Sample records for user-orientated comparative analysis

  1. User-orientated comparative analysis of climate compatible development...

    Open Energy Info (EERE)

    private sector, NGO and country-led methodologies for climate compatible development strategy building and planning. There are many methodologies being developed and utilised...

  2. User-orientated comparative analysis of climate compatible development

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTown of Ladoga,planning methodologies and tools | Open Energy Information

  3. User-Oriented Software for Energy Conservation with Personal Computers

    E-Print Network [OSTI]

    Schmidt, P. S.; Fischer, D. B.; Barr, C. L.

    1982-01-01T23:59:59.000Z

    files: In many types of technical computation, input data may be characterized as "common" or "case-specific". The former category includes data that don't generally change from case to case, whereas the latter includes information that is unique... distrObuted capability within a price range comparable nationally (4). Several techniques hav been to common office equipment. Microcomputers utilized in developing thes~ progr ms to with storage, computational, and display make them easy to use...

  4. Comparative Analysis of Proteome and Transcriptome Variation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Comparative Analysis of Proteome and Transcriptome Variation in Mouse. Comparative Analysis of Proteome and Transcriptome Variation in Mouse. Abstract: The relationships between...

  5. Comparative analysis of collaboration networks

    SciTech Connect (OSTI)

    Progulova, Tatiana; Gadjiev, Bahruz [International University for Nature, Society and Man, 19 Universitetskaya Street, Dubna, 141980 (Russian Federation)

    2011-03-14T23:59:59.000Z

    In this paper we carry out a comparative analysis of the word network as the collaboration network based on the novel by M. Bulgakov 'Master and Margarita', the synonym network of the Russian language as well as the Russian movie actor network. We have constructed one-mode projections of these networks, defined degree distributions for them and have calculated main characteristics. In the paper a generation algorithm of collaboration networks has been offered which allows one to generate networks statistically equivalent to the studied ones. It lets us reveal a structural correlation between word network, synonym network and movie actor network. We show that the degree distributions of all analyzable networks are described by the distribution of q-type.

  6. Comparative analysis of debrites, turbidites, and contourites

    E-Print Network [OSTI]

    Pluenneke, Judith Louise

    1976-01-01T23:59:59.000Z

    COMPARATIVE ANALYSIS OF DEBRITES, TURBIDITES, AND CONTOURITES A Thesis by JUDITH LOUISE PLUENNEKE Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE May..., 1976 Major Subject: Oceanography COMPARATIVE ANALYSIS OF DEBRITES, TURBIDITES, AND CONTOURITES A Thesis by Judith Louise Pluenneke Approved as to style and content by: (C airman of Committee) (Head of Department (Member Member May 1976...

  7. Comparative analysis of peat gasification reactor configuration

    SciTech Connect (OSTI)

    Not Available

    1981-07-01T23:59:59.000Z

    A comparative analysis of two generic (fluidized and entrained beds) and two specific (PEATGAS and the Rockwell International) hydrogasifiers involved data-base assessment, regression analysis, a chemical-engineering evaluation of down- and upstream equipment needs, and computer simulation. The study concluded that the PEATGAS reactor is closer to commercialization than the Rockwell.

  8. The User Oriented Evaluation process: A process for preserving user needs during iterative system test and evaluation

    SciTech Connect (OSTI)

    Hunt, S.; Schur, A.

    1991-09-01T23:59:59.000Z

    A system development process, called the User Oriented Evaluation (UOE) process, and an evaluation tool were created to place greater emphasis on user needs during computer system development. The UOE process is an iterative method for design that emphasizes the role of the user as the initiator of system requirements; evolutionary design requirement definition by enabling users and development to experiment through the use of prototypes at all phases of system design; and appropriate utilization of developer and user areas of expertise. The evaluation tool is an integral part of the UOE process and provides the ability to solicit on-line meaningful feedback from users in real-time, and a means to capture on a user's on-going experience with the computer system. The paper contains a description of the UOE process and the evaluation tool, the capabilities of each and the history of their development. 12 figs., 3 tabs.

