Powered by Deep Web Technologies
Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network [OSTI]

2008 European PV Conference, Valencia, Spain COMPARISON OF SOLAR RADIATION FORECASTS FOR THE USA J, The University at Albany, 251 Fuller Rd, Albany, NY 12203, USA 3 University of Oldenburg, Institute of Physics for a half year period (summer 2007) at three different climates in the USA. ECMWF shows the best results

Perez, Richard R.


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 ELECTRON AND HOLE MOBILITY REDUCTION AND HALL FACTOR IN PHOSPHORUS-  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 1 West, Hamilton, Ontario, Canada L8S 4L7 ABSTRACT: The conductivity mobility for majority carrier holes the behaviour of solar cells or other devices under various conditions. Solar-grade silicon often contains high


ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.



Universidad Politecnica de Valencia Departamento de Sistemas Informaticos y Computacion  

E-Print Network [OSTI]

develop a novel framework for Code-Carrying Theory which is a methodology for software certificationUniversidad Polit´ecnica de Valencia Departamento de Sistemas Inform´aticos y Computaci´on Universidad Polit´ecnica de Valencia Camino de Vera, s/n 46022 Valencia Espa~na #12;Here the dedication #12

Alpuente, María


Morphology and downslope sediment displacement in a deep-sea valley, the Valencia Valley (Northwestern Mediterranean)  

Science Journals Connector (OSTI)

The Valencia Valley is a Quaternary, 200 km long deep-sea valley in the Valencia Trough, Western Mediterranean Sea ... A swathmapping survey approximately mid-way along the valley length, where the floor has an a...

Suzanne O'Connell; Belen Alonso; Kim A. Kastens; Andrs Maldonado



Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +


Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Enerstar SA | Open Energy Information  

Open Energy Info (EERE)

Valencia, Spain Zip: 467022 Sector: Solar Product: Developing a 50.0MW parabolic trough solar thermal project in Villena. References: Enerstar SA1 This article is a stub. You...


Association of Renewable Energy Producers Spain | Open Energy Information  

Open Energy Info (EERE)

Producers Spain Producers Spain Jump to: navigation, search Name Association of Renewable Energy Producers (Spain) Place Barcelona, Spain Zip 8008 Sector Renewable Energy Product Spain's Association of renewable energy producers Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick



Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +


Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology




E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add


Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +


Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +


Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Valencia County, New Mexico: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Valencia County, New Mexico: Energy Resources Valencia County, New Mexico: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.6743674°, -106.6291304° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.6743674,"lon":-106.6291304,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


In Autonomous Robots and Multirobot Systems Workshop at AAMAS (ARMS 12), Valencia, Spain, June 5 2012.  

E-Print Network [OSTI]

distribution statistics. Belief revision and energy minimization algorithms used the learned object models recognition algorithms that use a variety of visual cues [7, 8, 13­16, 24]. Real-world application domains hypothesize that once a map of the world (with stationary objects and obstacles) has been learned, objects

Gelfond, Michael


European Academy of Management 14th Annual Conference EURAM 4-7 June 2014 Valencia Spain  

E-Print Network [OSTI]

relies on the capacity to reuse and connect existing technologies; 3) the design of GT might require forward new markets (first unknown: the markets) and new technologies (second unknown: the technologies innovation that impacts or generate many markets and many technical variations. From a statistical point

Paris-Sud XI, Université de


Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL


Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of


Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org


Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are


Networks Spanish project COPABIB Group Murcia Group Polit. Valencia Group La Laguna Computation in heterogeneous-hierarchical  

E-Print Network [OSTI]

Networks Spanish project COPABIB Group Murcia Group Polit. Valencia Group La Laguna Computation in heterogeneous-hierarchical environments Project COPABIB: Univ. Alicante, Castell´on, La Laguna, Murcia COPABIB Group Murcia Group Polit. Valencia Group La Laguna Contents 1 Networks 2 Spanish project COPABIB 3

Giménez, Domingo


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles


TME Spain | Open Energy Information  

Open Energy Info (EERE)

TME Spain TME Spain Jump to: navigation, search Name TME Spain Place Spain Sector Wind energy Product Spanish firm TME, a privately owned company, currently holds equity investments in various wind farm developments in Spain. References TME Spain[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. TME Spain is a company located in Spain . References ↑ "TME Spain" Retrieved from "http://en.openei.org/w/index.php?title=TME_Spain&oldid=352302" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load)


Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.


Film Photo-Advanced Place Shelby Herrera, Valencia County "Reaching for the Sun"*  

E-Print Network [OSTI]

Film Photo- Advanced 1st Place ­Shelby Herrera, Valencia County "Reaching for the Sun"* 2nd Place "Star Gazing"* Digital Photo- Beginner 1st Place ­Colton McVaugh, Dona Ana County "Monsoon Sunset"* 2nd, "Catepillar"* Honorable Mention ­Colton McVaugh, Dona Ana County "Dinner Time"* Digital Photo- Advanced 1st


Encuesta sobre la satisfaccin de los pacientes dependientes de herona de la Comunidad de Valencia con los centros de tratamiento con metadona  

Science Journals Connector (OSTI)

ResumenObjetivo Valorar multidimensionalmente la satisfaccin de los pacientes dependientes de herona con los centros de tratamiento con metadona de la Comunidad de Valencia. Mtodo Se solicit a 278 pacientes que llegaron consecutivamente a los 12 centros (9 convencionales y 3 unidades mviles) seleccionados aleatoriamente, su participacin en una encuesta que inclua la Escala de Verona para valorar la Satisfaccin con los Servicios en los centros de Tratamiento con Metadona (VSSS-MT). Resultados Ciento sesenta y seis (59,7%) pacientes aceptaron participar. La media global de las puntuaciones en la VSSS-MT fue 3,5 (DT=0,6), siendo el rango de puntuaciones de dicha escala 15 (1: malsima y 5: excelente). El porcentaje de pacientes que se sinti satisfecho (VSSS-MT > 3) fue, por categoras, el siguiente: valoracin global, 82,4%; intervenciones bsicas 80,6%; intervenciones especficas 59,3%; habilidades de los trabajadores sociales 66,3%; habilidades de los psiclogos 71,7%. En un anlisis de regresin mltiple, los predictores independientes de la satisfaccin con el tratamiento de mantenimiento con metadona (TMM) fueron: hallarse en rgimen de take-home o dosis para llevar a casa, un menor nmero de das desde el ltimo ajuste de dosis, y recibir el TMM en un centro convencional y no en unidad mvil. Este modelo de regresin explic el 9% de la varianza de las puntuaciones totales de la VSSS-MT. Conclusiones Los pacientes dependientes de opioides de la Comunidad de Valencia se sienten ligeramente satisfechos con los centros de tratamiento con metadona. Las variables ms intensamente asociadas con tal satisfaccin explican un limitado porcentaje de la varianza de la puntuacin global de la VSSS-MT. Objective To multidimensionally assess heroin-dependent patients satisfaction with methadone treatment centres from Valencia Region (Spain). Method An independent interviewer recruited 278 consecutively arriving patients from 12 randomly selected centres (9 conventional centres and 3 mobile methadone clinics) to participate in a survey that included the Verona Service Satisfaction Scale for Methadone Treatment (VSSS-MT). Results One hundred sixty-six (59.7%) patients agreed to participate. Mean overall VSSS-MT score was 3.5 (SD=0.6), on a 15 point scale (1 = terrible; 5 = excellent). The percentage of patients who felt satisfied (VSSS-MT scores > 3) was, by category: overall satisfaction, 82.4%; basic interventions, 80.6%; specific interventions, 59.2%; social worker skills, 66.3%; psychologist skills, 71.6%. In a multiple regression analysis, methadone take-home privileges, lower number of days from the last dose adjustment, and being treated in a conventional (not mobile) methadone clinic appeared as independent predictors of satisfaction with methadone maintenance treatment. This regression model accounted for 9% of the variance in VSSS-MT overall scores. Conclusions The survey results show that heroin-dependent patients from Valencia Region are slightly satisfied with methadone treatment centres. The variables most strongly related to this satisfaction accounted for only a limited amount of the variance in VSSS-MT overall scores.

J. Prez de los Cobos; J.C. Valderrama; S. Valero; N. Snchez; I. Gich; J. Trujols



Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...



E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of


WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...


Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade


Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


Immosolar Spain | Open Energy Information  

Open Energy Info (EERE)

Spain Spain Jump to: navigation, search Logo: Immosolar Spain Name Immosolar Spain Address C/ Sigfrido 1, pl.2 of.21 Place Barcelona, Spain Sector Solar Product Solar energy systems and equipment Phone number (+34) 902 405 001 Website http://www.immosolar.com/ Coordinates 41.387917°, 2.1699187° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.387917,"lon":2.1699187,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL



E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx


State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California


Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http


Demand Response Research in Spain  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Demand Response Research in Spain Demand Response Research in Spain Speaker(s): Iñigo Cobelo Date: August 22, 2007 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Mary Ann Piette The Spanish power system is becoming increasingly difficult to operate. The peak load grows every year, and the permission to build new transmission and distribution infrastructures is difficult to obtain. In this scenario Demand Response can play an important role, and become a resource that could help network operators. The present deployment of demand response measures is small, but this situation however may change in the short term. The two main Spanish utilities and the transmission network operator are designing research projects in this field. All customer segments are targeted, and the research will lead to pilot installations and tests.


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.2.36 DETERMINING THE BULK LIFETIME OF UNPASSIVATED MULTICRYSTALLINE SILICON WAFERS  

E-Print Network [OSTI]

. Brendel1 , R. Falster2 and R. Sinton3 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1 Sinton Instruments, 4720 Walnut Street, Suite 102, Boulder, CO 80301, USA ABSTRACT: The determination potential and benefit of carrier lifetime measure- ments on unprocessed bare wafers, Sinton et al. [3] pre


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.25 MODELLING THE CURING DYNAMICS OF ETHYLENE-VINYL ACETATE  

E-Print Network [OSTI]

.25 MODELLING THE CURING DYNAMICS OF ETHYLENE-VINYL ACETATE S. Kajari-Schröder1 , U. Eitner1 , C. Oprisoni2 , T Hannover, Germany ABSTRACT: The encapsulation of solar cells in polymeric sheets such as ethylene PV module [1]. Ethylene-vinyl acetate (EVA) is the most common encapsulant in the PV industry


25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CO.4.3 IMPACT OF LATERAL VARIATIONS ON THE SOLAR CELL EFFICIENCY  

E-Print Network [OSTI]

analyze various monocrystalline silicon solar cells. The light-IV curves around the maximum power point.3 IMPACT OF LATERAL VARIATIONS ON THE SOLAR CELL EFFICIENCY David Hinken, Karsten Bothe and Rolf Brendel-dimensional approach to calculate the impact of local parameters on the global solar cell efficiency. The presented


2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.


Renewable Energies and Photovoltaics Spain S L REPS | Open Energy  

Open Energy Info (EERE)

Energies and Photovoltaics Spain S L REPS Energies and Photovoltaics Spain S L REPS Jump to: navigation, search Name Renewable Energies and Photovoltaics Spain S.L. (REPS) Place Spain Sector Solar Product Spanish solar project developer. The firm is a subsidiary of Norwegian energy company Statkraft. References Renewable Energies and Photovoltaics Spain S.L. (REPS)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Energies and Photovoltaics Spain S.L. (REPS) is a company located in Spain . References ↑ "Renewable Energies and Photovoltaics Spain S.L. (REPS)" Retrieved from "http://en.openei.org/w/index.php?title=Renewable_Energies_and_Photovoltaics_Spain_S_L_REPS&oldid=350310"


Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Spain: Energy Resources Spain: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40,"lon":-4,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Senior DOE Officials in Spain to Participate in World Petroleum...  

Broader source: Energy.gov (indexed) [DOE]

Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior...


CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning  

E-Print Network [OSTI]

CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning Francesca Rossi University of Padova, Italy CP 2005 Sitges, Spain, October 3, 2005 Joint work with ... Stefano Bistarelli, Univ. Pescara, Australia CP 2005 Sitges, Spain, October 3, 2005 Ultimate goal A formalism to model many kinds

Rossi, Francesca


Pollution by cereal waste burning in Spain  

Science Journals Connector (OSTI)

In this paper, the amount of cereal waste burned in Spain, which represents the most important source of biomass burning in this country, is estimated. During the period between 1980 and 1998, an average mass of 8 Tg of cereal waste was burned annually, with remaining 1 Tg of ash on the cereal fields after combustion. By using emission factors previously calculated by Ortiz de Zrate et al. [Ortiz de Zrate, I., Ezcurra, A., Lacaux, J.P., Van Dihn, P., 2000. Emission factor estimates of cereal waste burning in Spain. Atmos. Environ. 34, 31833193.], it is deduced that pollutant emissions linked to cereal waste-burning process reach values of 11 Tg CO2, 80 Gg of TPM and 23 Gg of \\{NOx\\} year?1 during the cereal-burning period. These emissions represent 46% of total CO2 and 23% \\{NOx\\} emitted in Spain during the burning period that lasts 1 month after harvesting. Therefore, the relative importance of cereal waste burning as pollutant source in Spain almost during fire period becomes evident. Finally, our study allows to deduce that the production of 1 kg of cereal crop implies that 410 g of carbon and 3.3 g of nitrogen are going to be introduced into the atmosphere by this pollutant process. We estimate a total gaseous emission of 3.3 Tg of C and 25 Gg N as different pollutants by cereal waste burning.

I. Ortiz de Zrate; A. Ezcurra; J.P. Lacaux; P. Van Dinh; J. Daz de Argandoa



Renewable Energy Policy and Developments in Spain  

E-Print Network [OSTI]

Renewable Energy Policy and Developments in Spain Wednesday, October 30, 2013 4:00 - 5:30 p in Spanish energy policy. In this talk, Labandeira describes Spanish policies to promote renewable energy, assessing their effectiveness within a wider energy and public-policy context. RSVP link: Download any free

Zhang, Junshan


Foreign Fishery Developments United States-Spain  

E-Print Network [OSTI]

.S. fishing industry's hopes to enter the $500 million Spanish seafood market have not materialized, even-mile Exclusive Economic Zones (EEZ) by coastal coun tries. U.S. exports of edible seafoods to Spain trade. The Spanish Seafood Market The Spanish market for seafood prod ucts is highly developed

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Barcelona, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Barcelona, Spain: Energy Resources Barcelona, Spain: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 3128760 Coordinates 41.38879°, 2.15899° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.38879,"lon":2.15899,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond



UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Spain Installed Wind Capacity Website | Open Energy Information  

Open Energy Info (EERE)

Spain Installed Wind Capacity Website Spain Installed Wind Capacity Website Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Spain Installed Wind Capacity Website Focus Area: Renewable Energy Topics: Market Analysis Website: www.gwec.net/index.php?id=131 Equivalent URI: cleanenergysolutions.org/content/spain-installed-wind-capacity-website Language: English Policies: Regulations Regulations: Feed-in Tariffs This website presents an overview of total installed wind energy capacity in Spain per year from 2000 to 2010. The page also presents the main market developments from 2010; a policy summary; a discussion of the revision in feed-in tariffs in 2010; and a future market outlook. References Retrieved from "http://en.openei.org/w/index.php?title=Spain_Installed_Wind_Capacity_Website&oldid=514562"


Spain excites U.S. chemicals makers for investment  

Science Journals Connector (OSTI)

Spain excites U.S. chemicals makers for investment ... Strategic economic factors make Spain an attractive target for U.S. investment overseas, chemical producers told fellow foreign investors at a meeting of the American Management Association last week in New York City.. ...



E-Print Network 3.0 - asturias spain idria Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...


E-Print Network 3.0 - almaden asturias spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...


E-Print Network 3.0 - area sw spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

from temperature profiles... , SW Spain Large altitudinal changes A variable; R mma Gran Canaria island Guiniguada NE basins; 0... to the peninsular territory of Spain map...


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115 NON-LINEAR MECHANICAL PROPERTIES OF ETHYLENE-VINYL ACETATE (EVA) AND ITS  

E-Print Network [OSTI]

.115 1 NON-LINEAR MECHANICAL PROPERTIES OF ETHYLENE-VINYL ACETATE (EVA) AND ITS RELEVANCE ABSTRACT: Polymers such as ethylene-vinyl acetate (EVA) encapsulants are known for their non for PV modules is ethylene-vinyl acetate (EVA). It is thus essential for mechanical module and lamination


Energy Consumption Patterns of the Rural Photovoltaic Market In Spain  

Science Journals Connector (OSTI)

This paper presents an analysis of the energy consumption of photovoltaic-powered rural dwellings in a representative region of Spain. We have measured the actual consumed electrical energy in several dwelling...

A. Krenzinger; M. Montero



IM2 Energia Solar | Open Energy Information  

Open Energy Info (EERE)

IM2 Energia Solar IM2 Energia Solar Jump to: navigation, search Name IM2 Energia Solar Place Valencia, Spain Zip 46002 Sector Solar Product Valencia-based developer of roof-mounted solar projects. Coordinates 39.468791°, -0.376913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.468791,"lon":-0.376913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alineasolar Alternas SA | Open Energy Information  

Open Energy Info (EERE)

Alineasolar Alternas SA Alineasolar Alternas SA Jump to: navigation, search Name Alineasolar Alternas SA Place Valencia, Spain Zip 46021 Product Valencia-based designer, seller and installer of turnkey roof-mounted PV systems. Coordinates 39.468791°, -0.376913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.468791,"lon":-0.376913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Madrid, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Madrid, Spain: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 3117735 Coordinates 40.4165°, -3.70256° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4165,"lon":-3.70256,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


BeyWatch (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

BeyWatch (Smart Grid Project) (Spain) BeyWatch (Smart Grid Project) (Spain) Jump to: navigation, search Project Name BeyWatch Country Spain Coordinates 40.65564°, -4.075928° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.65564,"lon":-4.075928,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


HiperDNO (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

(Spain) (Spain) Jump to: navigation, search Project Name HiperDNO Country Spain Coordinates 40.563896°, -3.735352° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.563896,"lon":-3.735352,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Complementary Pu Resuspension Study at Palomares, Spain  

SciTech Connect (OSTI)

Soil in an area near Palomares, Spain, was contaminated with plutonium as a result of a mid-air collision of U.S. military aircraft in January 1966. The assessment for potential inhalation dose can be found in Iranzo et al., (1987). Long-term monitoring has been used to evaluate remedial actions (Iranzo et al., 1988) and there are many supporting studies of the Pu contamination at Palomares that have been carried out by the Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas (CIEMAT) in Madrid. The purpose of this study is to evaluate the resuspension of Pu from the soil in terms of Pu-concentrations in air and resuspension rates in a complementary investigation to those of CIEMAT but in an intensive short-term field effort. This study complements the resuspension studies of CIEMAT at Palomares with additional information, and with confirmation of their previous studies. Observed mass loadings (M) were an average of 70 mg/m{sup 3} with peaks in the daytime of 130 mg/m{sup 3} and low values at night below 30 {micro}g/m{sup 3}. The Pu-activity of aerosols (A) downwind of plot 2-1 was 0.12 Bq/g and the enhancement factor (E{sub f}) had a value of 0.3, which is low but similar to a typical value of 0.7 for other undisturbed sites. This E{sub f} value may increase further away from ground zero. The particle size distribution of the Pu in air measured by cascade impactors was approximately lognormal with a median aerodynamic diameter of 3.7 {micro}m and a geometric standard deviation of 3.5 in the respirable range. This peak midway between 1 ? m and 10 {micro}m in the respirable range is commonly observed. Daily fluctuations in the Pu concentration in air (C) detected by the UHV were lognormally distributed with a geometric standard deviation of 4.9 indicating that the 98th percentile would be 24 times as high as the median. Downwind of plot 2-1 the mean Pu concentration in air, C, was 8.5 {micro}Bq/m{sup 3}. The resuspension factor (Sf) was 2.4 x 10{sup -10} m{sup -1} and agrees very well with the values between 10{sup -10} m{sup -1} and 10{sup -9} m{sup -1} previously reported. We observed a mean Pu/Am ratio of 7.1 with a relative variation of 30%, which compares well with a mean value of 6.5 for nearby plot 2-2. The resuspension rate (R) was in the middle of the range, 10{sup -11} s{sup -1} to 10{sup -12} s{sup -1} as observed in other stable sites, and indicates low potential for Pu redistribution.

Shinn, J



The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain)  

E-Print Network [OSTI]

The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain): Implications Recherche Développement, Carbonate Sedimentology Group, avenue Larribau s/n, 64018 Pau Cedex - France e'Espagne) sont présentées dans cette étude. Les corps dolomitiques sont encaissés dans des carbonates de

Paris-Sud XI, Université de


EWIS European wind integration study (Smart Grid Project) (Spain) | Open  

Open Energy Info (EERE)

Spain Spain Coordinates 40.522152°, -4.163818° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.522152,"lon":-4.163818,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tourism's Impact on Economic Growth and Development in Spain  

E-Print Network [OSTI]

Tourism's Impact on Economic Growth and Development in Spain Jessica Dennis #12;Spanish Civil War,500,000,000 International Tourism Receipts 1960-2008 (US$ in year 2000) #12;$0 $200,000,000,000 $400,000,000,000 $600 (US$ in the year 2000) #12;0.00% 1.00% 2.00% 3.00% 4.00% 5.00% 6.00% International Tourism Receipts

New Hampshire, University of


Emission factor estimates of cereal waste burning in Spain  

Science Journals Connector (OSTI)

Every year more than 5 million ha of cereal fields are affected by fires in order to eliminate cereal waste in Spain. The characteristics of this type of fire with intense flames are similar to those of the African dry savanna heading fires. This paper surveys the atmospheric emission caused by this process by combining results of field and combustion chamber experiments. Combustion chamber experiments show that during the flaming phase 88% of the fire exposed carbon is converted into CO2 and during the smoldering phase this percentage changes to 74%. These combustion chamber experiments also show that the soluble part of the aerosols emitted during the course of fires only represent 3% of the total particulate matter (TPM) produced, being the ions K+ and CI? the predominant ones. The cereal waste fire process can be represented by an arithmetic combination that takes into account the amounts of mass burned during the two phases of the fire: 0.90 flaming +0.10 smoldering. Emission factor estimates from field burning experiment are 137g TPMkg?1(dm) and 2.80.2g NOxkg?1 (dm). Finally, we obtain average emissions of 80130Gg TPM, 1728Gg NOx, 210350Gg CO and 814Tg CO2 in Spain. These emissions represent nearly 25% of the total \\{NOx\\} and 50% of the total CO2 emissions by other pollution sources during the burning period in Spain.

