Powered by Deep Web Technologies
Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tips on Studying Abroad at the Universidad Politcnica de Valencia in Spain  

E-Print Network [OSTI]

Tips on Studying Abroad at the Universidad Politécnica de Valencia in Spain Want to know what it- ence a new culture. · Valencia was the only place that CEE majors could go in Spain, so that's where I largest city in Spain, so don't worry about running out of things to do or being bored. From the City

Li, Mo


The Dirichlet Problem for the Total Variation Flow Dept. de An'alisis Matem'atico, Universitat de Valencia, 46100 Burjassot (Valencia), Spain  

E-Print Network [OSTI]

'atico, Universitat de Valencia, 46100 Burjassot (Valencia), Spain C. Ballester Department of Tecnologia, University of Pompeu­Fabra, La Rambla 30­32, 08002 Barcelona, Spain V. Caselles Department of Tecnologia, University of Pompeu­Fabra, La Rambla 30­32, 08002 Barcelona, Spain J. M. Maz'on Dept. de An'alisis Matem

Caselles, Vicent



E-Print Network [OSTI]

2008 European PV Conference, Valencia, Spain COMPARISON OF SOLAR RADIATION FORECASTS FOR THE USA J models 1 INTRODUCTION Solar radiation and PV production forecasts are becoming increasingly important/) three teams of experts are benchmarking their solar radiation forecast against ground truth data

Perez, Richard R.


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2DO.1.6 BULK LIFETIME ENHANCEMENT BY FIRING STEPS  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2DO.1.6 1 to getter metallic impurities and firing of silicon nitride (SiN) to induce hydrogen passivation. We analyse impurities and hydrogen bulk passivation, respectively. Additionally, the fired SiN layers have to ensure


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.25 MODELLING THE CURING DYNAMICS OF ETHYLENE-VINYL ACETATE  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3. Alshuth2 , M. Köntges1 and R. Brendel1,3 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, D-31860 Emmerthal, Germany 2 German Institute of Rubber Technology, Eupener Stra?e 33, D-30519


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 ELECTRON AND HOLE MOBILITY REDUCTION AND HALL FACTOR IN PHOSPHORUS-  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 1 of Engineering, The Australian National University, Canberra, ACT 0200, Australia 2 Department of Electronic Materials Engineering, The Australian National University, Canberra ACT 0200, Australia 3 Institut für


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1.5 BORON-OXYGEN-RELATED RECOMBINATION CENTERS IN COMPENSATED SILICON  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1 Rougieux2 , Daniel Macdonald2 , Karsten Bothe1 , and Jan Schmidt1 1 Institute for Solar Energy Research and Computer Science, The Australian National University Canberra ACT 0200, Australia ABSTRACT: The impact


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.3.24 DAIDALOS A PLUGIN BASED FRAMEWORK  

E-Print Network [OSTI]

these plugins, complex objects can be created in a modular way. The definitions of input- and output-data within25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.3,2 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, 31860 Emmerthal, Germany 2


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2.3 EFFECT OF SiN DEPOSITION TEMPERATURE ON SURFACE PASSIVATION OF N-TYPE CZ SILICON  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2N deposition leads to increasing the hydrogen content of the SiN layers. This improves the supply of hydrogen silicon using thermally grown oxide or amorphous films based on hydrogenated silicon compounds has been


European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115 NON-LINEAR MECHANICAL PROPERTIES OF ETHYLENE-VINYL ACETATE (EVA) AND ITS  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3,2 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, D-31860 Emmerthal, Germany 2 ABSTRACT: Polymers such as ethylene-vinyl acetate (EVA) encapsulants are known for their non


Black Africans in Barcelona, Spain: An Exploration of Integration into Catalan Society  

E-Print Network [OSTI]

les minoreis elniques. Lerida, Spain: Universitat de L1eida.6 200 1-2004. Catalunya, Spain: Grinver. SA. Gozalvez Perez,Picanya (Valencia), Spain: Generalitat Valenciana. Makom

Osuji, Chinyere



Immigration, work and health in Spain: the influence of legal status and employment contract on reported health indicators  

E-Print Network [OSTI]

Universidad de Valencia, Valencia, Spain J. Benach HealthNetwork (Emconet), Barcelona, Spain A. M. Garc? a M.and Health (ISTAS), Madrid, Spain C. Ruiz-Frutos Department



Universidad Politecnica de Valencia Departamento de Sistemas Informaticos y Computacion  

E-Print Network [OSTI]

develop a novel framework for Code-Carrying Theory which is a methodology for software certificationUniversidad Polit´ecnica de Valencia Departamento de Sistemas Inform´aticos y Computaci´on Universidad Polit´ecnica de Valencia Camino de Vera, s/n 46022 Valencia Espa~na #12;Here the dedication #12

Alpuente, María


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld



ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone



E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick



Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin


Universidad Politecnica de Valencia Departamento de Matematica Aplicada  

E-Print Network [OSTI]

Universidad Polit´ecnica de Valencia Departamento de Matem´atica Aplicada M´etodos Num´ericos para;#12;Universidad Polit´ecnica de Valencia Departamento de Matem´atica Aplicada M´etodos Num´ericos para la Resoluci 3.4.3 Resultados de convergencia para el m´etodo AGS. . . . 104 3.5 Experimentos num´ericos

Marín, José



E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add


Universidad Politecnica de Valencia Departamento de Sistemas Informaticos y Computacion  

E-Print Network [OSTI]

/n 46022 Valencia Espa~na #12;Abstract In 1936, Alan Turing proved that the halting problem, that is for automatic proofs of termi- nation of narrowing. #12;#12;Resumen En 1936 Alan Turing demostr´o que el halting

Alpuente, María


Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of


Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL


European Academy of Management 14th Annual Conference EURAM 4-7 June 2014 Valencia Spain  

E-Print Network [OSTI]

relies on the capacity to reuse and connect existing technologies; 3) the design of GT might require forward new markets (first unknown: the markets) and new technologies (second unknown: the technologies innovation that impacts or generate many markets and many technical variations. From a statistical point

Paris-Sud XI, Université de


Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip


Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.


Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation


Networks Spanish project COPABIB Group Murcia Group Polit. Valencia Group La Laguna Computation in heterogeneous-hierarchical  

E-Print Network [OSTI]

Networks Spanish project COPABIB Group Murcia Group Polit. Valencia Group La Laguna Computation in heterogeneous-hierarchical environments Project COPABIB: Univ. Alicante, Castell´on, La Laguna, Murcia COPABIB Group Murcia Group Polit. Valencia Group La Laguna Contents 1 Networks 2 Spanish project COPABIB 3

Giménez, Domingo


Nota de prensa Valencia CSIC c o m u n i c a c i n  

E-Print Network [OSTI]

la Medicina y de la Ciencia López Piñero, centro mixto del Consejo Superior de Investigaciones Valencia, y que son una muestra de la presencia de la cultura y la ciencia alemana en la universidad pensionados enviados a Alemania, destacándose, además, otras personalidades dentro de la ciencia española

Fitze, Patrick

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Polymeric Nanoparticles for Drug Delivery Juliana M. Chan, Pedro M. Valencia, Liangfang Zhang,  

E-Print Network [OSTI]

Chapter 11 Polymeric Nanoparticles for Drug Delivery Juliana M. Chan, Pedro M. Valencia, Liangfang Zhang, Robert Langer, and Omid C. Farokhzad Abstract The use of biodegradable polymeric nanoparticles. In cancer, targeted polymeric NPs can be used to deliver chemotherapies to tumor cells with greater efficacy

Zhang, Liangfang


Instructions to obtain apostille certification of the FBI background check (Valencia Year-Long Students)  

E-Print Network [OSTI]

Instructions to obtain apostille certification of the FBI background check (Valencia Year-Long Students) Once you have received the FBI background check. You will need to proceed with step two, obtain not waste time submitting your FBI Background Check for certification. 1.) Complete the DS-4194 Request

Hull, Elaine


SPAIN PROGRAM Madrid Four Week /  

E-Print Network [OSTI]

SPAIN PROGRAM Madrid Four Week / Madrid and Málaga Six Week 2014 Summer Program APPLICATION FORM face to scapobia@binghamton.edu. It will be used to make a photo ID card for you to use in Spain. 7 and the full refund and cancellation policy on the Spain program website pages. 8. Submit all materials to the

Suzuki, Masatsugu



E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi


Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL


Index of /~lipman/Spain  

E-Print Network [OSTI]

Index of /~lipman/Spain. [ICO], Name Last modified Size Description. [DIR], Parent Directory, -. [ ], 1. Derived_categories_and_functors.pdf, 22-Feb-2009 04:


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip


Mirrors and Echoes: Women's Writing in Twentieth-Century Spain  

E-Print Network [OSTI]

Contemporary Women Writers of Spain. Boston: Twayne, 1988.L. , ed. Women Writers of Spain: An Annotated Bio-Biblio-Identity in Contemporary Spain, ed. Jo Labanyi. New York:

Bergmann, Emilie L.; Herr, Richard



Economy and Rhetoric of Exchange in Early Modern Spain  

E-Print Network [OSTI]

Elliott, J. H. Imperial Spain 1469-1716. London: Penguin,2002. ---. Spain and its World 1500-1700. New Haven andin Early Seventeenth- Century Spain. Lewisburg: Bucknell UP,

Ruiz, Eduardo German



Professor Ignacio Luengo, Universidad Complutense, Madrid, Spain ...  

E-Print Network [OSTI]

Apr 14, 2009 ... Speaker: Professor Ignacio Luengo, Universidad Complutense, Madrid, Spain. Title: Rational Cuspidal Curves, Surface Singularities and...



The Electricity Industry In Spain Edward Kahn  

E-Print Network [OSTI]

PWP-032 The Electricity Industry In Spain Edward Kahn August 1995 This paper is part of the working-5180 www.ucei.berkeley.edu/ucei #12;1 The Electricity Industry In Spain Edward Kahn Lawrence Berkeley the current structure of the electricity industry in Spain and recent changes to its legal and regulatory

California at Berkeley. University of


Foreign Fishery Developments United States-Spain  

E-Print Network [OSTI]

Foreign Fishery Developments United States-Spain Fisheries Trade, 1980-85 Introduction The U though Spain was forced to become a net importer of fishery products in 1977. due to the extension of 200-mile Exclusive Economic Zones (EEZ) by coastal coun tries. U.S. exports of edible seafoods to Spain



E-Print Network [OSTI]

UNIVERSIDAD CARLOS III de MADRID Madrid, Spain College of Charleston Bilateral Exchange Program Spain and around the world. It programs in Business Ad- ministration, Economics and Law are ranked among the best in Spain. While studying at UC3M, students are able to partake of the vibrant culture of Madrid

Young, Paul Thomas


Pain in Spain: Immigrant Integration and Prosperity  

E-Print Network [OSTI]

Pain in Spain: Immigrant Integration and Prosperity Kevin Kennedy University of New Hampshire % Unemployment Rate, 2008-2010 Time #12;Background Foreign Population in Spain by Countries 2011 2010 Foreigners #12;Foreign-Born Population in Spain Year Total % of Total Population 2008 6418. 1 14.1 2007 6044. 5

New Hampshire, University of


2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.


Low-Cost Photovoltaics: Luminescent Solar Concentrators And Colloidal Quantum Dot Solar Cells  

E-Print Network [OSTI]

Photovoltaic Solar Energy Conference and Exhibition, Barcelona, Spain,Photovoltaic Solar Energy Conference and Exhibition, Valencia, Spain,

Leow, Shin Woei



European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.2.36 DETERMINING THE BULK LIFETIME OF UNPASSIVATED MULTICRYSTALLINE SILICON WAFERS  

E-Print Network [OSTI]

. Brendel1 , R. Falster2 and R. Sinton3 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1 Sinton Instruments, 4720 Walnut Street, Suite 102, Boulder, CO 80301, USA ABSTRACT: The determination potential and benefit of carrier lifetime measure- ments on unprocessed bare wafers, Sinton et al. [3] pre


25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CO.4.3 IMPACT OF LATERAL VARIATIONS ON THE SOLAR CELL EFFICIENCY  

E-Print Network [OSTI]

analyze various monocrystalline silicon solar cells. The light-IV curves around the maximum power point.3 IMPACT OF LATERAL VARIATIONS ON THE SOLAR CELL EFFICIENCY David Hinken, Karsten Bothe and Rolf Brendel-dimensional approach to calculate the impact of local parameters on the global solar cell efficiency. The presented


The Virtual Observatory and Grid in Spain  

E-Print Network [OSTI]

The Virtual Observatory (VO) is nearing maturity, and in Spain the Spanish VO (SVO) exists since June 2004. There have also been numerous attempts at providing more or less encompassing grid initiatives at the national level, and finally Spain has an official National Grid Initiative (NGI). In this article we will show the VO and Grid development status of nationally funded initiatives in Spain, and we will hint at potential joint VO-Grid use-cases to be developed in Spain in the near future.

J. D. Santander-Vela


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TME Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende NewSowitec do Brasil EnergiaSur deT-O Green EuropeTME Spain


from the members: The naked truth of postdocs in Spain  

E-Print Network [OSTI]

cuts will cause exodus from Spain. Science, 336, 139-140.naked truth of postdocs in Spain With this letter we intendfellowship to later return to Spain thanks to another (

Jimenez-Valverde, Alberto; Acevedo, Pelayo



Is Nothing Sacred? Spain Performs the Death of God  

E-Print Network [OSTI]

The Poetry of modernismo in Spain." The Cambridge HistoryNothing Sacred? Spain Performs the Death of God Is Alrick C.tone of nineteenth-century Spain evolves, in the strategy of

Knight, Jr., Alrick C.



Light pollution in Spain. An european perspective  

E-Print Network [OSTI]

Spain appears in light pollution maps as a country less polluted than their neighbours in the European Union. This seems to be an illusion due to its low population density. The data indicate that Spain is one of the most contaminated countries. To reach these conclusions we compare the Spanish case to those of other European countries.

Alejandro Sanchez de Miguel; Jaime Zamorano



Secrets of the arts : Enlightenment Spain's contested Islamic craft heritage  

E-Print Network [OSTI]

This dissertation examines the artistic and architectural mutations occurring in Spain during the eighteenth century, when Spain decided to participate in the Enlightenment's philosophical project that emphasized the ...

Francis, Razan



Live in Spain while earning academic credit Spring 2013  

E-Print Network [OSTI]

+ + + Live in Spain while earning academic credit Spring 2013 · Study at one of Spain's oldest Spain with other CSU students · Take advantage of the opportunities you will have to travel throughout Spain & greater Europe Centrally located 20 miles from the vibrant city of Madrid, Alcalá de Henares


Spain offers a total of 900 Millions Spain proposes to double her contribution to host ITER, the experimental fusion  

E-Print Network [OSTI]

Spain offers a total of 900 Millions Spain proposes to double her contribution to host ITER commission Romani Prodi and the rotating presidency of the European Union, held by Italy, that Spain. The science and technology minister, Juan Costa, stated that Spain is now willing to contribute 20


Course Syllabus-"Sketches of Spain": Spain in Contemporary Mass and Visual Culture Language of Instruction: English  

E-Print Network [OSTI]

Course Syllabus-"Sketches of Spain": Spain in Contemporary Mass and Visual Culture Language and assets and in the development of Spain's main industries and businesses, leveraging the legacy would address questions such as: how is "Spanish-ness" been fabricated in Spain and outside? how does


A residential energy demand system for Spain  

E-Print Network [OSTI]

Sharp price fluctuations and increasing environmental and distributional concerns, among other issues, have led to a renewed academic interest in energy demand. In this paper we estimate, for the first time in Spain, an ...

Labandeira Villot, Xavier



Discriminating Shareholders through the Exclusion of Pre-emption Rights? The European Infringement Proceeding against Spain  

E-Print Network [OSTI]

Kristoffel Grechenig ECFR 4/2007 V. Why Spain? . . . . . . .Commission decided to call on Spain to change its corporatewould decrease in value. Spain considered the Com- missions

Grechenig, Kristoffel



Is Spain a Statist Society? A Research Perspective on Organizations, Reflexivity and Collective Action  

E-Print Network [OSTI]

the United Kingdom and Spain, Direccin General de Cienciathe United Kingdom and Spain. Direccin General de Ciencia1994b. Social Movements in Spain. Tocqueville Revue, Vol.

Laraa, Enrique



Readings in Common: Assimilation and Interpretive Authority in Early Modern Spain  

E-Print Network [OSTI]

Practice in Early Modern Spain. Minneapolis: University of1993. Harvey, L. P. Muslims in Spain, 1500-1614. Chicago:of Religion in Early Modern Spain. Princeton: Princeton

Kimmel, Seth Ross



Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

station, Constant, Catalonia, Spain. We are grateful toBoella farm (La Canonja, Spain) for their collaboration inolive oil production in Spain Paul M. Vossen by Joan Tous,

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia



The Pitfalls of Democracy and Debate: Authority and Inequality in Classrooms in Southeast Spain  

E-Print Network [OSTI]

F. (2011, February 7). Spains salad growers are modern-dayclasses in southeast Spain. She can be contacted atin Classrooms in Southeast Spain Maisa Taha University of

Taha, Maisa



Internship in Toulouse FRANCE / Girona SPAIN / Nottingham UK The Company  

E-Print Network [OSTI]

Internship in Toulouse FRANCE / Girona SPAIN / Nottingham UK The Company Stipje is an organisation. We have offices in the United Kingdom, France and Spain and have students working with us from almost

Rostock, Universität


Computer Architecture and Electronics Department University of Crdoba (Spain)  

E-Print Network [OSTI]

Computer Architecture and Electronics Department University of Córdoba (Spain) Advance Driver. The University of Córdoba is one of the most prestigious universities in Spain, and a pioneer in the fields

Kuehnlenz, Kolja


Senior DOE Officials in Spain to Participate in World Petroleum...  

Broader source: Energy.gov (indexed) [DOE]

Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior...


CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning  

E-Print Network [OSTI]

CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning Francesca Rossi University of Padova, Italy CP 2005 Sitges, Spain, October 3, 2005 Joint work with ... Stefano Bistarelli, Univ. Pescara, Australia CP 2005 Sitges, Spain, October 3, 2005 Ultimate goal A formalism to model many kinds

Rossi, Francesca


Spain and the Bologna Plan: A Modern Day  

E-Print Network [OSTI]

Spain and the Bologna Plan: A Modern Day Controversy By: Danielle Vasan Communication of Privatization #12;Higher Education in Spain before Bologna 1983: Three-cycled degree system Diplomado (3-5 years) Licenciado (1-2 years) Doctor (3 years & Thesis) #12;Higher Education in Spain Today Graduado

New Hampshire, University of


UMass Lowell Intensive Spanish Language & Culture in Cdiz, Spain  

E-Print Network [OSTI]

UMass Lowell Intensive Spanish Language & Culture in Cádiz, Spain Program Description Travel to Spain and study at the University of Cádiz in a specialized intensive language program established Lowell During the Summer in Cádiz, Spain! Complete Levels 1-4 (12 credit) of Spanish language in one

Massachusetts at Lowell, University of

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Regional Management of Mediterranean Ecosystems in Spain1  

E-Print Network [OSTI]

Regional Management of Mediterranean Ecosystems in Spain1 Jose A. Carrera, Estanislao de Simon Conservacion de la Naturaleza), Madrid, Spain. Abstract: Management of the fragile and greatly modified level studies on reforestation, hydrol- ogy, and desert control. Most of Spain has a typical

Standiford, Richard B.


