Powered by Deep Web Technologies
Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

VA's CHP Program  

NLE Websites -- All DOE Office Websites (Extended Search)

- 36,353 MWh Total Contract Cost - 70.3 million 1,900MWh generation + Extra Boilers + FREE STEAM VA's Existing CHP Plants Partnerships for Healing Environments 2010 6...

2

Elements VA VIIIB  

NLE Websites -- All DOE Office Websites (Extended Search)

2793 LIII 2p32 2677 MI 3s 544* MII 3p12 447.6 MIII 3p32 417.7 MIV 3d32 257.6 MV 3d52 253.9* Technetium 43 Rh K 1s 23220 LI 2s 3412 LII 2p12 3146 LIII 2p32 3004 MI 3s 628.1+...

3

US ENC WI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.

4

US ENC WI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.

5

WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Eugenio Magistretti  

E-Print Network (OSTI)

WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Slots Eugenio Magistretti Rice University of WiFi has deteriorated from over 80% at 1 Mbps to under 10% at 1 Gbps. In this paper, we propose WiFi-Nano, thereby reducing ack overhead. We validate the effectiveness of WiFi-Nano through im- plementation

Mellor-Crummey, John

6

VA Energy Management Action Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VA Energy Management VA Energy Management Action Plan Ken Demers Chief, VA National Energy Business Center Purpose Cited Deficiencies Within VA's Previous Energy Program... *No comprehensive Department-wide policy *Lack of coordinated acquisition and investment strategies throughout the Administrations and Staff Offices *No uniform measurement and verification of energy usage *Unverifiable reporting mechanism *Lack of capturing "lessons learned" and best practices from previous experiences Potential Annual Savings ENERGY COST ($000) CONSUMPTION (Billion Btu) Baseline - FY 2005: $397,577 Baseline - FY 2005: 29,094 Savings Savings SOURCE OF SAVINGS FY 2007 FY 2008 Future TOTAL

7

WI Windinvest | Open Energy Information  

Open Energy Info (EERE)

WI Windinvest WI Windinvest Jump to: navigation, search Name WI Windinvest Place Westfalen, Germany Zip 48727 Sector Wind energy Product Westfalen based wind project developer Coordinates 43.992484°, -117.711985° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.992484,"lon":-117.711985,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

8

Category:Richmond, VA | Open Energy Information  

Open Energy Info (EERE)

VA VA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Richmond, VA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Richmond VA Virginia Electric & Power Co.png SVFullServiceRestauran... 64 KB SVQuickServiceRestaurant Richmond VA Virginia Electric & Power Co.png SVQuickServiceRestaura... 64 KB SVHospital Richmond VA Virginia Electric & Power Co.png SVHospital Richmond VA... 66 KB SVLargeHotel Richmond VA Virginia Electric & Power Co.png SVLargeHotel Richmond ... 62 KB SVLargeOffice Richmond VA Virginia Electric & Power Co.png SVLargeOffice Richmond... 69 KB SVMediumOffice Richmond VA Virginia Electric & Power Co.png SVMediumOffice Richmon... 64 KB SVMidriseApartment Richmond VA Virginia Electric & Power Co.png

9

Evansville WI (WWTP) | Open Energy Information  

Open Energy Info (EERE)

Evansville WI (WWTP) Evansville WI (WWTP) Jump to: navigation, search Name Evansville WI (WWTP) Facility Evansville WI (WWTP) Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Evansville WI (WWTP) Energy Purchaser Evansville WI (WWTP) Location Evansville WI Coordinates 42.77765315°, -89.28004146° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.77765315,"lon":-89.28004146,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

10

Scheduling in multihop WiMAX networks  

Science Conference Proceedings (OSTI)

IEEE 802.16, popularly known as WiMAX, is at the forefront of the technology drive because of the growing demand for high-speed wireless broadband networks. Multihop WiMAX networks are particularly useful as they increase the coverage area without the ...

Debalina Ghosh; Ashima Gupta; Prasant Mohapatra

2008-04-01T23:59:59.000Z

11

VA  

NLE Websites -- All DOE Office Websites (Extended Search)

and Sm 2 K 2 IrO 7 : Iridium(VI) Oxides Prepared under Ambient Pressure," Ange- wandte Chemie, International Edition, 48, 215 (2009). of one particular group of solvents: molten...

12

What is MoWiTT  

NLE Websites -- All DOE Office Websites (Extended Search)

the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and...

13

Category:Green Bay, WI | Open Energy Information  

Open Energy Info (EERE)

WI WI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Green Bay, WI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVFullServiceRestauran... 79 KB SVQuickServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVQuickServiceRestaura... 79 KB SVHospital Green Bay WI Wisconsin Electric Power Co.png SVHospital Green Bay W... 79 KB SVLargeHotel Green Bay WI Wisconsin Electric Power Co.png SVLargeHotel Green Bay... 78 KB SVLargeOffice Green Bay WI Wisconsin Electric Power Co.png SVLargeOffice Green Ba... 90 KB SVMediumOffice Green Bay WI Wisconsin Electric Power Co.png SVMediumOffice Green B... 78 KB SVMidriseApartment Green Bay WI Wisconsin Electric Power Co.png

14

US SoAtl VA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

SoAtl VA SoAtl VA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl VA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl VA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl VA Expenditures dollars ELECTRICITY ONLY average per household * Virginia households consume an average of 86 million Btu per year, about 4% less than the U.S. average. * Average electricity consumption and costs are higher for Virginia households than the national average, but similar to those in neighboring states where electricity is the most common heating fuel. * Virginia homes are typically newer and larger than homes in other parts of the country. CONSUMPTION BY END USE

15

US SoAtl VA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

SoAtl VA SoAtl VA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl VA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl VA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl VA Expenditures dollars ELECTRICITY ONLY average per household * Virginia households consume an average of 86 million Btu per year, about 4% less than the U.S. average. * Average electricity consumption and costs are higher for Virginia households than the national average, but similar to those in neighboring states where electricity is the most common heating fuel. * Virginia homes are typically newer and larger than homes in other parts of the country. CONSUMPTION BY END USE

16

MoWiTT: The Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Airflow schematic MoWiTT: The Mobile Window Thermal Test Facility In the MoWiTT facility, efficient window-and-frame systems are measured to understand the flow of energy through...

17

DOE - Office of Legacy Management -- Reynolds Metals Co - VA 04  

Office of Legacy Management (LM)

Reynolds Metals Co - VA 04 Reynolds Metals Co - VA 04 FUSRAP Considered Sites Site: REYNOLDS METALS CO. (VA.04 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Virginia-Carolina Chemical Corporation VA.04-1 Location: 818 Perry Street , Richmond , Virginia VA.04-1 Evaluation Year: 1985 VA.04-2 VA.04-3 Site Operations: Preparatory process development involving only gram quantities of uranium performed in the 1950s. VA.04-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited materials handled VA.04-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.04-1 Radiological Survey(s): None Indicated VA.04-1 VA.04-4 Site Status: Eliminated from consideration under FUSRAP

18

The Atlanta VA Medical Center The Atlanta VA Medical Center http://www.atlanta.va.gov/careers/ is seeking candidates for a Speech  

E-Print Network (OSTI)

The Atlanta VA Medical Center The Atlanta VA Medical Center http regarding this position. The Atlanta VA Medical Center is comprised of 173 operating hospital beds and 100 at the Atlanta VA Medical Center. We are affiliated with the Emory University School of Medicine and are located

Peterson, Blake R.

19

An efficient security framework for mobile WiMAX  

Science Conference Proceedings (OSTI)

WiMAX is a technology that provides continuous high data throughput with low delays for various user types and modes of operation. The security protocols proposed for WiMAX impose a heavy performance overhead, especially on mobile subscribers running ... Keywords: PKMv2, WiMAX, handover, hierarcical identity based cryptography, security

Mete Rodoper; Arati Baliga; Edward Jung; Wade Trappe

2012-03-01T23:59:59.000Z

20

DOE - Office of Legacy Management -- Norfolk Naval Station - VA 05  

NLE Websites -- All DOE Office Websites (Extended Search)

Norfolk Naval Station - VA 05 Norfolk Naval Station - VA 05 FUSRAP Considered Sites Site: NORFOLK NAVAL STATION (VA.05) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Norfolk , Virginia VA.05-1 Evaluation Year: 1993 VA.05-1 Site Operations: Demonstration of extinguishing a uranium fire at the Fire Fighters School for AEC contractors. VA.05-3 VA.05-2 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited quantity of materials handled VA.05-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.05-2 Radiological Survey(s): Yes - Health and Safety Monitoring during operations only VA.05-2 Site Status: Eliminated from consideration under FUSRAP

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

DOE - Office of Legacy Management -- Mobil Oil Corp - VA 01  

Office of Legacy Management (LM)

Mobil Oil Corp - VA 01 Mobil Oil Corp - VA 01 FUSRAP Considered Sites Site: Mobil Oil Corp. (VA.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Virginia-Carolina Chemical Corporation VA.01-1 Location: 818 Perry Street , Richmond , Virginia VA.01-1 Evaluation Year: Circa 1987 VA.01-2 VA.01-3 Site Operations: Research/Development to recover Uranium as a byproduct of phosphate production; preparatory process for pilot plant scale operation at Nichols, Florida. VA.01-1 Site Disposition: Eliminated - Potential for residual radioactive contamination from small quantities of material used at the site is considered remote VA.01-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.01-1

22

KENO V.a certification package  

Science Conference Proceedings (OSTI)

KENO V.a has been certified. KENO V.a is a multigroup Monte Carlo criticality program used to calculate the k-effective of a 3-D system. It is part of the SCALE modular code system for performing Standardized Computer Analyses for Licensing Evaluation. SCALE was developed for the Nuclear Regulatory Commission to satisfy a need for a standardized method of analysis for the evaluation of nuclear fuel facility and package designs. In its present form, the system has the capability to perform criticality, shielding, and heat transfer analyses using well established functional modules tailored to the SCALE system. KENO V.a will be used at SRS to perform critical calculations related to nuclear criticality safety.

Niemer, K.A.

1994-04-01T23:59:59.000Z

23

Utilizing WiMAX mesh mode for efficient IPTV transmission  

Science Conference Proceedings (OSTI)

Providing high bit-rates, WiMAX enables IPTV multicasting for several simultaneous broadcasting channels. WiMAX base stations can offer higher capacity to users with better signal quality values, and more robust but lower capacity modulations to users ... Keywords: iptv, mesh mode, multicasting, wimax

Murat Ozyurt; Seckin Ulug; Tuna Tugcu

2010-10-01T23:59:59.000Z

24

Detecting transmission power misbehaviour in wi-fi networks  

Science Conference Proceedings (OSTI)

In Wi-Fi networks, transmission (TX) power levels are constrained by regulatory limits. However, the emergence of flexible MAC drivers allows the easy modification of PHY and MAC layer parameters. This has enabled users to attempt to violate these limits. ... Keywords: EIRP, Wi-Fi, detection, misbehaviour, transmission power

Szymon Szott, Marek Sikora, Marek Natkaniec, Krzysztof Loziak

2013-09-01T23:59:59.000Z

25

100-kVA Intelligent Universal Transformer Development  

Science Conference Proceedings (OSTI)

This status report documents the design and development of EPRI's 100-kVA Intelligent Universal Transformer (IUT).

2008-12-16T23:59:59.000Z

26

DOE - Office of Legacy Management -- Besley-Wells - Wisconsin - WI 03  

Office of Legacy Management (LM)

Besley-Wells - Wisconsin - WI 03 Besley-Wells - Wisconsin - WI 03 FUSRAP Considered Sites Site: Besley-Wells - Wisconsin (WI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Besley Products Co. WI.03-3 Location: Beloit , Wisconsin WI.03-1 Evaluation Year: 1994 WI.03-1 Site Operations: 1953 proposal for a trial lot of 500 uranium slugs to be machined by Besley double spindle wet grinder in order to compare production rate with that of current process; no indication proposed activities were carried out. WI.03-2 WI.03-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the indication that proposed activities were not carried out WI.03-1 WI.03-3 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None WI.03-3

27

WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS Location: Tribe WI-TRIBE- STOCKBRIDGE- MUNSEE BAND OF MOHICAN INDIANS WI American Recovery and Reinvestment Act: Proposed Action or Project Description The Stockbridge-Munsee Band of Mohican Indians proposes to conduct energy efficient audits of residential and commerical buildings. Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or

28

On the Construction of WiMax Mesh Tree  

E-Print Network (OSTI)

Abstract The IEEE 802.16 protocol, also known as WiMAX, has been designed to support long-range communications with high bitrates, using two operation modes: Point-to-Multi-Point (PMP) and Mesh. In the mesh mode, Subscriber Stations (SSs) can directly communicate with each other, thus forming a tree, and can be used to forward others data packets in a multihop fashion. On the contrary, in the PMP mode only one hop communication toward the Base Station (BS) is allowed. In this paper, we investigate the performance of the mesh mode by proposing an algorithm for constructing the WiMAX mesh tree. Our algorithm increases routes effective throughput by splitting long links into multiple shorter ones. We show through simulations that this approach leads to improving the throughput capacity of WiMAX-based wireless mesh networks. Index Terms WiMAX, wireless mesh networks. I.

Salim Nahle; Luigi Iannone; Benoit Donnet; Naceur Malouch

2007-01-01T23:59:59.000Z

29

DOE - Office of Legacy Management -- Allis-Chalmers Co - WI 01  

Office of Legacy Management (LM)

Allis-Chalmers Co - WI 01 Allis-Chalmers Co - WI 01 FUSRAP Considered Sites Site: Allis-Chalmers Co (WI.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Hawley Plant WI.01-1 Location: Milwaukee , Wisconsin WI.01-1 Evaluation Year: 1987 WI.01-1 Site Operations: Manufactured electrical equipment - pumps, motors, and switchgears for K-25 and Y-12. WI.01-1 Site Disposition: Eliminated - Scope of testing activities were limited - Very small amounts of Uranium metal were used for testing - Potential for residual radioactive material on the site considered remote. WI.01-1 WI.01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium Metal WI.01-1 Radiological Survey(s): None Indicated

30

DOE - Office of Legacy Management -- Trane Co - WI 0-02  

Office of Legacy Management (LM)

Trane Co - WI 0-02 Trane Co - WI 0-02 FUSRAP Considered Sites Site: TRANE CO. (WI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: LaCross , Wisconsin WI.0-02-1 Evaluation Year: 1987 WI.0-02-1 Site Operations: Produced Aluminum cans for fuel rod experiments at Argonne Met Lab; Supplied construction materials to Oak Ridge. WI.0-02-1 Site Disposition: Eliminated - No radioactive materials used at this site WI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None WI.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TRANE CO. WI.0-02-1 - Memorandum/Checklist; A. Wallo to the File; (Elimination

31

Communication and Collaboration Keep San Francisco VA Medical Center  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Communication and Collaboration Keep San Francisco VA Medical Communication and Collaboration Keep San Francisco VA Medical Center Project on Track Communication and Collaboration Keep San Francisco VA Medical Center Project on Track October 7, 2013 - 1:56pm Addthis San Francisco VA Medical Center The San Francisco VA Medical Center is saving more than $500,000 and almost 3 million kWh every year through a retrofit financed by FEMP's Super ESPC Program. Overview The Veterans Affairs Medical Center in San Francisco is saving almost 3 million kilowatt-hours of electricity, more than 70,000 therms of natural gas, and more than $500,000 annually. The energy savings are enough to power 400 homes and supply natural gas to more than 100 homes each year in California. These savings were realized by taking advantage of Super Energy

32

MoWiTT:Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed to help buildings retain some of the energy that would have leaked out of less efficient windows. Designing efficient window-and-frame systems requires accurate measurement of the flow of energy through windows in realistic conditions, a capability provided by the Mobile Window Thermal Test facility. Consisting of a pair of outdoor, room-sized calorimeters, MoWiTT measures the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and measures the temperatures, solar fluxes, and

33

Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Moving to a Clean Energy Economy-VA 9 24 09.doc Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09.doc Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09.doc...

34

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

35

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

36

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

37

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

38

Fundamentals of WiMAX: Understanding Broadband Wireless Networking  

Science Conference Proceedings (OSTI)

This is the eBook version of the printed book. Praise for Fundamentals of WiMAX "This book is one of the most comprehensive books I have reviewed ... it is a must-read for engineers and students planning to remain current or who plan to pursue a career ...

