSTI)

In an insurance c o text,o ne isoB interested in thedistributio functio o a sum o rando variables. Such a sum appears when coBBthe aggregate claimso f an insurance po rtfo o ver a certain reference perio d. Italso appears when coBdisco ted payments related to a single po licyo a poBat di#erent future po ints in time. Theassumptio o mutual independence between the coB oB ts o the sum is very co venient fro a coB- po int o view, butsoB no a realistico ne. In The Concept of Comonotonicity in Actuarial Science and Finance: Theory, we determined appro ximatio fo sumso f rando variables, when thedistributio o f the coB oB ts are kno wn, but thesto chastic dependence structure between them isunkno wn oto o cumberso to wo rk with. Practical applicatio o f thistheo will becoBin this paper. o. papers are to a large extent ano verviewo recent research resultsos tained by theautho butalso newtheoBand practical results are presented. 1

J. Dhaene; M. Denuit; M.J. Goovaerts; R. Kaas; D. Vyncke

2002-01-01T23:59:59.000Z

342

Proceedings of the 2013 Winter Simulation Conference R. Pasupathy, S.-H. Kim, A. Tolk, R. Hill, and M. E. Kuhl, eds.  

E-Print Network (OSTI)

that can allow policy makers to study various counter-factual experiments in the event of a large human-initiated crisis. The specific scenario we consider is a ground detonation caused by an improvised nuclear device period after the initial blast. A novel computing and data processing architecture is described

Swarup, Samarth

343

Radial-Transverse (SV-SH) Coordinates for 9-C 3-D Seismic Reflection Data Analysis James L. Simmons, Jr.* and Milo M. Backus  

E-Print Network (OSTI)

, Jr.* and Milo M. Backus Bureau of Economic Geology, The University of Texas at Austin Summary Nine energy on the crossterms and are likely more prevalent causes of crossterm energy than is fracture

Texas at Austin, University of

344

A l u m n i C a m p u sh a n n o v e r Zu Gast bei max und moritz  

E-Print Network (OSTI)

Gastfreundschaft des WilhelmBuschMuseums und genossen im Garten die eigens gegrillten Würstchen und knüpften noch nachempfunden wurde. · Bild: Behrens Der gro?zügig angelegte Garten des Georgenpalais dient auch als Café

Nejdl, Wolfgang

345

OVERVIEW OF DT RESULTS FROM TFTR M.G. BELL, K.M. McGUIRE, V. ARUNASALAM, C.W. BARNES', S.H. BATHA2,  

E-Print Network (OSTI)

. DORLAND7, H.H. DUONG8, R.D. DURST4, P.C. EFTHIMION, D. ERNST9, H. EVENSON4, N.J. FISCH, R.K. FISHER8, R

346

PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

- integrated emissions, DAQ, CAN, power analyzer 3 Testing Completed - Kokam Hymotion Prius, dedicated test vehicle - EnergyCS Prius ver.1 and ver.2, AVTA vehicle - A123 Hymotion...

347

Static Analyzers in Software Engineering  

Science Conference Proceedings (OSTI)

... Testing also requires artifacts that are complete enough to be executable, possibly with supporting dri- vers, stubs, or simulated components. ...

2013-05-07T23:59:59.000Z

348

Environmental Protection Agency 61.193 (3) The date and time identifying  

E-Print Network (OSTI)

Emissions From Phosphogypsum Stacks SOURCE: 57 FR 23317, June 3, 1992, unless otherwise noted. VerDate 11

349

Towards a Theory of Proofs of Classical Logic Habilitation diriger des recherches  

E-Print Network (OSTI)

iii 0 Vers une thorie des preuves pour la logique classique v 0.1 Catgories des preuves.............................. vi

Universit Denis; Diderot Paris; Lutz Straburger; Gilles Dowek; Delia Kesner; Christian Retor

2013-01-01T23:59:59.000Z

350

Time scale of the fission process in the reaction 50A MeV 20Ne + 165Ho  

E-Print Network (OSTI)

The pre-scission time in the de-excitation of highly excited 178W produced in the reaction of 2ONe + 165Ho at 50A MeV was determined as a function of fission fragment mass asymmetry. The techniques employed used the pre-scission and post scission multiplicities of alpha particles, measured in coincidence with the fission fragments, to determine excitation energy of the fissioning nucleus at scission. Then the fission time was evaluated using statistical model calculations. It was found for a compound system of mass 178 amu and excitation energy of 580 MeV that the fission time is [ ] 1 x 10-20 s regardless of the asymmetry.

Mdeiwayeh, Nader

1995-01-01T23:59:59.000Z

351

Superfund Record of Decision (EPA Region 7): Cornhusker Army Ammunition Plant, Operable Unit 2, Hall County, NE, September 30, 1998  

Science Conference Proceedings (OSTI)

This Record of Decision (ROD) document presents the selected remedial action for the six areas of concern (AOCs) located at the Cornhusker Army Ammunition Plant (CHAAP) in Grand Island, Nebraska designated as OU2. The remedial action is chosen in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERLCA), as amended by the Superfund Amendments and Reauthorization Act (SARA) of 1986, and with the National Oil and Hazardous Substances Pollution Contingency Plan (NCP). The information supporting the decisions contained in the remedy is contained in the administrative record.

NONE

1999-03-01T23:59:59.000Z

352

A multiapproach study of soil attributes under land use and cover change at the Cap de Creus Pennsula, NE Spain.  

E-Print Network (OSTI)

??The work presented in this Doctoral Thesis has studied the temporal and spatial patterns of the most relevant soil parameters with special attention posed to (more)

Emran Khaled Abd El Aziz, Mohamed

2012-01-01T23:59:59.000Z

353

CASTELLA FRANCOIS IRISA & IRMAR Ne le 18 Decembre 1971 `a Fontenay-aux-Roses (92) Universite de Rennes I  

E-Print Network (OSTI)

dadantii (Grenier et al., 2006) and Pseudomonas syrin- gae pv. syringae B728a (Stavrinides et al., 2009 several bac- terial Cyt-like toxin genes in aphid pathogenesis (Grenier et al., 2006), and although­pathogen interactions (Lin et al., 1984; Sadosky et al., 1989; Zhao et al., 1993; Hill et al., 1994; Zhao and Hill, 1995

Castella, François

354

CASTELLA FRANCOIS IRISA & IRMAR Ne le 18 Decembre 1971 a FontenayauxRoses (92) Universit e de Rennes I  

E-Print Network (OSTI)

dadantii (Grenier et al., 2006) and Pseudomonas syrin- gae pv. syringae B728a (Stavrinides et al., 2009 several bac- terial Cyt-like toxin genes in aphid pathogenesis (Grenier et al., 2006), and although­pathogen interactions (Lin et al., 1984; Sadosky et al., 1989; Zhao et al., 1993; Hill et al., 1994; Zhao and Hill, 1995

Castella, François

355

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

356

Climatic implications of correlated upper Pleistocene glacial and fluvial deposits on the Cinca and Gallego rivers, NE Spain  

SciTech Connect

We correlate Upper Pleistocene glacial and fluvial deposits of the Cinca and Gallego River valleys (south central Pyrenees and Ebro basin, Spain) using geomorphic position, luminescence dates, and time-related trends in soil development. The ages obtained from glacial deposits indicate glacial periods at 85 {+-} 5 ka, 64 {+-} 11 ka, and 36 {+-} 3 ka (from glacial till) and 20 {+-} 3 ka (from loess). The fluvial drainage system, fed by glaciers in the headwaters, developed extensive terrace systems in the Cinca River valley at 178 {+-} 21 ka, 97 {+-} 16 ka, 61 {+-} 4 ka, 47 {+-} 4 ka, and 11 {+-} 1 ka, and in the Gallego River valley at 151 {+-} 11 ka, 68 {+-} 7 ka, and 45 {+-} 3 ka. The times of maximum geomorphic activity related to cold phases coincide with Late Pleistocene marine isotope stages and heinrich events. The maximum extent of glaciers during the last glacial occurred at 64 {+-} 11 ka, and the terraces correlated with this glacial phase are the most extensive in both the Cinca (61 {+-} 4 ka) and Gallego (68 {+-} 7 ka) valleys, indicating a strong increase in fluvial discharge and availability of sediments related to the transition to deglaciation. The global Last Glacial Maximum is scarcely represented in the south central Pyrenees owing to dominantly dry conditions at that time. Precipitation must be controlled by the position of the Iberian Peninsula with respect to the North Atlantic atmospheric circulation system. The glacial systems and the associated fluvial dynamic seem sensitive to (1) global climate changes controlled by insolation, (2) North Atlantic thermohaline circulation influenced by freshwater pulses into the North Atlantic, and (3) anomalies in atmospheric circulation in the North Atlantic controlling precipitation on the Iberian peninsula. The model of glacial and fluvial evolution during the Late Pleistocene in northern Spain could be extrapolated to other glaciated mountainous areas in southern Europe.

Lewis, Claudia J [Los Alamos National Laboratory; Mcdonald, Eric [NON LANL; Sancho, Carlos [NON LANL; Pena, Jose- Luis [NON LANL

2008-01-01T23:59:59.000Z

357

EXPERIMENTAL STUDY OF RADIATIVE PION CAPTURE ON 13c, 20Ne, 90Zr, 19F AND 12C  

E-Print Network (OSTI)

charged particles. liie event trigger requirement for datasee Section IV.C). An event trigger causes the triggeringsoftware system "Q". The event trigger rate is about 100 per

Martoff, Charles Jeffrey

2010-01-01T23:59:59.000Z

358

DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program Joint Research and Development Plan  

SciTech Connect

Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's electrical generation capability.

