Powered by Deep Web Technologies
Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Technology Ventures Corporation  

NLE Websites -- All DOE Office Websites (Extended Search)

Ventures Corporation Technology Ventures Corporation (TVC) identifies technologies with commercial potential, coordinates the development of business and management capabilities,...


"2012 Non-Utility Power Producers- Customers"  

U.S. Energy Information Administration (EIA) Indexed Site

Customers" Customers" "(Data from form EIA-861U)" ,,,"Number of Customers" "Entity","State","Ownership","Residential","Commercial","Industrial","Transportation","Total" "Riceland Foods Inc.","AR","Non_Utility",".",".",1,".",1 "Constellation Solar Arizona LLC","AZ","Non_Utility",".",".",1,".",1 "FRV SI Transport Solar LP","AZ","Non_Utility",".",1,".",".",1 "MFP Co III, LLC","AZ","Non_Utility",".",1,".",".",1 "RV CSU Power II LLC","AZ","Non_Utility",".",1,".",".",1


Noventi Venture Capital formerly CIR Ventures | Open Energy Information  

Open Energy Info (EERE)

Noventi Venture Capital formerly CIR Ventures Noventi Venture Capital formerly CIR Ventures Jump to: navigation, search Name Noventi Venture Capital (formerly CIR Ventures) Place Menlo Park, California Zip CA 94025 Product Noventi (formerly CIR Ventures, aka Cypress Ventures, part of the CIR Group) is an early-stage venture capital firm actively looking for investment opportunities that focus on the convergence of technology, energy, and the environment. References Noventi Venture Capital (formerly CIR Ventures)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Noventi Venture Capital (formerly CIR Ventures) is a company located in Menlo Park, California . References ↑ "Noventi Venture Capital (formerly CIR Ventures)"


"2012 Non-Utility Power Producers- Sales"  

U.S. Energy Information Administration (EIA) Indexed Site

Sales" Sales" "(Data from form EIA-861U)" ,,,"Sales (Megawatthours)" "Entity","State","Ownership","Residential","Commercial","Industrial","Transportation","Total" "Riceland Foods Inc.","AR","Non_Utility",".",".",33463,".",33463 "Constellation Solar Arizona LLC","AZ","Non_Utility",".",".",6883,".",6883 "FRV SI Transport Solar LP","AZ","Non_Utility",".",1820,".",".",1820 "MFP Co III, LLC","AZ","Non_Utility",".",9651,".",".",9651


"2012 Non-Utility Power Producers- Revenue"  

U.S. Energy Information Administration (EIA) Indexed Site

Revenue" Revenue" "(Data from form EIA-861U)" ,,,"Revenue (thousand dollars)" "Entity","State","Ownership","Residential","Commercial","Industrial","Transportation","Total" "Riceland Foods Inc.","AR","Non_Utility",".",".",1735,".",1735 "Constellation Solar Arizona LLC","AZ","Non_Utility",".",".",798,".",798 "FRV SI Transport Solar LP","AZ","Non_Utility",".",243,".",".",243 "MFP Co III, LLC","AZ","Non_Utility",".",603,".",".",603


Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures Ventures Jump to: navigation, search Name @Ventures Place Wilmington, Massachusetts Zip 18870 Product Massachusetts-based venture capital firm investing in early stage clean technology enterprises. Coordinates 42.866922°, -72.868494° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.866922,"lon":-72.868494,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oceanshore Ventures | Open Energy Information  

Open Energy Info (EERE)

Product Palo Alto, CA based venture capital firm that invests in companies in the alternative energy, environmental and advanced materials sectors. References Oceanshore...


Summit Ventures | Open Energy Information  

Open Energy Info (EERE)

search Name Summit Ventures Place Sao Paulo, Sao Paulo, Brazil Sector Biomass, Hydro, Wind energy Product Brazil based advisory and consulting company, focused on wind,...


Non-utility power generation continues to grow  

SciTech Connect

This article examines why the number of non-utility power plants is increasing. The topics include the impact of the changes to the Public Utility Holding Company Act, and bidding for capacity. It includes a look at Texaco's Puget Sound oil refinery and how its efficiency problems were solved using cogeneration including the need to improve energy balance and engineering of the plant. Grayling generating station (wood waste) and Kalaeloa cogeneration power plant (low sulfur fuel oil) are also discussed.

Smith, D.J.



West Virginia Venture Capital (West Virginia)  

Energy.gov (U.S. Department of Energy (DOE))

The West Virginia Venture Capital provides investment funds to eligible businesses stimulating economic growth and providing or retaining jobs within the state through qualified venture capital...


Chevron Technology Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

Chevron Technology Ventures LLC Jump to: navigation, search Name Chevron Technology Ventures LLC Address 3901 Briarpark Drive Place Houston Zip 77042 Sector Marine and Hydrokinetic...


Sino Transpacific Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

California Sector Wind energy Product A venture capital established for clean energy investment in China, mainly in wind. References Sino Transpacific Ventures LLC1 LinkedIn...


Energy Ventures Organization Inc | Open Energy Information  

Open Energy Info (EERE)

search Name Energy Ventures Organization Inc Place United States Sector Hydro, Hydrogen Product Hydrogen ( Private family-controlled ) References Energy Ventures...


New Ventures Mexico | Open Energy Information  

Open Energy Info (EERE)

New Ventures Mexico Jump to: navigation, search Name New Ventures Mexico Place Mexico Sector Services Product General Financial & Legal Services ( Charity Non-profit ...


@Ventures (California) | Open Energy Information  

Open Energy Info (EERE)

California) California) Jump to: navigation, search Logo: @Ventures (California) Name @Ventures (California) Address 800 Menlo Avenue, Suite 120 Place Menlo Park, California Zip 94025 Region Bay Area Product Venture capital firm investing in early stage clean technology enterprises Phone number (650) 322-3246 Website http://www.ventures.com/ Coordinates 37.450078°, -122.184403° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.450078,"lon":-122.184403,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Battery Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures (Boston) Ventures (Boston) Name Battery Ventures (Boston) Address 930 Winter Street, Suite 2500 Place Waltham, Massachusetts Zip 02451 Region Greater Boston Area Product Venture Capital Year founded 1983 Phone number (781) 478-6600 Website http://www.battery.com/ Coordinates 42.4024072°, -71.274181° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.4024072,"lon":-71.274181,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


@Ventures (Massachusetts) | Open Energy Information  

Open Energy Info (EERE)

Massachusetts) Massachusetts) Jump to: navigation, search Logo: @Ventures (Massachusetts) Name @Ventures (Massachusetts) Address 187 Ballardvale Street, Suite A260 Place Wilmington, Massachusetts Zip 01887 Region Greater Boston Area Product Venture capital firm investing in early stage clean technology enterprises Phone number (978) 658-8980 Website http://www.ventures.com/ Coordinates 42.581566°, -71.158217° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.581566,"lon":-71.158217,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hydrogen Ventures | Open Energy Information  

Open Energy Info (EERE)

Hydrogen Ventures Hydrogen Ventures Name Hydrogen Ventures Address 1219 N. Studabaker Road Place Long Beach, California Zip 90811 Region Southern CA Area Product Venture fund focusing on hydrogen technology Phone number (562) 618-8641 Website http://www.hydrogen.la/ Coordinates 33.781788°, -118.103155° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.781788,"lon":-118.103155,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Redpoint Ventures | Open Energy Information  

Open Energy Info (EERE)

Redpoint Ventures Redpoint Ventures Jump to: navigation, search Logo: Redpoint Ventures Name Redpoint Ventures Address 3000 Sand Hill Road Bldg 2 Ste 290 Place Menlo Park, California Zip 94025 Region Bay Area Number of employees 11-50 Year founded 1999 Phone number 650 926 5600 Website http://www.redpoint.com/ Coordinates 37.4234385°, -122.2210783° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.4234385,"lon":-122.2210783,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Venture Capital Program (North Dakota)  

Energy.gov (U.S. Department of Energy (DOE))

The Venture Capital Program, provided by the ND Department of Commerce, is an innovative financial program that provides flexible financing through debt and equity investments for new or expanding...

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ark Ventures | Open Energy Information  

Open Energy Info (EERE)

Ark Ventures Ark Ventures Jump to: navigation, search Name Ark Ventures Address 85 Wall Street Place Madison, CT Zip 06443 Website http://www.arkventures.com Coordinates 41.2822696°, -72.5937049° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.2822696,"lon":-72.5937049,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SJF Ventures | Open Energy Information  

Open Energy Info (EERE)

SJF Ventures SJF Ventures Jump to: navigation, search Name SJF Ventures Address 200 N Mangum St., Suite 203 Place Durham, North Carolina Zip 27701 Number of employees 1-10 Website [www.sjfventures.com www.sjfventures.com ] Coordinates 35.995645°, -78.899877° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.995645,"lon":-78.899877,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NBGI Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures Ventures Jump to: navigation, search Name NBGI Ventures Place London, United Kingdom Zip EC4V 4BJ Product UK-based firm focused on investing in early stage, high growth and innovative companies. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Primary Energy Ventures | Open Energy Information  

Open Energy Info (EERE)

Primary Energy Ventures Primary Energy Ventures Jump to: navigation, search Name Primary Energy Ventures Place Oak Brook, Illinois Zip 60523 Product Primary Energy Ventures is a privately held developer, owner and operator of on-site combined heat and power and recycled energy projects. References Primary Energy Ventures[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Primary Energy Ventures is a company located in Oak Brook, Illinois . References ↑ "Primary Energy Ventures" Retrieved from "http://en.openei.org/w/index.php?title=Primary_Energy_Ventures&oldid=349951" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


Braemar Energy Ventures | Open Energy Information  

Open Energy Info (EERE)

Braemar Energy Ventures Braemar Energy Ventures Jump to: navigation, search Name Braemar Energy Ventures Place New York City, New York Zip 10017 Product New York-based venture capital firm, that invests in early to expansion stage companies focusing on technology, clean technology, communications, alternative energy and energy sectors. References Braemar Energy Ventures[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Braemar Energy Ventures is a company located in New York City, New York . References ↑ "Braemar Energy Ventures" Retrieved from "http://en.openei.org/w/index.php?title=Braemar_Energy_Ventures&oldid=343002" Categories: Clean Energy Organizations Companies


CampVentures | Open Energy Information  

Open Energy Info (EERE)

venture capital firm. References CampVentures1 LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now This article is a stub. You can help OpenEI...


Venture Capital, High Technology and Regional Development  

E-Print Network (OSTI)

This paper explores the role ofventure capital in technological innovation and regional development. Both aggregate data and a unique firm level data base are employed to determine the location of major centres of venture capital, flows of venture capital investments, and patterns of investment syndication or coinvestment among venture capital firms. Three major centres of venture capital arc identified: California (San Francisco-Silicon Valley); New York; and Ncw England (Massachusetts-Connecticut): as well as three minor venture capital centres: Illinois (Chicago); Texas; and Minnesota. Venture capital firms are found to cluster in areas with high concentrations of financial institutions and those with high concentrations of technology-intensive enterprises. Venture capital firms which are based in financial centres are typically export-oriented, while those in technology centres tend to invest in their own region and attract outside venture capital. Venture capital investmcnts flow predominantly toward established high technology areas such as Silicon Valley and Boston-Iioute 128, and venturc investing is also characterized by high degrees of intra-and inter-regional syndication or coinvestment. The venture capital industry displays a high level of agglomeration due to the information intensive nature of the investment process and the importance of venture capital networks in locating investments, mobilizing resources, and establishing business start-ups. The existence of well developed venture capital networks in technology-based regions significantly accelerates the pace of technological innovation and economic development in those regions.

Richard L. Florida; Martin Kenneyt



MRI Ventures | Open Energy Information  

Open Energy Info (EERE)

MRI Ventures MRI Ventures Jump to: navigation, search Logo: MRI Ventures Name MRI Ventures Address 425 Volker Boulevard Place Kansas City, Missouri Zip 64110 Product Handles the commercialization of intellectual property and new technologies that are developed either at MRI or through collaborative efforts Phone number (816) 753-7600 Website http://www.mriresearch.org/Abo Coordinates 39.0386366°, -94.5819018° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.0386366,"lon":-94.5819018,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Battelle Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures LP Ventures LP Name Battelle Ventures LP Address 103 Carnegie Center, Suite 100 Place Princeton, New Jersey Zip 08540 Region Northeast - NY NJ CT PA Area Product Venture fund supporting new and early-stage companies Number of employees 1-10 Year founded 2003 Phone number (609) 921-1456 Website http://www.battelleventures.co Coordinates 40.323515°, -74.642505° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.323515,"lon":-74.642505,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Economic impact of non-utility generation on electric power systems .  

E-Print Network (OSTI)

??Non-Utility Generation is a major force in the way electrical energy is now being produced and marketed, and electric utilities are reacting to the growth (more)

Gupta, Rajnish



CPV Wind Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

CPV Wind Ventures LLC CPV Wind Ventures LLC Jump to: navigation, search Name CPV Wind Ventures LLC Place Silver Spring, Maryland Zip 20910 Sector Wind energy Product Wind power project developer. References CPV Wind Ventures LLC[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. CPV Wind Ventures LLC is a company located in Silver Spring, Maryland . References ↑ "CPV Wind Ventures LLC" Retrieved from "http://en.openei.org/w/index.php?title=CPV_Wind_Ventures_LLC&oldid=343959" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)


Malibu Joint Venture | Open Energy Information  

Open Energy Info (EERE)

Malibu Joint Venture Malibu Joint Venture Jump to: navigation, search Name Malibu Joint Venture Place Germany Sector Solar Product String representation "German utility ... e of next year." is too long. References Malibu Joint Venture[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Malibu Joint Venture is a company located in Germany . References ↑ "Malibu Joint Venture" Retrieved from "http://en.openei.org/w/index.php?title=Malibu_Joint_Venture&oldid=348612" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)


DTE Energy Venture formerly EdVenture Capital Corporation | Open Energy  

Open Energy Info (EERE)

Venture formerly EdVenture Capital Corporation Venture formerly EdVenture Capital Corporation Jump to: navigation, search Name DTE Energy Venture (formerly EdVenture Capital Corporation) Place Detroit, Michigan Zip 48226 Product EdVenture Capital Corporation provides venture capital investments in new energy technologies. Coordinates 42.331685°, -83.047924° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331685,"lon":-83.047924,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Contour Venture Partners | Open Energy Information  

Open Energy Info (EERE)

Zip 10017 Sector Services, Wind energy Product String representation "New York-based ... n October 2009." is too long. References Contour Venture Partners1 LinkedIn Connections...


Venture Capital and the New Energy Opportunity  

NLE Websites -- All DOE Office Websites (Extended Search)

venture capital is increasingly providing expansion capital for new companies in the energy sector. The result is a dramatic increase of private capital flows supporting an...


Venture Acceleration Fund now accepting 2012 applications  

NLE Websites -- All DOE Office Websites (Extended Search)

2012 applications Venture Acceleration Fund now accepting 2012 applications The three companies selected will receive up to 100,000 each to commercialize technology and take it to...


Carbon Credit Capital and Feedback Ventures JV | Open Energy...  

Open Energy Info (EERE)

Feedback Ventures JV Jump to: navigation, search Name Carbon Credit Capital and Feedback Ventures JV Place India Sector Carbon Product String representation "Carbon Credit C ......


Pure Michigan Venture Match Fund (Michigan) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pure Michigan Venture Match Fund (Michigan) Pure Michigan Venture Match Fund (Michigan) Eligibility Commercial StateProvincial Govt Savings For Alternative Fuel Vehicles Hydrogen...