Jeffrey Andrews; Arunabha Ghosh; Rias Muhamed

2011-10-01T23:59:59.000Z

39

A survey of MAC based QoS implementations for WiMAX networks  

Science Conference Proceedings (OSTI)

We present a comprehensive survey of proposed Quality of Service (QoS) mechanisms in the Media Access Control (MAC) sublayer of WiMAX based wireless networks. QoS support in WiMAX is a fundamental design requirement, and is considerably more difficult ... Keywords: MAC, Media Access Control, QoS, Quality of Service, WiMAX, Wireless networks

Y. Ahmet ?ekercio?lu; Milosh Ivanovich; Alper Ye?in

2009-09-01T23:59:59.000Z

40

QoS differentiation for IEEE 802.16 WiMAX mesh networking  

Science Conference Proceedings (OSTI)

Recently IEEE 802.16 WiMAX has attracted a lot of attention in wireless networking research and applications. To enable a flexible and cost-effective deployment, mesh networking mode is defined in WiMAX standard. In this paper, we introduce a system ... Keywords: IEEE 802.16, QoS, WiMAX mesh, interference-aware design, scheduling

Yan Zhang; Honglin Hu; Hsiao-Hwa Chen

2008-04-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

A joint centralized scheduling and channel assignment scheme in WiMax mesh networks  

Science Conference Proceedings (OSTI)

The IEEE 802.16 standard, also known as Worldwide Interoperability for Microwave Access (WiMax), which provides a mechanism for deploying high-speed wireless mesh networks in metropolitan areas. Thus, Quality of Service (QoS) is very important for WiMax ... Keywords: MDFS algorithm, WiMax mesh networks, centralized scheduling, channel assignment

Yuliang Tang; Yan Yao; Xinrong Lin

2009-06-01T23:59:59.000Z

42

Hydrogen Production and Dispensing Facility Opens at W. Va. Airport |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hydrogen Production and Dispensing Facility Opens at W. Va. Airport Hydrogen Production and Dispensing Facility Opens at W. Va. Airport Hydrogen Production and Dispensing Facility Opens at W. Va. Airport August 19, 2009 - 1:00pm Addthis Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Washington, D.C. -- A hydrogen production and dispensing station constructed and operated with support from the Office of Fossil Energy's National Energy Technology Laboratory (NETL) was officially opened Monday at the Yeager Airport in Charleston, W.Va. The facility is an example of how domestically produced fuels may be used to power a variety of vehicles

43

DOE - Office of Legacy Management -- Naval Proving Ground - VA 0-01  

NLE Websites -- All DOE Office Websites (Extended Search)

Proving Ground - VA 0-01 Proving Ground - VA 0-01 FUSRAP Considered Sites Site: NAVAL PROVING GROUND (VA.0-01 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Dahlgren , Virginia VA.0-01-1 Evaluation Year: 1987 VA.0-01-1 Site Operations: Site operations were not specified; this site was identified on the 1954 Accountable Station Lists. VA.0-01-1 VA.0-01-2 Site Disposition: Eliminated - Referred to DOD VA.0-01-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD VA.0-01-1 Also see Documents Related to NAVAL PROVING GROUND VA.0-01-1 - DOE Letter; Fiore to Schafer; Referral of DOD or Former

44

DOE - Office of Legacy Management -- Reactor Site - Fort Belvoir - VA 0-02  

NLE Websites -- All DOE Office Websites (Extended Search)

Reactor Site - Fort Belvoir - VA Reactor Site - Fort Belvoir - VA 0-02 FUSRAP Considered Sites Site: REACTOR SITE - FORT BELVOIR (VA.0-02 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Fort Belvoir , Virginia VA.0-02-1 Evaluation Year: 1987 VA.0-02-1 Site Operations: No evidence of AEC involvement with reactor operations. AEC conducted health and safety inspections of this site. Probably a licensed operation. VA.0-02-1 Site Disposition: Eliminated - Referred to DOD VA.0-02-1 Radioactive Materials Handled: Reactor fuel Primary Radioactive Materials Handled: Reactor Fuel Radiological Survey(s): Health and safety inspections VA.0-02-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD VA.0-02-1

45

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...

46

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

47

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

48

Wireless wakeups revisited: energy management for voip over wi-fi smartphones  

Science Conference Proceedings (OSTI)

IP based telephony is rapidly gaining acceptance over traditional means of voice communication. Wireless LANs are also becoming ubiquitous due to their inherent ease of deployment and decreasing costs. In enterpriseWi-Fi environments, VoIP is a compelling ... Keywords: VoIP, Wi-Fi, cellular networks, power management, smartphones

Yuvraj Agarwal; Ranveer Chandra; Alec Wolman; Paramvir Bahl; Kevin Chin; Rajesh Gupta

2007-06-01T23:59:59.000Z

49

Applications of WiMAX-based wireless mesh network in monitoring wind farms  

Science Conference Proceedings (OSTI)

This paper has studied the feasibility of applying World Interoperability for Microwave Access (WiMAX) based Wireless Mesh Networks (WMNs) in monitoring wind farms. WMNs provide a dynamic topology which meets the requirements of communications ... Keywords: WMNs, WiMAX, World Interoperability for Microwave Access, communications, renewable energy, simulation, wind energy, wind farm monitoring, wind farms, wind power, wireless mesh networks, wireless networks

Gang Zheng; Hongbing Xu; Xinheng Wang; Jianxiao Zou

2010-09-01T23:59:59.000Z

50

Blue-Fi: enhancing Wi-Fi performance using bluetooth signals  

Science Conference Proceedings (OSTI)

Mobile devices are increasingly equipped with multiple network interfaces with complementary characteristics. In particular, the Wi-Fi interface has high throughput and transfer power efficiency, but its idle power consumption is prohibitive. In this ... Keywords: bluetooth, context-awareness, energy-efficiency, location, mobile device, wi-fi

Ganesh Ananthanarayanan; Ion Stoica

2009-06-01T23:59:59.000Z

51

Citywide mobile internet access using dense urban WiFi coverage  

Science Conference Proceedings (OSTI)

We investigate if it is feasible to use the WiFi coverage in urban areas for mobile Internet access and which type of applications can benefit from the Internet access provided by the already deployed WiFi Access Points (APs). Nowadays, most smartphones ... Keywords: mobile clients, mobile internet access, wifi, wireless networks

Maria Eugenia Berezin; Franck Rousseau; Andrzej Duda

2012-12-01T23:59:59.000Z

52

WiMAX Double Movable Boundary Scheme in the Vehicle to Infrastructure Communication Scenario  

Science Conference Proceedings (OSTI)

WiMAX is an interesting technology that will be applied in vehicular networks due to the provisioning of high mobility, wide coverage, and different classes of service. In this paper, we investigate the problem of vehicular applications mapping in the ... Keywords: Intelligent Transportation System, Quality of service, Scheduling, WiMAX

Rola Naja; Melhem El Helou; Samir Tohm

2012-11-01T23:59:59.000Z

53

Beyond deployments and testbeds: experiences with public usage on vehicular WiFi hotspots  

Science Conference Proceedings (OSTI)

We describe our experiences with deploying a vehicular Internet access service on public transit buses. Our system, called WiRover, has been running on these buses since April 2010 for about 18 months till date providing a WiFi hotspot to which bus passengers ... Keywords: network diversity, vehicular connectivity, wireless, wirover

Joshua Hare; Lance Hartung; Suman Banerjee

2012-06-01T23:59:59.000Z

54

Fast-converging scheduling and routing algorithms for WiMAX mesh networks  

Science Conference Proceedings (OSTI)

In this paper, we present fast converging algorithms that fit well WiMAX mesh networks. First, a centralized scheduling algorithm is presented. It calculates schedules by transforming the multi-hop tree into a single hop, and then repartitioning the ... Keywords: WiMAX, mesh networks, routing, scheduling

Salim Nahle; Naceur Malouch

2011-05-01T23:59:59.000Z

55

VA-4-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4-B Wholesale Power Rate Schedule 4-B Wholesale Power Rate Schedule VA-4-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina served through the transmission facilities of Virginia Electric and Power Company (hereinafter called the Company) and PJM Interconnection LLC (hereinafter called PJM). This rate schedule shall be applicable to the sale at wholesale of power and accompanying energy generated at the John H. Kerr and Philpott Projects (hereinafter called the Projects) and sold under appropriate contracts between the Government and the Customer. Document Available for Download VA-4-B Rate Schedule More Documents & Publications

56

Energy Management for the "WiFi of Things"  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Management for the "WiFi of Things" Energy Management for the "WiFi of Things" Speaker(s): Janet Peterson Date: May 6, 2010 - 12:00pm Location: 90-3122 This seminar will present an overview of the WiFi enabled energy management technologies pioneered by Our Home Spaces. Our Home Spaces provides consumer facing energy management solutions. These energy management solutions are based on using the existing consumer infrastructure and devices - this allows a lower cost of entry for both the utilities and less complexity in the home. Working with low cost low power WiFi chips from GainSpan and Marvell allow WiFi solutions to range from communicating thermostat, to energy monitoring and controlling smart plugs thru irrigation controllers. The system takes advantage of ubiquitous nature

57

A-GPS Assisted Wi-Fi Access Point Discovery on Mobile Devices for Energy Saving  

E-Print Network (OSTI)

Mobile devices have been shipped with multiple wireless network interfaces in order to meet their diverse communication and networking demands. In this paper, we propose an A-GPS assisted scheme that discovers the nearest Wi-Fi network access points (APs) by using user's location information. This allows the user to switch to the Wi-Fi interface in an intelligent manner when she/he arrives at the nearest Wi-Fi network AP. Therefore, it avoids the long periods in idle state and greatly reduces the number of unnecessary Wi-Fi scans on the mobile device. The experimental results demonstrate that our scheme effectively saves energy for mobile devices integrated with Wi-Fi and cellular interfaces.

Xia, Feng; Ding, Fangwei; Hao, Ruonan

2012-01-01T23:59:59.000Z

58

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

59

Super Wi-Fi is Super for Energy Too | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too September 24, 2010 - 11:45am Addthis Super Wi-Fi is Super for Energy Too Nick Sinai Senior Advisor to the U.S. Chief Technology Officer, White House Office of Science and Technology Policy What does this mean for me? By integrating broadband into the emerging Smart Grid, consumers will have revolutionized communication with their utility -- they will have detailed information on their energy use that will help inform them how they can save on their electric bills. Editor's Note: Cross-posted from the National Broadband Plan blog, which deals with how broadband technology will integrate into the smart grid. We at the FCC are very excited about yesterday's order to free up the unused "white spaces" spectrum between television channels, intended to

60

Using unlabeled Wi-Fi scan data to discover occupancy patterns of private households  

Science Conference Proceedings (OSTI)

This poster presents the homeset algorithm, a lightweight approach to estimate occupancy schedules of private households. The algorithm relies on the mobile phones of households' occupants to collect Wi-Fi scans. The scans are then used to determine ...

Wilhelm Kleiminger, Christian Beckel, Anind Dey, Silvia Santini

2013-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Identified Patent Waiver W(I)2012-003 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 Identified Patent Waiver W(I)2012-003 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...

62

Identified Patent Waiver W(I)2012-004 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 Identified Patent Waiver W(I)2012-004 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...

63

Identified Patent Waiver W(I)2012-005 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 Identified Patent Waiver W(I)2012-005 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...

64

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

65

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

66

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

67

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

68

VA-2-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2-B Wholesale Power Rate Schedule 2-B Wholesale Power Rate Schedule VA-2-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina to whom power may be transmitted pursuant to contracts between the Government, Virginia Electric and Power Company (hereinafter called the Company), the Company's Transmission Operator, currently PJM Interconnection LLC (hereinafter called PJM), and the Customer. This rate schedule shall be applicable to the sale at wholesale of power and accompanying energy generated at the John H. Kerr and Philpott Projects and sold under appropriate contracts between the Government and the Customer. Document Available for Download

69

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

70

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

71

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

72

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

73

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

74

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

75

FI St Po Crypto IPS 140 tanley ortal Ga ograph 0-2 Sec Wi-Q ...  

Science Conference Proceedings (OSTI)

... Q Portal Gat ey Wi-Q Port a wireless ga Wi-Q Comm ry 802.15.4 on tested: 3. on tested: 12 tion ... he s the nts. Page 11. ... The PG d lf Test ower-Up ...

2013-06-12T23:59:59.000Z

76

A study on the security, the performance and the penetration of Wi-Fi networks in a Greek urban area  

Science Conference Proceedings (OSTI)

This paper presents a study on the expansion of urbanWi-Fi networks and the degree of users' awareness about their characteristics. It involves an experiment contacted at the area of Serres, a Greek city of around 70,000 inhabitants. The findings revealed ... Keywords: Wi-Fi networks usage, urban networks, war driving, wireless security

Savvas Mousionis; Alex Vakaloudis; Constantinos Hilas

2011-06-01T23:59:59.000Z

77

A Silence Duration Based Uplink Scheduling Algorithm for Multiple VoIP Users in M-WiMAX  

Science Conference Proceedings (OSTI)

This paper proposes an efficient uplink scheduling algorithm that can perfectly support various VoIP CODECs with VAD/DTX/CNG in M-WiMAX considering the variants of silence duration between different voice users, solving the problems of uplink resources ... Keywords: G.729B, VAD/DTX/CNG, VoIP CODECs, WiMAX, ertPS, scheduling algorithm

Farouk Y. M. Alkadhi; Zheng Liu; Min Yang; Qiuhong Wang; Jufeng Dai

2010-01-01T23:59:59.000Z

78

Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7  

E-Print Network (OSTI)

Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7 1 the box is unchecked. #12;Quick GuideWindows 7 Wi-Fi set up 7. Successfully added postech -> Change Connection Setup Guide for Windows 7 Make sure this box is unchecked. #12;

Kim, Yong Jung

79

A cross-layer framework for video-on-demand service in multi-hop WiMax mesh networks  

Science Conference Proceedings (OSTI)

In this work, we introduce a cross-layer framework to favor the video-on-demand service in multi-hop WiMax mesh networks. We first propose a joint solution of admission control and channel scheduling for video streams. The proposed approach guarantees ... Keywords: Cross-layer design, Simulation, Video-on-demand, WiMax, Wireless mesh network

Fei Xie; Kien A. Hua; Ning Jiang

2008-05-01T23:59:59.000Z

80

W.Va. Mom Sees Benefits of Weatherization | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

W.Va. Mom Sees Benefits of Weatherization W.Va. Mom Sees Benefits of Weatherization W.Va. Mom Sees Benefits of Weatherization April 2, 2010 - 2:43pm Addthis Joshua DeLung Not only is Rachael McCarty working full-time and going to college, but also she's a full-time single mom of two small children. After moving to Bluefield, W.Va., from California a few years ago, Rachel bought her first home, a property that needed some work. "It's a very, very old house, and it didn't really have any insulation," she says. Last year, Rachael was approved for the weatherization assistance program from Community Action of South Eastern West Virginia. The agency installed a new furnace and insulation, along with a new hot water heater and weather stripping for the doors. She says the house was much easier to heat this

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

If you reside in WASHINGTON, DC - MD -VA - WV your salary will...  

National Nuclear Security Administration (NNSA)

If you are employed in the WASHINGTON, DC Metropolitan Area (D.C., Baltimore, Northern VA, Eastern WV, and Southern PA) your salary will range from: Pay Band Pay Plan(s) Minimum...

82

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY  

E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew

83

Experiences, challenges and lessons from rolling out a rural WiFi mesh network  

Science Conference Proceedings (OSTI)

The computing for development community knows that technology interventions involve consideration of social, technical and environmental factors. Research into WiFi solutions has fallen off as ubiquitous mobile solutions penetrate even the deepest rural ... Keywords: VoIP, baseline study, community co-design, inverse infrastructure, participatory and ethnographic methods, telecommunications

Carlos Rey-Moreno; Zukile Roro; William D. Tucker; Masbulele Jay Siya; Nicola J. Bidwell; Javier Simo-Reigadas

2013-01-01T23:59:59.000Z

84

Improvement security for RuBee radio-WiMAX mesh networks  

Science Conference Proceedings (OSTI)

Next generation communication standard integrate various access networks technology to become mesh networks. One of air interface standard is metropolitan area wireless broadband service. IEEE 802.16 is the basis for Worldwide Interoperability for Microwave ... Keywords: AAA, RuBee (IEEE 1902.1), WiMAX, gateway access point, group identity key

Tin-Yu Wu; Jhong-Ci Wu; Wei-Fang Weng

2008-09-01T23:59:59.000Z

85

Wi-Fi/ZigBee coexistence for fault-tolerant building automation system  

Science Conference Proceedings (OSTI)

The paper presents a case study where a building automation system is investigated using two wireless standards, ZigBee and Wi-Fi 802.11b. Since each standard has specific features and advantages, a network incorporating both manifests itself as an optimal ...

Tarek K. Refaat, Mohamed A. Saleh, Ramz M. Daoud, Hassanein H. Amer, Magdy S. El-Soudani, Magdi S. Moustafa

2013-08-01T23:59:59.000Z

86

An experimental performance comparison of 3G and Wi-Fi  

Science Conference Proceedings (OSTI)

Mobile Internet users have two options for connectivity: pay premium fees to utilize 3G or wander around looking for open Wi-Fi access points. We perform an experimental evaluation of the amount of data that can be pushed to and pulled from the Internet ...

Richard Gass; Christophe Diot

2010-04-01T23:59:59.000Z

87

Perspectives on quality of experience for video streaming over WiMAX  

Science Conference Proceedings (OSTI)

The advent of broadband wireless networks, such as WiMAX, is paving the way for the widespread deployment of high-bandwidth video streaming services for mobile users. To provide acceptable end-to-end performance in such a network, it is important to ...

Arun Vishwanath; Partha Dutta; Malolan Chetlu; Parul Gupta; Shivkumar Kalyanaraman; Amitabha Ghosh

2010-03-01T23:59:59.000Z

88

WiMAX-RBDS-Sim: an OPNET simulation framework for IEEE 802.16 mesh networks  

Science Conference Proceedings (OSTI)

In this paper, a simulation model for IEEE 802.16 (WiMAX) wireless mesh networks with distributed scheduling is developed. It provides a framework for the evaluation of reservation-based distributed scheduling (RBDS) policies at the medium access control ... Keywords: IEEE 802.16, OPNET, distributed scheduling, simulation, wireless mesh networks

Gustavo Vejarano; Janise McNair

2010-03-01T23:59:59.000Z

89

Demonstration Project for a 300 kVA Dynamic Sag Corrector  

Science Conference Proceedings (OSTI)

The dynamic sag corrector (DySC) represents a relatively new technology for mitigating voltage sags in a cost-effective manner. The device -- which comes in sizes ranging from 1 kVA to 2 MVA -- can provide ride-through during voltage sags to 50 percent of nominal voltage for up to 12 cycles with no energy storage. This report documents the installation, testing, and performance of a 300-kVA ProDySC, with optional energy storage capacitors.