INTRODUCTION The massive sulfide deposits of southern Spain  

E-Print Network [OSTI]

INTRODUCTION The massive sulfide deposits of southern Spain and Portugal were formed about 300 Ma). Spain became a Roman province, and mining of the rich deposits of the Iberian pyrite belt for copper, California 94025 A. Palanques Instituto de Ciencias del Mar, 08039 Barcelona, Spain ABSTRACT A metal

van Geen, Alexander


Renewable Energy Policy and Developments in Spain  

E-Print Network [OSTI]

Renewable Energy Policy and Developments in Spain Wednesday, October 30, 2013 4:00 - 5:30 p in Spanish energy policy. In this talk, Labandeira describes Spanish policies to promote renewable energy, assessing their effectiveness within a wider energy and public-policy context. RSVP link: Download any free

Zhang, Junshan


Meteorology Group, Departament de Fsica, Universitat de les Illes Balears, Palma de Mallorca, Spain IMEDEA, UIB-CSIC, Palma de Mallorca, Spain  

E-Print Network [OSTI]

, Spain 2 IMEDEA, UIB-CSIC, Palma de Mallorca, Spain 3 Instituto Nacional de Meteorologõ?a, Madrid, Spain Geltru, Barcelona, Spain A Case of Convection Development over the Western Mediterranean Sea: A Study of precipitation were recorded in coastal lands of eastern Spain, and 180 mm were estimated over the sea with radar

Romero, Romu


Madrid, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowell Point,ECO Auger11.Spain: Energy Resources Jump to:


Territorial Dimension as Political Strategy: Elite-driven Center-Periphery Cleavage in Spain 1977-2008  

E-Print Network [OSTI]

Party Collaboration in Spain (1977-2004). ComparativeEthnoterritorial Concurrence in Spain. Publius: Journal ofand Regional Elections in Spain. South European Society and

Martinez-Tapia, Oscar



Note on: "Inevitability of Plate Tectonics on Super-Earths" by Valencia, O Connell and Sasselov, arXiv preprint 0710.0699  

E-Print Network [OSTI]

Valencia et al. recently claimed that the mass of a Super-Earth (SE) is a sole factor in determining whether a SE is tectonically active or not. However, mass resolving astrometry is unable to discern between a SE and its moons if any. The fact that no exomoons have been discovered yet is rather a matter of instrumentation imperfection at the present, not of physical absence of exomoons. This, with recently discovered relationships between geometric and physical properties in astronomical bodies (Transiting planets; the Earth) makes it impossible to know yet if the Wageners (here constraining) supposition on somehow-tidally caused tectonics holds universally or not also.

Omerbashich, Mensur



asturias spain genetic: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

true of Jurassic turtles from Wes- tern Europe. A new genus and species of Late Jurassic turtle Benton, Michael 204 Last date modified 11613 Location and Institution SPAIN...


andratx mallorca spain: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: Iron oxide mineralogy in late Miocene red beds from La Gloria, Spain: rock-magnetic, voltammetric spectroscopy and voltammetry. All three methods have low limits...


Zarzuela : or lyric theatre as consumer nationalism in Spain, 1874-1930  

E-Print Network [OSTI]

2003. Carr, Raymond. Spain, 1808-1975. 2 nd ed. Oxford:Chase, Gilbert. The Music of Spain. 2 nd rev. ed. New York:in Renaissance England and Spain. Ithaca: Cornell UP, 1985.

Young, Clinton David



First approach to the El Frontal tracksite (Berriasian, Soria, Spain): perspectives on  

E-Print Network [OSTI]

207 First approach to the El Frontal tracksite (Berriasian, Soria, Spain): perspectives Català de Paleontologia Miquel Crusafont. Carrer Escola Industrial, 23, 08201 Sabadell (Barcelona) Spain Ciencias. Universidad de Zaragoza. Calle Pedro Cerbuna, 12, 50009 Zaragoza, Spain. bernat

Falkingham, Peter


International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

4. Recents reforms in Spain 4.1. Family Protocols in theDevelopments in Germany and Spain Business Roland Krausein North America; 50% in Spain and 80 % in Germany. 8

Krause, Roland



Last date modified 1/16/13 Location and Institution SPAIN -MADRID  

E-Print Network [OSTI]

Last date modified 1/16/13 Location and Institution SPAIN - MADRID ST. LOUIS/or Scholarships http://spain.slu in Spain. You must apply within 3 months prior to departure. Documents must

Galles, David


Traumatized subjects : horror film and the legacy of mass extermination in post-dictatorship Spain  

E-Print Network [OSTI]

6-18. No-Do. Dir. Elio Quiroga. Spain: Eqlipse ProduccionesDir. Antonio Bayona. Spain: Rodar y Rodar, 2007. Los ojos deDir. Guillem Morales. Spain: Rodar y Rodar, 2010. Ortega y

Boehm, Scott Walter



SPAN 320's (all civ courses, Spain and Latin America) Course Objectives and Programmatic Alignment  

E-Print Network [OSTI]

SPAN 320's (all civ courses, Spain and Latin America) Course Objectives in Spain/Latin America's social history Graded oral presentation Essays 1a, 1b

Mayfield, John


E-Print Network 3.0 - asturias spain idria Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...


E-Print Network 3.0 - almaden asturias spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...


Instructions to obtain the FBI background check Long-Stay Valencia Students The FBI Background Check is the first step in a two-part process. The FBI Background Check takes 4-6  

E-Print Network [OSTI]

Instructions to obtain the FBI background check Long-Stay Valencia Students The FBI Background Check is the first step in a two-part process. The FBI Background Check takes 4-6 weeks for processing form, fingerprint card and payment--to the following address: FBI CJIS Division Record Request 1000

Hull, Elaine


ROSER MATAMALA Ph.D. in Biological Sciences, 1997. University of Barcelona (Spain), Smithsonian  

E-Print Network [OSTI]

-1993 Research Assistant, Institut de Recerca i Tecnologia Agroalimentaries, IRTA, Cabrils, Spain Publications

Kemner, Ken



E-Print Network [OSTI]

CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN. (SUMMER 2012) Lecturer: Ms. Pilar Barra etiquette and the way to negotiate in Spain. - To analyse the keys to improve business negotiations in Spain Traditions and Customs 2.- Corporate Culture in Spain 2.1 Spanish Economy 2.2 Corporate Culture in Spanish

Escolano, Francisco

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Volume 102, pp. 209220 OctoberDecember 2007 Observations in Pluteus section Pluteus in Spain  

E-Print Network [OSTI]

in Spain: two new records for Europe A. Justo & M.L. Castro fjusto@uvigo.es or alfredo de Vigo E-36310 Vigo Spain Abstract -- Pluteus atropungens and Pluteus brunneidiscus are recorded in studies of fungal biodiversity in the Iberian Peninsula (Spain, Portugal) and Balearic Islands (Spain

Hibbett, David S.


Coming out in Spain: 'Los Invisibles Published Thursday 24th February 11  

E-Print Network [OSTI]

Coming out in Spain: 'Los Invisibles Published Thursday 24th February 11 Dr Richard Cleminson in Spain. His co-authored 'Los Invisibles': A History of Male Homosexuality in Spain, 1850 been published in Spain. "The history of this period must never be forgotten. It serves not only

Berzins, M.


GENERAL CO-CHAIRS: F. J. Perales (Univ. Illes Balears, Spain)  

E-Print Network [OSTI]

GENERAL CO-CHAIRS: F. J. Perales (Univ. Illes Balears, Spain) B. Fisher (University of Edinburgh, UK) PROGRAM COMMITTEE: Abásolo, M. (DMI-UIB, Spain) Aloimonos, Y. (Univ. of Maryland, USA) Bagdanov, A. D. (UAB-CVC, Spain) Baldasarri, S. (Univ. Zaragoza, Spain) Bartoli A. (CNRS_LASMEA, France

Illes Balears, Universitat de les


Fusing Statecharts and Java MARIA-CRISTINA MARINESCU, Computer Science Dept., Universidad Carlos III, Leganes, Spain  

E-Print Network [OSTI]

III, Legan´es, Spain C ´ESAR S ´ANCHEZ, IMDEA Software Institute, Spain and Institute for Applied Physics, CSIC, Spain This paper presents FUSE, an approach for modeling and implementing embedded software-Cristina Marinescu, Computer Science Dept., Universidad Carlos III de Madrid, Leganes, Spain; C´esar S´anchez IMDEA

Sánchez, César



E-Print Network [OSTI]

MANAGING THE NATIONAL ROAD NETWORK MAINTENANCE IN SPAIN Víctor Gómez Frías GETINSA (Spain), vgomez@getinsa.es Teresa Sánchez Chaparro ANECA (Spain), tsanchez@aneca.es ABSTRACT The Spanish Ministry of Public Works point of view. In order to understand the importance and difficulty that presents in Spain

Paris-Sud XI, Université de


Sir --We read with interest your editorial "Ending the pain in Spain" (Nature 428, 1;  

E-Print Network [OSTI]

Sir -- We read with interest your editorial "Ending the pain in Spain" (Nature 428, 1; 2004 expertise and will to come and work in Spain. Mark van Raaij* Departamento de Bioqumica, Facultad de postdoc working outside Spain for almost five years, I welcome your Editorial "Ending the pain in Spain


Comparison of the Evolution of Energy Intensity in Spain and in the EU15. Why is Spain Different?  

E-Print Network [OSTI]

Energy intensity in Spain has increased since 1990, while the opposite has happened in the EU15. Decomposition analysis of primary energy intensity ratios has been used to identify which are the key sectors driving the ...

Ocaa, Carlos


July 2013 M.S. in Genetics -University of A Corua, A Corua, Spain June 2012 B.S. in Biology -University of A Corua, A Corua, Spain  

E-Print Network [OSTI]

EDUCATION July 2013 M.S. in Genetics - University of A Coruña, A Coruña, Spain June 2012 B.S. in Biology - University of A Coruña, A Coruña, Spain RESEARCH INTERESTS Marine Biology, Genotoxicology, Chromosomal Proteins, Molecular Evolution, Genomics, Molecular Techniques. 2011 University of A Coruña, Spain

Eirin Lopez, Jose Maria


Forging an Ascetic Planet: Jesuit Lives and Virtues on the Mission Frontier of Eighteenth-Century New Spain  

E-Print Network [OSTI]

Atlantic World: Britain and Spain in America, 1492-1830. Newcentury Revolution in Spain. Princeton: Princeton UP, 1958.265-76. Lynch, John. Bourbon Spain, 1700-1808. New York:

Green, Bryan David



ACTIVITY COORDINATOR HOST LOCATION 1.1. Observation session for management level European partners UA Spain  

E-Print Network [OSTI]

UA Spain 1.2. Observation session for Staff level European partners UPMF France 2.1. Development.3. Management meetings UA, PU UA, PU Spain, Jordan 4. Networking and sustainability (network) 3. Capacity


E-Print Network 3.0 - asturias northern spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Publishers. Printed in the Netherlands. Summary: , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo... Spain in Galicia by 1988,...


Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

and Nationality Policies in Argentina, Italy, and Spain (First, I examine Argentinas policy of attracting migrants/and Nationality Policy in Argentina, Italy, and Spain (1850-

Cook Martn, David



Join the College of Business and Behavioral Science in Barcelona, Spain When: First Summer Session 2012  

E-Print Network [OSTI]

Join the College of Business and Behavioral Science in Barcelona, Spain When: First Summer Session 2012 Where: Barcelona, Spain Courses: Clemson University courses taught in English by Clemson Spain's Majestic Costa Brava Current plans call for students and professors to live together

Bolding, M. Chad


PEFC-Certified Fencing for 2010 Pamplona Bull Run JUL 05 2010 | SPAIN  

E-Print Network [OSTI]

PEFC-Certified Fencing for 2010 Pamplona Bull Run JUL 05 2010 | SPAIN This year, the fences marking and to create local jobs. Welcoming the decision, PEFC Spain Director, Ana Noriega commented "we are delighted to PEFC, the world's largest forest certification system and the leading system in Spain, ensuring


Late Quaternary deposition and facies model for karstic Lake Estanya (North-eastern Spain)  

E-Print Network [OSTI]

Late Quaternary deposition and facies model for karstic Lake Estanya (North-eastern Spain) MARIO-50059 Zaragoza, Spain (E-mail: mariomm@ipe.csic.es) EAWAG, Swiss Federal Institute of Aquatic Research Ca´diz, Poli´gono Ri´o San Pedro s/n, 11510 Puerto Real (Ca´diz), Spain Associate Editor: Stephen

Gilli, Adrian


Fire Effects and Fuel Management in Mediterranean Ecosystems in Spain1  

E-Print Network [OSTI]

Fire Effects and Fuel Management in Mediterranean Ecosystems in Spain1 Ricardo Vélez2 1 Presented, California. 2 Doctor Ingeniero de Montes, ICONA - Forest Fire Section, Madrid Spain. Abstract: Forest fuels in the Mediterranean eco- systems of Spain are characterized by generalized pyrophytism and large accumulations

Standiford, Richard B.


Country Profile -Spain What are my chances of getting a job?  

E-Print Network [OSTI]

1 Country Profile - Spain Job market What are my chances of getting a job? Finding graduate work in Spain is currently very difficult as unemployment is extremely high. In March 2012 the BBC reported that Spain has the highest unemployment rate in the European Union (EU), with almost one in four people

Banaji,. Murad


Astronomical forcing of sedimentary cycles in the middle to late Miocene continental Calatayud Basin (NE Spain)  

E-Print Network [OSTI]

Basin (NE Spain) H. Abdul Aziz aY *, F. Hilgen a , W. Krijgsman b , E. Sanz c , J.P. Calvo d, Spain d Departemento de Petrologia y Geoqu|¨mica, Fac. CC. Geolo¨gicas, Universidad Complutense, 28040 Madrid, Spain Received 16 August 1999; received in revised form 28 January 2000; accepted 29 January 2000

Utrecht, Universiteit


Numerical simulation and sensitivity study of a severe hailstorm in northeast Spain  

E-Print Network [OSTI]

Numerical simulation and sensitivity study of a severe hailstorm in northeast Spain E. García Atmósfera, Instituto de Medio Ambiente, Universidad de León, 24071 León, Spain b Grup de Meteorologia, Departament de Física, Universitat de les Illes Balears, Palma de Mallorca, Spain Accepted 8 August 2005

Romero, Romu


A Comparison of Management Strategies in the Oak Woodlands of Spain and California1  

E-Print Network [OSTI]

A Comparison of Management Strategies in the Oak Woodlands of Spain and California1 Lynn Huntsinger and savannas in California and southern Spain are compared. There are many similarities between the Spanish woodlands and savanna in California and southern Spain (table 1). Although the two woodlands have much

Standiford, Richard B.

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cultural Capital in Spain'S MeMory WarS Dr. SebaStiaan Faberoberlin College  

E-Print Network [OSTI]

History MeMory trutH Cultural Capital in Spain'S MeMory WarS Dr. SebaStiaan Faberoberlin College Since the late 1990s, Spain has seen a series of public disputes over the historical memory tell it--and the relationship that today's Spain should have with that past. In the past fifteen years

Andrews, Peter B.


SPAIN: COTS Data-Center Ethernet for Multipathing over Arbitrary Topologies  

E-Print Network [OSTI]

SPAIN: COTS Data-Center Ethernet for Multipathing over Arbitrary Topologies Jayaram Mudigonda switches, which could obviate the commodity pricing of these parts. In this paper, we describe SPAIN ("Smart Path Assign- ment In Networks"). SPAIN provides multipath forward- ing using inexpensive


Long-period eccentricity control on sedimentary sequences in the continental Madrid Basin (middle Miocene, Spain)  

E-Print Network [OSTI]

Miocene, Spain) Hemmo A. Abels a,b, , Hayfaa Abdul Aziz a,b , Wout Krijgsman b , Sander J.B. Smeets Madrid Basin (central Spain) is dated bio-magnetostratigraphically between 15.2 Ma and 11.5 Ma-dominated intervals is similar to a previously documented Late Miocene shift in the Teruel Basin of northeast Spain

Utrecht, Universiteit


Cestodes from Artemia parthenogenetica (Crustacea, Branchiopoda) in the Odiel Marshes, Spain  

E-Print Network [OSTI]

Cestodes from Artemia parthenogenetica (Crustacea, Branchiopoda) in the Odiel Marshes, Spain/n, 41013 Seville, Spain Abstract A total of 3,300 specimens of brine shrimps Artemia parthenogenetica from the Odiel Marshes, Huelva Province, SW Spain, were studied during several seasons of 2002 and 2003

Green, Andy J.


2011-2012BROWNBAGCOLLOQUIUMSERIES A Gambler's Penance in Seventeenth Century Spain  

E-Print Network [OSTI]

2011-2012BROWNBAGCOLLOQUIUMSERIES A Gambler's Penance in Seventeenth Century Spain WEDNESDAY, and Collaboration in Early Modern Spain," has been published in 2011. He has also published various chapters in books about Cervantes or about Masculinity in Spain and Italy. Additionally, he is a member

Berdichevsky, Victor



E-Print Network [OSTI]

SEDIMENTARY ARCHITECTURE AND CONTROLING MECHANISMS, LLOBREGAT DELTA, HOLOCENE-PLEISTOCENE (SPAIN baixa. E-08034 Barcelona, Spain. E-mail: (desire.gamez@upc.edu) 2 ICREA, Geomodels- Dep. of Geotechnical Madrid, Spain The reconstruction of the sedimentary architecture of the Llobregat delta is based

Politècnica de Catalunya, Universitat



E-Print Network [OSTI]

Chapter MODELING MULTIFUNCTIONAL AGROFORESTRY SYSTEMS WITH ENVIRONMENTAL VALUES: DEHESA IN SPAIN Research (CSIC) Pinar 25, 28006, Madrid, Spain. e-mail: pcampos@ieg.csic.es; acaparros@ieg.csic.es 2 University Complutense, Madrid, Spain. E-mail: ecerdate@ccee.ucm.es 3 College of Natural Resources

Standiford, Richard B.