Gaebler Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

Gaebler Ventures LLC Gaebler Ventures LLC Jump to: navigation, search Logo: Gaebler Ventures LLC Name Gaebler Ventures LLC Address 156 N. Jefferson Street, Suite 301 Place Chicago, Illinois Zip 60661 Product Seed-stage and early-stage venture capital fund. Year founded 1999 Website http://www.gaebler.com/ Coordinates 41.885004°, -87.643754° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.885004,"lon":-87.643754,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sustainable Energy Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures Ventures Jump to: navigation, search Logo: Sustainable Energy Ventures Name Sustainable Energy Ventures Address Kalkkaai 6 Place Brussels, Belgium Zip 1000 Product Investment fund providing venture capital and private equity to sustainable energy companies Phone number +32 2 229 53 10 Website http://www.fuelcellmarkets.com Coordinates 50.8551654°, 4.3473341° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.8551654,"lon":4.3473341,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Solar Array Ventures Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Inc Jump to: navigation, search Name Solar Array Ventures Inc Place Austin, Texas Product Texas-based start-up thin film PV panel maker, which plans to develop five production plants over the next five years, with four of those facilities located at a site in New Mexico. References Solar Array Ventures Inc[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solar Array Ventures Inc is a company located in Austin, Texas . References ↑ "Solar Array Ventures Inc" Retrieved from "http://en.openei.org/w/index.php?title=Solar_Array_Ventures_Inc&oldid=351246" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


Specializing Financial Intermediation: Evidence from venture capital  

E-Print Network (OSTI)

While many parts of the financial systems are becoming increasingly commoditized, there is a concurrent trend towards greater specialization of financial intermediaries, especially in information-intensive market segments. This paper examines the impact of this specialization, focusing on venture capital. We use a unique hand-collected dataset on European venture capital deals that includes detail on the services provided by venture capital firms. We find that the willingness to invest in information-intensive deals, and the extent to which investor provide services (from corporate governance to additional financing) to their companies, critically depends on how specialized investors are. This applies not only to the organizational structure of the venture capital firm, but also to the human capital of its venture partners.

Laura Bottazzi; Marco Da Rin; Thomas Hellmann



Arch Venture Partners (Washington) | Open Energy Information  

Open Energy Info (EERE)

Arch Venture Partners (Washington) Arch Venture Partners (Washington) Jump to: navigation, search Name Arch Venture Partners Address 1000 Second Avenue Place Seattle, Washington Zip 98104 Region Pacific Northwest Area Product Venture capital firm investing in alternative energy production Website http://www.archventure.com/ Coordinates 47.6051741°, -122.3351302° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.6051741,"lon":-122.3351302,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DTE Energy Ventures | Open Energy Information  

Open Energy Info (EERE)

DTE Energy Ventures DTE Energy Ventures Name DTE Energy Ventures Address 414 S.Main Street, Suite 600 Place Ann Arbor, Michigan Zip 48104 Product Venture capital Phone number (734) 302-5309 Website http://www.dteenergyventures.c Coordinates 42.277198°, -83.749123° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.277198,"lon":-83.749123,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ARCH Venture Partners (Texas) | Open Energy Information  

Open Energy Info (EERE)

ARCH Venture Partners (Texas) ARCH Venture Partners (Texas) Jump to: navigation, search Logo: ARCH Venture Partners Name ARCH Venture Partners Address 6300 Bridgepoint Parkway, Bldg 1, Suite 500 Place Austin, Texas Zip 78730 Region Texas Area Coordinates 30.3732514°, -97.8395151° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.3732514,"lon":-97.8395151,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Arch Venture Partners | Open Energy Information  

Open Energy Info (EERE)

Arch Venture Partners Arch Venture Partners Name Arch Venture Partners Address 1700 Owens Street Place San Francisco, California Zip 94158 Region Bay Area Product Venture capital firm investing in alternative energy production Website http://www.archventure.com/ Coordinates 37.7679113°, -122.3941495° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.7679113,"lon":-122.3941495,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Clean Pacific Ventures | Open Energy Information  

Open Energy Info (EERE)

Clean Pacific Ventures Clean Pacific Ventures Name Clean Pacific Ventures Address 425 California Street, Suite 2450 Place San Francisco, California Zip 94104 Region Bay Area Product Venture capital firm investing in early stage clean technology companies Phone number (415) 433-0123 Website http://www.cleanpacific.com/ Coordinates 37.792796°, -122.401353° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.792796,"lon":-122.401353,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


CEI Community Ventures | Open Energy Information  

Open Energy Info (EERE)

CEI Community Ventures CEI Community Ventures Jump to: navigation, search Name CEI Community Ventures Address 2 Portland Fish Pier, Suite 206 Place Portland, Maine Zip 04101 Product Venture fund targeting the northeast US. Phone number (207) 772-5356 Website http://www.ceicommunityventure Coordinates 43.653517°, -70.255563° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.653517,"lon":-70.255563,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Technology Ventures Corporation | Open Energy Information  

Open Energy Info (EERE)

Ventures Corporation Ventures Corporation Jump to: navigation, search Logo: Technology Ventures Corporation Name Technology Ventures Corporation Address PO Box 1280 Place Menlo Park, California Zip 94026 Region Bay Area Coordinates 37.4539°, -122.1813° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.4539,"lon":-122.1813,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Foothills Energy Ventures | Open Energy Information  

Open Energy Info (EERE)

Foothills Energy Ventures Foothills Energy Ventures Jump to: navigation, search Name Foothills Energy Ventures Place Denver, Colorado Zip 80202 Product Foothills Energy Ventures, is a Denver-based firm engaged in the development, acquisition, and operation of midstream energy assets. Coordinates 39.74001°, -104.992259° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.74001,"lon":-104.992259,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Conduit Ventures Ltd | Open Energy Information  

Open Energy Info (EERE)

Name Conduit Ventures Ltd Place London, United Kingdom Zip EC1N 8LS Sector Hydro, Hydrogen Product Focuses purely upon fuel cells and related hydrogen technologies. Opening an...


Applied Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

Applied Ventures LLC Applied Ventures LLC Name Applied Ventures LLC Address 3050 Bowers Avenue Place Santa Clara, California Zip 95054 Region Southern CA Area Product Venture capital. Number of employees 1-10 Phone number (408) 727-5555 Website http://www.appliedventures.com Coordinates 37.37751°, -121.978721° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.37751,"lon":-121.978721,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Haddington Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

Haddington Ventures LLC Haddington Ventures LLC Jump to: navigation, search Logo: Haddington Ventures LLC Name Haddington Ventures LLC Address 2603 Augusta, Suite 900 Place Houston, Texas Zip 77057 Region Texas Area Product Midstream energy private equity fund Phone number (713) 532-7992 Website http://www.hvllc.com/ Coordinates 29.739323°, -95.481781° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.739323,"lon":-95.481781,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SAIL Venture Partners (California) | Open Energy Information  

Open Energy Info (EERE)

SAIL Venture Partners (California) SAIL Venture Partners (California) Name SAIL Venture Partners (California) Address 600 Anton Blvd, Suite 1010 Place Costa Mesa, California Zip 92626 Region Southern CA Area Product Venture fund focusing on clean energy Year founded 2002 Phone number (714) 241-7500 Website http://www.sailvc.com/ Coordinates 33.690295°, -117.881439° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.690295,"lon":-117.881439,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Climate Leaders Joint Venture | Open Energy Information  

Open Energy Info (EERE)

Leaders Joint Venture Leaders Joint Venture Jump to: navigation, search Name Climate Leaders' Joint Venture Place Dallas, Texas Product Tudor Investment and Camco International have partnered to create Climate Leaders' Joint Venture. They will have inital working capital of USD 10m, with Camco owning 60%. Coordinates 32.778155°, -96.795404° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.778155,"lon":-96.795404,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


WHEB Venture Partners LLP | Open Energy Information  

Open Energy Info (EERE)

WHEB Venture Partners LLP WHEB Venture Partners LLP Jump to: navigation, search Name WHEB Venture Partners LLP Place London, United Kingdom Zip W1G 8HE Product London-based venture capital investor focused on European cleantech. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Chrysalix Energy Venture Capital | Open Energy Information  

Open Energy Info (EERE)

Chrysalix Energy Venture Capital Chrysalix Energy Venture Capital Jump to: navigation, search Logo: Chrysalix Energy Venture Capital Name Chrysalix Energy Venture Capital Address 1367 West Broadway, Suite 400 Place Vancouver, Canada Zip V6H 4A7 Product Venture capital firm. Phone number (604) 659-5499 Website http://www.chrysalix.com/ Coordinates 49.2635735°, -123.1352545° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.2635735,"lon":-123.1352545,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FA Technology Ventures (Boston) | Open Energy Information  

Open Energy Info (EERE)

Ventures (Boston) Ventures (Boston) Jump to: navigation, search Logo: FA Technology Ventures (Boston) Name FA Technology Ventures (Boston) Address 100 High Street, Suite 1105 Place Boston, Massachusetts Zip 02110 Region Greater Boston Area Product Venture capital fund focused on investing in early and expansion-stage information technology and energy technologies companies Phone number (617) 757-3880 Website http://www.fatechventures.com/ Coordinates 42.3545166°, -71.0547625° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.3545166,"lon":-71.0547625,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MDV - Mohr, Davidow Ventures | Open Energy Information  

Open Energy Info (EERE)

MDV - Mohr, Davidow Ventures MDV - Mohr, Davidow Ventures Jump to: navigation, search Logo: MDV - Mohr, Davidow Ventures Name MDV - Mohr, Davidow Ventures Address 3000 Sand Hill Road Building 3, Suite 290 Place Menlo Park, California Zip 94025 Region Bay Area Product Early Stage Venture Capital Number of employees 51-200 Year founded 1983 Phone number 650-854-7236 Website http://www.mdv.com Coordinates 37.4234385°, -122.2210783° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.4234385,"lon":-122.2210783,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FA Technology Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures Ventures Jump to: navigation, search Logo: FA Technology Ventures Name FA Technology Ventures Address 677 Broadway Place Albany, New York Zip 12207 Region Northeast - NY NJ CT PA Area Product Venture capital fund focused on investing in early and expansion-stage information technology and energy technologies companies Phone number (518) 447-8525 Website http://www.fatechventures.com/ Coordinates 42.653416°, -73.748465° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.653416,"lon":-73.748465,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Conduit Ventures Limited | Open Energy Information  

Open Energy Info (EERE)

Conduit Ventures Limited Conduit Ventures Limited Name Conduit Ventures Limited Address 59-61 Hatton Garden, Unit B, 2nd Floor Colonial Buildings Place London, United Kingdom Zip EC1N 8LS Product Venture capital funding for fuel cells and hydrogen. Phone number +44 (0) 20 7831 3131 Website http://www.conduit-ventures.co Coordinates 51.5179133°, -0.1097391° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.5179133,"lon":-0.1097391,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Garage Technology Ventures | Open Energy Information  

Open Energy Info (EERE)

Garage Technology Ventures Garage Technology Ventures Jump to: navigation, search Logo: Garage Technology Ventures Name Garage Technology Ventures Address 360 Bryant St., Suite 100 Place Palo Alto, California Zip 94301 Region Bay Area Product Seed-stage and early-stage venture capital fund. Year founded 1997 Phone number (650) 838-0811 Website http://www.garage.com/ Coordinates 37.446731°, -122.163101° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.446731,"lon":-122.163101,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Puna Geothermal Venture | Open Energy Information  

Open Energy Info (EERE)

Venture Venture Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: Puna Geothermal Venture Project Location Information Coordinates 19.478799°, -154.888701° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":19.478799,"lon":-154.888701,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mainsail Energy Ventures Inc | Open Energy Information  

Open Energy Info (EERE)

Mainsail Energy Ventures Inc Mainsail Energy Ventures Inc Jump to: navigation, search Name Mainsail Energy Ventures Inc Place Beijing, China Zip 100022 Sector Renewable Energy Product A renewable energy asset development, investment and management firm. Coordinates 39.90601°, 116.387909° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.90601,"lon":116.387909,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Access Venture Partners | Open Energy Information  

Open Energy Info (EERE)

Logo: Access Venture Partners Name Access Venture Partners Address 8787 Turnpike Drive, Suite 260 Place Westminster, Colorado Zip 80030 Region Rockies Area Product Venture Capital Number of employees 1-10 Year founded 1998 Phone number 303-426-8899 Website http://www.accessvp.com/ Coordinates 39.854298°, -105.052635° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.854298,"lon":-105.052635,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


OVP Venture Partners | Open Energy Information  

Open Energy Info (EERE)

OVP Venture Partners OVP Venture Partners Address 5550 SW Macadam Ave Place Portland, Oregon Zip 97239 Region Pacific Northwest Area Product Cleantech venture fund Website http://www.ovp.com/ Coordinates 45.483923°, -122.673013° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.483923,"lon":-122.673013,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Commercial Solar Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures Ventures Jump to: navigation, search Name Commercial Solar Ventures Place Portland, Oregon Zip 97205 Sector Solar Product Portland based company that specializes in commercial scale solar installations throughout Oregon. Coordinates 45.511795°, -122.675629° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.511795,"lon":-122.675629,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


OVP Venture Partners (Washington) | Open Energy Information  

Open Energy Info (EERE)

OVP Venture Partners OVP Venture Partners Address 1010 Market Street Place Kirkland, Washington Zip 98033 Region Pacific Northwest Area Product Cleantech venture fund Website http://www.ovp.com/ Coordinates 47.6829783°, -122.2096335° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.6829783,"lon":-122.2096335,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Clear Power Ventures | Open Energy Information  

Open Energy Info (EERE)

Clear Power Ventures Clear Power Ventures Place Boston, Massachusetts Product Venture development firm focused on deals in the cleantech market. Coordinates 42.358635°, -71.056699° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.358635,"lon":-71.056699,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy Ventures Group | Open Energy Information  

Open Energy Info (EERE)

Energy Ventures Group Energy Ventures Group Name Energy Ventures Group Address 3050 K Street, N.W., Suite 205 Place Washington, District of Columbia Zip 20007 Product Boutique investment firm focused on emerging technologies in the energy industry Phone number (202) 944-4141 Website http://www.energyvg.com/ Coordinates 38.90137°, -77.059768° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.90137,"lon":-77.059768,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


New Energy Ventures (Kentucky) | Open Energy Information  

Open Energy Info (EERE)

Ventures (Kentucky) Ventures (Kentucky) No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Last modified on August 29, 2013. EZFeed Policy Place Kentucky Applies to States or Provinces Kentucky Name New Energy Ventures (Kentucky) Policy Category Financial Incentive Policy Type Equity Investment, Grant Program Affected Technologies Biomass/Biogas, Coal with CCS, Concentrating Solar Power, Energy Storage, Fuel Cells, Hydroelectric, Hydroelectric (Small), Natural Gas, Solar Photovoltaics, Wind energy Active Policy Yes Implementing Sector State/Province Primary Website http://startups.kstc.com/index.php/funding-opportunities/kef-funds Information Source http://startups.kstc.com/images/resource_docs/knev%20guidelines%20revision%2020121112.pdf


American River Ventures | Open Energy Information  

Open Energy Info (EERE)

American River Ventures American River Ventures Place Roseville, California Sector Efficiency Product Early-stage venture capital firm, ARV invests in new technologies which provide a platform for a sustainable future, specifically, energy efficiency, energy intelligence and advanced materials. Coordinates 41.865599°, -76.958585° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.865599,"lon":-76.958585,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Clean Wave Ventures | Open Energy Information  

Open Energy Info (EERE)

Clean Wave Ventures Clean Wave Ventures Place Indianapolis, Indiana Zip 46204 Product Midwest-based venture capital firm specializing in high growth Clean Technology investments Coordinates 39.76691°, -86.149964° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.76691,"lon":-86.149964,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Opean Ventures Ltd | Open Energy Information  

Open Energy Info (EERE)

Opean Ventures Ltd Opean Ventures Ltd Jump to: navigation, search Name Opean Ventures Ltd Place London, United Kingdom Sector Renewable Energy, Solar Product London-based firm investing in the renewable energy and solar raw materials supply markets. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EcoElectron Ventures | Open Energy Information  

Open Energy Info (EERE)

EcoElectron Ventures EcoElectron Ventures Jump to: navigation, search Name EcoElectron Ventures Address 1106 2nd Street Place Encinitas, California Zip 92024 Region Southern CA Area Product Seed stage capital investment fund Phone number (760) 635-1681 Website http://www.ecoelectron.com/ Coordinates 33.037816°, -117.293986° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.037816,"lon":-117.293986,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Designing the organizational structure for an entrepreneurial venture  

E-Print Network (OSTI)

BS Grupo is a Peruvian entrepreneurial venture begun in 2000. The company has grown relatively fast, becoming a leading training provider in Peru. The venture delivers high level and specialized training services in the ...