2001-10-23T23:59:59.000Z

90

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

91

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

92

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

93

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"

94

U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co

95

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

96

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

97

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...

98

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

99

C:\\ANNUAL\\VENTCHAP.V8\\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...

100

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

102

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

3 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE...

103

File:USDA-CE-Production-GIFmaps-WI.pdf | Open Energy Information  

Open Energy Info (EERE)

WI.pdf WI.pdf Jump to: navigation, search File File history File usage Wisconsin Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 326 KB, MIME type: application/pdf) Description Wisconsin Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Wisconsin External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (326 KB) MapBot (Talk | contribs) Automated bot upload

104

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

105

Multi-channel transmission with efficient delivery of routing information in maritime WiMAX mesh networks  

Science Conference Proceedings (OSTI)

There is a lack of broadband wireless network in sea to meet the increasing needs of modern maritime users and we have envisaged WiMAX mesh networks for high-speed and low-cost ship-to-ship/shore communications. In such a maritime WiMAX mesh network, ... Keywords: IEEE Std 802.16-2004, broadband wireless access, maritime communications, mesh network, multi-channel transmission

Ming-Tuo Zhou; Hiroshi Harada; Peng-Yong Kong; Chee-Wei Ang; Yu Ge; J. S. Pathmasuntharam

2009-06-01T23:59:59.000Z

106

50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

107

February 2006, NRAO, VA (or why H0 is the Dark Energy)  

E-Print Network (OSTI)

Wayne Hu February 2006, NRAO, VA (or why H0 is the Dark Energy) Dark Energy in Light of the CMB #12;If its not dark, it doesn't matter! · Cosmic matter-energy budget: Dark Energy Dark Matter Dark provide the high redshift cornerstone to cosmological inferences on the dark matter and dark energy WMAP

Hu, Wayne

108

Digital pioneers: computer-generated art from the v&a's collections  

Science Conference Proceedings (OSTI)

The Victoria and Albert's acquisition of major computer art collections is part of an ongoing project to document and preserve the history of this field. The V&A's pioneering work in this area is connected to the Computer Art and Technocultures project, ...

Douglas Dodds

2010-02-01T23:59:59.000Z

109

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

110

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

111

DOE Spent Nuclear Fuel Information In Support of TSPA-VA  

SciTech Connect

RW has started the viability assessment (VA) effort to determine the feasibility of Yucca Mountain as the first geologic repository for spent nuclear fuel (SNF) and high-level waste. One component of the viability assessment will be a total system performance assessment (TSPA), based on the design concept and the scientific data and analysis available, describing the repository's probable behavior relative to the overall system performance standards. Thus, all the data collected from the Exploratory Studies Facility to-date have been incorporated into the latest TSPA model. In addition, the Repository Integration Program, an integrated probabilistic simulator, used in the TSPA has also been updated by Golder Associates Incorporated at December 1997. To ensure that the Department of Energy-owned (DOE-owned) SNF continues to be acceptable for disposal in the repository, it will be included in the TSPA-VA evaluation. A number of parameters are needed in the TSPA-VA models to predict the performance of the DOE-owned SNF materials placed into the potential repository. This report documents all of the basis and/or derivation for each of these parameters. A number of properties were not readily available at the time the TSPA-VA data was requested. Thus, expert judgement and opinion was utilized to determine a best property value. The performance of the DOE-owned SNF will be published as part of the TSPA-VA report. Each DOE site will be collecting better data as the DOE SNF program moves closer to repository license application. As required by the RW-0333P, the National Spent Nuclear Fuel Program will be assisting each site in qualifying the information used to support the performance assessment evaluations.

A. Brewer; D. Cresap; D. Fillmore; H. Loo; M. Ebner; R. McCormack

1998-09-01T23:59:59.000Z

112

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

113

File:EIA-Appalach6-WV-VA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-GAS.pdf Appalach6-WV-VA-GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.09 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

114

File:USDA-CE-Production-GIFmaps-VA.pdf | Open Energy Information  

Open Energy Info (EERE)

VA.pdf VA.pdf Jump to: navigation, search File File history File usage Virginia Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 380 KB, MIME type: application/pdf) Description Virginia Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Virginia External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (380 KB) MapBot (Talk | contribs) Automated bot upload

115

Case Study - The Department of Veterans Affairs West Haven Campus, VA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Department of Veterans Affairs West Haven Campus, The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System Case Study - The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System October 7, 2013 - 1:59pm Addthis Overview The West Haven (Connecticut) Campus of the Veterans Affairs Connecticut Health Care System was the first Veteran's Hospital to award a shared energy savings (SES) contract (now known as energy savings performance contracts). The project involves replacement of the lighting system, installation of a cooling system, maintenance of the new chiller equipment, and several smaller efforts. Up-front costs are being provided through a $3.9 million investment by the contractor, EUA Cogenex, about $400,000 in rebates from the local utilities for gas and electric service (Southern

116

File:EIA-Appalach6-WV-VA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-BOE.pdf Appalach6-WV-VA-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.02 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

117

Naval Station Norfolk, VA- Energy Conservation Program UESC Partnership Success Story  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Station Norfolk, VA Station Norfolk, VA Energy Conservation Program UESC Partnership Success Story 20 November 2008 2 Agenda Background Basis for Success Phase I Phase I Mod 01 Phase II Other / Future Program Aspects Why the Partnership Works 3 Background Minimal structured plan for NS Norfolk prior to 2006 Other MidLant Installations had aggressive ESPC programs in place The largest US Navy Installation in the World had only scratched the surface on all the opportunities for energy conservation Decision made to establish long term UESC partnership / program with VNG 4 NS Norfolk Basis for Success Focus on long term partnership with Utility to meet infrastructure needs and energy goals Gear project efforts to support core Mission of NS Norfolk Long term benefits more important than strict

118

KENO3D Visualization Tool for KENO V.a and KENO-VI Geometry Models  

SciTech Connect

Criticality safety analyses often require detailed modeling of complex geometries. Effective visualization tools can enhance checking the accuracy of these models. This report describes the KENO3D visualization tool developed at the Oak Ridge National Laboratory (ORNL) to provide visualization of KENO V.a and KENO-VI criticality safety models. The development of KENO3D is part of the current efforts to enhance the SCALE (Standardized Computer Analyses for Licensing Evaluations) computer software system.

Horwedel, J.E.; Bowman, S.M.

2000-06-01T23:59:59.000Z

119

The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-1  

E-Print Network (OSTI)

The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33 of WAPs Up to 125 1 WAP / 25 people #12;The University of Texas at Austin July 11, 2012 Data of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-3 5. Distance limitation

Texas at Austin, University of

120

Human activity recognition in indoor environments by means of fusing information extracted from intensity of WiFi signal and accelerations  

Science Conference Proceedings (OSTI)

In this work, we propose an activity recognition system based on the use of a topology-based WiFi localization system combined with accelerometers for body posture recognition. The WiFi localization system is developed using a fuzzy rule-based classifier ... Keywords: Fuzzy logic, Human activity recognition, Interpretability-accuracy trade-off

Alberto Alvarez-Alvarez; Jose M. Alonso; Gracian Trivino

2013-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Radiometric and Engineering Performance of the SeaWiFS Quality Monitor (SQM): A Portable Light Source for Field Radiometers  

Science Conference Proceedings (OSTI)

A portable and stable source of radiant flux, the Sea-viewing Wide Field-of-view Sensor (SeaWiFS) Quality Monitor (SQM), was developed as a field instrument for use in experiments away from the calibration laboratory such as those encountered ...

B. Carol Johnson; Ping-Shine Shaw; Stanford B. Hooker; Don Lynch

1998-08-01T23:59:59.000Z

122

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

123

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

124

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

125

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

126

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

127

Testing and Development of a 30-kVA Hybrid Inverter: Lessons Learned and Reliability Implications  

SciTech Connect

A 30-kVA Trace Technologies hybrid power processor was specified and tested at the Sandia inverter test facility. Trace Technologies involving the control system, in response to suggestions made modifications, primarily by Sandia and Arizona Public Service (APS) personnel. The modifications should make the inverter more universally applicable and less site-specific so that it can be applied in various sites with minimal field interaction required from the design engineer. The project emphasized the importance of battery management, generator selection, and site load management to the performance and reliability of hybrid power systems.

Ginn, J.W.

1998-12-21T23:59:59.000Z

128

¿A dónde se va la energía?  

NLE Websites -- All DOE Office Websites (Extended Search)

¿A dónde se va la energía? ¿A dónde se va la energía? Sólo aproximadamente el 14% -26% de la energía del combustible que usted pone en su tanque se usa para mover su coche o operar accesorios útiles, como el aire acondicionado. El resto de la energía es perdida en ineficiencias del motor, de la líínea de conducción y al estar a ralentí. Por lo tanto, el potencial para mejorar la eficiencia del combustible con tecnologías avanzadas es enorme. Combinadas Ciudad Carretera Conducir en Ciudad Los requerimientos de energía mostrados en el diagrama se calcularon conduciendo por la ciudad en el modo para-avanzar usando el procedimiento de la EPA FTP-75 Test. Perdidas de Motor En vehículos propulsados por gasolina, gran parte de la energía del combustible se pierde en el motor, primordialmente al calentarse. Pequeñas

129

Enhanced T-lymphocyte blastogenic response to tuberculin (PPD) in children of northeast (NE) Thailand supplemented with vitamin A (VA) and zinc (Zn)  

SciTech Connect

Beneficial effects of Va and/or Zn supplementation of children in NE Thailand are described in a companion abstract. In the same study, blastogenic response (BR) of T-lymphocytes to concanavalin-A (ConA) and PPD were assayed in cultures containing mononuclear cells (MNC) or whole blood (WB). Methods were previously described. Children were previously vaccinated with BCG. BR to ConA of MNC or WB from children supplemented with VA, Zn, VA + Zn or placebo were similar. BR to PPD of MNC was higher in children receiving VA + Zn than placebo, but not in children supplemented with VA or Zn alone. Data indicate that children with suboptimal VA and Zn nutriture supplemented with < 2 times RDA of these nutrients showed enhanced cellular immunity to PPD. This observation is relevant to BCG immunization program and thus may benefit public health.

Kramer, T.R.; Udomkesmalee, E.; Dhanamitta, S.; Sirisinha, S.; Charoenkiatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Smith, J.C. Jr. (Dept. of Agriculture, Beltsville, MD (United States) Mahidol Univ., Nakhon Pathom (Thailand))

1991-03-15T23:59:59.000Z

130

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook  

U.S. Energy Information Administration (EIA)

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook for Winter Fuels Outlook Conference National Association of State Energy Officials (NASEO)

131

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

132

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

133

Window nighttime U-values: A comparison between computer calculations and MoWiTT measurements  

SciTech Connect

The proper specification of window U-values has been a controversial area for many years, and current attempts to incorporate more careful treatment of windows into building standards and utility conservation programs and to define window energy labels has heightened the controversy. In a previous paper (Klems 1979) it was argued that current calculation techniques, as embodied in the computer program WINDOW, accurately represented field-measured window U-values, provided frame corrections and surface heat transfer coefficients were correctly estimated, and that in most cases the calculations were also consistent with test laboratory measurements on the same windows. This means that the calculation could serve both as a standard for deriving calculated U-values and as a method of comparing measurements made under different conditions to determine their consistency. This work has now been extended to form a joint US/Canadian collaborative effort to test current computer programs. For six windows the U-values measured with the MoWiTT under field conditions are compared with detailed U-value calculations for the same conditions using the programs WINDOW and ANSYS. There is good agreement between measurements and calculations. 7 refs., 3 figs., 4 tabs.

Klems, J.H.; Reilly, S.

1989-11-01T23:59:59.000Z

134

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

135

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

136

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

137

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

138

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

139

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

140

Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)

T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K J a p a n Mexico M e x...

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

142

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

143

Projected Regional Impacts of Appliance Efficiency Standards for the U.S. Residential Sector  

E-Print Network (OSTI)

TX UT VA VT WA WI WV WY US Primary Energy Savings PetajoulesTX UT VA VT WA WI WV WY US Primary Energy Savings PetajoulcsTX UT VA VT WA WI wv WY US Primary Energy Savings Petaioules

Koomey, J.G.

2010-01-01T23:59:59.000Z

144

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

145

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

146

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

147

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

148

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

149

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."

150

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

151

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

152

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

153

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

154

Validation of KENO V.a for highly enriched uranium systems with hydrogen and/or carbon moderation  

SciTech Connect

This paper describes the validation in accordance with ANSI/ANS-8.1-1983(R1988) of KENO V.a using the 27-group ENDF/B-IV cross-section library for systems containing highly-enriched uranium, carbon, and hydrogen and for systems containing highly-enriched uranium and carbon with high carbon to uranium (C/U) atomic ratios. The validation has been performed for two separate computational platforms: an IBM 3090 mainframe and an HP 9000 Model 730 workstation, both using the Oak Ridge Y-12 Plant Nuclear Criticality Safety Software (NCSS) code package. Critical experiments performed at the Oak Ridge Critical Experiments Facility, in support of the Rover reactor program, and at the Pajarito site at Los Alamos National Laboratory were identified as having the constituents desired for this validation as well as sufficient experimental detail to allow accurate construction of KENO V.a calculational models. Calculated values of k{sub eff} for the Rover experiments, which contain uranium, carbon, and hydrogen, are between 1.0012 {+-} 0.0026 and 1.0245 {+-} 0.0023. Calculation of the Los Alamos experiments, which contain uranium and carbon at high C/U ratios, yields values of k{sub eff} between 0.9746 {+-} 0.0028 and 0.9983 {+-} 0.0027. Safety criteria can be established using this data for both types of systems.

Elliott, E.P.; Vornehm, R.G. [Oak Ridge Y-12 Plant, TN (United States); Dodds, H.L. Jr. [Univ. of Tennessee, Knoxville, TN (United States). Nuclear Engineering Dept.

1993-06-04T23:59:59.000Z

155

Cross-layer modeling of capacity in wireless networks: Application to UMTS/HSDPA, IEEE802.11 WLAN and IEEE802.16 WiMAX  

Science Conference Proceedings (OSTI)

We investigate in this work the cross-layer modeling of the capacity of wireless systems in the presence of two types of flows: streaming and elastic, under a dynamic configuration wherein users join the system and leave it after a finite duration. For ... Keywords: Capacity, Cross-layer design, Flow level, IEEE802.11 WLAN, IEEE802.16 WiMAX, Integrated services, MAC scheduling, UMTS/HSDPA

Mariana Dirani; Chadi Tarhini; Tijani Chahed

2007-11-01T23:59:59.000Z

156

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

157

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

158

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

159

A High-Energy High-Luminosity p+-p* Collider David V. Neuffer, CEBAF', 12000 Jefferson Avenue, Newport News VA 23692  

E-Print Network (OSTI)

A High-Energy High-Luminosity p+-p* Collider David V. Neuffer, CEBAF', 12000 Jefferson Avenue be costly and does not use our ability to recirculate p's. A recirculating linac (RLA) like CEBAF" can and M. S. Zolotorev, Phys. Rev. Lett.71, 4146 (1993). 11. CEBAF Design Report, CEBAF, Newport News VA

McDonald, Kirk

160

U.S. Department of Energy Hydrogen and Fuel Cells Program 2012 Annual Merit Review and Peer Evaluation Report: May 14-18, 2012, Arlington, VA  

DOE Green Energy (OSTI)

This document summarizes the comments provided by peer reviewers on hydrogen and fuel cell projects presented at the fiscal year (FY) 2012 U.S. Department of Energy (DOE) Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting (AMR), held May 14-18, 2012, in Arlington, VA.

Not Available

2012-09-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

WI Radiation Protection  

Energy.gov (U.S. Department of Energy (DOE))

This statute seeks to regulate radioactive materials, to encourage the constructive uses of radiation, and to prohibit and prevent exposure to radiation in amounts which are or may be detrimental...

162

Wi-Fi security  

Science Conference Proceedings (OSTI)

"ALL [wireless security] mechanisms are completely in-effective" was the conclusion of a study by the Department of Computer Science at the University of Maryland. This discussion will systematically shed light on the inherent insecurities involved with ...

Paul Williams

2006-04-01T23:59:59.000Z

163

Neutrino--deuterium reactions in the 7-foot bubble chamber. [Strangeness, CVC theory, V-A theory  

DOE Green Energy (OSTI)

Recent results are reported from the analysis of 569,000 ..nu.. pictures taken in the BNL 7-ft bubble chamber filled with D/sub 2/ (and an additional 204,000 pictures in H/sub 2/). The statistics of current analysis include 648 quasielastic ..nu../sub ..mu../ d ..-->.. ..mu../sup -/pp/sub s/ events and 25 events with visible strangeness present. Using the quasielastic events in the framework of the conventional V-A theory, the values M/sub V/ = 0.87 +- 0.09 GeV and M/sub A/ = 1.03 +- 0.19 GeV are found. The value is in good agreement with the CVC prediction of M/sub V/ = 0.84 GeV. With the fixed value of M/sub V/ = 0.84 GeV, a one-parameter fit yields M/sub A/ = 1.08 +- 0.08 GeV. Also 8 events are found in the exclusive channel ..nu..n ..-->.. ..mu../sup -/K/sup +/..lambda.. in agreement with a theoretical calculation using the generalized Born approximation. 30 references.