I. Ortiz de Zrate; A. Ezcurra; J.P. Lacaux; Pham Van Dinh


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Senior DOE Officials in Spain to Participate in World Petroleum Congress,  

Broader source: Energy.gov (indexed) [DOE]

Senior DOE Officials in Spain to Participate in World Petroleum Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior DOE Officials in Spain to Participate in World Petroleum Congress. U.S. Department of Energy (DOE) Assistant Secretary for Electricity Delivery and Energy Reliability Kevin Kolevar and Acting Principal Deputy Assistant Secretary for Fossil Energy James A. Slutz are in Madrid, Spain this week to participate in the 19th World Petroleum Congress-a global forum held every three years by the World Petroleum Council to address resource potential, infrastructure, the regulatory framework and other key issues related to the future of petroleum development. Senior DOE Officials in Spain to Participate in World Petroleum Congress,


E-Print Network 3.0 - abstracts boron americas Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Chemistry, University of Pittsburgh Collection: Chemistry ; Materials Science 90 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1.5...


E-Print Network 3.0 - ai seville spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Spain Universidad de Alicante CIEE, Council 20th Century Spanish......


E-Print Network 3.0 - arousa nw spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on Nutrient and Phytoplankton Dynamics in a Shallow Estuary After Summary: Kingdom (Wash, Thames estuary, Horecambe and Caenarfon bays), in Spain (Galice, Mediterranean coast......


E-Print Network 3.0 - algeciras spain steel Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

lower values than model columns... : at a station in Spain. Bottom: at a station in Netherland. The model simulation with assimilation shows better Source: Ecole Polytechnique,...


International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

Tools of transmission in Germany 2.1. Power of attorney postas being unconstitutional. 33 Germany's Constitutional CourtRecent Developments in Germany and Spain Business Roland

Krause, Roland



Tobacco use among adolescents aged 1016 in Gran Canaria, Canary Islands, Spain  

Science Journals Connector (OSTI)

In this survey, we tried to assess tobacco consumption among adolescents aged 1016 on the island of Gran Canaria (Canary Islands, Spain). We also...

J. M. Segura; J. R. Calvo; M. C. Navarro; M. Torres



E-Print Network 3.0 - almeria spain alteracion Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Regional de... Salud Publica, Madrid, Comunidad de Madrid, Spain3 ; Hospital General de Gran Canaria Dr. ... Source: Columbia University - Jerome L. and Dawn Greene Infectious...


Characterisation of a Pleistocene debris-avalanche deposit in the Tenteniguada Basin, Gran Canaria Island, Spain  

Science Journals Connector (OSTI)

We studied a large debris-avalanche deposit of Pleistocene age in the Tenteniguada Basin, Gran Canaria Island, Spain. This deposit, which is...

Alejandro Lomoschitz; Javier Hervs; Jorge Yepes; Joaqun Meco




E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS


Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter


Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter


EUDEEP (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

EUDEEP EUDEEP Country Spain Coordinates 40.663975°, -3.658447° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.663975,"lon":-3.658447,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


LCA of integrated orange production in the Comunidad Valenciana (Spain)  

Science Journals Connector (OSTI)

In order to perform an LCA of integrated orange production in the Comunidad Valenciana two representative areas were studied. The functional unit was 1 kg oranges at the farm gate. Eight scenarios were considered according to type of irrigation, the origin of water and the tillage practice. The production of agrochemicals, the production and use of energy in agriculture (for irrigation and machinery), and the agricultural practices were included in the study. Hot spots were detected. Although differences were found between scenarios, it was difficult to establish which one is the best because some practices, such as tillage, are more advisable when considering herbicide production, but the herbicides used are more toxic. The lack of environmental information for agricultural LCA in Spain and the need to adapt some aspects of impact methodology to the Spanish soil and climate characteristics have also been pointed out.

N. Sanjuan; L. Ubeda; G. Clemente; A. Mulet; F. Girona



Spanish Wind Energy Association AEE | Open Energy Information  

Open Energy Info (EERE)

AEE Jump to: navigation, search Name: Spanish Wind Energy Association (AEE) Place: Madrid, Spain Zip: 28006 Sector: Wind energy Product: Spain's association of wind-energy related...


Nonlinear Invertible Representation for Joint Statistical and Perceptual Feature Decorrelation  

E-Print Network [OSTI]

. Malo 1 , R. Navarro 3 , I. Epifanio 2 , F. Ferri 2 , and J.M. Artigas 1 1 Dpt. d' ` Optica, Universitat Burjassot, Val`encia, Spain 3 Instituto de ' Optica (CSIC) C/ Serrano 122, 28006 Madrid, Spain Abstract

Malo, Jesus


Designing the properties of dispersion-flattened photonic crystal fibers  

E-Print Network [OSTI]

Silvestre, and Pedro Andr´es Departament d' `Optica, Universitat de Val`encia, E-46100 Burjassot, Spain albert.ferrando@uv.es Juan J. Miret Departament d' `Optica, Universitat d'Alacant, E-03080 Alacant, Spain

Fernández de Córdoba, Pedro


IEEE TRANSACTIONS ON IMAGE PROCESSING, VOL. XX, NO. Y, MONTH Z 2004 1 Non-Linear Image Representation for Efficient  

E-Print Network [OSTI]

is with the Department d' `Optica, Universitat de Val`encia, 46100 Burjas- sot, Val`encia, Spain (jesus.malo@uv.es, http. RN is with Instituto de ´Optica, CSIC, Spain. EPS is with Howard Hughes Medical Institute, Center

Simoncelli, Eero


Arsenic in public water supplies and cardiovascular mortality in Spain  

SciTech Connect (OSTI)

Background: High-chronic arsenic exposure in drinking water is associated with increased cardiovascular disease risk. At low-chronic levels, as those present in Spain, evidence is scarce. In this ecological study, we evaluated the association of municipal drinking water arsenic concentrations during the period 1998-2002 with cardiovascular mortality in the population of Spain. Methods: Arsenic concentrations in drinking water were available for 1721 municipalities, covering 24.8 million people. Standardized mortality ratios (SMRs) for cardiovascular (361,750 deaths), coronary (113,000 deaths), and cerebrovascular (103,590 deaths) disease were analyzed for the period 1999-2003. Two-level hierarchical Poisson models were used to evaluate the association of municipal drinking water arsenic concentrations with mortality adjusting for social determinants, cardiovascular risk factors, diet, and water characteristics at municipal or provincial level in 651 municipalities (200,376 cardiovascular deaths) with complete covariate information. Results: Mean municipal drinking water arsenic concentrations ranged from <1 to 118 {mu}g/L. Compared to the overall Spanish population, sex- and age-adjusted mortality rates for cardiovascular (SMR 1.10), coronary (SMR 1.18), and cerebrovascular (SMR 1.04) disease were increased in municipalities with arsenic concentrations in drinking water >10 {mu}g/L. Compared to municipalities with arsenic concentrations <1 {mu}g/L, fully adjusted cardiovascular mortality rates were increased by 2.2% (-0.9% to 5.5%) and 2.6% (-2.0% to 7.5%) in municipalities with arsenic concentrations between 1-10 and>10 {mu}g/L, respectively (P-value for trend 0.032). The corresponding figures were 5.2% (0.8% to 9.8%) and 1.5% (-4.5% to 7.9%) for coronary heart disease mortality, and 0.3% (-4.1% to 4.9%) and 1.7% (-4.9% to 8.8%) for cerebrovascular disease mortality. Conclusions: In this ecological study, elevated low-to-moderate arsenic concentrations in drinking water were associated with increased cardiovascular mortality at the municipal level. Prospective cohort studies with individual measures of arsenic exposure, standardized cardiovascular outcomes, and adequate adjustment for confounders are needed to confirm these ecological findings. Our study, however, reinforces the need to implement arsenic remediation treatments in water supply systems above the World Health Organization safety standard of 10 {mu}g/L.

Medrano, Ma Jose, E-mail: pmedrano@isciii.es [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Boix, Raquel; Pastor-Barriuso, Roberto [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Palau, Margarita [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain)] [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain); Damian, Javier [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Ramis, Rebeca [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain) [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); CIBER en Epidemiologia y Salud Publica (CIBERESP), Madrid (Spain); Barrio, Jose Luis del [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain)] [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain); Navas-Acien, Ana [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States) [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Department of Epidemiology, Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States)



U.S. and Spain to Develop Solar Decathlon Europe | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Spain to Develop Solar Decathlon Europe Spain to Develop Solar Decathlon Europe U.S. and Spain to Develop Solar Decathlon Europe October 18, 2007 - 3:21pm Addthis WASHINGTON, DC - Today U.S. Department of Energy (DOE) Assistant Secretary for Energy Efficiency and Renewable Energy Alexander Karsner and Spain's Undersecretary of Housing Fernando Magro Fernández signed a Memorandum of Understanding (MOU) to collaborate in the development of a Solar Decathlon Europe competition in 2010. The Solar Decathlon is a competition launched by DOE in 2002 which challenges university-led teams to build the most attractive and efficient solar-powered homes, held on the National Mall in Washington, DC. Under the MOU signed today, the DOE will assist in developing a similar event in Europe. "The twin challenges of increasing energy security and confronting climate

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Object of the Atlantic: Concrete Aesthetics in Cuba, Brazil, and Spain, 1868-1968  

E-Print Network [OSTI]

Concrete Aesthetics in Cuba, Brazil, and Spain, 18681968,in the Back- lands of Brazil. Pittsburgh: University ofCosta, Emlia Viotti da. Brazil: The Age of Reform, 1870

Price, Rachel L.



Wind power plants and the conservation of birds and bats in Spain: a geographical assessment  

Science Journals Connector (OSTI)

The number of wind power plants installed in Spain has increased dramatically, and ... . This paper explores the geographical overlap of wind power plants with the ranges of flying vertebrate species. ... 10נ10...

Jos Luis Tellera



E-Print Network 3.0 - asturias spain genetic Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Issued 24 August 2004 DOI: 10.1017S1477200004001355 Printed in the United Kingdom C The Natural History Museum Summary: Somiedo, Asturias (Spain) AY151912 AY151992 Podarcis...


E-Print Network 3.0 - area cadiz spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Sample search results for: area cadiz spain Page: << < 1 2 3 4 5 > >> 1 CURRICULUM VITAE (update October 2007) Mariana Ribas Ribas mariana.ribas@uca.es Summary: ....


The Historical, Legal, Political, Social and Economic Context of Solar Photovoltaics in Spain  

Science Journals Connector (OSTI)

The Spanish government operated under the philosophy that Spain needed as much domestically produced power as possible. In March of 2004, the government created a premium feed-in-tariff scheme similar to solar PV...

Pedro A. Prieto; Pedro A. Prieto; Charles A. S. Hall



Renewables 2050: A Report About the Potential of Renewable Energy in Peninsular Spain  

Science Journals Connector (OSTI)

In this paper detailed results are presented about the capacity and generation potential of the different renewable energy technologies in Spain, showing its space distribution as well as the relative weight b...

Xavier Garca-Casals; Javier Dominguez Bravo



E-Print Network 3.0 - anesthesia santiago spain Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

groups J. Lopez-Santiago... Complutense de Madrid, E-28040 Madrid, Spain. (dmg@astrax.fis.ucm.es) During the last years (1999 - 2004), our Source: Gutirrez, David Montes -...


Forecasting the need for medical specialists in Spain: application of a system dynamics model  

Science Journals Connector (OSTI)

Spain has gone from a surplus to a shortage of medical doctors in very few years. Medium and long-term planning for health professionals has become a high priority for health authorities.

Patricia Barber; Beatriz Gonzlez Lpez-Valcrcel



The Occurrence of Mycoplasmas in the Lungs of Swine in Gran Canaria (Spain)  

Science Journals Connector (OSTI)

The study was conducted to investigate the mycoplasmal flora in the lungs of pigs with enzootic pneumonia at Gran Canaria (Spain). From 54 pneumonic lungs collected...Mycoplasma species. Using different species-s...

P. Assunao; C. De la Fe; B. Kokotovic; O. Gonzlez



Screening of antimicrobial activities in red, green and brown macroalgae from Gran Canaria (Canary Islands, Spain)  

Science Journals Connector (OSTI)

Extracts from 44species of seaweed from Gran Canaria (Canary Islands, Spain) were screened for...Asparagopsis taxiformis and Cymopolia barbata were the species with the strongest activities against the broadest...

Antonio Val; Gonzalo Platas; Angela Basilio; Angeles Cabello



U.S. Liquefied Natural Gas Exports to Spain  

Gasoline and Diesel Fuel Update (EIA)

Warroad, MN Babb, MT Havre, MT Port of Morgan, MT Sherwood, ND Pittsburg, NH Buffalo, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Sweetgrass, MT Total to Chile Sabine Pass, LA Total to China Kenai, AK Sabine Pass, LA Total to India Freeport, TX Sabine Pass, LA Total to Japan Cameron, LA Freeport, TX Kenai, AK Port Nikiski, AK Sabine Pass, LA Total to Mexico Douglas, AZ Nogales, AZ Calexico, CA Ogilby Mesa, CA Otay Mesa, CA San Diego, CA Alamo, TX Clint, TX Del Rio, TX Eagle Pass, TX El Paso, TX Hidalgo, TX McAllen, TX Penitas, TX Rio Bravo, TX Roma, TX Total to Portugal Sabine Pass, LA Total to Russia Kenai, AK Total to South Korea Freeport, TX Sabine Pass, LA Total to Spain Cameron, LA Sabine Pass, LA Total to United Kingdom Freeport, TX Sabine Pass, LA LNG Exports from Cameron, LA LNG Exports from Kenai, AK LNG Exports from Freeport, TX LNG Exports from Nogales, AZ LNG Exports from Otay Mesa, CA LNG Exports from Sabine Pass, LA LNG Exports from Sweetgrass, MT Period: Monthly Annual


SERSA | Open Energy Information  

Open Energy Info (EERE)

SERSA SERSA Jump to: navigation, search Name SERSA Place Valencia, Spain Zip 46010 Sector Wind energy Product Project developer, primarily in the wind sector. Coordinates 39.468791°, -0.376913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.468791,"lon":-0.376913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gesfesa Energia SL | Open Energy Information  

Open Energy Info (EERE)

Gesfesa Energia SL Gesfesa Energia SL Jump to: navigation, search Name Gesfesa Energia SL Place Valencia, Spain Zip 46004 Sector Solar Product Involved in construction of buidings and and solar infrastructure. Coordinates 39.468791°, -0.376913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.468791,"lon":-0.376913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ABO Wind Espana SA | Open Energy Information  

Open Energy Info (EERE)

Espana SA Espana SA Jump to: navigation, search Name ABO Wind Espana SA Place Valencia, Spain Zip 46002 Sector Wind energy Product Spanish branch of project developer ABO Wind AG. Coordinates 39.468791°, -0.376913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.468791,"lon":-0.376913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gastro-enteritis outbreak among Nordic patients with psoriasis in a health centre in Gran Canaria, Spain: a cohort study  

Science Journals Connector (OSTI)

Between November 2 and 10, 2002 several patients with psoriasis and personnel staying in the health centre in Gran Canaria, Spain fell ill with diarrhoea, vomiting...

Hanne M Eriksen; Philippe J Guerin; Karin Nygrd



The Energy in Western Europe, Spain and Germany: From Renewable Energies to  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Energy in Western Europe, Spain and Germany: From Renewable Energies to The Energy in Western Europe, Spain and Germany: From Renewable Energies to Energy-Saving Programs Speaker(s): Jose MaCampos Date: November 29, 2007 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Girish Ghatikar The strong increase in the price of oil, and the dependency on oil from foreign, politically unstable countries has forced the European Union to develop programs to increase the efficiency of energy, not only in the industrial sector but also in residential and transports sectors. With common policies coming from the European Union, two countries with different economical and political conditions adapt these common policies to their reality. Spain, a strong developing country within the Union, and Germany, as a developed country, are approaching the same problems in


Multicomponent reactive transport modeling at the Ratones uranium mine, Cceres (Spain)  

E-Print Network [OSTI]

Multicomponent reactive transport modeling at the Ratones uranium mine, Cáceres (Spain) Modelación management. The Ratones uranium mine was abandoned and flooded in 1974. Due to its reducing underground water, uranium, reactive transport, granite hydrochemistry, Ratones mine. Resumen La inundación de minas

Politècnica de Catalunya, Universitat


The 14 July 2001 hailstorm in northeastern Spain: diagnosis of the meteorological situation  

E-Print Network [OSTI]

by a coastal range. The Ebro valley is a closed basin in which air masses penetrate from the west valley (NE Spain) during the evening of 14 July 2001, affecting mainly the Lerida province. Hail stones. Meteosat images and radar data demonstrate that the storms formed over the central part of the Ebro valley

Romero, Romu


New technologies as social fact: gender and digital divide in Spain in compared perspective  

Science Journals Connector (OSTI)

This paper presents a comparative analysis of the effect that the new technologies has had on the social structure and on unequal access by gender in Southern European countries, particularly in Spain. I have used data from the Eurobarometer for the ... Keywords: education, gender, information technology, women studies

Almudena Moreno Minguez



Traces of fission products in southeast Spain after the Fukushima nuclear accident  

Science Journals Connector (OSTI)

Traces of 131I, 134Cs and 137Cs were measured after the Fukushima nuclear accident between 23 March and 13 April 2011 in southeast Spain. The movement of the radioactive cloud toward southeast Spain was reconstructed based on the backward and forward trajectory cluster analyses. Polar maritime air masses which had originated over North America transported the radioactive plume toward the southeast Spain. Aerosols, rainwater, vegetables and cheese were analyzed to determine the radioactive risk. The highest concentrations of 131I, 134Cs and 137Cs in air samples were 2.630.12mBq/m3; 0.100.03mBq/m3; 0.090.02mBq/m3, respectively. After precipitation on April 3rd, the maximum concentrations of 131I, 134Cs and 137Cs were detected in rainwater samples, 1.100.16mBq/L; 0.0220.003mBq/L; 0.050.03mBq/L, respectively. As a consequence, 131I was transferred to the human food chain, and found in chard and goat cheese, 0.970.20Bq/kg and 0.520.08Bq/kg, respectively. The traces of 131I, 134Cs and 137Cs detected in the different samples were so low, that there is no impact on human health or the environment in Spain after the Fukushima nuclear accident.

F. Piero Garca; M.A. Ferro Garca


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010  

E-Print Network [OSTI]

First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010 automatic optimisation tools to design efficient trawls in terms of energy consumption. The developed tool should provide a substantial gain on the fuel consumed of actual fishing devices while maintaining

Lewandowski, Roger


Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality.  

E-Print Network [OSTI]

Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality. samuel networks, S. Johnson, J. J. Torres, J. Marro, and M. A. Muñoz, Physical Review Letters, in press. arXiv: 1002.3286. Evolving networks and the development of neural systems, S. Johnson, J. Marro and J. J

Johnson, Samuel


Environmental impact of natural radionuclides from a coal-fired power plant in Spain  

Science Journals Connector (OSTI)

......natural radionuclides from a coal-fired power plant in Spain...natural radionuclides of the coal. The three most important nuclides...20). Owing to considerable economic and environment importance and...from different processes of the coal industrial cycle. A radiological......

Elena Charro; Vctor Pea



The Impact of a Wildland Fire on Air Pollution Concentrations Using WRF/Chem/Fire: An Application over Murcia (Spain)  

Science Journals Connector (OSTI)

In this contribution we will show the impact on air pollution concentration of a Fire developed in the ... of Murcia (Spain). The impact on air pollution concentrations has been done using the WRF/ ... modifying ...

Roberto San Jos; Juan Luis Prez



Heterozoan carbonate lithofacies and sequence stratigraphy: a study of Pliocene strata of the Agua Amarga basin, southeastern Spain  

E-Print Network [OSTI]

This study of Pliocene heterozoan carbonates in the Agua Amarga basin southeastern Spain seeks to increase understanding of factors controlling facies distribution and sequence stratigraphic stacking in heterozoan carbonates. Geologic mapping...

Hess, Anya Victoria



Evolution of the energy consumed by street lighting in Spain estimated with DMSP-OLS data  

E-Print Network [OSTI]

We present the results of the analysis of satellite imagery to study light pollution in Spain. Both calibrated and non-calibrated DMSP-OLS images were used. We describe the method to scale the non-calibrated DMSP-OLS images which allows us to use differential photometry techniques in order to study the evolution of the light pollution. Population data and DMSP-OLS satellite calibrated images for the year 2006 were compared to test the reliability of official statistics in public lighting consumption. We found a relationship between the population and the energy consumption which is valid for several regions. Finally the true evolution of the electricity consumption for street lighting in Spain from 1992 to 2010 was derived, it have been doubled in the last 18 years in most of the provinces.

de Miguel, Alejandro Snchez; Castao, Jos Gmez; Pascual, Sergio



Evolution of the energy consumed by street lighting in Spain estimated with DMSP-OLS data  

Science Journals Connector (OSTI)

Abstract We present the results of the analysis of satellite imagery to study light pollution in Spain. Both calibrated and non-calibrated DMSP-OLS images were used. We describe the method to scale the non-calibrated DMSP-OLS images which allows us to use differential photometry techniques in order to study the evolution of the light pollution. Population data and DMSP-OLS satellite calibrated images for the year 2006 were compared to test the reliability of official statistics in public lighting consumption. We found a relationship between the population and the energy consumption which is valid for several regions. Finally the true evolution of the electricity consumption for street lighting in Spain from 1992 to 2010 was derived; it has been doubled in the last 18 years in most of the provinces.

Alejandro Snchez de Miguel; Jaime Zamorano; Jos Gmez Castao; Sergio Pascual



ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...