  9. Comparative Analysis of Urban Atmospheric Aerosol by Particle...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Analysis of Urban Atmospheric Aerosol by Particle-Induced X-ray Emission (PIXE), Proton Elastic Scattering Analysis Comparative Analysis of Urban Atmospheric Aerosol by...

  10. Comparative analysis of selected fuel cell vehicles

    SciTech Connect (OSTI)

    NONE

    1993-05-07T23:59:59.000Z

    Vehicles powered by fuel cells operate more efficiently, more quietly, and more cleanly than internal combustion engines (ICEs). Furthermore, methanol-fueled fuel cell vehicles (FCVs) can utilize major elements of the existing fueling infrastructure of present-day liquid-fueled ICE vehicles (ICEVs). DOE has maintained an active program to stimulate the development and demonstration o fuel cell technologies in conjunction with rechargeable batteries in road vehicles. The purpose of this study is to identify and assess the availability of data on FCVs, and to develop a vehicle subsystem structure that can be used to compare both FCVs and ICEV, from a number of perspectives--environmental impacts, energy utilization, materials usage, and life cycle costs. This report focuses on methanol-fueled FCVs fueled by gasoline, methanol, and diesel fuel that are likely to be demonstratable by the year 2000. The comparative analysis presented covers four vehicles--two passenger vehicles and two urban transit buses. The passenger vehicles include an ICEV using either gasoline or methanol and an FCV using methanol. The FCV uses a Proton Exchange Membrane (PEM) fuel cell, an on-board methanol reformer, mid-term batteries, and an AC motor. The transit bus ICEV was evaluated for both diesel and methanol fuels. The transit bus FCV runs on methanol and uses a Phosphoric Acid Fuel Cell (PAFC) fuel cell, near-term batteries, a DC motor, and an on-board methanol reformer. 75 refs.

  11. Comparative Analysis of Genome Sequences with VISTA

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Dubchak, Inna

    VISTA is a comprehensive suite of programs and databases developed by and hosted at the Genomics Division of Lawrence Berkeley National Laboratory. They provide information and tools designed to facilitate comparative analysis of genomic sequences. Users have two ways to interact with the suite of applications at the VISTA portal. They can submit their own sequences and alignments for analysis (VISTA servers) or examine pre-computed whole-genome alignments of different species. A key menu option is the Enhancer Browser and Database at http://enhancer.lbl.gov/. The VISTA Enhancer Browser is a central resource for experimentally validated human noncoding fragments with gene enhancer activity as assessed in transgenic mice. Most of these noncoding elements were selected for testing based on their extreme conservation with other vertebrates. The results of this enhancer screen are provided through this publicly available website. The browser also features relevant results by external contributors and a large collection of additional genome-wide conserved noncoding elements which are candidate enhancer sequences. The LBL developers invite external groups to submit computational predictions of developmental enhancers. As of 10/19/2009 the database contains information on 1109 in vivo tested elements - 508 elements with enhancer activity.

  12. Comparative molecular dynamics analysis of tapasin-dependent...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    molecular dynamics analysis of tapasin-dependent and -independent MHC class I alleles. Comparative molecular dynamics analysis of tapasin-dependent and -independent MHC class I...

  13. Comparative naval architecture analysis of diesel submarines

    E-Print Network [OSTI]

    Torkelson, Kai Oscar

    2005-01-01T23:59:59.000Z

    Many comparative naval architecture analyses of surface ships have been performed, but few published comparative analyses of submarines exist. Of the several design concept papers, reports and studies that have been written ...

  14. Daylighting Prediction Software: Comparative Analysis and Application

    E-Print Network [OSTI]

    Estes, J. M. Jr.; Schreppler, S.; Newsom, T.

    2004-01-01T23:59:59.000Z

    in selecting a software program are presented. “Radiance”, a reverse ray tracing method software package, was chosen for use in the simulations. An existing school was modeled with the Radiance software and predictions of daylighting contributions were compared...