Analysis of badlands: coupling of tectonic and land surface processes in the Pyrenees of Spain  

E-Print Network [OSTI]

Analysis of badlands: coupling of tectonic and land surface processes in the Pyrenees of Spain MSc to rainstorms. In north-east Spain, sediment from rapidly eroding badlands has significantly reduced reservoir-funded research consortium (SESAM II) with partners at the University of Lleida, Spain

Baer, Christian


Testing models for the Messinian salinity crisis: The Messinian record in Almera, SE Spain  

E-Print Network [OSTI]

Testing models for the Messinian salinity crisis: The Messinian record in Almería, SE Spain Juan C Fuentenueva s.n., Universidad de Granada, 18002 Granada, Spain b School of Earth, Ocean and Planetary Sciences, SE Spain, display excellent exposures of Messinian (Late Miocene) sequences. The Sorbas, Almería

Riding, Robert


Last updated: June 13, 2013 4:29 pm Brain drain in Spain leaves  

E-Print Network [OSTI]

Last updated: June 13, 2013 4:29 pm Brain drain in Spain leaves scientific research on the wane By Tobias Buck in Madrid Amaya Moro-Martín returned to Spain five years ago, after spending 11 years generous funding and a tenured position in Spain. Ms Moro-Martín's fellowship runs out at the end

Moro-Martin, Amaya



E-Print Network [OSTI]

FEEDING ECOLOGY OF THE BARN OWL IN CENTRAL CHILE AND SOUTHERN SPAIN: A COMPARATIVE STUDY CARLOSM. HERREV&AND FABIANM. JAKSI·1 EstacidnBioldgicade Dogaria, Sevilla-12, Andalucia, Spain, and Instituto de of the Barn Owl (Tyro alba) in the mediterranean- climate areasof central Chile and southernSpain. In both

Herrera, Carlos M.


First report of Neofusicoccum parvum causing canker and die-back of Eucalyptus in Spain  

E-Print Network [OSTI]

First report of Neofusicoccum parvum causing canker and die-back of Eucalyptus in Spain Eugenia disease in Eucalyptus globulus in North Spain. Keywords Eucalyptus canker. Neofusicoccum parvum . Botryosphaeriaceae A canker disease outbreak was observed for the first time on Eucalyptus globulus in North Spain


Seropositivity and Risk Factors Associated with Toxoplasma gondii Infection in Wild Birds from Spain  

E-Print Network [OSTI]

Spain Oscar Cabezo´ n1 , Ignacio Garci´a-Bocanegra2 , Rafael Molina-Lo´ pez3 , Ignasi Marco1 , Juan M Veterinaria, Universitat Auto`noma de Barcelona, Bellaterra, Spain, 2 Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad de Co´rdoba, Co´rdoba, Spain, 3 Centre de Fauna Salvatge de Torreferrussa

Richner, Heinz


Facultad de Ciencias Econmicas y Empresariales CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN.  

E-Print Network [OSTI]

IN SPAIN. (SUMMER 2011) Lecturer: Ms. Pilar Barra. Department: Finance and Accounting. Universidad de intercultural communication. - To learn both business etiquette and the way to negotiate in Spain. - To analyse the keys to improve business negotiations in Spain. CONTENTS 0.- Introduction. Stereotypes 1.- Influences

Escolano, Francisco


BC3954/BC5974 Construction and Culture through Spain and Portugal  

E-Print Network [OSTI]

BC3954/BC5974 Construction and Culture through Spain and Portugal December 27, 2014 ­ January 11 and Culture through Spain and Portugal December 27, 2014 ­ January 11, 2015 The Department of Building Construction is offering its 13th annual interdisciplinary Winter Education Abroad Program through Spain

Beex, A. A. "Louis"


WORKING PAPER N 2007 -39 Income and wealth concentration in Spain in a  

E-Print Network [OSTI]

WORKING PAPER N° 2007 - 39 Income and wealth concentration in Spain in a historical and fiscal and Wealth Concentration in Spain in a Historical and Fiscal Perspective Facundo Alvaredo, Paris School of income and wealth in Spain over the 20th century using personal income and wealth tax return statistics

Boyer, Edmond


Holocene forest history of the eastern plateaux in the Segura Mountains (Murcia, southeastern Spain)  

E-Print Network [OSTI]

Holocene forest history of the eastern plateaux in the Segura Mountains (Murcia, southeastern Spain´nica), Facultad de Biologi´a, Universidad de Murcia, Campus de Espinardo, 30100 Murcia, Spain b Area de Bota´nica, Facultad de Ciencias, Universidad Auto´noma de Barcelona, 01893 Bellaterra, Barcelona, Spain c School

Herrera, Carlos M.


Madrid, Spain *This program is offered every Summer, Spring and Fall  

E-Print Network [OSTI]

Madrid, Spain *This program is offered every Summer, Spring and Fall To view the most recent information about the Spanish Language Immersion Program in Spain please go to the SDSU College of Extended 2009 Gloria Cossio and Jose Alberto Martinez Spain Summer 2008 Experience by Rodolfo Nubes My

Ponce, V. Miguel


Complementary Pu Resuspension Study at Palomares, Spain  

SciTech Connect (OSTI)

Soil in an area near Palomares, Spain, was contaminated with plutonium as a result of a mid-air collision of U.S. military aircraft in January 1966. The assessment for potential inhalation dose can be found in Iranzo et al., (1987). Long-term monitoring has been used to evaluate remedial actions (Iranzo et al., 1988) and there are many supporting studies of the Pu contamination at Palomares that have been carried out by the Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas (CIEMAT) in Madrid. The purpose of this study is to evaluate the resuspension of Pu from the soil in terms of Pu-concentrations in air and resuspension rates in a complementary investigation to those of CIEMAT but in an intensive short-term field effort. This study complements the resuspension studies of CIEMAT at Palomares with additional information, and with confirmation of their previous studies. Observed mass loadings (M) were an average of 70 mg/m{sup 3} with peaks in the daytime of 130 mg/m{sup 3} and low values at night below 30 {micro}g/m{sup 3}. The Pu-activity of aerosols (A) downwind of plot 2-1 was 0.12 Bq/g and the enhancement factor (E{sub f}) had a value of 0.3, which is low but similar to a typical value of 0.7 for other undisturbed sites. This E{sub f} value may increase further away from ground zero. The particle size distribution of the Pu in air measured by cascade impactors was approximately lognormal with a median aerodynamic diameter of 3.7 {micro}m and a geometric standard deviation of 3.5 in the respirable range. This peak midway between 1 ? m and 10 {micro}m in the respirable range is commonly observed. Daily fluctuations in the Pu concentration in air (C) detected by the UHV were lognormally distributed with a geometric standard deviation of 4.9 indicating that the 98th percentile would be 24 times as high as the median. Downwind of plot 2-1 the mean Pu concentration in air, C, was 8.5 {micro}Bq/m{sup 3}. The resuspension factor (Sf) was 2.4 x 10{sup -10} m{sup -1} and agrees very well with the values between 10{sup -10} m{sup -1} and 10{sup -9} m{sup -1} previously reported. We observed a mean Pu/Am ratio of 7.1 with a relative variation of 30%, which compares well with a mean value of 6.5 for nearby plot 2-2. The resuspension rate (R) was in the middle of the range, 10{sup -11} s{sup -1} to 10{sup -12} s{sup -1} as observed in other stable sites, and indicates low potential for Pu redistribution.

Shinn, J



Paternal Genetic History of the Basque Population of Spain  

E-Print Network [OSTI]

This study examines the genetic variation in Basque Y chromosome lineages using data on 12 Y-short tandem repeat (STR) loci in a sample of 158 males from four Basque provinces of Spain (Alava, Vizcaya, Guipuzcoa, and Navarre). As reported...

Young, Kristin Leigh; Sun, Guangyun; Deka, Ranjan; Crawford, Michael H.


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain)  

E-Print Network [OSTI]

The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain): Implications Recherche Développement, Carbonate Sedimentology Group, avenue Larribau s/n, 64018 Pau Cedex - France e'Espagne) sont présentées dans cette étude. Les corps dolomitiques sont encaissés dans des carbonates de

Paris-Sud XI, Université de


1 INTRODUCTION In Spain, Plasticized polyvinyl chloride (PVC-  

E-Print Network [OSTI]

1 INTRODUCTION In Spain, Plasticized polyvinyl chloride (PVC- P) geomembranes began being used in waterproof- ing of infrastructure in the seventies. Early usage of PVC-P geomembranes was not particularly for the PVC-P homogeneous geomem- branes used in roofing. Subsequently, other stan- dards were drafted

Zornberg, Jorge G.


July 2010 M.S. in Molecular, Cellular Biology and Genetics -University of A Corua, A Corua, Spain. July 2009 B.S. in Biology -University of A Corua, A Corua, Spain.  

E-Print Network [OSTI]

, A Coruña, Spain. July 2009 B.S. in Biology - University of A Coruña, A Coruña, Spain. RESEARCH INTERESTS, Spain. ISBN:978-3-8484-5960-8, pp. 1-66. Ciro Rivera-Casas Ph. D. Student - Department of Cellular15171, Spain GRANTS Grants as a particioant researcher 2011 MICINN, Spanish Research Program

Eirin Lopez, Jose Maria


A review of "Conscience on Stage: The Comedia as Casuistry in Early Modern Spain" by Hillaire Kallendorf  

E-Print Network [OSTI]

, social and cultural historians? (20). Hilaire Kallendorf. Conscience on Stage: The Comedia as Casuistry in Early Modern Spain. Toronto: University of Toronto Press, 2007. x + 299 pp. $65. Review by elizabeth r. wright, university of georgia. Spain?s... playwrights. Yet a miniscule proportion of plays have attracted careful and sustained scholarly scrutiny or are performed regularly in repertories. This book reports on one scholar?s project to widen the lens through which we view Spain?s ?Golden Age...

Wright, Elizabeth



Tourism's Impact on Economic Growth and Development in Spain  

E-Print Network [OSTI]

Tourism's Impact on Economic Growth and Development in Spain Jessica Dennis #12;Spanish Civil War,500,000,000 International Tourism Receipts 1960-2008 (US$ in year 2000) #12;$0 $200,000,000,000 $400,000,000,000 $600 (US$ in the year 2000) #12;0.00% 1.00% 2.00% 3.00% 4.00% 5.00% 6.00% International Tourism Receipts

New Hampshire, University of


amyl acetate: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

tissues retain donor characteristics. G. Krueger; Donald A; Jane Shelby 187 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


antibiotika til hunde: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Malin Lundquist Britta ?nnegren CMTS CMTS CMTS ulran Merkel, Magnus 310 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.1.4...


acetate nomac estradiol: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

tissues retain donor characteristics. G. Krueger; Donald A; Jane Shelby 282 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


adaptive support vector: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(GPDS) Doctor Moliner 50, 46100, Burjassot, Valencia - Spain 3- University Hospital Virgen de la Arrixaca - Lab. of Electrophysiology Ct. Madrid-Cartagena sn, 30120, El...


arterias digitales palmares: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(GPDS) Doctor Moliner 50, 46100, Burjassot, Valencia - Spain 3- University Hospital Virgen de la Arrixaca - Lab. of Electrophysiology Ct. Madrid-Cartagena sn, 30120, El...


amyloid fibril mass-per-length: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(GPDS) Doctor Moliner 50, 46100, Burjassot, Valencia - Spain 3- University Hospital Virgen de la Arrixaca - Lab. of Electrophysiology Ct. Madrid-Cartagena sn, 30120, El...


E-Print Network 3.0 - abstracts boron americas Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Chemistry, University of Pittsburgh Collection: Chemistry ; Materials Science 90 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1.5...


26 IEEE COMPUTATIONAL INTELLIGENCE MAGAZINE | NOVEMBER 2011 1556-603X/11/$26.002011IEEE European Centre for Soft Computing, SPAIN  

E-Print Network [OSTI]

, European Centre for Soft Computing, SPAIN O. Cordón, European Centre for Soft Computing, SPAIN CITIC-UGR: Research Center on Information and Communication Technologies, University of Granada, 18014 Granada, SPAIN, SPAIN J. Santamaría, University of Granada, SPAIN #12;NOVEMBER 2011 | IEEE COMPUTATIONAL INTELLIGENCE

Granada, Universidad de


E-Print Network 3.0 - ai seville spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Spain Universidad de Alicante CIEE, Council 20th Century Spanish......


E-Print Network 3.0 - arousa nw spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on Nutrient and Phytoplankton Dynamics in a Shallow Estuary After Summary: Kingdom (Wash, Thames estuary, Horecambe and Caenarfon bays), in Spain (Galice, Mediterranean coast......


E-Print Network 3.0 - almeria spain alteracion Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

del Grup d'Hidrologia Subterrnia Dept. Enginyeria del Terreny, Cartogrfica i Geofsica UPC Summary: Groundwater flow and recharge in the Doana aquifer system (Huelva, SW Spain)...


E-Print Network 3.0 - algeciras spain steel Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

lower values than model columns... : at a station in Spain. Bottom: at a station in Netherland. The model simulation with assimilation shows better Source: Ecole Polytechnique,...


International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

Tools of transmission in Germany 2.1. Power of attorney postas being unconstitutional. 33 Germany's Constitutional CourtRecent Developments in Germany and Spain Business Roland

Krause, Roland



Continuous Time Random Walks and South Spain Seismic Series  

E-Print Network [OSTI]

Levy flights were introduced through the mathematical research of the algebra or random variables with infinite moments. Mandelbrot recognized that the Levy flight prescription had a deep connection to scale-invariant fractal random walk trajectories. The theory of Continuous Time Random Walks (CTRW) can be described in terms of Levy distribution functions and it can be used to explain some earthquake characteristics like the distribution of waiting times and hypocenter locations in a seismic region. This paper checks the validity of this assumption analyzing three seismic series localized in South Spain. The three seismic series (Alboran, Antequera and Loja) show qualitatively the same behavior, although there are quantitative differences between them.

A. Posadas; J. Morales; F. Vidal; O. Sotolongo-Costa; J. C. Antoranz



Association of Renewable Energy Producers Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine: Energy Resources JumpAspen Aerogels JumpRenewable Energy Producers Spain

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


BeyWatch (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: Energy ResourcesJersey: EnergyBerthoud,Biodiesel Place: Orem,BeyWatchSpain)


Spain Installed Wind Capacity Website | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA Region -SonelgazSunbelt Wind FarmSouthwestSpain


Theory Auger neutralization and deexcitation slow ions metal surfaces Materialen Fisika Kimika Fakultatea, 1072 Postakutxatila, Euskal Herriko Unibertsitatea, 20080 Donostia, Spain  

E-Print Network [OSTI]

Kimika Fakultatea, 1072 Postakutxatila, Euskal Herriko Unibertsitatea, 20080 Donostia, Spain Lorente Unibertsitatea, 20080 Donostia, Spain Unidad Asociada al Instituto Ciencia Ciencia Materiales, C.S.I.C., Cantoblanco, 28049 Madrid, Spain #Received contribution of conduction electrons to Auger neutralization

Muiño, Ricardo Díez


The 1964 Festival of Music of the Americas and Spain: A Critical Examination of Ibero-American Musical Relations in the Context of Cold War Politics  

E-Print Network [OSTI]

Rodrigo dies, telling him that Spain will be reborn from theAsturias. All bells of Spain miraculously toll at Rodrigos1964): 6. . Bases in Spain. The Washington Post, 10

Payne, Alyson



8th International Symposium on Growth and Nutrition in Children with Chronic Renal Disease: 2830 May 2009, Oviedo, Asturias, Spain  

E-Print Network [OSTI]

2009, Oviedo, Asturias, Spain Fernando Santos & Frederick J.of Oviedo, Oviedo, Asturias, Spain F. J. Kaskel Montefiores/n, 33006 Oviedo, Asturias, Spain e-mail: fsantos@uniovi.es

Santos, Fernando; Kaskel, Frederick J.; Mak, Robert H.; Caldas, Alberto



July 2012 M.S. in Molecular Cellular and Genetic Biology (honors) -University of A Corua, A Corua, Spain July 2011 B.S. in Biology -University of A Corua, A Corua, Spain  

E-Print Network [OSTI]

of A Coruña, A Coruña, Spain July 2011 B.S. in Biology - University of A Coruña, A Coruña, Spain RESEARCH, University of A Coruña, Spain. Advisors: Dr. Jose M. Eirin Lopez, Dr. Josefina Mendez. 2011 - 2012 Master student, Dept. Cellular and Molecular Biology, University of A Coruña, Spain. 2005 - 2011 Bachelor student

Eirin Lopez, Jose Maria


Quality of environmental impact statements in Portugal and Spain  

SciTech Connect (OSTI)

One of the key steps of the Environmental Impact Assessment Process, defined by Directive 337/85 'on the assessment of the effects of certain public and private projects' is the preparation of the Environmental Impact Statement (EIS) of a Project. The quality of the EIS is of great importance to properly inform the public and the decision makers about the significant environmental effects of the project. Using the 'Guidance on EIA-EIS Review' 2001 report, produced with the support of the European Commission, this paper analyses the overall quality of 46 recently elaborated EIS from Portugal and Spain (1998-2003). It also analyses the quality of the various chapters of the EIS and the Non-Technical Summary. A comparison is made between the quality of the EIS from Portugal and from Spain. The results for Portugal are also compared with those of other European countries (Ireland and United Kingdom) in similar periods. Finally it presents overall conclusions and suggestions for improvement.

Canelas, Leonel; Almansa, P.; Merchan, M.; Cifuentes, Pedro



Helsinki Journal, Entry 38, April 22, 2007 Well, we have successfully completed our eleven day trip to Spain. Our itinerary  

E-Print Network [OSTI]

to Spain. Our itinerary was as follows: catch a morning flight from Helsinki to Barcelona, sightsee-efficient design and architecture, but thank God for countries like Spain, where beauty can trump practicality

Bardsley, John


CEEI Valencia | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Areais3: Crystalline Rock - Basement JumpGeneral:CEEGGALICIA S


November 2010-Ph.D. in Biology. University of A Corua, Spain. Dr. J.M. Eirin-Lopez, advisor (Genetics, Evolution). July 2007-M.S. in Genetics and Biochemistry University of A Corua, Spain.  