Martinez Delgado, Juan Carlos



Pangaea Ventures Ltd (Canada) | Open Energy Information  

Open Energy Info (EERE)

Pangaea Ventures Ltd (Canada) Pangaea Ventures Ltd (Canada) Jump to: navigation, search Logo: Pangaea Ventures Ltd (Canada) Name Pangaea Ventures Ltd (Canada) Address 1500 West Georgia Street, Suite 1580 Place Vancouver, Canada Zip V6G 2Z6 Product Invests in early-stage clean energy technology Phone number (604) 738-0225 Website http://www.pangaeaventures.com Coordinates 49.2897844°, -123.1294356° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.2897844,"lon":-123.1294356,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Green Spark Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

Spark Ventures LLC Spark Ventures LLC Jump to: navigation, search Name Green Spark Ventures, LLC Place Denver, Colorado Zip 80203 Sector Efficiency, Renewable Energy Product Denver-based venture capital fund prioritizing investing in start-up and early-stage companies in the Rocky Mountain region, operating in the area of renewable energy and energy efficiency. Coordinates 39.74001°, -104.992259° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.74001,"lon":-104.992259,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FRV USA formerly Fotowatio Renewable Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

FRV USA formerly Fotowatio Renewable Ventures LLC FRV USA formerly Fotowatio Renewable Ventures LLC Jump to: navigation, search Name FRV USA (formerly Fotowatio Renewable Ventures LLC) Place San Francisco, California Zip 94104 Sector Renewable Energy Product A wholly-owned subsidiary of FRV which manages and operates renewable energy assets in the US. References FRV USA (formerly Fotowatio Renewable Ventures LLC)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. FRV USA (formerly Fotowatio Renewable Ventures LLC) is a company located in San Francisco, California . References ↑ "FRV USA (formerly Fotowatio Renewable Ventures LLC)" Retrieved from "http://en.openei.org/w/index.php?title=FRV_USA_formerly_Fotowatio_Renewable_Ventures_LLC&oldid=345517"


Solar Torx New Solar Ventures | Open Energy Information  

Open Energy Info (EERE)

Torx New Solar Ventures Torx New Solar Ventures Jump to: navigation, search Name Solar Torx / New Solar Ventures Place Arizona Product Set up in November 2005 to secure finance for a thin-film amorphous silicon cell and module manufacturing plant, and an associated 300MW power project. No evidence of progress as of June 2008, has probably been abandoned. References Solar Torx / New Solar Ventures[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solar Torx / New Solar Ventures is a company located in Arizona . References ↑ "Solar Torx / New Solar Ventures" Retrieved from "http://en.openei.org/w/index.php?title=Solar_Torx_New_Solar_Ventures&oldid=351340" Categories:

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ceres BioVentures Ltd | Open Energy Information  

Open Energy Info (EERE)

Ceres BioVentures Ltd Ceres BioVentures Ltd Jump to: navigation, search Name Ceres BioVentures Ltd Place Surrey, United Kingdom Zip TW10 5ED Sector Biomass Product UK-based firm that provides biomass supply solutions to European power and heat markets. It controls the entire supply chain to deliver reliable, repeatable and certifiably sustainable volumes in woodchip and wood pellet form. References Ceres BioVentures Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Ceres BioVentures Ltd is a company located in Surrey, United Kingdom . References ↑ "Ceres BioVentures Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Ceres_BioVentures_Ltd&oldid=343419"


Persu Mobility was Venture Vehicles Inc | Open Energy Information  

Open Energy Info (EERE)

Persu Mobility was Venture Vehicles Inc Persu Mobility was Venture Vehicles Inc Jump to: navigation, search Name Persu Mobility (was Venture Vehicles Inc) Place Los Angeles, California Zip 90067 Product Los Angeles based electric and hybrid plug-in vehicle developer with a Persu Hybrid vehicle that has 3 wheels and leans into turns. References Persu Mobility (was Venture Vehicles Inc)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Persu Mobility (was Venture Vehicles Inc) is a company located in Los Angeles, California . References ↑ "Persu Mobility (was Venture Vehicles Inc)" Retrieved from "http://en.openei.org/w/index.php?title=Persu_Mobility_was_Venture_Vehicles_Inc&oldid=349682"


Core Technology Ventures Services CTV | Open Energy Information  

Open Energy Info (EERE)

Technology Ventures Services CTV Technology Ventures Services CTV Jump to: navigation, search Name Core Technology Ventures Services (CTV) Place Co Durham, United Kingdom Zip DL13 3DS Sector Hydro, Hydrogen Product An independent advisory team focused on seed and early stage companies developing fuel cell systems and hydrogen storage technologies. References Core Technology Ventures Services (CTV)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Core Technology Ventures Services (CTV) is a company located in Co Durham, United Kingdom . References ↑ "Core Technology Ventures Services (CTV)" Retrieved from "http://en.openei.org/w/index.php?title=Core_Technology_Ventures_Services_CTV&oldid=34391


ARCH Venture Partners (Washington) | Open Energy Information  

Open Energy Info (EERE)

Washington) Washington) Jump to: navigation, search Logo: ARCH Venture Partners Name ARCH Venture Partners Address 1000 Second Avenue, Suite 3700 Place Seattle, Washington Zip 98104 Region Pacific Northwest Area Coordinates 47.605526°, -122.334716° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.605526,"lon":-122.334716,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Arch Venture Partners (Texas) | Open Energy Information  

Open Energy Info (EERE)

Texas) Texas) Jump to: navigation, search Name Arch Venture Partners Address 6300 Bridgepoint Parkway Place Austin, Texas Zip 78730 Region Texas Area Product Venture capital firm investing in alternative energy production Website http://www.archventure.com/ Coordinates 30.354669°, -97.794039° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.354669,"lon":-97.794039,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Venture Formation | BNL Technology Commercialization and Partnerships  

NLE Websites -- All DOE Office Websites (Extended Search)

Entrepreneurs and Investors Entrepreneurs and Investors Venture Formation Resources Entrepreneurship Resource Center - Entrepreneurship.org was created by the Ewing Marion Kauffman Foundation as a free, online international resource with a vast array of content designed to assist entrepreneurs, business mentors, policy makers, academics and investors through each phase of the entrepreneurial process. U.S. Small Business Administration - The U.S. Small Business Administration (SBA) is a federally funded organization developed to aid, counsel, assist and protect the interests of small business concerns and new ventures in the United States. Wall Street Journal Entrepreneur Resource - An online how to guide for small businesses and start ups with tips from The Wall Street Journal's reporters and columnists.


Texaco, carbide form hydrogen plant venture  

Science Conference Proceedings (OSTI)

This paper reports that Texaco Inc. and Union Carbide Industrial Gases Inc. (UCIG) have formed a joint venture to develop and operate hydrogen plants. The venture, named HydroGEN Supply Co., is owned by Texaco Hydrogen Inc., a wholly owned subsidiary of Texaco, and UCIG Hydrogen Services Inc., a wholly owned subsidiary of UCIG. Plants built by HydroGEN will combine Texaco's HyTEX technology for hydrogen production with UCIG's position in cryogenic and advanced air separation technology. Texaco the U.S. demand for hydrogen is expected to increase sharply during the next decade, while refinery hydrogen supply is expected to drop. The Clean Air Act amendments of 1990 require U.S. refiners to lower aromatics in gasoline, resulting in less hydrogen recovered by refiners from catalytic reforming units. Meanwhile, requirements to reduce sulfur in diesel fuel will require more hydrogen capacity.

Not Available



Illinois Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

LLC LLC Jump to: navigation, search Name Illinois Ventures LLC Place Champaign, Illinois Zip 61820 Product Illinois Ventures partners with faculty inventors and entreprenuers to build breakthrough start-up companies based on University of Illinois research and development. Coordinates 40.1142°, -88.243499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.1142,"lon":-88.243499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Perestroika, Soviet oil, and joint ventures  

SciTech Connect

Glaznost, the freedom of expression in both the public and private sectors of the Soviet Union, has rapidly transformed the country form a largely isolated and closed society to one that is rapidly becoming more cosmopolitan and open to the West. Now that the Soviet Union is moving toward a free-market economy, a number of new laws are being generated to create a favorable environment for Western investment, especially joint ventures. First, crude oil sales have provided over 75% of much-needed hard currency, and oil has been the principal barter for manufactured goods produced in eastern Europe. Second, joint oil ventures with Western companies can reverse declining production levels and provide sufficient stimulus to turn around the economic recession. The Soviet Union has a very large inventory of discovered but undeveloped oil and gas fields. Most of these fields are difficult for the Soviets to produce technically, financially, and environmentally safely, and they are actively seeking appropriate Western partners. From an exploration point of view, the Soviet Union has probably the largest number of undrilled and highly prospective oil basins, which may replenish declining reserves in the West. Finally, the Soviet Union represents in the long term a large unsaturated market eager to absorb the surplus of goods and services in the Western world. Again, joint oil ventures could provide the convertible currency to increase East-West trade.

Churkin, M. Jr.



Small Business Venture Capital Tax Credit Program (Manitoba, Canada) |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Venture Capital Tax Credit Program (Manitoba, Venture Capital Tax Credit Program (Manitoba, Canada) Small Business Venture Capital Tax Credit Program (Manitoba, Canada) < Back Eligibility Agricultural Commercial Construction Developer Fuel Distributor Industrial Installer/Contractor Investor-Owned Utility Municipal/Public Utility Retail Supplier Rural Electric Cooperative Systems Integrator Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Home Weatherization Water Solar Wind Program Info State Manitoba Program Type Corporate Tax Incentive Personal Tax Incentives Provider Manitoba Entrepreneurship, Training and Trade The Small Business Venture Capital Tax Credit Program (SBVCTC) assists eligible small corporations to issue new equity to primarily new investors.


Solar Ventures SpA | Open Energy Information  

Open Energy Info (EERE)

search Name Solar Ventures SpA Place Milan, Italy Zip 20122 Sector Solar Product Solar PV project developer investor, focused on the Italian market and considering...


U.S. Department of Energy Selects Venture Capital Firms to Accelerate...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Venture Capital Firms to Accelerate Adoption of Advanced Energy Technologies U.S. Department of Energy Selects Venture Capital Firms to Accelerate Adoption of Advanced Energy...


The Paper Industry: Strategic Alliances, Joint Ventures, and  

E-Print Network (OSTI)

The Paper Industry: Strategic Alliances, Joint Ventures, and Electronic Commerce Are Reshaping Our may take the form of a collaborative effort, licensing of technology, or joint venture (Berryman, 1998 technology is affected when one company licenses its production or service methods to another firm. A joint


Commercialization of coal diesel engines for non-utility and export power markets  

DOE Green Energy (OSTI)

The basic motivation behind this project is to develop coal-burning heat engine technology primarily for 10-100 MW modular stationary power applications in the late 1990`s and beyond, when oil and gas prices may return to the $5--7/MMBtu range. The fuel is a low-cost, coal-based liquid with the consistency of black paint, composed of 12-micron mean size premium 2% ash coal dust mixed 50/50 with water. The Clean Coal Diesel Plant of the future is targeted for the 10-100 MW non-utility generation (NUG) and small utility markets, including independent power producers (IPP) and cogeneration. A family of plant designs will be offered using the Cooper-Bessemer 3.8, 5.0, and 6.3 MW Model LS engines as building blocks. In addition, larger plants will be configured with an engine in the 10-25 MW class (Cooper will license the technology to other large bore stationary engine manufacturers). The reciprocating engine offers a remarkable degree of flexibility in selecting plant capacity. This flexibility exists because the engines are modular in every sense (fuel cell stacks have similar modularity). Scale-up is accomplished simply by adding cylinders (e.g., 20 vs 16) or by adding engines (4 vs 3). There is no scale-up of the basic cylinder size. Thus, there is essentially no technical development needed to scale-up the Cooper-Bessemer Clean Coal Diesel Technology all the way from 2 MW (one 6-cylinder engine) to 50 MW (eight 20-cylinder engines), other than engineering adaptation of the turbocharger to match the engine.

Wilson, R.P.; Balles, E.N.; Rao, K.; Benedek, K.R.; Benson, C.E.; Mayville, R.A.; Itse, D.; Kimberley, J.; Parkinson, J.



Venture Capital Fund Performance and the IPO Market  

E-Print Network (OSTI)

flow data used in this paper is net of fees. Thus, to provide a fair basis for comparison, some adjustment must be made to account for the likely fees a GP would receive. Metrick and Yasuda (2007) provide some guidance on this issue... of those who invest in venture capital funds. This is an important issue as the liquidity risk of venture funds is significantly greater than for any other class of asset insomuch as most venture funds have a contractual lifespan of ten years...

McKenzie, Michael; Janeway, William



Florida Venture Capital Program (Florida) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Florida Venture Capital Program (Florida) Florida Venture Capital Program (Florida) Florida Venture Capital Program (Florida) < Back Eligibility Commercial Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info Funding Source US Department of the Treasury State Florida Program Type Equity Investment Grant Program Provider Florida Opportunity Fund The Florida Venture Capital Program provides equity investments and convertible debt instruments to emerging Florida companies and companies locating in Florida with long-term growth potential. Equity investments require a matching private capital investment or other credit assistance. Equity investments and debt instruments ranging from $1,000,000 to $5,000,000 are available, though larger transactions are permitted in


Alvan Blanch Green Fuels joint venture | Open Energy Information  

Open Energy Info (EERE)

venture Place United Kingdom Product A partnership in which Alvan Blanch provides an oil press to extract oil from rape and Green Fuels provides the equipment to turn the oil...


Lasting social impact : Community Development Venture Capital investing  

E-Print Network (OSTI)

Community Development Venture Capital Funds (CDVC) funds are an emerging group of Community Development Financial Institutions, that make equity investments in businesses in economically distressed areas. As equity investors, ...

Silberberg, Hattie Paige



Vantage Point Venture Partners (Canada) | Open Energy Information  

Open Energy Info (EERE)

Vantage Point Venture Partners (Canada) Vantage Point Venture Partners (Canada) Name Vantage Point Venture Partners (Canada) Address 1200 McGill College, Suite 1240 Place Montreal, Canada Zip QC H3B 4G7 Product Venture capital fund. Website http://www.vpvp.com/ Coordinates 45.501418°, -73.5703564° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.501418,"lon":-73.5703564,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Puna Geothermal Venture 8MW Expantion | Open Energy Information  

Open Energy Info (EERE)

Venture 8MW Expantion Venture 8MW Expantion Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Puna Geothermal Venture 8MW Expantion Abstract Adding to its existing generating capacity of 27 MW, Ormat's Puna Geothermal Venture (PGV) geothermal power plant recently completed a successful 8MW expansion project bringing more renewable, low-cost electricity to the people of Hawaii. The project presented several technical challenges including use of high scale potential brine in a state-of-the-art binary plant, development of highly reliable brine pH monitoring and control system, and brine injection management in a high energy resource. Each of the project challenges were overcome with unique engineering solutions. Authors Mike Kaleikini, Paul Spielman, Tom Buchanan, Ormat Technologies

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Native American Venture Acceleration Fund provides boost to six regional  

NLE Websites -- All DOE Office Websites (Extended Search)

Native American Venture Acceleration Fund Native American Venture Acceleration Fund Native American Venture Acceleration Fund provides boost to six regional businesses The grants are designed to help the recipients create jobs, increase their revenue base and help diversify the area economy. February 26, 2013 Ribbon cutting and grand opening of Than Povi Fine Art Gallery in Cuyamungue. Ribbon cutting and grand opening of Than Povi Fine Art Gallery in Cuyamungue. Contact Steve Sandoval Communications Office (505) 665-9206 Email LANS and Los Alamos National Laboratory are excited to announce the first of these Native American Venture Acceleration Grant Fund recipients and we look forward to working with these and other Native American businesses to promote economic development in Northern New Mexico.


Advanced Lighting Controls - My Venture from the Ivory Tower  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Lighting Controls - My Venture from the Ivory Tower Speaker(s): Charlie Huizenga Date: June 15, 2012 - 12:00pm Location: 90-3122 Seminar HostPoint of Contact: Dragan...


United States -- Mexican joint ventures: A case history approach  

Science Conference Proceedings (OSTI)

Because the Mexican government has encouraged investment in Mexico by increasing the percentage of ownership of a Mexican business that a US company can hold, joint ventures are more attractive now than they had been in the past. This study provides preliminary information for US renewable energy companies who are interested in forming a joint venture with a Mexican company. This report is not intended to be a complete reference but does identifies a number of important factors that should be observed when forming a Mexican joint venture: (1)Successful joint ventures achieve the goals of each partner. (2)It is essential that all parties agree to the allocation of responsibilities. (3)Put everything in writing. (4)Research in depth the country or countries in which you are considering doing business.

Moore, N.L.; Chidester, R.J.; Hughes, K.R.; Fowler, R.A.