  15. Comparative analysis of plant oil based fuels

    SciTech Connect (OSTI)

    Ziejewski, M.; Goettler, H.J.; Haines, H.; Huong, C.

    1995-12-31T23:59:59.000Z

    This paper presents the evaluation results from the analysis of different blends of fuels using the 13-mode standard SAE testing method. Six high oleic safflower oil blends, six ester blends, six high oleic sunflower oil blends, and six sunflower oil blends were used in this portion of the investigation. Additionally, the results from the repeated 13-mode tests for all the 25/75% mixtures with a complete diesel fuel test before and after each alternative fuel are presented.

  16. TROPICAL DEFORESTATION MODELLING: A COMPARATIVE ANALYSIS OF DIFFERENT PREDICTIVE APPROACHES.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    TROPICAL DEFORESTATION MODELLING: A COMPARATIVE ANALYSIS OF DIFFERENT PREDICTIVE APPROACHES-time discretisation; Remote Sensing; Neural Networks; Markov Chains; MCE; Dinamica; Risk management; Deforestation

  17. Commercial Property Assessed Clean Energy: A Comparative Analysis

    Broader source: Energy.gov [DOE]

    Hosted by the Technical Assistance Program (TAP), this webinar, held on Feb. 26, 2015, focused on a comparative analysis of program design elements of existing Property Assessed Clean Energy (PACE) programs across the country.

  18. TR-010 Hydrology March 2001 Comparative Analysis of Sediment Production

    E-Print Network [OSTI]

    TR-010 Hydrology March 2001 Comparative Analysis of Sediment Production in Two Partially Harvested Disciplines: Ecology ~ Geology ~ Geomorphology ~ Hydrology ~ Pedology ~ Silviculture ~ Wildlife Forest ~ Hydrology ~ Pedology ~ Silviculture ~ Wildlife CONTENTS ABSTRACT

  19. Probabilistic Approaches in Comparative Analysis of Biological Networks and Sequences

    E-Print Network [OSTI]

    Sahraeian, Sayed 1983-

    2013-01-07T23:59:59.000Z

    PROBABILISTIC APPROACHES IN COMPARATIVE ANALYSIS OF BIOLOGICAL NETWORKS AND SEQUENCES A Dissertation by SAYED MOHAMMAD EBRAHIM SAHRAEIAN Submitted to the O ce of Graduate Studies of Texas A&M University in partial ful llment...: Electrical Engineering Copyright 2013 Sayed Mohammad Ebrahim Sahraeian ABSTRACT Comparative analysis of genomic data investigates the relationship of genome structure and function across di erent biological species to shed light on their sim- ilarities...

  20. SynBrowse: A Synteny Browser for Comparative Sequence Analysis

    E-Print Network [OSTI]

    Brendel, Volker

    1 SynBrowse: A Synteny Browser for Comparative Sequence Analysis Xiaokang Pan * , Lincoln Stein published June 30, 2005 #12;Pan et al. 2005 2 ABSTRACT Motivation: The recent efforts of various sequence projects to sequence deeply into various phylogenies provide great resources for comparative sequence

  1. Genomewide comparative analysis of alternative splicing in plants

    E-Print Network [OSTI]

    Brendel, Volker

    Genomewide comparative analysis of alternative splicing in plants Bing-Bing Wang* and Volker in mamma- lian systems but much less in plants. Here we report AS events deduced from EST cDNA analysis in two model plants: Arabidopsis and rice. In Arabidopsis, 4,707 (21.8%) of the genes with EST c

  2. LIFE CYCLE ANALYSIS: COMPARING PLA PLASTIC FOOD USE PRODUCTS

    E-Print Network [OSTI]

    sections--agriculture, manufacture and transport. Energy inputs for each of these sections were determined in the analysis. BFS, however, avoids this energy input by purchasing a starch that is a waste stream from anotherLIFE CYCLE ANALYSIS: COMPARING PLA PLASTIC FOOD USE PRODUCTS ON THE BASIS OF ENERGY CONSUMPTION Sin

  3. Comparative genomics analysis of Liberibacter species to elucidate pathogenesis and culturability

    E-Print Network [OSTI]

    Leonard, Michael T.; Fagen, Jennie R.; McCullough, Connor M.; Davis-Richardson, Austin G.; Davis, Michael J.; Triplett, Eric W.