E-Print Network [OSTI]

EDUCATION November 2010- Ph.D. in Biology. University of A Coruña, Spain. Dr. J.M. Eirin-Lopez, advisor (Genetics, Evolution). July 2007- M.S. in Genetics and Biochemistry University of A Coruña, Spain. July 2005- B.S. in Biology (honors). University of A Coruña, Spain. RESEARCH INTERESTS Marine Biology

Eirin Lopez, Jose Maria


Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter


Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter


Use of high-resolution ichnological and stable isotope data for assessing completeness of a KP boundary section, Agost, Spain  

E-Print Network [OSTI]

­P boundary section, Agost, Spain Francisco J. Rodri´guez-Tovar a,*, Francisca Marti´nez-Ruiz b , Stefano M. Bernasconi c a Departamento de Estratigrafi´a y Paleontologi´a, Universidad de Granada, 18002 Granada, Spain b Instituto Andaluz de Ciencias de la Tierra CSIC-Universidad de Granada, 18002 Granada, Spain c

Gilli, Adrian


See also http://www.umass.edu/loop/content/civil-andenvironmental-engineering-student-wins-fulbright-study-rail-transportation-spain  

E-Print Network [OSTI]

See also http://www.umass.edu/loop/content/civil-andenvironmental-engineering- student-wins-fulbright-study-rail-transportation-spain to study transportation engineering in Madrid, Spain during 2013-2014. I had the good fortune to meet with Radha a short time ago and learned during our conversation that while abroad in Spain, one of her

Massachusetts at Amherst, University of


On the late Miocene closure of the MediterraneanAtlantic gateway through the Guadix basin (southern Spain)  

E-Print Network [OSTI]

(southern Spain) S.K. Hüsing a, , O. Oms b , J. Agustí c , M. Garcés d , T.J. Kouwenhoven e , W. Krijgsman, 08193 Bellaterra, Spain c Institut de Paleontologia M. Crusafont, Escola Industrial 23, 08201 Sabadell, Spain d Group of Geodynamics and Basin Analysis, University of Barcelona, Campus de Pedralbes, 08028

Utrecht, Universiteit


CAMBRIDGE, U.K., AND BARCELONA, SPAIN--As the horse-trading to select a site for the Inter-  

E-Print Network [OSTI]

CAMBRIDGE, U.K., AND BARCELONA, SPAIN--As the horse-trading to select a site for the Inter studying four candidate sites, in Canada, Japan, France, and Spain. To boost its odds, the E.U. decided to put forward only one candidate--either Cadarache in France or Vandellòs in Spain--and asked David King


STANDARD RESIDUE REGULATIONS FOR CHLORAMPHENICOL Departmento de Farmacologia y Toxicologia, Facultad de Veterinaria, Universidad de Leon, Spain  

E-Print Network [OSTI]

STANDARD RESIDUE REGULATIONS FOR CHLORAMPHENICOL IN SPAIN A. ANADON Departmento de Farmacologia y Toxicologia, Facultad de Veterinaria, Universidad de Leon, Spain Chloramphenicol is an antibiotic widely used forms mainly used in Spain are the free base, succinate and palmitate and the dosage forms

Boyer, Edmond


A Statistical Adjustment of Regional Climate Model Outputs to Local Scales: Application to Platja de Palma, Spain  

E-Print Network [OSTI]

de Palma, Spain A. AMENGUAL Grup de Meteorologia, Departament de Fi´sica, Universitat de les Illes Mallorca, Spain V. HOMAR AND R. ROMERO Grup de Meteorologia, Departament de Fi´sica, Universitat de les Illes Balears, Palma de Mallorca, Spain S. ALONSO Grup de Meteorologia, Departament de Fi

Romero, Romu


The multi-dimensional additionality of innovation policies. A multi-level application to Italy and Spain.  

E-Print Network [OSTI]

and Spain. Alberto Marzucchi & Sandro Montresor October 2012 Preliminary ­ Do not quote without prior, at the national and regional level (multi-level). An empirical application is carried out for Italy and Spain, while they show output additionality in Spain only, where they are also able to spur innovative

Sussex, University of


Birori Goa Lima Mexico City Lisbon Naples Palermo Seville Soriano Liampo Villanovafranca Beyond Italy and New Spain  

E-Print Network [OSTI]

Italy and New Spain Itineraries for an Iberian Art History (1440-1640) Convened by Michael Cole Iberian Europe to the Kingdom of the New Spain. New proposals of itineraries for the origin and interpretation of corn cane sculptures Joana Barreto (Villa Medici, Rome): Spain, Italy, Flanders: Some Dynamics

Qian, Ning

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tornadoes over complex terrain: an analysis of the 28th August 1999 tornadic event in eastern Spain  

E-Print Network [OSTI]

Tornadoes over complex terrain: an analysis of the 28th August 1999 tornadic event in eastern Spain Fi´sica, Universitat de les Illes Balears, Palma de Mallorca 07071, Spain b Instituto Nacional de Meteorologi´a, Centre Meteorolo`gic a les Illes Balears, Palma de Mallorca, Spain c IMEDEA, UIB-CSIC, Palma de

Romero, Romu


Nonlinear Invertible Representation for Joint Statistical and Perceptual Feature Decorrelation  

E-Print Network [OSTI]

. Malo 1 , R. Navarro 3 , I. Epifanio 2 , F. Ferri 2 , and J.M. Artigas 1 1 Dpt. d' ` Optica, Universitat Burjassot, Val`encia, Spain 3 Instituto de ' Optica (CSIC) C/ Serrano 122, 28006 Madrid, Spain Abstract

Malo, Jesus


Designing the properties of dispersion-flattened photonic crystal fibers  

E-Print Network [OSTI]

Silvestre, and Pedro Andr´es Departament d' `Optica, Universitat de Val`encia, E-46100 Burjassot, Spain albert.ferrando@uv.es Juan J. Miret Departament d' `Optica, Universitat d'Alacant, E-03080 Alacant, Spain

Fernández de Córdoba, Pedro


Stabilization and restoration of an uranium mill site in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings site has been remediated in place. Mill equipment, buildings and process facilities have been dismantled and demolished and 06q the resulting metal wastes and debris have been placed in the tailings pile. The tailings mass has been reshaped by flattening the sideslopes to improve stability and a cover system has been placed over the pile. Remedial action works started in February 1991 and were completed by April 1994. This paper describes the remediation works for the closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the stabilization of the tailings pile.

Santiago, J.L.; Estevez, C.P. [ENRESA, Madrid (Spain)



IEEE TRANSACTIONS ON IMAGE PROCESSING, VOL. XX, NO. Y, MONTH Z 2004 1 Non-Linear Image Representation for Efficient  

E-Print Network [OSTI]

is with the Department d' `Optica, Universitat de Val`encia, 46100 Burjas- sot, Val`encia, Spain (jesus.malo@uv.es, http. RN is with Instituto de ´Optica, CSIC, Spain. EPS is with Howard Hughes Medical Institute, Center

Simoncelli, Eero


INFORMATION MEETINGS: HBC 340-G from 12:00-1:00 on Wednesday, 9/28 Spend Spring Break in Spain  

E-Print Network [OSTI]

in Spain Spring break 2012 in Madrid, Toledo and Barcelona SPA 300.3 Culture and Arts of Spain (1 and monuments in Castile Tuesday, March 13: Excursion to Toledo Lecture Jewish Spain and El Greco's paintings in Toledo Group lunch in Toledo Wednesday, March 14: Contemporary Spain

Kovalev, Leonid



E-Print Network [OSTI]


Royal Holloway, University of London


Marta Poblet, Universitat Autonoma de Barcelona, Spain (Ed.) Mobile Technologies for Conflict  

E-Print Network [OSTI]

in conflict prevention and dispute management aiming to learn how mobile technologies can play a disruptive. Mobile Technologies, Conflict Management, and ODR: Exploring Common Grounds; Marta Poblet.- Part IMarta Poblet, Universitat Autonoma de Barcelona, Spain (Ed.) Mobile Technologies for Conflict

Autnoma de Barcelona, Universitat


To Spain and Back: Changing Roles and Identities of Ecuadorian Female Migrants  

E-Print Network [OSTI]

In the late 1990s and early 2000s, Ecuadorian migration to Spain expanded due to economic and political push and pull factors between the two countries. Through the feminization of migration, women came to represent approximately half of all...

Dudley, Lindsay Erin



Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

oil output Cumulative oil production tons/acre 5.68b 5.83bmodern hedgerow olive oil production in Spain Paul M. VossenNinot Traditional olive oil production is limited by its

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia



E-Print Network 3.0 - area cadiz spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Sample search results for: area cadiz spain Page: << < 1 2 3 4 5 > >> 1 CURRICULUM VITAE (update October 2007) Mariana Ribas Ribas mariana.ribas@uca.es Summary: ....


Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

Energy Researh (SEfAS) Norway Ms. Grnli has been workingPower Research Institute), Norway, since 1995. She holds aGRID ACCESS AND PRICING IN NORWAY, SPAIN AND CALIFORNIA A

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris



Contribution (Poster) TNT2008 September 01-05, 2008 Oviedo-Spain  

E-Print Network [OSTI]

Contribution (Poster) TNT2008 September 01-05, 2008 Oviedo-Spain LIGHT EMITTING DIODES ON SILICON) or quantum well (QW) light-emitting diodes by molecular beam epitaxy to obtain direct band gaps on GaP grown

Boyer, Edmond


E-Print Network 3.0 - anesthesia santiago spain Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

groups J. Lopez-Santiago... Complutense de Madrid, E-28040 Madrid, Spain. (dmg@astrax.fis.ucm.es) During the last years (1999 - 2004), our Source: Gutirrez, David Montes -...


E-Print Network 3.0 - andalusia sothern spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

6164, 2008 www.adv-sci-res.net2612008 Summary: , in Spain, Eastern Andalusia (AOR), Aragon (ARN), the Balearic Islands (BAL), Castilla la Man- cha (MCM... ogico en Illes...


The Photovoltaic Crisis and the Demand-side Generation in Spain  

E-Print Network [OSTI]

The RES-E promotion policy in Spain gave priority to the photovoltaic (henceforth, PV) ground-mounted installations. For years, the coupling of customer-side generation coupled with excess energy exports was never specifically considered. However...

Mir-Artigues, Pere



Arsenic in public water supplies and cardiovascular mortality in Spain  

SciTech Connect (OSTI)

Background: High-chronic arsenic exposure in drinking water is associated with increased cardiovascular disease risk. At low-chronic levels, as those present in Spain, evidence is scarce. In this ecological study, we evaluated the association of municipal drinking water arsenic concentrations during the period 1998-2002 with cardiovascular mortality in the population of Spain. Methods: Arsenic concentrations in drinking water were available for 1721 municipalities, covering 24.8 million people. Standardized mortality ratios (SMRs) for cardiovascular (361,750 deaths), coronary (113,000 deaths), and cerebrovascular (103,590 deaths) disease were analyzed for the period 1999-2003. Two-level hierarchical Poisson models were used to evaluate the association of municipal drinking water arsenic concentrations with mortality adjusting for social determinants, cardiovascular risk factors, diet, and water characteristics at municipal or provincial level in 651 municipalities (200,376 cardiovascular deaths) with complete covariate information. Results: Mean municipal drinking water arsenic concentrations ranged from <1 to 118 {mu}g/L. Compared to the overall Spanish population, sex- and age-adjusted mortality rates for cardiovascular (SMR 1.10), coronary (SMR 1.18), and cerebrovascular (SMR 1.04) disease were increased in municipalities with arsenic concentrations in drinking water >10 {mu}g/L. Compared to municipalities with arsenic concentrations <1 {mu}g/L, fully adjusted cardiovascular mortality rates were increased by 2.2% (-0.9% to 5.5%) and 2.6% (-2.0% to 7.5%) in municipalities with arsenic concentrations between 1-10 and>10 {mu}g/L, respectively (P-value for trend 0.032). The corresponding figures were 5.2% (0.8% to 9.8%) and 1.5% (-4.5% to 7.9%) for coronary heart disease mortality, and 0.3% (-4.1% to 4.9%) and 1.7% (-4.9% to 8.8%) for cerebrovascular disease mortality. Conclusions: In this ecological study, elevated low-to-moderate arsenic concentrations in drinking water were associated with increased cardiovascular mortality at the municipal level. Prospective cohort studies with individual measures of arsenic exposure, standardized cardiovascular outcomes, and adequate adjustment for confounders are needed to confirm these ecological findings. Our study, however, reinforces the need to implement arsenic remediation treatments in water supply systems above the World Health Organization safety standard of 10 {mu}g/L.

Medrano, Ma Jose, E-mail: pmedrano@isciii.es [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Boix, Raquel; Pastor-Barriuso, Roberto [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Palau, Margarita [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain)] [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain); Damian, Javier [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Ramis, Rebeca [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain) [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); CIBER en Epidemiologia y Salud Publica (CIBERESP), Madrid (Spain); Barrio, Jose Luis del [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain)] [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain); Navas-Acien, Ana [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States) [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Department of Epidemiology, Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States)



Genetic Variation in the Population of Ibiza (Spain): Genetic Structure, Geography, and Language  

E-Print Network [OSTI]

Genetic Variation in the Population of Ibiza (Spain): Genetic Structure, Geography, and Language ANTONIA PICORNELL,' ANA MIGUEL,' JOSE A. CASTRO,' M. MISERICORDIA RAMON,' RECTOR ARYA,2 AND M.H. CRAWFORD2 Abstract A sample of 203 individuals from... Ibiza (Balearic Islands, Spain) were tested for blood group and serum protein genetic variation and compared with other circum-Mediterranean populations. Allele fre- quencies were calculated for the following blood group and serum sys- tems: ABO, Rh...

Picornell, Antonia; Miguel, Ana; Castro, Jose A.; Ramon, M. Misericordia; Arya, Rector; Crawford, Michael H.



International Work Placement Case Study: Les Sol de Portecarrero, Almeria, Lara spent nine months in 2011/2012 as an English teaching assistant in Almeria in Spain  

E-Print Network [OSTI]

International Work Placement Case Study: Les Sol de Portecarrero, Almeria, Spain Lara spent nine months in 2011/2012 as an English teaching assistant in Almeria in Spain at Les Sol de Portocarrero

Mumby, Peter J.

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Time-resolved pattern evolution in a large-aperture class A laser Nonlinear Dynamics and Chaos Group. Universidad Rey Juan Carlos, 28933 Mostoles, Madrid, Spain  

E-Print Network [OSTI]

and Chaos Group. Universidad Rey Juan Carlos, 28933 Mo´stoles, Madrid, Spain J. M. Guerra Departamento de Optica, Facultad de Ciencias Fi´sicas, Universidad Complutense de Madrid, 28040 Madrid, Spain Received 15

Rey Juan Carlos, Universidad


Phone: (+34) 965 90 3707 -Fax: (+34) 965 90 3678 -email: dic@ua.es -twitter: @dic_ua Po. Box 99 -03080 -Alicante (Spain)  

E-Print Network [OSTI]

. Box 99 - 03080 - Alicante (Spain) NEWS & EVENTS PROFESSOR FLORENTINO REGALADO, AWARDED THE MEDAL Raspeig s/n 03690 San Vicente del Raspeig Alicante (Spain) Tel: (+34) 96 590 3707 Fax: (+34) 96 590 3678

Escolano, Francisco


Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barr 1 Supporting the Specification ofSupporting the Specification of  

E-Print Network [OSTI]

Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 1 Supporting the Specification of #12;Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 2 Outline 1. Research context. Summary and ongoing work #12;Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 3 Research Context

Laforcade, Pierre


Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain Paper number: 197  

E-Print Network [OSTI]

. Madrid, Spain Paper number: 197 #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis

Grilli, Stéphan T.


The Education Office of the Embassy of Spain in Canada would appreciate if your Organization/Institution could circulate among potential candidates this information about  

E-Print Network [OSTI]

The Education Office of the Embassy of Spain in Canada would appreciate if your Organization AND CULTURE TEACHING ASSISTANTS IN SPAIN FOR 2014/2015 (ENGLISH OR FRENCH LANGUAGES) Positions available as an English or French language teaching assistant all over Spain for university graduates or undergraduate


For most of its history Spain had been a country of emigration--sending laborers abroad to find employment. But the latter quarter of the 20th  

E-Print Network [OSTI]

1 I. Problem For most of its history Spain had been a country of emigration--sending laborers abroad to find employment. But the latter quarter of the 20th century has seen Spains status shift from individuals to live and work in the southern European state. Immigrants to Spain come from diverse locations

New Hampshire, University of


First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010  

E-Print Network [OSTI]

First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010 HydroPêche: a way to improve energy efficiency of fishing devices Grégory Germain 1 , Philippe Druault 2 should provide a substantial gain on the fuel consumed of actual fishing devices while maintaining

Lewandowski, Roger


Forms Of Address In The Popular Press: A Comparison of Spain, Mexico and the United States  

E-Print Network [OSTI]

with each form of address. A comparison of forms of address in magazines and newspapers in Spain, Mexico, and the United States reveals certain correlations with speech patterns in those three countries, as well as with the products and services advertised....

Callahan, Laura



Multicomponent reactive transport modeling at the Ratones uranium mine, Cceres (Spain)  

E-Print Network [OSTI]

Multicomponent reactive transport modeling at the Ratones uranium mine, Cáceres (Spain) Modelación management. The Ratones uranium mine was abandoned and flooded in 1974. Due to its reducing underground water, uranium, reactive transport, granite hydrochemistry, Ratones mine. Resumen La inundación de minas

Politècnica de Catalunya, Universitat


The Early Aptian of Aralar (northern Spain): stratigraphy, sedimentology, ammonite biozonation, and OAE1  

E-Print Network [OSTI]

The Early Aptian of Aralar (northern Spain): stratigraphy, sedimentology, ammonite biozonation Stratigraphy Ammonite biozonation TOC Oceanic Anoxic Event 1 a b s t r a c t The stratigraphy, sedimentology. The sedimentology indicates general deposition in a shallow marine environment, corresponding to mixed siliciclastic

Gilli, Adrian


Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality.  

E-Print Network [OSTI]

Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality. samuel networks, S. Johnson, J. J. Torres, J. Marro, and M. A. Muñoz, Physical Review Letters, in press. arXiv: 1002.3286. Evolving networks and the development of neural systems, S. Johnson, J. Marro and J. J

Johnson, Samuel


Tectonic control for evaporite formation in the Eastern Betics (Tortonian; Spain)  

E-Print Network [OSTI]

Tectonic control for evaporite formation in the Eastern Betics (Tortonian; Spain) Wout Krijgsman a for the Venta de la Virgen section by integration of biostratigraphic, magnetostratigraphic and isotopic dating for the emergence of a threshold that finally led to evaporite formation in the Fortuna basin. © 2006 Elsevier B

Utrecht, Universiteit


Impact of the lateral boundary conditions resolution on dynamical downscaling of precipitation in mediterranean spain  

E-Print Network [OSTI]

. We represent the spectrum of GCMs resolutions currently applied in climate change research by using for climate simulation and future climate change assessment (IPCC 2001). Although they incorpo- rate the main in mediterranean spain A. Amengual ? R. Romero ? V. Homar ? C. Ramis ? S. Alonso Received: 27 March 2006 / Accepted

Romero, Romu


Benthic foraminiferal turnover across the Cretaceous/ Paleogene boundary at Agost (southeastern Spain)  

E-Print Network [OSTI]

;c a Departamento de Ciencias de la Tierra, Universidad de Zaragoza, 50009 Zaragoza, Spain b Department of Earth and Environmental Sciences, Wesleyan University, Middletown, CT 06459-0139, USA c Center for the Study of Global, benthic foraminifera are rare. Several opportunistic taxa (e.g. the agglutinant Haplophragmoides sp.) have

Royer, Dana


Organochlorine pesticides in cow's milk from agricultural region in Northwestern Spain  

SciTech Connect (OSTI)

During the past 30 years, the variety and usage of pesticides have increased in Spain and worldwide. Agricultural use of pesticides can be expected to result in residues in or food and feed. Several limited monitoring programs have received an extensive investigation in order to detect residues from organochlorine compounds in milk. This paper reports the findings of a pesticide residue study in cow's milk samples examined during the time period of one year between May of 1987 and March of 1988. The cow's milk samples destined to human consumption were collected from an agrarian area located at a geographic region of northwestern Spain. Analyses were conducted for DDT complex DDT{sub s}, DDD, DDE and isomers alpha, beta and gamma (lindane), aldrin, dieldrin, endrin, heptachlor, heptachlor epoxide, alpha- and beta-endosulfan, metoxichlor and mirex.