Don Williams

2012-04-01T23:59:59.000Z

359

Regmi Research Series ,Year 4, January 1, 1972  

E-Print Network (OSTI)

more to ... 1~ 'people ? Thuroouy, Chrfl1loo' J3f,di 13 , C',pl1.E11 of NUlltI~ot. HottJ S ~:h~,SQ f ,ur l(;tttlre wore sent by J<;inr Pritlwi Nnrayan 'Shah to ' llllrid~": P:~ nd1.tJ his on..,.oy tn Tihilt. Cttleulnti-: ne reveal that the t... ~.cnureled cauriter.':: f El1ting, whicb would have lod to an inc~ase 1n price s 8 IX\\. thus hardll,tliP tJ ' . for the ptloplt: . Prithvl Na reya n ShAh, ther otON, fc llowed "he poUC),, "9t plinting purE! coint;!. 1J'bls BOOWS that Pri t"hvi Kareyan ?llah .,.d :8...

Regmi, Mahesh C

1972-01-01T23:59:59.000Z

360

Richland Operations (DOE-RL) Environmental Safety Health (ES and H) FY 2000 and FY 2001 Execution Commitment Summary  

SciTech Connect

All sites in the U.S. Department of Energy (DOE) Complex prepare this report annually for the DOE Office of Environment, Safety and Health (EH). The purpose of this report is to provide a summary of the previous and current year's Environment, Safety and Health (ES&H) execution commitments and the Safety and Health (S&H) resources that support these activities. The fiscal year (FY) 2000 and 2001 information and data contained in the Richland Operations Environment, Safefy and Health Fiscal Year 2002 Budget-Risk Management Summary (RL 2000a) were the basis for preparing this report. Fiscal year 2001 activities are based on the President's Amended Congressional Budget Request of $689.6 million for funding Ofice of Environmental Management (EM) $44.0 million for Fast Flux Test Facility standby less $7.0 million in anticipated DOE, Headquarters holdbacks for Office of Nuclear Energy, Science and Technology (NE); and $55.3 million for Safeguards and Security (SAS). Any funding changes as a result of the Congressional appropriation process will be reflected in the Fiscal Year 2003 ES&H Budget-Risk Management Summary to be issued in May 2001. This report provides the end-of-year status of FY 2000 ES&H execution commitments, including actual S&H expenditures, and describes planned FY 2001 ES&H execution commitments and the S&H resources needed to support those activities. This requirement is included in the ES&H guidance contained in the FY 2002 Field Budget Call (DOE 2000).

REEP, I.E.

2000-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Hanford Site Environment Safety and Health (ES and H) FY 1999 and FY 2000 Execution Commitment Summary  

SciTech Connect

All sites in the U.S. Department of Energy (DOE) Complex prepare this report annually for the DOE Office of Environment, Safety and Health (EH). The purpose of this report is to provide a summary of the previous and current year's Environment, Safety and Health (ES&H) execution commitments and the S&H resources that support these activities. The fiscal year (FY) 1999 and 2000 information (Sieracki 1999) and data contained in the ''Hanford Site Environment, Safety and Health Fiscal Year 2001 Budget-Risk Management Summary'' (RL 1999) were the basis for preparing this report. Fiscal year 2000 finding of Office of Environmental Management (EM) and Office of Nuclear Energy, Science and Technology (NE) activities is based on the President's budget of $1,065.1 million and $28.0 million, plus $2.7 million carryover finding, respectively, as of October 31, 1999. Any funding changes as a result of the Congressional appropriation process will be reflected in the Fiscal Year 2002 ES&H Budget-Risk Management Summary to be issued in May 2000. This report provides the end-of-year status of FY 1999 ES&H execution commitments, including actual S&H expenditures, and describes planned FY 2000 ES&H execution commitments and the S&H resources needed to support those activities. This requirement is included in the ES&H ''Guidance for FY200l Budget Formulations and Execution'' (DOE 1999).

REEP, I.E.

1999-12-01T23:59:59.000Z

362

Subroutine LENCH  

Science Conference Proceedings (OSTI)

... ne.' ' 1 .and. str(ilench:ilench).ne.tab !Look for trailing tabs as well 1 .and. str(ilench:ilench).ne.nul ) done=.true. END DO ...

363

Satellite altimeterderived monthly discharge of the GangaBrahmaputra River and its seasonal  

E-Print Network (OSTI)

+ QHg Cp SH Vair + QHw Cp SV Vair (8) q t TEB = QER + QEr + QEg SH Vair (9) with QHR , QHr , and QHg

364

CA.0  

Office of Legacy Management (LM)

James J. Fiore. Director Division of Facility and Site Decommissioning Projects Office of Nuclear Energy NE-23 5+%7 NE-23 Fiore 5%7 3 Enclosures bee: Aerospace NE-20 RF NE-23 RF...

365

Test de SCRIP a Spherical Coordinate Remapping  

E-Print Network (OSTI)

transmission d'informations entre deux grilles en g'eom'etrie sph'erique. Il propose quatre m'ethodes : ffl Une 'scrip in' doit contenir : ffl num map, fix'e `a 2 pour calculer le remapping de la grille 1 vers 2 et de la grille 2 vers 1, 1 pour un seul remapping, necessairement de 1 vers 2. ffl grid file, les noms des

366

Weights and Measures State Directors N  

Science Conference Proceedings (OSTI)

... Information. NE Division of Weights & Measures 301 Centennial Mall South Box #94757 Lincoln, NE 68509-4757. ... North Dakota. Mailing ...

2013-05-09T23:59:59.000Z

367

VerDate Aug2005 15:58 Nov 01, 2007 Jkt 214001 PO 00000 Frm 00009 Fmt 4703 Sfmt 4703 E:\\FR\\FM\\02NON1.SGM 02NON1 pwalkeronPROD1PC71withNOTICES  

E-Print Network (OSTI)

along the eastern portion of the Aleutian Island Arc and is similar in eruption style to the slightly

Magee, Joseph W.

368

VerDate Mar2010 19:05 Jul 27, 2010 Jkt 220001 PO 00000 Frm 00003 Fmt 4703 Sfmt 4703 E:\\FR\\FM\\28JYN1.SGM 28JYN1 srobertsonDSKD5P82C1PRODwithNOTICES  

E-Print Network (OSTI)

works with public and private stakeholders to protect critical infrastructure and key resources (CIKR).3, including those supporting CIKR sectors and their customers. The Task Force's report may include options, and citizens outside the CIKR sectors. Activities involving government systems, other critical infrastructures

Magee, Joseph W.

369

VerDate Mar2010 19:12 Mar 07, 2011 Jkt 223001 PO 00000 Frm 00022 Fmt 4703 Sfmt 4703 E:\\FR\\FM\\08MRN1.SGM 08MRN1 srobinsononDSKHWCL6B1PRODwithNOTICES  

E-Print Network (OSTI)

on the Smart Grid Web site at http://www.nist.gov/ smartgrid. DATES: The SGAC will hold a meeting on Thursday information on the Committee is available at http:// www.nist.gov/smartgrid/committee.cfm. Pursuant will be posted on the Smart Grid Web site at http://www.nist.gov/smartgrid. Individuals and representatives

370

Document  

NLE Websites -- All DOE Office Websites (Extended Search)

Transmission Project, the Pacific Alternating Current Intertie, and Information on the Path 15 Transmission Upgrade-Rate Order No. WAPA-156; Notice VerDate...

371

7/9 IDN  

Science Conference Proceedings (OSTI)

... Unlike other forms of identification (such as a passive printed dri- ver's license), a smart card does not expose all of an individual's personal ...

372

AVALIAO DE IMPACTO LEGISLATIVO NO BRASIL  

E-Print Network (OSTI)

Legislativa/Senado Federal. Brass, C.T. ; Williams, E.D. ;Research Service. Ver Brass, Williams e Nuez-Neto (2006)

Meneguin, Fernando B.

2010-01-01T23:59:59.000Z

373

Employing Two Question Answering Systems in TREC-2005  

Science Conference Proceedings (OSTI)

... nec- essary linguistic knowledge for COGEX to accurately ver- ify that the losing team is entailed by Padres, and not Yankees, the statistically ...

2006-02-21T23:59:59.000Z

374

McMinnville Cottage Grove  

E-Print Network (OSTI)

a River R oaring R iver S alm o n b e r r y River Fall R iv C ultus River ver CollawashRiver Breitenbush

375

Commercial Building Technology Evaluation Process  

NLE Websites -- All DOE Office Websites (Extended Search)

Flow 4 Proposed Program Elements Building Technologies Program 2 2 commercialbuildings.energy.gov ver ew Program Overview * Program Objective: - Evaluate emerging and underutilized...

376

Teil IV: Von der Satzung der Europischen Gemeinschaft ... - Springer  

Science Conference Proceedings (OSTI)

begriffenes Volk zuerst einen Gemeinsinn haben sollte, bevor es sich eine Ver- ... dermaen: Damit ein werdendes Volk die gesunden Grundstze der Politik.

377

Structure validation in the submission, review and  

E-Print Network (OSTI)

­ Release of powder CIF dictionary (ver. 1.0) · 1998 ­ Automated submission by email ­ use of the VRF

Magee, Joseph W.

378

FI 6 -7 JUILLET 98 flash informatique  

E-Print Network (OSTI)

de McKinsey qui vont à di- vers degrés développer, adapter, tester, évaluer les machines prototypes

379

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

380

ASMA 74 -CENTRE DE HAUTE MONTAGNE Plateau de Rochebrune  

E-Print Network (OSTI)

navette vers le téléphérique de Rochebrune. En voiture depuis Albertville : Ugine, Flumet, Praz sur Arly

Chamroukhi, Faicel

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Computer Applications in Directional Solidification Processing  

Science Conference Proceedings (OSTI)

load at high temperature were pointed out by. VerSnyder in 1959 .... In the analysis, the temperature profiles on the external mold .... sistances and the electrical.

382

August 2011 Curriculum Vita  

E-Print Network (OSTI)

Energiewirtschaft, 1 (1989), 36-50. (34) "Les Frontières des Entreprises: Vers une Théorie de la Cohérence de la

Kammen, Daniel M.