Formal Verification of Websites1 Sonia Flores2  

E-Print Network [OSTI]

. As expected in any software project, the web developers or designers must guarantee that the system (i, Universidad Polit´ecnica de Valencia Camino de Vera s/n, 46022 Valencia, Spain Abstract In this paper, a model as the environment of the system. We also present the logic which is used to specify properties of websites

Lucas, Salvador


Evaluating Rogue User Testing: an Industrial Case Study at Softeam  

E-Print Network [OSTI]

Bagnato2 1 Universidad Polit´ecnica de Valencia, Valencia, Spain http://www.pros.upv.es/ 2 SOFTEAM, Paris in the FITTEST project. This document presents the results of this study. 1 Introduction Software Testing is an important practice to assure the quality of and avoid critical errors in software products. However, modern

Utrecht, Universiteit


Formal Verification of Websites1 Sonia Flores2  

E-Print Network [OSTI]

. As expected in any software project, the web developers or designers must guarantee that the system (i Polit´ecnica de Valencia Camino de Vera s/n, 46022 Valencia, Spain Abstract In this paper, a model as the environment of the system. We also present the logic which is used to specify properties of websites

Villanueva, Alicia


The anatomy of the fruit in relation to the propensity of citrus species to split  

E-Print Network [OSTI]

The anatomy of the fruit in relation to the propensity of citrus species to split A. Garcõ?cnica de Valencia, 46071 Valencia, Spain Accepted 29 March 2000 Abstract The anatomy of the fruit has been of clementine mandarin (Fino, Clementina de Nules and Orogrande), and in Owari satsuma mandarin. The fruit

Ljubljana, University of



Science Journals Connector (OSTI)

...find an account of the snail-market at Valencia, and numerous references...which are large enough to be worth theb trouble of collection...open square used as a snail-market, cry their wares loudly, VCE...Spain; and in the Valencia market Kobelt also obtained H. Dupoteliana...



Effect of alcohol and competition levels on viability of eye colour mutants of Drosophila melanogaster  

E-Print Network [OSTI]

Valencia, 50 Dr. Moliner, Burjassot, Valencia, Spain Summary In order to test the influence of ethanol could explain their high frequency in this habitat. Key words :D. melanogaster, viability, ethanol higher tolerance to ethanol (DAVIDet al., 1979), D. melanognster is also remarkable because of its high

Boyer, Edmond


On Automatic Plagiarism Detection Based on n-Grams Comparison  

E-Print Network [OSTI]

´ecnica de Valencia, Spain {lbarron,prosso}@dsic.upv.es http://www.dsic.upv.es/grupos/nle/ Abstract. When on the basis of flexible search strategies (able to detect plagiarised fragments M. Boughanem et al. (Eds

Rosso, Paolo


Enrichment of Bilingual Dictionary through News Stream Data , Parth Gupta  

E-Print Network [OSTI]

Varma , Paolo Rosso Search and Information Extraction Lab International Institute of Information PRHLT Research Center Universitat Polit`ecnica de Val`encia, Spain http://www.dsic.upv.es/grupos/nle

Rosso, Paolo


Order-Sorted Dependency Pairs Salvador Lucas  

E-Print Network [OSTI]

Order-Sorted Dependency Pairs Salvador Lucas DSIC, Universidad Polit´ecnica de Valencia, Spain modeled as many-sorted or, more Salvador Lucas was partially supported by the EU (FEDER) and the Spanish

Lucas, Salvador


The World Conference on Marine Biodiversity: current global trends in marine biodiversity research  

Science Journals Connector (OSTI)

This paper contains an analysis of the communications presented at the World Conference on Marine Biodiversity in Valencia, Spain, November 2008. Our ... was to determine the current global trends in marine biodiversity

Patricia Miloslavich; Eduardo Klein



E-Print Network 3.0 - ambient temperature passive Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of California at Riverside Collection: Materials Science 3 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2.3 EFFECT OF SiN...


Consequential LCA of two alternative systems for biodiesel consumption in Spain, considering uncertainty  

Science Journals Connector (OSTI)

Abstract This study assesses possible biodiesel pathways for the Spanish transport sector, representing the current situation. Life Cycle Assessment was carried out for two scenarios: Scenario 1, where 1MJ of soybean biodiesel was imported from Argentina, and Scenario 2, where 1MJ of biodiesel from used cooking oil (UCO) was manufactured in Spain. System expansion was performed to include the marginal products involved and additional functions were considered under a consequential approach. Scenario 1 included the production of palm oil in Malaysia (+25.27 g), as the marginal supplier in the global market. This also implied a decrease in the production of soybean meal in Brazil (?3.44 g). In Scenario 2, interactions in the global oil market led to changes in the opposite direction: the production of palm oil decreases in Malaysia (?26.31 g), whereas the production of soybean meal increases in Brazil (+3.58 g). Without considering emissions from Land Use Change (LUC), UCO biodiesel produced in Spain performed better than imported biodiesel from Argentina in all the analyzed impact categories but Global Warming (GW), which was 138.9% lower in Scenario 1, mainly due to the carbon uptake by soybeans in Argentina and palm trees in Malaysia. Since these results could be misleading, GHG emissions from LUC in each country were included. Indirect functions of the expanded systems appeared to have a great contribution in the overall GW impact, especially in Scenario 2. Results show that there are clear environmental benefits arising from the use of UCO biodiesel in Spain to meet the European targets, as compared to the use of imported soybean biodiesel from Argentina. The Monte Carlo simulation for both scenarios also reinforces confidence in the comparative assessment.

Neus Escobar; Javier Ribal; Gabriela Clemente; Neus Sanjun


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ferven Technologia | Open Energy Information  

Open Energy Info (EERE)

Madrid, Spain Zip: 28035 Sector: Solar Product: Madrid-based distributor and supplier of solar panels. References: Ferven Technologia1 This article is a stub. You can help...


Gas Natural Corporacion Eolica SL | Open Energy Information  

Open Energy Info (EERE)

SL Jump to: navigation, search Name: Gas Natural Corporacion Eolica SL Place: Barcelona, Spain Zip: 8002 Sector: Wind energy Product: Barcelona headquartered wind development wing...


Leonardo Venablers | Open Energy Information  

Open Energy Info (EERE)

search Name: Leonardo Venablers Place: Barcelona, Spain Zip: 8003 Sector: Renewable Energy, Services Product: Headquartered in Barcelona, the company offers management and...


El Marquesado Eolico EOZEN | Open Energy Information  

Open Energy Info (EERE)

Madrid, Spain Zip: 28043 Sector: Wind energy Product: Manufacturer of gearless wind turbines References: El Marquesado Eolico (EOZEN)1 This article is a stub. You can help...


J Bornay Windturbines | Open Energy Information  

Open Energy Info (EERE)

Spain Zip: 3420 Sector: Wind energy Product: Manufacturer of micro scale wind turbines and windmills. References: J Bornay Windturbines1 This article is a stub. You...


Aerogeneradores Canarios SA ACSA | Open Energy Information  

Open Energy Info (EERE)

de Gran Canaria, Spain Zip: 35011 Sector: Wind energy Product: Manufacturer mini wind-turbines and wind farm developer References: Aerogeneradores Canarios SA (ACSA)1 This...


Equips Nucleares SA | Open Energy Information  

Open Energy Info (EERE)

SA Place: Madrid, Spain Zip: 28006 Sector: Services Product: ENSA is a Spanish nuclear components and nuclear services supply company. References: Equips Nucleares, SA1...


Perseo | Open Energy Information  

Open Energy Info (EERE)

Name: Perseo Place: Madrid, Spain Zip: 28033 Product: Madrid-based corporate venture investment arm of Spanish utility Iberdrola that was launched in 2008. References: Perseo1...


Campo 3 SL | Open Energy Information  

Open Energy Info (EERE)

Name: Campo 3 SL Place: Ciudad Real, Spain Zip: 13170 Sector: Solar Product: Solar PV and solar thermal project developer, also involved in environmental consulting. References:...


Aries Solar Termoelectrica SL ASTE | Open Energy Information  

Open Energy Info (EERE)

SL (ASTE) Place: Madrid, Spain Zip: 28046 Sector: Solar Product: Joint venture to set up Solar Thermal Electricity Generation (STEG) plants in Castilla la Mancha. References:...


ATERSA Electridad Solar | Open Energy Information  

Open Energy Info (EERE)

Name: ATERSA Electridad Solar Place: Madrid, Spain Zip: 28045 Product: Madrid-based manufacturer of PV modules and balance of plant such as mounting and inverters; commercial and...


Blue Green Capital | Open Energy Information  

Open Energy Info (EERE)

Green Capital Jump to: navigation, search Name: Blue Green Capital Place: Spain Zip: 8860 Sector: Renewable Energy, Solar Product: String representation "Spanish develop ... their...


Solea Consulting | Open Energy Information  

Open Energy Info (EERE)

Place: Spain Zip: 18009 Sector: Carbon, Renewable Energy Product: Solea is a renewable energy and CDM project development consultancy. Solea acts as PDD consultant and...


Spanish Power | Open Energy Information  

Open Energy Info (EERE)

Power Jump to: navigation, search Name: Spanish Power Place: Madrid, Spain Zip: 28014 Sector: Solar, Wind energy Product: Madrid-based electricity producer and distributor active...


Efficiency, effectiveness and implementation feasibility of energy efficiency rebates: The Renove plan in Spain  

Science Journals Connector (OSTI)

Abstract State-sponsored incentive policies frequently include subsidies or rebates for the purchase of more efficient appliances. However, more research is required into the effects of this tool in isolation. A case in point is the so-called Renove plan in Spain. First, the inefficiency losses (dead-weight losses) associated with energy efficiency rebates must be taken into account. Such a policy may also encourage the large-scale purchasing of energy-efficient appliances, which may finally result in an increase in electricity consumption (rebound effect). Furthermore, although a subsidy is more widely accepted than other tools from social and political viewpoints, especially than taxes, the fiscal consolidation challenge faced by many countries reduces the scope for environmental policy measures on the expenditure side of the budget and strengthens the need to use taxes to meet the agreed policy objectives. This paper shows that the current application of the Spanish Renove plan with rebates on the dishwasher market for energy efficient appliances generates some welfare losses, a rebound effect and a considerable deficit in public budgets. The paper examines and assesses the effect of different combinations of taxes and rebates in the case of dishwashers in Spain based on their performance in terms of economic efficiency, environmental effectiveness and implementation feasibility.

Ibon Galarraga; Luis M. Abadie; Alberto Ansuategi



Cereal waste burning pollution observed in the town of Vitoria (northern Spain)  

Science Journals Connector (OSTI)

Agricultural waste burning is a widespread practice throughout the world but there is little information about its pollutant impact. This paper deals with a preliminary study of the pollution observed in Vitoria (Northern Spain) caused by cereal waste burning. The mean hourly flux of pollutants produced by cereal waste burning fires can reach values of 1.4kt of CO2, 13t of TPM and 3t of \\{NOx\\} in the area around Vitoria. Measurements obtained in the area of emission and inside fire plumes show high ratios (NO2/NOx) indicating that nitrogen oxides emitted by the source undergo a rapid transformation in the same area of emission. Results relating to aerosol composition collected in Vitoria during burning periods show an increase in the concentration of K+, NO3? and Cl? ions, that are inter-correlated. The modification of the ionic composition of aerosols also affects the chemistry of the rain collected in Vitoria. During the burning period, it is particularly noticeable that anthropogenic pollution (usually identifiable by the correlation between SO42? and NO3? concentrations) disappears, indicating the existence of an independent source of NO3? not linked to the SO42? source. Similar results were deduced studying BAPMON data collected in Spain during cereal waste burning. Finally, we note that ozone concentration measured at Vitoria is not affected by the pollution generated by the burning fires.

A. Ezcurra; I. Ortiz de Zrate; Pham Vhan Dhin; J.P. Lacaux



A Review of "New World Gold: Cultural Anxiety and Monetary Disorder in Early Modern Spain" by Elvira Vilches  

E-Print Network [OSTI]

) and the Dominican Tom?s Mercado?s Suma de tratos y contratos (Guide to negotiations and contracts, 1569). Not unlike the bumper crop of books on personal finance that have ap- peared since our own economic meltdown of 2008, the proliferation of such texts... of Columbus?s travel log or Cort?s?s ?Letters from Mexico.? Whether read in parts or as a whole, Vilches?s book offers the reader a layered and insightful examination of early modern Spain?s ?Golden Age,? attune to all the contradictions that follow from...

Wright, Elizabeth R.



Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain Paper number: 197  

E-Print Network [OSTI]

Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain Paper number: 197 #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis, Fifth

Grilli, Stéphan T.


Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August 29-September Xing Fan, Carlos Busso and John H.L. Hansen  

E-Print Network [OSTI]

Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August Barcelona, Spain #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 2 EUSIPCO 2011, Barcelona with neutral speech #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 3 EUSIPCO 2011, Barcelona

Busso, Carlos


Suntrack P4Q Electronics SL | Open Energy Information  

Open Energy Info (EERE)

Suntrack P4Q Electronics SL Jump to: navigation, search Name: Suntrack (P4Q Electronics SL) Place: Alonsotegi, Spain Zip: 48810 Sector: Solar Product: Spain-based firm that...

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Luz de Viento | Open Energy Information  

Open Energy Info (EERE)

Place: Madrid-Pozuelo, Spain Zip: E-28224 Sector: Wind energy Product: Wind farm, Biogas, Biodiesel and waste-to-energy project developer in Spain References: Luz de Viento1...


T Solar Global SA | Open Energy Information  

Open Energy Info (EERE)

T-Solar Global SA Place: Madrid, Spain Zip: 28042 Product: Spain-based thin-film silicon PV cell and module maker, using Applied Materials equipment. The firm is also a major...


European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind Generation by a Dynamic  

E-Print Network [OSTI]

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind forecasting. I. INTRODUCTION HE actual large-scale integration of wind energy in several European countries enhance the position of wind energy compared to other dispatchable forms of generation. Predicting

Paris-Sud XI, Université de


An Edition and Interdisciplinary Study of a Sermon from New Spain (1675), Written and Preached by Joseph Das Chamorro and Printed by Ins Vsquez Infante  

E-Print Network [OSTI]

The printing press was introduced to Puebla, Mexico, in the middle of the 17th century. Juan de Borja y Ganda and his wife Ins Vsquez Infante, Spanish immigrants from Cadiz, Spain established a printing press and book selling business...

Mielke, Lynne Ellen



An example of realization of Gis ecological maps derived from Ellenberg indicators in the Biological Reserve of Doana National Park (Spain)  

Science Journals Connector (OSTI)

This study is focussed on the Biological Reserve of Doana (Spain) where a first application of Ellenbergs indicators has been attempted on dune vegetation. Ellenberg indicators have been estimated for specie...

Anna Testi; Elisabetta Cara; Giuliano Fanelli



Canine dirofilariosis caused by Dirofilaria immitis is a risk factor for the human population on the island of Gran Canaria, Canary Islands, Spain  

Science Journals Connector (OSTI)

The aim of the present study was compare the prevalence of D. immitis in dogs and seroprevalence in humans of Gran Canaria (Canary Islands, Spain) taking into consideration...Dirofilaria immitis in dogs and the s...

Jose Alberto Montoya-Alonso; Isabel Mellado; Elena Carretn



A review of "The Sale of the Century: Artistic Relations between Spain and Great Britain, 1604-1655." by Jonathan Brown and John Elliott, eds.  

E-Print Network [OSTI]

. Jonathan Brown and John Elliott, eds. The Sale of the Century: Ar- tistic Relations between Spain and Great Britain, 1604?1655. Madrid: Yale University Press and Museo Nacional del Prado, 2002. 315 pp. $65 hardback. Review by ELIZABETH R. WRIGHT..., UNIVERSITY OF GEORGIA. Art historian Jonathan Brown and historian John Elliott have joined forces to provide an indispensable guide to the political and artistic relationship between Spain and England in the first half of the seventeenth century. Though...

Elizabeth R. Wright



Toward a less natural gas dependent energy mix in Spain: Crowding-out effects of shifting to biomass power generation  

Science Journals Connector (OSTI)

Abstract This paper estimates the impact of a hypothetical change in Spain's energy mix on a number of productive sectors. The change would be brought about by substituting power generation from natural gas with generation from biomass. The total amount of electricity supplied has been calculated to remain constant so that a crowding-out effect would be derived from the displacement of one technology with another. An inputoutput (IO) framework has been used to estimate the overall economic impact on 26 productive sectors included on Spain's 2007 IO Table. Based on the available literature, the consideration of net impact improves the analysis. The results show that the overall net impact across all productive sectors of this change in the energy mix would be positive and equal to about 0.5% for the period. Higher impacts were measured for the Electricity power and Electricity Supply sector (15.4%) followed by the Agriculture, Hunting, Forestry sector (7.1%). Only the Gas generation and Gas supply sector showed a negative impact (2.5%), which is consistent with the reduced use of natural gas. The overall calculated total impact for Spain's productive sector was equal to 8074.95 million at the 2007-equivalent value.

Mara J. Colinet; Jos M. Cansino; Jos M. Gonzlez-Limn; Manuel Ordez



Microbiological quality and safety of fresh cultivated and wild mushrooms commercialized in Spain  

Science Journals Connector (OSTI)

402 samples of 22 species of cultivated and wild fresh mushrooms sold in retail markets and supermarkets in Zaragoza (Spain) were studied to quantify their microbial load (mesophilic aerobic microorganisms, Pseudomonas genus, Enterobacteriaceae, lactic acid bacteria, total and thermotolerant coliform bacteria, Escherichia coli, yeasts and moulds) and to investigate the presence of E.coli O157:H7, Listeria monocytogenes, Salmonella spp., Staphylococcus aureus and Yersinia enterocolitica. The total microbial counts ranged from 4.4 to 9.4 logcfu/g, the genus Pseudomonas being the most prevalent with counts from 3.7 to 9.3 logcfu/g and Auricularia auricula-judae the species with the highest microbial load (9.4 logcfu/g). No significant differences (p>0.05) were detected between mean counts of wild and cultivated species in all the microbial groups studied. The microbiological safety level of the cultivated mushrooms was excellent since no pathogens were isolated, and the microbial counts of indicator microorganisms were low, being detected in only half of the species. Salmonella spp, E.coli O157:H7 and S.aureus were not isolated from any sample, Y.enterocolitica was detected in only four samples of wild mushrooms whereas twenty-six (6.5%) were positive for L.monocytogenes, their occurrence being relatively high in Calocybe gambosa (40%), Hygrophorus limacinus (40%) and Tuber indicum (100%). These results suggest that a strategy to reduce bacterial populations, and to improve the microbiological safety of some species of fresh mushrooms, should be investigated.

Mara E. Venturini; Juan E. Reyes; Carmen S. Rivera; Rosa Oria; Domingo Blanco



The Barranco de Tirajana basin, Gran Canaria (Spain). A major erosive landform caused by large landslides  

Science Journals Connector (OSTI)

The Barranco de Tirajana (BdT), located on the island of Gran Canaria (Spain), has some specific features that differentiate it from the ravines of other volcanic islands in the Atlantic Ocean. The origin of this unusually wide upper basin (35 km2) has been under discussion over the last century although its erosional origin is nowadays widely accepted. The purpose of this paper is to describe the landslide deposits that appear at the bottom of the basin and to assess their role in the geomorphological evolution of the basin. We suggest that the BdT basin is a major erosional landform initiated by important ravine incision and widened by a large number of landslides. There are 28 large landslides within the BdT basin. The main movements were of rock-slide and debris-slide types, affecting 70% and 25% of the total area, respectively. In addition, modes of displacement were predominantly translational (rock-, debris-, and earth-slides) consisting of 89% of the total, compared to rotations and flows that constitute only 11%. Three main periods of landslide activity have been established in the development of the BdT basin, using geomorphological criteria. Period I includes ancient movements that could have started at about 0.6 Ma or even 2.7 Ma ago and are considered as abandoned landslides. Period II corresponds to old landslides considered as dormant, which occurred within the MiddleUpper Pleistocene. Finally, period III includes recent Upper Pleistocene landslides and Holocene landslides that are still active. We suggest that interglacials in the Canary Islands and NW Africa included humid and wet episodes that could account for the occurrence of periods of landslide activity in the BdT basin.

Alejandro Lomoschitz; Joaqu??n Meco; Jordi Corominas



Attitudes to diversity: A cross-cultural study of education students in Spain, England, and the United States  

E-Print Network [OSTI]

, Florian, Lani , Rouse, Martyn and Stough, Laura M.(2010) 'Attitudes to diversity: a cross-cultural study of education students in Spain, England and the United States', European Journal of Teacher Education, 33: 3, 245 264 To link to this Article: DOI...), and American students (70% White or European American, 19% Hispanic, 4% Asian American, 2% African American, and 4% other). The average age of the students was 26 years with a mean teaching experience of 2.31 years (SD = 4.38) (5.68 for the Spanish students, 1...

Stough, Laura



Megarhizoliths in Pleistocene aeolian deposits from Gran Canaria (Spain): Ichnological and palaeoenvironmental significance  

Science Journals Connector (OSTI)

The Pleistocene dune field of Tufia, located on the east of Gran Canaria (Spain), contains different stratigraphic levels of indurated pillar-like structures that are interpreted as megarhizoliths. The megarhizoliths occur at the top of different aeolian sets and reach 31.5cm in diameter and over 1m in height. These scattered, free-standing, vertical, cylindrical-to-slightly conical columns usually appear as hollow cylinders, displaying elliptical cross-sections aligned with the prevailing wind. On the leeward side of some specimens the external wall shows a tail of rock matrix resembling a sort of wind shadow. These tails and other remains of the associated rock matrix show a texture composed of long, horizontal, parallel cylinders orientated with the wind. Internally the most complete structures show five concentrically arranged zones: Zone (a), is a central pore corresponding to the cavity originally occupied by the root; Zones (b) and (c), which include alveolar and laminated carbonate textures indicating that carbonate precipitation was mostly induced by the roots and their associated microorganisms; and Zones (d) and (e), consisting mostly of aeolian sands. In (d) the sand grains show thin micritic coatings whereas in (e) vadose aragonite cements can be seen on the grain surface suggesting a less biogenic influence in their formation. The degree of cementation and the time of the precipitation of carbonate around the roots controlled the preservation of these zones. Thus, in some cases, Zones b, c and/or d are not preserved. Cylinders are up to 30 the diameter of the root that nucleated them. The presence of the megarhizoliths at the top of the aeolianite beds indicates that aeolian sedimentation halted several times, allowing soil formation and plant colonisation during slightly more humid periods. The occurrence of megarhizoliths is further proof of the alternation of arid and slightly more humid climates in the north Atlantic during the last glacial period. It is also noted that they may be misinterpreted as animal trace fossils or tree trunk casts, resulting in incorrect ichnological or palaeoenvironmental interpretations.