Cnops, A M; Connolly, P L; Kahn, S A; Kirk, H G; Murtagh, M J; Palmer, R B; Samios, N P; Tanaka, M

1978-01-01T23:59:59.000Z

164

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

165

Advanced Battery Manufacturing (VA)  

SciTech Connect

LiFeBATT has concentrated its recent testing and evaluation on the safety of its batteries. There appears to be a good margin of safety with respect to overheating of the cells and the cases being utilized for the batteries are specifically designed to dissipate any heat built up during charging. This aspect of LiFeBATTs products will be even more fully investigated, and assuming ongoing positive results, it will become a major component of marketing efforts for the batteries. LiFeBATT has continued to receive prismatic 20 Amp hour cells from Taiwan. Further testing continues to indicate significant advantages over the previously available 15 Ah cells. Battery packs are being assembled with battery management systems in the Danville facility. Comprehensive tests are underway at Sandia National Laboratory to provide further documentation of the advantages of these 20 Ah cells. The company is pursuing its work with Hybrid Vehicles of Danville to critically evaluate the 20 Ah cells in a hybrid, armored vehicle being developed for military and security applications. Results have been even more encouraging than they were initially. LiFeBATT is expanding its work with several OEM customers to build a worldwide distribution network. These customers include a major automotive consulting group in the U.K., an Australian maker of luxury off-road campers, and a number of makers of E-bikes and scooters. LiFeBATT continues to explore the possibility of working with nations that are woefully short of infrastructure. Negotiations are underway with Siemens to jointly develop a system for using photovoltaic generation and battery storage to supply electricity to communities that are not currently served adequately. The IDA has continued to monitor the progress of LiFeBATTs work to ensure that all funds are being expended wisely and that matching funds will be generated as promised. The company has also remained current on all obligations for repayment of an IDA loan and lease payments for space to the IDA. A commercial venture is being formed to utilize the LiFeBATT product for consumer use in enabling photovoltaic powered boat lifts. Field tests of the system have proven to be very effective and commercially promising. This venture is expected to result in significant sales within the next six months.

Stratton, Jeremy

2012-09-30T23:59:59.000Z

166

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

167

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

168

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

169

Measurement of single and double glazing thermal performance under realistic conditions using the mobile window thermal test (MoWiTT) facility  

SciTech Connect

The thermal performance of single glazing, clear double glazing, and double glazing with a low-emissivity coating was measured in both south-facing and north-facing orientations under realistic field conditions using the new MoWiTT field test facility. The time-dependent net heat flow through each fenestration was found to be consistent with the predictions of the standard simplified heat transfer model, provided that an angle-dependent shading coefficient is used and diffuse solar gain is included in the calculation. Summer-condition average U-values were derived for each glazing type and were found to agree with the expected values for both types of double glazing. The measured U-value for single glazing was lower than predicted.

Klems, J.; Keller, H.

1986-11-01T23:59:59.000Z

170

www.eia.gov  

U.S. Energy Information Administration (EIA)

Vermont Yankee Vermont Total VA Surry North Anna Virginia Total WA Columbia Generating Station Washington Total WI Point Beach Nuclear Plant Kewaunee Wisconsin Total

171

www.eia.gov  

U.S. Energy Information Administration (EIA)

Vermont Yankee Vermont Total VA Surry North Anna Virginia Total WA Columbia Generating Station Washington Total WI Point Beach Nuclear Plant Wisconsin Total U.S. Total.

172

Better Buildings Neighborhood Program: Boulder, Garfield, and...  

NLE Websites -- All DOE Office Websites (Extended Search)

| SC TN | TX | VT | VI | VA WA | WI Boulder County, Colorado Customized Programs Help Energy Efficiency Rise in Three Colorado Counties Photo of buildings spread across a...

173

LBNL-4183E-rev1 N NA AT TU UR RA AL L G GA AS S V VA AR RI  

NLE Websites -- All DOE Office Websites (Extended Search)

4183E-rev1 4183E-rev1 N NA AT TU UR RA AL L G GA AS S V VA AR RI IA AB BI IL LI IT TY Y I IN N C CA AL LI IF FO OR RN NI IA A: : E EN NV VI IR RO ON NM ME EN NT TA AL L I IM MP PA AC CT TS S A AN ND D D DE EV VI IC CE E P PE ER RF FO OR RM MA AN NC CE E E EX XP PE ER RI IM ME EN NT TA AL L E EV VA AL LU UA AT TI IO ON N O OF F I IN NS ST TA AL LL LE ED D C CO OO OK KI IN NG G E EX XH HA AU US ST T F FA AN N P PE ER RF FO OR RM MA AN NC CE E Brett C. Singer, William W. Delp and Michael G. Apte Indoor Environment Department Atmospheric Sciences Department Environmental Energy Technologies Division July 2011 (Revised February 2012) Disclaimer 1 This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the United States Government nor any agency thereof, nor The Regents of the University of California, nor any of

174

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

175

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

176

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

177

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

178

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

179

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

180

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

182

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

183

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

184

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

185

NETL Researcher Honored with 2013 Federal Laboratory Award Morgantown, W.Va. - Dr. Stephen E. Zitney of the National Energy Technology  

NLE Websites -- All DOE Office Websites (Extended Search)

Researcher Honored with 2013 Federal Laboratory Award Researcher Honored with 2013 Federal Laboratory Award Morgantown, W.Va. - Dr. Stephen E. Zitney of the National Energy Technology Laboratory (NETL) has been awarded a Mid-Atlantic region Federal Laboratory Consortium (FLC) award for Excellence in Technology Transfer for his work on the 3D Virtual Energy Plant Simulator and Immersive Training System. The 3D Virtual Energy Plant Simulator and Immersive Training System (ITS) deployed at NETL's Advanced Virtual Energy Simulation Training and Research (AVESTAR ® ) Center delivers the first virtual energy plant for training, research, and development. NETL and its training partners are using the system to deliver realistic, cost-effective, and low-risk workforce training to the energy industries. Virtual reality-based training

186

Assessment of Degree of Applicability of Benchmarks for Gadolinium Using KENO V.a and the 238-Group SCALE Cross-Section Library  

SciTech Connect

A review of the degree of applicability of benchmarks containing gadolinium using the computer code KENO V.a and the gadolinium cross sections from the 238-group SCALE cross-section library has been performed for a system that contains {sup 239}Pu, H{sub 2}O, and Gd{sub 2}O{sub 3}. The system (practical problem) is a water-reflected spherical mixture that represents a dry-out condition on the bottom of a sludge receipt and adjustment tank around steam coils. Due to variability of the mixture volume and the H/{sup 239}Pu ratio, approximations to the practical problem, referred to as applications, have been made to envelop possible ranges of mixture volumes and H/{sup 239}Pu ratios. A newly developed methodology has been applied to determine the degree of applicability of benchmarks as well as the penalty that should be added to the safety margin due to insufficient benchmarks.

Goluoglu, S.

2003-12-01T23:59:59.000Z

187

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

188

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

189

Characterization of the environmental fate of Bacillus thuringiensis var. kaurstaki (Btk) after pest eradication efforts in Seattle, WA and Fairfax county, VA  

SciTech Connect

Understanding the fate of biological agents in the environment will be critical to recovery and restoration efforts after a biological attack. Los Alamos National Laboratory (LANL) is conducting experiments in the Seattle, WA and Fairfax County, VA areas to study agent fate in urban environments. As part of their gypsy moth suppression efforts, Washington State and Fairfax County have sprayed Bacillus thuringiensis var. kurstaki (Btk), a common organic pesticide for decades. Many of the spray zones have been in or near urban areas. LANL has collected surface and bulk samples from historical Seattle spray zones to characterize how long Btk persists at detectable levels in the environment, and how long it remains viable in different environmental matrices. This work will attempt to address three questions. First, how long does the agent remain viable at detectable levels? Second, what is the approximate magnitude and duration of resuspension? And third, does the agent transport into buildings? Data designed to address the first question will be presented. Preliminary results indicate Btk remains viable in the environment for at least two years.

Ticknor, Lawrence [Los Alamos National Laboratory; Van Cuyk, Sheila M [Los Alamos National Laboratory; Deshpande, Alina [Los Alamos National Laboratory; Omberg, Kristin M [Los Alamos National Laboratory

2008-01-01T23:59:59.000Z

190

sqas wi9 final document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SQAS96-001 SQAS96-001 Quality Report SQAS96-001 Preparation for a Software Quality Audit June 1996 Software Quality Assurance Subcommittee of the Nuclear Weapons Complex Quality Managers United States Department of Energy Albuquerque Operations Office Abstract This document will enable a site to prepare for a software quality audit by providing specific guidance. It will also provide guidance to a site that would enable it to perform a software quality audit. Preparation for a Software Quality Audit SQAS96-001 ACKNOWLEDGMENT This document was prepared for the Department of Energy (DOE) by a Working Group of the Nuclear Weapons Complex (NWC) Quality Managers' Software Quality Assurance Subcommittee (SQAS). The following contributed towards the creation of this document:

191

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

192

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

193

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

194

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

195

VA's Performance Contracting Program Overview  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kristan Higgins Kristan Higgins Phyllis Stange October 17, 2012 1 Keeping our promises to veterans through sustainability OVERVIEW  Veteran - Centric  Good stewards of the taxpayers dollars.  Process is about 14 months from Agency Developed Package Award  New stream-lined process on next slide  Removed 2-3 months 2 Keeping our promises to veterans through sustainability Requirement s Package Received by NEBC; NEBC and OAEM Validate Package Phase 1 - Project Planning Assemble Acquisition Team; Engage Project Facilitator; Build RFP/NOO 6 weeks Send RFP for Technical & Legal Review Interested ESCOs respond to NOO (Can't close until legal review is complete) Technical & Legal Reviews Completed Send Invitation for Preliminary Site Survey

196

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

197

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

198

Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy

199

Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects

200

Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

202

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.

203

Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective

204

Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County

205

Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades

206

Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for

207

Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades

208

Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan

209

Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio

210

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

211

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

212

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

213

www.eia.gov  

U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...

214

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

215

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

216

Better Buildings Neighborhood Program: Eagle County, Colorado  

NLE Websites -- All DOE Office Websites (Extended Search)

VA WA | WI Eagle County, Colorado Three Resort Communities in Colorado Get Smart With Energy Upgrades Photo of a ski lodge with snow surrounding it. An image of a map of the...

217

Better Buildings Neighborhood Program: Connecticut  

NLE Websites -- All DOE Office Websites (Extended Search)

TN | TX | VT | VI | VA WA | WI Connecticut Volunteers Help Connecticut Homeowners Save Energy Photo of a variety of buildings in an urban area, with a river flowing in the...

218

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

219

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

220

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type

222

Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product

223

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI

224

WiH1950s poster  

Science Conference Proceedings (OSTI)

... definitive work on the thermochemical properties of ions: Gas-Phase Ion ... Despite working under a very tight deadline, she successfully designed a ...

2013-03-07T23:59:59.000Z

225

a beneficial manner. The three projects wi  

NLE Websites -- All DOE Office Websites (Extended Search)

beneficial manner. The three projects will demonstrate technologies beneficial manner. The three projects will demonstrate technologies that: (1) make progress toward DOE's target CO 2 capture efficiency of 90 percent; (2) make progress toward DOE's capture and sequestration goal of less than 10 percent increase in the cost of electricity for gasification systems and less than 35 percent for combustion and oxy-combustion systems; and (3) capture and sequester, or put to

226

Microsoft Word - topic_B_WI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Interconnection on Electric Resource Western Interconnection on Electric Resource Planning and Priorities The awardee must complete the following at a minimum: 1. Continued development of the Western Renewable Energy Zone (WREZ) analysis, currently performed by the Western Governors' Association (WGA) under DOE Cooperative Agreement (DE-FC26-08NT01788) in order to identify those areas in the West with vast renewable resources to expedite the development and delivery of renewable energy to where it is needed. Specifically, the awardee must complete the following tasks. a. Coordinating Energy Purchasing from the WREZs Aggregating demand for renewable energy can stimulate the development of commercial renewable generation and supporting transmission projects. Many public power, cooperative, state, federal and provincial electric systems have

227

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848

228

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.

229

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624

230

San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC

231

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates

232

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601

233

DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

234

Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information

235

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423

236

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

237

VA UESC with PG&E  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Federal Utility Partnership Working Group Spring 2013: May 22-23 San Francisco, CA Hosted by: Pacific Gas and Electric Company  Review Key Challenges  Strategies Utilized to Achieve Success  Lessons Learned  Project Profile  Project Challenges  UESC Energy Saving Results  Conclusion  Facilities Targeted: ◦ 3 VAMCs and 2 clinics within VISN 21 ◦ Over 2,000,000 square feet  Project Size: $9.9 Million  Project Timeline: ◦ Business development: May 2009 ◦ Awarded: October 2011 ◦ Construction completed: July 2013 Martinez Outpatient Clinic and Community Living Center Mather VAMC San Francisco VAMC Fresno VAMC McClellan Outpatient Clinic  FEMP UESC Workshop - April 2009  Review of Existing Audits 

238

Case Study: Grand Junction VA Medical Center  

NLE Websites -- All DOE Office Websites (Extended Search)

Expansion Data - Building Additions - PV Solar Array www.antaresgroupinc.com Key Energy Usage Characteristics * Electricity Use: - Summer (Max.): 494 MWh - Winter (Min.): 367 MWh -...

239

VA Medical Device Protection Program Information Security ...  

Science Conference Proceedings (OSTI)

... Photo Source: Idaho Department of Commerce 3 ... in patient healthcare for diagnosis, treatment or monitoring; ... medical system: Any group of devices ...

2011-03-10T23:59:59.000Z

240

VA Medical Device Protection Program (MDPP)  

Science Conference Proceedings (OSTI)

... Photo Source: Idaho Department of Commerce ... in patient healthcare for diagnosis, treatment, or monitoring; ... medical system: Any group of devices ...

2011-05-11T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

242

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming

243

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

244

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

245

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

246

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

247

Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

248

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

249

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

250

Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8

251

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA

252

Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006

253

Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC

254

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity

255

AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP

256

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013

257

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value

258

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)

259

Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0

260

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

262

Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

SciTech Connect

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.

2003-09-15T23:59:59.000Z

263

Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

Science Conference Proceedings (OSTI)

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.

2003-09-15T23:59:59.000Z

264

www.eia.gov  

U.S. Energy Information Administration (EIA)

MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY U.S. Number of states in which marketer is licensed ... Service Tech & Research Corp

265

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

TX2","N3035UT2","N3035VT2","N3035VA2","N3035WA2","N3035WV2","N3035WI2","N3035WY2" "Date","U.S. Natural Gas Industrial Consumption (MMcf)","Alabama Natural Gas Industrial...

266

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

TX2","N3010UT2","N3010VT2","N3010VA2","N3010WA2","N3010WV2","N3010WI2","N3010WY2" "Date","U.S. Natural Gas Residential Consumption (MMcf)","Alabama Natural Gas Residential...

267

Nation Weekly June 6, 2004, Volume 1, Number 7  

E-Print Network (OSTI)

ec ted c o- or din ate s yo u wi ll f ind u nli mi ted p os sib ilit y f or yo ur lim ite d bu dg et. Sp re ad y ou r n et at th e Te x-W or ld an d sp en d so me qu ite h ou rs fi sh ing th ro ug h ou r c oll ec tio n yo u wi ll...

Upadhyay, Akhilesh

268

R:\DATA\AS\ERORPTS\WI@INEEL\ig0454.PDF  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

INCINERATION AT THE INCINERATION AT THE IDAHO NATIONAL ENGINEERING AND ENVIRONMENTAL LABORATORY U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL OFFICE OF AUDIT SERVICES DECEMBER 1999 DOE/IG-0454 AUDIT REPORT December 15, 1999 MEMORANDUM FOR THE SECRETARY FROM: Gregory H. Friedman (Signed) Inspector General SUBJECT: INFORMATION : Audit Report on "Waste Incineration at the Idaho National Engineering and Environmental Laboratory" BACKGROUND The Waste Experimental Reduction Facility (WERF) Incinerator is located at the Idaho National Engineering and Environmental Laboratory (INEEL) in Idaho Falls, Idaho. The primary mission of the incinerator is to provide mixed waste treatment until a demonstrated, more cost-effective commercial facility is available.

269

Harnessing frequency diversity in wi-fi networks  

Science Conference Proceedings (OSTI)

Wireless multicarrier communication systems transmit data by spreading it over multiple subcarriers and are widely used today owing to their robustness to multipath fading, high spectrum efficiency, and ease of implementation. In this paper, we use real ... Keywords: IEEE 802.11, cross layer design, forward error correction (FEC), orthorgonal frequency division multiplexing (OFDM), rate adaptation

Apurv Bhartia; Yi-Chao Chen; Swati Rallapalli; Lili Qiu

2011-09-01T23:59:59.000Z

270

Identified Patent Waiver W(I)2008-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ELTRON RESEARCH, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-05NT42469

271

Patent Waiver W(I)2011-013  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.

272

Identified Patent Waiver W(I)2011-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.

273

Identified Patent Waiver W(I)2011-012  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.

274

Identified Patent Waiver W(I)2012-002  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by BATTELLE MEMORIAL INSTITUTE for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC07-05ID14517.

275

Identified Patent Waiver W(I)2012-009  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by UNITED TECHNOLOGIES RESEARCH for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC02-05CH11231.

276

THE MOBILE WINDOW THERMAL TEST FACILITY (MoWiTT)  

E-Print Network (OSTI)

December 3-5, 1979 THE MOBILE WINDOW THERMAL TEST FACILITY (Orlando, Florida. The Mobile Window Thermal Test Facility (Press, 197 . THE NOBILE WINDOW THERMAL TEST FACILITY (

Klems, J. H.

2011-01-01T23:59:59.000Z

277

Why Wi-Fi wants to be free  

Science Conference Proceedings (OSTI)

As the telecommunications industry wavers, a global grassroots movement is building the next-generation wireless network.