383

Graduate Handbook Energy Science and Engineering Program  

E-Print Network (OSTI)

- Transport Processes in Nuclear Engineering NE 571 - Reactor Theory and Design NE 572 - Nuclear Systems - Nuclear Systems Dynamics and Control NE 522 - Experimental Methods in Reactor Dynamics NE 550 - Radiation Advanced (6 credits) Reactor Design and Modeling emphasis NE 611 - Selected Topics in Reactor Theory NE 640

Tennessee, University of

384

Le'u gsum pa _'phags pa shA ri'i bu dang 'phags pa mo'u 'gal gyi bu gnyis khyim nas khyim med par rab tu byung ba'i lo rgyus  

E-Print Network (OSTI)

{ ~ f:! ~ !":1 ~ LI :- [j' , Ll ~ . ~ y- . ~ , ~ ~ :-.... ~ ci19 Ll "to t{ ~ !":1 [( ~ ~ t6' ~ ~ ~ !O f:! ET y- LI 4! to I.ltf fit> iJ ~~ !O LI , Ll ~ c!fJI ~ Ier- I~ Ll fi1 6~ t6' @ ~? rn . Ll y- ~ ~ ~ @ ~ ~ !f6"- i... Ll ~ !O IF" u:-fT- P 17""- v-- W v-- LI iJ c~ ~ LI I~ t{ [j' 1!":1 ' iJ 4! ~ /:Zl ~ 1>:'"" .... ~ ~ "-I 6fT ~ i7~' LI t{ fl W ffii?'~ ~ t{ LI !":1 W {~ t~ ~ ,W- fT iLl 6f:! lr I :-::= (!Ii' rn t'}f ~ ,:.". rn r.::l LI . II:[) ~ Ll...

Lepcha, Samten Gyatso

1997-01-01T23:59:59.000Z

385

CN He Ne Ar Kr Xe 4 0.90 :t 0.06 1.18 :t 0.02  

E-Print Network (OSTI)

t in understanding glass structures (e.g., Shackelford and Masaryk, 1978; Shackelford and Brown, 1981

Zhang, Youxue

386

General P-T fit construction for He, N sub 2 , Ar, H sub 2 and Ne VPT used at Fermilab  

DOE Green Energy (OSTI)

Polynomial fits are constructed for Fermilab Tevatron vapor pressure thermometers (VPT) for use with ACNET database. Fit coefficients and P-T graphs are included. Fits cover the VPT saturation region and the gas region. The thermodynamic analysis of VPT bulb is used to define transition points for each cryogenic VPT with given geometry and charge'' conditions. The methodology is described to repeat fit construction calculations for any geometry and charge'' conditions if required.

Geynisman, M.; Makara, J.

1992-01-01T23:59:59.000Z

387

Materials Reliability Program: Effect of Defects in an Alloy 600/82 Weld on Stress Corrosion Cracking in Testing of Heat Affected Zo ne Specimens (MRP-254)  

Science Conference Proceedings (OSTI)

Primary water stress corrosion cracking (PWSCC) data for heat affected zones (HAZs) in thick-walled components of both Alloy 600 and Alloy 690TT are needed to support the Materials Reliability Program, MRP-55 crack growth rate (CGR) disposition relationship for Alloy 600 (EPRI report 1006695). Such data are also needed to ensure that welding of Alloy 690TT does not deleteriously affect its inherent resistance to PWSCC. CGR experiments to obtain data in the HAZ of Alloy 600 plates welded with Alloy 82 and...

2008-11-26T23:59:59.000Z

388

Petrochemical and Mineralogical Constraints on the Source and Processes of Uranium Mineralisation in the Granitoids of Zing-Monkin Area, Adamawa Massif, NE Nigeria  

Science Conference Proceedings (OSTI)

Zing-Monkin area, located in the northern part of Adamawa Massif, is underlain by extensive exposures of moderately radioactive granodiorites, anatectic migmatites, equigranular granites, porphyritic granites and highly radioactive fine-grained granites with minor pegmatites. Selected major and trace element petrochemical investigations of the rocks show that a progression from granodiorite through migmatite to granites is characterised by depletion of MgO, CaO, Fe{sub 2}O{sub 3,} Sr, Ba, and Zr, and enrichment of SiO{sub 2} and Rb. This trend is associated with uranium enrichment and shows a chemical gradation from the more primitive granodiorite to the more evolved granites. Electron microprobe analysis shows that the uranium is content in uranothorite and in accessories, such as monazite, titanite, apatite, epidote and zircon. Based on petrochemical and mineralogical data, the more differentiated granitoids (e.g., fine-grained granite) bordering the Benue Trough are the immediate source of the uranium prospect in Bima Sandstone within the Trough. Uranium was derived from the granitoids by weathering and erosion. Transportation and subsequent interaction with organic matter within the Bima Sandstone led to precipitation of insoluble secondary uranium minerals in the Benue Trough.

Haruna, I. V., E-mail: vela_hi@yahoo.co.uk [Federal University of Technology, Geology Department (Nigeria); Orazulike, D. M. [Abubakar Tafawa Balewa University, Geology Programme (Nigeria); Ofulume, A. B. [Federal University of Technology, Geosciences Department (Nigeria); Mamman, Y. D. [Federal University of Technology, Geology Department (Nigeria)

2011-12-15T23:59:59.000Z

389

I ERPO NE 2007 04 a 06 de junho de 2007 Recife / PE AVALIAO E CORREO DE VIS NO MODELO DE REGRESSO DE COX  

E-Print Network (OSTI)

31270-901 - Belo Horizonte ­ MG E-mail: {jangiovani,fcruz,enricoc}@ufmg.br Resumo O modelo de riscos viés de segunda ordem do EMVP. As simulações Monte Carlo indicam viés menor, sem aumento de variância present computational results for second-order bias evaluation and correction of MPLE's. Monte Carlos

Cruz, Frederico

390

Accurate correlation consistent basis sets for molecular core-valence correlation effects: The second row atoms Al-Ar and the first row atoms B-Ne revisited  

Science Conference Proceedings (OSTI)

Correlation consistent basis sets for accurately describing core-core and core-valence correlation effects in atoms and molecules have been developed for the second row atoms Al - Ar. Two different optimization strategies were investigated, which led to two families of core-valence basis sets when the optimized functions were added to the standard correlation consistent basis sets (cc-pVnZ). In the first case, the exponents of the augmenting primitive Gaussian functions were optimized with respect to the difference between all-electron and valence-electron correlated calculations, i.e., for the core-core plus core-valence correlation energy. This yielded the cc-pCVnZ family of basis sets, which are analogous to the sets developed previously for the first row atoms[D.E. Woon and T.H. Dunning, Jr., J. Chem. Phys. 103, 4572 (1995)]. Although the cc-pCVnZ sets exhibit systematic convergence to the all-electron correlation energy at the complete basis set limit, the intershell (core-valence ) correlation energy converges more slowly than the intrashell (core-core) correlation energy. Since the effect of including the core electrons on the calculation of molecular properties tends to be dominated by core-valence correlation effects, a second scheme for determining the augmenting functions was investigated. In this approach, the exponents of the functions to be added to the cc-pVnZ sets were optimized with respect to just the core-valence (intershell) correlation energy, except that a small amount of core-core correlation energy was included in order to ensure systematic convergence to the complete basis set limit. These new sets, denoted weighted core-valence basis sets (cc-pwCVnZ), significantly improve the convergence of many molecular properties with n. Optimum cc-pwCVnZ sets for the first-row atoms were also developed and show similar advantages.

Peterson, Kirk A. (WASHINGTON STATE UNIV TC); Dunning, Thom H. (BATTELLE (PACIFIC NW LAB))

2002-12-15T23:59:59.000Z

391

2 | engineering neWs | spring 2010 coluMBia engineering | spring 2010 | 3 his issue of Columbia Engineering magazine focuses on engineering  

E-Print Network (OSTI)

alumni whose work has left its mark on our daily lives. If you have information about other alumni Hankow to Canton (a line still in use today), built docks in Cuba, and was instrumental 15,000 people world-wide. Our School today has more than 24,000 living alumni, each of them leaders

Hone, James

392

50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

393

Nuclear Engineering (NE) is one of the divisions within the Applied Science and Technology directorate of Argonne National Laboratory. The Division and its precursors  

E-Print Network (OSTI)

completion. However, the Project was awaiting a response from the Nuclear Decommissioning Authority over DECOMMISSIONING PLANNING PROJECT 13. The College Secretary presented the Second Annual Report on the Reactor Decommissioning Planning Project (RDPP). He reported that the Project had made significant progress in its task

Kemner, Ken

394

Quantum-fluid-dynamics approach for strong-field processes: Application to the study of multiphoton ionization and high-order harmonic generation of He and Ne atoms  

E-Print Network (OSTI)

Wigner cor- relation energy functionals are used. QUANTUM-FLUID-DYNAMICS APPROACH FOR STRONGQuantum-fluid-dynamics approach for strong-field processes: Application to the study of multiphoton; published 18 March 2002 We explore the feasibility of extending the quantum-fluid dynamics QFD approach

Chu, Shih-I

395

Nuclear engineering recruitment effort program, DE-FG02-00NE22797.A000. Report for grant issued July 1, 2000 - September 30, 2000  

SciTech Connect

Report on status of program to raise awareness and heighten interest in nuclear engineering and nuclear science, particularly among 7th through 12th grade students and pre-college freshmen.

Kerrick, Sharon

2000-12-21T23:59:59.000Z

396

RE SONANT PHO NON -A 8 8 IS TE D 6E NE HA TION. . . not observed, presumably because either the  

E-Print Network (OSTI)

,2' in the rotational position of the crystal. This separation agrees closely with the expected separation of & p of Vacancies and Rare-Gas Crystal Mixtures H. R. Glyde Chalk Riser +unclear «boratories, ~topi@ Energy of Canada Iimited, Chalk River, Ontario, Canada (Received 21 December 1970) The Gibbs-Bogolyubov variational

Glyde, Henry R.