A.M. Alonso-Zarza; J.F. Genise; M.C. Cabrera; J. Mangas; A. Martn-Prez; A. Valdeolmillos; M. Dorado-Valio



G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June -1 July 2005 Tarragona (Spain) 1 Source Regulation of Fast Energetic  

E-Print Network [OSTI]

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005 Tarragona (Spain, Rome, Italy #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005, EPM, ...) #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005

Vlad, Gregorio


Valencia West, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

West, Arizona: Energy Resources West, Arizona: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 32.135139°, -111.106913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.135139,"lon":-111.106913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean



Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds



Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies


Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...


Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...


Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...


Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member


In T. R. G. Green, J. J. Canas, & C. P. Warren (Eds): Proceedings of the Eight Conference on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.)  

E-Print Network [OSTI]

on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.) Reusing processes and documenting Ergonomic Psychology Group Language and Communication Laboratory Ergonomic Psychology Group INRIA

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Memorandum of Understanding between the Department of Energy of the United States of America and the National Company of Radioactive Waste of Spain Concerning Cooperation in the Field of Used Nuclear Fuel and Radioactive Waste Management  

Broader source: Energy.gov [DOE]

Memorandum of Understanding between the Department of Energy of the United States of America and the National Company of Radioactive Waste of Spain Concerning Cooperation in the Field of Used Nuclear Fuel and Radioactive Waste Management


The estimation of radiation doses in human organs due to natural and artificial radioactivity in surface waters of the Ebro river basin (Northeast Spain)  

Science Journals Connector (OSTI)

This paper reports the estimation of the radiation doses in the human body in the Ebro river basin (Northeast Spain), following drinking water ingestion by measuring 40K, 226Ra, 90Sr and 3H. The equivalent dose in ten different organs was estimated. Dose calculations were performed by means of the GENII computer program. The lowest equivalent dose calculated through ingesting drinking water was in the small intestine whereas the highest was in the bone surface.

Feda Oner; Nazmi T. Okumusoglu



Factors controlling the morphology of monogenetic basaltic volcanoes: The Holocene volcanism of Gran Canaria (Canary Islands, Spain)  

Science Journals Connector (OSTI)

A detailed morphometric analysis was performed on the 24 Holocene eruptions of Gran Canaria, a nearly circular island located at the centre of the Canary Islands (Spain), developed as result of the eastward movement of the African plate over a mantle hotspot. Rigorous field work was carried out to generate a palaeogeomorphological reconstruction of the Holocene eruptions of Gran Canaria to obtain pre- and post-eruption digital terrain models (DTMs). These eruptions were of Strombolian monogenetic basaltic volcanism style. With respect to the cones, feeder fissures determine their location and some morphological features as crater openings which are usually perpendicular to the slope direction. In addition, the trade winds influence the final volcanic edifice shape and the extent of the pyroclastic sheet-like fall deposits. For the lava flows, the most significant controls are the eruption rate, affecting the maximum distance travelled, and the gully slope and shape that condition their flow path. Concerning volcanic hazard and risk assessment, the applied methodology has led to a better understanding of the recent eruptions and foresees the location and nature of future eruptions.

A. Rodriguez-Gonzalez; J.L. Fernandez-Turiel; F.J. Perez-Torrado; R. Paris; D. Gimeno; J.C. Carracedo; M. Aulinas



Sur de Renovables | Open Energy Information  

Open Energy Info (EERE)

Spain Zip: 41092 Sector: Wind energy Product: Development and construction of wind, PV and STEG plants. References: Sur de Renovables1 This article is a stub. You can help...


MTorres Group | Open Energy Information  

Open Energy Info (EERE)

MTorres Group Place: Murcia, Spain Zip: 30320 Sector: Wind energy Product: Wind turbine manufacturer References: MTorres Group1 This article is a stub. You can help OpenEI by...


Sequential extraction of metals from mixed and digested sludge from aerobic WWTPs sited in the south of Spain  

SciTech Connect (OSTI)

The content of heavy metals is the major limitation to the application of sewage sludge in soil. However, assessment of the pollution by total metal determination does not reveal the true environmental impact. It is necessary to apply sequential extraction techniques to obtain suitable information about their bioavailability or toxicity. In this paper, sequential extraction of metals from sludge before and after aerobic digestion was applied to sludge from five WWTPs in southern Spain to obtain information about the influence of the digestion treatment in the concentration of the metals. The percentage of each metal as residual, oxidizable, reducible and exchangeable form was calculated. For this purpose, sludge samples were collected from two different points of the plants, namely, sludge from the mixture (primary and secondary sludge) tank (mixed sludge, MS) and the digested-dewatered sludge (final sludge, FS). Heavy metals, Al, Cd, Co, Cr, Cu, Fe, Hg, Mn, Mo, Ni, Pb, Ti and Zn, were extracted following the sequential extraction scheme proposed by the Standards, Measurements and Testing Programme of the European Commission and determined by inductively-coupled plasma atomic emission spectrometry. The total concentration of heavy metals in the measured sludge samples did not exceed the limits set out by European legislation and were mainly associated with the two less-available fractions (27-28% as oxidizable metal and 44-50% as residual metal). However, metals as Co (64% in MS and 52% in FS samples), Mn (82% in MS and 79% in FS), Ni (32% in MS and 26% in FS) and Zn (79% in MS and 62% in FS) were present at important percentages as available forms. In addition, results showed a clear increase of the concentration of metals after sludge treatment in the proportion of two less-available fractions (oxidizable and residual metal)

Alonso, E. [Department of Analytical Chemistry, Industrial Engineering School, University of Seville, c/Virgen de Africa 7, 41011, Sevilla (Spain)], E-mail: ealonso@us.es; Aparicio, I.; Santos, J.L.; Villar, P.; Santos, A. [Department of Analytical Chemistry, Industrial Engineering School, University of Seville, c/Virgen de Africa 7, 41011, Sevilla (Spain)



North Atlantic Oscillation influence and weather types associated with winter total and extreme precipitation events in Spain  

Science Journals Connector (OSTI)

An analysis of winter intensity and frequency of precipitation is presented, based on 102 daily precipitation stations over Spain and the Balearic Islands for the 19972006 decade. Precipitation stations have been merged in the eight different regions which compose the analyzed area by the use of an EOF analysis. NAO influence on the intensity and frequency of precipitation of each region is described in terms of mean precipitation, mean rain frequency, the number of extreme events, changes in the precipitation distribution and the prevalent synoptic configuration. Results indicate a non-stationary response; NAO signal being more evident in midlate winter. Strong regional differences in the response to NAO are also found, which vary according to the specific character of the precipitation under analysis. Thus, NAO exerts a clear effect on the intensity of total and extreme precipitation rates in northern and westernmost Spanish regions, whereas the frequency of precipitation is clearly affected by NAO in central and southwestern areas. While the correlation between NAO and precipitation is negative for most of the analyzed area, two regions reveal positive responses to NAO in total precipitation occurrence and intensity for specific months. Further analyses reveal asymmetric responses to opposite phases of NAO in the precipitation distributions of some regions. The complex regional relationship between NAO and precipitation is also revealed through the modulation of the former in the preferred Circulation Weather Types associated to precipitation in each region. This spatially non-homogeneous NAO signal stresses the need of caution when employing Iberian precipitation as a proxy for NAO.

S. Queralt; E. Hernndez; D. Barriopedro; D. Gallego; P. Ribera; C. Casanova



Characterization of U/Pu Particles Originating From the Nuclear Weapon Accidents at Palomares, Spain, 1966 And Thule, Greenland, 1968  

SciTech Connect (OSTI)

Following the USAF B-52 bomber accidents at Palomares, Spain in 1966 and at Thule, Greenland in 1968, radioactive particles containing uranium (U) and plutonium (Pu) were dispersed into the environment. To improve long-term environmental impact assessments for the contaminated ecosystems, particles from the two sites have been isolated and characterized with respect to properties influencing particle weathering rates. Low [239]Pu/[235]U (0.62-0.78) and [240]Pu/[239]Pu (0.055-0.061) atom ratios in individual particles from both sites obtained by Inductively Coupled Plasma Mass Spectrometry (ICP-MS) show that the particles contain highly enriched U and weapon-grade Pu. Furthermore, results from electron microscopy with Energy Dispersive X-ray analysis (EDX) and synchrotron radiation (SR) based micrometer-scale X-ray fluorescence ({micro}-XRF) 2D mapping demonstrated that U and Pu coexist throughout the 1-50 {micro}m sized particles, while surface heterogeneities were observed in EDX line scans. SR-based micrometer-scale X-ray Absorption Near Edge Structure Spectroscopy ({micro}-XANES) showed that the particles consisted of an oxide mixture of U (predominately UO[2] with the presence ofU[3][8]) and Pu ((III)/(IV), (V)/(V) or (III), (IV) and (V)). Neither metallic U or Pu nor uranyl or Pu(VI) could be observed. Characteristics such as elemental distributions, morphology and oxidation states are remarkably similar for the Palomares and Thule particles, reflecting that they originate from similar source and release scenarios. Thus, these particle characteristics are more dependent on the original material from which the particles are derived (source) and the formation of particles (release scenario) than the environmental conditions to which the particles have been exposed since the late 1960s.

Lind, O.C.; Salbu, B.; Janssens, K.; Proost, K.; Garcia-Leon, M.; Garcia-Tenorio, R.



Unit References Module 1: The Science of Climate Change  

E-Print Network [OSTI]

164 Unit References Module 1: The Science of Climate Change 1. Intergovernmental Panel on Climate Change. (2007). Climate change 2007: synthesis report. IPCC Plenary XXVII (Valencia, Spain, 12-17 November 2007). 2. America's Climate Choices: Panel on Advancing the Science of Climate Change, National

Smith, Kate


Corpus and Evaluation Measures for Automatic Plagiarism Detection Alberto Barrn-Cedeo1  

E-Print Network [OSTI]

of Information Systems and Computation Universidad Politécnica de Valencia, Spain http://users.dsic.upv.es/grupos/nle apply character n-grams profiles to characterize an author's style and search for irregularities across retrieval of a small number of candidate source documents using a Web search engine, and to compare them

Rosso, Paolo


NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.  

E-Print Network [OSTI]

NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

Rosso, Paolo


Cross-Language High Similarity Search Using a Conceptual Thesaurus  

E-Print Network [OSTI]

Cross-Language High Similarity Search Using a Conceptual Thesaurus Parth Gupta, Alberto Barr Universitat Polit`ecnica de Val`encia, Spain {pgupta,lbarron,prosso}@dsic.upv.es http://www.dsic.upv.es/grupos/nle Abstract. This work addresses the issue of cross-language high similarity and near-duplicates search, where

Rosso, Paolo


Encoding transliteration variation through dimensionality reduction: FIRE Shared Task on  

E-Print Network [OSTI]

on Transliterated Search Parth Gupta1 , Paolo Rosso1 , and Rafael E. Banchs2 1 Natural Language Engineering Lab Department of Information Systems and Computation Universitat Polit`ecnica de Val`encia, Spain http://www.dsic.upv.es/grupos/nle are written in indigenous scripts for various rea- sons. In the light of this phenomenon, the search engines

Rosso, Paolo


THIESEL 2010 Conference on Thermo-and Fluid Dynamic Processes in Diesel Engines Influence of Nozzle Geometry on Spray Shape, Particle Size, Spray  

E-Print Network [OSTI]

THIESEL 2010 Conference on Thermo- and Fluid Dynamic Processes in Diesel Engines Influence Abstract. Air/fuel mixing process in the combustion chamber of Diesel engines plays an important role on Thermo- and Fluid Dynamic Processes in Diesel Engines, Valencia : Spain (2010)" #12;388 C. Hespel, J. B

Paris-Sud XI, Université de


Parallel Interconnection of Broadcast Systems with Multiple FIFO Channels  

E-Print Network [OSTI]

´ecnica de Madrid, Ctra. Valencia, km 7 28031 Madrid (Spain) rjuan@iti.upv.es, vcholvi@uji.es, ernes@eui/005 e-mail: rjuan@iti.upv.es, vcholvi@uji.es, ernes@eui.upm.es, fmunyoz@iti.upv.es August 6, 2009

Muñoz, Francesc


Cheap solar cells tempt businesses  

Science Journals Connector (OSTI)

... of Valencia in Spain, first heard about perovskites, the latest hope for low-cost solar power, in April last year. Unlike the slabs of purified silicon at the heart ... in April last year. Unlike the slabs of purified silicon at the heart of the solar ...

Richard Van Noorden



CLOUD SCREENING METHODOLOGY FOR MERIS/AATSR SYNERGY PRODUCTS Luis Gomez-Chova, Gustavo Camps-Valls, Jordi Mu~noz-Mari, Javier Calpe, and Jose Moreno  

E-Print Network [OSTI]

CLOUD SCREENING METHODOLOGY FOR MERIS/AATSR SYNERGY PRODUCTS Luis G´omez-Chova, Gustavo Camps (Valencia), Spain. ABSTRACT This paper describes the current development status of a cloud-screening method to improve current cloud mask- ing products for both sensors. Preliminary results based on simulated TOA

Camps-Valls, Gustavo


Inter-comparison between HERMESv2.0 and TNO-MACC-II emission data using the CALIOPE air quality system (Spain)  

Science Journals Connector (OSTI)

Abstract This work examines and compares the performance of two emission datasets on modelling air quality concentrations for Spain: (i) the High-Elective Resolution Modelling Emissions System (HERMESv2.0) and (ii) the TNO-MACC-II emission inventory. For this purpose, the air quality system CALIOPE-AQFS (WRF-ARW/CMAQ/BSC-DREAM8b) was run over Spain for February and June 2009 using the two emission datasets (4kmנ4km and 1h). Nitrogen dioxide (NO2), sulphur dioxide (SO2), Ozone (O3) and particular matter (PM10) modelled concentrations were compared with measurements at different type of air quality stations (i.e. rural background, urban, suburban industrial). A preliminary emission comparison showed significant discrepancies between the two datasets, highlighting an overestimation of industrial emissions in urban areas when using TNO-MACC-II. However, simulations showed similar performances of both emission datasets in terms of air quality. Modelled NO2 concentrations were similar between both datasets at the background stations, although TNO-MACC-II presented lower underestimations due to differences in industrial, other mobile sources and residential emissions. At Madrid urban stations NO2 was significantly underestimated in both cases despite the fact that HERMESv2.0 estimates traffic emissions using a more local information and detailed methodology. This NO2 underestimation problem was not found in Barcelona due to the influence of international shipping emissions located in the coastline. An inadequate characterization of some TNO-MACC-II's point sources led to high SO2 biases at industrial stations, especially in northwest Spain where large facilities are grouped. In general, surface O3 was overestimated regardless of the emission dataset used, depicting the problematic of CMAQ on overestimating low ozone at night. On the other hand, modelled PM10 concentrations were less underestimated in urban areas when applying HERMESv2.0 due to the inclusion of road dust resuspension, whereas the underestimation at suburban industrial stations indicated deficiencies in fugitive emission sources characterization (agricultural operations, windblown dust emissions).

Marc Guevara; Mara Teresa Pay; Francesc Martnez; Albert Soret; Hugo Denier van der Gon; Jos M. Baldasano



This is the authors' version of the work. It is posted here for your personal use only. Not for redistribution. The definitive version is accepted for publication in the European Wireless 2014, Barcelona, Spain, May 2014.  

E-Print Network [OSTI]

, Spain, May 2014. Distributed Spectrum Allocation for Autonomous Cognitive Radio Networks Anatolij Zubow usage of non-occupied spectrum licensed to Pri- mary Users (PU). With the Non-Contiguous OFDM of available spectrum. A promising solution to achieve this goal is the Cognitive Radio (CR) approach

Wichmann, Felix


The impact of peak oil on tourism in Spain: An inputoutput analysis of price, demand and economy-wide effects  

Science Journals Connector (OSTI)

This article examines the potential effects of peak oil on Spanish tourism and indirectly on the rest of the economy. We construct several scenarios of price increases in oil, related fossil fuels and their inflationary effects. These scenarios provide the context for an inputoutput (I/O) analysis which uses I/O tables extended with Tourism Satellite Accounts. The analysis comprises three steps: (1) applying an I/O price model to estimate the price change of tourism services in Spain due to an increase in the prices of oil and other fossil fuels; (2) assessing the effects of price changes on demand for tourism services; and (3) estimating the impacts of demand change on the country's economy using an I/O demand model. The results show that a decreased demand for tourism services results in the greatest fall in outputs in the tourism-related shares of air, water, land and railway transport sectors. These are followed by tourism agencies' activities, non-market recreational, cultural and sporting activities, restaurants, and hotels. Depending on the oil price scenario adopted, GDP (Gross domestic product) decreases between?0.08% and?0.38% and the number of jobs lost through direct and indirect effects varies between approximately 20,000 and 100,000.

Ivana Logar; Jeroen C.J.M. van den Bergh


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GIS methods applied to the degradation of monogenetic volcanic fields: A case study of the Holocene volcanism of Gran Canaria (Canary Islands, Spain)  

Science Journals Connector (OSTI)

Modeling of volcanic morphometry provides reliable measurements of parameters that assist in the determination of volcanic landform degradation. Variations of the original morphology enable the understanding of patterns affecting erosion and their development, facilitating the assessment of associated hazards. A total of 24 volcanic Holocene eruptions were identified in the island of Gran Canaria (Canary Islands, Spain). 87% of these eruptions occurred in a wet environment while the rest happened in a dry environment. 45% of Holocene eruptions are located along short barrancos (S-type, less than 10km in length), 20% along large barrancos (L-type, 1017km in length) and 35% along extra-large barrancos (XL-type, more than 17km in length). The erosional history of Holocene volcanic edifices is in the first stage of degradation, with a geomorphic signature characterized by a fresh, young cone with a sharp profile and a pristine lava flow. After intensive field work, a careful palaeo-geomorphological reconstruction of the 24 Holocene eruptions of Gran Canaria was conducted in order to obtain the Digital Terrain Models (DTMs) of the pre- and post-eruption terrains. From the difference between these DTMs, the degradation volume and the incision rate were obtained. The denudation of volcanic cones and lava flows is relatively independent both their geographical location and the climatic environment. However, local factors, such as pre-eruption topography and ravine type, have the greatest influence on the erosion of Holocene volcanic materials in Gran Canaria. Although age is a key factor to help understand the morphological evolution of monogenetic volcanic fields, the Gran Canaria Holocene volcanism presented in this paper demonstrates that local and regional factors may determine the lack of correlation between morphometric parameters and age. Consequently, the degree of transformation of the volcanic edifices evolves, in many cases, independently of their age.

A. Rodriguez-Gonzalez; J.L. Fernandez-Turiel; F.J. Perez-Torrado; M. Aulinas; J.C. Carracedo; D. Gimeno; H. Guillou; R. Paris



United Biorefineries Corp UBC | Open Energy Information  

Open Energy Info (EERE)

Biorefineries Corp UBC Biorefineries Corp UBC Jump to: navigation, search Name United Biorefineries Corp (UBC) Place Valencia, California Zip 91354-1532 Sector Biofuels Product California-based technology management company doing commercial physical & biological research. Involved in the project development of an Integrated Biorefinery Complex utilizing algae and cellulosic-based second generation biofuels technology. References United Biorefineries Corp (UBC)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. United Biorefineries Corp (UBC) is a company located in Valencia, California . References ↑ "United Biorefineries Corp (UBC)" Retrieved from "http://en.openei.org/w/index.php?title=United_Biorefineries_Corp_UBC&oldid=352515


NLEL-MAAT at ResPubliQA Santiago Correa and Davide Buscaldi and Paolo Rosso  

E-Print Network [OSTI]

NLEL-MAAT at ResPubliQA Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the QA@CLEF-2009 competition. We used

Rosso, Paolo


NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso  

E-Print Network [OSTI]

NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

Rosso, Paolo


NLEL-MAAT at CLEF-ResPubliQA Santiago Correa, Davide Buscaldi, Paolo Rosso.  

E-Print Network [OSTI]

NLEL-MAAT at CLEF-ResPubliQA Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the QA@CLEF-2009 competition. We used

Rosso, Paolo


Retail marketing innovation in Spain  

Science Journals Connector (OSTI)

This paper presents a study carried out on innovation within the field of retail marketing. It arises from the limited scientific literature on the subject, given the significant current interest in marketing innovation as a possible solution to confront the new competitive scene in the current economic and social climate. The database utilised was provided by PITEC 2008 (June 2010). The main findings highlight that retail marketing innovation is in an initial phase; turnover, export activities and internal R&D appear to be the characteristics that make retailers more likely to develop marketing innovations.

Natalia Medrano-Sáez; Mª Cristina Olarte-Pascual



Southwestern Power Administration  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Carlos Valencia Named Director of Transmission Engineering and Planning Carlos Valencia Named Director of Division of Transmission Engineering and Planning Carlos Valencia Carlos...


VALENCIA Y PLAZA 1 Dise~no e implementacion de un algoritmo  

E-Print Network [OSTI]

, resultantes de la interacci´on de la energ´ia so- lar con la estructura molecular de los materiales [1]. La que la mayor´ia de las estrategias de procesamiento paralelo utilizadas para el an´alisis de im mayor´ia de las aplicaciones de ´esta tecnolog´ia necesitan tiempos de respuesta muy r´apidos para poder

Plaza, Antonio J.


Nota de prensa Valencia CSIC c o m u n i c a c i n  

E-Print Network [OSTI]

del Palau de les Arts Reina Sofía, y al que asistieron más de 1.500 personas, se engloba dentro del

Fitze, Patrick


3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced


A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-



Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating



Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music


A Hybrid Geometric Modeling Method for Large Scale Conformal Cellular 3D Systems, 26081 Avenue Hall, Valencia, CA 91354  

E-Print Network [OSTI]

Structures, Conformal Structures, Additive Manufacturing, STL 1 INTRODUCTION Cellular material structures can distributions than stochastic metal foams [5]. With the development of additive manufacturing processes (also, 8, 9]. The manufacturing of mesoscopic truss structures utilizes the unique capability of additive

Chen, Yong


Examen cri?tico-anali?tico de las ilustraciones encontradas en tres Celestinas: (Burgos, 1499; Sevilla, 1502; Valencia, 1514)  

E-Print Network [OSTI]

de los tallados. . . . C. Comentario Social D. Simbolismo Artistico E. Jerarquia de las series de acuerdo a la calidad de los tallados. . . . . . . . . . . 1. Detalles. 2. Montaje de los tallados. . . . . . . . . 3. Medidas promedio y ubicacion... MEDIDA PROMEDIO DE LAS TRES EDICIONES 94 Tabla 5. 2 UBICACION DE LOS TALLADOS EN LAS TRES EDICIONES 95 CAPITULO I Nihil Sine Cavsa INTRODUCCION Una primera etapa para el presente estudio supone la formulacidn de ideas concretas del estudio de la...