California Coast Venture Forum | Open Energy Information  

Open Energy Info (EERE)

Forum Forum Jump to: navigation, search Name California Coast Venture Forum Address 800 Anacapa Street, Suite A Place Santa Barbara, California Zip 93101 Region Southern CA Area Year founded 1996 Phone number (805) 495-6962 Website http://www.ccvf.org/ Notes Mission is to mentor, advise and promote growing companies in markets in California Coordinates 34.421162°, -119.698427° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.421162,"lon":-119.698427,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


thanks go to Jesse Reyes and Thomson Venture Economics, who provided the Venture Economics data and  

E-Print Network (OSTI)

This paper demonstrates how the principal-agent problem between venture capitalists and their investors (limited partners) causes limited partner returns to depend on diversifiable risk. Our theory shows why the need for investors to motivate VCs alters the negotiations between VCs and entrepreneurs and changes how new firms are priced. The three-way interaction rationalizes the use of high discount rates by VCs and predicts a correlation between total risk and net of fee investor returns. We take our theory to a unique data set and find empirical support for the effect of the principal-agent problem on equilibrium private equity asset prices. (JEL G24, D82, G31) 2 Venture capitalists (often called VCs) are known to use high discount rates in assessing potential investments. This strategy may be just a fudge factor that offsets optimistic entrepreneurial projections, but VCs claim to use high discount rates even in internal projections. Furthermore, Cochrane (2005) looks at individual VC projects and shows that they earn large positive alphas, which suggests the use of high discount rates in pricing. In general, VCs seem

Michael Ewens; Charles M. Jones



Vantage Point Venture Partners (California) | Open Energy Information  

Open Energy Info (EERE)

Point Venture Partners (California) Point Venture Partners (California) Jump to: navigation, search Logo: Vantage Point Venture Partners (California) Name Vantage Point Venture Partners (California) Address 1001 Bayhill Drive, Suite 300 Place San Bruno, California Zip 94066 Region Bay Area Product Venture capital fund. Phone number (650) 866-3100 Website http://www.vpvp.com/ Coordinates 37.6301458°, -122.4189541° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.6301458,"lon":-122.4189541,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vantage Point Venture Partners (China) | Open Energy Information  

Open Energy Info (EERE)

China) China) Jump to: navigation, search Logo: Vantage Point Venture Partners (China) Name Vantage Point Venture Partners (China) Address No. 79 Jan Guo Road Place Beijing, China Zip 100025 Product Venture capital fund. Phone number 86-10-59204270 Website http://www.vpvp.com/ Coordinates 39.9090502°, 116.5382066° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.9090502,"lon":116.5382066,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vantage Point Venture Partners (Hong Kong) | Open Energy Information  

Open Energy Info (EERE)

Kong) Kong) Jump to: navigation, search Logo: Vantage Point Venture Partners (Hong Kong) Name Vantage Point Venture Partners (Hong Kong) Address Two Exchange Square, Level 8-5 Place Central, Hong Kong Product Venture capital fund. Phone number 852 2297 2325 Website http://www.vpvp.com/ Coordinates 22.2838889°, 114.1583333° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":22.2838889,"lon":114.1583333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Venture Wind II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Venture Wind II Wind Farm Venture Wind II Wind Farm Facility Venture Wind II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner SeaWest Developer Seawest Energy Purchaser Pacific Gas & Electric Co Location Altamont Pass CA Coordinates 37.7347°, -121.652° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.7347,"lon":-121.652,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EcoElectron Ventures Inc | Open Energy Information  

Open Energy Info (EERE)

EcoElectron Ventures Inc EcoElectron Ventures Inc Jump to: navigation, search Name EcoElectron Ventures Inc Address 1106 Second Street, PMB 212 Place Encinitas, California Zip 92024 Region Southern CA Area Coordinates 33.052083°, -117.2793685° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.052083,"lon":-117.2793685,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rudd Klein Alternative Energy Ventures LLC aka Phoenix Energy Fund | Open  

Open Energy Info (EERE)

Rudd Klein Alternative Energy Ventures LLC aka Phoenix Energy Fund Rudd Klein Alternative Energy Ventures LLC aka Phoenix Energy Fund Jump to: navigation, search Name Rudd-Klein Alternative Energy Ventures LLC (aka Phoenix Energy Fund) Place New York, New York Sector Solar Product New York venture capital firm, specialising in early-stage solar companies. References Rudd-Klein Alternative Energy Ventures LLC (aka Phoenix Energy Fund)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Rudd-Klein Alternative Energy Ventures LLC (aka Phoenix Energy Fund) is a company located in New York, New York . References ↑ "Rudd-Klein Alternative Energy Ventures LLC (aka Phoenix Energy Fund)" Retrieved from "http://en.openei.org/w/index.php?title=Rudd_Klein_Alternative_Energy_Ventures_LLC_aka_Phoenix_Energy_Fund&oldid=350507"


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


WindPole Ventures LLC | Open Energy Information  

Open Energy Info (EERE)

WindPole Ventures LLC WindPole Ventures LLC Jump to: navigation, search Logo: WindPole Ventures LLC Name WindPole Ventures LLC Address 48 Pleasant Street Place Lexington, Massachusetts Zip 02421 Sector Wind energy Product Will create, develop and operate commercial-scale wind powered electric generating facilities Website http://www.windpoleventures.co Coordinates 42.423694°, -71.207449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.423694,"lon":-71.207449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SAIL Venture Partners (New York) | Open Energy Information  

Open Energy Info (EERE)

SAIL Venture Partners (New York) SAIL Venture Partners (New York) Name SAIL Venture Partners (New York) Address 30 Rockefeller Plaza Place New York, New York Zip 10112 Region Northeast - NY NJ CT PA Area Product Venture capital fund focusing on clean energy Year founded 2002 Phone number (917) 612-2620 Website http://www.sailvc.com/ Coordinates 40.7589558°, -73.9794642° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.7589558,"lon":-73.9794642,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


WORKING PAPER The survival of venture capital backed companies  

E-Print Network (OSTI)

management. Her interests are mainly related to the financing of growing companies, more specifically venture capital. She is also founding partner of the Vlerick Business Angels Network. Katleen Baeyens is research assistant at the Department of Corporate Finance, Faculty of Economics

Sophie Manigart; Vlerick Leuven; Gent Management School; Katleen Baeyens; Wim Van Hyfte



Venture Wind I Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind I Wind Farm Wind I Wind Farm Jump to: navigation, search Name Venture Wind I Wind Farm Facility Venture Wind I Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner SeaWest Developer SeaWest Energy Purchaser Pacific Gas & Electric Co Location Altamont Pass CA Coordinates 37.7347°, -121.652° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.7347,"lon":-121.652,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Advanced Lighting Controls - My Venture from the Ivory Tower  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Lighting Controls - My Venture from the Ivory Tower Advanced Lighting Controls - My Venture from the Ivory Tower Speaker(s): Charlie Huizenga Date: June 15, 2012 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Dragan Charlie Curcija Lighting energy represents 30-40% of commercial building electricity consumption, yet very few buildings have advanced lighting controls. The potential energy savings are tremendous as is the opportunity to reduce demand on the grid during critical peak use periods. Charlie will describe how low-cost wireless radio technology developed at UC Berkeley and commercialized by Adura Technologies is creating a paradigm shift in the way we think about controlling lighting. Beyond deep energy savings and demand response, the technology offers personal control for occupants and

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Point Venture, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Venture, Texas: Energy Resources Venture, Texas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 30.3793672°, -97.9961238° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.3793672,"lon":-97.9961238,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Technical status of the Dish/Stirling Joint Venture Program  

DOE Green Energy (OSTI)

Initiated in 1991; the Dish/Stirling Joint Venture Program (DSJVP) is a 5-year, $17.2 million joint venture which is funded by Cummins Power Generation, Inc. (CPG) of Columbus, Indiana and the United States Department of Energy`s (DOE) Solar Thermal and Biomass Power Division. Sandia National Laboratories administers and provides technical management for this contract on the DOE`s behalf. In January, 1995; CPG advanced to Phase 3 of this three-phase contract. The objective of the DSJVP is to develop and commercialize a 7-kW. Dish/Stirling System for remote power markets by 1997. In this paper, the technical status of the major subsystems which comprise the CPG 7-kW{sub e} Dish/Stirling System is presented. These subsystems include the solar concentrator, heat pipe receiver, engine/alternator, power conditioning, and automatic controls.

Bean, J.R. [Cummins Power Generation, Inc., Columbus, IN (United States); Diver, R.B. [Sandia National Labs., Albuquerque, NM (United States)



SAIL Venture Partners (Washington DC) | Open Energy Information  

Open Energy Info (EERE)

DC) DC) Name SAIL Venture Partners (Washington DC) Address 2900 S. Quincy St, Suite 375 Place Arlington, Virginia Zip 22206 Product Venture capital fund focusing on clean energy Year founded 2002 Phone number (703) 379-2713 Website http://www.sailvc.com/ Coordinates 38.839975°, -77.087781° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.839975,"lon":-77.087781,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Photovoltaic-Based Projects and Ventures: Development Guides  

Science Conference Proceedings (OSTI)

Photovoltaic (PV)-based systems have demonstrated the ability to help utilities reduce their cost of service, expand their customer service options, increase their customer base, decrease emissions, and enhance their public image. This report provides an organized approach to developing PV-based projects, programs, or ventures. It discusses how PV systems can be effectively used and describes the advantages, disadvantages, costs, and limitations of such systems. In addition, the report offers insight int...



The Utility-Scale Joint-Venture Program  

DOE Green Energy (OSTI)

The Department of Energy`s Utility-Scale Joint-Venture (USJV) Program was developed to help industry commercialize dish/engine electric systems. Sandia National Laboratories developed this program and has placed two contracts, one with Science Applications International Corporation`s Energy Projects Division and one with the Cummins Power Generation Company. In this paper we present the designs for the two dish/Stirling systems that are being developed through the USJV Program.

Gallup, D.R.; Mancini, T.R.



O2Diesel Corporation formerly Dynamic Ventures | Open Energy Information  

Open Energy Info (EERE)

O2Diesel Corporation formerly Dynamic Ventures O2Diesel Corporation formerly Dynamic Ventures Jump to: navigation, search Name O2Diesel Corporation (formerly Dynamic Ventures) Place Newark, Delaware Zip 19713 Product O2Diesel Corporation has a proprietary additive made from fats and oils, which facilitates the blending of ethanol with diesel. Coordinates 44.690435°, -71.951685° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.690435,"lon":-71.951685,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Russian joint ventures, upstream deals hit fast clip  

Science Conference Proceedings (OSTI)

This paper reports that Russia is stepping up the pace of joint ventures and imports of petroleum technology and hardware. Among the latest action: Polar Lights, a 50-50 venture of Conoco Timan-Pechora Ltd. and Arkhangelskgeologia (AAG), started drilling in the first new-field oil-development project in Russia to include a US partner; The governments of Oman and the Kazakhstan republic signed an agreement covering oil and gas exploration, field development, and production in Kazakhstan; Phibro Energy Inc., Greenwich, Conn., last week reported the sale and delivery of the first full cargo of Russian crude oil produced and exported by a Russian-American joint venture; Era Aviation Inc., Anchorage, Alas., is sending two helicopters with crewmen to Russia to help assess the feasibility of oil and gas development off Sakhalin Island; In deals involving Canadian companies, SNC-Lavalin Inc., Montreal, received a contract for initial work on a $350 million (US) modernization of the Volvograd refinery in southern Russia.

Not Available



Double Bottom Line Project Report:Assessing Social Impact In Double Bottom Line Ventures  

E-Print Network (OSTI)

of Key Characteristics Glossary Method Summaries Theories ofin double bottom line ventures methods catalog glossary ofterms glossary of terms This glossary defines the variables

Rosenzweig, William



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Trends in U.S. Venture Capital Investments Related to Energy: 1980-2007  

SciTech Connect

This report documents trends in U.S. venture capital investments over the period 1980-2008. Particular attention is given to U.S. venture capital investments for internet-specific, biotechnology, and energy / industrial sectors over the period 1980-2007. During the early 1980s, U.S. venture capital investments in the energy / industrial area accounted for more than 20% of all venture capital investments. However subsequent periods of low energy prices and the emergence of fast growing new industries like computers (both hardware and software), biotechnology and the Internet quickly reduced the priority accorded to energy / industrial investments as by 2000 these investments accounted for only 1% of the $119 billion dollars invested that year by the U.S. venture capital community. The significant increase in the real price of oil that began in 2003-2004 correlates with renewed interest and increased investment by the venture capital community in energy / industrial investment opportunities. Venture capital investments in 2007 for the energy / industrial sector accounted for $3 billion or slightly more than 10% of all venture capital invested that year.

Dooley, James J.



Pangaea Ventures Ltd (New Jersey) | Open Energy Information  

Open Energy Info (EERE)

Logo: Pangaea Ventures Ltd (New Jersey) Name Pangaea Ventures Ltd (New Jersey) Address 90 Amwell Road, Bldg 3, Suite 318 Place Hillsborough, New Jersey Zip 08844 Region Northeast - NY NJ CT PA Area Product Invests in early-stage clean energy technologies. Phone number (908) 874-3880 Website http://www.pangaeaventures.com Coordinates 40.5067431°, -74.6589497° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.5067431,"lon":-74.6589497,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Photovoltaic venture analysis. Final report. Volume III. Appendices  

DOE Green Energy (OSTI)

This appendix contains a brief summary of a detailed description of alternative future energy scenarios which provide an overall backdrop for the photovoltaic venture analysis. Also included is a summary of a photovoltaic market/demand workshop, a summary of a photovoltaic supply workshop which used cross-impact analysis, and a report on photovoltaic array and system prices in 1982 and 1986. The results of a sectorial demand analysis for photovoltaic power systems used in the residential sector (single family homes), the service, commercial, and institutional sector (schools), and in the central power sector are presented. An analysis of photovoltaics in the electric utility market is given, and a report on the industrialization of photovoltaic systems is included. A DOE information memorandum regarding ''A Strategy for a Multi-Year Procurement Initiative on Photovoltaics (ACTS No. ET-002)'' is also included. (WHK)

Costello, D.; Posner, D.; Schiffel, D.; Doane, J.; Bishop, C.



Photovoltaic venture analysis. Final report. Volume II. Appendices  

DOE Green Energy (OSTI)

A description of the integrating model for photovoltaic venture analysis is given; input assumptions for the model are described; and the integrating model program listing is given. The integrating model is an explicit representation of the interactions between photovoltaic markets and supply under alternative sets of assumptions. It provides a consistent way of assembling and integrating the various assumptions, data, and information that have been obtained on photovoltaic systems supply and demand factors. Secondly, it provides a mechanism for understanding the implications of all the interacting assumptions. By representing the assumptions in a common, explicit framework, much more complex interactions can be considered than are possible intuitively. The integrating model therefore provides a way of examining the relative importance of different assumptions, parameters, and inputs through sensitivity analysis. Also, detailed results of model sensitivity analysis and detailed market and systems information are presented. (WHK)

Costello, D.; Posner, D.; Schiffel, D.; Doane, J.; Bishop, C.



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Dacite Melt at the Puna Geothermal Venture Wellfield, Big Island of Hawaii  

Open Energy Info (EERE)

Dacite Melt at the Puna Geothermal Venture Wellfield, Big Island of Hawaii Dacite Melt at the Puna Geothermal Venture Wellfield, Big Island of Hawaii Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Dacite Melt at the Puna Geothermal Venture Wellfield, Big Island of Hawaii Abstract During the drilling of injection well KS-13 in 2005 at the Puna Geothermal Venture (PGV) well field, on the island of Hawaii, a 75-meter interval of diorite containing brown glass inclusions was penetrated at a depth of 2415 m. At a depth of 2488 m a melt of dacitic composition was encountered. The melt flowed up the well bore and was repeatedly re-drilled over a depth interval of 8 m, producing several kilograms of clear, colorless vitric cuttings at the surface. The dacitic glass cuttings have a perlitic texture, a silica content of 67 wgt.%, are enriched in alkalis and nearly


U.S. Department of Energy Selects Venture Capital Firms to Accelerate  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Venture Capital Firms to Venture Capital Firms to Accelerate Adoption of Advanced Energy Technologies U.S. Department of Energy Selects Venture Capital Firms to Accelerate Adoption of Advanced Energy Technologies February 27, 2008 - 11:43am Addthis SAN FRANCISCO, CA - U.S. Department of Energy (DOE) Assistant Secretary for Energy Efficiency and Renewable Energy Alexander Karsner today announced the competitive selection of three venture capital firms to participate in DOE's newly established Entrepreneur in Residence (EIR) pilot program, which aims to accelerate deployment and commercialization of advanced clean energy technologies from three DOE National Laboratories into the global marketplace. The EIR pilot program furthers President Bush's comprehensive strategy to reduce our nation's dependence on foreign oil and


Interaction model of private equity and venture capital developing factors in Chile and Latin America  

E-Print Network (OSTI)

Private equity and venture capital (PE/VC) are efficient resource allocation systems that provide equity capital to selected entrepreneurs, industries or firms that contribute to advance the economic welfare of society. ...