397

1995-2011 | LS-LAMP IMPACT REPORT uniVersity of neW orLeAns | new orleans, la  

E-Print Network (OSTI)

.S., mathematics, michigan State University, East Lansing, mI m.S., Statistical Science, Baylor University, waco was the second place winner of the 2010 Joint statistical meetings (Jsm) stat Bowl. she was also named oustanding Graduate stu- dent (2010) by Baylor university's Department of statistical sciences. she has also

Kulp, Mark

398

Spectral linewidth of a Ne-like Ar capillary discharge soft x-ray laser and its dependence on amplification beyond gain-saturation  

Science Conference Proceedings (OSTI)

We report the measurement of the linewidth and temporal coherence of a = 46.9 nm neon-like argon capillary discharge soft x-ray laser and its variation with plasma column length. A wavefront division interferometer was used to resolve the 3p 1S0-3s 1P1 laser line, resulting in a measured relative linewidths of / = 3-4 10 -5. The measurements do not observe saturation re-broadening as this clearly dominantly Doppler-broadened inhomogeneous line is amplified beyond the intensity corresponding to gain saturation. Model simulations indicate that this is the result of comparatively small collisional broadening that homogenizes the line profile to practically eliminate inhomogeneous saturation re-broadening. Collisional re-distribution is computed to only play a minor role in homogenizing the line profile.

Urbanski, Lukasz [Colorado State University, Fort Collins; Marconi, Mario [Colorado State University, Fort Collins; Meng, L. M. [Colorado State University, Fort Collins; Berrill, Mark A [ORNL; Guilbaud, O. [Universite Paris Sud, Orsay, France; Klisnick, Annie [Universite Paris Sud, Orsay, France; Rocca, Jorge [Colorado State University, Fort Collins

2012-01-01T23:59:59.000Z

399

Bell L a b s , NE C Re s e ar ch I n stit u t e a nd Telco r d ia ... - CECM  

E-Print Network (OSTI)

i nfo r m ation doe s no t t ell u s t he loc ation of t he co rr e sp ond i ng f ra gmen t on t he tar ge t D N A , only s ome t h i ng a bou t t he r el ative o r de r of t he...

400

Funding for state, city, and county governments in the state includes:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Nebraska Total Sum City, County, and SEO Allocations NE Nebraska Total Sum City, County, and SEO Allocations All $18,810,300 NE Nebraska State Energy Office $9,593,500 NE Bellevue City $194,200 NE Fremont City $106,400 NE Grand Island City $199,000 NE Hastings City $109,900 NE Kearney City $131,100 NE Lincoln City $2,401,000 NE Norfolk City $101,500 NE North Platte City $105,300 NE Omaha City $4,331,500 NE Papillion City $91,300 NE Cass County $99,900 NE Dakota County $87,300 NE Dawson County $106,300 NE Douglas County $255,800 NE Gage County $98,000 NE Lancaster County $110,300 NE Platte County $139,200 NE Sarpy County $312,600 NE Saunders County $80,600 NE Scotts Bluff County $155,600 In addition, today's announcement includes funding for the following Tribal

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

A framework for information system usage in collaborative care  

Science Conference Proceedings (OSTI)

Clinical information systems (CIS) can affect the quality of patient care. In this paper, we focus on CIS use in the collaborative treatment of chronic diseases. We have developed a framework to determine which CIS functions have general usefulness for ... Keywords: Collaboration, Cooperative behavior [MeSH], Information systems [MeSH], Interdisciplinary communication [MeSH], Organizational models [MeSH

David A. Dorr; Spencer S. Jones; Adam Wilcox

2007-06-01T23:59:59.000Z

402

Richard Gerber!  

NLE Websites -- All DOE Office Websites (Extended Search)

1 2x o ver n ext 3 y ears * Sequencer c ost d eceasing b y 1 0 o ver s ame p eriod Compu>ng * Simulaons a t S cale a nd a t H igh V olume a lready p roduce P etabytes o f data a...

403

,"Nebraska Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050NE3","N3010NE3","N3020NE3","N3035NE3","N3045NE3" "Date","Natural Gas Citygate Price in Nebraska (Dollars per Thousand Cubic Feet)","Nebraska Price of...

404

Pontotoc Co. Greene Co. Hale Co. OAK GROVE C OAL D EGAS CEDAR COVE  

U.S. Energy Information Administration (EIA) Indexed Site

COAL D EGAS BLU E CREEK COAL DEGAS BR OOKWOOD C OAL D EGAS ST AR ROBIN SONS BEND COAL D EGAS BLU FF COR INNE MOU NDVILLE COAL D EGAS BLU EGU T CR EEK WH ITE OAK CREEK COAL DEGAS BEAVERT ON BLU FF FAYETTE W SN EAD S CREEK SPLU NGE PAR HAM N MUSGR OVE CR EEK MCCRAC KEN MOU NTAIN DAVIS C HAPEL BAC ON BLOOMING GROVE MT Z ION FAIRVIEW JASPER BLOWHORN CREEK MAPLE BRAN CH KEN NEDY COAL F IRE CR EEK MCGEE LAKE SILOAM MILLPOR T FERNBANK DAVIS C HAPEL NE DETROIT E BEANS F ERRY LEXIN GT ON PET ERSON COAL D EGAS CALEDONIA ABERD EEN HOL T COAL D EGAS MULDON ELD RIDGE MCKINLEY CREEK TREBLOC HEARTLIN E SH ANNON TROY_MS_D BOXES CREEK WISE GAP NOR THSID E TREMONT VAN VLEET HOL LY BET HEL CHU RCH ABERD EEN S ST RONG BAN KST ON MOLLOY WR EN COR INTH WELLS THORN REID REID HOU STON ST AR DEERLICK CREEK COAL D EGAS OAK GROVE COAL D EGAS BIG SANDY CREEK COAL D EGAS MABEN LITT LE SAND Y CREEK COAL D

405

Pontotoc Co. Greene Co. Hale Co. OAK GROVE C OAL D EGAS CEDAR COVE COAL DEGAS  

U.S. Energy Information Administration (EIA) Indexed Site

COAL DEGAS COAL DEGAS BLU E CREEK COAL DEGAS BR OOKWOOD C OAL D EGAS ST AR ROBIN SONS BEND COAL DEGAS BLU FF COR INNE MOU NDVILLE COAL DEGAS BLU EGU T CR EEK WH ITE OAK CREEK COAL DEGAS BEAVERT ON BLU FF FAYETTE W SN EAD S CREEK SPLU NGE PAR HAM N MUSGR OVE CR EEK MCCRAC KEN MOU NTAIN DAVIS C HAPEL BAC ON BLOOMING GROVE MT Z ION FAIRVIEW JASPER BLOWHORN CREEK MAPLE BRAN CH KEN NEDY COAL F IRE CR EEK MCGEE LAKE SILOAM MILLPOR T FERNBANK DAVIS C HAPEL NE DETROIT E BEANS F ERRY LEXIN GT ON PET ERSON COAL DEGAS CALEDONIA ABERD EEN HOL T COAL DEGAS MULDON ELD RIDGE MCKINLEY CREEK TREBLOC HEARTLIN E SH ANNON TROY_MS_D BOXES CREEK WISE GAP NOR THSID E TREMONT VAN VLEET HOL LY BET HEL CHU RCH ABERD EEN S ST RONG BAN KST ON MOLLOY WR EN COR INT H WELLS THORN REID REID HOU STON ST AR DEERLICK CR EEK C OAL DEGAS OAK GROVE C OAL D EGAS BIG SANDY C REEK COAL D EGAS MABEN LITT LE SAND Y CREEK COAL DEGAS

406

Lawrence Co. Scioto Co. Greenup Co. Jack  

U.S. Energy Information Administration (EIA) Indexed Site

COWEN COWEN BELLS F OR D FREDVILLE BIG CH IMNEY ALVIN N RPD-LAWRENC E-2 PEYTONA-EMMON S TOM PR ICE SCHOOL NE BREEDEN MAR E CREEK SCHOOL FAR LEY C HUR CH W LON G R UN LICKBURG RPD-GALLIA-1 MIMA LEF T F OR K RPD-MASON-1 MABSCOT T-CBM CON LEY MEAD E BR ANCH PET ERSBURG VAN LEAR SILVERTON RPD-SC IOT O-2 HURR ICANE CR EEK OT TER ROAD BRANCH SH AVERS FORK HAGERH ILL KEEL FORK CRAGER FORK CON TRARY BRAN CH HUNN EWELL S DUMPS CREEK DOBSON SCH OOL BU LAN DANIEL HINDMAN N LAU REL HILL CROOK PYR AMI D AU XIER LEF T F OR K B CUCU MBER CRK CHANEY CREEK DINGUS RPD-SC IOT O-3 MOORE BRANC H RPD-TAZ EWELL-1 PORT ER CAMP MOU SIE WILD CAT HOLLOW SPR ING CREEK RACCOON SCHOOL ALVIN W ROSC OE GEORGES F ORK DAVISPOR T N LEATH ER BAR K CRK MOON N RPD-673 RPD-678 RPD-520 RPD-334 RPD-335 RPD-510 RPD-100 RPD-333 RPD-509 RPD-280 MAL DEN SALYERSVILLE FAR LEY C HUR CH CEREDO LINCOLN ST RAT TON KNOB SALLY BR ANCH

407

Comparison of Firm Commitments by Pipeline Company  

U.S. Energy Information Administration (EIA)

CNG Transmission Corp. 22 NE 3,736,840 4,750,112 Columbia Gas Transmission Corporation 21 NE 5,183,990 8,911,651 Columbia Gulf Transmission Company 70 NE 1,277,200 ...