La Riva, C. de (Municipal Lab. of Leon, (Spain)); Anadon, A. (Univ. Complutense, Madrid (Spain))



Extended Finite Element Method for Fretting Fatigue Crack Propagation  

E-Print Network [OSTI]

.D. Denia a , F.J. Fuenmayor a aDepartamento de Ingenier´ia Mec´anica y de Materiales Universidad Polit´ecnica de Valencia, Camino de Vera, 46022 Valencia, Spain. bDepartment of Civil and Environmental

Sukumar, N.


INTERNATIONAL JOURNAL FOR NUMERICAL METHODS IN ENGINEERING Int. J. Numer. Meth. Engng 2000; 00:16 Prepared using nmeauth.cls [Version: 2002/09/18 v2.02  

E-Print Network [OSTI]

. Vercher1 1 Departamento de Ingenier´ia Mec´anica y de Materiales, Universidad Polit´ecnica de Valencia, E­46022 Valencia, Spain. 2 Department of Civil and Environmental Engineering, University of California enrichment leads to Correspondence to: Eugenio Giner, Departamento de Ingenier´ia Mec´anica y de Materiales

Sukumar, N.


An Abaqus implementation of the extended finite element method  

E-Print Network [OSTI]

. Taranc´on a , F. J. Fuenmayor a aDepartamento de Ingenier´ia Mec´anica y de Materiales Universidad Polit´ecnica de Valencia, Camino de Vera, 46022 Valencia, Spain. bDepartment of Civil and Environmental

Sukumar, N.


The anatomy of the fruit in relation to the propensity of citrus species to split  

E-Print Network [OSTI]

The anatomy of the fruit in relation to the propensity of citrus species to split A. Garcõ?cnica de Valencia, 46071 Valencia, Spain Accepted 29 March 2000 Abstract The anatomy of the fruit has been of clementine mandarin (Fino, Clementina de Nules and Orogrande), and in Owari satsuma mandarin. The fruit

Ljubljana, University of



E-Print Network [OSTI]

EUROPEAN ORGANIZATION FOR NUCLEAR RESEARCH CERN-PPE/97-162 December 11, 1997 Performance of Long, F.J.P. Solerd, D. Steelei, M. Stipcevicj, M. Veltrik. Abstract This note describes the performance of Valencia, Valencia, Spain. g. Joint Institute for Nuclear Research, Dubna, Russia. h. Dortmund University

Boyer, Edmond

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Formal Verification of Websites1 Sonia Flores2  

E-Print Network [OSTI]

. As expected in any software project, the web developers or designers must guarantee that the system (i, Universidad Polit´ecnica de Valencia Camino de Vera s/n, 46022 Valencia, Spain Abstract In this paper, a model as the environment of the system. We also present the logic which is used to specify properties of websites

Lucas, Salvador


Evaluating Rogue User Testing: an Industrial Case Study at Softeam  

E-Print Network [OSTI]

Bagnato2 1 Universidad Polit´ecnica de Valencia, Valencia, Spain http://www.pros.upv.es/ 2 SOFTEAM, Paris in the FITTEST project. This document presents the results of this study. 1 Introduction Software Testing is an important practice to assure the quality of and avoid critical errors in software products. However, modern

Utrecht, Universiteit


Formal Verification of Websites1 Sonia Flores2  

E-Print Network [OSTI]

. As expected in any software project, the web developers or designers must guarantee that the system (i Polit´ecnica de Valencia Camino de Vera s/n, 46022 Valencia, Spain Abstract In this paper, a model as the environment of the system. We also present the logic which is used to specify properties of websites

Villanueva, Alicia


`Home Away From Home:' Migrant Organizations and Transnational Politics Among Latin American Migrants in Spain  

E-Print Network [OSTI]

, Argentina, Bolivia, Chile, Colombia, Costa Rica, the Dominican Republic, Ecuador, Equatorial Guinea Guatemala, Honduras, Nicaragua, Paraguay, Peru, the Philippines, Portugal, and Uruguay. 3 Although the process of migration has never been... well be the catalyst for national political change, and at the very least may alter the political priorities of governments by focusing their energies abroad (Itzigsohn 2000). 19 In the case of Latin American migrants to Spain, their presence...

Freudenburg, Kevin Michael



Fast neutron incineration in the energy amplifier as alternative to geologic storage the case of Spain  

E-Print Network [OSTI]

In previous reports [1][2] we have presented the conceptual design of a fast neutron driven sub-critical device (Energy Amplifier) designed both for energy amplification (production) and for the incineration of unwanted waste from Nuclear Light Water Reactors (LWR). The latter scheme is here applied to the specific case of Spain, where 9 large LWRs are presently in operation. It is shown that a cluster of 5 EAs is a very effective and realistic solution to the elimination (in 37 years) of the present and foreseen (till 2029) LWR-Waste stockpiles of Spain, but with major improvements over Geologic Storage, since: (1) only a Low Level Waste (LLW) surface repository of reasonable size is ultimately required; (2) the large amount of energy stored in the trans-Uranics is recovered, amounting for each of the 37 years of incineration to a saving of about 8% of the present primary energy demand of Spain (100 MTep/y); (3) the slightly enriched (1.1%) Uranium, unburned by LWRs, can be recovered for further us...

Rubbia, Carlo; Kadi, Y; Rubio, Juan Antonio



Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +


E-Print Network 3.0 - ambient temperature passive Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of California at Riverside Collection: Materials Science 3 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2.3 EFFECT OF SiN...


al2o3 thin film: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of an HfAlO composite or an Al2O3-HfO2 nanolaminate Eisenstein, Gadi 75 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.1.4...


av urinveiene hos: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 449 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av loevtraed paa: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 385 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av konsekvenser foer: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 387 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av skogsbraensleuttag paa: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 385 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av bildkvalitet vid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 493 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


al2o3 thin films: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of an HfAlO composite or an Al2O3-HfO2 nanolaminate Eisenstein, Gadi 75 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.1.4...


av svaveladditiv paa: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 385 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


avfall syntes av: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 387 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av sveriges integrationspolitik: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 423 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av haverifallet kylmedelsfoerlust: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 377 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av hofteledd ved: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 460 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


atypical cell surface: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

case of weak anchoring 13-17. The aim Paris-Sud XI, Universit de 265 23rd European Photovoltaic Solar Energy Conference, Valencia, Spain, Sept. 2008 PROGRESS IN THE SURFACE...

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


av taalegrenseoverskridelser paa: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 385 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av laangtidsegenskaper hos: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 449 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av3 reveals selectivity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

require expression of the transgene, and is therefore free Spiker, Steven L. 17 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av hoegaktivt kaernavfall: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 377 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av verksamheten paa: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 389 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av sammenhengen mellom: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 404 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


albicans cell surface: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

case of weak anchoring 13-17. The aim Paris-Sud XI, Universit de 229 23rd European Photovoltaic Solar Energy Conference, Valencia, Spain, Sept. 2008 PROGRESS IN THE SURFACE...


av pfg vid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 497 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av egenkontrollen vid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 493 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


archaeal cell surface: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

case of weak anchoring 13-17. The aim Paris-Sud XI, Universit de 244 23rd European Photovoltaic Solar Energy Conference, Valencia, Spain, Sept. 2008 PROGRESS IN THE SURFACE...


akustisk beskrivning av: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 385 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av forholdet mellom: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 405 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


ajo cv nieve: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sellers & Toll PLLC 88 Pine Street 14th Floor New York, NY Straight, Aaron 157 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.2.36...


anvaendningen av reaktorer: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 377 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


av formen av: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 378 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


analyse av miljoerisiko: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The prototype of the antenna is fabricated in metallized foam Boyer, Edmond 500 European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115...


Princeton University Diffusion of Networking Technologies  

E-Print Network [OSTI]

Electronic Commerce (EC'12) Valencia, Spain June 7, 2012 ISP #12;Seedset: A set of nodes that can kick off, photovoltaics, fax, computers, Internet, video games, ... Source: Rogers. "The Diffusion of Home Computers Among

Goldberg, Sharon


Order-Sorted Dependency Pairs Salvador Lucas  

E-Print Network [OSTI]

Order-Sorted Dependency Pairs Salvador Lucas DSIC, Universidad Polit´ecnica de Valencia, Spain modeled as many-sorted or, more Salvador Lucas was partially supported by the EU (FEDER) and the Spanish

Lucas, Salvador


Fermilab Today  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

hangout from the ICHEP conference in Valencia, Spain, on the latest news about the Higgs boson and more. Chat with Fermilab and CMS scientist Don Lincoln and with incoming CMS...


On Automatic Plagiarism Detection Based on n-Grams Comparison  

E-Print Network [OSTI]

´ecnica de Valencia, Spain {lbarron,prosso}@dsic.upv.es http://www.dsic.upv.es/grupos/nle/ Abstract. When on the basis of flexible search strategies (able to detect plagiarised fragments M. Boughanem et al. (Eds

Rosso, Paolo

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Enrichment of Bilingual Dictionary through News Stream Data , Parth Gupta  

E-Print Network [OSTI]

Varma , Paolo Rosso Search and Information Extraction Lab International Institute of Information PRHLT Research Center Universitat Polit`ecnica de Val`encia, Spain http://www.dsic.upv.es/grupos/nle

Rosso, Paolo


First Results of a Full Scaled Passive Treatment System for High Metal Concentration AMD at the Iberian Pyrite Belt, SW Spain  

E-Print Network [OSTI]

at the Iberian Pyrite Belt, SW Spain M. A. Caraballo a), F. Macías a), T. S. Rötting b), J. M. Nieto a), C. Ayora c) a) Department of Geology, University of Huelva. Avda. Fuerzas Armadas s/n, 21071 Huelva, Spain "Jaume Almera" CSIC, Lluís Solé y Sabarís, s/n. Barcelona 08028, Spain. Abstract Acidity load

Politècnica de Catalunya, Universitat


Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

SciTech Connect (OSTI)

The openness of the transmission grid and the incentives given by transmission pricing form the foundation for retail and wholesale competition in the electricity market. The deregulated markets of Norway, Spain, and California all have introduced retail access and wholesale competition, although with different approaches to pricing of transmission grid services. This paper will briefly describe the three different solutions, and discuss some of their implications. Of the three electricity systems, Norway was the first to open the grid to competition in electricity trade. The Norwegian Energy Law of 1990 introduced open competition to wholesale and retail trade starting January 1991. In Spain, the Electricity Law of 1997 came into force early in 1998. Wholesale and retail markets in California were opened for competition on April 1, 1998, following the passage of Assembly Bill 1890, in August 1996. Introducing competition in electricity markets also implies introducing Third Party Access to the transmission grid. All potential competitors have to be given access to the grid in order to compete, no matter who owns the actual wires. This principle raises several challenges, notably, how to price transmission services. Who is to pay for which transmission services? The Norwegian grid is divided into three levels depending on its function. The transmission grid includes all parts of the national grid having a transmission function, meaning that some lower voltage levels also are included. In Spain, the definition of the transmission grid is similar, including the 400 kV and 220 kV national grid as well as lower voltage installations that could affect transmission operation or generation dispatch. For historic reasons, wholesale electricity transactions in the US are regulated by the federal government through the FERC. However, operations of utility systems within one state fall primarily under state jurisdiction. Because the utility systems in California generally are large and exchanges between them limited, the role of FERC was small prior to restructuring, although the state is a large importer of power.

Gronli, H.; Gomez San Ramon, T.; Marnay, C.



Decommissioning and waste disposal methods for an uranium mill facility in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings pile is being stabilized in place. Mill equipment, buildings and process facilities have been dismantled and demolished and the resulting metal wastes and debris will be placed in the pile. The tailings mass is being reshaped by flattening the sideslopes and a cover system will be placed over the pile. This paper describes the technical procedures used for the remediation and closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the disposal of the metal wastes and demolition debris.

Santiago, J.L. [ENRESA, Madrid (Spain); Sanchez, M. [INITEC, Madrid (Spain)



Sabine Pass, LA Exports to Spain Liquefied Natural Gas (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet) Brazil LiquefiedSpain


Cameron, LA Liquefied Natural Gas Exports to Spain (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998 10,643 10,998 10,998 10,64397 272 522 542 627ThousandThousandSpain


U.S. and Spain to Develop Solar Decathlon Europe | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of Dept. of Energy, OfficeDepartment ofSpain to Develop Solar


Organochlorine pollutants in water, soils, and earthworms in the Guadalquivir River, Spain  

SciTech Connect (OSTI)

Organochlorine compounds (insecticides and polychlorinated biphenyls) are known to maintain their stability in the aquatic environment for long periods. DDT and cyclodiene insecticides were used widely in Spain until their use was banned in 1976; DDT and its degradation products are still found in environmental samples. Since DDT has been legally restricted for use, lindane has become important as a substitute for DDT. This study has been carried out along Guadalquivir River, Spain. This river runs across an agricultural area where pesticides are used extensively. The Guadalquivir basin is the most economically important area of the South of the Iberian Peninsula; its economic importance stems from its proximity to a major metropolitan areas (Cordova, Seville), which indicates the presence of numerous urban, commercial, and industrial locations in the vicinity of the sampling stations. The purposes of this investigation are: (1) to determine the levels of organochlorine compounds in water, soils, and earthworms sampled in ten stations of the Guadalquivir River; (2) to evaluate biological accumulation of pollutants studied within the food webs; (3) to evaluate regional patterns and time trends of residues. 15 refs., 1 fig., 2 tabs.

Hernandez, L.M.; Fernandez, M.A.; Gonzalez, M.J. (Institute of Organic Chemistry, Madrid (Spain))



A proposal to improve ecological compensation practice in road and railway projects in Spain  

SciTech Connect (OSTI)

To reduce ecological impacts caused by development projects, avoidance, minimization and compensation techniques have to be taken together into consideration along Environmental Impact Assessment (EIA) procedures. This paper explores the particular role that ecological compensation has had in recent road and railway EIA procedures in Spain, as seen through the review of a set of recent EIA Records of Decision (RODs) that confirms precedent findings. Noticing that residual impacts are not paid much attention, and that there is no evidence of a solid public participation in ecological impact evaluation, it proposes to increase the awareness on residual impacts, as a way to make easier public access to the allegedly most sensitive moment of EIA implementation: (residual) impact evaluation. -- Highlights: ? Ecological compensation practice in Spain is much lower than avoidance or mitigation. ? Residual impacts are overlooked in EIA processes and public participation is low. ? An increased awareness of residual impacts may also promote public participation. ? Current context needs these small steps to move towards better compensation practice.

Villarroya, Ana, E-mail: avillarroya@alumni.unav.es; Puig, Jordi, E-mail: jpbaguer@unav.es



A Review of "New World Gold: Cultural Anxiety and Monetary Disorder in Early Modern Spain" by Elvira Vilches  

E-Print Network [OSTI]

) and the Dominican Tom?s Mercado?s Suma de tratos y contratos (Guide to negotiations and contracts, 1569). Not unlike the bumper crop of books on personal finance that have ap- peared since our own economic meltdown of 2008, the proliferation of such texts... of Columbus?s travel log or Cort?s?s ?Letters from Mexico.? Whether read in parts or as a whole, Vilches?s book offers the reader a layered and insightful examination of early modern Spain?s ?Golden Age,? attune to all the contradictions that follow from...

Wright, Elizabeth R.



Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August 29-September Xing Fan, Carlos Busso and John H.L. Hansen  

E-Print Network [OSTI]

Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August Barcelona, Spain #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 2 EUSIPCO 2011, Barcelona with neutral speech #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 3 EUSIPCO 2011, Barcelona

Busso, Carlos


Highlights of Spanish Astrophysics VI, Proceedings of the IX Scientific Meeting of the Spanish Astronomical Society held on September 13 -17, 2010, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.)  

E-Print Network [OSTI]

, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.) Chromospheric activity of FGK stars. Astrof´isica, E-28040 Madrid, Spain 2 Universidad Aut´onoma de Madrid, Dpto. de F´isica Te´orica C-XI, Fac. Ciencias, Madrid, Spain 3 LAEX, CAB (CSIC-INTA), ESAC Campus, P.O. BOX 73, 28691 Villanueva de la

Complutense de Madrid, Universidad


Highlights of Spanish Astrophysics VI, Proceedings of the IX Scientific Meeting of the Spanish Astronomical Society held on September 13 -17, 2010, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.)  

E-Print Network [OSTI]

, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.) Chemical Tagging the Hyades-28040 Madrid, Spain. 2 Instituto de Astrof´isica de Canarias, C/ Via L´actea s/n, E-38200 La Laguna, Spain Abstract Stellar Kinematic Groups are kinematical coherent groups of stars which may share a com

Complutense de Madrid, Universidad


European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind Generation by a Dynamic  

E-Print Network [OSTI]

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind. Abstract-Short-term wind power forecasting is recognized nowadays as a major requirement for a secure and economic integration of wind power in a power system. In the case of large-scale integration, end users

Paris-Sud XI, Université de


An estimate of the effects of climate change on the rainfall of Mediterranean Spain by the late twenty first century  

E-Print Network [OSTI]

An estimate of the effects of climate change on the rainfall of Mediterranean Spain by the late outside the periods, which would incorporate changing AP frequencies during a period of sustained climate the atmospheric circulation at 925 and 500 hPa and the distribution of daily pre- cipitation for Mediterranean

Romero, Romu


Decommissioning of facilities and encapsulation of wastes for an uranium mill site in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings site is being remediated in place. Mill equipment, buildings and process facilities have been dismantled and demolished and the resulting metal wastes and debris have been placed in the tailings pile. The tailings mass has been reshaped by flattening the sideslopes to improve stability and a cover system has been placed over the pile. Remedial action works started in February 1991 and will be completed by March 1994. This paper describes the progress of the remediation works for the closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the stabilization of the tailings pile.