Sevil Esteban, ngel


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Agency conflicts in financial contracting with applications to venture capital and CDO markets  

E-Print Network (OSTI)

In these papers I examine efficient financial contracting when incentive problems play a significant role. In the first chapter (joint with Z. Fluck and S. Myers) we focus on the venture capital industry. We build a two-stage ...

Garrison, Kedran



Price of anarchy in supply chains, congested systems and joint ventures  

E-Print Network (OSTI)

This thesis studies the price of anarchy in supply chains, congested systems and joint ventures. It consists of three main parts. In the first part, we investigate the impact of imperfect competition with nonlinear demand. ...

Sun, Wei, Ph. D. Massachusetts Institute of Technology



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Trends in U.S. Venture Capital Investments Related to Energy: 1980 through the Third Quarter of 2010  

SciTech Connect

This report documents trends in U.S. venture capital investments over the period 1980 through the third quarter of calendar year 2010 (2010 Q1+Q2+Q3). Particular attention is given to U.S. venture capital investments in the energy/industrial sector over the period 1980-2010 Q1+Q2+Q3 as well as in the more recently created cross-cutting category of CleanTech over the period 1995-2010 Q1+Q2+Q3. During the early 1980s, U.S. venture capital investments in the energy/industrial sector accounted for more than 20% of all venture capital investments. However subsequent periods of low energy prices, the deregulation of large aspects of the energy industry, and the emergence of fast growing new industries like computers (both hardware and software), biotechnology and the Internet quickly reduced the priority accorded to energy/industrial investments. To wit, venture capital investments related to the energy/industrial sector accounted for only 1% of the $132 billion (in real 2010 US$) invested in 2000 by the U.S. venture capital community. The significant increase in the real price of oil that began in 2003-2004 correlates with renewed interest and increased investment by the venture capital community in energy/industrial investment opportunities. Venture capital investments for 2009 for the energy/industrial sector accounted for $2.4 billion or slightly more than 13% of all venture capital invested that year. The total venture capital invested in energy/industrial during the first three quarters of 2010 is close to $2.4 billion accounting for slightly less than 15% of all venture capital investments during the first three quarters of 2010. In 2009, the aggregate amount invested in CleanTech was $2.1 billion (11% of the total US venture capital invested in that lean year) and for the first three quarters of 2010 US venture capital investments in CleanTech have already exceeded $2.8 billion (18% of all US venture capital investments made during the first three quarters of 2010). Between 2004 and 2009, U.S. venture capital investments in energy/industrial as well as CleanTech have more than quadrupled in real terms.

Dooley, James J.



Trends in U.S. Venture Capital Investments Related to Energy: 1980 through the Second Quarter of 2010  

SciTech Connect

This report documents trends in U.S. venture capital investments over the period 1980 through the second quarter of calendar year 2010 (2010Q1+Q2). Particular attention is given to U.S. venture capital investments in the energy/industrial sector over the period 1980-2010Q1+Q2 as well as in the more recently created cross-cutting category of CleanTech over the period 1995-2010Q1+Q2. During the early 1980s, U.S. venture capital investments in the energy/industrial sector accounted for more than 20% of all venture capital investments. However subsequent periods of low energy prices, the deregulation of large aspects of the energy industry, and the emergence of fast growing new industries like computers (both hardware and software), biotechnology and the Internet quickly reduced the priority accorded to energy/industrial investments. To wit, venture capital investments related to the energy/industrial sector accounted for only 1% of the $119 billion dollars invested in 2000 by the U.S. venture capital community. The significant increase in the real price of oil that began in 2003-2004 correlates with renewed interest and increased investment by the venture capital community in energy/industrial investment opportunities. Venture capital investments for 2009 for the energy/industrial sector accounted for $2.1 billion or slightly more than 13% of all venture capital invested that year. The total venture capital invested in energy/industrial during the first two quarters of 2010 is close to $1.8 billion accounting for 17% of all venture capital investments during the first two quarters of 2010. In 2009, the aggregate amount invested in CleanTech was $1.8 billion (30% of the total US venture capital invested in that lean year) and for the first two quarters of 2010 US venture capital investments in CleanTech have already exceeded $1.9 billion (19% of all US venture capital investments made during the first half of 2010). Between 2004 and 2009, U.S. venture capital investments in energy/industrial as well as CleanTech have more than quadrupled in real terms.

Dooley, James J.



Non-Federal Participation Federal Marketing and Joint Ventures : Administrator`s Record of Decision.  

SciTech Connect

By this Record of Decision, the Bonneville Power Administrtion (BPA) adopts the Federal Marketing and Joint Ventures alternative to guide future BPA contract negotiations involving use of the Pacific Northwest-Pacific Southwest AC Intertie (Intertie). To implement this concept, BPa intends to negotiate an array of flexible, market-oriented contracts, expanded Intertie access for non-BPA parties, efficient use of Federal Columbia River resources, and facilitation of efficient, coordinated west coast development of generating resources. Federal Marketing and Joint Ventures meets need and serves purposes to a better degree than No Action. BPA considers Federal Marketing and Joint Ventures to be the environmentally preferable alternative in that it encourages long-term coordination of west coast generating resource development and operation. This provides the greatest opportunity to decrease generation of more environmentally harmful plants which would otherwise have greater effects on air, land, and water, and to avoid construction of new generation plants.

United States. Bonneville Power Administration.



Women & early-stage entrepreneurship : examining the impact of the venture funding crisis on male and female-led technology start-ups  

E-Print Network (OSTI)

Women in technology have always been a minority and the number of women who are founders of venture backed start-ups is even lower. This research empirically investigates venture capital funding received by entrepreneurs ...

Swaminathan, Shuba



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Private equity and venture capital in emerging markets : a case study of Egypt and the MENA region  

E-Print Network (OSTI)

Private equity and venture capital investments in emerging markets grew significantly over the past five years (2003-2008), both in absolute and relative terms. In this study, we examine the industry's role in emerging ...

Ismail, Ayman (Ayman Adel), 1973-


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Zero Gravity 2.0: Launching Technology Companies in a Tougher Venture Capital World, 2nd edition  

Science Conference Proceedings (OSTI)

From the Publisher:The handbook for the next phenomenal period of venture capital. Zero Gravity quickly became one of the defining books during an unprecedented period in entrepreneurship. But, the world it described and helped shape changed ...

Steve Harmon / Ann Winblad



Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Application for Underground Injection Control Permit for the PUNA Geothermal Venture Project  

DOE Green Energy (OSTI)

Puna Geothermal Venture (PGV) plans to construct and operate the 25 MW Puna Geothermal Venture Project in the Puna District of the Island of Hawaii. The project will drill geothermal wells within a dedicated 500-acre project area, use the produced geothermal fluid to generate electricity for sale to the Hawaii Electric Light Company for use on the Island of Hawaii, and inject all the produced geothermal fluids back into the geothermal reservoir. Since the project will use injection wells, it will require an Underground Injection Control (UIC) permit from the Drinking Water Section of the State of Hawaii Department of Health. The PGV Project is consistent with the State and County of Hawaii's stated objectives of providing energy self-sufficiency and diversifying Hawaii's economic base. The project will develop a new alternate energy source as well as provide additional information about the nature of the geothermal resource.




Application for Underground Injection Control Permit for the PUNA Geothermal Venture Project  

SciTech Connect

Puna Geothermal Venture (PGV) plans to construct and operate the 25 MW Puna Geothermal Venture Project in the Puna District of the Island of Hawaii. The project will drill geothermal wells within a dedicated 500-acre project area, use the produced geothermal fluid to generate electricity for sale to the Hawaii Electric Light Company for use on the Island of Hawaii, and inject all the produced geothermal fluids back into the geothermal reservoir. Since the project will use injection wells, it will require an Underground Injection Control (UIC) permit from the Drinking Water Section of the State of Hawaii Department of Health. The PGV Project is consistent with the State and County of Hawaii's stated objectives of providing energy self-sufficiency and diversifying Hawaii's economic base. The project will develop a new alternate energy source as well as provide additional information about the nature of the geothermal resource.



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


BOLD VENTURE COMPUTATION SYSTEM for nuclear reactor core analysis, Version III  

Science Conference Proceedings (OSTI)

This report is a condensed documentation for VERSION III of the BOLD VENTURE COMPUTATION SYSTEM for nuclear reactor core analysis. An experienced analyst should be able to use this system routinely for solving problems by referring to this document. Individual reports must be referenced for details. This report covers basic input instructions and describes recent extensions to the modules as well as to the interface data file specifications. Some application considerations are discussed and an elaborate sample problem is used as an instruction aid. Instructions for creating the system on IBM computers are also given.

Vondy, D.R.; Fowler, T.B.; Cunningham, G.W. III.



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


VENTURE/PC manual: A multidimensional multigroup neutron diffusion code system. Version 3  

SciTech Connect

VENTURE/PC is a recompilation of part of the Oak Ridge BOLD VENTURE code system, which will operate on an IBM PC or compatible computer. Neutron diffusion theory solutions are obtained for multidimensional, multigroup problems. This manual contains information associated with operating the code system. The purpose of the various modules used in the code system, and the input for these modules are discussed. The PC code structure is also given. Version 2 included several enhancements not given in the original version of the code. In particular, flux iterations can be done in core rather than by reading and writing to disk, for problems which allow sufficient memory for such in-core iterations. This speeds up the iteration process. Version 3 does not include any of the special processors used in the previous versions. These special processors utilized formatted input for various elements of the code system. All such input data is now entered through the Input Processor, which produces standard interface files for the various modules in the code system. In addition, a Standard Interface File Handbook is included in the documentation which is distributed with the code, to assist in developing the input for the Input Processor.

Shapiro, A.; Huria, H.C.; Cho, K.W. [Cincinnati Univ., OH (United States)



Women & early-stage entrepreneurship : examining the impact of the venture funding crisis on male and female-led technology start-ups; Women and early-stage entrepreneurship; Examining the impact of the venture funding crisis on male and female-led technology start-ups.  

E-Print Network (OSTI)

??Women in technology have always been a minority and the number of women who are founders of venture backed start-ups is even lower. This research (more)

Swaminathan, Shuba



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Joint venture terms that hasten production in the Black Sea region  

Science Conference Proceedings (OSTI)

The break up of the Former Soviet Union (FSU) provided opportunities for the major western oil companies to access the giant oil and gas fields of Siberia, Kazakhstan and Azerbaijan. Meanwhile, smaller companies spotted the hydrocarbon provinces further west long neglected by the centralized Soviet system. Gas production in Ukraine was established long before the Tyumen area was opened up, oil production had started in Georgia more than 100 years ago and the North Caucasus fields in Dagestan have been in production for over 50 years. All these areas are also close to the Black Sea with short links to export terminals. Legislation already provided for joint venture companies but not production sharing contracts. The compromise was to build production sharing into the JV company structure. This allowed the state partner to obtain some revenue from start-up of production with no cash outlay. It also ensured that the western company obtained a substantial amount of its investment back in cost recovery before the more onerous profit sharing arrangement commenced. These conditions enabled JKX to rapidly agree four JV's in three countries and start operations almost immediately. Production of hydrocarbons began in Ukraine in early 1995 with exploration and appraisal drilling in the Black Sea and onshore Georgia following soon after. Continued close contact with the governments has permitted JKX to demonstrate the benefits of the PSC without the need for JVs. Legislation is being enacted for future licenses in the region to be issued as PSC's along conventional lines.

Miller, M.; Robson, D. (JKX Oil and Gas plc, Guildford (United Kingdom))



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Novel Biomass Conversion Process Results in Commercial Joint Venture, The Spectrum of Clean Energy Innovation (Fact Sheet)  

NLE Websites -- All DOE Office Websites (Extended Search)

Novel Biomass Conversion Process Novel Biomass Conversion Process Results in Commercial Joint Venture A novel biomass-to-ethanol process developed, integrated, and demonstrated at pilot scale at the National Renewable Energy Laboratory (NREL) is the basis for one of the world's first cellulosic ethanol demonstration plants. The 74,000-ft 2 plant in Vonore, Tennessee, began production in January 2010. Through a Cooperative Research and Development Agreement (CRADA) with DuPont, NREL and DuPont scientists and engineers developed a unique low-cost pretreatment process that converts raw biomass to ethanol in high yields. The process was developed to facilitate the commercial readiness of lignocellulosic ethanol, which is ethanol produced from nonfood biomass feedstocks such as corn stover, agricultural waste, and energy crops.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Independent Technical Investigation of the Puna Geothermal Venture Unplanned Steam Release, June 12 and 13, 1991, Puna, Hawaii  

DOE Green Energy (OSTI)

On June 24, 1991, a third-party investigation team consisting of Richard P. Thomas, Duey E. Milner, James L. Moore, and Dick Whiting began an investigation into the blowout of well KS-8, which occurred at the Puna Geothermal Venture (PGV) site on June 12, 1991, and caused the unabated release of steam for a period of 31 hours before PGV succeeded in closing in the well. The scope of the investigation was to: (a) determine the cause(s) of the incident; (b) evaluate the adequacy of PGVs drilling and blowout prevention equipment and procedures; and (c) make recommendations for any appropriate changes in equipment and/or procedures. This report finds that the blowout occurred because of inadequacies in PGVs drilling plan and procedures and not as a result of unusual or unmanageable subsurface geologic or hydrologic conditions. While the geothermal resource in the area being drilled is relatively hot, the temperatures are not excessive for modem technology and methods to control. Fluid pressures encountered are also manageable if proper procedures are followed and the appropriate equipment is utilized. A previous blowout of short duration occurred on February 21, 1991, at the KS-7 injection well being drilled by PGV at a depth of approximately 1600'. This unexpected incident alerted PGV to the possibility of encountering a high temperature, fractured zone at a relatively shallow depth. The experience at KS-7 prompted PGV to refine its hydrological model; however, the drilling plan utilized for KS-8 was not changed. Not only did PGV fail to modify its drilling program following the KS-7 blowout, but they also failed to heed numerous ''red flags'' (warning signals) in the five days preceding the KS-8 blowout, which included a continuous 1-inch flow of drilling mud out of the wellbore, gains in mud volume while pulling stands, and gas entries while circulating muds bottoms up, in addition to lost circulation that had occurred earlier below the shoe of the 13-3/8-hch casing.

Thomas, Richard; Whiting, Dick; Moore, James; Milner, Duey



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Corporate Venture Capital (CVC)  

Science Conference Proceedings (OSTI)

... US Department of Commerce Carlos M. Gutierrez, Secretary ... Industrial/Energy 6.9% 5.3 ... report providing scientific and technical advisory support to ...



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



SGI Ventures | Open Energy Information  

Open Energy Info (EERE)

Partner Partnering Center within NREL Electricity Resources & Building Systems Integration LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now SGI...


Career Advice Venturing into New  

E-Print Network (OSTI)

, including which were approved. Information on companies and trends in every market sector is available mechanical engineering professor realized, "The biology and energy had to be tightly coupled to produce, then reduce the capital and energy expenditures of production to keep costs below $80 per barrel. Expecting 80

Hammock, Bruce D.


Ideum awarded Venture Acceleration Funds  

NLE Websites -- All DOE Office Websites (Extended Search)

(R) has tapped into the Lab's economic development programs: VAF, NMSBA, Market Intelligence. Ideum, his Corrales, New Mexico based business, creates gesture-based software for...


Ilion Ventures | Open Energy Information  

Open Energy Info (EERE)

Policies International Clean Energy Analysis Low Emission Development Strategies Oil & Gas Smart Grid Solar U.S. OpenLabs Utilities Water Wind Page Actions View form View source...


Joint venture builds new rigs  

Science Conference Proceedings (OSTI)

Recent emphasis on increasing drilling efficiency and avoiding additional environmental damage has led Russian operator Gazprom to specify a new generation drilling rig for exploratory and development drilling in the Astrakhan gas/condensate field in southwestern Russia. The two rigs on order combine Russian and American technology and include a unique system for processing contaminated drill cuttings. The article describes the rig package and cuttings treatment system.




Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Non-utility marketers provide over 20% of residential natural gas ...  