408

A MULTI-COUNTRY ANALYSIS OF LIFECYCLE EMISSIONS FROM TRANSPORTATION FUELS AND MOTOR VEHICLES  

E-Print Network (OSTI)

oil n.e. ULSD oil n.e. FTD NG n.e. Fuel oil Still gas oiln.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. CH2 water CH2 NGMeOH NG n.e. MeOH coal n.e. MeOH Ethanol Ethanol wood n.e.

Delucchi, Mark

2005-01-01T23:59:59.000Z

409

A Multi-Country Analysis of Lifecycle Emissions From Transportation Fuels and Motor Vehicles  

E-Print Network (OSTI)

oil n.e. ULSD oil n.e. FTD NG n.e. Fuel oil Still gas oiln.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. CH2 water CH2 NGMeOH NG n.e. MeOH coal n.e. MeOH Ethanol Ethanol wood n.e.

Delucchi, Mark

2005-01-01T23:59:59.000Z

410

Corrective Actin Tracking System CATS User's Guide for Direct Web Access, Version 4.0  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CATS CATS Corrective Action Tracking System The United States Department of Energy Office of Environment, Safety and Health EH-33-2004-09-0001.Ver.4.0 09/07/2004 Corrective Action Tracking System (CATS) User's Guide for Direct Web Access Document Number EH-33-2004-09-0001.Ver.4.0 The United States Department of Energy Office of Environment, Safety and Health Prepared by Highland Technology Services, Inc. September 2004 CATS User Guide i Document # EH-33-2004-09-0001.Ver.4.0 Table of Contents 1.0 Overview ....................................................................................................................................3 1.1 CATS Database Access Control Overview ........................................................................

411

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1209 - 1213 Omaha, NE Midwest Region Alternative Fuels Project NEPA Approval for 1 CNG Vehicle Refueling Appliance to be installed in Omaha, NE. Grant funded by Solicitation...

412

DOE - Office of Legacy Management -- Hallam Nuclear Power Facility...  

Office of Legacy Management (LM)

Hallam Nuclear Power Facility - NE 01 FUSRAP Considered Sites Site: Hallam Nuclear Power Facility (NE.01 ) Designated Name: Alternate Name: Location: Evaluation Year: Site...

413

A Climatology of Cyclogenesis for the Southern Hemisphere  

Science Conference Proceedings (OSTI)

This study surveys life cycle characteristics of cyclones in the Southern Hemisphere (SH). An objective technique for locating instances of cyclone formation, intensification, maturation, and decay is applied to a 7-year dataset of SH cyclone ...

Mark R. Sinclair

1995-06-01T23:59:59.000Z

414

Development Languages and Environment  

E-Print Network (OSTI)

It combines many of the best features of the standard UNiX working environment like C, sed, awk, csh and sh. Similar to sh and csh, it is used as a scripting...

415

National Nuclear Security Administration Supplemental Listing...  

National Nuclear Security Administration (NNSA)

the Defense Nuclear Facilities Safety Board NA-SH-10 DOE G 151.1-1A Emergency Management Fundamentals and the Operational Emergency Base Program NA-SH-10 DOE G 151.1-2 Technical...

416

Increasing and Decreasing Subsequences Richard P. Stanley  

E-Print Network (OSTI)

= sh(w), the shape of w. R = Gilbert de Beauregard Robinson S = Craige Schensted (= Ea Ea) K = Donald of the same shape n. Write = sh(w), the shape of w. R = Gilbert de Beauregard Robinson S = Craige Schensted

417

Mnard. Reptin silencing blocks liver cancer progression 1 In vivo silencing of Reptin blocks the progression of human hepatocellular carcinoma in  

E-Print Network (OSTI)

with doxycycline (Dox)-dependent expression of Reptin (R2) or control shRNA (GL2). Cells were injected target in HCC. Key words : liver cancer, apoptosis, senescence, shRNA, doxycycline inserm-00449372

Paris-Sud XI, Université de

418

Simulation and Projection of the Southern Hemisphere Annular Mode in CMIP5 Models  

Science Conference Proceedings (OSTI)

Climate variability in the Southern Hemisphere (SH) extratropical regions is dominated by the SH Annular Mode (SAM). Future changes in the SAM could have a large influence on climate over broad regions. In this paper, we utilized model simulations ...

Fei Zheng; Jianping Li; Robin T. Clark; Hyacinth C. Nnamchi

419

ORISE: Equal Access Initiative - HIV/AIDS Information Resources...  

NLE Websites -- All DOE Office Websites (Extended Search)

searching by topic, journal titleabbreviation, ISSN, or browsing by subject terms. To build a search strategy with MeSH terms, use the MeSH Database-NLM's...

420

Alan Band  

Science Conference Proceedings (OSTI)

... and private industry as a design engineer, engineering technician and ... Klouda, SH Pheiffer, Journal of Radioanalytical and Nuclear Chemistry 276 ...

2010-11-23T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Residential Electricity Demand in China -- Can Efficiency Reverse the Growth?  

E-Print Network (OSTI)

location (index r), and climate zone (index c). SH is thehousehold, which varies by climate zone and location. UEC

Letschert, Virginie

2010-01-01T23:59:59.000Z

422

Energy Efficient, Evaporative Desalination Using ...  

Energy Efficient, Evaporative Desalination Using Superhydrophobic (SH) Technology Evaporative desalination is a simple and easy way to convert salt ...

423

U.S. Department of Energy Amerian Indian Policy | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy Amerian Indian Policy U.S. Department of Energy Amerian Indian Policy DOE Indian Policy Rev January 2006- Vers 3.pdf More Documents & Publications DOE...

424

CRIMES VIOLENTOS E DESENVOLVIMENTO SOCIOECONMICO: UM ESTUDO PARA O ESTADO DO PARAN  

E-Print Network (OSTI)

a questo das travas do crime, ver: Shikida et al. (2005).G. A teoria econmica do crime. Revista Leader, Edio n.35.desenvolvimento socioeconmico e crime. In: HENRIQUE, R. (

Assis Shikida, Pery Francisco

2009-01-01T23:59:59.000Z

425

Universitt Rostock PRESSE + KOMMUNIKATION  

E-Print Network (OSTI)

bereits fertig gebauten Atom- kraftwerks Zwentendorf. In den bei- den Jahren vor der Abstimmung ha- be er Volksbegehren unter seinem Namen gegen das Kraftwerk Hainburg 1988 Veröffentlichung von ,,Hier bin ich ­ wo bist

Rostock, Universität

426

Precios de Gasolina  

NLE Websites -- All DOE Office Websites (Extended Search)

Precios de Gasolina para Ciudades en EEUU Pulse en el mapa para ver los precios de la gasolina en diferentes ciudades de su estado. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV...

427

Trends in the Health of Older Californians  

E-Print Network (OSTI)

Hing E, Burt CW, Hall MJ. Trend Data On Medical Encounters:Ver5-C.1 TRENDS IN THE HEALTH OF OLDER CALIFORNIANS: DataSurveys November 2008 TRENDS IN THE HEALTH OF OLDER

Wallace, Steven P.; Lee, Jennifer H.; Jawad, May Aydin

2008-01-01T23:59:59.000Z

428

The Atmospheric Chemistry of Iodine Monoxide  

Science Conference Proceedings (OSTI)

... of I, and C1, or by reaction of 0 with a mixture of IC1 and CIO,. ... Stein, SE; Rukkers, JM; Brown, RM NIST Structures & Properties Database; ver. ...

2011-10-18T23:59:59.000Z

429

A spatial location-allocation GIS framework for managing water resources in a savanna nature reserve  

E-Print Network (OSTI)

dry season. Ryan & Getz: GIS framework for managing waterpolygons ver 2.6 for ArcView GIS. Avenue script available atspatial locationallocation GIS framework for managing water

Ryan, Sadie

2006-01-01T23:59:59.000Z

430

A spatial location-allocation GIS framework for managing water sources in a savanna nature reserve  

E-Print Network (OSTI)

dry season. Ryan & Getz: GIS framework for managing waterpolygons ver 2.6 for ArcView GIS. Avenue script available atspatial locationallocation GIS framework for managing water

Ryan, Sadie J.; Getz, W M

2005-01-01T23:59:59.000Z

431

Microsoft Word - Document1  

Science Conference Proceedings (OSTI)

Professional Educators Common Interest Group AOCS Annual Meeting/Seattle, Washington Tuesday, May 20, 2008 Participants: Andy Proctor (University of Arkansas, aproctor@uark.edu) Roland Verhe (Ghent University, roland.ver

432

NOTIFICATION AND FEDERAL EMPLOYEE ANTIDISCRIMINATION AND RETALIATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7-174-MAY 15, 2002 NOTIFICATION AND FEDERAL EMPLOYEE ANTIDISCRIMINATION AND RETALIATION ACT OF 2002 VerDate 11-MAY-2000 09:01 May 20, 2002 Jkt 099139 PO 00174 Frm 00001 Fmt 6579...

433

The WaveZonal Mean Flow Interaction in the Southern Hemisphere  

Science Conference Proceedings (OSTI)

This study examines the wavezonal mean flow interaction in the Southern Hemisphere (SH) and in an SH- like model atmosphere. During the SH winter, when there exist both subtropical and polar front jets, growing baroclinic waves are found between ...