Terry Schmidt; Anthony Townsend

2003-05-01T23:59:59.000Z

278

203 Multiwalled Carbon Nanotubes Decorated with Va and Ni by ...  

Science Conference Proceedings (OSTI)

... of LiMnxFe1-xPO4 Glass and Glass-Ceramics for Lithium Ion Battery .... and Comparing the Inhibition Effect of Chromate, Bromate and Molybdate on the...

279

ENERGY STAR Success Story VA Beach Convention Center  

NLE Websites -- All DOE Office Websites (Extended Search)

STAR Success Story: STAR Success Story: The Virginia Beach Convention Center Located in Virginia's most populous city, the Virginia Beach Convention Center (VBCC) comprises more than 516,000 square feet and typically hosts 400 events a year. Fully opened in 2007, the VBCC has served as the anchor for the successful revitalization of Virginia Beach's old beach district. With historical references and maritime themes integrated into the structure's modern design, the Center features many technological advances that make it a prime location for meetings, conferences, and trade shows. However, even with a newly constructed building, the VBCC has demonstrated an important energy management principle: all buildings, regardless of their age and building systems they employ, can reduce energy consumption, save money, and offset greenhouse gas

280

Plasma driven superpermeation of hydrogen through group Va metals  

Science Conference Proceedings (OSTI)

A barrier for the absorption of hydrogen molecules generated by a nonmetallic film on a metal surface may result in superpermeation of suprathermal hydrogen particles. Virtually all the sticking or implanted particles may permeate through the metallic membrane

A. I. Livshits; F. Sube; M. N. Solovyev; M. E. Notkin; M. Bacal

1998-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Communication and Collaboration Keep San Francisco VA Medical...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

project involving a substantial capital investment, "Some of our infrastructure was aging and needed to be replaced, and these replacements were going to be pretty expensive,"...

282

VA-s--- ' At&LYTlCAL DATA SHEET  

Office of Legacy Management (LM)

the fire. b&,, Ro All wore Comfo type respirators and extinguished the fire from oil PH an upwind position. Sample No. Hour Sample Description Be Th (R ( T 1 Q 331 1400 I...

283

U.S. GEOLOGICAL SURVEY Reston, VA 20192  

E-Print Network (OSTI)

and an Establishment Risk Assessment for Nine Large Species of Pythons, Anacondas, and the Boa Constrictor". Regarding

284

VA-3-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Company (hereinafter called the Company), the Company's Transmission Operator, currently PJM Interconnection LLC (hereinafter called PJM), and the Customer. This rate schedule...

285

VA-1-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Company (hereinafter called the Company), the Company's Transmission Operator, currently PJM Interconnection LLC (hereinafter called PJM), and the Customer. This rate schedule...

286

NoVaS Transformations: Flexible Inference for Volatility Forecasting  

E-Print Network (OSTI)

and Correlation Forecasting in G. Elliott, C.W.J.Handbook of Economic Forecasting, Amsterdam: North-Holland,Transformations, forthcoming in Forecasting in the Presence

Politis, Dimitris N; Thomakos, Dimitrios D

2008-01-01T23:59:59.000Z

287

Phase Locked Loop Control of Inverters in a Microgrid  

E-Print Network (OSTI)

Phase Locked Loop Control of Inverters in a Microgrid Matthew Surprenant Dept of ECE University Venkataramanan Dept of ECE University of Wisconsin Madison, WI, USA Abstract--Microgrids are small for inverter-based microsources within a mi- crogrid. The general control philosophy within a microgrid

Hiskens, Ian A.

288

Microsoft PowerPoint - Junior_ONR  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mi Mi it S i I tit ti (MSI ) Minority Serving Institutions (MSIs): Bridging the Gap between Federal g g p Agencies and MSIs Dr. Anthony Junior, Program Manager Naval Historically Black Colleges and University/Minority Institutions Program Office of Naval Research 874 North Randolph Street, Arlington, VA 22203 anthony.junior@navy.mil AVJ HBCU/MI SP Concepts V2 Agenda * The Requirement The Requirement * The Strategic Plan * HBCU/MI Full Engagement Model HBCU/MI Full Engagement Model * STEM Research Pipeline * HBCU/MI Accredited Engineering Schools * HBCU/MI Accredited Engineering Schools 2 10 USC 2362 Objective: Enhance defense-related research and education at HBCU/MIs to assist the Department in education at HBCU/MIs to assist the Department in defense-related research, development, testing, and

289

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly

290

UNIVERSITY OF CALIFORNIA HUMANS AS PREDATORS AND PREY IN ECOLOGICAL SYSTEMS  

E-Print Network (OSTI)

in Wisconsin. 59 2.S4 Buck harvest per license (blue) and license sales (red) in MN, WI, PA, and VA. 60 3.1 Map 4.3 Catch per unit effort at the steady state spider monkey population size for bow hunters and gun by bow and gun hunters. 145 4.6 Comparing model output and data to validate the biodemographic mode

Mangel, Marc

291

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

292

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

293

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

294

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

295

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

296

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

297

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

298

SCOTT T. SANDERS 1500 Engineering Dr., Madison, WI, 53706 | 608 262 3540 | stsanders@wisc.edu  

E-Print Network (OSTI)

, S.T., and Okura, Y., "Design of System for Rugged, Low-noise Fiber-optic Access to High Study: Two-Step Water Splitting Cycle Using the Fe3O4/FeO Redox System," Solar Energy 65, 43-53, 1999} Walewski, J.W., Filipa, J.A., and Sanders, S.T., "Optical beating of polychromatic light and its impact

Van Veen, Barry D.

299

Identified Patent Waiver W(I)2012-012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

has to inventions conceived or first actually reduced to practice by DR. F. JEFFREY MARTIN under agreement DE-AC52-06NA25396, as the DOE has determined that granting such a...

300

Centr um voor Wi skunde en I nf or mati ca Modelling, AnalysisandSimulation  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . 31 iii #12;Contents CAFE Final Report Volume II III Protocols 33 6 Notation and De nitions 35 6.1 and Simulation CAFE project _ Final report volume II Secure protocols and architecture Edited by A. Bosselaers, R;CAFE Project - Final Report Volume II Secure Protocols and Architecture Edited by A. Bosselaers, R

Schoenmakers, Berry

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

The Xirrus Wi-Fi Array XS4, XS8 Security Policy Xirrus, Inc.  

Science Conference Proceedings (OSTI)

... Production-grade components and production-grade opaque ... dirt, or oil. ... The security strap should be pulled tight to disallow turning of the mounting ...

2011-04-01T23:59:59.000Z

302

The Xirrus Wi-Fi Array XN4, XN8, XN12, XN16 Security Policy ...  

Science Conference Proceedings (OSTI)

... Production?grade components and production?grade opaque ... the surface area of any grease, dirt, or oil. ... strap should be pulled tight to disallow ...

2011-05-05T23:59:59.000Z

303

WiFi Meet FuFi: Research Topics in SCM and DSS  

E-Print Network (OSTI)

Disruptive innovation catalysed by energy (carbon footprint) may reshape supply chain and logistics. The continents of Europe, Asia and Africa may evolve as a connected value network through railroad logistics.

Datta, Shoumen

2008-07-31T23:59:59.000Z

304

Evaluating next-cell predictors with extensive Wi-Fi mobility data  

E-Print Network (OSTI)

cycles or more. If an external fault happens, breaker B1 will shut down the fuel cell immediately and separate it from the system. The breaker B2 will then operate to isolate the fault. As a result, the user factor 1HK (7) where

305

WiGriMMA: A Wireless Grid Monitoring Model Using Agents  

Science Conference Proceedings (OSTI)

The complexity, heterogeneity, device mobility and the unpredictable user behavior demands proper automation of monitoring activity in the wireless Grid to enable the user needs. Since the wireless devices can dynamically join/leave the Grid, and its ... Keywords: Agent, Credit management, Device state control, Grid monitoring, Wireless Grid

Mahantesh N. Birje; Sunilkumar S. Manvi

2011-12-01T23:59:59.000Z

306

North Brazil Current Ring Generation and Evolution Observed with SeaWiFS  

Science Conference Proceedings (OSTI)

The earth's largest oceanic rings are formed by the retroflecting North Brazil Current (NBC) near 8N in the western tropical Atlantic. The NBC flows northward across the equator and past the mouth of the Amazon River entraining river-influenced ...

David M. Fratantoni; Deborah A. Glickson

2002-03-01T23:59:59.000Z

307

ARIEL: automatic wi-fi based room fingerprinting for indoor localization  

Science Conference Proceedings (OSTI)

People spend the majority of their time indoors, and human indoor activities are strongly correlated with the rooms they are in. Room localization, which identifies the room a person or mobile phone is in, provides a powerful tool for characterizing ...

Yifei Jiang; Xin Pan; Kun Li; Qin Lv; Robert P. Dick; Michael Hannigan; Li Shang

2012-09-01T23:59:59.000Z

308

High School Visits (WI, IL, MN and other states) Arranged in alpha order  

E-Print Network (OSTI)

High School 10/5/12 8:15 a.m. Black River Falls High School 9/21/12 9:00 a.m. Bollingbrook High School High School 10/16/12 12:00 p.m. Crystal Lake Central High School 10/15/12 9:40 a.m. Cuba City High

Saldin, Dilano

309

Achieving True Video-on-Demand Service in Multi-Hop WiMax Mesh Networks  

E-Print Network (OSTI)

Mesh Network Configuration (MSH-NCFG) messages. Each MSH-NCFG message contains a Network Descriptor by listening to MSH-NCFG messages. From all the possible neighboring nodes that advertise MSH-NCFG messages

Hua, Kien A.

310

Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Virginia Virginia United States Department of Energy September 24, 2009 2 OVERVIEW: VIRGINIA HAS MAJOR ECONOMIC OPPORTUNITIES IN A CLEAN ENERGY ECONOMY The threat of climate change caused by carbon pollution poses a major challenge to the United States and the world, but it also represents an unprecedented opportunity to create new industries and build a strong, thriving clean energy economy. The clean energy sector is one of the fastest growing industries in the world -- the demand for solar panels and wind turbines, for example, has been growing exponentially over the past few years. Among industrialized nations, the race is on for the clean energy jobs of the future. China is investing $12.6 million per hour in clean energy. Denmark has made significant investments in wind capacity and is now

311

Microsoft Word - DM_VA-#121918-v2-SmartGrid_Comments_--_DOE.DOC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

COMMENTS OF VERIZON AND VERIZON WIRELESS COMMENTS OF VERIZON AND VERIZON WIRELESS Michael Glover Of Counsel Edward Shakin William H. Johnson VERIZON 1320 North Courthouse Road Ninth Floor Arlington, Virginia 22201 (703) 351-3060 John T. Scott, III William D. Wallace VERIZON WIRELESS 1300 I Street N.W. Suite 400 West Washington, DC 20005 July 12, 2010 TABLE OF CONTENTS Page -i- I. USE OF COMMERCIAL BROADBAND NETWORKS WOULD FACILITATE THE EFFICIENT AND EFFECTIVE IMPLEMENTATION OF SMART GRID TECHNOLOGY. ............................................................................................................... 2 II. RESPONSES TO SPECIFIC QUESTIONS RAISED IN THE REQUEST FOR INFORMATION................................................................................................................

312

File:EIA-Appalach6-WV-VA-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

LIQ.pdf LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.77 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

313

LORNA SUNDBERG INTERNATIONAL CENTER A division of U.Va.'s International Studies Office  

E-Print Network (OSTI)

-5 PM #12;Exploring the Caucasus: The Best of Georgia Polina Oganesyan Sunday, March 24, 1-3 PM Cavalier

Humphrey, Marty

314

NETL Researcher Wins R&D 100 Award Morgantown, W.Va.-The National...  

NLE Websites -- All DOE Office Websites (Extended Search)

oxide fuel cells from R&D Magazine. R&D Magazine held its 49 th annual R&D 100 Awards Banquet, where the awards were presented, on Thursday, October 13, 2011 in Orlando, Fla....

315

Proceedings of the American Control Conference Arlington, VA June 25-27, 2001  

E-Print Network (OSTI)

superheaters is an attemperator which regu- lates the temperature of the steam exiting the secondary su of the steam-water flow). y3-- Steam u3 -- Attemperator Temperature I SprayFlow s.....o ~ ....... [.-_900: Y3: Y4: feedwater flow rate (kg/s), fuel flow rate (kg/s), attemperator spray flow rate (kg/s), air

Marquez, Horacio J.

316

Performance Assessment of the Marathon Power 3kVA Supercapacitor UPS  

Science Conference Proceedings (OSTI)

The objective of this report is to describe and document the operation and performance of the Marathon Power Supercapacitor UPS 120V system. This report will describe the different tests that were conducted and their results to characterize the Supercapacitor UPS system. It will cover voltage sag and swell protection, interruption, recloser, and life cycle capabilities of this system. Additional characterization tests will also be discussed. The Supercapacitor UPS was tested at 50%, 77% and 99% of ...

2012-11-28T23:59:59.000Z

317

Iron carbide on titania surface modified with group VA oxides as Fisher-Tropsch catalysts  

SciTech Connect

Catalysts comprising iron carbide on a surface modified titania support wherein said support comprises a surface modifying oxide of tantalum, niobium, vanadium and mixtures thereof supported on said titania wherein at least a portion of said surface modifying oxide is in a non-crystalline form. These catalysts are useful for Fischer-Tropsch hydrocarbon synthesis reactions. Preferably, at least about 25 wt. % of said surface modifying oxide will be in a non-crystalline form.

Wachs, I. E.; Cherisch, C. C.; Fiato, R. A.

1985-12-17T23:59:59.000Z

318

Design of a 20-kWp photovoltaic concentrator experiment at Fauquier High School, Warrenton, VA  

DOE Green Energy (OSTI)

The design and systems analysis of the photovoltaic concentrator system for Fauquier High School in Warrenton, Virginia, are presented. The system provides both electrical energy from the photovoltaic modules and thermal energy from the cooling of those modules. The dc electrical energy from the photovoltaic modules will be first converted to ac and then used to provide power for lighting in the vocational/technical building and the system control building. The thermal energy collected is stored in a 6500-gallon tank for use in the wintertime to provide heat for a greenhouse located adjacent to the array. The photovoltaic system supplies 20 kWp of electrical power by means of 40 6' wide by 10' long parabolic-cylinder collectors mounted in a polar mode. (WHK)

None

1979-10-18T23:59:59.000Z

319

Cost effective solar hot water system for econo-travel motor hotel located at Hampton, VA  

SciTech Connect

This paper gives the final report of a cost effective solar hot water heating system installed on the Econo-Travel Motor Hotel at 2708 Mercury Boulevard, Hampton, Virginia. The description of the system along with the final cost breakdown, performance data and payback time are given. The payback time for the installed system will be approximately four (4) years instead of the 6.65 years estimated for the proposal. The additional savings is due to the reduction in the peak demand charge since the electric hot water heaters are not required to operate at the same time each morning as the dryers used for the laundry. As called for in the proposal to DOE, the success of the system will be determined by the reduction in the utility cost and reduced use of our fossil fuels. The results shown in the hotel's monthly electricity bills indicate that this goal has been accomplished.

1978-11-01T23:59:59.000Z

320

Microsoft Word - va_Final3a_06-04-032.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8. Enter mailing address of employer listed in item 7. 9.-11. Enter city, state, and zip code portion of employer's mailing address. 12. Enter Applicant's home or work...

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Validation of KENO V.a Code for High Flux Isotope Reactor (HFIR)  

Science Conference Proceedings (OSTI)

The core of the High Flux Isotope Reactor (HFIR) is composed of two concentric annular elements, inner and outer, each containing highly enriched uranium fuel as a mixture of triuranium octoxide (U3O8) and aluminum encapsulated within aluminum alloy plates. The fuel plates are of involute shape and the fuel within the plates has a distribution across the plate width. Previous KENO code validation efforts have used a relatively simple single region homogeneous fuel model for each of the two annular regions by assuming that the materials in each were homogenized within the total volume of the fueled region. The computed results have tended to be about 2 to 3% greater than experimentally measured results. To improve computed results, a multi-zone fuel model was developed and used to validate the KENO code.

Primm, Trent [ORNL

2009-01-01T23:59:59.000Z

322

Pseudnim: Ermessenda Elogi de la mentida (o l'emperador no va  

E-Print Network (OSTI)

pornografia i tothom diria la veritat. L'art i les mentides naveguen en aigües turbulentes, de clarobscurs i

Geffner, Hector

323

A VaR Black-Litterman Model for the Construction of Absolute ...  

E-Print Network (OSTI)

rithmic technique is very efficient, outperforming, in terms of both speed and ..... It can be seen that the error term vector ? does not directly enter the Black-

324

Hotel gets 9-month payback on HVAC project. [Midtown Holiday Inn, Richmond, VA  

SciTech Connect

The Midtown Holiday Inn at Richmond, Virginia, recovered its $45,200 investment in heating and cooling modifications in nine months by reducing energy consumption by 43%. Natural gas use was reduced 48% and electricity 25%, while comfort levels were improved. The retrofit involved replacing the old three-pipe design, which traditionally returns both heating and cooling water and is inefficient during fall and spring when both hot and chill water are needed. A new control strategy keeps the chiller and boiler from working simultaneously by alternating the two on 15-minute cycles. The chiller automatically cuts off when outside air goes below 55/sup 0/F, while the boiler shuts off at 75/sup 0/F. (DCK)

Deans, B.

1982-10-11T23:59:59.000Z

325

Proceedings of Human Systems Integration Symposium 2003, Engineering for Usability, Vienna, VA, June 2325, 2003.  