U.S. Energy Information Administration (EIA)

Biofuels: Ethanol & Biodiesel ... customersaveraging over 85% of total deliveries since 2000. Starting October 1, 1999, all residential natural gas customers ...


Commercialization of coal-fired diesel engines for cogeneration and non-utility power markets  

DOE Green Energy (OSTI)

The primary objective of this METC project is to established practical, durable components compatible with clean coal slurry fuel and capable of low emissions. The components will be integrated into a coal power system for a 100-hr proof-of-concept test. The goal of this program is to advance the stationary coal-fueled diesel engine to the next plateau of technological readiness, and thus provide the springboard to commercialization.

Wilson, R.P.; Rao, K.; Benedek, K.R.; Itse, D.; Parkinson, J.; Kimberley, J.; Balles, E.N.; Benson, C.E.; Smith, C.



Commercialization of coal-fired diesel engines for cogeneration and non-utility power markets  

DOE Green Energy (OSTI)

The primary objective of this METC project is to established practical, durable components compatible with clean coal slurry fuel and capable of low emissions. The components will be integrated into a coal power system for a 100-hr proof-of-concept test. The goal of this program is to advance the stationary coal-fueled diesel engine to the next plateau of technological readiness, and thus provide the springboard to commercialization.

Wilson, R.P.; Rao, K.; Benedek, K.R.; Itse, D.; Parkinson, J.; Kimberley, J.; Balles, E.N.; Benson, C.E.; Smith, C.



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



New venture commercialization of clean energy technologies  

E-Print Network (OSTI)

Clean energy technologies lower harmful emissions associated with the generation and use of power (e.g. CO2) and many of these technologies have been shown to be cost effective and to provide significant benefits to adopters. ...

Miller, David S. (David Seth)



New Energy Ventures (Kentucky) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kentucky Science and Technology Corp. This fund provides capital for companies exploring alternative and renewable energy technologies. Companies may apply for a 30,000 grant, an...


LANL announces Venture Acceleration Fund recipients  

NLE Websites -- All DOE Office Websites (Extended Search)

Environment Feature Stories Public Reading Room: Environmental Documents, Reports LANL Home Phonebook Calendar Video Newsroom News Releases News Releases - 2011 ...


Technology Ventures Corporation (TVC) K-12 Education ...  

Northern New Mexico Regional Science Bowl for both high school and middle school students engaging over 500 students from nearly 60 schools.


Hot dry rock venture risks investigation:  

DOE Green Energy (OSTI)

This study assesses a promising resource in central Utah as the potential site of a future commerical hot dry rock (HDR) facility for generating electricity. The results indicate that, if the HDR reservoir productivity equals expectations based on preliminary results from research projects to date, a 50 MWe HDR power facility at Roosevelt Hot Springs could generate power at cost competitive with coal-fired plants. However, it is imperative that the assumed productivity be demonstrated before funds are committed for a commercial facility. 72 refs., 39 figs., 38 tabs.

Not Available



Lab seeks venture acceleration initiative partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Initiative is a pilot program to strategically spin off from the Lab start-up companies with emphasis on establishing new businesses in northern New Mexico. June 9, 2008...


Lab seeks ideas for venture acceleration fund  

NLE Websites -- All DOE Office Websites (Extended Search)

investments of up to 100,000 to facilitate projects with regional entrepreneurs, companies, investors, or strategic partners. July 9, 2008 Los Alamos National Laboratory sits...



E-Print Network (OSTI)

Board Steven Crouch Michelle Hopewell Jim Kakalios David Hoffman Kristine Kosek Vaughan Voller Inventing

Minnesota, University of


Renewable Energy Business Venture Assistance Program (REBVAP...  

Open Energy Info (EERE)

photovoltaic system for instance, balance of systems refers to equipment such as the inverter, disconnects, and power conditioning devices, other than the photovoltaic panels....


Dish-Stirling Joint Venture Program  

SciTech Connect

A brief report about DOE/Sandia National Laboratories/Cummins Engine Company dish-Stirling solar electric engine system being perfected.




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Serial Entrepreneurs and Venture Performance: Evidence from U.S. Venture-Capital-Financed  

E-Print Network (OSTI)

the microenvironment surrounding the fossil material and the macroenviron- ment of the background lake bottom water

Sadoulet, Elisabeth


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Strategic analysis of mobile money ventures in Developing countries  

E-Print Network (OSTI)

Mobile money services are spreading rapidly in many developed and developing countries across the world. Whereas in developed economies these new services are seen as a way to make current services more functional and ...

Caballero, Luis (Luis Alberto Caballero Parra)



Los Alamos National Laboratory announces selection of venture...  

NLE Websites -- All DOE Office Websites (Extended Search)

early 2012. The core project team includes Charles Lieber, Ph.D.; Spencer Farr, Ph.D.; Noah Clay, Ph.D.; and Mark Walztoni. Vista anticipates hiring 17 additional full-time, high...


Early-stage technology ventures in India : opportunities and issues  

E-Print Network (OSTI)

High-technology Entrepreneurship has been a key driver of innovation and economic growth in the US. Aided by factors such as the success in IT and IT-enabled services industries and a booming economy, India has seen a sharp ...

Chennapragada, Aparna



Venture capital returns, new firms and social networks  

E-Print Network (OSTI)

C. Green, and Vasant Naik, Optimal Investment, GrowthGreen and Naik (2004) formulate a model of staged investments

Ewens, Michael



European Recycling Platform Experiences from a New Venture  

Science Conference Proceedings (OSTI)

Materialization of Manganese by Selective Precipitation from Used Battery Materials ... The Challenge of Allocation in LCA: The Case of Open-Loop Recycling.


The Internationalization of Venture Capital and Private Equity*  

E-Print Network (OSTI)

Guler I. and M. F. Guillen (2005), Knowledge, Institutions,A study by Guler and Guillen (2005) finds that VC firms tend2001), and Guler and Guillen (2005)]. We also find that a

Aizenman, Joshua; Kendall, Jake



Five companies received funding through new venture acceleration...  

NLE Websites -- All DOE Office Websites (Extended Search)

proposals and those receiving funding included: San Ildefonso Development Corp., Three Eagles Development Corp., Cochitit Pueblo Development Corp., Sunbeam Indian Art and Avanyu...


Land-incentivized joint ventures for infrastructure development in India  

E-Print Network (OSTI)

Over the next 20 years, it is projected that India will make the transition from a primarily rural economy to one in which more than half of its 1.1 billion strong population will live in urban areas. As this demographic ...

Hingorani, Pritika



Venture Acceleration Funds go to nine regional businesses to...  

NLE Websites -- All DOE Office Websites (Extended Search)

fluid injection projects are occurring. The smart-sensor technology will be offered to field operators at a fraction of the cost of current systems. * NuAira, Inc. (nuaira.com) of...



this risk capital in order to receive above average returns (better than the stock market) on their money over a period of 10-12 years.


Photovoltaic venture analysis. Final report. Volume I. Executive summary  

DOE Green Energy (OSTI)

The objective of the study, government programs under investigation, and a brief review of the approach are presented. Potential markets for photovoltaic systems relevant to the study are described. The response of the photovoltaic supply industry is then considered. A model which integrates the supply and demand characteristics of photovoltaics over time was developed. This model also calculates the economic benefits associated with various government subsidy programs. Results are derived under alternative possible supply, demand, and macroeconomic conditions. A probabilistic analysis of the costs and benefits of a $380 million federal photovoltaic procurement initiative, as well as certain alternative strategies, is summarized. Conclusions and recommendations based on the analysis are presented.

Costello, D.; Posner, D.; Schiffel, D.; Doane, J.; Bishop, C.



Laboratory announces selection of Venture Acceleration Fund recipients  

NLE Websites -- All DOE Office Websites (Extended Search)

as the city of Albuquerque and the state of New Mexico. Both currently purchase their biofuels from the Midwest. "In July 2010, all municipal and state governments will be...


LANS Venture Acceleration Fund announces "Call for Ideas"  

NLE Websites -- All DOE Office Websites (Extended Search)

promising companies received VAF awards totaling 100,000 each: Simtable and Southwest Biofuels. All companies interested in submitting an idea statement for VAF are strongly...


SERI photovoltaic venture analysis: long term demand estimation  

SciTech Connect

This report presents the results of a sectoral demand analysis for photovoltaic power systems used in the residential sector (single family homes), the service, commercial, and institutional sector (schools), and in the central power sector. The results described are the output of a set of three normative modeling activities carried out by the MIT Energy Laboratory. They are based on the assumption that the sectors, i.e., the utilities, schools, and homeowners, will switch to photovoltaic power systems when they are cost-effective relative to the competition, that is, centralized power generation using conventional fuels. In each case the assumption is made that the market for photovoltaic power systems will be a new market, not a retrofit market. As a result the annual (total for utilities) sales potential at a given price is estimated for each sector assuming a specific level of new installations in that sector, i.e., new single-family homes, new schools, and additions to utility stocks. As such, the results presented are maxima for a given application. While the methodology presented does not allow for any early acceptors, it does assume that once economic all new homeowners, school-builders, and utilities will buy to a fixed level.

Tabors, R.D.; Finger, S.; Burns, A.; Carpenter, P.; Dinwoodie, T.



Energy Venture Investing Guidebook: Managing the Investment Process  

Science Conference Proceedings (OSTI)

The electricity industry is undergoing an unprecedented change as states legislate and implement deregulation of the integrated electric utility business. Formerly protected markets are being opened to competition. It is widely believed that competition will result in lower electricity prices and the loss of a share of current customers, a loss which will squeeze the cash flows of utilities participating in newly competitive markets. As a result, many firms that had been integrated utilities are now look...



Lab announces selection of partner for venture acceleration initiative  

NLE Websites -- All DOE Office Websites (Extended Search)

initiative is a pilot program aimed at strategically spinning off technology-based companies from the Lab with emphasis on establishing new businesses in Northern New Mexico....


Early Stage Impacts of the Printed Wiring Board Joint Venture ...  

Science Conference Proceedings (OSTI)

... The outlook for the future was not considered ... material handling, machining equipment, pollution, energy and safety ... at a double-digit annual rate of ...



Political chaos reins progress on new joint ventures in Russia  

SciTech Connect

This paper reports that frustration is mounting among foreign petroleum companies chasing business opportunities in Russia. Political uncertainty continues to block large oil and gas exploration and production deals there. Most foreign officials believe Russia's transformation from a centrally planned economy to a market economy is irreversible. But enough political, social, and economic uncertainty persists that Russian leaders are hesitant to approve deals with foreign companies. The lack of certainty among leaders of the former Soviet republic about who controls Russia's natural resources, who can approve contracts, and who determines winners of bid tenders is causing confusion among foreign companies trying to negotiate major E and P deals. With no clearly successful path apparent for completing large deals, various secondary negotiating strategies are prevailing. Russian industry specialists say those secondary strategies work best for small deals involving relatively small players in less prospective regions. Meantime, countervailing political forces within the country, the world's top producer of oil and gas, continue to buffet petroleum companies that are negotiating deals or getting projects off the ground.

Not Available



""Panel on Strategies for CrossPanel on Strategies for Cross--Cutting Research Ventures"Cutting Research Ventures"  

E-Print Network (OSTI)

.g., gender, ethnicity, disability, geography, etc.)? To what extent will it enhance the infrastructure! This is a vital element of a center. It takes a great deal of time and energy to bring together the team

Peterson, Blake R.

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Technological innovation, venture formation and resource allocation : the impact of economic downturn on life sciences venture capital and start-ups  

E-Print Network (OSTI)

The Massachusetts life sciences supercluster is a source of tremendous innovation. The Commonwealth's academic and industrial institutions produce a consistent stream of cutting-edge scientific research and the region has ...

Wolfson, Avidon M




E-Print Network (OSTI)


O'Mahony, Donal E.


Scattering Geese: The Venture Capital Industries of East Asia: A Report to the World Bank  

E-Print Network (OSTI)

led to a deterioration of the SME's margins leading to weakening balance sheets, making it difficult for them to get further funding

Kenney, Martin; Han, Kyonghee; Tanaka, Shoko



Double Bottom Line Project Report:Assessing Social Impact In Double Bottom Line Ventures  

E-Print Network (OSTI)

Ongoing Assessment of Social Impact (OASIS) rubicon programsHall, 1996). poverty and social impact analysis (psia) Datas Guide to Poverty and Social Impact Analysis (World Bank,

Rosenzweig, William



Home Sweet Home: Entrepreneurs' Location Choices and the Performance of Their Ventures  

Science Conference Proceedings (OSTI)

Entrepreneurs, even more than employees, tend to locate in regions in which they have deep roots (home regions). Here, we examine the performance implications of these choices. Whereas one might expect entrepreneurs to perform better in ... Keywords: behavior, econometrics, economics, effectiveness--performance, organizational studies

Michael S. Dahl; Olav Sorenson



Radiation exposure liability : the burden of responsibility and compensation in civilian and military nuclear ventures  

E-Print Network (OSTI)

Since Enrico Fermi first discovered that neutrons could split atoms in 1934, peaceful and militaristic uses of nuclear energy have become prevalent in our society. Two case studies, Three Mile Island and the Nevada Test ...

Flores, Jessica (Jessica Alejandro)



Double Bottom Line Project Report:Assessing Social Impact In Double Bottom Line Ventures  

E-Print Network (OSTI)

tract and zip code analysis Quality Jobs Sample Metric: PayAnalysis benefit cost analysis of job corps summary of davidand costs of the job corps. journal of policy analysis and

Rosenzweig, William



Combustion characterization of carbonized RDF, Joint Venture Task No. 7. Topical Report  

Science Conference Proceedings (OSTI)

The overall objective of this research program was to demonstrate EnerTech?s and the Energy & Environmental Research Center?s (EERC) process of slurry carbonization for producing homogeneous, pumpable titels from refuse-derived fuel (RDF) with continuous pilot plant facilities, and to characterize flue gas and ash emissions from combustion of the carbonizd RDF slurry fuel. Please note that ?Wet Thermal Oxidation? is EnerTech?s trademark mme for combustion of the carbonized RDF slurry fuel. Carbonized RDF slurry fuels were produced with the EERC?S 7.5-tpd (wet basis) pilot plant facility. A hose diaphragm pump pressurized a 7- lo-wt% feed RDF slurry, with a viscosity of 500 cP, to approximately 2500 psig. The pressurized RDF slurry was heated by indirect heat exchangers to between 5850 -626?F, and its temperature and pressure was maintained in a downflow reactor. The carbonized slurry was flashed, concentrated in a filter press, and ground in an attritor. During operation of the pilot plant, samples of the feed RDF slurry, carbonization gas, condensate, carbonized solids, and filtrate were taken and analyzed. Pilot-scale slurry carbonization experiments with RDF produced a homogeneous pumpable slurry fuel with a higher heating value (HHV) of 3,000-6,600 Btu/lb (as-received basis), at a viscosity of 500 CP at 100 Hz decreasing, and ambient temperature. Greater-heating-value slurry fuels were produced at higher slurry carbonization temperatures. During slurry carbonization, polyvinyl chloride (PVC) plastics in the feed RDF also decompose to form hydrochloric acid and salts. Pilot-scale slurty carbonization experiments extracted 82-94% of the feed RDF chlorine content as chloride salts. Higher carbonization temperatures and higher alkali additions to the feed slurry produced a higher chlorine extraction.




The Contested Energy Future of Amman, Jordan: Between Promises of Alternative Energies and a Nuclear Venture  

E-Print Network (OSTI)

policies, among which are included a green growth program and the building of a nuclear power plant, this article explores the case of Amman's energy transition. The growth of consumption coupled with new energy demographic and economic growth, particularly fueled by regional migrations. New consumption practices


The Ups and Downs of Collaborative Ventures: A Case Study on Being a Collaborator  

E-Print Network (OSTI)

populations hosted by the ticks, resulting in an epidemic of Lyme disease 100 years after the extinction

Berkowitz, Alan R.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Many new ventures in the Middle East focus on old oil, gas fields  

SciTech Connect

This paper reviews the oil and supplies of the world and then focuses on the Middle East as the primary source of oil and gas for the world in the future. It provides data on the total world production and reserves and compares that to the Middle East production and reserves. Data is also provided on pricing and consumption from 1965 to 1995. It goes on to provide information on petroleum exports for the major users and makes predictions on future trends. Finally the paper presents aspects of investment opportunities, sources or needs for capital investments, and the politics associated with the Middle East oil and gas industry.