    2014-01-01T23:59:59.000Z

    Vol. 1 (2014) Comparative genomics analysis of Liberibacterof citrus, comparative genomics of this strain with other

  4. Comparative Analysis on the Effects of Diesel Particulate Filter and

    E-Print Network [OSTI]

    Wu, Mingshen

    Comparative Analysis on the Effects of Diesel Particulate Filter and Selective Catalytic Reduction February 15, 2008. Revised manuscript received May 2, 2008. Accepted May 27, 2008. Two methods, diesel that these aftertreatment systems may have on the emission levels of a wide spectrum of chemical species found in diesel

  5. Comparative Analysis of Conventional Oil and Gas and

    E-Print Network [OSTI]

    Jaramillo, Paulina

    Comparative Analysis of Conventional Oil and Gas and Wind Project Decommissioning Regulations Generation Energy, a non-profit renewable investment firm focusing on extending capital from private School and on the board of the Vermont Energy Investment Corporation, which manages ``Efficiency Vermont

  6. A COMPARATIVE ANALYSIS OF THE INFLUENCE OF WEATHER ON THE

    E-Print Network [OSTI]

    Loon, E. Emiel van

    conditions (Bouten et al. 2003). This model will be used by experts as a decision support tool to reduceA COMPARATIVE ANALYSIS OF THE INFLUENCE OF WEATHER ON THE FLIGHT ALTITUDES OF BIRDS Meteorological/Bash/stats.html). The International Civil Aviation Organization (ICAO) has long acknowledged the risk of bird hazards to civil

  7. Sequence and comparative analysis of the chicken genome provide unique

    E-Print Network [OSTI]

    Edwards, Scott

    Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution International Chicken Genome Sequencing Consortium* *Lists of participants and affiliations appear ........................................................................................................................................................................................................................... We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken

  8. Initial sequencing and comparative analysis of the mouse genome

    E-Print Network [OSTI]

    Eddy, Sean

    Initial sequencing and comparative analysis of the mouse genome Mouse Genome Sequencing Consortium ........................................................................................................................................................................................................................... The sequence of the mouse genome is a key informational tool for understanding the contents of the human genome collaboration to produce a high-quality draft sequence of the mouse genome. We also present an initial

  9. Initial sequencing and comparative analysis of the mouse genome

    SciTech Connect (OSTI)