E-Print Network (OSTI)

.S. Usability Engineering for Complex Interactive Systems Development ABSTRACT Usability engineering is a cost. These activities are further explained in Section "Activities in Usability Engineering." Usability engineering interactive systems (Section "Usability Engineering Case Studies: Developing Complex Interactive Systems

Swan II, J. Edward

326

Cost effective solar hot water system for econo-travel motor hotel located at Hampton, VA  

DOE Green Energy (OSTI)

This paper gives the final report of a cost effective solar hot water heating system installed on the Econo-Travel Motor Hotel at 2708 Mercury Boulevard, Hampton, Virginia. The description of the system along with the final cost breakdown, performance data and payback time are given. The payback time for the installed system will be approximately four (4) years instead of the 6.65 years estimated for the proposal. The additional savings is due to the reduction in the peak demand charge since the electric hot water heaters are not required to operate at the same time each morning as the dryers used for the laundry. As called for in the proposal to DOE, the success of the system will be determined by the reduction in the utility cost and reduced use of our fossil fuels. The results shown in the hotel's monthly electricity bills indicate that this goal has been accomplished.

Not Available

1978-11-01T23:59:59.000Z

327

Evaluation tests of Abacus 6 kVA utility-interactive inverter  

SciTech Connect

The voltage pattern spectra were analyzed for 100% and 50% pattern ratios and harmonics analyses are provided for the Abacus inverter. The harmonics are compared with those calculated for a simple model with no agreement. AC waveforms and inverter current spectra are given as well as basic electrical data. (LEW)

Landsman, E.E.

1981-08-01T23:59:59.000Z

328

NIST-VA Agreement Leads to New Research on Hearing Aids  

Science Conference Proceedings (OSTI)

... saturation sound pressure level, equivalent input noise level, coherence, battery drain, and ... NIST have the potential to impact the quality of life for a ...

2012-12-14T23:59:59.000Z

329

12th International Conference on Nuclear Engineering Arlington, VA, April 25-29, 2004  

E-Print Network (OSTI)

measurements of the CTE and tensile properties were performed in the BNL hot cell facility equipped with remote the measurements were confined to a hot cell where remote manipulation of the equipment as well as the mechanical handling capabilities. 2.2 Measurements Activation Measurements The irradiated samples were placed

McDonald, Kirk

330

Microsoft Word - DM_VA-#126832-v3-Smart_Grid_Comments_--_DOE...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OF ENERGY Office of Electricity Delivery and Energy Reliability In the matter of: Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation...

331

,"Wisconsin Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050WI3","N3010WI3","N3020WI3","N3035WI3","N3045WI3" "Date","Natural Gas Citygate Price in Wisconsin (Dollars per Thousand Cubic Feet)","Wisconsin...

332

bersicht ber die Durchfhrung der Fachpraktika Master Gym Bachelor BEU / Master GH / R  

E-Print Network (OSTI)

) WiSe od. SoSe 2) WiSe 1) 4) WiSe od. SoSe 2) Chemie SoSe SoSe 5) ______ SoSe 5) _____ _____ _____ _____ Deutsch WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. So

Kallenrode, May-Britt

333

SRBAVG: Its Time to Archive CERES Next-Generation Monthly Means  

NLE Websites -- All DOE Office Websites (Extended Search)

Langley Research Center Langley Research Center Advances in Cloud Satellite Cloud Retrievals for ARM Patrick Minnis, W. L. Smith, Jr., D. R. Doelling NASA Langley Research Center, Hampton, VA R. F. Arduini, J. K. Ayers, M. M. Khaiyer, R. Palikonda, D. A. Spangenberg, Y. Yi, C. R. Yost SSAI, Hampton, VA P. W. Heck CIMSS, Univ. Wisconsin, Madison, WI F.-L. Chang National Institute for Aerospace ARM 19 th Annual Science Team Meeting Louisville, KY 30 March - 2 April 2009 NASA Langley Research Center Objectives * Develop cloud and radiative flux retrieval algorithms and satellite- based cloud property datasets for use in ARM's characterizations of clouds and radiation over all domains - construct an approximate 4-D field of cloud hydrometeors - know horizontal footprints, vertical boundaries val w/

334

EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.

335

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

336

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

337

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

338

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

339

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

340

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

342

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

343

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

344

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

345

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

346

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

347

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

348

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

349

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

350

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

351

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

352

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

353

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

354

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

355

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

356

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

357

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

358

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

359

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

360

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

362

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

363

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

364

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

365

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

366

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

367

A Model Of Pedestal Structure J.D. Callen, University of Wisconsin, Madison, WI 53706-1609  

E-Print Network (OSTI)

paleoclassical ones, i.e., for Dan > Dpc eff fDD where fD ( 0.1 in 988892 ) is degree of diffusion reduction

Princeton Plasma Physics Laboratory

368

AN INVESTIGATION OF THE FACTORS RELATED TO DIRECT CARE STAFFS' KNOWLEDGE OF EFFECTIVE INSTRUCTIONAL STRATEGIES FOR PEOPLE WI.  

E-Print Network (OSTI)

??The Medicaid Home and Community Based Services Waiver (HCBS) funds services for people with developmental disabilities in community based group homes. The purpose of the (more)

Cook, Craig

2009-01-01T23:59:59.000Z

369

a h|^w[!"????????x?x?Wi8]4!xb0??*ܼ |uY ...  

Science Conference Proceedings (OSTI)

... sG?? w?A?????9???*vv*?_*?g*'??^? 8DXit7=5???*r?*L??*ATS????\\?2??*`*m ...

2012-11-15T23:59:59.000Z

370

Calibration Evaluation and Radiometric Testing of Field Radiometers with the SeaWiFS Quality Monitor (SQM)  

Science Conference Proceedings (OSTI)

One of the goals of calibration and validation programs supporting ocean color satellites is to produce water-leaving radiances with an uncertainty of 5% in clear-water regions. This objective requires field instruments with a calibration and ...

Stanford B. Hooker; James Aiken

1998-08-01T23:59:59.000Z

371

WiMsh: a simple and efficient tool for simulating IEEE 802.16 wireless mesh networks in ns-2  

Science Conference Proceedings (OSTI)

Wireless mesh networks (WMNs) are two-tier wireless multihop networks. The top tier is made of wireless routers, which provide access to the wireless clients in the bottom tier. One technology for enabling multi-hop communication in the top tier is IEEE ... Keywords: IEEE 802.16, network simulator 2, simulation, wireless mesh networks

Claudio Cicconetti; Ian F. Akyildiz; Luciano Lenzini

2009-03-01T23:59:59.000Z

372

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY

373

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"

374

Microsoft Word - DM_VA-#126832-v3-Smart_Grid_Comments_--_DOE_--_Policy_and_Logistical_Challenges.DOC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

UNITED STATES DEPARTMENT OF ENERGY Office of Electricity Delivery and Energy Reliability In the matter of: Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation 75 FR 57006 COMMENTS OF VERIZON AND VERIZON WIRELESS Michael Glover Of Counsel Edward Shakin William H. Johnson VERIZON 1320 North Courthouse Road Ninth Floor Arlington, Virginia 22201 (703) 351-3060 John T. Scott, III William D. Wallace VERIZON WIRELESS 1300 I Street N.W. Suite 400 West Washington, DC 20005 November 1, 2010 As the Department of Energy (DOE) correctly notes, Smart Grid technology that "better integrates information, communication, and intelligent control technology [] into the nation's electrical system" holds "significant promise."

375

2 0 1 0 va n g u a r d 1 vanguardCOLLEGE OF HUMAN ENVIRONMENTAL SCIENCES 2010  

E-Print Network (OSTI)

Symposium on Fiber Recycling and has done much research on textile recycling and the disposal of what we and Elm Streets.The historic marker was positioned close to the ground, where it became obscured by layers of time and thought into my project ...it wasn't something I took lightly," saysTobin, who spent her

Taylor, Jerry

376

Conditional Volatility and Correlations of Weekly Returns and the VaR Analysis of 2008 Stock Market  

E-Print Network (OSTI)

intensive and requires in- tradaily observations. Although, intradaily observations are becoming increas- ingly available across a large number of assets, it would still be desirable to work with a version of ~rit that does not require intradaily... Consider a portfolio based on the m assets with the return vector rt using the m #2; 1 vector of pre-determined weights, wt#0;1. The return on this portfolio is given by #26;t = w 0 t#0;1rt: (19) Suppose that we are interested in computing the capital Value...

Pesaran, M Hashem

377

HIEU 124GS/VA 122EGS: The City in Renaissance Italy Revelle in Rome--Summer 2011  

E-Print Network (OSTI)

Spagna (4 hrs) 6/30 Thursday (Ancient Rome): S. Pietro in Vincoli, *Capitoline Museum, Crypta Balbi (4, "The Planning of Renaissance Rome" (Handout) Th 6/30 8:30 AM- 1:00 PM Ancient Rome: *Crypta Balbi

Tsien, Roger Y.

378

HIEU 124GS/VA 122EGS: The City in Renaissance Italy Revelle and Renaissance in Rome--Summer 2012  

E-Print Network (OSTI)

/04 Wed (Anc/Ren Rome): S.Pietro in Vincoli,*Capitoline Museum,*Crypta Balbi (4 hrs) 7/06 Friday (Walking/04 Anc/Ren Rome: S.Pietro in Vincoli, Capitoline Museum, Crypta Balbi Medieval Rome: From the Renaissance

Russell, Lynn

379

HIEU 124GS/VA 122EGS: The City in Renaissance Italy Revelle and Renaissance in Rome--Summer 2013  

E-Print Network (OSTI)

, Capitoline Museum, Crypta Balbi Medieval Rome: From the Renaissance of the Twelfth Century to the Avignon

Blanco, Philip R.

380

Reprinted from: Trends in new crops and new uses. 2002. J. Janick and A. Whipkey (eds.). ASHS Press, Alexandria, VA.  

E-Print Network (OSTI)

trade deficits, create jobs in rural areas, reduce air pollution, and reduce global climate change or by microbial conversion of biomass materials through fermentation. In 1995, about 93% of the ethanol sugars, one of the most common being glucose. Therefore, biomass materials containing high levels

Laughlin, Robert B.

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

WINSURE: A NEW WINDOWS INTERFACE TO THE SURE PROGRAM Ricky W. Butler, NASA Langley Research Center, Hampton, Va  

E-Print Network (OSTI)

is used: 1,2 = 0.0001; This defines a slow exponential transition from state 1 to state 2 with rate 0, the last statement defines a transition from state 7 to state 8 with rate LAMBDA. If the transitionSURE program (See CREATE button), though the more powerful Emacs text editor is recommended. The states

Butler, Ricky W.

382

Cost effective solar hot water system for Econo-Travel Motor Hotel located at Woodbrdge, VA. Final report  

SciTech Connect

The final report of a cost effective solar hot water heating system installed on the Econo-Travel Motor Hotel at 13317 Gordon Boulevard, Woodbridge, Virginia is given. The description of the system along with the final breakdown, performance data and payback time are given. The payback time for the installed system will be approximately four (4) years instead of the 7.2 years estimated for the proposal. The additional savings is due to the reduction in the peak demand charge since the electric hot water heaters are not required to operate at the same time each morning as the dryers used for the laundry. As called for in the proposal to DOE, the success of the system will be determined by the reduction in the utility cost and reduced use of our fossil fuels. The results shown in the hotel's monthly electricity bills indicate that this goal has been accomplished.

1978-11-01T23:59:59.000Z

383

Meeting of the Society for Machinery Failure Prevention Technology, March 30 April 2, 1998, Cavalier Hotel, Virginia Beach, VA.  

E-Print Network (OSTI)

organization. The fabrication plant is located in Hillsboro, Oregon (approximately 15 miles from Portland associated with resin mixing, resin transfer molding, prepregging, filament winding, and composite layup

Giurgiutiu, Victor

384

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................

385

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................

386

Presented at the 16th ANS Topical Meeting on the Technology of Fusion Energy, Madison WI, Sept. 14-16, 2004.  

E-Print Network (OSTI)

Stanford University . . . . . . . . #12;13 Solar Energy Ordered Bulk Heterojunction Photovoltaic Cells Inorganic Nanocomposite Solar Cells by Atomic Layer Deposition Nanostructured Metal-Organic Composite Solar Cells Nanostructured Silicon-Based Tandem Solar Cells Photosynthetic Bioelectricity Biomass Energy

Ghoniem, Nasr M.

387

Thermal performance measurements of sealed insulating glass units with low-E coatings using the MoWiTT (Mobile Window Thermal Test) field-test facility  

SciTech Connect

Using data obtained in a mobile field-test facility, measured performance of clear and low-emissivity double-glazing units is presented for south-facing and north-facing orientations. The changes in U-value and shading coefficient resulting from addition of the low-E coating are found to agree with theoretical expectations for the cold spring test conditions. Accurate nighttime U-values were derived from the data and found to agree with calculations. Expected correlation between U-value and wind speed was not observed in the data; a plausible experimental reason for this is advanced.

Klems, J.; Keller, H.

1986-12-01T23:59:59.000Z

388

Mercury Measurements Characterizing the Impact of SCR on Mercury: Consol Test Site 5 - Eastern Bituminous Coal-Fired Power Plant wi th an SCR, ESP, and Wet FGD  

Science Conference Proceedings (OSTI)

CONSOL Energy Inc., Research & Development (CONSOL), with support from the U.S. Department of Energy, National Energy Technology Laboratory (DOE) and the Electric Power Research Institute (EPRI), is evaluating the effects of selective catalytic reduction (SCR) on mercury (Hg) capture in coal-fired plants equipped with an electrostatic precipitator (ESP) - wet flue gas desulfurization (FGD) combination or a spray dyer absorber 8212 fabric filter (SDA-FF) combination. In this program CONSOL is determining ...

2005-11-28T23:59:59.000Z

389

Dept. of Sol Science, UW-Madison/UW-Extension, 1525 Observatory Dr., Madison, WI 53706/608-262-0485 November 2010 Issue #2 2010  

E-Print Network (OSTI)

plants burn low S coal and some have installed flue gas scrubbers to reduce sulfur emissions. Use is generated from burning coal. As a consequence of the 1990 Clean Air Act Amendment many coal-burning power power plants in the south- eastern part of the state producing FGD gypsum, with a third to come on

Balser, Teri C.

390

Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 2. Final remedial investigation report  

SciTech Connect

Volume II of this report contains data tables and field notes of information gathered from the sampling of soils and ground water. Hydrocarbons and aromatic volatile organics are among the contaminants listed.

Not Available

1990-07-01T23:59:59.000Z

391

Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 1. Final remedial investigation report  

SciTech Connect

Volume 1 of this report covers the Remedial Investigation conducted on Site 1, Fire Training Area at Volk Field Air National Guard Base. The remedial work is described and the testing conducted after remediation to insure all contamination has been removed. The study as conducted under the Air National Guard's Installation Restoration Program. Partial contents include: Meteorology; Hydrology; Soils; Water wells; Groundwater; Borings; Samplings; Chemical contamination; Migration; Decontamination.

Not Available

1990-07-01T23:59:59.000Z

392

Optimum Cycle Length and Discharge Burnup for Nuclear Fuel - A Comprehensive Study for BWRs and PWRs: Phase I: Results Achievable Wi thin the 5 Percent Enrichment Limit  

Science Conference Proceedings (OSTI)

Core reload design and economic analyses show that both pressurized water reactors (PWRs) and boiling water reactors (BWRs) can derive significant benefits by increasing the discharge burnup of their fuel above the currently licensed values. Optimum discharge burnup levels, however, may not be achievable without exceeding the current 5 wt percent limit on enrichment.

2001-12-06T23:59:59.000Z

393

Matching renewal energy sources to rural development needs : a prototype design for a rural community development center for Jamaica, W.I.  

E-Print Network (OSTI)

The opportunities for utilizing Jamaica/s rich supply of renewable energy resources as a base for stead, environmentally sound rural development is tremendous. This thesis explores as way of tapping this potential. Jamaica's ...

Jackson, Michael Onaje

1982-01-01T23:59:59.000Z

394

Anthropogenic impact on spring bloom dynamics in the Yangtze River Estuary based on SeaWiFS mission 19982010 and MODIS 20032010 observations  

Science Conference Proceedings (OSTI)

Nutrient output from the Yangtze River to the sea has increased dramatically since the 1960s, and over the past 50 years more than 50,000 reservoirs on the Yangtze River basin have had little impact on water discharge, but have drastically reduced the ...

Cheng Chen, Hong Jiang, Yu Zhang

2013-08-01T23:59:59.000Z

395

~o,nnarrrs C/WI. Vol. 19.No. 2. no. 85-90. 1995I. Copyright f. 1995Els&er ScienceLrd  

E-Print Network (OSTI)

`A' to interpret it as a chemical element and searches its memory for the element that corresponds of the program can be secured by sending a disk to the author. Acknou,lrrlg~nle,lrs-The author would like

Campanario, Juan Miguel

396

wyang98@stanford.edu; phone 1 650 723-6213; fax 1 650 725-9755; http://eil.stanford.edu/WiMMS/  

E-Print Network (OSTI)

In this study, a new wireless sensing unit for operation within an automated Structural Health Monitoring (SHM) system is proposed, designed and validated. The design of the wireless sensing unit emphasizes minimization of its power consumption characteristics to ensure it is suited for long-term field deployment in civil structures. The wireless modem integrated with the unit has a long communication range that permits wireless sensors to be spaced over 100m apart. A multi-channel high-resolution analog-to-digital converter is included within each sensing unit to provide flexibility for high-fidelity data collection. A key feature of the wireless sensing unit design is the inclusion of a sophisticated computing core that is capable of locally executing engineering algorithms in real-time. As part of the embedded software, a novel communication protocol is written that can accomplish low-latency communications for accurate time synchronization between spatially distributed wireless sensors. To illustrate the capabilities of the wireless monitoring platform, including the execution of extensive computational tasks, a prototype system is fabricated and tested in the laboratory and field. As part of validating the system performance in the field, the vertical acceleration response of the Geumdang Bridge under traffic loading is measured by 14 wireless sensing unit prototypes.