Reyes-Dura?n, Marti?n



Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi



Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne



Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Problematical Pleistocene Artifact Assemblage from Northwestern Spain  

Science Journals Connector (OSTI)

...tiger), Panlthliera par-du.v L. (panther). Fe/is ri/fai Schreber (bobcat...show that. in the blood of tigers, panthers, and lynxes, active compo-nents migrate...phenotypes are: 1, bobcat; 2, lynx; 3, panther; 4, tiger; 5, domestic cat B; and...

Emiliano de Aguirre; Karl W. Butzer



Spain's Earth Scientists and the Oil Spill  

E-Print Network [OSTI]

and a south to north slope current on the sea (1­11), the decision to move the vessel from about 43°N, 9.5°WSpain's Earth Scientists and the Oil Spill THE SPANISH COAST OF GALICIA IS CURRENT- ly subject to an oil spill that, given its spatial and temporal extent, could become one of the worst spills ever

Brown, James H.


Import of fruits from Spain to Finland.  

E-Print Network [OSTI]

??The research is made for company named Karamelo Citrus S.L.L. It has already business links to many countries and they are working on the link (more)

Hall, Hardi




E-Print Network [OSTI]

of history would support my point. There has not been any politically-inspired price disruption arising from JOHN F. KENNEDY SCHOOL OF GOVERNMENT HARVARD UNIVERSITY 79 JFK Street Cambridge, MA 02138, USA REPSOL de Publicaciones #12;23 KEYNOTE ADDRESS SECURITY AND ENERGY: SHORT-TERM IMPLICATIONS OF A LONG

Deutch, John


Spain (II): An Understanding with the Americans  

Science Journals Connector (OSTI)

...manufacturing, 52 percent; petroleum, 20 percent; and trade...capital, create jobs, and cut imports. The Spanish govern-ment...Emphasis is being put on the export potential of new industry...or the Peoples' Republic of China, and the United States seems...

John Walsh



H2Scan LLC | Open Energy Information  

Open Energy Info (EERE)

H2Scan LLC H2Scan LLC Jump to: navigation, search Name H2Scan LLC Place Valencia, California Zip 91355 Sector Hydro, Hydrogen Product Hydrogen specific sensing systems, uniquely able to detect hydrogen against virtually any background gases. Coordinates 39.468791°, -0.376913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.468791,"lon":-0.376913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Amur Energy Division | Open Energy Information  

Open Energy Info (EERE)

Amur Energy Division Amur Energy Division Jump to: navigation, search Name Amur Energy Division Place 46001 Valencia, Spain Sector Solar Product Engineering and construction group specialising in large solar power plants. References AMUR[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! TODO: Determine if this company is valid. This article is a stub. You can help OpenEI by expanding it. Amur Energy Division is a company located in Spain. Related Links http://findarticles.com/p/articles/mi_m5CNK/is_2007_Jan_4/ai_n24998390/ http://www.businesswirenet.org/pr/index.php/id/jesus-linares-gil-chairman-and-ceo-of-ae http://solarstocks.blogspot.com/2007_01_01_archive.html References ↑ "Amur Energy Division" Retrieved from "http://en.openei.org/w/index.php?title=Amur_Energy_Division&oldid=391205"



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Small fermionic systems: the common methods and challenges J. Navarro , P.-G. Reinhard and E. Suraud IFIC (CSIC-Universitat Valencia) Apdo. 22085 E-46071 Valencia,...


Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo



E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.


Technological Institute of Renewable Energy ITER | Open Energy Information  

Open Energy Info (EERE)

Renewable Energy ITER Renewable Energy ITER Jump to: navigation, search Name Technological Institute of Renewable Energy (ITER) Place Santa Cruz de Tenerife, Spain Zip 38611 Sector Solar, Wind energy Product Spain-based, technological research and development institute focused on the solar and wind sectors. References Technological Institute of Renewable Energy (ITER)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Technological Institute of Renewable Energy (ITER) is a company located in Santa Cruz de Tenerife, Spain . References ↑ "Technological Institute of Renewable Energy (ITER)" Retrieved from "http://en.openei.org/w/index.php?title=Technological_Institute_of_Renewable_Energy_ITER&oldid=352069


Amope s l | Open Energy Information  

Open Energy Info (EERE)

Amope s l Amope s l Jump to: navigation, search Name Amope s.l. Place La Coruña, Spain Zip 15005 Sector Services, Solar Product Spain-based company offering consultancy, financial and tax advising services to companies engaged in solar photovoltaic related services and products. References Amope s.l.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Amope s.l. is a company located in La Coruña, Spain . References ↑ "[ Amope s.l.]" Retrieved from "http://en.openei.org/w/index.php?title=Amope_s_l&oldid=342151" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link


Medicinal Chemistry and Enzyme Kinetics  

E-Print Network [OSTI]

, University of Valencia Jingzhi Pu, Harvard University Wangshen Xie, Shuhua Ma, Sudeep Bhattacharyay, Marian

Truhlar, Donald G


Searches for beyond the Standard Model physics with boosted topologies in the ATLAS experiment using the Grid-based Tier-3 facility at IFIC-Valencia  

E-Print Network [OSTI]

Both the LHC and ATLAS have been performing well beyond expectation since the start of the data taking by the end of 2009. Since then, several thousands of millions of collision events have been recorded by the ATLAS experiment. With a data taking efficiency higher than 95% and more than 99% of its channels working, ATLAS supplies data with an unmatched quality. In order to analyse the data, the ATLAS Collaboration has designed a distributed computing model based on GRID technologies. The ATLAS computing model and its evolution since the start of the LHC is discussed in section 3.1. The ATLAS computing model groups the different types of computing centers of the ATLAS Collaboration in a tiered hierarchy that ranges from Tier-0 at CERN, down to the 11 Tier-1 centers and the nearly 80 Tier-2 centres distributed world wide. The Spanish Tier-2 activities during the first years of data taking are described in section 3.2. Tier-3 are institution-level non-ATLAS funded or controlled centres that participate presuma...

Villaplana Prez, Miguel; Vos, Marcel


The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]



Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce


The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert


UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.



UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.


A gradient index sonic lens based on acoustic metamaterials  

Science Journals Connector (OSTI)

We report a method to design and characterize broadband gradient index lenses. The lenses are based on two?dimensional sonic crystals which are periodic arrangements of elastic cylinders embedded in air. It will be shown that gradient index sonic lenses built with rigid cylinders are more powerful than conventionally curved lenses. We also demonstrate that the designing possibilities increased by considering the mixture of two types of cylinders in the sonic crystal. So a gradient index lens with zero reflectance at the surface is proposed by employing a mixture of aerogel and rigid cylinders. Finally a multiple scatteringtheory has been employed to compare the performance of conventionally curved lenses and gradient index lenses. [Work supported by MEC of Spain and GVA of Valencia.

Jos Snchez?Dehesa; Daniel Torrent



Wind Alliance Group | Open Energy Information  

Open Energy Info (EERE)

Alliance Group Alliance Group Place Valencia, Spain Sector Wind energy Product Spanish wind developer with subsidiaries throughout emerging Europe Coordinates 39.468791°, -0.376913° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.468791,"lon":-0.376913,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Solar Radiation Mapping from NOAA AVHRR Data in Catalonia, Spain  

Science Journals Connector (OSTI)

A statistical model is presented for the determination of hourly global solar radiation from the National Oceanic and Atmospheric Administration advanced very high resolution radiometer (NOAA AVHRR) satellite data, which provide wide coverage ...

Henry Flores Tovar; Jose M. Baldasano



http://ifisc.uib.es -Mallorca -Spain BIOSIM: BIOSIMULATION  

E-Print Network [OSTI]

.; Mirasso, C.R.. Coherent regimes of mutually coupled Chua's circuits. Physical Review E 73, 036203 (1, Pere. Theory of collective firing induced by noise or diversity in excitable media. Physical Review E. # Tessone, C.J.; Zanette, D.H. ; Toral R.. Global firing induced by network disorder in ensembles of active

Oro, Daniel


21F.740 The New Spain: 1977-Present, Fall 2005  

E-Print Network [OSTI]

This course deals with the vast changes in Spanish social, political, and cultural life that have taken place since the death of Franco. It examines the new freedom from censorship; the re-emergence of strong movements for ...

Resnick, Margery


Mirrors and Echoes: Women's Writing in Twentieth-Century Spain  

E-Print Network [OSTI]

Centering of the Swimming Pool. Romance Studies 22.1 (Niche and into the Swimming Pool: The Transformation of theGlass Niche and into the Swimming Pool The Transformation of

Bergmann, Emilie L.; Herr, Richard



Daily Air Temperature and Electricity Load in Spain  

Science Journals Connector (OSTI)

Weather has a significant impact on different sectors of the economy. One of the most sensitive is the electricity market, because power demand is linked to several weather variables, mainly the air temperature. This work analyzes the ...

Enric Valor; Vicente Meneu; Vicente Caselles



Spain in the frame for Europe's bid to host  

E-Print Network [OSTI]

­110; 2003). Hans von Storch,a coastal researcher at the GKSS,an environmental research centre in Geesthacht


Supply chain network for hydrogen transportation in Spain  

E-Print Network [OSTI]

Hydrogen fuel is considered one of the major emerging renewable substitutes for fossil fuel. A crucial factor as to whether hydrogen will be successful depends on its cost as a substitute. Recently, there has been a growing ...

Liang, Li



2011 University of Castilla la ManCha toledo, spain  

E-Print Network [OSTI]

Change Applications Session A3: Best Management Practices Session F3: Urban Processes and Management Scale Applications Session I4: Hydrology Session B2: Environmental Applications Session G2: Best.m. Discussion & Wrap Up 10:50 a.m. - 12:35 p.m. session a3 - Best management Practices (BmPs) moderator: C


Spanish Research Centre for Energy Environment and Technology CIEMAT | Open  

Open Energy Info (EERE)

Energy Environment and Technology CIEMAT Energy Environment and Technology CIEMAT Jump to: navigation, search Name Spanish Research Centre for Energy, Environment and Technology (CIEMAT) Place Madrid, Spain Zip 28040 Sector Solar, Wind energy Product CIEMAT, a Research Public Institution attached to the Ministry of Education and Science, is actively working on the research projects for PEM fuel cell, biofuel, solar and wind power. References Spanish Research Centre for Energy, Environment and Technology (CIEMAT)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Spanish Research Centre for Energy, Environment and Technology (CIEMAT) is a company located in Madrid, Spain . References ↑ "Spanish Research Centre for Energy, Environment and


Dyn Energia | Open Energy Information  

Open Energy Info (EERE)

Dyn Energia Dyn Energia Jump to: navigation, search Name Dyn Energia Place Albacete, Spain Zip 2001 Sector Solar Product Spanish-based energy consultants. Own and operate at least one solar PV plant in Albacete, Spain Coordinates 38.995067°, -1.854061° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.995067,"lon":-1.854061,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fire Energy S L | Open Energy Information  

Open Energy Info (EERE)

Fire Energy S L Fire Energy S L Jump to: navigation, search Name Fire Energy, S.L. Place Madrid, Spain Zip 28806 Sector Solar Product Solar power developer and distributor based in Spain. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Enertis Solar SL | Open Energy Information  

Open Energy Info (EERE)

Enertis Solar SL Enertis Solar SL Jump to: navigation, search Name Enertis Solar SL Place Madrid, Spain Zip 28703 Product Spain-based technical consultancy for PV projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Normawind S L | Open Energy Information  

Open Energy Info (EERE)

Normawind S L Normawind S L Jump to: navigation, search Name Normawind, S.L. Place Barcelona, Spain Zip 8006 Sector Wind energy Product Barcelona-based wind consultancy. References Normawind, S.L.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Normawind, S.L. is a company located in Barcelona, Spain . References ↑ "Normawind, S.L." Retrieved from "http://en.openei.org/w/index.php?title=Normawind_S_L&oldid=349287" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation:


SICE Renovables SL | Open Energy Information  

Open Energy Info (EERE)

SICE Renovables SL SICE Renovables SL Jump to: navigation, search Name SICE Renovables SL Place Madrid, Spain Zip 28050 Sector Services Product Madrid-based firm providing technical consultancy and engineering services for PV projects in Spain. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sinae Energia | Open Energy Information  

Open Energy Info (EERE)

Sinae Energia Sinae Energia Jump to: navigation, search Name Sinae Energia Place Madrid, Spain Zip 28033 Sector Renewable Energy, Services Product Spanish renewable energy and environmental services company. References Sinae Energia[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Sinae Energia is a company located in Madrid, Spain . References ↑ "Sinae Energia" Retrieved from "http://en.openei.org/w/index.php?title=Sinae_Energia&oldid=351104" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)


Spanish Hydrogen Association AeH | Open Energy Information  

Open Energy Info (EERE)

Hydrogen Association AeH Hydrogen Association AeH Jump to: navigation, search Name Spanish Hydrogen Association (AeH) Place Madrid, Spain Zip 28760 Sector Hydro, Hydrogen Product Spanish conference organiser and industry association for the hydrogen and fuel cell sectors. References Spanish Hydrogen Association (AeH)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Spanish Hydrogen Association (AeH) is a company located in Madrid, Spain . References ↑ "Spanish Hydrogen Association (AeH)" Retrieved from "http://en.openei.org/w/index.php?title=Spanish_Hydrogen_Association_AeH&oldid=351599" Categories: Clean Energy Organizations Companies Organizations Stubs What links here


Solynova Energia | Open Energy Information  

Open Energy Info (EERE)

Solynova Energia Solynova Energia Jump to: navigation, search Name Solynova Energia Place Madrid, Spain Zip 28023 Sector Solar Product SOLYNOVA ENERGIA, S.A. helps to develop photovoltaic solar energy and low temperature thermal solar energy. References Solynova Energia[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solynova Energia is a company located in Madrid, Spain . References ↑ "Solynova Energia" Retrieved from "http://en.openei.org/w/index.php?title=Solynova_Energia&oldid=351535" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties About us Disclaimers

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Grupo Activos | Open Energy Information  

Open Energy Info (EERE)

Grupo Activos Grupo Activos Jump to: navigation, search Name Grupo Activos Place Barcelona, Spain Zip 8022 Product Spanish biodiesel producer. References Grupo Activos[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Grupo Activos is a company located in Barcelona, Spain . References ↑ "Grupo Activos" Retrieved from "http://en.openei.org/w/index.php?title=Grupo_Activos&oldid=346151" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 1863371125 Varnish cache server


Anbelo Solar | Open Energy Information  

Open Energy Info (EERE)

Anbelo Solar Anbelo Solar Jump to: navigation, search Name Anbelo Solar Place Albacete, Spain Zip 2002 Product Spanish PV project developer working mostly in the provinces of Murcia and Albacete. References Anbelo Solar[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Anbelo Solar is a company located in Albacete, Spain . References ↑ "Anbelo Solar" Retrieved from "http://en.openei.org/w/index.php?title=Anbelo_Solar&oldid=342175" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load)


Cobra Instalaciones y Servicios S A | Open Energy Information  

Open Energy Info (EERE)

Cobra Instalaciones y Servicios S A Cobra Instalaciones y Servicios S A Jump to: navigation, search Name Cobra Instalaciones y Servicios S.A. Place Madrid, Spain Zip 28036 Product A subsidiary of ACS, founded in 1944, operating in the service sector, energy and water distribution networks, telecommunications, railways, industrial systems and energy projects. References Cobra Instalaciones y Servicios S.A.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Cobra Instalaciones y Servicios S.A. is a company located in Madrid, Spain . References ↑ "Cobra Instalaciones y Servicios S.A." Retrieved from "http://en.openei.org/w/index.php?title=Cobra_Instalaciones_y_Servicios_S_A&oldid=343757"


InfoPower | Open Energy Information  

Open Energy Info (EERE)

InfoPower InfoPower Jump to: navigation, search Name InfoPower Place Madrid, Spain Zip 28039 Product Information provider for the power sector in Spain Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Berge | Open Energy Information  

Open Energy Info (EERE)

Berge Berge Jump to: navigation, search Name Grupo Berge Place Madrid, Spain Zip 28002 Sector Services Product Grupo Bergé engages in distribution, logistic and services to the automobile industry in Spain. The group is affiliated with Isofoton, a manufacturer of PV and Thermal technology. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FerroAtlantica | Open Energy Information  

Open Energy Info (EERE)

FerroAtlantica FerroAtlantica Jump to: navigation, search Name FerroAtlantica Place Madrid, Spain Zip 28046 Product Spain-based silicon metal producer. FerroAtlantica is a supplier of silicon PV components. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Urbas | Open Energy Information  

Open Energy Info (EERE)

Urbas Urbas Jump to: navigation, search Name Grupo Urbas Place Madrid, Spain Zip 28005 Product Spain-based real estate company. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vestas E lica S A U | Open Energy Information  

Open Energy Info (EERE)

E lica S A U E lica S A U Jump to: navigation, search Name Vestas Eólica S.A.U Place Madrid, Spain Zip 28046 Product Vestas' division based in Spain. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Affirma Energia Solar | Open Energy Information  

Open Energy Info (EERE)

Affirma Energia Solar Affirma Energia Solar Jump to: navigation, search Name Affirma Energia Solar Place Madrid, Spain Zip 28046 Sector Solar Product Spain-based that is involved with the engineering and development of solar projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Promociones Medioambientales Villafranquesa PMV | Open Energy Information  

Open Energy Info (EERE)

Promociones Medioambientales Villafranquesa PMV Promociones Medioambientales Villafranquesa PMV Jump to: navigation, search Name Promociones Medioambientales Villafranquesa (PMV) Place Villafranca de los Barros, Badajoz, Spain Zip 6220 Sector Biomass Product Provides technical consultancy in agricultural waste management focusing on biomass energy generation. References Promociones Medioambientales Villafranquesa (PMV)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Promociones Medioambientales Villafranquesa (PMV) is a company located in Villafranca de los Barros, Badajoz, Spain . References ↑ "Promociones Medioambientales Villafranquesa (PMV)" Retrieved from "http://en.openei.org/w/index.php?title=Promociones_Medioambientales_Villafranquesa_PMV&oldid=350001"


Tu Transformas | Open Energy Information  

Open Energy Info (EERE)

Tu Transformas Tu Transformas Jump to: navigation, search Name Tu Transformas Place Ovideo, Spain Zip 33002 Sector Carbon, Efficiency, Renewable Energy Product Tu Transformas is a Spain-based company with business practices in carbon management consultancy, renewable energy development, and turnkey energy efficiency implementation. Coordinates 26.882929°, -82.033585° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":26.882929,"lon":-82.033585,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gabriel Benmayor SA | Open Energy Information  

Open Energy Info (EERE)

Gabriel Benmayor SA Gabriel Benmayor SA Jump to: navigation, search Name Gabriel Benmayor SA Place Barcelona, Spain Zip 8110 Sector Solar Product Barcelona-based, manufacturer and distributor of solar inverters in Spain. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vestas Mediterranean A S | Open Energy Information  

Open Energy Info (EERE)

Mediterranean A S Mediterranean A S Jump to: navigation, search Name Vestas Mediterranean A/S Place Barcelona, Spain Zip 8017 Sector Services, Wind energy Product Barcelona-based Vestas subsidiary heading sales and after sales services for wind operations in the countries of France, Spain and Portugal. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fersa Energias Renovables SA | Open Energy Information  

Open Energy Info (EERE)

Fersa Energias Renovables SA Fersa Energias Renovables SA Jump to: navigation, search Name Fersa Energias Renovables SA Place Barcelona, Spain Zip BAR 08021 Sector Renewable Energy Product A Spain-based specialised power company focusing on renewable energy generation. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Becosa Energias Renovables SA | Open Energy Information  

Open Energy Info (EERE)

Becosa Energias Renovables SA Becosa Energias Renovables SA Jump to: navigation, search Name Becosa Energias Renovables SA Place Seville, Spain Zip 41092 Sector Biomass, Wind energy Product Spanish construction company, part of the Detea Group, which constructs biomass plants and wind projects. References Becosa Energias Renovables SA[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Becosa Energias Renovables SA is a company located in Seville, Spain . References ↑ "Becosa Energias Renovables SA" Retrieved from "http://en.openei.org/w/index.php?title=Becosa_Energias_Renovables_SA&oldid=342579" Categories: Clean Energy Organizations Companies Organizations Stubs What links here


Corporacion Eolica CESA SA | Open Energy Information  

Open Energy Info (EERE)

Corporacion Eolica CESA SA Corporacion Eolica CESA SA Jump to: navigation, search Name Corporacion Eolica CESA SA Place Madrid, Spain Zip 28036 Sector Wind energy Product Project developer and wind farm operator. References Corporacion Eolica CESA SA[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Corporacion Eolica CESA SA is a company located in Madrid, Spain . References ↑ "Corporacion Eolica CESA SA" Retrieved from "http://en.openei.org/w/index.php?title=Corporacion_Eolica_CESA_SA&oldid=343923" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


Geserv | Open Energy Information  

Open Energy Info (EERE)

Geserv Geserv Jump to: navigation, search Name Geserv Place Madrid, Spain Zip 28037 Sector Renewable Energy, Services Product Spain-based power and elctricity company offering supply and management services. The firm is involved in renewable energy project development and installations. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ingeteam | Open Energy Information  

Open Energy Info (EERE)

Ingeteam Ingeteam Jump to: navigation, search Name Ingeteam Place Pamplona, Spain Zip 31008 Sector Biomass, Hydro, Renewable Energy, Solar, Wind energy Product Spain-based firm that develops and supplies control and regulation systems for renewable energy sources, particularly wind, solar, hydro-electric and biomass power. Coordinates 42.81275°, -1.643754° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.81275,"lon":-1.643754,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Soluciones Energeticas SA Solener | Open Energy Information  

Open Energy Info (EERE)

Soluciones Energeticas SA Solener Soluciones Energeticas SA Solener Jump to: navigation, search Name Soluciones Energeticas SA (Solener) Place Madrid, Spain Zip 28021 Sector Hydro, Wind energy Product Designs and manufactures inverters, charge controllers and control devices for PV systems, and micro wind (up to 20kW) and hydro (up to 5kW) turbines. References Soluciones Energeticas SA (Solener)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Soluciones Energeticas SA (Solener) is a company located in Madrid, Spain . References ↑ "Soluciones Energeticas SA (Solener)" Retrieved from "http://en.openei.org/w/index.php?title=Soluciones_Energeticas_SA_Solener&oldid=351524"


Aries Ingeniera y Sistemas SA | Open Energy Information  

Open Energy Info (EERE)

Aries Ingeniera y Sistemas SA Aries Ingeniera y Sistemas SA Jump to: navigation, search Name Aries Ingeniera y Sistemas SA Place Madrid, Spain Zip 28046 Sector Services, Wind energy Product Provides project management and engineering services to wind, STEG, PV, biofuel and fuel cell power plants. References Aries Ingeniera y Sistemas SA[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Aries Ingeniera y Sistemas SA is a company located in Madrid, Spain . References ↑ "Aries Ingeniera y Sistemas SA" Retrieved from "http://en.openei.org/w/index.php?title=Aries_Ingeniera_y_Sistemas_SA&oldid=342308" Categories: Clean Energy Organizations Companies Organizations Stubs What links here

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter


2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


Biblioteca Universitria-Novas Aquisies V. 6 N. 9 2014  

E-Print Network [OSTI]

.). Evaluación de sustentabilidad: un enfoque dinámico y multidimensional. 1. ed. Catarroja (Espanha): Valencia

Floeter, Sergio Ricardo


USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)


Wind Energy Resource Atlas of Armenia (CD-ROM)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...