Santiago, J.L. [Enresa, Madrid (Spain); Sanchez, M. [Initec, Madrid (Spain)



A review of "The Sale of the Century: Artistic Relations between Spain and Great Britain, 1604-1655." by Jonathan Brown and John Elliott, eds.  

E-Print Network [OSTI]

. Jonathan Brown and John Elliott, eds. The Sale of the Century: Ar- tistic Relations between Spain and Great Britain, 1604?1655. Madrid: Yale University Press and Museo Nacional del Prado, 2002. 315 pp. $65 hardback. Review by ELIZABETH R. WRIGHT..., UNIVERSITY OF GEORGIA. Art historian Jonathan Brown and historian John Elliott have joined forces to provide an indispensable guide to the political and artistic relationship between Spain and England in the first half of the seventeenth century. Though...

Elizabeth R. Wright



Heterozoan carbonate lithofacies and sequence stratigraphy: a study of Pliocene strata of the Agua Amarga basin, southeastern Spain  

E-Print Network [OSTI]

). Heterozoan systems are likely to behave differently than photozoan systems in response to hydrodynamics and relative sea-level change, making the use of heterozoan models important for accurate prediction of facies distribution. The hydrodynamic regimen... response to sea- level change than is typical for photozoan carbonates. GEOLOGIC SETTING Throughout the Neogene, the Betic Cordillera of southern and southeastern Spain was compressed by the Iberia-Africa collision, with regional shortening oriented...

Hess, Anya Victoria



Environmental performance of construction waste: Comparing three scenarios from a case study in Catalonia, Spain  

SciTech Connect (OSTI)

The main objective of this paper is to evaluate environmental impacts of construction wastes in terms of the LIFE 98 ENV/E/351 project. Construction wastes are classified in accordance with the Life Program Environment Directive of the European Commission. Three different scenarios to current waste management from a case study in Catalonia (Spain) have been compared: landfilling, recycling and incineration, and these scenarios were evaluated by means of Life Cycle Assessment. The recommendations of the Catalan Waste Catalogue and the European Waste Catalogue have been taken into account. Also, the influence of transport has been evaluated. Results show that in terms of the Global Warming Potential, the most environmentally friendly treatment was recycling, followed by incineration and lastly landfilling. According to the influence of treatment plants location on the GWP indicator, we observe that incineration and recycling of construction wastes are better than landfilling, even for long distances from the building site to the plants. This is true for most wastes except for the stony types, than should be recycled close to the building site. In summary, data from construction waste of a Catalan case study was evaluated using the well established method of LCA to determine the environmental impacts.

Ortiz, O., E-mail: oscarortiz@unipamplona.edu.c [Rovira i Virgili University, Environmental Analysis and Management Group (AGA), Chemical Engineering Department, Av. Paisos Catalans 26, 43007, Tarragona (Spain); University of Pamplona, Department of Industrial Engineering, Km 1 Via Bucaramanga, Pamplona, N de S (Colombia); Pasqualino, J.C.; Castells, F. [Rovira i Virgili University, Environmental Analysis and Management Group (AGA), Chemical Engineering Department, Av. Paisos Catalans 26, 43007, Tarragona (Spain)



Lagrangian transport in a microtidal coastal area: the Bay of Palma, island of Mallorca, Spain  

E-Print Network [OSTI]

Coastal transport in the Bay of Palma, a small region in the island of Mallorca, Spain, is characterized in terms of Lagrangian descriptors. The data sets used for this study are the output for two months (one in autumn and one in summer) of a high resolution numerical model, ROMS, forced atmospherically and with a spatial resolution of 300 m. The two months were selected because its different wind regime, which is the main driver of the sea dynamics in this area. Finite-size Lyapunov Exponents (FSLEs) were used to locate semi-persistent Lagrangian coherent structures (LCS) and to understand the different flow regimes in the Bay. The different wind directions and regularity in the two months have a clear impact on the surface Bay dynamics, whereas only topographic features appear clearly in the bottom structures. The fluid interchange between the Bay and the open ocean was tudied by computing particle trajectories and Residence Times (RT) maps. The escape rate of particles out of the Bay is qualitatively different, with a 32$%$ more of escape rate of particles to the ocean in October than in July, owing to the different geometric characteristics of the flow. We show that LCSs separate regions with different transport properties by displaying spatial distributions of residence times on synoptic Lagrangian maps together with the location of the LCSs. Correlations between the time-dependent behavior of FSLE and RT are also investigated, showing a negative dependence when the stirring characterized by FSLE values moves particles in the direction of escape.

Ismael Hernndez-Carrasco; Cristbal Lpez; Alejandro Orfila; Emilio Hernndez-Garca


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Road-corridor planning in the EIA procedure in Spain. A review of case studies  

SciTech Connect (OSTI)

The assessment of different alternatives in road-corridor planning must be based on a number of well-defined territorial variables that serve as decision making criteria, and this requires a high-quality preliminary environmental assessment study. In Spain the formal specifications for the technical requirements stipulate the constraints that must be considered in the early stages of defining road corridors, but not how they should be analyzed and ranked. As part of the feasibility study of a new road definition, the most common methodology is to establish different levels of Territorial Carrying Capacity (TCC) in the study area in order to summarize the territorial variables on thematic maps and to ease the tracing process of road-corridor layout alternatives. This paper explores the variables used in 22 road-construction projects conducted by the Ministry of Public Works that were subject to the Spanish EIA regulation and published between 2006 and 2008. The aim was to evaluate the quality of the methods applied and the homogeneity and suitability of the variables used for defining the TCC. The variables were clustered into physical, environmental, land-use and cultural constraints for the purpose of comparing the TCC values assigned in the studies reviewed. We found the average quality of the studies to be generally acceptable in terms of the justification of the methodology, the weighting and classification of the variables, and the creation of a synthesis map. Nevertheless, the methods for assessing the TCC are not sufficiently standardized; there is a lack of uniformity in the cartographic information sources and methodologies for the TCC valuation. -- Highlights: We explore 22 road-corridor planning studies subjected to the Spanish EIA regulation. We analyze the variables selected for defining territorial carrying capacity. The quality of the studies is acceptable (methodology, variable weighting, mapping). There is heterogeneity in the methods for territorial carrying capacity valuation.

Loro, Manuel, E-mail: manuel.loro@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politcnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain) [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politcnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politcnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigacin del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politcnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Arce, Rosa M., E-mail: rosa.arce.ruiz@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politcnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politcnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigacin del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politcnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Ortega, Emilio, E-mail: e.ortega@upm.es [Transport Research Centre (TRANSyT-UPM) Universidad Politcnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain) [Transport Research Centre (TRANSyT-UPM) Universidad Politcnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigacin del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politcnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Department of Construction and Rural Roads, Forestry Engineering School, Universidad Politcnica de Madrid, Ciudad Universitaria s/n, 28040 Madrid (Spain); and others



Workshop (W60) on "Burning Plasma Physics and Simulation" 4-5 July 2005, University Campus, Tarragona, Spain  

E-Print Network [OSTI]

. Reimerdes EPS[2005] no wall limit ideal wall limit no wall limit with External coils #12;3.5 4.0 4.5 5.0 5.8 0.6 0.4 0.2 0 0.2 0.4 0.6 0.8 1.0 1.20 1.4 RFA b / 3.4li MARS with wall beta limit Pulse No: 59223, Tarragona, Spain Under the Auspices of the IEA Large Tokamak Implementing Agreement Present understanding


Attitudes to diversity: A cross-cultural study of education students in Spain, England, and the United States  

E-Print Network [OSTI]

, Florian, Lani , Rouse, Martyn and Stough, Laura M.(2010) 'Attitudes to diversity: a cross-cultural study of education students in Spain, England and the United States', European Journal of Teacher Education, 33: 3, 245 264 To link to this Article: DOI...), and American students (70% White or European American, 19% Hispanic, 4% Asian American, 2% African American, and 4% other). The average age of the students was 26 years with a mean teaching experience of 2.31 years (SD = 4.38) (5.68 for the Spanish students, 1...

Stough, Laura



,"Liquefied U.S. Natural Gas Re-Exports to Spain (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: EnergyShale Proved Reserves (Billion Cubic Feet)" ,"Click worksheet name orSpain (Million


Competitive sorption of cadmium and lead in acid soils of central Spain  

SciTech Connect (OSTI)

The bioavailability and ultimate fate of heavy metals in the environment are controlled by chemical sorption. To assess competitive sorption of Pb and Cd, batch equilibrium experiments (generating sorption isotherms) and kinetics sorption studies were performed using single and binary metal solutions in surface samples of four soils from central Spain. For comparisons between soils, as well as, single and binary metal solutions, soil chemical processes were characterized using the Langmuir equation, ionic strength, and an empirical power function for kinetic sorption. In addition, soil pH and clay mineralogy were used to explain observed sorption processes. Sorption isotherms were well described by the Langmuir equation and the sorption kinetics were well described by an empirical power function within the reaction times in this study. Soils with higher pH and clay content (characterized by having smectite) had the greatest sorption capacity as estimated by the maximum sorption parameter (Q) of the Langmuir equation. All soils exhibited greater sorption capacity for Pb than Cd and the presence of both metals reduced the tendency for either to be sorbed although Cd sorption was affected to a greater extent than that of Pb. The Langmuir binding strength parameter (k) was always greater for Pb than for Cd. However, these k values tended to increase as a result of the simultaneous presence of both metals, that may indicate competition for sorption sites promoting the retention of both metals on more specific sorption sites. The kinetic experiments showed that Pb sorption is initially faster than Cd sorption from both single and binary solutions although the simultaneous presence of both metals affected the sorption of Cd at short times while only a minor effect was observed on Pb. The estimated exponents of the kinetic function were in all cases smaller for Pb than for Cd, likely due to diffusion processes into micropores or interlayer space of the clay minerals which occurs more readily for Cd than Pb. Finally, the overall sorption processes of Pb and Cd in the smectitic soil with the highest sorption capacity of the studied soils are slower than in the rest of the soils with a clay mineralogy dominated by kaolinite and illite, exhibiting these soils similar sorption rates. These results demonstrate a significant interaction between Pb and Cd sorption when both metals are present that depends on important soil properties such as the clay mineralogy.

Serrano, S.; Garrido, F.; Campbell, C.G.; Garcia-Gonzolez, Maria Teresa



An analysis of markets for small-scale, advanced coal-combustion technology in Spain, Italy, and Turkey  

SciTech Connect (OSTI)

This report discusses the examination of potential overseas markets for using small-scale, US-developed, advanced coal-combustion technologies (ACTs). In previous work, member countries of the Organization for Economic Cooperation and Development (OECD) were rated on their potential for using ACTs through a comprehensive screening methodology. The three most promising OECD markets were found to be Spain, Italy, and Turkey. This report provides in-depth analyses of these three selected countries. First, it addresses changes in the European Community with particular reference to the 1992 restructuring and its potential effect on the energy situation in Europe, specifically in the three subject countries. It presents individual country studies that examine demographics, economics, building infrastructures, and energy-related factors. Potential niches for ACTs are explored for each country through regional analyses. Marketing channels, strategies, and the trading environments in each country are also discussed. The information gathered indicates that Turkey is a most promising market, Spain is a fairly promising market, and Italy appears to be a somewhat limited market for US ACTs. 76 refs., 16 figs., 14 tabs.

Placet, M.; Gerry, P.A.; Kenski, D.M.; Kern, D.M.; Nehring, J.L.; Szpunar, C.B.



G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June -1 July 2005 Tarragona (Spain) 1 Source Regulation of Fast Energetic  

E-Print Network [OSTI]

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005 Tarragona (Spain, Rome, Italy #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005, EPM, ...) #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005

Vlad, Gregorio


To Appear in Proc. Third International Workshop on Solar Polarization, Tenerife, Spain, 2002, Eds. J. Trujillo Bueno & J. Sanchez Almeida., ASP Conference Series  

E-Print Network [OSTI]

window and secondary optics. The secondary optics uses a field mirror to re-image the pupil on a 25 cmTo Appear in Proc. Third International Workshop on Solar Polarization, Tenerife, Spain, 2002, Eds Solar Telescope G¨oran B. Scharmer, Dan Kiselman, Mats G. L¨ofdahl & Luc H. M. Rouppe van der Voort

Löfdahl, Mats


European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. State-of-the-Art on Methods and Software Tools for Short-Term  

E-Print Network [OSTI]

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. State-of-the-Art on Methods and Software Tools for Short-Term Prediction of Wind Energy Production G. Giebel*, L. Landberg, Risoe National Roskilde, Denmark Abstract: The installed wind energy capacity in Europe today is 20 GW, while

Paris-Sud XI, Université de


Lung Cancer Attributable to Indoor Radon Exposures in Two Radon--Prone Areas, Stei (Romania) and Torrelodones (Spain)  

SciTech Connect (OSTI)

Radon and radon progeny are present indoors, in houses and others dwellings, representing the most important contribution to dose from natural sources of radiation. Most studies have demonstrated an increased risk of lung cancer at high concentration of radon for both smokers and nonsmokers. For medium and low concentrations which are the typical residential radon levels, recent researches have also demonstrated increased risks of lung cancer for people exposed. The work presents a comparative analysis of the radon exposure data in the two radon--prone areas, Stei, Transylvania, (Romania), in the near of old Romanian uranium mines and in the granitic area of Torrelodones town, Sierra de Guadarrama (Spain). One important difference between the two studied areas is related to the houses built using uranium waste as construction material in Stei area. Measurements of indoor radon were performed in 280 dwellings (Romania) and 91 dwellings (Spain) by using nuclear track detectors, CR 39. The highest value measured in Stei area was 2650 Bq{center_dot}m{sup -3}. and 366 Bq{center_dot}m{sup -3} in the Spanish region. The results are compute with the BEIR VI report estimates using the age-duration model at an exposure rate below 2650 Bq{center_dot}m{sup -3}. A total of 233 lung cancer deaths were calculated in the Stei area for a period of 13 years (1994-2006), which is 116.82% higher than observed from the national statistics. In comparison, in Torrelodones area, a number of 276 deaths caused by lung cancer were estimated along a period of 13 years, which is 2.09 times higher than the number observed by authorities. This represents a significantly evidence that elevated risk can strongly be associated with cumulated radon exposure.

Dinu, Alexandra; Cosma, Constantin; Vasiliniuc, Stefan [Faculty of Env. Science, 'Babes-Bolyai' University, Fantanele, No. 30 Cluj Napoca (Romania); Sainz, Carlos; Poncela, Luis Santiago Quindos [Department of Medical Physics, Faculty of Medicine, University of Cantabria, c/Herrera Oria s/n. 39011, Santander (Spain)



Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...


Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...


Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...


Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A



Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...


Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center


Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1


Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP


Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for


Valencia opta a albergar la Conferencia del Ao Europeo de la Innova... http://www.abc.es/20081210/valencia-valencia/valencia-opta-albergar... 1 de 1 10/12/2008 9:46  

E-Print Network [OSTI]

la Creatividad auspiciado por la Comisión Europea. El responsable de Educación asistió en Madrid reúne a los grandes expertos de la creatividad y la innovación europea el próximo mes de junio. Por su

Fernández de Córdoba, Pedro


Valencia County, New Mexico: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformation UC 19-6-401UpsonUtahTechnology Inc Place: Austin, Texas


Valencia West, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformation UC 19-6-401UpsonUtahTechnology Inc Place: Austin,


In T. R. G. Green, J. J. Canas, & C. P. Warren (Eds): Proceedings of the Eight Conference on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.)  

E-Print Network [OSTI]

on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.) Reusing processes and documenting Ergonomic Psychology Group Language and Communication Laboratory Ergonomic Psychology Group INRIA

Paris-Sud XI, Université de


Radar-based dynamic testing of the cable-suspended bridge crossing the Ebro River at Amposta, Spain  

SciTech Connect (OSTI)

Microwave remote sensing is the most recent experimental methodology suitable to the non-contact measurement of deflections on large structures, in static or dynamic conditions. After a brief description of the radar measurement system, the paper addresses the application of microwave remote sensing to ambient vibration testing of a cable-suspended bridge. The investigated bridge crosses the Ebro River at Amposta, Spain and consists of two steel stiffening trusses and a series of equally spaced steel floor beams; the main span is supported by inclined stay cables and two series of 8 suspension cables. The dynamic tests were performed in operational conditions, with the sensor being placed in two different positions so that the response of both the steel deck and the arrays of suspension elements was measured. The experimental investigation confirms the simplicity of use of the radar and the accuracy of the results provided by the microwave remote sensing as well as the issues often met in the clear localization of measurement points.

Gentile, Carmelo [Politecnico di Milano, Dept. of Architecture, Built environment and Construction engineering (ABC), Piazza Leonardo da Vinci 32, 20133 Milan (Italy); Luzi, Guido [Centre Tecnlogic de Telecomunicacions de Catalunya (CTTC), Division of Geomatics, Av. Gauss, 7 E-08860 Castelldefels (Barcelona) (Spain)



Roof-top solar energy potential under performance-based building energy codes: The case of Spain  

SciTech Connect (OSTI)

The quantification at regional level of the amount of energy (for thermal uses and for electricity) that can be generated by using solar systems in buildings is hindered by the availability of data for roof area estimation. In this note, we build on an existing geo-referenced method for determining available roof area for solar facilities in Spain to produce a quantitative picture of the likely limits of roof-top solar energy. The installation of solar hot water systems (SHWS) and photovoltaic systems (PV) is considered. After satisfying up to 70% (if possible) of the service hot water demand in every municipality, PV systems are installed in the remaining roof area. Results show that, applying this performance-based criterion, SHWS would contribute up to 1662 ktoe/y of primary energy (or 68.5% of the total thermal-energy demand for service hot water), while PV systems would provide 10 T W h/y of electricity (or 4.0% of the total electricity demand). (author)

Izquierdo, Salvador; Montanes, Carlos; Dopazo, Cesar; Fueyo, Norberto [Fluid Mechanics Group, University of Zaragoza and LITEC (CSIC), Maria de Luna 3, 50018 Zaragoza (Spain)



Proving Termination Properties with mu-term Beatriz Alarcon, Raul Gutierrez, Salvador Lucas, and Rafael Navarro-Marset  

E-Print Network [OSTI]

Proving Termination Properties with mu-term Beatriz Alarc´on, Ra´ul Guti´errez, Salvador Lucas Valencia, Spain Abstract. mu-term is a tool which can be used to verify a number of termination properties of (variants of) Term Rewriting Systems (TRSs): termination of rewriting, termination of innermost rewriting

Lucas, Salvador


CLOUD SCREENING METHODOLOGY FOR MERIS/AATSR SYNERGY PRODUCTS Luis Gomez-Chova, Gustavo Camps-Valls, Jordi Mu~noz-Mari, Javier Calpe, and Jose Moreno  

E-Print Network [OSTI]

CLOUD SCREENING METHODOLOGY FOR MERIS/AATSR SYNERGY PRODUCTS Luis G´omez-Chova, Gustavo Camps (Valencia), Spain. ABSTRACT This paper describes the current development status of a cloud-screening method to improve current cloud mask- ing products for both sensors. Preliminary results based on simulated TOA

Camps-Valls, Gustavo


Unit References Module 1: The Science of Climate Change  

E-Print Network [OSTI]

164 Unit References Module 1: The Science of Climate Change 1. Intergovernmental Panel on Climate Change. (2007). Climate change 2007: synthesis report. IPCC Plenary XXVII (Valencia, Spain, 12-17 November 2007). 2. America's Climate Choices: Panel on Advancing the Science of Climate Change, National

Smith, Kate


Corpus and Evaluation Measures for Automatic Plagiarism Detection Alberto Barrn-Cedeo1  

E-Print Network [OSTI]

of Information Systems and Computation Universidad Politécnica de Valencia, Spain http://users.dsic.upv.es/grupos/nle apply character n-grams profiles to characterize an author's style and search for irregularities across retrieval of a small number of candidate source documents using a Web search engine, and to compare them

Rosso, Paolo


NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.  