Design Of Low-Power; Wang Yang; Jerome P. Lynch; B Kincho H. Law

2005-01-01T23:59:59.000Z

397

The Tension in Solidarity: Race, Gender, and National Identity in Katherine Dunhams Southland  

E-Print Network (OSTI)

WI: The University of Wisconsin Press, 2005. 345-363.WI: The University of Wisconsin Press, 2005. 364-381. ---. WI: The University of Wisconsin Press, 2005. Cole, Johnnetta

Timmons, Michele

2009-01-01T23:59:59.000Z

398

100000241,1,1,1,1,20050516,"AL",10610,"Albertville Municipal...  

U.S. Energy Information Administration (EIA) Indexed Site

,1,229279,"WI",8026,"Sheboygan Falls City of",99 5500018312,1,1,1,1,18004899,"WI",10610,"Sun Prairie Water & Light Comm",99 5500018312,1,2,1,1,1961803,"WI",10620,"Sun Prairie Water...

399

Business Engineering (M.Sc.) Summer Term 2013  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68 Automated Manufacturing Systems- WI4INGMBWBK1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Material Flow in Logistic Systems- WI4INGMB25 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Material Flow in networked Logistics Systems- WI4INGMB26

Stein, Oliver

400

The Money Point Sustainable Revitalization Plan - Chesapeake, VA by Crisman+Petrus; UVA School of Architecture [EDRA/Places Awards 2007 -- Planning  

E-Print Network (OSTI)

meadow restoration on CITGOs Money Point site. The companymodel. Crisman+Petrus & UVA / Money Point 2007 EDRA/PlacesThe Money Point Sustainable Revitalization PlanChesapeake,

Moffat, David

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Electron trapping by a current vortex F. Bentosela, a;b P. Exner, c;d and V.A. Zagrebnov a;b  

E-Print Network (OSTI)

with the magnetic field due to an electric current forming a localized rotationally symmetric vortex. We show simpler example involves a Pauli electron interacting with a flux tube modelling a vortex magnetic field field Ansatz. To illustrate this point we analyze in this letter the situation where the vortex current

402

Interview du Recteur C. Conti : "Le projet du ministre Marcourt va dans le bon sens pour l'enseignement suprieur" (P7)  

E-Print Network (OSTI)

LINGUISTIQUE Faculté des arts 5-278 Répertoire 2012 Linguistique Les séquences de cours pour les linguistique ­ 120 crédits (4 ans) Total 1re année 2e année 3e année 4e année Total 120 crédits (40 cours) 30 60 crédits (20 cours) LIN1710 Introduction à la linguistique I : Des mots aux énoncés LIN1720

Glineur, François

403

Entergy Grand Gulf site, MS issued on April 5, 2007. Dominion Energy North Anna site, VA issued on November 27, 2007.  

E-Print Network (OSTI)

decision expected 2009. Duke notified NRC of future planned ESP applications (as many as 2) Possibly Oconee County, SC, and Davie County, NC, no dates identified. Unspecified power company announced plans to submit an ESP application in fiscal year 2010. Combined Construction and Operating License (COL) Summary: Of nine COL applications submitted, six have been docketed for NRC review. 20 power companies, of which two are unidentified, intend to submit 23 license applications for 34 units. A Reference COL (R-COL) application has been submitted for four of the five reactor designs. Combined Construction and Operating License Applications (COLA) Submitted:

unknown authors

2008-01-01T23:59:59.000Z

404

Entergy Grand Gulf site, MS issued on April 5, 2007. Dominion Energy North Anna site, VA issued on November 27, 2007.  

E-Print Network (OSTI)

decision expected 2009. Duke notified NRC of future planned ESP applications (as many as 2) Possibly Oconee County, SC, and Davie County, NC, no dates identified. Unspecified power company announced plans to submit an ESP application in fiscal year 2010. Combined Construction and Operating License (COL) Summary: Of nine COL applications submitted, four have been docketed for NRC review. 19 power companies, of which one is unidentified, intend to submit 22 license applications for 33 units. A Reference COL (R-COL) application has been submitted for four of the five reactor designs. Combined Construction and Operating License Applications (COLA) Submitted:

unknown authors

2008-01-01T23:59:59.000Z

405

A FULL-ORDER, ALMOST-DETERMINISTIC OPTICAL MATCHING Yu-Chiu Chao, Thomas Jefferson National Accelerator Facility, Newport News, VA 23606  

E-Print Network (OSTI)

to provide input to this algorithm. Preliminary on-line testing on the CEBAF accelerator has positively, the numerical tool for obtaining global solutions, adaptation to realistic matching problems at CEBAF 3.1 Transport Matching at CEBAF In the CEBAF accelerator proper where electron beam passes through 2

406

RF CONTROL REQUIREMENTS FOR THE CEBAF ENERGY UPGRADE C. Hovater, J. Delayen, L. Merminga, T. Powers, C. Reece, Jefferson Lab, Newport News, VA  

E-Print Network (OSTI)

arXiv:physics/000908727Sep2000 MEASURING AND CONTROLLING ENERGY SPREAD IN CEBAF G. A. Krafft, J spread from a CEBAF-type machine to be relatively small; the measured energy spread from CEBAF at 4 Ge, the various subsystems contributing to the energy spread of a CEBAF-type accel- erator are reviewed, as well

407

2011 The NEED Project P.O. Box 10101, Manassas, VA 20108 1.800.875.5029 www.NEED.org 43 How a Photovoltaic CellWorks  

E-Print Network (OSTI)

a Photovoltaic CellWorks Step 1 A slab (or wafer) of pure silicon is used to make a PV cell. The top of the slab electricfield PHOTONS n-type p-type p-n junction POSITIVE CHARGE NEGATIVE CHARGE SUNSTEP 3 PHOTOVOLTAIC CELLS that motivates the energetic electrons out of the cell created when light strikes the PV cell. The phosphorous

Oregon, University of

408

Final report from VFL technologies for the pilot-scale thermal treatment of Lower East Fork Poplar Creek floodplain soils. LEFPC Appendices, Volume 2, Appendix V-A  

Science Conference Proceedings (OSTI)

This document contains information concerning validation of analytical data for the pilot-scale thermal treatment of Lower East Fork Poplar Creek Floodplain soils located at the Y-12 Plant site. This volume is an appendix of compiled data from this validation process.

NONE

1994-09-01T23:59:59.000Z

409

Estimating VaR in crude oil market: A novel multi-scale non-linear ensemble approach incorporating wavelet analysis and neural network  

Science Conference Proceedings (OSTI)

Facing the complicated non-linear nature of risk evolutions, current risk measurement approaches offer insufficient explanatory power and limited performance. Thus this paper proposes wavelet decomposed non-linear ensemble value at risk (WDNEVaR), a ... Keywords: C45, C53, F31, Multi-resolution analysis, Neural networks, Non-linear ensemble algorithm, Value at risk, Wavelet analysis

Kaijian He; Chi Xie; Shou Chen; Kin Keung Lai

2009-10-01T23:59:59.000Z

411

Managing Distributed Temperature Measurements in an Embedded System of a 3-Phase 10 kVA Energy Efficient Switchable Distribution Transformer Employing a Modular Approach  

Science Conference Proceedings (OSTI)

Temperature measurements are one of the most significant factors in condition monitoring and protecting transformers as well as estimating their life expectancy. With switchable transformers, it is also significant to carry out temperature monitoring ... Keywords: Switchable Transformer, Distributed Temperature Measurement, Controller Area Network, Modular Approach

H. A. Dharmawan; S. A. M. Ali

2010-12-01T23:59:59.000Z

412

SEMIPERMEA LE MEM RANES FOR MI ROMA HINED SILI ON SURFA ES 5 US ...  

co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

413

May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po

2012-01-01T23:59:59.000Z

414

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

415

ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

416

UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...

417

Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche

2009-08-01T23:59:59.000Z

418

LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

419

Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

420

Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.

1993-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas

2009-01-01T23:59:59.000Z

422

Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan

2013-01-01T23:59:59.000Z

423

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

424

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

425

Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois

426

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

427

Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

428

Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela

429

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

As A As A Power Resource Steven Nadel, Executive Director American Council for an Energy-Efficient Economy October 2010 2 The American Council for an Energy- Efficient Economy (ACEEE) 30 year old, non-profit 501(c)(3) dedicated to advancing energy efficiency through research and education. 35+ staff in Washington DC, + field offices in DE, MI, WA and WI. Focus on End-Use Efficiency in Industry, Buildings, Utilities, and Transportation; Economic Analysis & Human Behavior; and State & National Policy Worked on utility-sector energy-efficiency programs and policies since 1980s Savings Potential from Jan. 2009 Electricity Advisory Committee Report Average Statewide Utility Cost of Saved Energy for Efficiency Programs 3.3 3.3 3.1 3.0 2.9 2.8 2.7 2.6 2.1 1.9 1.9 1.7

430

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4

431

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6

432

VERIFICATION SURVEY OF THE BAKER AND WILLIAMS WAREHOUSES  

Office of Legacy Management (LM)

~ *-,-' .r_~, ~ *-,-' .r_~, VERIFICATION SURVEY OF THE BAKER AND WILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by W. C. Adams Environmental Survey and Site Assessment Program Energy/Environment Systems Division Oak Ridge Institute for Science and Education Oak Ridge, Tennessee 37831-0117 Prepared for the Office of Environmental Restoration U.S. Department of Energy FINAL REPORT JUNE 1994 This report is based on work performed under contract number DE-AC05-760R00033 with the U.S. Department of Energy. Baker arId Wi,,iMI Wsrchouwl-Vcrification June 28, ,994 - ,I I_ ..I .- VERIFICATION SURVEY OF THE BAKER AND W ILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by: ' J .,,,~ ' . W . C. Adams, Project Leader Date: Environmental Survey and Site Assessment Program

433

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5

434

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8

435

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"

436

EA-16-C TransAlta Energy Marketing (U.S) Inc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 Federal Register 1 Federal Register / Vol. 76, No. 14 / Friday, January 21, 2011 / Notices Houghton, MI. NPA: Goodwill Industries of Northern Wisconsin & Upper Michigan, Inc., Marinette, WI Contracting Activity: Dept of the Interior, National Park Service, Midwest Region, Omaha, NE. Deletions On 10/22/2010 (FR 65305) and 11/19/ 2010 (75 FR 70909-70910), the Committee for Purchase From People Who Are Blind or Severely Disabled published notices of proposed deletions from the Procurement List. After consideration of the relevant matter presented, the Committee has determined that the products listed below are no longer suitable for procurement by the Federal Government under 41 U.S.C. 46-48c and 41 CFR 51- 2.4. Regulatory Flexibility Act Certification I certify that the following action will

437

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5500 5500 Johnson Controls, Inc. EE Multiple PMC/PVT 2011/ 10/1/2011 to 1/31/2015 Chris Johnson Multiple sites, CA, MI, WI, OR Significant Cost Improvement of Li-Ion Cells (SUMMARY CX) Reduce manufactured cost of large format Li-ion cells by 50% through use of coated separators, dry coated electrodes, and fast formation technologies. Christopher Johnson Digitally signed by Christopher Johnson DN: cn=Christopher Johnson, o=PMC, ou=PVT, email=cjohnson@netl.doe.gov, c=US Date: 2011.12.19 13:35:19 -05'00' 12 19 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.12.20 11:06:33 -05'00' 12 20 2011 Comprehensive list of subcontractors and five locations covered under this Summary CX has been

438

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"

439

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7

440

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253

442

Categorical Exclusion Determination Form It Submit by E-_  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It Submit by E-_ It Submit by E-_ I'llail - ] Proposed Action Title: (0672- 1610) Eaton Corporation - Highly Efficient, Nea r-Isothermal Liquid-Piston Compressor fo r Low Cost At-Home Natural Gas Refueli ng Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Southfield, MI ; Eden Prairie, MN; Minneapolis, MN; and Milwaukee, WI Proposed Action Description: Funding will support efforts to develop a highly efficient, near isothermal liquid piston compressor for low cost, at-home natu ral gas refueling Proposed work will consist of: (1) develop and optimize a concept compressor design to achieve established performance and cost targets; (2) characterize and verify the expected performance for the compressor design; and (3) develop a compressor system prototype to test proof of

443

A Numerical Model for Combustion of Bubbling Thermoplastic ...  

Science Conference Proceedings (OSTI)

... where Wi = dri/dt and Wi+1 = dri+1/dt are velocities of inner and outer nodes respectively, the mass conservation equation can be rewritten as ...

2002-12-20T23:59:59.000Z

444

MULTIPHASE REACTOR MODELING FOR ZINC CHLORIDE CATALYZED COAL LIQUEFACTION  

E-Print Network (OSTI)

of noble gases in molten salts, which also provide a modeln Hexane B2 275C. Hydrogen-Molten Salt WI (dynes/em) WI PI

Joyce, Peter James

2011-01-01T23:59:59.000Z

445

THE SYNTHESES AND ELECTRONIC STRUCTURES OF DECAMETHYLMETALLOCENES  

E-Print Network (OSTI)

NJ, 07036. **Present address: ***Present address: Chemistry Department, Beloit College, Beloit, WI Solar Energy

Robbins, J.L.

2013-01-01T23:59:59.000Z

446

Paper No. PIIB.6 THE 13TH INTERNATIONAL STELLARATOR WORKSHOP  

E-Print Network (OSTI)

, University of Wisconsin, Madison, WI 53706 (3) Department of Theoretical Physics and Plasma Research

Redi, Martha H.

447

Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti

2011-01-01T23:59:59.000Z

448

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTFWCT I 1 CONTRACT ID CODE PAGE I OF 2  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTFWCT I CONTFWCT I 1 CONTRACT ID CODE PAGE I OF 2 PAGES MI10 I See Block 16C I REQ. NO. BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUISITIONIPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e l . a , U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 871 85-5400 96. DATED (SEE ITEM 1 1 ) 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 J CODE U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 DE-AC04-00AL66620 1 1 106. DATED (SEE ITEM 1 0 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

449

The family of terpene synthases in plants: a midsize family of genes for specialized metabolism that is highly diversified throughout the kingdom  

NLE Websites -- All DOE Office Websites (Extended Search)

PLANT PLANT GENOME: AN EVOLUTIONARY VIEW ON STRUCTURE AND FUNCTION The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom Feng Chen 1,* , Dorothea Tholl 2 , Jo ¨ rg Bohlmann 3 and Eran Pichersky 4 1 Department of Plant Sciences, University of Tennessee, Knoxville, TN 37996, USA, 2 Department of Biological Sciences, 408 Latham Hall, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA, 3 Michael Smith Laboratories, 2185 East Mall, University of British Columbia, Vancouver, BC V6T 1Z4, Canada, and 4 Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA Received 14 October 2010; revised 19 January 2011; accepted 31 January 2011. * For correspondence (fax +1 865 974 1947; e-mail fengc@utk.edu). SUMMARY Some plant

450

Dislocation density in copper and tantalum after shock loading up to 20-80 GPa  

National Nuclear Security Administration (NNSA)

4: Materials-EOS and Thermodynamic Properties 4: Materials-EOS and Thermodynamic Properties Dislocation Density in Copper And Tantalum After Shock Loading Up To 20-100 GPA A.M. Podurets, M.I. Tkachenko, O.N. Ignatova, A.I. Lebedev, V.V. Igonin, V.A. Raevsky RFNC-VNIIEF, Institute of Physics of Explosion, Sarov, Russia Introduction A microstructure of metals at shock loading is determined by the same processes, which occur at any deformation including a competition of two basic mechanisms of plastic strain - dislocation slip and twinning. The action of a specified mechanism of plastic deformation under the conditions of dynamic loading is usually defined by the help of the analysis of samples recovered after loading. We consider the dislocation structure of two metals having various crystal lattices: face-centered cubic copper and body-

451

AMENDMENT OF SOLICITATIONIMODIFICATION OF CONTRACT I '. CONTRACT ID CODE  

National Nuclear Security Administration (NNSA)

SOLICITATIONIMODIFICATION OF CONTRACT I '. SOLICITATIONIMODIFICATION OF CONTRACT I '. CONTRACT ID CODE BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 PAGE I OF 12 PAGES Albuquerque, NM 871 85-5400 I Amarillo, TX 79120 I I 90. DATED (SEE ITEM 1 1 ) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) I 10A. MODIFICATION OF CONTRACTIORDER NO. 2. AMENDMENT/MODIFICATION NO. MI67 9A. AMENDMENT OF SOLICITATION NO. I 1 DE-AC04-00AL66620 100. DATED (SEE ITEM 13) 3. EFFECTIVE DATE See Block 16C Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the

452

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT ID PAGE I OF 2  

NLE Websites -- All DOE Office Websites (Extended Search)

/ ' / ' ID PAGE I OF 2 PAGES - . Albuquerque, NM 87185-5400 I Amarillo, TX 79120 I ( DE-AC04-00AL66620 10B. DATED (SEE ITEM 13) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) Babcock & W ~ ~ C O X Technical Services Pantex, LLC 800 Main Street Lynchburg, VA 24505 2 . AMENDMENTIMODIFICATION NO. MI50 9A. AMENDMENT OF SOLICITATION NO. 9B. DATED (SEE ITEM 11) 10A. MODIFICATION OF CONTRACTIORDER NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

453

Utility-Scale Smart Meter Deployments, Plans & Proposals  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

edisonfoundation.net/IEE edisonfoundation.net/IEE Utility-Scale Smart Meter Deployments, Plans & Proposals April 2010 Utility State Target Number of Meters Notes Resources AEP 1 IN, KY, MI, OH, OK, TX, VA, WV 5,000,000 AEP plans on deploying smart meters to all customers within their service territory and have deployed 10,000 meters to customers in South Bend, IN, and are presently deploying another 700,000 to AEP-Texas customers. Timing for the remaining deployments will depend on specific conditions in each of the seven operating company subsidiaries. AEP Corporate Sustainability Report 2009 2 Allegheny Power MD, PA, WV 700,000 Allegheny launched pilots in Morgantown, WV and Urbana, MD to test smart meters and thermostats (1,140 meters installed). In PA, Act 129 (2008)

454

Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA

455

Energy Project Incentive Funds: Updates and Trends  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Incentive Funds Project Incentive Funds Updates and Trends Elizabeth Stuart Lawrence Berkeley National Lab FUPWG Spring Meeting - April 20, 2011 EE Funding Overview * Ratepayer-funded EE budget $5.3B in 2010 - Plus over $1B for DR/LM and $1.5B for renewables * Expected to reach $6B for EE in 2011 - Nearly double the 2008 figure ($3.1B) * Strong expansion expected to 2020 - Total expected to reach $7.5-12.4B (EE only) * It's not just the usual suspects anymore - Recent entrants: NM, MI, NC, AR, VA, OH, PA, IN... EE Funding - Current Picture * ~ 45 states have ratepayer-funded EE * 2010 budget (EE only) $5.3B (source: CEE) - $4.4B in 2009, $3.1B in 2008 and $0.8B in 1998 - ~ 80% on electric side ($4.3B); ~20% for gas EE

456

Presentation-SNL_RICA-CEDS_Peer_Review_v2a.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Systems Systems 2010 Peer Review Alexandria, VA July 20-22, 2010 Co-PI: Jason Stamp, Ph.D. Co-PI: Laurie Phillips Sandia National Laboratories Reliability Impacts for Cyber Attack (RICA) Summary Slide: Reliability Impacts for Cyber Attack (RICA) Outcomes:
Quan&ta&ve
impact
analysis of
cyber
a5acks
against
power
grid control
systems
(that
affect
grid
topology and
opera&ons),
including
poten&al mi&ga&on
steps,
using
reliability
metrics. Analyze
large-scale
cases
using
simula&on soCware
in
a
High-Performance Compu&ng
(HPC)
environment. Roadmap
Challenges:
Develop
evidence- based
business
case
to
increase
and shape
investment
in
control
system security.