Abraxa IFS | Open Energy Information  

Open Energy Info (EERE)

Abraxa IFS Abraxa IFS Jump to: navigation, search Name Abraxa IFS Place Madrid, Spain Zip 28001 Sector Renewable Energy Product Abraxa is a private equity firm with investments in photovoltaic and other renewable energy sources. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Enerpal | Open Energy Information  

Open Energy Info (EERE)

Enerpal Enerpal Jump to: navigation, search Name Grupo Enerpal Place Palencia, Spain Zip 34001 Sector Wind energy Product Spanish PV and wind power system installer and project developer. Coordinates 42.010434°, -4.539262° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.010434,"lon":-4.539262,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ASSET LOGISTIC AG | Open Energy Information  

Open Energy Info (EERE)

ASSET LOGISTIC AG ASSET LOGISTIC AG Jump to: navigation, search Name ASSET@LOGISTIC AG Place Hamburg, Hamburg, Germany Zip 20148 Sector Wind energy Product Developer of 3 wind farms in Almeria, Spain Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Isolux Corsan | Open Energy Information  

Open Energy Info (EERE)

Isolux Corsan Isolux Corsan Jump to: navigation, search Name Isolux Corsan Place Madrid, Spain Zip 28010 Sector Solar Product Engineering and construction group, involved in biodiesel production and solar project development. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Barlovento Natural Resources | Open Energy Information  

Open Energy Info (EERE)

Barlovento Natural Resources Barlovento Natural Resources Jump to: navigation, search Name Barlovento Natural Resources Place Logrono, Spain Zip 26005 Sector Solar, Wind energy Product Technical consulting in the wind and solar energy sector. Coordinates 42.46528°, -2.446179° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.46528,"lon":-2.446179,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo San Jose | Open Energy Information  

Open Energy Info (EERE)

San Jose San Jose Place Madrid, Spain Zip 28760 Sector Solar, Wind energy Product Madrid based company which develops several projects including wind and solar. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MADE Tecnolog as Renovables | Open Energy Information  

Open Energy Info (EERE)

MADE Tecnolog as Renovables MADE Tecnolog as Renovables Jump to: navigation, search Name MADE TecnologÃ-as Renovables Place Madrid, Spain Zip 28046 Sector Solar Product Activities are focused on designing and manufacturing aerogenerators and solar collectors. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ACS | Open Energy Information  

Open Energy Info (EERE)

ACS ACS Jump to: navigation, search Name ACS Place Madrid, Spain Zip 28036 Sector Solar Product Madrid based construction company involved in the development of solar thermal projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Pasch y Cia SA | Open Energy Information  

Open Energy Info (EERE)

Pasch y Cia SA Pasch y Cia SA Jump to: navigation, search Name Pasch y Cia SA Place Madrid, Spain Zip 28020 Product Supplies and maintains industrial equipment for the marine, power generation and railway sectors. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Pevafersa | Open Energy Information  

Open Energy Info (EERE)

Pevafersa Pevafersa Jump to: navigation, search Name Grupo Pevafersa Place Zamora, Spain Zip 49800 Sector Services, Solar Product Develops PV projects, assembles modules, produces a tracking system for PV projects, and offers solar consultancy services. Coordinates 38.79435°, -121.895814° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.79435,"lon":-121.895814,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Naturener SA | Open Energy Information  

Open Energy Info (EERE)

Naturener SA Naturener SA Place Madrid, Spain Zip E-28006 Sector Hydro, Solar, Wind energy Product Spanish-based on-grid generator active in the hydro, wind, and solar sectors. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cadmos | Open Energy Information  

Open Energy Info (EERE)

Cadmos Cadmos Jump to: navigation, search Name Cadmos Place Madrid, Spain Zip 28001 Product Madrid-based vertically integrated PV company. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Capital Energy SL | Open Energy Information  

Open Energy Info (EERE)

Energy SL Energy SL Place Madrid, Spain Zip 28016 Sector Solar, Wind energy Product Offshore wind farm, solar and biodiesel plant developer. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Taiga Mistral | Open Energy Information  

Open Energy Info (EERE)

Taiga Mistral Taiga Mistral Jump to: navigation, search Name Taiga Mistral Place Madrid, Spain Zip 28023 Sector Wind energy Product Registered in Madrid, this Spanish-based investment-vehicle uses it funds to support the construction and enlargement of wind farms in Poland. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Turtle Airships | Open Energy Information  

Open Energy Info (EERE)

Airships Airships Jump to: navigation, search Name Turtle Airships Place Silla, Spain Zip 46460 Sector Solar Product Developing a rigid, helium-filled airship which is to run on solar power with backup engines; as of June 2008, had begun construction of a demonstration model. Coordinates 39.368555°, -0.417859° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.368555,"lon":-0.417859,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DISOLARFV Energia SL | Open Energy Information  

Open Energy Info (EERE)

DISOLARFV Energia SL DISOLARFV Energia SL Jump to: navigation, search Name DISOLARFV Energia SL Place Valladolid, Spain Zip 47014 Sector Solar Product Valladolid - based solar PV developer. Coordinates 41.654195°, -4.732124° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.654195,"lon":-4.732124,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hidroflot | Open Energy Information  

Open Energy Info (EERE)

Hidroflot Hidroflot Place Barcelona, Spain Zip 8107 Product Barcelona based developer of wave energy generation devices. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wattpic | Open Energy Information  

Open Energy Info (EERE)

Wattpic Wattpic Jump to: navigation, search Name Wattpic Place Barcelona, Spain Zip 8018 Sector Solar Product Conducting undisclosed research in the solar sector. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Windiberica | Open Energy Information  

Open Energy Info (EERE)

Windiberica Windiberica Jump to: navigation, search Name Windiberica Place Sevilla, Spain Zip 41018 Sector Wind energy Product Promoter of wind farms Coordinates 37.387697°, -6.001813° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.387697,"lon":-6.001813,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Abastecimientos Energeticos SL Abaste | Open Energy Information  

Open Energy Info (EERE)

Abastecimientos Energeticos SL Abaste Abastecimientos Energeticos SL Abaste Jump to: navigation, search Name Abastecimientos Energeticos SL (Abaste) Place Madrid, Spain Zip 28020 Sector Solar Product Solar project developer. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bio Oils Energy | Open Energy Information  

Open Energy Info (EERE)

Oils Energy Oils Energy Jump to: navigation, search Name Bio-Oils Energy Place Madrid, Spain Zip 28010 Sector Biofuels Product Madrid-based biofuels producer with plans to build a 500-tonne plant in Huelva. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Prointec SA | Open Energy Information  

Open Energy Info (EERE)

Prointec SA Prointec SA Jump to: navigation, search Name Prointec SA Place Madrid, Spain Zip 28036 Product Diversified engineering company who also builds RE projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ost Energy | Open Energy Information  

Open Energy Info (EERE)

Ost Energy Ost Energy Jump to: navigation, search Name Ost Energy Place London, United Kingdom Zip NW11 7TJ Product Provides engineering and technical consultancy for PV and STEG projects in Italy and Spain. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Arranz Acinas | Open Energy Information  

Open Energy Info (EERE)

Arranz Acinas Arranz Acinas Jump to: navigation, search Name Grupo Arranz Acinas Place Burgos, Spain Zip 9004 Sector Biomass, Renewable Energy, Solar, Wind energy Product String representation "Arranz Acinas i ... sota and Texas." is too long. Coordinates 42.341082°, -3.69981° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.341082,"lon":-3.69981,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energia Ercam SA | Open Energy Information  

Open Energy Info (EERE)

Ercam SA Ercam SA Jump to: navigation, search Name Energia Ercam SA Place Guadalajara, Spain Zip 19171 Sector Solar Product Builds a dual axis tracking system for solar plants. Coordinates 20.68759°, -103.351074° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":20.68759,"lon":-103.351074,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Terranova Energy Corp | Open Energy Information  

Open Energy Info (EERE)

Terranova Energy Corp Terranova Energy Corp Jump to: navigation, search Name Terranova Energy Corp Place Barcelona, Spain Zip 8034 Sector Wind energy Product Spanish wind developer with projects in Asturia,Catalunya and Galicia. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Abengoa Bioenergia SL | Open Energy Information  

Open Energy Info (EERE)

Abengoa Bioenergia SL Abengoa Bioenergia SL Place Seville, Spain Zip 41018 Product A biodiesel production and a plant operation company within the European market as a part of Abengoa group. Coordinates 37.387697°, -6.001813° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.387697,"lon":-6.001813,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Karpatok Tech SL | Open Energy Information  

Open Energy Info (EERE)

Karpatok Tech SL Karpatok Tech SL Jump to: navigation, search Name Karpatok Tech SL. Place Segovia, Spain Zip 40100 Sector Solar Product Segovia - based solar project developer. Coordinates 40.94821°, -4.116359° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.94821,"lon":-4.116359,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gestamp Asetym SA | Open Energy Information  

Open Energy Info (EERE)

Asetym SA Asetym SA Jump to: navigation, search Name Gestamp Asetym SA Place Madrid, Spain Zip 25760 Sector Renewable Energy Product A Spanish construction and engineering company, with activities in renewable energy projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Aldesa | Open Energy Information  

Open Energy Info (EERE)

Aldesa Aldesa Jump to: navigation, search Name Grupo Aldesa Place Madrid, Spain Zip 28042 Product Spanish construction group. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Abengoa SA | Open Energy Information  

Open Energy Info (EERE)

SA SA Jump to: navigation, search Name Abengoa SA Place Seville, Spain Zip 41018 Sector Bioenergy, Solar Product Construction, biofuel, solar and power company - parent of Abengoa Bioenergia, Abengoa Bioenergy Corp, and Solucar. Coordinates 37.387697°, -6.001813° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.387697,"lon":-6.001813,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eres | Open Energy Information  

Open Energy Info (EERE)

Eres Eres Jump to: navigation, search Name Eres Place Málaga, Spain Zip 29590 Sector Solar, Wind energy Product Eres develops solar and wind projects, from planning to the construction of the plants. Coordinates 56.68073°, -5.867574° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.68073,"lon":-5.867574,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Renovalia Energy | Open Energy Information  

Open Energy Info (EERE)

Renovalia Energy Renovalia Energy Jump to: navigation, search Name Renovalia Energy Place Madrid, Spain Zip 28006 Sector Hydro, Solar, Wind energy Product Madrid-based developer of solar, small hydro and wind projects in Europe, Central and North America. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fotosolar | Open Energy Information  

Open Energy Info (EERE)

Fotosolar Fotosolar Jump to: navigation, search Name Fotosolar Place Madrid, Spain Zip 28006 Product Develops, constructs and maintains Spanish PV plants. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Grupo Cobra | Open Energy Information  

Open Energy Info (EERE)

Cobra Cobra Jump to: navigation, search Name Grupo Cobra Place Madrid, Spain Zip 28016 Sector Wind energy Product Madrid based who develops wind farms and cogeneration projetcs. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Esinfer SL | Open Energy Information  

Open Energy Info (EERE)

Esinfer SL Esinfer SL Jump to: navigation, search Name Esinfer SL Place Madrid, Spain Zip 28880 Product Spanish PV system installer. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


IESA | Open Energy Information  

Open Energy Info (EERE)

IESA IESA Jump to: navigation, search Name IESA Place Madrid, Spain Zip 28036 Sector Renewable Energy Product Madrid based clean energy investment company. Joint owners with EHN of Iniciativas Energéticas Renovables, renewable energy project in Navarre, and the Eolica de Villanueva project also with EHN. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FRV formerly Fotowatio Energia Solar SL | Open Energy Information  

Open Energy Info (EERE)

Fotowatio Energia Solar SL Fotowatio Energia Solar SL Jump to: navigation, search Name FRV (formerly Fotowatio Energia Solar SL) Place Madrid, Spain Zip 28010 Sector Renewable Energy Product Spanish company planning to acquire, own and operate renewable energy projects, particularly PV projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Abantia | Open Energy Information  

Open Energy Info (EERE)

Grupo Abantia Grupo Abantia Jump to: navigation, search Name Grupo Abantia Place Barcelona, Spain Zip 8028 Product A Spanish construction company with a 100% daughter, called Abantia Sun Energy, who develops PV projects. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ra Solar Systems Solutions SL | Open Energy Information  

Open Energy Info (EERE)

Ra Solar Systems Solutions SL Ra Solar Systems Solutions SL Jump to: navigation, search Name Ra Solar Systems & Solutions SL Place Madrid, Spain Zip 28033 Sector Solar Product Spanish project developer and finance arranger for large-scale solar farms; also acts as distributors for complete PV systems and components. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Proener SL | Open Energy Information  

Open Energy Info (EERE)

Proener SL Proener SL Jump to: navigation, search Name Grupo Proener SL Place Madrid, Spain Zip 28109 Sector Renewable Energy Product A Spanish construction and engineering company, specialised in energy renewable energy and industrial installations. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sener SA | Open Energy Information  

Open Energy Info (EERE)

Sener SA Sener SA Jump to: navigation, search Name Sener SA Place Madrid, Spain Zip 28760 Sector Solar Product Engineering firm with experience in solar thermal electricity generation (STEG) technology since 1956, developing a tower and heliostat technology with molten salt thermal storage, and planning a project using this. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Acciona Biofuels | Open Energy Information  

Open Energy Info (EERE)

Acciona Biofuels Acciona Biofuels Jump to: navigation, search Name Acciona Biofuels Place Pamplona, Spain Zip 31002 Product A subsidiary of Acciona Energia, that specialises in the technological development of biofuel technology and power plants. Coordinates 42.81275°, -1.643754° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.81275,"lon":-1.643754,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Prosolmed SA | Open Energy Information  

Open Energy Info (EERE)

Prosolmed SA Prosolmed SA Jump to: navigation, search Name Prosolmed SA Place Barcelona, Spain Zip 8297 Sector Solar Product Solar project developer and equipment distributor. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Proyecciones Solares SL | Open Energy Information  

Open Energy Info (EERE)

Proyecciones Solares SL Proyecciones Solares SL Jump to: navigation, search Name Proyecciones Solares SL Place Madrid, Spain Zip 28007 Sector Solar Product A Spanish engineering company specialised in PV and solar passive system installation. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ecotecnia | Open Energy Information  

Open Energy Info (EERE)

Ecotecnia Ecotecnia Jump to: navigation, search Name Ecotecnia Place Barcelona, Spain Zip 8005 Sector Solar, Wind energy Product Spanish wind turbine manufacturer, wind park developer, and solar project developer. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Dalkia Solar | Open Energy Information  

Open Energy Info (EERE)

Solar Solar Jump to: navigation, search Name Dalkia Solar Place Agullent, Spain Zip 46890 Sector Solar Product Agullent-based installer of photovoltaic and solar thermal power plants. Coordinates 38.824755°, -0.547039° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.824755,"lon":-0.547039,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Montebalito SA | Open Energy Information  

Open Energy Info (EERE)

Montebalito SA Montebalito SA Jump to: navigation, search Name Montebalito SA Place Madrid, Spain Zip 28006 Sector Renewable Energy Product Develops renewable energy parks and is involved in real estate development. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GA Solar | Open Energy Information  

Open Energy Info (EERE)

Solar Solar Jump to: navigation, search Name GA-Solar Place Madrid, Spain Zip 28045 Sector Solar Product Madrid based solar project developer, owned by Spanish industrial group Corporacion Gestamp. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gestamp Biotermica | Open Energy Information  

Open Energy Info (EERE)

Biotermica Biotermica Jump to: navigation, search Name Gestamp Biotermica Place Madrid, Spain Zip 28045 Sector Biomass, Solar Product Biothermica is the company within gestamp dealing with products on the Biomass/Solar side. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Iberdrola Ingenieria y Construccion IBERINCO | Open Energy Information  

Open Energy Info (EERE)

Ingenieria y Construccion IBERINCO Ingenieria y Construccion IBERINCO Jump to: navigation, search Name Iberdrola Ingenieria y Construccion (IBERINCO) Place Madrid, Spain Zip 28036 Sector Services Product Offers services such as identification, development, resource assessment, and turnkey-based projects for Iberdrola Group. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Acciona Energia | Open Energy Information  

Open Energy Info (EERE)

Acciona Energia Acciona Energia Jump to: navigation, search Name Acciona Energia Place Sarriguren, Spain Zip 31621 Sector Biomass, Hydro, Solar, Wind energy Product Sarriguren-based active developer of wind power projects, but also acting in the biomass & waste, mini-hydro, & solar sectors and is a subsidiary of Acciona SA. Coordinates 42.812901°, -1.59779° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.812901,"lon":-1.59779,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Elecnor Group | Open Energy Information  

Open Energy Info (EERE)

Elecnor Group Elecnor Group Jump to: navigation, search Name Elecnor Group Place Madrid, Spain Zip 28003 Product Engineering conglomerate - specialises in promotion and project administration for energy generation, electricity, installations, gas, telecoms, rail, the environment and water projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Samca | Open Energy Information  

Open Energy Info (EERE)

Samca Samca Jump to: navigation, search Name Grupo Samca Place Zaragoza, Spain Zip ES 50001 Sector Wind energy Product Family-owned group with numerous interests including wind farms and STEG project development - plans "400MW of STEG projects" as of July 2008. Coordinates 41.65173°, -0.881319° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.65173,"lon":-0.881319,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Jayme da Costa | Open Energy Information  

Open Energy Info (EERE)

Jayme da Costa Jayme da Costa Jump to: navigation, search Name Jayme da Costa Place Grijo, Portugal Zip 4416-901 Sector Hydro, Solar, Wind energy Product Electrical goods manufacturer that is developing and building wind, solar and hydro projects in Portugal and wind projects in Spain. Coordinates 40.875332°, -7.92343° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.875332,"lon":-7.92343,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gadir Solar | Open Energy Information  

Open Energy Info (EERE)

Gadir Solar Gadir Solar Jump to: navigation, search Name Gadir Solar Place Madrid, Spain Zip 28001 Product Madrid-based manufacturer of thin-film silicon PV modules. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Acciona SA | Open Energy Information  

Open Energy Info (EERE)

SA SA Jump to: navigation, search Name Acciona SA Place Madrid, Spain Zip 20108 Sector Biofuels, Biomass, Hydro, Solar, Wind energy Product Madrid-headquartered company that specialises in infrastructure, civil engineering, & construction. Active in clean energy as a developer & operator of biofuels, biomass & waste, mini-hydro, solar, & wind projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Urbaenerg a S A | Open Energy Information  

Open Energy Info (EERE)

Urbaenerg a S A Urbaenerg a S A Jump to: navigation, search Name UrbaenergÃ-a S.A. Place Madrid, Spain Zip 28700 Sector Wind energy Product Developing a 50MW Teso Santo wind project near the town of Santiz in Salamanca, Castilla y León. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eshia Energia SL | Open Energy Information  

Open Energy Info (EERE)

Eshia Energia SL Eshia Energia SL Jump to: navigation, search Name Eshia Energia SL Place Barcelona, Spain Zip 8930 Sector Solar, Wind energy Product Manufacturer of on-board wind and solar systems Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vendaval Promociones Eolicas | Open Energy Information  

Open Energy Info (EERE)

Vendaval Promociones Eolicas Vendaval Promociones Eolicas Jump to: navigation, search Name Vendaval Promociones Eolicas Place Barcelona, Spain Zip 8005 Product A wholly-owned subsidiary of Ecotecnia. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Solartec Daxer S L SOLARTEX | Open Energy Information  

Open Energy Info (EERE)

Solartec Daxer S L SOLARTEX Solartec Daxer S L SOLARTEX Jump to: navigation, search Name Solartec Daxer S.L. (SOLARTEX) Place Granada, Spain Zip 18014 Sector Solar Product SOLARTEX plans and installs thermal solar systems, photovoltaic solar systems, air-conditioning systems and heating systems. Coordinates 37.170398°, -3.605426° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.170398,"lon":-3.605426,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Prime Solar Senergy SL | Open Energy Information  

Open Energy Info (EERE)

Solar Senergy SL Solar Senergy SL Jump to: navigation, search Name Prime Solar Senergy SL Place Barcelona, Spain Zip 8021 Product Spanish project developer; obtains regulatory approvals and certifications in the European markets. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Generaciones Fotovoltaicas de la Mancha GFM | Open Energy Information  

Open Energy Info (EERE)

Generaciones Fotovoltaicas de la Mancha GFM Generaciones Fotovoltaicas de la Mancha GFM Jump to: navigation, search Name Generaciones Fotovoltaicas de la Mancha (GFM) Place Toledo, Spain Zip 45850 Sector Solar, Wind energy Product Spanish solar and wind system builder and project developer. Coordinates 46.440613°, -122.847838° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.440613,"lon":-122.847838,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mepsolar AG aka Munich Energy Partners | Open Energy Information  