E-Print Network [OSTI]

NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

Rosso, Paolo


Cross-Language High Similarity Search Using a Conceptual Thesaurus  

E-Print Network [OSTI]

Cross-Language High Similarity Search Using a Conceptual Thesaurus Parth Gupta, Alberto Barr Universitat Polit`ecnica de Val`encia, Spain {pgupta,lbarron,prosso}@dsic.upv.es http://www.dsic.upv.es/grupos/nle Abstract. This work addresses the issue of cross-language high similarity and near-duplicates search, where

Rosso, Paolo


Encoding transliteration variation through dimensionality reduction: FIRE Shared Task on  

E-Print Network [OSTI]

on Transliterated Search Parth Gupta1 , Paolo Rosso1 , and Rafael E. Banchs2 1 Natural Language Engineering Lab Department of Information Systems and Computation Universitat Polit`ecnica de Val`encia, Spain http://www.dsic.upv.es/grupos/nle are written in indigenous scripts for various rea- sons. In the light of this phenomenon, the search engines

Rosso, Paolo


NREL Response to the Report 'Study of the Effects on Employment of Public Aid to Renewable Energy Sources' from King Juan Carlos University (Spain) (White Paper)  

SciTech Connect (OSTI)

Job generation has been a part of the national dialogue surrounding energy policy and renewable energy (RE) for many years. RE advocates tout the ability of renewable energy to support new job opportunities in rural America and the manufacturing sector. Others argue that spending on renewable energy is an inefficient allocation of resources and can result in job losses in the broader economy. The report, Study of the Effects on Employment of Public Aid to Renewable Energy Sources, from King Juan Carlos University in Spain, is one recent addition to this debate. This report asserts that, on average, every renewable energy job in Spain 'destroyed' 2.2 jobs in the broader Spanish economy. The authors also apply this ratio to the U.S. context to estimate expected job loss from renewable energy development and policy in the United States. This memo discusses fundamental and technical limitations of the analysis by King Juan Carlos University and notes critical assumptions implicit in the ultimate conclusions of their work. The memo also includes a review of traditional employment impact analyses that rely on accepted, peer-reviewed methodologies, and it highlights specific variables that can significantly influence the results of traditional employment impact analysis.

Lantz, E.; Tegen, S.



Please cite this article in press as: Otero, I., et al., Loss of water availability and stream biodiversity under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain). Land Use Policy (2010), doi:10.1016/j.landusepol.201  

E-Print Network [OSTI]

biodiversity under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain) Iago-cover change Warming Mediterranean catchment Water courses Aquatic fauna a b s t r a c t In the north rim

Gracia, Carlos


Highlights of Spanish Astrophysics VIII, Proceedings of the XI Scientific Meeting of the Spanish Astronomical Society held on September 8 12, 2014, in Teruel, Spain. A. J. Cenarro, F. Figueras, C. Hernndez-Monteagudo, J. Trujillo, and L.  

E-Print Network [OSTI]

/INTA), ctra. de Ajalvir km. 4, 28850 Torrej´on de Ardoz, Madrid, Spain 2 Center for Detectors, Rochester, circumstellar extinction and age of FS CMa stars in an unprecedented way. Due to their relatively low brightness ([14]). The distinguishing features consisted of a sharp decrease of the mid-infrared flux above 20µm

Figer, Donald F.

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


This is the authors' version of the work. It is posted here for your personal use only. Not for redistribution. The definitive version is accepted for publication in the European Wireless 2014, Barcelona, Spain, May 2014.  

E-Print Network [OSTI]

, Spain, May 2014. Distributed Spectrum Allocation for Autonomous Cognitive Radio Networks Anatolij Zubow usage of non-occupied spectrum licensed to Pri- mary Users (PU). With the Non-Contiguous OFDM of available spectrum. A promising solution to achieve this goal is the Cognitive Radio (CR) approach

Wichmann, Felix


*Holder of a Scholarship from the Fondo de Investigacin Sanitaria (File No. 97/5653). Sensitization to Anisakis simplex: prevalence in an allergy outpatient clinic of Madrid (Spain)  

E-Print Network [OSTI]

Background: Anisakis simplex is a nematode that has been implicated in IgE-mediated allergic episodes. The aim of this study was to determine the prevalence of clinical and subclinical sensitization to A. simplex in adults attending an allergy outpatient clinic in Madrid (Spain), as well as to assess clinical and laboratory data related to the diagnosis of A. simplex allergy. Methods: We have investigated the alimentary habits (fish ingestion) and the presentation of associated acute or chronic gastrointestinal symptoms in 87 patients referred to our Allergy Outpatient Clinic because of various pathologic conditions. Skin prick tests were performed with an A. simplex extract, and the total and specific (to this parasite) serum IgE levels were measured (CAP-FEIA). Results: Clinical and subclinical sensitization to A. simplex was found in 5.7 % and 23 % of the patients, respectively. The skin tests and the CAP were positive to A. simplex in 16 % and 22 % of the patients, respectively, but the two techniques were simultaneously positive in only 9% of the cases. Forty-four per cent of the patients who had sought medical care because of urticaria, angioedema or anaphylaxis of undetermined aetiology showed a positive CAP assay to A. simplex, as compared to 17 % of those with other reasons for requesting medical consultation (p<0.01). There were no statistically significant differences between the two groups in regard to the results of the skin prick tests. The alimentary habits in the patients with positive skin prick tests and/or positive CAP assay were not signifi-cantly different from those of the patients with negative results. Conclusions. A high proportion of clinical and subclinical sensiti-zation to A. simplex has been detected among patients attending an outpatient allergy clinic in Madrid (Spain). A discrepancy was detected between the skin prick tests and CAP assay results. A habit of fish ingestion and recurrent gastrointestinal episodes do not

M. P. Lpez Sez; J. M. Zubeldia; V. Matheu; M. T. Gracia; M. De Barrio; P. Tornero; T. Herrero


NLEL-MAAT at ResPubliQA Santiago Correa and Davide Buscaldi and Paolo Rosso  

E-Print Network [OSTI]

NLEL-MAAT at ResPubliQA Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the QA@CLEF-2009 competition. We used

Rosso, Paolo


NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso  

E-Print Network [OSTI]

NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

Rosso, Paolo


NLEL-MAAT at CLEF-ResPubliQA Santiago Correa, Davide Buscaldi, Paolo Rosso.  

E-Print Network [OSTI]

NLEL-MAAT at CLEF-ResPubliQA Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the QA@CLEF-2009 competition. We used

Rosso, Paolo


Immosolar Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI SolarIdanha,Information JumpMorocco Jump


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...


Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im



Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced


A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-




E-Print Network [OSTI]


Tsien, Roger Y.


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397


3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)


Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schfer, Eberhard


Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W



Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate


Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August


Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip


State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem


Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow


Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump


IMPLEMENTATION OF TEAN-SLEEP FOR WIRELESS SENSOR NETWORKS Jesus Jaquez, David Valencia, Manikanden Balakrishnan,  

E-Print Network [OSTI]

, storage but most importantly in energy. When a node's energy is exhausted, the node can no longer provide. A node is able to save energy while idle by sleeping. Topology and Energy Adaptive, Non-synchronous (TEAN) sleep provides the nodes in a network a mechanism to save energy by sleeping while also keeping

Johnson, Eric E.


Nota de Prensa Valencia CSIC c o m u n i c a c i n  

E-Print Network [OSTI]

que se incorporan a la biomasa, que sirve para alimentar a la humanidad y a los animales. Debido a la

Fitze, Patrick


VALENCIA Y PLAZA 1 Dise~no e implementacion de un algoritmo  

E-Print Network [OSTI]

, resultantes de la interacci´on de la energ´ia so- lar con la estructura molecular de los materiales [1]. La que la mayor´ia de las estrategias de procesamiento paralelo utilizadas para el an´alisis de im mayor´ia de las aplicaciones de ´esta tecnolog´ia necesitan tiempos de respuesta muy r´apidos para poder

Plaza, Antonio J.


Nota de prensa Valencia CSIC c o m u n i c a c i n  

E-Print Network [OSTI]

del Palau de les Arts Reina Sofía, y al que asistieron más de 1.500 personas, se engloba dentro del

Fitze, Patrick


Convocatoria Valencia CSIC c o m u n i c a c i n  

E-Print Network [OSTI]

Exposiciones de la ETS de Arquitectura del Campus de Vera UPV. La delegación del Consejo Superior de Exposiciones de la ETS de Arquitectura del Campus de Vera de la UPV, en un acto que contará con la presencia ETS de Arquitectura del Campus de Vera UPV FECHA: martes 29 de mayo de 2012 HORA: 19 horas ACUDIRÁN

Fitze, Patrick


Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo



E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.


Industrial and natural sources of gaseous elemental mercury in the Almadn district (Spain): An updated report on this issue after the ceasing of mining and metallurgical activities in 2003 and major land reclamation works  

SciTech Connect (OSTI)

Two events during the last decade had major environmental repercussions in Almadn town (Spain). First it was the ceasing of activities in the mercury mine and metallurgical facilities in 2003, and then the finalization of the restoration works on the main waste dump in 2008. The combination of both events brought about a dramatic drop in the emissions of gaseous elemental mercury (GEM) to the atmosphere. Although no one would now call the Almadn area as mercury-free, the GEM levels have fallen beneath international reference safety levels for the first time in centuries. This has been a major breakthrough because in less than one decade the site went from GEM levels in the order of tens of thousands to mere tens nanogram per cubic meter. Although these figures are per se a remarkable achievement, they do not mark the end of the environmental concerns in the Almadn district. Two other sites remain as potential environmental hazards. (1) The Las Cuevas mercury storage complex, a partially restored ex-mining site where liquid mercury is being stored. The MERSADE Project (LIFEEuropean Union) has tested the Las Cuevas complex as a potential site for the installation of a future European prototype safe deposit of surplus mercury from industrial activities. Despite restoration works carried out in 2004, the Las Cuevas complex can still be regarded as hotspot of mercury contamination, with high concentrations above 800 ?g g{sup ?1} Hg{sub soil} and 300 ng m{sup ?3} Hg{sub gas}. However, as predicted by air contamination modeling using the ISC-AERMOD software, GEM concentrations fade away in a short distance following the formation of a NWSE oriented narrow plume extending for a few hundred meters from the complex perimeter. (2) Far more dangerous from the human health perspective is the Almadenejos area, hosting the small Almadenejos village, the so-called Cerco de Almadenejos (CDA; an old metallurgical precinct), and the mines of La Nueva Concepcin, La Vieja Concepcin and El Entredicho. The CDA is an old metallurgical site that operated between 1794 and 1861, leaving behind a legacy of extremely contaminated soils (mean concentration=4220 ?g g{sup ?1} Hg) and GEM emissions that in summer can reach levels up to 4,0005,000 ng m{sup ?3}. Thus the CDA remains the sole urban site in the district surpassing GEM international reference safety levels. In order to prevent these emissions, the CDA requires immediate action regarding restoration works. These could involve the full removal of soils or their permanent capping to create an impermeable barrier.

Higueras, Pablo, E-mail: pablo.higueras@uclm.es [Departamento de Ingeniera Geolgica y Minera, Escuela Universitaria Politcnica de Almadn, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain) [Departamento de Ingeniera Geolgica y Minera, Escuela Universitaria Politcnica de Almadn, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain); Instituto de Geologa Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain); Mara Esbr, Jos [Departamento de Ingeniera Geolgica y Minera, Escuela Universitaria Politcnica de Almadn, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain) [Departamento de Ingeniera Geolgica y Minera, Escuela Universitaria Politcnica de Almadn, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain); Instituto de Geologa Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain); Oyarzun, Roberto; Llanos, Willans [Instituto de Geologa Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain) [Instituto de Geologa Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain); Departamento de Cristalografa y Mineraloga, Facultad de Ciencias Geolgicas, Universidad Complutense, 28040 Madrid (Spain); Martnez-Coronado, Alba [Instituto de Geologa Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain)] [Instituto de Geologa Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadn (Spain); and others



ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca


Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.


Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne



Spain's Earth Scientists and the Oil Spill  

E-Print Network [OSTI]

and a south to north slope current on the sea (1­11), the decision to move the vessel from about 43°N, 9.5°WSpain's Earth Scientists and the Oil Spill THE SPANISH COAST OF GALICIA IS CURRENT- ly subject to an oil spill that, given its spatial and temporal extent, could become one of the worst spills ever

Brown, James H.


Import of fruits from Spain to Finland.  

E-Print Network [OSTI]

??The research is made for company named Karamelo Citrus S.L.L. It has already business links to many countries and they are working on the link (more)

Hall, Hardi



University of Castilla La Mancha Toledo, Spain  

E-Print Network [OSTI]

will be held concurrently. To Register online visit: swatmodel.tamu.edu/conferences/2011 Cancellation Policy Cancellation Policy: Cancel by April 15, 2011 -- receive 70% of registration fee. Cancel after April 15 gassman, Iowa State University, USA A.K. gosain, Indian Institute of Technology, India Ann van griensven



E-Print Network [OSTI]

of history would support my point. There has not been any politically-inspired price disruption arising from oil, natural gas, terrorism, and finally, about carbon. I offer these four thoughts to stimulate unpredictable and dangerous waters of energy policy in a turbulent and dangerous world. First, oil. We have

Deutch, John



E-Print Network [OSTI]

JOHN F. KENNEDY SCHOOL OF GOVERNMENT HARVARD UNIVERSITY 79 JFK Street Cambridge, MA 02138, USA REPSOL William W. Hogan French Electricity Liberalization and the European Context ............87 Michel Massoni.........................................................97 María Luisa Huidobro Restructuring Wholesale and Retail Electricity Markets in the United States

Deutch, John

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place: Missouri References: EIA


Barcelona, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCT BiomassArnprior,AurantiaBanburyBankInvestBarbados:


Examen cri?tico-anali?tico de las ilustraciones encontradas en tres Celestinas: (Burgos, 1499; Sevilla, 1502; Valencia, 1514)  

E-Print Network [OSTI]

, la cual se manifesto tan claramente en la Edad Media, se debio a la invencion de la imprenta ligada a su aceptacion por parte de un mundo cambiante y 5vido por el saber (DeVinne 46). Tambien esta relacionado el desarrollo de la imprenta con la...

Reyes-Dura?n, Marti?n



A Hybrid Geometric Modeling Method for Large Scale Conformal Cellular 3D Systems, 26081 Avenue Hall, Valencia, CA 91354  

E-Print Network [OSTI]

Structures, Conformal Structures, Additive Manufacturing, STL 1 INTRODUCTION Cellular material structures can distributions than stochastic metal foams [5]. With the development of additive manufacturing processes (also, 8, 9]. The manufacturing of mesoscopic truss structures utilizes the unique capability of additive

Chen, Yong


2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter


2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel


The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta


Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip...


Benchmarking Electron-Cloud Build-Up and Heat-Load Simulations against Large-Hadron-Collider Observations  

E-Print Network [OSTI]

After reviewing the basic features of electron clouds in particle accelerators, the pertinent vacuum-chamber surface properties, and the electron-cloud simulation tools in use at CERN, we report recent observations of electron-cloud phenomena at the Large Hadron Collider (LHC) and ongoing attempts to benchmark the measured LHC vacuum pressure increases and heat loads against electron-cloud build-up simulations aimed at determining the actual surface parameters and at monitoring the so-called scrubbing process. Finally, some other electron-cloud studies related to the LHC are mentioned, and future study plans are described. Presented at MulCoPim2011, Valencia, Spain, 21-23 September 2011.

Dominguez, O; Maury, H; Rumolo, G; Zimmermann, F



Searches for beyond the Standard Model physics with boosted topologies in the ATLAS experiment using the Grid-based Tier-3 facility at IFIC-Valencia  

E-Print Network [OSTI]

Both the LHC and ATLAS have been performing well beyond expectation since the start of the data taking by the end of 2009. Since then, several thousands of millions of collision events have been recorded by the ATLAS experiment. With a data taking efficiency higher than 95% and more than 99% of its channels working, ATLAS supplies data with an unmatched quality. In order to analyse the data, the ATLAS Collaboration has designed a distributed computing model based on GRID technologies. The ATLAS computing model and its evolution since the start of the LHC is discussed in section 3.1. The ATLAS computing model groups the different types of computing centers of the ATLAS Collaboration in a tiered hierarchy that ranges from Tier-0 at CERN, down to the 11 Tier-1 centers and the nearly 80 Tier-2 centres distributed world wide. The Spanish Tier-2 activities during the first years of data taking are described in section 3.2. Tier-3 are institution-level non-ATLAS funded or controlled centres that participate presuma...

Villaplana Prez, Miguel; Vos, Marcel


Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...


21F.740 The New Spain: 1977-Present, Fall 2005  

E-Print Network [OSTI]

This course deals with the vast changes in Spanish social, political, and cultural life that have taken place since the death of Franco. It examines the new freedom from censorship; the re-emergence of strong movements for ...

Resnick, Margery


Supply chain network for hydrogen transportation in Spain  

E-Print Network [OSTI]

Hydrogen fuel is considered one of the major emerging renewable substitutes for fossil fuel. A crucial factor as to whether hydrogen will be successful depends on its cost as a substitute. Recently, there has been a growing ...

Liang, Li



Hydraulic fracking sustainability assesment : case of study Luena (Cantabria, Spain).  