Takin, M. [Centre for Global Energy Studies, London (United Kingdom)



Case Study of R&D Efficiency in an ATP Joint Venture  

Science Conference Proceedings (OSTI)

... the decline in US market share, one very ... Company, Type of Producer, Primary Market Niche. ... and a new, dimensionally stable thin film material that ...


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Scattering Geese: The Venture Capital Industries of East Asia: A Report to the World Bank  

E-Print Network (OSTI)

of the Hsinchu Science Park is ETRI. In Korea, the researchexceptions are the role of ETRI in Hsinchu, and China, thepossible (Mathews 1995). ETRI and the However, the most

Kenney, Martin; Han, Kyonghee; Tanaka, Shoko



Integrated gasification combined cycle and steam injection gas turbine powered by biomass joint-venture evaluation  

DOE Green Energy (OSTI)

This report analyzes the economic and environmental potential of biomass integrated gasifier/gas turbine technology including its market applications. The mature technology promises to produce electricity at $55--60/MWh and to be competitive for market applications conservatively estimated at 2000 MW. The report reviews the competitiveness of the technology of a stand-alone, mature basis and finds it to be substantial and recognized by DOE, EPRI, and the World Bank Global Environmental Facility.

Sterzinger, G J [Economics, Environment and Regulation, Washington, DC (United States)



Real lessons for venture capitalists in multimodal logistics systems : where does profitability come from?  

E-Print Network (OSTI)

In this thesis we review three case studies in multimodal logistics and transportation systems and analyze the reasons that lead to failure or success. We present the business idea and model of each case study and study ...

Veniamis, Nikolas Th



How to prepare the National Guard's leadership for successful venture in homeland security .  

E-Print Network (OSTI)

??The National Guard (NG) will be the first military force on disaster scenes in the United States. If the NG is to respond as efficiently (more)

Amundson, Randy J.



Patterns of partner selection within a network of joint ventures in oil and gas exploration.  

E-Print Network (OSTI)

?? Leaders of companies exploring for oil and gas had no means of characterizing the multitude of intercompany associations common to the industry. This study (more)

Cooke, Jeffrey Emmet




E-Print Network (OSTI)

U.S. Department of Energy under Contract No. DE-AC03-76SF00098Disclaimer This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the United States Government nor any agency thereof, nor The Regents of the University of California, nor any of their employees, makes any warranty, express or implied, or assumes any legal responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by its trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof, or The Regents of the University of California. The views and opinions of authors expressed herein do

Ernest Orlando Lawrence; Mireya Imaz; Carlos Gay; Rafael Friedmann; Beth Goldberg; Mireya Imaz; Carlos Gay; Rafael Friedmann; Beth Goldberg



Mexico joins the venture: Joint Implementation and Greenhouse Gas Emissions Reduction  

E-Print Network (OSTI)

to Promote Energy-Efficient Lighting in Mexico. EnergyCFLS, an energy-saving technology in Mexico. The Ilumexstudies in energy apd forestry to address Mexicos concerns

Imaz, Mireya; Gay, Carlos; Friedmann, Rafael; Goldberg, Beth



Puerto Rico | OpenEI  

Open Energy Info (EERE)

Puerto Rico Puerto Rico Dataset Summary Description Source The Wave Energy Resource Assessment project is a joint venture between NREL, EPRI, and Virginia Tech. EPRI is the prime contractor, Virginia Tech is responsible for development of the models and estimating the wave resource, and NREL serves as an independent validator and also develops the final GIS-based display of the data. Source National Renewable Energy Laboratory (NREL) Date Released September 27th, 2011 (3 years ago) Date Updated October 20th, 2011 (3 years ago) Keywords EPRI GIS NREL Puerto Rico shapefile United States Virginia Tech wave energy Data application/zip icon Download Data in CSV Format (zip, 3.4 MiB) application/zip icon Download Wave Power Density Shapefile (zip, 2.5 MiB) application/zip icon Download Wave Energy Period Shapefile (zip, 2.5 MiB)


EETD DLS: Extrapolate the Past...or Invent the Future  

NLE Websites -- All DOE Office Websites (Extended Search)

imprudent "science experiments," and to take on both "for profit" and for "social impact" ventures, he formed Khosla Ventures. Khosla Ventures focuses on both traditional...


Vinod Khosla  

NLE Websites -- All DOE Office Websites (Extended Search)

imprudent "science experiments," and to take on both "for profit" and for "social impact" ventures, he formed Khosla Ventures. Khosla Ventures focuses on both traditional...


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Prepared as part of a Joint Venture Agreement with the USDA Forest Service Pacific Northwest Research Station  

E-Print Network (OSTI)

There is widespread recognition of the potential role forests can play in contributing to Green House Gas (GHG) reductions through carbon sequestration. Non-industrial private forests (NIPF) comprise a significant portion of forests in the U.S. (approximately 40%). Thus, it is crucial to assess the role that NIPF landowners can play in broader carbon sequestration efforts. Management actions that could increase carbon sequestration on NIPF lands include afforestation of agricultural land, longer rotations, intensive management, changing stocking density, or choosing alternative tree species. Because the resulting carbon sequestration benefits are to a large extent external to individual landowners, incentives such as carbon sequestration subsidies and carbon release taxes, carbon rental fees, or cost-sharing agreements, may be necessary to induce them to adopt these management options. A key question is how effective these different policies can be in eliciting the desired management choices by NIPF owners. In this report we assess the current state of knowledge about carbon sequestration in forests, including afforestation of agricultural land, sequestration in existing forests, and sequestration in NIPFs. We review the broader literature on the response of NIPF owners to incentives intended to promote specific forest management activities and to conserve habitat for endangered species,

Christian Langpap; Taeyoung Kim



Qualification Plan for Phase One of True-MidPacific Geothermal Venture: James Campbell - Kahaualea Project, Island of Hawaii  

DOE Green Energy (OSTI)

The objective of this project is to develop the geothermal resources of the James Campbell Estate, comprising acres in the Puna District of the Island of Hawaii. The geothermal resource is assumed to exist in the vicinity of the East Rift of the Kilauea volcano. The location of the proposed geothermal well field and the geothermal-electric power plant are shown on Dwg. No. E-04-001. Access to the project area will be provided by a new road extension from the boundary road south from Glenwood on Highway 11.




Novel Biomass Conversion Process Results in Commercial Joint Venture; The Spectrum of Clean Energy Innovation (Fact Sheet)  

SciTech Connect

Fact sheet describing DuPont/NREL cooperative research and development agreement that resulted in biomass-to-ethanol conversion process used as a basis for DuPont Danisco Cellulosic Ethanol, LLC and cellulosic ethanol demonstration plant.



Entity State Ownership Residential Commercial Industrial Transportation  

U.S. Energy Information Administration (EIA) Indexed Site

. 1 Constellation Solar Arizona LLC AZ Non_Utility . . 1 . 1 FRV SI Transport Solar LP AZ Non_Utility . 1 . . 1 MFP Co III, LLC AZ Non_Utility . 1 . . 1 RV CSU Power II LLC AZ Non_Utility . 1 . . 1 Scottsdate Solar Holdings LLC AZ Non_Utility . 1 . . 1 SunE M5C Holdings LLC AZ Non_Utility . . 1 . 1 Alliance Star Energy LLC CA Non_Utility . 1 . . 1 Applied Energy Inc CA Non_Utility . . 1 . 1 Bloom Energy 2009 PPA CA Non_Utility . 1 . . 1 Bloom Energy 2009 PPA CA Non_Utility . 1 . . 1 Bloom Energy 2009 PPA CA Non_Utility . 1 . . 1 Bloom Energy 2009 PPA CA Non_Utility . 1 . . 1 CPKelco U S Inc CA Non_Utility . . 1 . 1 Calpine Corp-Agnews CA Non_Utility . 1 . . 1 Cardinal Cogen Inc CA Non_Utility . 1 . . 1 City of Madera CA WWTP CA Non_Utility . . 1 . 1 DPC Juniper, LLC CA Non_Utility . . 1 . 1 DPC Juniper, LLC CA Non_Utility . . 1 . 1 Energy Alchemy TA Vernalis, LLC CA Non_Utility . . 1 . 1 Enfinity NorCal 1 FAA LLC


Partnerships and Technology Transfer - ORNL  

... Directorate organized a Venture Showcase so the venture firms better understand ORNL's research capabilities in solar energy, ... by legislation passed by the ...


Managing R&D Risk in Renewable Energy  

E-Print Network (OSTI)

tenfold increase in alternative energy venture capitalTable 5: US Alternative Energy Venture Capital ($M) Biofuelsstrategy across alternative renewable energy technologies

Rausser, Gordon C.; Papineau, Maya



Corporate venture capital : transforming CVC into an effective corporate strategic tool for seeking innovation and growth in the 21st Century  

E-Print Network (OSTI)

The decline of innovation has hampered the growth of many large corporations as they seek to remain competitive in increasingly challenging conditions. To complement, and at times, replace their internal Research and ...

Barretto-Ko, Percival



Best practices for venture philanthropy collaborations between disease-focused foundations and for-profit life science companies by Joanne Chang.  

E-Print Network (OSTI)

The history of private philanthropy in the US has been dominated by family foundations with arms-length philanthropy practices that largely existed in separation from commercial enterprise and business operations. This ...

Chang, Joanne



The Prospects for Social Business in Peri-Urban Water Supply: Employment and Household Welfare Impacts of the Grameen Veolia Venture  

E-Print Network (OSTI)

such as pipes, spigots and jars. Masons are essential toselling water delivered in jars. These alterations to thethe program launched a jar business in peri-urban centers

Pierce, Gregory



Technology transfer for residential energy programs in new construction and existing housing: A joint venture between the City of St. Louis and Hennepin County  

SciTech Connect

The St. Louis Year VII project built on previous work conducted in St. Louis to demonstrate the technology and financing of superinsulated housing, to implement a full-scale, energy efficient housing program in St. Louis. The project also involved the transfer of elements of the St. Louis program to assist Hennepin County in establishing a program to promote energy efficient new residential construction in Minnesota. During the project, Hennepin County (Minneapolis, Minnesota) presented the results of a performance contracting program implemented in Years V and VI to provide energy retrofit for existing homeowners in Minneapolis. This program has special appeal in St. Louis because of the difficulty in motivating middle-income homeowners to invest in conservation options.



EaglePicher Horizon Batteries LLC | Open Energy Information  

Open Energy Info (EERE)

EaglePicher Horizon Batteries LLC EaglePicher Horizon Batteries LLC Jump to: navigation, search Name EaglePicher Horizon Batteries, LLC Place Dearborn, Michigan Zip MI 48126 Product Joint Venture developing, manufacturing and distributing a breakthrough, high performance sealed lead-acid battery. Coordinates 39.520064°, -94.770486° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.520064,"lon":-94.770486,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Entity State Ownership Residential Commercial Industrial Transportation  

U.S. Energy Information Administration (EIA) Indexed Site

,735 ,735 . 1,735 Constellation Solar Arizona LLC AZ Non_Utility . . 798 . 798 FRV SI Transport Solar LP AZ Non_Utility . 243 . . 243 MFP Co III, LLC AZ Non_Utility . 603 . . 603 RV CSU Power II LLC AZ Non_Utility . 436 . . 436 Scottsdate Solar Holdings LLC AZ Non_Utility . 49 . . 49 SunE M5C Holdings LLC AZ Non_Utility . . 212 . 212 Alliance Star Energy LLC CA Non_Utility . 266 . . 266 Applied Energy Inc CA Non_Utility . . 935 . 935 Bloom Energy 2009 PPA CA Non_Utility . 183 . . 183 Bloom Energy 2009 PPA CA Non_Utility . 382 . . 382 Bloom Energy 2009 PPA CA Non_Utility . 583 . . 583 Bloom Energy 2009 PPA CA Non_Utility . 771 . . 771 CPKelco U S Inc CA Non_Utility . . 4 . 4 Calpine Corp-Agnews CA Non_Utility . 47 . . 47 Cardinal Cogen Inc CA Non_Utility . 15,846 . . 15,846 City of Madera CA WWTP CA Non_Utility . . 310 . 310 DPC Juniper, LLC CA Non_Utility . . 21 . 21 DPC Juniper, LLC


Denmarks future as leading centre of competence within  

E-Print Network (OSTI)

is to strengthen public-private cooperation between the state, businesses, knowledge institutions and venture


Workshop on Future Directions in Cyber-Physical  

E-Print Network (OSTI)

and Key Resources (CIKR) owners/operators and state representatives; industry; sectors, venture capital

Washington at Seattle, University of


Zahlen und Fakten / Highlights Wissen umsetzen Firmen grnden  

E-Print Network (OSTI)

Kurse, Beratung, ETH transfer, Venture Businessplan (mit McKinsey Schweiz) sowie in Zusammenarbeit mit


Strategic evaluation of investments in coal-dust fuel for blast furnaces  

SciTech Connect

The paper discusses the evaluation of venture investment projects in pulverized coal injection into blast furnaces.

S.V. Bogdanov; S.M. Kornilaev [State University of Management, Moscow (Russian Federation)



Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital


Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius



I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc


Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals


Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of


Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area


Innovative Wind Concepts GmbH | Open Energy Information  

Open Energy Info (EERE)

Innovative Wind Concepts GmbH Place Germany Sector Services, Wind energy Product Joint venture founded by Siemens Project Ventures GmbH (SPV), a subsidiary of Siemens Financial...



Science Conference Proceedings (OSTI)

1. Joint Venture Prograamme at Cranfield (UK)The Joint Venture Programme, newly launched by the Cranfield School of Management, offers help to companies that are looking to expand their business in developing countries. It is claimed that ...

B. H. Rudall



Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en


Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard



Robert Amaro  

Science Conference Proceedings (OSTI)

... mechanical engineering firms. 2005-2007: Partner, Monsoon Ventures design/build engineering firm, Tucson AZ. 1999-2003 ...



Waltham, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Minuteman Wind LLC Registered Financial Organizations in Waltham, Massachusetts Battery Ventures Utility Companies in Waltham, Massachusetts National Grid References US...


Charlie Huizenga  

NLE Websites -- All DOE Office Websites (Extended Search)

Huizenga Adura TechnologiesUC Berkeley This Speaker's Seminars Advanced Lighting Controls - My Venture from the Ivory Tower...



E-Print Network (OSTI)

as from its participation in a joint · 9 venture with Nordwestdeutsche Kraftwerke A.G. . The latter

Columbia University


ECONOMIC I S a n d i a Na t i o n a l L a b o r a t o r i e s ...  

Technology Ventures Corporation (TVC) TVC identi? es technologies with commercial potential, coordinates the development of business and management capabilities ...


2011 Wind Technologies Market Report  

E-Print Network (OSTI)

joint venture between Duke Energy and American Transmissionwind energy to load centers in Michigan. Duke-American

Bolinger, Mark



Michigan - State Energy Profile Data - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Monroe (Detroit Edison Co) ; Ludington (Consumers Energy Co) ; Dan E Karn (Consumers Energy Co) ; Midland Cogeneration Venture (Midland Cogeneration ...


Michigan Profile - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Monroe (Detroit Edison Co) ; Ludington (Consumers Energy Co) ; Dan E Karn (Consumers Energy Co) ; Midland Cogeneration Venture (Midland Cogeneration ...


US energy research and development: Declining investment, increasing need, and the feasibility of expansion  

E-Print Network (OSTI)

energy Apollo or Manhattan project, as these ventures pyIncrease n/a Program Manhattan Project Apollo Program

Nemet, Gregory F; Kammen, D M



Entity State Code Class of Ownership Residential Commercial...  

U.S. Energy Information Administration (EIA) Indexed Site

Code Class of Ownership Residential Commercial Industrial Transportation All Sectors DTE Energy Services AL Non-Utility - - 458,868 - 458,868 Riceland Foods Inc. AR Non-Utility -...


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob



Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro



Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California


1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa



Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock



Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine



Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL



SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass




Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan




SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan




SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan




SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan



AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico



SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan



Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market


,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...


Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsamiR- 195. Hsa-miR-30a and hsa-miR-195 were...


Research & Technology Showcase in Albuquerque on September 12  

NLE Websites -- All DOE Office Websites (Extended Search)

Sponsors for the event include Sandia National Laboratories, Bernalillo County, the City of Albuquerque, Sandia Science & Technology Park, and Technology Ventures Corporation...