    Waterston, Robert H.; Lindblad-Toh, Kerstin; Birney, Ewan; Rogers, Jane; Abril, Josep F.; Agarwal, Pankaj; Agarwala, Richa; Ainscough, Rachel; Alexandersson, Marina; An, Peter; Antonarakis, Stylianos E.; Attwood, John; Baertsch, Robert; Bailey, Jonathon; Barlow, Karen; Beck, Stephan; Berry, Eric; Birren, Bruce; Bloom, Toby; Bork, Peer; Botcherby, Marc; Bray, Nicolas; Brent, Michael R.; Brown, Daniel G.; Brown, Stephen D.; Bult, Carol; Burton, John; Butler, Jonathan; Campbell, Robert D.; Carninci, Piero; Cawley, Simon; Chiaromonte, Francesca; Chinwalla, Asif T.; Church, Deanna M.; Clamp, Michele; Clee, Christopher; Collins, Francis S.; Cook, Lisa L.; Copley, Richard R.; Coulson, Alan; Couronne, Olivier; Cuff, James; Curwen, Val; Cutts, Tim; Daly, Mark; David, Robert; Davies, Joy; Delehaunty, Kimberly D.; Deri, Justin; Dermitzakis, Emmanouil T.; Dewey, Colin; Dickens, Nicholas J.; Diekhans, Mark; Dodge, Sheila; Dubchak, Inna; Dunn, Diane M.; Eddy, Sean R.; Elnitski, Laura; Emes, Richard D.; Eswara, Pallavi; Eyras, Eduardo; Felsenfeld, Adam; Fewell, Ginger A.; Flicek, Paul; Foley, Karen; Frankel, Wayne N.; Fulton, Lucinda A.; Fulton, Robert S.; Furey, Terrence S.; Gage, Diane; Gibbs, Richard A.; Glusman, Gustavo; Gnerre, Sante; Goldman, Nick; Goodstadt, Leo; Grafham, Darren; Graves, Tina A.; Green, Eric D.; Gregory, Simon; Guigo, Roderic; Guyer, Mark; Hardison, Ross C.; Haussler, David; Hayashizaki, Yoshihide; Hillier, LaDeana W.; Hinrichs, Angela; Hlavina, Wratko; Holzer, Timothy; Hsu, Fan; Hua, Axin; Hubbard, Tim; Hunt, Adrienne; Jackson, Ian; Jaffe, David B.; Johnson, L. Steven; Jones, Matthew; Jones, Thomas A.; Joy, Ann; Kamal, Michael; Karlsson, Elinor K.; Karolchik, Donna; Kasprzyk, Arkadiusz; Kawai, Jun; Keibler, Evan; Kells, Cristyn; Kent, W. James; Kirby, Andrew; Kolbe, Diana L.; Korf, Ian; Kucherlapati, Raju S.; Kulbokas III, Edward J.; Kulp, David; Landers, Tom; Leger, J.P.; Leonard, Steven; Letunic, Ivica; Levine, Rosie; et al.

    2002-12-15T23:59:59.000Z

    The sequence of the mouse genome is a key informational tool for understanding the contents of the human genome and a key experimental tool for biomedical research. Here, we report the results of an international collaboration to produce a high-quality draft sequence of the mouse genome. We also present an initial comparative analysis of the mouse and human genomes, describing some of the insights that can be gleaned from the two sequences. We discuss topics including the analysis of the evolutionary forces shaping the size, structure and sequence of the genomes; the conservation of large-scale synteny across most of the genomes; the much lower extent of sequence orthology covering less than half of the genomes; the proportions of the genomes under selection; the number of protein-coding genes; the expansion of gene families related to reproduction and immunity; the evolution of proteins; and the identification of intraspecies polymorphism.

  10. Comparative analysis of evaluation techniques for transport policies

    SciTech Connect (OSTI)

    Browne, David, E-mail: davidbrowne2@gmail.co [Department of Civil, Structural and Environmental Engineering, Trinity College, Dublin (TCD), Dublin 2 (Ireland); Ryan, Lisa, E-mail: Lisa.RYAN@iea.or [International Energy Agency (IEA), Paris (France)

    2011-04-15T23:59:59.000Z

    The objective of this paper is to examine and compare the use of a number of policy evaluation tools, which can be used to measure the impact of transport policies and programmes as part of a strategic environmental assessment (SEA) or sustainability appraisal. The evaluation tools that were examined include cost-benefit analysis (CBA), cost-effectiveness analysis (CEA) and multi-criteria decision analysis (MCDA). It was concluded that both CEA and CBA are useful for estimating the costs and/or benefits associated with transport policies but are constrained by the difficulty in quantifying non-market impacts and monetising total costs and benefits. Furthermore, CEA is limited to identifying the most 'cost-effective policy' for achieving a single, narrowly defined objective, usually greenhouse gas (GHG) reduction and is, therefore, not suitable for evaluating policy options with ancillary costs or a variety of potential benefits. Thus, CBA or CEA evaluation should be complemented by a complete environmental and socio-economic impact assessment approach such as MCDA. This method allows for participatory analysis and qualitative assessment but is subject to caveats such as subjectivity and value-laden judgments.

  11. Imaging hydrated microbial extracellular polymers: Comparative analysis by electron microscopy

    SciTech Connect (OSTI)

    Dohnalkova, A.C.; Marshall, M. J.; Arey, B. W.; Williams, K. H.; Buck, E. C.; Fredrickson, J. K.