457

Data:5ccaa7a7-0863-44b5-98fe-1e44dc285b01 | Open Energy Information  

Open Energy Info (EERE)

ccaa7a7-0863-44b5-98fe-1e44dc285b01 ccaa7a7-0863-44b5-98fe-1e44dc285b01 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Wolverine Pwr Supply Coop, Inc Effective date: 2013/02/26 End date if known: Rate name: Schedule B- General Service (Single Phase) Sector: Description: Available in all territories served by the Association to members with installed transformer capacity of 25 kVa or less subject to the Association's established service rules and reg Source or reference: http://www.dleg.state.mi.us/mpsc/electric/ratebooks/ontonagon/ontonagonmemberregcur.pdf Source Parent: Comments Applicability

458

Microsoft Word - 2007hsn-infocom-paper-lehman-etal.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Control Plane Architecture and Design Considerations for Multi-Service, Multi-Layer, Multi- Domain Hybrid Networks Tom Lehman 1 , Xi Yang 1 , Chin P. Guok 2 , Nageswara S. V. Rao 3 , Andy Lake 4 , John Vollbrecht 4 , Nasir Ghani 5 1 Information Sciences Institute East, University of Southern California, Arlington, VA 22203, USA, Email: {tlehman,xyang}@isi.edu 2 Network Engineering Services Group, ESnet, Berkeley, CA 94720, USA, Email: chin@es.net 3 Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA, Email: raons@ornl.edu 4 University Corporation for Advanced Internet Development, Internet2, Ann Arbor, MI 48104, USA, Email: {jrv,alake}@internet2.edu 5 Department of Electrical and Computer Engineering, Tennessee Technological University, Cookville, TN 38505, USA,

459

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT I ' CONTRACT ID CODE  

National Nuclear Security Administration (NNSA)

' ' CONTRACT ID CODE BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 PAGE 1 OF 12 PAGES 9B. DATED (SEE ITEM 11) 5. PROJECT NO. (If applicable) 4. REQUlSlTlONlPURCHASE REQ. NO. 2. AMENDMENTIMODIFICATION NO. MI39 extended. 6. ISSUED BY CODE U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 871 85-5400 3. EFFECTIVE DATE See Block 16C CODE I FACILITY CODE Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the

460

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT ID PAGE I OF 2  

National Nuclear Security Administration (NNSA)

/ ' / ' ID PAGE I OF 2 PAGES - . Albuquerque, NM 87185-5400 I Amarillo, TX 79120 I ( DE-AC04-00AL66620 10B. DATED (SEE ITEM 13) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) Babcock & W ~ ~ C O X Technical Services Pantex, LLC 800 Main Street Lynchburg, VA 24505 2 . AMENDMENTIMODIFICATION NO. MI50 9A. AMENDMENT OF SOLICITATION NO. 9B. DATED (SEE ITEM 11) 10A. MODIFICATION OF CONTRACTIORDER NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT BWXT Pantex, LLC  

NLE Websites -- All DOE Office Websites (Extended Search)

BWXT Pantex, LLC BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 . - ~ . ~ - - Albuquerque, NM 87185-5400 I Amarillo, TX 79120 9B. DATED (SEE ITEM 11) CONTRACT ID CODE 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) DE-AC04-00AL66620 I I IOB. DATED (SEE ITEM 13) PAGE I OF 2 PAGES 2. AMENDMENTIMODIFICATION NO. MI06 9A. AMENDMENT OF SOLICITATION NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

462

Data:C3e4018a-013e-463c-9ff9-163e18d1374b | Open Energy Information  

Open Energy Info (EERE)

018a-013e-463c-9ff9-163e18d1374b 018a-013e-463c-9ff9-163e18d1374b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Wolverine Pwr Supply Coop, Inc Effective date: 2013/02/26 End date if known: Rate name: Schedule B- General Service (Three Phase) Sector: Description: Available in all territories served by the Association to members with installed transformer capacity of 25 kVa or less subject to the Association's established service rules and regulations. Source or reference: http://www.dleg.state.mi.us/mpsc/electric/ratebooks/ontonagon/ontonagonmemberregcur.pdf Source Parent: Comments There is also a surcharge of $1.85/meter/month

463

,"Virginia Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050VA3","N3010VA3","N3020VA3","N3035VA3","N3045VA3" "Date","Natural Gas Citygate Price in Virginia (Dollars per Thousand Cubic Feet)","Virginia Price of...

464

Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available

1987-01-01T23:59:59.000Z

465

1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.

1996-12-31T23:59:59.000Z

466

Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.

2011-01-01T23:59:59.000Z

467

Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius

2009-01-01T23:59:59.000Z

468

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

469

Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl

470

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st

471

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS

472

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL

473

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION

474

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN

475

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS

476

LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance

477

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS

478

I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals

479

Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of

480

Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.

Note: This page contains sample records for the topic "va wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Michael L. Corradini Nuclear Engineering & Engineering Physics -Birthdate -8/6/52, US Citizen 1500 Engineering Drive, Madison WI -Phone: 608-263-1648 -Email: Corradini@engr.wisc.edu  

E-Print Network (OSTI)

's Award in Nuclear Reactor Safety -1984 * Member of the Wisconsin Radioactive Waste Review Board Technical and ACCOMPLISHMENTS * Awarded the NSF Presidential Young Investigator's Award, 1984 * American Nuclear Society Reactor.Budnitz, M.Pilch, "Perspectives on Advanced Simulation for Nuclear Reactor Safety Applications", Nuclear

Volpe, Francesco

482

1300 Linden Drive Madison, WI 53706-1524 (608) 262-4847 www.sohe.wisc.eduVol.11, No.1 Spring 2008 impactSchool of Human Ecology  

E-Print Network (OSTI)

. Carbone, K. Saarnio, S. Saarikoski, T. Makela, M. Kulmala, V.-M. Kerminen, D.R. Worsnop, and R. Hillamo

Sheridan, Jennifer

483

Intrusion detection and monitoring for wireless networks.  

SciTech Connect

Wireless computer networks are increasing exponentially around the world. They are being implemented in both the unlicensed radio frequency (RF) spectrum (IEEE 802.11a/b/g) and the licensed spectrum (e.g., Firetide [1] and Motorola Canopy [2]). Wireless networks operating in the unlicensed spectrum are by far the most popular wireless computer networks in existence. The open (i.e., proprietary) nature of the IEEE 802.11 protocols and the availability of ''free'' RF spectrum have encouraged many producers of enterprise and common off-the-shelf (COTS) computer networking equipment to jump into the wireless arena. Competition between these companies has driven down the price of 802.11 wireless networking equipment and has improved user experiences with such equipment. The end result has been an increased adoption of the equipment by businesses and consumers, the establishment of the Wi-Fi Alliance [3], and widespread use of the Alliance's ''Wi-Fi'' moniker to describe these networks. Consumers use 802.11 equipment at home to reduce the burden of running wires in existing construction, facilitate the sharing of broadband Internet services with roommates or neighbors, and increase their range of ''connectedness''. Private businesses and government entities (at all levels) are deploying wireless networks to reduce wiring costs, increase employee mobility, enable non-employees to access the Internet, and create an added revenue stream to their existing business models (coffee houses, airports, hotels, etc.). Municipalities (Philadelphia; San Francisco; Grand Haven, MI) are deploying wireless networks so they can bring broadband Internet access to places lacking such access; offer limited-speed broadband access to impoverished communities; offer broadband in places, such as marinas and state parks, that are passed over by traditional broadband providers; and provide themselves with higher quality, more complete network coverage for use by emergency responders and other municipal agencies. In short, these Wi-Fi networks are being deployed everywhere. Much thought has been and is being put into evaluating cost-benefit analyses of wired vs. wireless networks and issues such as how to effectively cover an office building or municipality, how to efficiently manage a large network of wireless access points (APs), and how to save money by replacing an Internet service provider (ISP) with 802.11 technology. In comparison, very little thought and money are being focused on wireless security and monitoring for security purposes.

Thomas, Eric D.; Van Randwyk, Jamie A.; Lee, Erik J.; Stephano, Amanda (Indiana University); Tabriz, Parisa (University of Illinois at Urbana-Champaign); Pelon, Kristen (Cedarville University); McCoy, Damon (University of Colorado, Boulder); Lodato, Mark (Lafayette College); Hemingway, Franklin (University of New Mexico); Custer, Ryan P.; Averin, Dimitry (Polytechnic University); Franklin, Jason (Carnegie Mellon University); Kilman, Dominique Marie

2005-11-01T23:59:59.000Z

484

Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...

485

Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...

486

Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...

487

Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard

2004-01-01T23:59:59.000Z

488

1 Department of Veterans Affairs Office of Research and ...  

Science Conference Proceedings (OSTI)

... in which countries, VA will pursue international filings. ... 3: Revise VA Patent Policy for more ... finances Develop patent financial policies and metrics ...

2012-10-11T23:59:59.000Z

489

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

08 VA Dept. of Mines, Minerals & Energy EE Pulaski County IPODEE FY 2012 Jason Powers - DOE HQ 802 E Main St., Pulaski, VA Economic Development - Lighting Fixture Replacement...

490

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1006 - 911 Wytheville, VA VA-MD-DC Public E85 Refueling Project Install retail biofuel fueling infrastructure. 10 20 2010 Digitally signed by Steven Richardson Date:...

491

Static pushover analyses of pile groups in liquefied and laterally spreading ground in centrifuge tests  

E-Print Network (OSTI)

AND GEOENVIRONMENTAL ENGINEERING ASCE / SEPTEMBER 2007Special Publication No. 145, ASCE, Reston, Va. Brandenberg,Special Publication No. 145, ASCE, Reston, Va. , 204217.

Brandenberg, Scott J; Boulanger, R W; Kutter, Bruce L; Chang, Dongdong

2007-01-01T23:59:59.000Z

492

Federal Energy Management Program: Case Study - The Department...  

NLE Websites -- All DOE Office Websites (Extended Search)

VA Connecticut Health Care System to someone by E-mail Share Federal Energy Management Program: Case Study - The Department of Veterans Affairs West Haven Campus, VA Connecticut...

493

HIGH VOLTAGE TERMINAL IN COSY ELECTRON COOLER V.A. Chekavinskiy, E.A. Bekhtenev, I.A. Gusev, M.N. Kondaurov, V.R. Kozak, E.A. Kuper, V.R.  

E-Print Network (OSTI)

, and powered by multistage transformer, capable of 15 kW power at 26 kHz. Wireless control is passed through high voltage circumstances. Powering of HVT electronics is provided by cascade transformer acceleration system ­ high voltage terminal. All power and control electronics were placed in a single isolated

Kozak, Victor R.

494

HARVARD SCHOOL OF PUBLIC HEALTH A D VA N C I N G T H E P U B L I C 'S H E A LT H T H R O U G H  

E-Print Network (OSTI)

Alaska, Arizona, California, Hawaii, Nevada, Oregon, Washington, and British Columbia #12;4 An important organizations ­ Energy, utility, and pipeline companies ­ Colleges and universities ­ Trade associations capture ­ Dispatch mode and remaining life ­ Proximity to suitable geologic storage sites and pipelines

Gunawardena, Jeremy

495

Selective Catalytic Reduction (SCR) of nitric oxide with ammonia using Cu-ZSM-5 and Va-based honeycomb monolith catalysts: effect of H2 pretreatment, NH3-to-NO ratio, O2, and space velocity  

E-Print Network (OSTI)

In this work, the steady-state performance of zeolite-based (Cu-ZSM-5) and vanadium-based honeycomb monolith catalysts was investigated in the selective catalytic reduction process (SCR) for NO removal using NH3. The aim was to delineate the effect of various parameters including pretreatment of the catalyst sample with H2, NH3-to-NO ratio, inlet oxygen concentration, and space velocity. The concentrations of the species (e.g. NO, NH3, and others) were determined using a Fourier Transform Infrared (FTIR) spectrometer. The temperature was varied from ambient (25 C) to 500 C. The investigation showed that all of the above parameters (except pre-treatment with H2) significantly affected the peak NO reduction, the temperature at which peak NO reduction occurred, and residual ammonia left at higher temperatures (also known as 'NH3 slip'). Depending upon the particular values of the parameters, a peak NO reduction of around 90% was obtained for both the catalysts. However, an accompanied generation of N2O and NO2 species was observed as well, being much higher for the vanadium-based catalyst than for the Cu-ZSM-5 catalyst. For both catalysts, the peak NO reduction decreased with an increase in space velocity, and did not change significantly with an increase in oxygen concentration. The temperatures at which peak NO reduction and complete NH3 removal occurred increased with an increase in space velocity but decreased with an increase in oxygen concentration. The presence of more ammonia at the inlet (i.e. higher NH3-to-NO ratio) improved the peak NO reduction but simultaneously resulted in an increase in residual ammonia. Pretreatment of the catalyst sample with H2 (performed only for the Cu-ZSM-5 catalyst) did not produce any perceivable difference in any of the results for the conditions of these experiments.

Gupta, Saurabh

2003-08-01T23:59:59.000Z

496

In Proceedings Human Systems Integration Symposium 2003, Vienna, VA, June 23-25, 2003. Joseph L. Gabbard, M.S., Deborah Hix, Ph.D., J. Edward Swan II, Ph.D.  

E-Print Network (OSTI)

for Complex Interactive Systems Development ABSTRACT Usability engineering is a cost-effective, user- centered systems (Section "Usability Engineering Case Studies: Developing Complex Interactive Systems"). For each, M.S., Simon J. Julier, Ph.D. Dennis Brown, M.S., Yohan Baillot, M.S. Usability Engineering

Gabbard, Joseph L.

497

A d vA n c e m e n t o f t h e PRACTICEA d vA n c e m e n t o f t h e PRACTICE D I R E C T F R O M C D C E N V I R O N M E N TA L H E A LT H S E R V I C E S B R A N C H  

E-Print Network (OSTI)

development infrastructure, insufficient training budgets, and a short age of designated staff persons in carrying out daily job duties and to determine the utility of the program in preparation of the REHS/RS pro

498

A d VA N c E m E N t o f t H E PraCtICEA d VA N c E m E N t o f t H E PraCtICE D I r E C t F r o M C D C e n v I r o n m e n tA L h e A Lt h S e r v I c e S B r A n c h  

E-Print Network (OSTI)

worker and manager food safety training and experience, restaurant and food worker busyness. She helps the branch's Environmental Health Specialists Network (EHS-Net) with the design and implementation of restaurant food safety studies and analysis of eHS-Net Restaurant Food Safety Studies: What

499

Section 2  

Science Conference Proceedings (OSTI)

... The normal prescribed test pattern shall be an area of 1 .2 m (4 ft) inl ength an d 3. 0 m (10 ft) in wi dth or t he wi dth oft he scal e pl atform ...

2011-09-21T23:59:59.000Z

500

STUTCO","SN","LN","CL","FL","AMOUNT","SCHEDULE","UTNAME","YEAROFDAT  

U.S. Energy Information Administration (EIA) Indexed Site

08026","Sheboygan Falls City of",98 5500018312,01,001,1,1,000016519548,"WI 10610","Sun Prairie Water & Light Comm",98 5500018312,01,002,1,1,000001111652,"WI 10620","Sun...