Hyun-kyung Kim; Sukyoung Lee

2004-05-01T23:59:59.000Z

434

Introduction On the Fault Resilience Metric  

E-Print Network (OSTI)

, Fl´avia Maristela2, Ver^onica Lima3 gmlima@ufba.br, flaviamsn@ifba.edu.br, cadena@ufba.br 1Department of Computer Science ­ Distributed Systems Lab (UFBA) 2Department Technology in Electro-electronics (IFBA) 3 and Real-time Systems George Lima, Fl´avia Maristela, Ver^onica Lima gmlima@ufba.br, flaviamsn@ifba

Lipari, Giuseppe

435

peu de radium D. En outre, la liqueur contient encore la plus grande partie du radium D ;  

E-Print Network (OSTI)

ajoute ensuite un peu d'eau oxygénée. Au bout d'une heurte on a déjà un léger précipité dhy peroxyde d'uranium déter- mine sont déplacées aussi bien vers les petites que vers les grandes longueurs d'onde. Au

Paris-Sud XI, Université de

436

Corona driven air propulsion for cooling of electronics F. Yang, N.E. Jewell-Larsen, D.L. Brown, K. Pendergrass, D.A. Parker, I.A. Krichtafovitch*, A.V. Mamishev  

E-Print Network (OSTI)

generation with low noise, static filtration [5], air sterilization [6], and no moving parts. These ideal Abstract: The possibility of building a high voltage electrostatic air pump for cooling of microelectronics is investigated. Existing cooling technology no longer provides adequate heat dissipation due to excessive heat

Mamishev, Alexander

437

9432 Alamo Ct NE, Blaine, MN 55449 (612) 625-0519(O) (505) 270-0316(C) dagao2008@gmail.com http://www-users.cs.umn.edu/dagao  

E-Print Network (OSTI)

and developed the test suite for the Culgi multiscale modeling software using Tcl/Tk and C++ #12;Idaho National

Minnesota, University of

438

P LUS: A DVENT URES I N VET ERI NA RY M EDI CI NE s T RA NSF O R MI N G D A I RY FA R MS Boosting the  

E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University

439

P2JW323012-0-A01900-1--------XA AZ,EE,MW,NE,NY,SC,SW,WB,WE P2JW323012-0-A01900-1--------XA  

E-Print Network (OSTI)

/11 Status after 9/11 CTBT Comprehensive Test Ban Treaty Not supported by administration. No change. NPT Non-ProliferationPutting the Genie Back in the Bottle: Nuclear Non-Proliferation in the New Millennium G by an adversary could have a devastating influence on US security and non-proliferation. One of the highest

Deutch, John

440

Office of Nuclear Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Human Capital Plan Revised August 2006 U. S. Department of Energy NE Human Capital Plan i August 2006 Office of Nuclear Energy Table of Contents Executive Summary...................................................................................................................................1 Background .................................................................................................................................................2 NE Human Capital Strategy.....................................................................................................................2 NE Human Capital Plan: At-A-Glance ..................................................................................................3

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

1 Managed by UT-Battelle for the U.S. Department of Energy  

E-Print Network (OSTI)

Gleason NE-Instrumentation Program Dwight Clayton Sensors and Controls Programs Peter Fuhr USEC CRADA

442

A High Performance Pneumatic Force Actuator System Part 1 - Nonlinear Mathematical Model  

E-Print Network (OSTI)

In this pap er we developed a detailed mathematical model of dual action pneumatic actuator contr16 with pr2 or2520 spool valves. E#ects of nonlinear flowthr35 the valve,air compr6T430035 y incylinder chamber2 leakage between chamber6 end of str1 e inactive volume, and time delay and attenuation in the pneumatic lines wercar14T4 consider6 System identification, numer4T simulation and model validation experT11 ts wer conducted for two types of air cylinder and di#er4 t connecting tubes length, showing ver goodagr552T t. This mathematical model will be used in the development of high per35T423 nonlinear for3 contr330T with applications in teleopereopT1 haptic inter164T and rT otics. 1 Introducti Mode) forceIP(k)fiXe tek## e ration, haptic inte#kP9kX andothe applications in robotics recsX( high pefifiP6XIP# force actuators, with highforce output pe r unit wefi9 t. It is also important to have line96 fast andaccurate reu onse as we# as low friction and me hanical impe dance Traditional gekk9 e lek9#6XI motors can not provide the characteP#BfiBXe Fe w ne## de#(#XI motors may have spek)fi dire)XIB(# e actuators, with no intefi)BB9XI # This ar116 has appear in the September 2000 issue of ASME Jour3 of Dynamic Systems Measur2 ment and ContrT1 Vol. 122, No.3, pp. 416-425 1 me hanisms. YeP applications such astek9( ek9(P maste arms with gravitational compe nsation, rePPfi# long duration, static highforce output. In the6 caseB direB drive e levXfi)(6 actuators nekBB6XI9k speXPB cooling syste) todissipate the e xceipa e hei We be lie e thatpneXP96# cylinde# can o#e a be tte alte9BkXI e toefik)6(XI9 or hydraulic actuators forceXP#B type s of applications. PneP966X actuators provide the preBfifi)XI e umeBfifi) qualitie at low cost. The are alsosuitable forcle# e nvironme ts ands...

Edmond Richer; Yildirim Hurmuzlu

2001-01-01T23:59:59.000Z

443

Microsoft PowerPoint - handout.pptx [Read-Only]  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Energy Nuclear Energy Get in Contact with Argonne's Nuclear Engineering Division Visit our website: http://www.ne.anl.gov NE Division research programs: http://www.ne.anl.gov/capabilities NE Division Outreach Committee: e-mail us at neoutreach@anl.gov Like us on Facebook: NuclearEngineeringAtArgonne Follow us on @ArgonneNE Nuclear Energy Learning Resources http://students.ne.anl.gov/schools * Middle school students * High school students * Teacher resources Student/Postdoc Nuclear Energy Opportunities at Argonne * Graduating high school seniors: http://students.ne.anl.gov/students * Undergraduate and graduate internships: http://students.ne.anl.gov/students * Postdoc appointments: http://students.ne.anl.gov/postdocs Commercial nuclear energy technology began at Argonne

444

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Reorganization and NE Reorganization and FY 2011 Budget Request Pete Lyons Principal Deputy Assistant Secretary Office of Nuclear Energy U.S. Department of Energy NEAC Meeting April 29, 2010 2 April 29, 2010 NEAC Meeting Current Official NE Organization 3 April 29, 2010 NEAC Meeting NE-3 Deputy Assistant Secretary for Nuclear Facility Operations Dennis Miotla NE-7 Deputy Assistant Secretary for Nuclear Reactor Technologies Shane Johnson, Acting NE-5 Deputy Assistant Secretary for Fuel Cycle Technologies Buzz Savage, Acting NE-6 Deputy Assistant Secretary for International Nuclear Energy Policy and Cooperation Ed McGinnis NE-4 Deputy Assistant Secretary for Business and Technical Support Bob Lange, Acting NE-21 Office of Policy, Integration & Communication Tim Frazier, Acting Assistant Secretary for

445

DOE  

Gasoline and Diesel Fuel Update (EIA)

DOE DOE /E/A- 0202( 83//Q J Sh or t-T er m En er gy O ut lo ok a to m Quar terly Proje ction s Febru ary 1983 Ene rgy Info rma tion Adm inist ratio n Was hing ton, D.C. t rt jrt .or t lor t lor t .lor t- ior t- ior t <.o rt ort . m .er m -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -Te rm -T erm -T erm -T erm Nrm ue rgy En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y En erg y ^n erg y Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Ou tlo ok Sh ort -T erm 1 Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm Sh ort -T erm

446

Spontaneous fission modes and lifetimes of super-heavy elements in the nuclear density functional theory  

E-Print Network (OSTI)

Lifetimes of super-heavy (SH) nuclei are primarily governed by alpha decay and spontaneous fission (SF). Here we study the competing decay modes of even-even SH isotopes with 108 cold fusion" and "hot fusion" reactions. The region of long-lived SH nuclei is expected to be centered on $^{294}$Ds with a total half-life of ?1.5 days.

A. Staszczak; A. Baran; W. Nazarewicz

2012-08-06T23:59:59.000Z

447

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

41 - 17650 of 26,764 results. 41 - 17650 of 26,764 results. Download 2011 Workshop Agenda_Ver_21.xlsx http://energy.gov/management/downloads/2011-workshop-agendaver21xlsx Download 2011 Workshop Agenda_Ver_21.xlsx http://energy.gov/management/downloads/2011-workshop-agendaver21xlsx-0 Download 2011_Workshop_Agenda_Ver_16(1).pdf http://energy.gov/management/downloads/2011workshopagendaver161pdf Download DOE and NYSERDA Join in $7.1 Million Program to Demonstrate Advanced Electric Energy Storage Devices http://energy.gov/oe/downloads/doe-and-nyserda-join-71-million-program-demonstrate-advanced-electric-energy-storage Download Department of Energy Official Touts Bush Administration's Efforts to Modernize our Nation's Electric Grid, August 28, 2007 http://energy.gov/oe/downloads/department-energy-official-touts-bush-administration-s-efforts-modernize-our-nation-s

448

Experiments with Underwater Robot Localization and Tracking  

E-Print Network (OSTI)

pipeline-, and ?sh tracking, Journal of Marine Design andRobot Localization and Tracking Peter Corke , Carrickinvestigation into feature tracking for visual odometry for

Corke, Peter; Detwiler, Carrick; Dunbabin, Matthew; Hamilton, Michael; Rus, Daniela; Vasilescu, Iuliu

2007-01-01T23:59:59.000Z

449

Concept recognition and the TREC Genomics tasks  

Science Conference Proceedings (OSTI)

... The associated MeSH terms are then retrieved from our local installation of MEDLINE. ... [20] S. Kinoshita, KB Cohen, PV Ogren, and L. Hunter. ...

2006-02-21T23:59:59.000Z

450

Entity-Based Tracking Hypothesis for TREC-9 / TDT2000 Work  

Science Conference Proceedings (OSTI)

... Places ? capital Baku (1) ? Baku (1) ? Azerbaijan (1) ? Soviet Union (1) ? Events ? October (1) ? MeSH Terms ? Ctrack(norm) = 0.00 (2 Corr. ...