Open Energy Info (EERE)

Mepsolar AG aka Munich Energy Partners Mepsolar AG aka Munich Energy Partners Jump to: navigation, search Name Mepsolar AG (aka Munich Energy Partners) Place Munich, Germany Zip 81829 Product Develops utility scale PV projects in Spain and Bulgaria and plans also to launch a PV direct selling business for residential customers. Coordinates 48.136415°, 11.577531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.136415,"lon":11.577531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rodesol SL | Open Energy Information  

Open Energy Info (EERE)

Rodesol SL Rodesol SL Jump to: navigation, search Name Rodesol SL Place Madrid, Spain Zip 28042 Product Spanish PV project developer. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Dhamma Energy | Open Energy Information  

Open Energy Info (EERE)

Dhamma Energy Dhamma Energy Jump to: navigation, search Name Dhamma Energy Place Madrid, Spain Zip 28001 Sector Solar Product Madrid-based solar project developer. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sustainable Investments Capital SI Capital | Open Energy Information  

Open Energy Info (EERE)

SI Capital SI Capital Jump to: navigation, search Name Sustainable Investments Capital (SI Capital) Place Barcelona, Spain Zip 8021 Sector Renewable Energy, Services Product SI Capital is an independent financial institution set up to develop investment products and services for renewable energy and other sustainable projects. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Texsa S A | Open Energy Information  

Open Energy Info (EERE)

Texsa S A Texsa S A Jump to: navigation, search Name Texsa S.A. Place Barcelona, Spain Zip 8755 Sector Solar Product Texsa sells various roofing products and has partnered with Colorado-based thin-film module maker Ascent Solar to develop built-in photovoltaic products. Coordinates 41.385589°, 2.168745° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.385589,"lon":2.168745,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Sylcom | Open Energy Information  

Open Energy Info (EERE)

Sylcom Sylcom Jump to: navigation, search Name Grupo Sylcom Place Madrid, Spain Zip 28021 Sector Services, Solar Product An IT and network company. Owns a subsidy called Slycom Solar that offers engineering consultant services to PV and STEG plants. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grupo Ibereolica | Open Energy Information  

Open Energy Info (EERE)

Ibereolica Ibereolica Jump to: navigation, search Name Grupo Ibereolica Place Madrid, Spain Zip 28009 Sector Solar, Wind energy Product Spanish solar and wind farm developer. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Abasol SA | Open Energy Information  

Open Energy Info (EERE)

Abasol SA Abasol SA Jump to: navigation, search Name Abasol SA Place Madrid, Spain Zip 28026 Sector Solar Product Engineering, design and development consultancy for solar projects. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DS Deutsche Solargesellschaft mbH | Open Energy Information  

Open Energy Info (EERE)

DS Deutsche Solargesellschaft mbH DS Deutsche Solargesellschaft mbH Jump to: navigation, search Name DS Deutsche Solargesellschaft mbH Place Heilbronn, Germany Zip 74074 Sector Solar Product DS Deutsche Solargesellschaft markets PV installations in Spain to mostly German private investors. Coordinates 49.143145°, 9.219295° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.143145,"lon":9.219295,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Himin Solar | Open Energy Information  

Open Energy Info (EERE)

Himin Solar Himin Solar Jump to: navigation, search Name Himin Solar Place Alicante, Spain Zip 3201 Sector Solar Product Manufacturing, planning, development and distribution of projects of solar energy products. Coordinates 38.344085°, -0.480474° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.344085,"lon":-0.480474,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Isofoton SA | Open Energy Information  

Open Energy Info (EERE)

Isofoton SA Isofoton SA Jump to: navigation, search Name Isofoton SA Place Madrid, Spain Zip 28014 Sector Solar Product A large Spanish manufacturer of PV wafers, cells and modules, as well as thermal solar energy solutions. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


9REN Group formerly Gamesa Solar | Open Energy Information  

Open Energy Info (EERE)

REN Group formerly Gamesa Solar REN Group formerly Gamesa Solar Jump to: navigation, search Name 9REN Group (formerly Gamesa Solar) Place Madrid, Spain Zip 28002 Sector Solar Product Spanish company active in PV and solar passive system installation and PV project development. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vade Solar SL | Open Energy Information  

Open Energy Info (EERE)

Vade Solar SL Vade Solar SL Jump to: navigation, search Name Vade Solar SL Place Tudela, Spain Zip 31500 Sector Solar Product Vade Solar is part of Canaliza Energia, a company created and to 50% owned by Caja Navarra. Coordinates 42.061925°, -1.602954° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.061925,"lon":-1.602954,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Acciona Windpower | Open Energy Information  

Open Energy Info (EERE)

Windpower Windpower Jump to: navigation, search Name Acciona Windpower Place Navarra, Spain Zip 31395 Sector Wind energy Product Navarra-headquartered manufacturer of 1.5MW & 3MW wind turbines that is a 100% subsidiary of Acciona Energia. Coordinates 42.612419°, -1.61172° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.612419,"lon":-1.61172,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Saclima | Open Energy Information  

Open Energy Info (EERE)

Saclima Saclima Jump to: navigation, search Name Saclima Place Alaquas, Spain Zip 46970 Sector Solar Product A Spanish distributer of solar passive and PV systems. Coordinates 39.454635°, -0.457844° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.454635,"lon":-0.457844,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Asociacion de la Industria Fotovoltaica ASIF | Open Energy Information  

Open Energy Info (EERE)

la Industria Fotovoltaica ASIF la Industria Fotovoltaica ASIF Jump to: navigation, search Name Asociacion de la Industria Fotovoltaica (ASIF) Place Madrid, Spain Zip 28002 Product Spanish Photovoltaic Industry Association. Coordinates 40.4203°, -3.705774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4203,"lon":-3.705774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Algasol Renewables SL | Open Energy Information  

Open Energy Info (EERE)

Algasol Renewables SL Algasol Renewables SL Jump to: navigation, search Name Algasol Renewables SL Place Baleares, Spain Zip E-07121 Sector Renewable Energy Product Newly started technology firm that will seek to use the photosynthetic capabilities of algae to generate renewable energy and other products. Coordinates 39.613529°, 2.91156° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.613529,"lon":2.91156,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Petroleum Supply Annual  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- - - - - - - - - - Portugal ... - - - - - - - - - - Russia ... - - - 7,489 - - - - - - Spain ......


Late Quaternary climate change from delta 13O records of multiple species of planktonic foraminifera: High-resolution records from the Anoxic Cariaco Basin, Venezuela  

E-Print Network [OSTI]

the Lake Valencia Basin, Venezuela, Ecology, 66, 1279-1295,1954. waters of eastern Venezuela, Bol. Inst. Oceanogr.Los foraminiferos de Venezuela (resumen), Acta Geol. Hisp. ,

Lin, Hui-Ling; Peterson, Larry C; Overpeck, Jonathan T; Trumbore, Susan E; Murray, David W



Evaluacin de la generacin de gases de efecto invernadero asociados al ciclo de vida de los biocombustibles colombianos = Assessment of greenhouse gases emissions associated to colombian biofuels lifecycle.  

E-Print Network [OSTI]

??Valencia Botero, Monica Julieth (2012) Evaluacin de la generacin de gases de efecto invernadero asociados al ciclo de vida de los biocombustibles colombianos = Assessment (more)

Valencia Botero, Monica Julieth



Action Plan Food Science and  

E-Print Network [OSTI]

Agroquímica y Tecnolo- gía de Alimentos (Institute of Agrochemicals and Food Technology) in Valencia. During

Fitze, Patrick


Environmental Determinants of the Occurrence and Distribution of Vibrio parahaemolyticus in the Rias of Galicia, Spain  

Science Journals Connector (OSTI)

...southeast) or no wind (calm). Wind speed was measured as kilometers...gov/products/las/docs/wind_calc_details.html#interp...Ambient temperature, rain, wind, hours of sunshine, and rainfall...with the following settings: power, 2 (Euclidean distance...

Jaime Martinez-Urtaza; Antonio Lozano-Leon; Jose Varela-Pet; Joaquin Trinanes; Yolanda Pazos; Oscar Garcia-Martin



2010 Robotics: Science and Systems June 27-31, 2010, Zaragoza, Spain  

E-Print Network [OSTI]

wheeled inverted pendulum, are also presented. I. INTRODUCTION Underactuated mechanical systems underactuated systems used in controls research include Acrobot, Pendubot, Cart-Pole, Beam-Ball and Rotating of underactuated systems. They include wheeled robots like Segway [2], ballbots [3] and legged robots like Big


Concentrations and activity ratios of uranium isotopes in groundwater from Donana National Park, South of Spain  

SciTech Connect (OSTI)

The levels and distribution of natural radionuclides in groundwaters from the unconfined Almonte-Marismas aquifer, upon which Donana National Park is located, have been analysed. Most sampled points were multiple piezometers trying to study the vertical distribution of the hydrogeochemical characteristics in the aquifer. Temperature, pH, electrical conductivity, dissolved oxygen and redox potential were determined in the field. A large number of parameters, physico-chemical properties, major and minor ions, trace elements and natural radionuclides (U-isotopes, Th-isotopes, Ra-isotopes and {sup 210}Po), were also analysed. In the southern zone, where aeolian sands crop out, water composition is of the sodium chloride type, and the lower U-isotopes concentrations have been obtained. As water circulates through the aquifer, bicarbonate and calcium concentrations increase slightly, and higher radionuclides concentrations were measured. Finally, we have demonstrated that {sup 234}U/{sup 238}U activity ratios can be used as markers of the type of groundwater and bedrock, as it has been the case for old waters with marine origin confined by a marsh in the south-east part of aquifer.

Bolivar, J. P.; Olias, M.; Gonzalez-Garcia, F. [Department of Applied Physics, University of Huelva, Campus de El Carmen, 21071-Huelva (Spain); Garcia-Tenorio, R. [Department of Applied Physics II, University of Sevilla, ETSA Arquitectura, 41012-Sevilla (Spain)



Human MutationSPECIAL ARTICLE Planning the Human Variome Project: The Spain Report  

E-Print Network [OSTI]

-da-Silva-Lopes,50 Finlay A. Macrae,51 Donna Maglott,52 Makia J. Marafie,53 Steven G.E. Marsh,54 Yoichi Matsubara,55 Parboosingh,65 George P. Patrinos,66 Giuditta Perozzi,67 Ian R. Phillips,68 Sue Povey,34 Suyash Prasad,69 Ming. Smith,2 Mari´a-Jesu´s Sobrido,80 Toshihiro Tanaka,81 Sean V. Tavtigian,82 Graham R. Taylor,83 Jon Teague


Analysis of a superbolide from a damocloid observed over Spain on 2012 July 13  

Science Journals Connector (OSTI)

......Halley-family and long-period comets and, so, they are depleted...considered. According to this, the landing point would be located around...proportions close to those found for comet 1P/Halley, but some small...meteorites was considered and their landing point was calculated. Several......

Jos M. Madiedo; Josep M. Trigo-Rodrguez; Jaime Zamorano; Jos L. Ortiz; Alejandro Snchez de Miguel; Francisco Ocaa; Jaime Izquierdo; Alberto J. Castro-Tirado; Nicols Morales; David Galad; Enrique de Guindos; Juan Lacruz; Faustino Organero; Leonor Ana-Hernndez; Fernando Fonseca; Mar Tapia; Felipe Gallego; Jess Cabrera-Cao



A new Lower Pleistocene archeological site in Europe (Vallparads, Barcelona, Spain)  

Science Journals Connector (OSTI)

...electron spin resonance-uranium series (ESR-US) readings...extended to a new knapping plan, polyhedrical and cubical forms were...Lower Pleistocene and a review of the evidence for the first...spectrometry, according to the standard procedure described...H (1988) A test of Uranium-Series dating of fossil...

Kenneth Martnez; Joan Garcia; Eudald Carbonell; Jordi Agust; Jean-Jaques Bahain; Hugues-Alexandre Blain; Francesc Burjachs; Isabel Cceres; Mathieu Duval; Christophe Falgures; Manuel Gmez; Rosa Huguet



Traumatized subjects : horror film and the legacy of mass extermination in post-dictatorship Spain  

E-Print Network [OSTI]

the display in the shop window, and the films last line ofwindow, the most brilliant flash of color in the entire film.windows, which had been covered with curtains throughout the rest of the film.

Boehm, Scott Walter



Serotype 5 Pneumococci Causing Invasive Pneumococcal Disease Outbreaks in Barcelona, Spain (1997 to 2011)  

Science Journals Connector (OSTI)

...Dolores Quesada, and Carlos Rodrigo). We also thank Montserrat...Tamayo, M , R Sa-Leao, I Santos Sanches, E Castaneda, and...Dolores Quesada, and Carlos Rodrigo). We also thank Montserrat...26. Tamayo M, S -Le o R, Santos Sanches I, Casta eda E, de...

Dora Rolo; Asuncin Fenoll; Dionsia Fontanals; Nieves Larrosa; Montserrat Gimnez; Immaculada Grau; Romn Pallars; Josefina Liares; Carmen Ardanuy; the Serotype 5 Study Group



Designing new performance-based incentive regimes for operating contracts in the Province of Gipuzkoa, Spain  

E-Print Network [OSTI]

Over the last several decades, local transport authorities in Europe and around the world have introduced competitive bidding in concessions for providing bus service, often resulting in reduced costs for service. The main ...

Laidig, David Antonio



Empire's experts : the politics of knowledge in Spain's royal monopoly of quina (1751-1808)  

E-Print Network [OSTI]

Enlightenment Science and South America. Chicago: UniversityEnlightenment Science and South America, by Neil Safier.French territory in South America. 20 The order cited three

Crawford, Matthew James


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EAGE Conference & Exhibition incorporating SPE EUROPEC 2010 Barcelona, Spain, 14 -17 June 2010  

E-Print Network [OSTI]

-three are missing due to non-deposition or erosion in the latest Permian times. Broadly, anhydrite and halite


Science and Literary Culture during Spain's Edad de Plata (1923-1936)  

E-Print Network [OSTI]

Whitehead, Alfred North. Science and the Modern World. NewPostures: Literature, Science and the Two Cultures Debate.Critical Theory and Science Fiction. Hanover: Wesleyan

Hiller, Anna Eva



Application of a pedestrian portal monitor at Madrid International Airport in Spain  

Science Journals Connector (OSTI)

Three pedestrian portal monitor systems, designed to detect illicit trafficking or inadvertent movement of radioactive materials carried by passengers at airports, have been evaluated. The systems were supplied by three manufacturers: Bicron, Exploranium and Thermo-Eberline. In an initial evaluation, conducted at the Laboratory of Nuclear Engineering of the School of Civil Engineering, it was observed that the FHT-1372 system manufactured by Thermo-Eberline gave a more sensitive response and allowed the measurement of total photon dose rate and artificial photon dose rate. Therefore, this system was installed at Barajas International Airport in Madrid in 2002 for a period of 108 days in order to select an appropriate investigation level (defined as the radiation level that is selected as the trigger for further investigation). During this period 1,339,931 passengers were screened and a total of 39 alarms were triggered, 5 of which with a value 10 times the mean value of the natural background from photon radiation (which was 85nSv/h), and no alarms exceeded 100?Sv/h at 1m distance, which is the level of response for legal transport of radioactive materials set by the International Atomic Energy Agency (IAEA). An investigation level of approximately 1.3 times the natural background was finally selected. This value coincides with the results obtained in the ITRAP (Illicit Trafficking Radiation Detection Assessment Program) carried out by the IAEA.

Ll. Pujol; J.A. Gonzalez-Gonzalez; M.J. Suarez-Navarro



A Cross-Cultural Comparison of Electronic Government Adoption in Spain and the USA  

Science Journals Connector (OSTI)

Electronic Government (e-government) is growing in popularity across the globe. Given the increasing relevance of electronic services in the public sector, there is a need for a global agreement on a consistent framework for assessing e-government. This ... Keywords: Cross-Cultural Studies, E-Government, Public Marketing, Technology Adoption

Ramn Rufn, France Blanger, Cayetano Medina Molina, Lemuria Carter, Juan Carlos Snchez Figueroa



Diagenetic controls on porosity and permeability in Miocene carbonates, La Molata, Spain  

E-Print Network [OSTI]

and oxygen isotopes, Sr concentration and 87Sr/86Sr. The carbonate platform was extensively dolomitized at the end of the Miocene but before Pliocene deposition. Amount of dolomite increases basinward and down section; limestone is restricted to the most...

Li, Zhaoqi



E-Print Network 3.0 - association barcelona spain Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

| Study Abroad Program Summer Programs Course Syllabus- Barcelona: the City and its History... city in Europe," Barcelona enjoys the reputation of a cosmopolitan city with a...


Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

incentives given by transmission pricing form the foundationhas focussed on transmission pricing, monopoly regulation,

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris



Design and test results of a low-capacity solar cooling system in Alicante (Spain)  

Science Journals Connector (OSTI)

Despite its attractiveness, solar cooling technology is still in an early stage of development. Most installations currently in operation show differences in the collector area per kilowatt of cooling capacity that cannot be explained only by project-specific circumstances. The purpose of this paper was twofold. First, to answer some questions that came up during the design process of the plant by using a TRNSYS system model and statistical tools. Second, to gain knowledge about the plant operation and validate the TRNSYS model through measured data. The system was equipped with a flat-plate collector field of 38.4m2. A lithium bromide-water single-effect absorption chiller (17.6kW) was selected in order to provide chilled water to fan-coils. Performance data were registered at the solar plant working with a 1000-l heat storage tank and a required temperature of 80C to drive the absorption machine. An average of 29% of the solar energy incident on the solar collectors surface was transferred to the hot water storage. The registered average COP of the absorption chiller was 0.691. The performance data were compared with the values predicted by the TRNSYS plant model and a high level of agreement was obtained.

Pedro J. Martnez; Jos C. Martnez; Manuel Lucas



Can using a global perspective help control migration? : Ecuador and Spain's Proyecto Codesarrollo Canar-Murcia  

E-Print Network [OSTI]

process? Did you receive any help in the reintegrationUsing a Global Perspective Help Control Migration? Ecuadortheir time and hospitality to help me with my research while

Velasquez, Christina L.



Zarzuela : or lyric theatre as consumer nationalism in Spain, 1874-1930  

E-Print Network [OSTI]

French farce Miss Helyet. It received mixed reviews, with the critics praising the music but taking broad

Young, Clinton David



Design Optimization International Conference, April 5 -April 7 2005, Las Palmas, Spain,  

E-Print Network [OSTI]

Analysis, Product Line E1, Volkswagen AG, Wolfsburg Key words: Automatic Differentiation, Optimisation design process. The design application consists in the optimisation of the topology of a duct of dissipated energy with respect to the duct topology. This gradient is provided by the adjoint of the solver

Giering, Ralf


Empire's experts : the politics of knowledge in Spain's royal monopoly of quina (1751-1808)  

E-Print Network [OSTI]

of cinchona trees in the forests on two hills Cajanuma anda sample of bark from a hill or forest called Chima nearhills that surround [this town], wrote Olmedo, [the forests

Crawford, Matthew James



Are the transport fuel retail markets regionally integrated in Spain? Evidence from price transmission  

Science Journals Connector (OSTI)

Abstract In this paper we explore whether the Spanish retail fuel markets are integrated at the regional level. We perform a comparative analysis of the transmission of international wholesale fuel prices to retail fuel prices. Our results are in favor of market segmentation, since the degree of cost pass-through differs noticeably across provinces (NUTS 3) and this outcome is clearly robust to the exclusion of the island provinces. We also found that cost pass-through is more similar for those provinces belonging to the same autonomous community (NUTS 2). It is suggested that different regulations and criteria regarding the granting of administrative authorizations from the autonomous communities could be hindering the integration of geographical markets.

Jacint Balaguer; Jordi Ripolls



Paleomagnetic Dating of Cave Paintings in Tito Bustillo Cave, Asturias, Spain  

Science Journals Connector (OSTI)

...temperature releases free energy. Salination power...1010 watts. The energy flux available for...osmotic salination converter could possibly operate...efficiency. This energy source is renewable...of tidal, geo-thermal, wind, and hydroelectric...nonequilibrium state of the oceans (2) have been proposed...

Kenneth M. Creer; John S. Kopper



Trends of cross-border mobility of physicians and nurses between Portugal and Spain  

Science Journals Connector (OSTI)

Health workforce cross-border mobility has an impact not only on individual health workers, but also on how health services are organized, planned, and delivered. This paper presents the results of a study of ...

Claudia Leone; Cludia Conceio; Gilles Dussault



Rock-magnetic properties of multicomponent natural remanent magnetization in alluvial red beds (NE Spain)  

Science Journals Connector (OSTI)

......palaeoenvironmental changes., Palaeogeog. Palaeoclimat. Palaeoecol., 93, 227-253. Van Hoof A.A.M. , Van Os B.J.H., Rademakers J.G., Langereis C.G., De Lange G.J., 1993. A paleomagnetic and geochemical record of the Upper Cochiti reversal......

Pauline P. Kruiver; Cor G. Langereis; Mark J. Dekkers; Wout Krijgsman



holger.lange@physik.tu-berlin.de Oviedo/Spain -September, 2008  

E-Print Network [OSTI]

micrographs were taken by a Philips CM200-FEG- UT operated at 200 kV. Low-frequency vibrational mode clearly at liquid helium temperatures with the 514 nm line of an Ar+ laser and a Dilor-XY triple monochromator system. Nanorods were characterized with high resolution transmission electron microscopy . HRTEM

Nabben, Reinhard


The Object of the Atlantic: Concrete Aesthetics in Cuba, Brazil, and Spain, 1868-1968  

E-Print Network [OSTI]

Myth of Modernity and the Transatlantic Onset of Modernism.cable, the great transatlantic?. ?. ?. ?the linotype,of Moder- nity and the Transatlantic Onset of Modernism (

Price, Rachel L.