E-Print Network [OSTI]

??The opposition to Hydraulic fracturing in Cantabria, has led the Regional Government to enact a law that prohibits their use in the region, which has (more)

Fernndez Ferreras, Jose Antonio



Integration of public transportation systems : the case of Gipuzkoa, Spain  

E-Print Network [OSTI]

This thesis studies the integration of public transportation systems, focusing on the development of strategies to implement such goal for networks operated by different service agencies. A literature review on public ...

Gmez Glvez, Julin Andrs



The regional trade-union : lessons from Spain  

E-Print Network [OSTI]

The region has emerged in the last two decades as a new field of trade-union activity. There is increasing interaction across Europe between unions, employer associations, and state actors at the subnational territorial ...

Fraile, Lydia M



The Breeding Population of Eurasian Dotterel Charadrius Morinellus in Spain  

E-Print Network [OSTI]

Ricard Gutierrez, Antoni Carulla, Xavier Parellada, Diego Garcia-Ferre, Francesc Xavier Santaeufemia, Jordi Figuerola, Oriol Muntane, Francisco Cerda Journal: Wader Study Group Bulletin ...


Fertility, Female Participation in Employment and Reconciliation Policies in Spain  

E-Print Network [OSTI]

Different aspects of decisions regarding parenthood are analysed. From an institutional perspective, reconciliation policies and features of the female labour market are studied, as well as the values and life views that ...

Ibanez, Marta


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Lindane pollution near an industrial source in Northeast Spain  

SciTech Connect (OSTI)

Since DDT has been legally restricted for use in many countries, lindane, the gamma isomer of hexachlorocyclohexane, ({delta}-HCH), has become important as a substitute for DDT. Lindane is degraded poorly in the environment: it is hydrolyzed poorly and biodegrades slowly. Lindane is relatively immobile in soil. The town of Sabinanigo, located in northeast of the Iberian Peninsula, is host to one of only two factories in western Europe that manufacture lindane. HCH waste is being dumped near Sabinanigo by the chemical company Inquinosa. The purpose of this investigation are: (1) to determine the levels of HCH isomers in water, soil, vegetation, and invertebrates samples in five places of the Gallego river; (2) to evaluate biological accumulation of pollutant studied within the food webs; (3) to find out if the residue levels exceeded the limits recommended of HCH in water.

Hernandez, L.M.; Fernandez, M.A.; Gonzalez, M.J. (Inst. of Organic Chemistry, Madrid (Spain))



Mirrors and Echoes: Women's Writing in Twentieth-Century Spain  

E-Print Network [OSTI]

Balts sublima su creatividad frustrada en la lectura, perovoz, el espritu y la creatividad femeninas con la crnicaque se da entre creatividad y frustracin sexual y de los

Bergmann, Emilie L.; Herr, Richard



http://ifisc.uib.es -Mallorca -Spain BIOSIM: BIOSIMULATION  

E-Print Network [OSTI]

.; Mirasso, C.R.. Coherent regimes of mutually coupled Chua's circuits. Physical Review E 73, 036203 (1, Pere. Theory of collective firing induced by noise or diversity in excitable media. Physical Review E. # Tessone, C.J.; Zanette, D.H. ; Toral R.. Global firing induced by network disorder in ensembles of active

Oro, Daniel


Spain in the frame for Europe's bid to host  

E-Print Network [OSTI]

­110; 2003). Hans von Storch,a coastal researcher at the GKSS,an environmental research centre in Geesthacht


Paternal Genetic History of the Basque Population of Spain  

E-Print Network [OSTI]

; 0.0073 Mertens et al. (2007) Bosnia 181 0.4621 0.9734#5; 0.0054 Klaric et al. (2005) Bulgaria 126 0.5604 0.9874 #5; 0.0047 Zaharova et al. (2001) Castilla la Mancha 63 0.5226 0.9794 #5; 0.0089 Adams et al. (2008) Castile 131 0.5343 0.9799 #5; 0...% of the total variation and spreading from southeast to northwest through Europe (Cavalli- Sforza et al. 1994). This cline has been interpreted as a genetic signature of the DDM model, with a correlation of 0.89 between the first principal component of gene...

Young, Kristin L.; Sun, Guangyun; Deka, Ranjan; Crawford, Michael H.



ADASS XV in Spain: The Old Systems Are Dying.  

E-Print Network [OSTI]

and Systems Annular Solar Eclipse! Old Software systems are losing support Scripting and API's are being specifications for a new system which OIR Lunch 2005-10-20 Since 1995, there has been a Birds of a Feather


EUDEEP (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified as ASHRAEDuvalJusticeEPS Corp JumpESVEUDEEPEUDEEP (Smart


HiperDNO (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHi Gtel Jump to:County,1143807°,Hilltop,Hinsdale Wave


Renewable Energies and Photovoltaics Spain S L REPS | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia Blue Ridge And PiedmontReminderville,Jump to:Information


EWIS European wind integration study (Smart Grid Project) (Spain) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen


2011 University of Castilla la ManCha toledo, spain  

E-Print Network [OSTI]

Change Applications Session A3: Best Management Practices Session F3: Urban Processes and Management Scale Applications Session I4: Hydrology Session B2: Environmental Applications Session G2: Best.m. Discussion & Wrap Up 10:50 a.m. - 12:35 p.m. session a3 - Best management Practices (BmPs) moderator: C


Discriminacin, generalizacin y clasicacin mediante autmatas neuronales con ruido que induce depresin sinptica  

E-Print Network [OSTI]

Granada Universidad de Granada 18071, Granada (SPAIN) 18071, Granada (SPAIN) 18071, Granada (SPAIN) jmarro

Marro, Joaquín


Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren


Biblioteca Universitria-Novas Aquisies V. 6 N. 9 2014  

E-Print Network [OSTI]

.). Evaluación de sustentabilidad: un enfoque dinámico y multidimensional. 1. ed. Catarroja (Espanha): Valencia

Floeter, Sergio Ricardo



E-Print Network [OSTI]

Alcaide/Francisco Montero. Universitat de Valencia Caf 12.00.- Estimacin de biomasa en jaulas. Vctor

Escolano, Francisco


Graellsia, 63(1): 135-142 (2007) * Department of Animal Biology, Faculty of Sciences, University of Granada (Spain) 18071, Granada. Spain. hormiga@ugr.es  

E-Print Network [OSTI]

: Rossomyrmex anatolicus nov. sp., found in the eastern part of the Anatolian plains, near the region of Konya

Villemant, Claire


Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan


E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...


[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]


Sze, Lawrence


The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database https://github.com/solarpermit/solarpermit/archive/devel.zip


UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship



E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers


Evaluacin de la generacin de gases de efecto invernadero asociados al ciclo de vida de los biocombustibles colombianos = Assessment of greenhouse gases emissions associated to colombian biofuels lifecycle.  

E-Print Network [OSTI]

??Valencia Botero, Monica Julieth (2012) Evaluacin de la generacin de gases de efecto invernadero asociados al ciclo de vida de los biocombustibles colombianos = Assessment (more)

Valencia Botero, Monica Julieth



asma aguda bronquial: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paris-Sud XI, Universit de 23 Gastroenteritis aguda por rotavirus en poblacin infantil ingresada en unidades de lactantes de Valencia. Open Access Theses and...


Late Quaternary climate change from delta 13O records of multiple species of planktonic foraminifera: High-resolution records from the Anoxic Cariaco Basin, Venezuela  

E-Print Network [OSTI]

the Lake Valencia Basin, Venezuela, Ecology, 66, 1279-1295,1954. waters of eastern Venezuela, Bol. Inst. Oceanogr.Los foraminiferos de Venezuela (resumen), Acta Geol. Hisp. ,

Lin, Hui-Ling; Peterson, Larry C; Overpeck, Jonathan T; Trumbore, Susan E; Murray, David W



Herman Rubin: Publications  

E-Print Network [OSTI]

Robustness in generalized ridge regression and related topics. In Bayesian statistics, 3 (Valencia, 1987), Oxford Sci. Publ., pages 403-410. Oxford Univ. Press...


Science and Literary Culture during Spain's Edad de Plata (1923-1936)  

E-Print Network [OSTI]

Whitehead, Alfred North. Science and the Modern World. NewPostures: Literature, Science and the Two Cultures Debate.Critical Theory and Science Fiction. Hanover: Wesleyan

Hiller, Anna Eva



E-Print Network 3.0 - area sw spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics 2 MSWMA DUAL DEGREE PROGRAM Effective for students starting in 2011-2012 Summary: Academic Years Summer I: STM Course Course Area Credits TMxxx Christology or...


Diagenetic controls on porosity and permeability in Miocene carbonates, La Molata, Spain  

E-Print Network [OSTI]

and oxygen isotopes, Sr concentration and 87Sr/86Sr. The carbonate platform was extensively dolomitized at the end of the Miocene but before Pliocene deposition. Amount of dolomite increases basinward and down section; limestone is restricted to the most...

Li, Zhaoqi



E-Print Network 3.0 - association barcelona spain Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

| Study Abroad Program Summer Programs Course Syllabus- Barcelona: the City and its History... city in Europe," Barcelona enjoys the reputation of a cosmopolitan city with a...


Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

incentives given by transmission pricing form the foundationhas focussed on transmission pricing, monopoly regulation,

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris



Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

Institut de Recerca i Tecnologia Agroali- mentaria (IRTA)the Institut de Recerca i Tecnologia Agroalimentaria (IRTA)

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia



Impact of GPS Zenith Tropospheric Delay data on precipitation forecasts in Mediterranean France and Spain  

E-Print Network [OSTI]

implies that the GPS data has good potential for influencing numerical models in rapidly developing, high for the forecasting of rainfall. Water vapor plays an important role in energy transfer and in the formation of clouds. 1992]. Rocken et al. (1993)] demonstrated agreement between water vapor radiometers and GPS derived

Haase, Jennifer


Traumatized subjects : horror film and the legacy of mass extermination in post-dictatorship Spain  

E-Print Network [OSTI]

the display in the shop window, and the films last line ofwindow, the most brilliant flash of color in the entire film.windows, which had been covered with curtains throughout the rest of the film.

Boehm, Scott Walter



Discriminating Shareholders through the Exclusion of Pre-emption Rights? The European Infringement Proceeding against Spain  

E-Print Network [OSTI]

2004) 14546. 41 Siemens AG v Henry Nold, C-42/95 [1996] ECRin azioni (1978) 295. 55 Siemens AG v Henry Nold, C- 42/95 [of other investors. 54 In Siemens v. Nold, 55 the European

Grechenig, Kristoffel



Traumatized subjects : horror film and the legacy of mass extermination in post-dictatorship Spain  

E-Print Network [OSTI]

Film, in which an aging porn star agrees to participate inpolitics at work (torture porn after 9/11 and Abu Ghraib)wave of Hollywood torture porn (i.e. , the Saw and Hostel

Boehm, Scott Walter



The `Tortonian salinity crisis' of the eastern Betics (Spain) W. Krijgsman aY  

E-Print Network [OSTI]

The late Miocene depositional history of the Lorca and Fortuna basins, both occupying an internal position stratigraphy of this regressive sequence which shows that the evaporites of the Lorca and Fortuna basins

Utrecht, Universiteit


Can using a global perspective help control migration? : Ecuador and Spain's Proyecto Codesarrollo Canar-Murcia  

E-Print Network [OSTI]

process? Did you receive any help in the reintegrationUsing a Global Perspective Help Control Migration? Ecuadortheir time and hospitality to help me with my research while

Velasquez, Christina L.



Zarzuela : or lyric theatre as consumer nationalism in Spain, 1874-1930  

E-Print Network [OSTI]

French farce Miss Helyet. It received mixed reviews, with the critics praising the music but taking broad

Young, Clinton David


Note: This page contains sample records for the topic "valencia spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Designing new performance-based incentive regimes for operating contracts in the Province of Gipuzkoa, Spain  

E-Print Network [OSTI]

Over the last several decades, local transport authorities in Europe and around the world have introduced competitive bidding in concessions for providing bus service, often resulting in reduced costs for service. The main ...

Laidig, David Antonio



Design Optimization International Conference, April 5 -April 7 2005, Las Palmas, Spain,  

E-Print Network [OSTI]

Analysis, Product Line E1, Volkswagen AG, Wolfsburg Key words: Automatic Differentiation, Optimisation design process. The design application consists in the optimisation of the topology of a duct of dissipated energy with respect to the duct topology. This gradient is provided by the adjoint of the solver

Giering, Ralf


Empire's experts : the politics of knowledge in Spain's royal monopoly of quina (1751-1808)  

E-Print Network [OSTI]

of cinchona trees in the forests on two hills Cajanuma anda sample of bark from a hill or forest called Chima nearhills that surround [this town], wrote Olmedo, [the forests

Crawford, Matthew James



Present and future climate resources for various types of tourism in the Bay of Palma, Spain  

E-Print Network [OSTI]

such as solar heat load, heat loss by convection (i.e. wind), heat loss by evaporation (i.e. perspiration), long calculation The Rayman model accounts for the integrated body-atmosphere energy budget scheme by means-wave radiation exchanges and metabolic heat (i.e. level of activity). After computing Tmrt, the Physiological

Romero, Romu


Science and Literary Culture during Spain's Edad de Plata (1923-1936)  

E-Print Network [OSTI]

en estas Ciencias No es una sola, seor mo la causa de losque aunque cada una por s sola hara poco dao, el complejoAstronmica was on Josep Comas Sol, who would become a

Hiller, Anna Eva



Empire's experts : the politics of knowledge in Spain's royal monopoly of quina (1751-1808)  

E-Print Network [OSTI]

1776, fols. 24r-27v; Marcos de Lamar and Alvaro de Leon, 11, fol. 26r. Ibid. Marcos de Lamar and Alvaro de Leon, in the bark. Marcos de Lamar and Alvaro de Leon, officials

Crawford, Matthew James



Cyclostratigraphy and astronomical tuning of the Late Maastrichtian at Zumaia (Basque country, Northern Spain)  

E-Print Network [OSTI]

Department of Earth Sciences, Utrecht University, Budapestlaan 4, 3584 CD Utrecht, the Netherlands e Fort Hoofddijk Paleomagnetic Laboratory, Utrecht University, Budapestlaan 17, 3584 CD Utrecht, the Netherlands f

Utrecht, Universiteit


Meandering through southern Spain, the Rio Tinto's blood red colour warns that this  

E-Print Network [OSTI]

in Woods Hole to wonder how these microalgae prosper in acid (p. 2569). Messerli assumed that the acid if the microalgae maintain a neutral pH inside their cells. When they loaded a fluorescent pH-sensitive dye the microalgae deal with the onslaught of protons from the Rio Tinto, the team measured the microalgae

Gray, Matthew


Insights in Economical Complexity in Spain: the hidden boost of migrants in international tradings  

E-Print Network [OSTI]

We consider extensive data on Spanish international trades and population composition and, through statistical-mechanics and graph-theory driven analysis, we unveil that the social network made of native and foreign-born individuals plays a role in the evolution and in the diversification of trades. Indeed, migrants naturally provide key information on policies and needs in their native countries, hence allowing firm's holders to leverage transactional costs of exports and duties. As a consequence, international trading is affordable for a larger basin of firms and thus results in an increased number of transactions, which, in turn, implies a larger diversification of international traded products. These results corroborate the novel scenario depicted by "Economical Complexity", where the pattern of production and trade of more developed countries is highly diversified. We also address a central question in Economics, concerning the existence of a critical threshold for migrants (within a given territorial di...

Agliari, Elena; Galluzzi, Andrea; Requena-Silvente, Francisco; Tantari, Daniele



In Proc. Sixth International Symposium on Programming Language Implementation and Logic Programming, Madrid (Spain),  

E-Print Network [OSTI]

styles with a complete operational semantics are based on narrowing. In order to avoid useless described in this paper was supported in part by the German Mini* *stry for Research and Technology (BMFT at an outer position. Similarly to pure functional programming, such a lazy strat- egy avoids some useless

Hanus, Michael



E-Print Network [OSTI]

Menor from a drainage channel and the Albujon wadi, the main watercourse, and their influence. The Albujon wadi exported about 80% of the N load and 70% of the P load. Higher flows contributed pattern, decreasing with distance from the mouth of the Albujon wadi. Water nitrate and phosphate

Murcia, Universidad de


Zarzuela : or lyric theatre as consumer nationalism in Spain, 1874-1930  

E-Print Network [OSTI]

1962), 23-48. are either Allegro or Allegretto). 4 ChuecasBut the title music is a 2/4 Allegro moderato number whosethe tempo is marked Allegro. The prelude is orchestrated

Young, Clinton David



ISFNT-11, Barcelona, Spain, September 16-20, 2013 2013, ITER Organization  

E-Print Network [OSTI]

, Fabrication and Testing of the ITER First Wall and Shielding Blanket Presented by A. René Raffray Blanket Domestic Agency; 7SNL , US ITER Domestic Agency; 11th International Symposium on Fusion Nuclear Technology and neutron loads in the vacuum vessel and ex-vessel components · Provide a plasma-facing surface which

Raffray, A. René


2010 Robotics: Science and Systems June 27-31, 2010, Zaragoza, Spain  

E-Print Network [OSTI]

wheeled inverted pendulum, are also presented. I. INTRODUCTION Underactuated mechanical systems underactuated systems used in controls research include Acrobot, Pendubot, Cart-Pole, Beam-Ball and Rotating of underactuated systems. They include wheeled robots like Segway [2], ballbots [3] and legged robots like Big


Biogeochemical cycles in forests of the "Sierra de Bjar" mountains (province of Salamanca, Spain)  

E-Print Network [OSTI]

, a paraclimax Castanea sativa Miller sweet-chestnut coppice, and a disclimax Pinus sylvestris L Scots pine clear cutting; ii) a chestnut (Castanea sativa Miller) coppice about 15 years old after the last harvest

Boyer, Edmond


A growth model for eucalypt in Galicia, Spain Oscar Garcia a,1  

E-Print Network [OSTI]

was used for predicting growth of eucalypt coppice stands. Only limited, low quality data was available and techniques may be useful in other data-poor situations. Key words: Eucalyptus globulus, coppice, site index and accuracy. Dynamic models deal with these issues in a natural way. Most of the data corresponds to coppice

García, Oscar


Price Liquefied Sabine Pass, LA Natural Gas Exports Price to Spain (Dollars  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan670,174per Thousandperper Thousand Cubic


Price Liquefied Sabine Pass, LA Natural Gas Exports Price to Spain (Dollars  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan670,174per Thousandperper Thousand


U.S. Liquefied Natural Gas Exports to Spain (Million Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelinesProved ReservesFeet)per Thousand28 198 18 QInternational Falls, MNNoyes,2009 2010


Liquefied U.S. Natural Gas Re-Exports to Spain (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia,(Million Barrels) Crude Oil Reserves in Nonproducing Reservoirs Year in Review1,213 136,422Year Jan FebYear Jan Feb Mar