The 21st NREL Industry Growth Forum Program  

How is the clean energy market evolving? How has the credit crisis impacted cleantech and what Speaker: Dave Edwards, Partner, Vantage Point Ventures


International collaborations | Princeton Plasma Physics Lab  

NLE Websites -- All DOE Office Websites (Extended Search)

around the world. Such collaborations include supplying diagnostic equipment to ITER, a joint venture of the European Union, the United States and five other countries that...


Energy Department Announces Regional Winners of University Clean...  

NLE Websites -- All DOE Office Websites (Extended Search)

include: the National Renewable Energy Laboratory (NREL), law firm Mintz Levin, the Clean Energy Alliance (CEA), Battelle Ventures, and The Cleantech Open. The six winning...


Bill Vogel  

NLE Websites -- All DOE Office Websites (Extended Search)

and Vantage Point Ventures. His areas of interest and area of expertise is renewable smart grids, or the unified management of distributed energy resources and demand response...



E-Print Network (OSTI)

Profile, 2001. Anon. Azerbaijan: RJR in Joint venture.by cigarettes Armenia Azerbaijan Estonia Georgia Kazakhstansid=57. Source quoted for Azerbaijan and Moldova: household

Anna BC Gilmore



About the Financial Reporting System Companies  

U.S. Energy Information Administration (EIA)

After Exxon and Mobil merged, the venture was continued with Exxon Mobil as the partner. 44 Performance Profiles of Major Energy Producers 2009.


NETL: Clean Coal Technology Demonstration Program (CCTDP) - Round...  

NLE Websites -- All DOE Office Websites (Extended Search)

Wabash River Coal Gasification Repowering Project - Project Brief PDF-250KB Wabash River Coal Gasification Repowering Project Joint Venture West Terre Haute, IN Program...


Countries Algeria Overview - Energy Information Administration  

U.S. Energy Information Administration (EIA)

new ventures, particularly exploration in offshore areas and in areas onshore that contain shale resources. ... PTTEP is PTT Exploration and Production of Thailand.


Sudan and South Sudan - Analysis - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Both companies are active in their respective country's oil exploration and production and are often minority shareholders in joint ventures with foreign oil ...


New Cycle Capital LLC | Open Energy Information  

Open Energy Info (EERE)

California Zip 94103 Product San Francisco-based venture capitalist firm prioritising investment into early stage companies that are active in the "green economy". References...


Not All Carbon Credits are Created Equal: The Constitutional and the Cost of Regional Cap-and-Trade Market Linkage  

E-Print Network (OSTI)

California's Green Policies, Encourages More Investment (increased investments from venture capitalists and green jobClean, green technology is] one of the best investments out

Howland, Juliet


Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EERE: Commercialization & Deployment  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

marketplace. Commercialization Commercialization initiatives help bridge the gap between technology R&D and venture capital funding and marketing. Energy Innovation Portal...


Performance Profiles of Major Energy Producers - Energy ...  

U.S. Energy Information Administration (EIA)

... which includes the addition of three refinery joint ventures to the FRS survey. FRS companies accounted for 78 percent of U.S. refining capacity ...


RUSNANO Solnechniy Potok JV | Open Energy Information  

Open Energy Info (EERE)

Russian Federation Sector Solar Product Russia-based new generation solar PV systems joint venture. References RUSNANO & Solnechniy Potok JV1 LinkedIn Connections CrunchBase...


SkyPower Pekon Electronics JV | Open Energy Information  

Open Energy Info (EERE)

search Name SkyPower-Pekon Electronics JV Place India Sector Wind energy Product Joint venture for development of Indian wind farms. References SkyPower-Pekon Electronics...


Aries Solar Termoelectrica SL ASTE | Open Energy Information  

Open Energy Info (EERE)

Aries Solar Termoelectrica SL (ASTE) Place Madrid, Spain Zip 28046 Sector Solar Product Joint venture to set up Solar Thermal Electricity Generation (STEG) plants in Castilla la...


Titan Energy Systems Enfinity JV | Open Energy Information  

Open Energy Info (EERE)

Systems & Enfinity JV Place Andhra Pradesh, India Sector Solar Product India-based joint venture to develop solar PV projects. References Titan Energy Systems & Enfinity JV1...


Aerowatt Energies | Open Energy Information  

Open Energy Info (EERE)

Name Aerowatt Energies Place France Sector Solar, Wind energy Product France-based joint venture established to develop wind and solar projects in French territories....


Abener Ghenova | Open Energy Information  

Open Energy Info (EERE)

to: navigation, search Name Abener Ghenova Place Spain Sector Renewable Energy Product Joint venture between Abener Energia and Ghesa to build renewable projects in Spain....


International Power Girasolar joint company | Open Energy Information  

Open Energy Info (EERE)

Girasolar joint company Jump to: navigation, search Name International Power Girasolar joint company Sector Solar Product Joint venture announced between US IPWG and...


Proyectos Eolicos Valencianos Project Finance | Open Energy Informatio...  

Open Energy Info (EERE)

Proyectos Eolicos Valencianos Project Finance Place Spain Sector Wind energy Product Joint venture to build 500 MW of wind power in Valencia. References Proyectos Eolicos...


Sunluz | Open Energy Information  

Open Energy Info (EERE)

search Name Sunluz Place Fort Worth, Texas Product Texas-based PV module manufacturing joint venture between Coaire and and an undisclosed South Korean majority owner. References...


Laurentian Energy Authority | Open Energy Information  

Open Energy Info (EERE)

search Name Laurentian Energy Authority Place Minnesota Sector Biomass Product Joint venture between Hibbing and Virginia Public Utilities to develope, own and manage a...


Jetion Europe Ltd | Open Energy Information  

Open Energy Info (EERE)

to: navigation, search Name Jetion Europe Ltd Place Liechtenstein Zip FL-9490 Product Joint venture between Chinese PV cell and module manufacturer Jetion (AIM: JHL), Andreas...


Acciona Renault Nissan Alliance JV | Open Energy Information  

Open Energy Info (EERE)

Acciona & Renault-Nissan Alliance JV Place Spain Sector Vehicles Product Spain-based joint venture to promote electric vehicles. References Acciona & Renault-Nissan Alliance...


RGS Development BV | Open Energy Information  

Open Energy Info (EERE)

to: navigation, search Name RGS Development BV Place Netherlands Sector Solar Product Joint venture between the Energy Research Centre of the Netherlands, Deutsche Solar and...


LNR SY SBC JV | Open Energy Information  

Open Energy Info (EERE)

search Name LNR, SY & SBC JV Place Jiangsu Province, China Sector Biomass Product A joint venture between Libra Natural Resources, SY Energy and SBC International to...


Solar Express | Open Energy Information  

Open Energy Info (EERE)

Solar Express Jump to: navigation, search Name Solar Express Place Italy Product A joint venture established to install some 11MW of photovoltaic generation capacity around the...


Small Business Status  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of capabilities on the part of offerors, which might result in teaming arrangements or joint ventures being formed. Given this, the Department believes that potential offerors...


Pioneer Wincon Pvt Ltd PWPL | Open Energy Information  

Open Energy Info (EERE)

Place Saidapet, Tamil Nadu, India Zip 600 015 Sector Wind energy Product Saidapet-based joint venture between Pioneer Asia Group and Wincon West Wind involved in design,...


Joint Institutes | ornl.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Joint Institutes SHARE Joint Institutes ORNL, in partnership with the Science Alliance of the University of Tennessee, Knoxville, has a number of cooperative ventures in science...

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Integrity Automotive | Open Energy Information  

Open Energy Info (EERE)

Automotive Jump to: navigation, search Name Integrity Automotive Place Kentucky Product Joint venture between Kentucky businessman Randal Waldman of Integrity Manufacturing and...


Wattner and Scheuten JV | Open Energy Information  

Open Energy Info (EERE)

Name Wattner and Scheuten JV Place Kln, Germany Zip 50679 Sector Solar Product A joint venture between Wattner and Scheuten to finance and construct solar plants worth EUR...


Solaire Durance | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name Solaire Durance Place France Sector Solar Product Joint venture between French state bank la Caisse des Dpots and French solar power...


RDC Falck Renewables JV | Open Energy Information  

Open Energy Info (EERE)

JV Place United Kingdom Sector Renewable Energy, Wind energy Product RDC created a joint venture with Falck Renewables Ltd (FRL) to develop a portfolio of wind energy projects...


Viryd Technologies Ningbo Shentong JV | Open Energy Information  

Open Energy Info (EERE)

JV Place China Sector Wind energy Product China-based joint venture to manufacture wind turbines. References Viryd Technologies & Ningbo Shentong JV1 LinkedIn Connections...


State of the Art Report on  

Science Conference Proceedings (OSTI)

... SAC Joint Venture, AISC, the American Iron and ... of steel shape outside the USA, is by ... producers for consumption in the United States, are produced ...



Dynamic Engineering | Open Energy Information  

Open Energy Info (EERE)

clients ranging from large multi-national firms to start-up ventures in the chemical, petroleum, pharmaceutical, biotech and food processing industries. Coordinates 44.414935,...


ECRS-NTS -- Home Page  

NLE Websites -- All DOE Office Websites (Extended Search)

2 - Reporting Requirements Rev 2 (doc, 117 kb) Attachment 5 - List of DOE Applicable Directives (xls, 33kb) Attachment L-1 - Corporate, Partnership, Joint Venture Certificates...


Stumbling Toward Capitalism: The State, Global Production Networks, and the Unexpected Emergence of China's Independent Auto Industry  

E-Print Network (OSTI)

with Geely to develop electric car,? 6 January. http://Venture to Develop Electric Cars. ? Bloomberg News. May 27.and Technology released ?Electric Cars in the United States:

Chang, Crystal Whai-ku



Brian Heimberg  

NLE Websites -- All DOE Office Websites (Extended Search)

ventures include culinary tourism, green building materials trading, and sustainable agriculture advocacy. Brian Heimberg is a UC Berkeley graduate with a self-designed...


Overview of Gridscale Rampable Intermittent Dispatchable Storage...  

NLE Websites -- All DOE Office Websites (Extended Search)

Gridscale Rampable Intermittent Dispatchable Storage (GRIDS) Program Mark Johnson, Program Director Advanced Research Projects Agency - Energy March 7, 2012 Venture Capital and...


DOE Awards $5.3 Million to Support the Development of University...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and development activities with the venture capital funding and expertise that will help increase the rate and scale of clean energy technology market penetration across the...


Ahura Energy Inc | Open Energy Information  

Open Energy Info (EERE)

stage venture capital financing. The company is developing a low-cost, high efficiency solarthermal concentrating system. References Ahura Energy Inc.1 LinkedIn Connections...


The Politics of Carbon Dioxide Emissions Reduction: The Role of Pluralism in Shaping the Climate Change Technology Initiative  

E-Print Network (OSTI)

solar thermal systems at utility/field sites through the Utility-Scale Joint Venture Program. Both the energy-efficiency

Golden, Dylan



Business Plan Competition Opportunities  

The Draper Fisher Jurvetson Venture Challenge is a West Coast business plan competition available to the colleges and universities across the West Coast that


Distributed Wind Power Generation - National Renewable Energy ...  

Technology breakthrough in roof-top distributed wind power generation Multi-billion $ market opportunity in next 10 years recent venture capital investments


EA-1873: Department of Energy Loan Guarantee to Bayerische Landesbank...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

with Fotowatio Renewable Ventures for the Tucson Solar Photovoltaic Power Plant, Arizona EA-1873: Department of Energy Loan Guarantee to Bayerische Landesbank, as...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1970's, and the selective catalytic reduction process for removing oxides of nitrogen in power plant emissions. It is engaged in a joint venture, Salem Engelhard, which...


Nonoxide Fluorescent Nanoparticles - Oak Ridge National Laboratory  

for the U.S. Department of Energy Presentation_name ... y of the dopanmatert Gallium Indium ... Bloo Solar; EPOD Solar. AQT; Canrom. New Solar Ventures;


Performance Profiles of Major Energy Producers - Energy ...  

U.S. Energy Information Administration (EIA)

State Energy Data System (SEDS) International Energy Statistics ... which includes the addition of three refinery joint ventures to the FRS survey.

Note: This page contains sample records for the topic "venture mi non-utility" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

NOCs have partnered with international companies to provide technology and ... a joint venture between ... such as Natuna's D-Alpha Block and offshore ...


Equatorial Guinea - Analysis - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

According to the International Monetary Fund's latest data, ... and joint ventures (JVs) ... and R along with those involved in the first LNG train.



The Commercialization Team of the Office of Energy Efficiency and Renewable Energy (EERE) works to bridge the gap between research and development (R&D), and venture ...


Opportunities for R&D Partnerships - Energy  

239 Opportunities for R&D Partnerships Small Business Innovation Research (SBIR) Small Business Technology Transfer (STTR) Venture Capital Technology Showcase Larry S ...


Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Schlumberger Carbon Services Spectra Energy Corporation Tenaska Taylorville, LLC Total Gas and Power Ventures USA, Inc. Vectren Corporation COST Total Project Value 28,948,987...


Related Articles  

Science Conference Proceedings (OSTI)

... Best Practices that Lead to Successful New Ventures, David A. Lewis, Else Harper-Anderson, Lawrence A. Molnar, 2011 University of Michigan. ...



Aquaint Dialogue Experiment  

Science Conference Proceedings (OSTI)

... three - company joint venture established two years ago by the Seoul Office , together with both Japanese and South Korean LPG container makers ...




75 vehicle technologies program ed wall, program manager ed.wall@ee.doe.gov (202) 586-8055 venture capital technology showcase aug 21 and 22, 2007


GRR/Elements/3-FD-b.2 - Evaluate and Negotiate Proposal | Open...  

Open Energy Info (EERE)

Foremost among the beneficial effects of IMDA was the opportunity for Indian tribes to enter into joint venture agreements with mineral developers. The contractual relationships...


Obama Administration Announces 14 Initial Partners in the Better...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

This will be achieved by leveraging its recent joint venture equity investment by Mitsui USA to attract additional debt providers while aggressively marketing and sourcing...


Ascopiave Gruppo Casillo JV | Open Energy Information  

Open Energy Info (EERE)

search Name Ascopiave & Gruppo Casillo JV Place Italy Sector Solar Product Italy-based solar PV joint venture. References Ascopiave & Gruppo Casillo JV1 LinkedIn Connections...


Capturing Episodes: May the Frame Be with You David Maier, Michael Grossniklaus, Sharmadha Moorthy, Kristin Tufte  

E-Print Network (OSTI)

Edison B uffalo Venture S t Lawren ceDr Kilrea Cres Tyndale CresSouthview Pl C amr ose Ellerslie Ave

Bertini, Robert L.


Strategic Alliances in the Japanese Economy: Types, Critiques, Embeddedness, and Change  

E-Print Network (OSTI)

Hitachi, Matsushita, and Toyota compared. Californiaventure and NUMMI, the GM-Toyota joint venture in Northerncommitment to learning from Toyota, much of Toyotas system

Lincoln, James R.



Bringing Entrepreneurial Ideas to Life  

E-Print Network (OSTI)

Organizational design in the context of new venture development is particularly challenging due to initially severe resource constraints. Deepening our understanding of differential productivity in the startup resource ...

Eesley, Charles E.


Solicore Inc | Open Energy Information  

Open Energy Info (EERE)

Florida-based, venture backed start-up focused on lithium ion polymer re-chargeable battery technology as well as manufacturing battery equipment. References Solicore Inc1...


Solar Parks of Extremadura | Open Energy Information  

Open Energy Info (EERE)

Parks of Extremadura Jump to: navigation, search Name Solar Parks of Extremadura Place Spain Sector Solar Product A joint venture by Spanish Solar company Econenergias and Deutsche...


Missouri/EZ Policies | Open Energy Information  

Open Energy Info (EERE)

Equity Investment Yes StateProvince Certified Capital Companies (CAPCO), the creation of the Department of Economic Development (DED,) are venture capital firms which have...


Missouri/EZFeed Policies | Open Energy Information  

Open Energy Info (EERE)

Photovoltaics Wind energy StateProvince Certified Capital Companies (CAPCO), the creation of the Department of Economic Development (DED,) are venture capital firms which have...


Certified Capital Companies (Missouri) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Missouri Program Type Equity Investment Certified Capital Companies (CAPCO), the creation of the Department of Economic Development (DED,) are venture capital firms which have...


SeaMicro | Open Energy Information  

Open Energy Info (EERE)

SeaMicro Place Santa Clara, California Zip 95054 Product SeaMicro develops energy efficient server systems and is backed by Khosla Ventures, Draper Fisher Jurvetson and...