Science and Literary Culture during Spain's Edad de Plata (1923-1936)  

E-Print Network [OSTI]

1925. Print. Xirau, Joaqun. Ciencia i cultura. La GacetaPrint. ---. Filosofa, ciencia. Las lecciones del fsicoPrint. ---. Filosofa, ciencia: El profesor Carrasco y la

Hiller, Anna Eva



Empire's experts : the politics of knowledge in Spain's royal monopoly of quina (1751-1808)  

E-Print Network [OSTI]

e Histricos sobre la Ciencia, 1992. Campillo y Coso, JosOrtega, Zea, Cavanilles: la ciencia al servicio del poder.Sarmiento, Francisco Javier. Ciencia de Cmara. Casimiro

Crawford, Matthew James


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Sources of PM2.5 impacting on Gran Canaria, Spain  

Science Journals Connector (OSTI)

Abstract This paper reports on sequential aerosol sample sets collected at the Campus de Tafira, University of Las Palmas de Gran Canaria (ULPGC), in 2010. Gran Canaria is located approximately 250km off the coast of North Africa and at the northern margin of the dominant Saharan dust plumes being blown westward across the Atlantic Ocean. PM2.5 aerosol samples were collected on 47mm filter substrates of Teflon, quartz fiber and Nuclepore, generally at weekly sampling intervals. Subsets of these were analyzed for their mass, as well as elemental and ionic compositions. The 2010 annual geometric mean PM2.5 concentration at Tafira was 6.2?g/m3, with only two particularly dusty events. From a simultaneous PM10 study at the same site, a PM2.5/PM10 mass ratio of 0.35 was calculated. Diagnostic chemical ratios for PM2.5, for both moderate and severe Saharan dust events (calimas) in 2010 are: Al : Si : K : Ti : Mn : Fe : Sr 1 : 2.818 : 0.330 : 0.078 : 0.012 : 0.847 : 0.0088 . To better understand the mineralogy of the aerosols and for inter-comparison purposes, normative mineral compositions were calculated from the chemical compositions. Depending on their transport patterns, four source regions, each with a distinct mineralogical signature were distinguished. The Northwest to North sector (Oceanic NW) aerosols contain evaporites, secondary ammonium sulfate, lesser amounts of organic carbon, and minor amounts of quartz and other silicates. The North to Northeast sector (Europe NE) generated aerosols of evaporites, ammonium sulfate and organic carbon. The Northeast (Africa NE) sector, with influx of air from the Iberian Peninsula and North Africa, contained evaporites and secondary ammonium sulfate with some organic carbon, and minor amounts of silicates and quartz. In 2010, the main African transport pathway from the Sahara region and across northern Mali, northern Mauritania, Western Sahara and Morocco was responsible for elevated concentrations of mineral dust during calima events.

Johann P. Engelbrecht; Inmaculada Menndez; Edward Derbyshire



Fluvial dissection, isostatic uplift, and geomorphological evolution of volcanic islands (Gran Canaria, Canary Islands, Spain)  

Science Journals Connector (OSTI)

Digital analysis of torrential gullies (barrancos) deeply incised into the volcanic Island of Gran Canaria (Canary Islands) allows us to extract the longitudinal profiles and pre-incision surfaces for individual basins, from which morphometric parameters (length, elevation, area, slope) have been calculated. Other derived parameters, such as ridgeline profiles, maximum incision values, volume removed by fluvial erosion, geophysical relief and isostatic uplift, have also been computed. Based on K/Ar ages for the island, well-constrained incision-uplift rates have been calculated by means of the combination of different methodological approaches commonly used in orogens and large mountain ranges. The geomorphological and morphometric analyses reveal that the island is clearly divided into four environmental quadrants determined by the combination of a couple of key-factors: the age of the volcanic surfaces and the climatic conditions. These factors determine a young sector covered with Plio-Quaternary platform-forming lavas (finished at 1.91.5Ma) evolving under contrasting wet (NE) to dry (SE) climates, and an older sector, conserving the residual surfaces of the Miocene shield building (14.58.7Ma) at the ridgelines, also subjected to wet (NW) and dry (SW) climates. Incision is related to the age zonation of the island. Maximum incisions (Gran Canaria. Additional sources of uplift, such as gravitational unloading, lithospheric flexure induced by adjacent islands, and/or volcanic underplating, are required. The theoretical onset of lithospheric bulging beneath Gran Canaria, as exerted by Tenerife, promoted a broad westwards tilting of the former from 3.83.5Ma ago. This overall tilting accelerated fluvial incision, erosional unloading, and, therefore, the sustained differential uplift on the Eastern slope of the island over its last erosional stage. Considering mean uplift rates for the East and West sectors, Eastern values (0.024mm/yr) are double than those in the West (0.011mm/yr), supporting the role of lithospheric flexure of adjacent islands as an additional source of uplift. Complex feedback between fluvial unloading, differential uplift, orographic effect, lithospheric flexure, and volcanic underplating, seems to control the geomorphological development of hot-spot volcanic islands, after the gravitational collapse of stratovolcanos during their rejuvenation stage.

Inmaculada Menndez; Pablo G. Silva; Moises Martn-Betancor; Francisco Jos Prez-Torrado; Herv Guillou; S. Scaillet



Plasmid mediated resistance to trimethoprim in Enterobacteriaceae isolated in Gran Canaria, Canary Islands (Spain)  

Science Journals Connector (OSTI)

Summary During a 2 month period, 145 Enterobacteriaceae isolated from clinical specimens, at the Hopital Nuestra Seora del Pino (Gran Canaria), were tested for their susceptibility to trimethoprim (Tp) by an agar diffusion method. Seven-two (49.6 %) strains (including E. coli, Proteus spp., E. cloacae, Citrobacter spp., Serratia spp., Klebsiella spp. and S. enteritidis) were considered as resistant to Tp, and 28.1 % of the resistant strains could transfer the Tp-resistance marker into E. coli by conjugation. Tp-resistance was encoded by plasmids of different molecular weights, ranging from 52.5 to 165 kb (mean 107.5). These plasmids encoded a high level resistance to Tp (MIC ? 1000 ?g/ml). The other resistance markers co-transferred with the Tp were ampicillin (80.9 %), sulfamethoxazole (61.9 %), streptomycin (57.1 %), kanamycin (47.6 %), tetracycline (42.8 %), tobramycin, gentamicin and chloramphenicol (28.5 %, respectively). These data suggest that : (I) plasmid-mediated resistance to Tp represents a serious problem in the Canary Islands ; (II) in at least 42.9 % of the strains, resistance to Tp is not due to dissemination of Tn7, encoding joint-resistance to Tp and streptomycin ; (III) selection of Tp-resistant strains may be achieved by unrelated antibiotics such ampicillin, whose resistance is encoded by the same plasmid.

C. Monzon-Moreno; I. Alamo; F.W. Goldstein; J.F. Acar



Seasonal changes in agar characteristics of two populations ofPterocladia capillacea in Gran Canaria, Spain  

Science Journals Connector (OSTI)

Agar characteristics ofPterocladia capillacea...were examined seasonally at two intertidal populations exposed to different wave energy on the northern rocky shore of Gran Canaria Island. Plants were collected mo...

Y. Freile-Pelegrn; D. Robledo; R. Armisn; G. Garca-Reina



Deposition of rheomorphic ignimbrite D (Mogn Formation), Gran Canaria, Canary Islands, Spain  

Science Journals Connector (OSTI)

...?Rheomorphic ignimbrite D (13.4?Ma, Upper Mogn Formation on Gran Canaria), a multiple flowsingle cooling unit,...

Gustav Kobberger; Hans-Ulrich Schmincke



E-Print Network 3.0 - andratx mallorca spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

JM, Gonz... . International Workshop on Computer Vision and Image Analysis, Palmas de Gran Canaria, ... Source: Illes Balears, Universitat de les - Departament de Cincies...


Isolation and characterization of Acanthamoeba strains from soil samples in Gran Canaria, Canary Islands, Spain  

Science Journals Connector (OSTI)

Free-living Amoebae of Acanthamoeba genus include non-pathogenic and pathogenic strains that are currently classified in 18 different genotypes, T1T18. In this study, a survey was carried out to evaluate the pre...

Mara Reyes-Batlle; Cheridah D. Todd; Carmen M. Martn-Navarro



Engineering geology and future stability of the El Risco landslide, NW-Gran Canaria, Spain  

Science Journals Connector (OSTI)

A 200m long segment of the only main road in NW-Gran Canaria is built on landslide deposits near the...

Marc-Antoine Longpr; Rodrigo del Potro



Groundwater flow in a volcanicsedimentary coastal aquifer: Telde area, Gran Canaria, Canary Islands, Spain  

Science Journals Connector (OSTI)

Groundwater conditions in a 75- km2...coastal area around the town of Telde in eastern Gran Canaria island have been studied. Pliocene to Recent...2day?1; 5 and 0.5mday?1, respectively). These two formations a...

M. C. Cabrera; E. Custodio



Occurrence ofSalmonella in cold-blooded animals in Gran Canaria, Canary Islands, Spain  

Science Journals Connector (OSTI)

The occurrence ofSalmonella...in endemic and subendemic species of lizard and frog of Gran Canaria,Gallotia stehlini andRana perezi, as well as captive reptiles from other regions of the world was investigated. T...

C. Monzn Moreno; M. M. Ojeda Vargas; A. Echeita; M. A. Usera



Geomorphologic Evidences of Great Flank Collapses in the Northwest of Gran Canaria (Canary Islands, Spain)  

Science Journals Connector (OSTI)

This work provides geological observations that support the existence of several large rock slides in the northwest sector of the Gran Canaria Island, which are now covered by recent ... slides that affect succes...

Jorge Yepes Temio; Nieves Snchez



Assuming Roles: Gender, Crisis and the Conservation of Spain in the Early Seventeenth Century  

E-Print Network [OSTI]

and the Hispanic World, 1606-1611 (Oxford: Clarendon Press, 1982), 2, and especially the first section of chapter 2 entitled Renewed Deliberations. 5 Giovanni Botero, The Reason of State (1589), trans. P.J. and D.P Whaley (London: Routledge, 1956), 157. 6... Espaola: Segn la Impresin de 1611, con las Adiciones de Benito Remigio Noydens Publicadas en la de 1674, Martn de Riquer, ed. (Barcelona: S.A. Horta, 1943), 1011. 18 Alexandra Shepard notes that in early modern England a man lacking money...

Gaston, Ryan



A multiobjective interactive approach to determine the optimal electricity mix in Andaluca (Spain)  

Science Journals Connector (OSTI)

It seems clear that energy production is one of the key aspects ... and on the environmental damage of a potential mix, more focused on renewable sources. Some ... , in order to determine the optimal electrical mix

J. M. Cabello; M. Luque; F. Miguel; A. B. Ruiz; F. Ruiz



Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren


Iberdrola SA | Open Energy Information  

Open Energy Info (EERE)

SA SA Jump to: navigation, search Name Iberdrola SA Place Bilbao, Spain Zip 48008 Sector Hydro, Renewable Energy, Solar, Wind energy Product Spain-based company engaged in the generation, transmission, distribution and marketing of electricity and natural gas. Producer of renewable energy power through mini-hydro, wind, solar and nuclear power. Coordinates 43.26865°, -2.946119° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.26865,"lon":-2.946119,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Existing Commercial Reference Buildings Constructed Before 1980 - Archive  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed Before 1980 - Existing Commercial Reference Buildings Constructed Before 1980 - Archive Existing Commercial Reference Buildings Constructed Before 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB) Full service restaurant


Existing Commercial Reference Buildings Constructed In or After 1980 -  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed In or After Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB)


Energy Efficiency and Conservation Block Grant Program  

Broader source: Energy.gov (indexed) [DOE]

U.S. Department of Energy Categorical Exclusion Determination Form Program or Field Office: Energy Efficiency and Conservation Block Grant Program Project Title NM-County-Valencia Location: County Valencia NM American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Develop energy efficiency and conservation strategy which includes conducting energy audits and


Dynamic Software Update Emili Miedes and Francesc D. Mu~noz-Escoi  

E-Print Network [OSTI]

, it complicates the design and development of the software service. For instance, the software must be ableDynamic Software Update Emili Miedes and Francesc D. Mu~noz-Esco´i Instituto Universitario Mixto Tecnol´ogico de Inform´atica Universitat Polit`ecnica de Val`encia Campus de Vera s/n, 46022 Valencia

Muñoz, Francesc


Constitutional Environment and Entrepreneurship: An Empirical Study  

E-Print Network [OSTI]

Singapore Slovenia Spain Suriname Switzerland Tanzania TongaSingapore Slovenia Spain Suriname Switzerland Tanzania TongaSingapore Slovenia Spain Suriname Switzerland Tanzania Tonga

Zhang, Wei


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Past, Current and Future Trends in Tobacco Use  

E-Print Network [OSTI]

Spain Sri Lanka Sudan Suriname Swaziland Sweden SwitzerlandSpain Sri Lanka Sudan Suriname Swaziland Sweden SwitzerlandSpain Sri Lanka Sudan Suriname Swaziland Sweden Switzerland

Guindon, G. Emmanuel; Boisclair, David



Sub-constitutional dialogues of national recognition: a comparative study of Quebec-Canada and Catalonia-Spain.  

E-Print Network [OSTI]

??This thesis provides a comparative analysis of two recent sub-constitutional acts of recognition extended by the Canadian and Spanish governments towards Quebec and Catalonia, respectively. (more)

Gunn, Alexander



Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

Oxford University Press. Hacking, Ian. 1986. "Making Upof counting them, see Hacking 1986, 1990:3. On the role of

Cook Martn, David



Naturally occurring radioactive material (NORM V): proceedings of an international symposium, Seville, Spain, 1922 March 2007  

Science Journals Connector (OSTI)

......their decay chain members in rare earth minerals is often enough...occupational exposure during rare earth production gives rise...variety of monazite mining and rare earth recovery industries...environmental weathering of stacked phosphogypsum waste materials, with observed......

William E. Kennedy; Jr.



Koleopterologische Rundschau 66 39-45 Wien, Juni 1996 Deronectes fosteri sp.n. from northeastern Spain  

E-Print Network [OSTI]

, Ayr CFB Coll. Fery, Berlin CFP Coll. Fresneda, El Pont de Suert, Lleida CHB Coll. Hernando, Barcelona." and with holotype label. Paratypes (NWM, MZB, CAB, CAL, CBP, CFA, CFB, CFP, CHB, CRM): 12 SO and 8 9 9 with same

Ribera, Ignacio


Residential Radon Exposure, Histologic Types, and Lung Cancer Risk. A CaseControl Study in Galicia, Spain  

Science Journals Connector (OSTI)

...a federal action plan for saving lives...Radon_Action_Plan.pdf . 6. A citizen's...exposure? A systematic review.Int J Radiat Biol...and American Indian uranium miners: an update...carcinoma in German uranium miners.Cancer 2006...was measured using standard procedures. Results...

Juan Miguel Barros-Dios; Alberto Ruano-Ravina; Mnica Prez-Ros; Margarita Castro-Bernrdez; Jose Abal-Arca; and Marta Tojo-Castro



Magnetotelluric characterization of a salt diapir: a case study on BicorbQuesa Diapir (Prebetic Zone, SE Spain)  

Science Journals Connector (OSTI)

...the adjacent synclines (Garca ZZQQhya-Rodrigo 1960; De Ruig 1992). Most of these anticlines...Mijnbow 59:155a 168. a Garca ZZQQhya-Rodrigo B. (1960) Sur la structure du Nord de...Mateus A., Pous J., Heise W., Santos F.M., Almeida E. (2008) Unraveling...

M. Rubinat; J. Ledo; E. Roca; O. Rosell; P. Queralt


Chemical variation and significance of micas from the Fregeneda-Almendra pegmatitic field (Central-Iberian Zone, Spain and Portugal)  

Science Journals Connector (OSTI)

...Lisboa, Portugal, 48 p. Silva A.F., Santos A.J., Ribeiro A., and Ribeiro M...Geologicos de Portugal. Silva A.F., Santos A.J., Ribeiro A., Cabral J., and...e Barca DAlva (Figueira de Castelo Rodrigo). Campo aplitopegmatitico da Fregeneda-Almendra...

Romeu Vieira; Encarnacin Roda-Robles; Alfonso Pesquera; Alexandre Lima


Effects of Greater flamingo Phoenicopterus ruber on macrophytes, chironimds and turbidity in natural marshes in Doana, SW Spain.  

E-Print Network [OSTI]

resuspension. #12;3 Introduction Submerged vegetation has a major functional role in shallow wetlands, because it provides refuge for invertebrates, changes the nutrient dynamics of the system, prevents resuspension sediment resuspension (SCHEFFER et al. 1993, SCHEFFER 1998). However, the potential effects of benthivorous

Green, Andy J.


Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

ABBREVIATIONS AFI CGE CCI CNC CSE DSCD DSCS DGI DGRN DNM ICImore likely to naturalize) ( CNC 1916:212). Considering thatbetween 1910 and 1911 (CNC 1916:212). An alternative to

Cook Martn, David



Usuard's Journey to Spain and Its Influence on the Dissemination of the Cult of the Cordovan Martyrs  

E-Print Network [OSTI]

Saint Germain ct 'Auxerre. Heric of Auxerre, who became aconducted miracles there, Heric omits any reference to theMartyrology 4. Calendar of Heric of Auxerre 5. Calendar of

Effros, Bonnie



New archaeomagnetic data recovered from the study of Roman and Visigothic remains from central Spain (3rd-7th centuries)  

Science Journals Connector (OSTI)

......materials are represented by poorly consolidate baked clay sediments containing...means of gypsum bandages and plaster of Paris. In Figs 3(a...faces were covered by a flat plaster surface (Fig. 3a). After...RSC1 and VBK1. Here, flat plaster surfaces adhering on selected......

Gianluca Catanzariti; Miriam Gmez-Paccard; Gregg McIntosh; Francisco J. Pavn-Carrasco; Annick Chauvin; Mara L. Osete



Cost-effectiveness of memantine in community-based Alzheimers disease patients: an adaptation in Spain  

Science Journals Connector (OSTI)

Several clinical trials have demonstrated the efficacy and safety of the NMDA antagonist memantine in moderately severe to severe Alzheimers ... compared to placebo. Long-term implications of memantine treatment...

Fernando Antonanzas; Benoit Rive



Leukemia, Lymphomas, and Myeloma Mortality in the Vicinity of Nuclear Power Plants and Nuclear Fuel Facilities in Spain  

Science Journals Connector (OSTI)

...Douglas A. J. Mortality of workers at the Sellafield plant of...combined mortality data on workers at the Hanford Site, Oak Ridge National Laboratory, and Rocky...mortality and morbidity among workers at the Sellafield plant of...

Gonzalo Lpez-Abente; Nuria Aragons; Marina Polln; Mara Ruiz; and Ana Gandarillas



Leukemia, Lymphomas, and Myeloma Mortality in the Vicinity of Nuclear Power Plants and Nuclear Fuel Facilities in Spain  

Science Journals Connector (OSTI)

...study among workers at two nuclear...mortality near Oak Ridge, Tennessee...leukaemia in Europe after Chernobyl...Mortality, 1950-1978: Part...Mortality of workers at the Sellafield...Hanford Site, Oak Ridge National Laboratory...

Gonzalo Lpez-Abente; Nuria Aragons; Marina Polln; Mara Ruiz; and Ana Gandarillas



Residential Radon Exposure, Histologic Types, and Lung Cancer Risk. A CaseControl Study in Galicia, Spain  

Science Journals Connector (OSTI)

...in miners (WISMUT Mining Company) have revealed...Perez-Rios Writing, review, and/or revision...a federal action plan for saving lives...Radon_Action_Plan.pdf . 6. A citizen's...exposure? A systematic review.Int J Radiat Biol...was measured using standard procedures. Results...

Juan Miguel Barros-Dios; Alberto Ruano-Ravina; Mnica Prez-Ros; Margarita Castro-Bernrdez; Jose Abal-Arca; and Marta Tojo-Castro



Reference concepts for the final disposal of LWR spent fuel and other high activity wastes in Spain  

SciTech Connect (OSTI)

Studies over the last three years have been recently concluded with the selection of a reference repository concept for the final disposal of spent fuel and other high activity wastes in deep geological formations. Two non-site specific preliminary designs, at a conceptual level, have been developed; one considers granite as the host rock and the other rock salt formations. The Spanish General Radioactive Waste Program also considers clay as a potential host rock for HLW deep disposal; conceptualization for a deep repository in clay is in the initial phase of development. The salt repository concept contemplates the disposal of the HLW in self-shielding casks emplaced in the drifts of an underground facility, excavated at a depth of 850 m in a bedded salt formation. The Custos Type I(7) cask admits up to seven intact PWR fuel assemblies or 21 of BWR type. The final repository facilities are planned to accept a total of 20,000 fuel assemblies (PWR and BWR) and 50 vitrified waste canisters over a period of 25 years. The total space needed for the surface facilities amounts to 322,000 m{sup 2}, including the rock salt dump. The space required for the underground facilities amounts to 1.2 km{sup 2}, approximately. The granite repository concept contemplates the disposal of the HLW in carbon steel canisters, embedded in a 0.75 m thick buffer of swelling smectite clay, in the drifts of an underground facility, excavated at a depth of 55 m in granite. Each canister can host 3 PWR or 9 BWR fuel assemblies. For this concept the total number of canisters needed amounts to 4,860. The space required for the surface and underground facilities is similar to that of the salt concept. The technical principles and criteria used for the design are discussed, and a description of the repository concept is presented.

Huertas, F.; Ulibarri, A. [ENRESA, Madrid (Spain)



Proc. Advanced Workshop on Frontiers in Electronics (WOFE), Tenerife, Spain Jan. 1997 IEEE Cat. No. 97TH8292  

E-Print Network [OSTI]

of various types of optoelectronic devices which play important roles in commercial and communication in optoelectronic devices Computer Usage: None. Laboratory Experiments: None. Course Contribution to Engineering optoelectronic devices. Students are required to analyze and solve problems using modern physics concepts

Steckl, Andrew J.


A Transatlantic Dialogue: Argentina, Mexico, Spain, and the Literary Magazines that Bridged the Atlantic (1920-1930)  

E-Print Network [OSTI]

broad geographical scope, tracing the development of Rubn Daros modernismo in Argentinean, French, and

Fernandez, Vanessa



Methodology for Landslide Susceptibility Mapping by Means of a GIS. Application to the Contraviesa Area (Granada, Spain)  

Science Journals Connector (OSTI)

This article presents a method to map landslide susceptibility in rock massifs using Geographical Information Systems (GIS). The method is based on making ... of the susceptibility of the terrain. The map thus ob...

T. Fernndez; C. Irigaray; R. El Hamdouni; J. Chacn