2008-03-06T23:59:59.000Z

451

Publications Portal  

Science Conference Proceedings (OSTI)

... D Reintsema, CA Allen, David I Bergman, SH Mosely, Rick A. Shafer Abstract: We ... Dale E Newbury, Gene C Hilton, Kent D Irwin, Norman F Bergren ...

2012-09-17T23:59:59.000Z

452

Publications Portal  

Science Conference Proceedings (OSTI)

... D Irwin, Gene C Hilton, John M. Martinis, Steven Deiker, Norman F Bergren ... CA Allen, David I Bergman, SH Mosely, Rick A. Shafer Abstract: We ...

2012-09-17T23:59:59.000Z

453

February 2013 Most Viewed Documents for Geosciences | OSTI, US...  

Office of Scientific and Technical Information (OSTI)

Savannah River Co., Aiken, SC (United States); Bandyopadhyay, K. Brookhaven National Lab., Upton, NY (United States); Bush, S.H. Review & Synthesis Association,...

454

June 2013 Most Viewed Documents for Geosciences | OSTI, US Dept...  

Office of Scientific and Technical Information (OSTI)

Savannah River Co., Aiken, SC (United States); Bandyopadhyay, K. Brookhaven National Lab., Upton, NY (United States); Bush, S.H. Review & Synthesis Association,...

455

Analysis of local stress distribution in a metal gate MOSFET ...  

Science Conference Proceedings (OSTI)

... Raman spectroscopy is a promising technique for stress analysis in Si devices Non-destructive, non-contact Bulk sample cf TEM ... Ram an Sh ift (c ...

2013-03-29T23:59:59.000Z

456

Availability, usage and expected contribution of potential nursery habitats for the California halibut  

E-Print Network (OSTI)

of a damsel?sh re?ect availability of suitable habitat.locate/ecss Availability, usage and expected contribution ofthe spatial coverage (availability) of all potential nursery

Fodrie, Fredrick Joel; Mendoza, Guillermo F.

2006-01-01T23:59:59.000Z

457

Effect of food level and rearing temperature on burst speed and muscle composition of Western Spadefoot Toad (Spea hammondii)  

E-Print Network (OSTI)

in larval and juvenile herring. Journal of Experimentaltemperature in Atlantic herring development Clupea harengus.sh, the spring-spawning herring (Johnston, Vieira & Temple

Arendt, J; Hoang, L

2005-01-01T23:59:59.000Z

458

Porous Core-Shell Nanostructures for Catalytic Applications  

E-Print Network (OSTI)

CO oxidation. Angewandte Chemie, [24] GA Somorjai. Surfacereaction. Angewandte Chemie, Jan 2008. [53] S.H Wu, C.Tnanocrystals. Angewandte Chemie International Edi- tion, 46:

Ewers, Trevor David

2012-01-01T23:59:59.000Z

459

OneTouch 4.0 Scanned Documents  

NLE Websites -- All DOE Office Websites (Extended Search)

area. Future surveys of ant species in severely impacted habitats (control burn areas, coal-fly sh storage areas, forest clear cuts, areas affected by thermal or chemical...

460

ENERGY ANALYSIS PROGRAM. CHAPTER FROM THE ENERGY AND ENVIRONMENT DIVISION ANNUAL REPORT 1978  

E-Print Network (OSTI)

energy consumption in each sector (e.g. , per capita value of industrial sh"ipments, travel demand, rate of increase

Various, Various,

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Journal of Research Volume 111  

Science Conference Proceedings (OSTI)

... Optimization Models for Scheduling of Jobs, p. 103 SH Sathish Indika and ... of the NIST and BIPM Standards for Air Kerma in Medium-Energy X-Rays ...

2012-10-03T23:59:59.000Z

462

1232.ps  

E-Print Network (OSTI)

Observe that SH,? (?) is a trigonometric polynomial taking values in the space of ... stock at warehouse # 1; the stock at warehouse # i is replenished from...

463

X:\\ARM_19~1\\P193-223.WPD  

NLE Websites -- All DOE Office Websites (Extended Search)

Raman Lidar Measurements of Water Vapor and Aerosols During the Atmospheric Radiation Measurement (ARM) Remote Cloud Sensing (RCS) Intensive Observation Period (IOP) S.H. Melfi, D....

464

Microsoft Word - NEAC Tasker Letters and Charter Establishing New Subcommittee _ATR_.DOC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 1 Nuclear Energy Advisory Committee (NEAC) - Task 2009-1 1. Project Title - Establish the Standing Subcommittee on Office of Nuclear Energy (NE) Nuclear Operations and Management 2. Responsible Office of Nuclear Energy (NE) Program Office - Office of Nuclear Power Deployment, NE-3 3. Statement of Work - NE is requesting NEAC to establish a standing subcommittee to provide independent advice on NE's nuclear operations and management activities. NE will provide NEAC with requests for specific advisory tasks for the subcommittee to perform. 4. Background - The Assistant Secretary for NE has determined that it would be beneficial to obtain independent advice on NE's nuclear operations and management activities. The primary areas of interest are operations and activities at the nuclear reactors and other

465

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Omaha, NE Midwest Region Alternative Fuels Project NEPA approval for CNG station to be constructed in Omaha, NE. Grant funded by Solicitation DE-PS26-09NT01236-04. 06 03 2010 Kay...

466

--No Title--  

NLE Websites -- All DOE Office Websites (Extended Search)

R&D for Mu2e conversion experiment MicroBooNE neutrino detector R&D for MicroBooNE neutrino experiment Proposed Mu2e experiment NOvA prototype detector Hydraulic platform for...

467

EAC Recommendations for DOE Action on Non-Wires Solutions - October...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Long-Term Study Task Force Electric Reliability Council of Texas, Inc., August, 2011 DOE Electricity Advisory Committee October 2012 7 ISO-NE - The current ISO-NE Tariff does not...

468

Uranium Management and Policy  

Energy.gov (U.S. Department of Energy (DOE))

The Office of Uranium Management and Policy (NE-54), as part of the Office of Fuel Cycle Technologies (NE-5), supports the Department of Energy (DOE) by assuring domestic supplies of fuel for...

469

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050ne2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050ne2a.htm" ,"Source:","Energy Information...

470

FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT U. S. Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

crosscuts the NE R&D portfolio. The primary objective of consolidating fiscal year (FY) 2013 competitive research sought by NE in the area of innovative nuclear research into a...

471

Wave breaking in beam-plasma system with finite geometry - Springer  

Science Conference Proceedings (OSTI)

Jun 7, 1993 ... eTx--~ +O-gx--O. Oz 2 t--~x2 = n"e + nbe - ni. In the above equation nPe and ne b denote, respectively, the electron density in the plasma and...

472

An Empirical Assessment of the Competitiveness of the New England Electricity Market  

E-Print Network (OSTI)

May - December 99 Cal PJM New England Density ResidualMay - December 1999) Cal NE PJM (p-MC)/p Residual Demand/Demand May - December 00 PJM NE Cal Density Residual Demand/

Bushnell, Jim; Saravia, Celeste

2002-01-01T23:59:59.000Z

473

,"Nebraska Natural Gas Underground Storage Net Withdrawals (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

312013" ,"Excel File Name:","n5070ne2m.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn5070ne2m.htm" ,"Source:","Energy Information Administration" ,"For...

474

Microphysical modeling of ultrane hydrocarbon-containing aerosols in aircraft emissions  

E-Print Network (OSTI)

Combustion engines emit precursors of ne particulate matter (PM) into the atmosphere. Numerous gaseous species, soot particles, and liquid aerosols in the aircraft exhaust are involved in PM formation, and these very ne, ...

Jun, Mina

2011-01-01T23:59:59.000Z

475

7+6( (1 &2787(//( Prsente  

E-Print Network (OSTI)

combustibles (SOFC), des capteurs à oxygène pour l'analyse des processus d'oxydation, de l solides pour piles à combustibles (SOFC), capteurs à oxygène pour l'analyse des processus d'oxydation, ou'oxygène à la cathode d'une pile SOFC conduisent à la production d'électricité de chaleur tout en ne rejetant

476

DOE Hyrogen and Fuel Cells Coordination Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy (FE) Nuclear Energy (NE) Science Management, Budget & Evaluation Policy & International Affairs Applications Project Manager Delivery Project Manager Production Project...

477

Exotlst_short_4_21_04.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

alba Setaria pumila Belamcanda chinensis Eragrostis curvula Melilotus officinalis Setaria viridis Berberis thunbergii* (ne) Erysimum cheiranthoides Mentha spicata Sida spinosa...

478

Explaining Harvard's Greenhouse Gas Inventory  

E-Print Network (OSTI)

No data available Factors from EPA's eGRID database, MA-specific Factors from ISO NE's emission reports

Paulsson, Johan

479

Engineering Experimentation - Nuclear Engineering Division (Argonne...  

NLE Websites -- All DOE Office Websites (Extended Search)

such as corrosivehazardous materials, high-temperature structural integrity, and remote handling. More... NE Departments involved: Engineering Development and...

480

Three-Dimensional Thermal Tomography Advances Cancer Treatment  

Jiangang Sun Contact Argonne Technology Development and Commercialization partners@anl.gov ne_TT3Dfs_0812. Title:

Note: This page contains sample records for the topic "ver ne sh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

A Multi-Country Analysis of Lifecycle Emissions From Transportation Fuels and Motor Vehicles  

E-Print Network (OSTI)

LPG 57NGL n.e. LPG NG n.e. CNG NG n.e. n.a. 11618% Table Y-active in model (M85) M100 NGV active in model (CNG)CNG LNG Compressed hydrogen (CH2) Liquified hydrogen (LH2)

Delucchi, Mark

2005-01-01T23:59:59.000Z

482

A MULTI-COUNTRY ANALYSIS OF LIFECYCLE EMISSIONS FROM TRANSPORTATION FUELS AND MOTOR VEHICLES  

E-Print Network (OSTI)

LPG 57NGL n.e. LPG NG n.e. CNG NG n.e. n.a. 11618% Table Y-active in model (M85) M100 NGV active in model (CNG)CNG LNG Compressed hydrogen (CH2) Liquified hydrogen (LH2)

Delucchi, Mark

2005-01-01T23:59:59.000Z

483

4, 23292384, 2007 Greenhouse gas  

E-Print Network (OSTI)

BGD 4, 2329­2384, 2007 Greenhouse gas balance of NE Siberian tundra M. K. van der Molen et al The seasonal cycle of the greenhouse gas balance of a continental tundra site in the Indigirka lowlands, NE, 2329­2384, 2007 Greenhouse gas balance of NE Siberian tundra M. K. van der Molen et al. Title Page

Paris-Sud XI, Université de

484

Observed Trends and Teleconnections of the Siberian High: A Recently Declining Center of Action  

Science Conference Proceedings (OSTI)

This study investigates variability in the intensity of the wintertime Siberian high (SH) by defining a robust SH index (SHI) and correlating it with selected meteorological fields and teleconnection indices. A dramatic trend of 2.5 hPa decade?1 ...

Fotis Panagiotopoulos; Maria Shahgedanova; Abdelwaheb Hannachi; David B. Stephenson

2005-05-01T23:59:59.000Z

485

Factors Controlling the Vertical Extent of Fair-Weather Shallow Cumulus Clouds over Land: Investigation of Diurnal-Cycle Observations Collected at the ARM Southern Great Plains Site  

Science Conference Proceedings (OSTI)

Summertime observations for 13 yr at the Atmospheric Radiation Measurement Southern Great Plains site are used to study fair-weather shallow cumuli (ShCu). To roughly separate forced from active ShCu, days are categorized into thin- or thick- ...

Yunyan Zhang; Stephen A. Klein

2013-04-01T23:59:59.000Z

486

Draft AGENDA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3, 2 3, 2 nd Floor Washington, D.C. 20024 April 29, 2010 8:30 a.m. Continental Breakfast NEAC members 9:00 a.m. Welcome and Opening Remarks Chairman Bill Martin and Warren "Pete" Miller, NE-1 9:15 a.m. NE Update Dr. Miller, NE-1 9:45 a.m. Summary of NE Reorganization & Dr. Lyons, NE-2 FY 2011 Budget Request 10:00 a.m. New Program Proposal for FY 2011 - Edward McGinnis, NE International Nuclear Energy Cooperation 10:30 a.m. Break 10:45 a.m. Nuclear Energy Advanced Modeling & Alex Larzelere, NE Simulation Activities and its Relation to The Energy Innovation Hub for Modeling & Simulation 11:45 am Update on New NEAC Subcommittees Vice-Chairman Ahearne 12:00 noon Lunch (NEAC members and Marquette Room, 1

487

Impact of Mobility on Structure-Based Drug Design for the MMPs Franklin J. Moy, Pranab K. Chanda, James Chen, Scott Cosmi, Wade Edris, Jeremy I. Levin,  

E-Print Network (OSTI)

Impact of Mobility on Structure-Based Drug Design for the MMPs Franklin J. Moy, Pranab K. Chanda and Chemical Sciences, Wyeth Research, 401 North Middletown Road, Pearl RiVer, New York 10965 Received June 20 design of new drug candidates (for reviews, see refs 1-4). The beneficial impact of structure- based

Powers, Robert

488

First Set of CRA Comments General Comments  

E-Print Network (OSTI)

(WIPP) continues to comply with EPA's environmental radiation protection standards for the disposal of radioactive waste. Pursuant to the 1992 WIPP Land Withdrawal Act (LWA), as amended, the U.S. VerDate Nov the initial receipt of transuranic waste at WIPP. EPA initially certified that WIPP met applicable regulatory

489

Using CSP||B Components: Application to a Platoon of Vehicles  

E-Print Network (OSTI)

Using CSP||B Components: Application to a Platoon of Vehicles Samuel Colin1, Arnaud Lanoix1, Olga- tionalities and services. It is specified using the combination, named CSP B, of two well-known formal methods: formal methods, CSP||B, compositional modelling, specification, ver- ification, case study 1 Introduction

Paris-Sud XI, Université de

490

September 8, 2008 Department of  

E-Print Network (OSTI)

sturgeon (Moyle et al., 1992; Adams et al., 2002; BRT, 2005), and the proposed and final listing rules Administration 50 CFR Part 226 Endangered and Threatened Wildlife and Plants: Proposed Rulemaking To Designate; Proposed Rule VerDate Aug2005 18:13 Sep 05, 2008 Jkt 214001 PO 00000 Frm 00001 Fmt 4717 Sfmt 4717 E

491

September 28, 2010 Department of  

E-Print Network (OSTI)

Blaricom et al., 2009), and the proposed and final listing rules for black abalone (71 FR 1986, January 11 Administration 50 CFR Part 226 Endangered and Threatened Wildlife and Plants: Proposed Rulemaking To Designate Critical Habitat for Black Abalone; Proposed Rule VerDate Mar2010 15:27 Sep 27, 2010 Jkt 220001 PO

492

Gewaltiger war nur der Urknall  

E-Print Network (OSTI)

Universum handelt. Seitdem hat sich das Forschungsgebiet dieser Gamma Ray Bursts so stürmisch entwickelt wie sichtbaren Lichts das Nachleuchten von zwei Gamma Ray Bursts zu beobachten. Eine Spektralanalyse zeigte dann Jahren nach seiner Inbetriebnahme hat sich die Anzahl der Veröffentlichungen zu Gamma Ray Bursts

493

PUBLIC LAW 10958--AUG. 8, 2005 ENERGY POLICY ACT OF 2005  

E-Print Network (OSTI)

PUBLIC LAW 109­58--AUG. 8, 2005 ENERGY POLICY ACT OF 2005 VerDate 14-DEC-2004 09:45 Sep 08, 2005. (a) SHORT TITLE.--This Act may be cited as the ``Energy Policy Act of 2005''. (b) TABLE OF CONTENTS conservation standards. Subtitle D--Public Housing Sec. 151. Public housing capital fund. Energy Policy Act

Laughlin, Robert B.

494

62369Federal Register / Vol. 75, No. 195 / Friday, October 8, 2010 / Notices with otter trawls that are fully  

E-Print Network (OSTI)

­6, a Categorical Exclusion or other appropriate NEPA document would be completed prior to the issuance of the EFP national policies as set forth by the President and the Congress. The agenda will include a TIP update) improve the accuracy, timing, and quality of fisheries data. VerDate Mar2010 15:29 Oct 07, 2010 Jkt

Magee, Joseph W.

495

Use of Treated Municipal Wastewater as Power Plant Cooling System...  

NLE Websites -- All DOE Office Websites (Extended Search)

PA 15213-3890 412-268-2946 dzombak@cmu.edu Use of TreaTed MUnicipal WasTeWaTer as poWer planT cooling sysTeM MakeUp WaTer: TerTiary TreaTMenT VersUs expanded cheMical regiMen...

496

Is the Gas-Fed PPT an Electromagnetic Accelerator? An Investigation using Measured Performance  

E-Print Network (OSTI)

operating at low mass bits (pump oil to reduce diffusion pump oil backstreaming were implemented and are discussed. A portion of the database has been dupli- cated in a cryo-pumped facility at NASA-JPL to ver- ify that the contamination effects have

Choueiri, Edgar

497

Universitatsbibliothek Heidelberg Plock 107-109 Postfach 105749  

E-Print Network (OSTI)

- Fachlexikon Recht / [Red.: Sascha Lübbersmann ...] Hrsg. von den Ver- lagen Alpmann & Schmidt Juristische-24157::(2) Einführung in das französische Recht / hrsg. von Hans Jürgen Sonnenberger und Claus Dieter Classen. Bearb-VB 005 Einführung in das italienische Recht / hrsg. von Stefan Grundmann .... - Frankfurt am Main : Verl

Heermann, Dieter W.

498

MHH Forschungsbericht 2004 385 Abteilung Klinische Psychiatrie und Psychotherapie  

E-Print Network (OSTI)

Emotionen in der Demenz. In: Schneider U, Dietrich DE, Gast U (Hrsg.). Aspekte des Psychischen. Würzburg. In: Machleidt W, Garlipp P, Haltenhof H (Hrsg.). Schizophre- nie ­ Behandlungspraxis zwischen speziel. Dörner & D. Naber (Hrsg.), Psychiatrie Ver- lag, Bonn, 2004, 44-54. Emrich H.M. Ambiguität des

Manstein, Dietmar J.

499

MHH Forschungsbericht 2004556 Abteilung Pharmakologie  

E-Print Network (OSTI)

der Toxikologie (Marquardt und Schäfer Hrsg.) Wissenschaftliche Ver- lagsgesellschaft mbH Stuttgart Hrsg.) Springer Verlag Heidelberg; 2004, pp 429-440. PHARMAKOLOGIE UND TOXIKOLOGIE #12;MHH- ologischer Sicht in Botulinus Neurotoxin Vi- sionen und Realität (Erbguth und Naumann Hrsg

Manstein, Dietmar J.

500

ffnungszeiten: Montag -Freitag 8.00 -22.00 Uhr. Samstag -Sonntag 9.00 -18.00 Uhr Auswahlliste von LEHRBCHERN fr das Fach ANATOMIE  

E-Print Network (OSTI)

, Hülsemann JL, Lehmann H, Liman W, Köneke N. DRG-Evaluationsprojekt Rheumatologie. Hrsg: Verband Rheumato-Skelett-Systems und des Bindegewebes In: Kommentierung der Deutschen Kodierrichtlinien Version 2004. Hrsg: Schlottmann die Praxis. Version 2004. Hrsg: VRA, DRG Research Group Münster. Schüling Ver- lag, Münster 2004

Manstein, Dietmar J.