    2011-01-01T23:59:59.000Z

    Microbe-mineral and -metal interactions represent a major intersection between the biosphere and geosphere but require high-resolution imaging and analytical tools for investigating microscale associations. Electron microscopy has been used extensively for geomicrobial investigations and although used bona fide, the traditional methods of sample preparation do not preserve the native morphology of microbiological components, especially extracellular polymers. Herein, we present a direct comparative analysis of microbial interactions using conventional electron microscopy approaches of imaging at room temperature and a suite of cryogenic electron microscopy methods providing imaging in the close-to-natural hydrated state. In situ, we observed an irreversible transformation of the hydrated bacterial extracellular polymers during the traditional dehydration-based sample preparation that resulted in their collapse into filamentous structures. Dehydration-induced polymer collapse can lead to inaccurate spatial relationships and hence could subsequently affect conclusions regarding nature of interactions between microbial extracellular polymers and their environment.

  12. Imaging Hydrated Microbial Extracellular Polymers: Comparative Analysis by Electron Microscopy

    SciTech Connect (OSTI)

    Dohnalkova, Alice; Marshall, Matthew J.; Arey, Bruce W.; Williams, Kenneth H.; Buck, Edgar C.; Fredrickson, Jim K.

    2011-02-01T23:59:59.000Z

    Microbe-mineral and -metal interactions represent a major intersection between the biosphere and geosphere but require high-resolution imaging and analytical tools for investigating microscale associations. Electron microscopy has been used extensively for geomicrobial investigations and although used bona fide, the traditional methods of sample preparation do not preserve the native morphology of microbiological components, especially extracellular polymers. Herein, we present a direct comparative analysis of microbial interactions using conventional electron microscopy approaches of imaging at room temperature and a suite of cryo-electron microscopy methods providing imaging in the close-to-natural hydrated state. In situ, we observed an irreversible transformation of bacterial extracellular polymers during the traditional dehydration-based sample preparation that resulted in the collapse of hydrated gel-like EPS into filamentous structures. Dehydration-induced polymer collapse can lead to inaccurate spatial relationships and hence could subsequently affect conclusions regarding nature of interactions between microbial extracellular polymers and their environment.

  13. Comparative analysis of peat gasification reactor configuration. Final report

    SciTech Connect (OSTI)

    Not Available

    1981-07-01T23:59:59.000Z

    This report summarizes the comparative analysis of two generic gasifiers (fluidized bed and entrained bed) and two specific hydrogasifiers (IGT's Peat-gas and Rockwell International's hydrogasifier). The objective is to establish a basis for recommending a peat gasification reactor configuration for testing in a DOE peat gasification pilot plant project. The approach involved the following four steps: data base evaluation, regression analysis, a chemical engineering evaluation of upstream and downstream equipment requirement, and computer simulation. Mathematical models and computer programs were developed to simulate the entrained-bed and fluidized-bed reactors. Parametric analyses were made, using these computer programs, to test the sensitivity and effects of significant operating variables (temperature, pressure and feed gas composition, for instance) on the product gas composition in the IGT gasifier and Rockwell International gasifier. This review and analysis concentrates primarily upon the Peatgas process of the Institute of Gas Technology and the Rockwell International Hydrogasification Process. The two-stage Peatgas process appears to have advantages in higher thermal efficiency, smaller capital investment, and its application of existing commercial operations and proven design practices from other types of fluidized solids processing units. There are two problems concerning operability of the Peatgas process: (1) the design of a fluidized solids unit for quite low standpipe densities (approximately 11 to 15 pounds per cubic foot), which may become even lower upon operating upsets, and (2) the potential problem of ash sintering in the very hot combustion zone of the steam-oxygen gasifier. On a relative time scale of development, the Peatgas would seem to be much closer to possible early commercialization than is the Rockwell system.

  14. Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU

    E-Print Network [OSTI]

    Ussery, David W.

    Comparative Microbial Genomics group Centerfor%-8531)1-803,% - or - Where Does Vibrio cholera come from? #12;Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU #12;Comparative Microbial Genomics

  15. analysis comparing coplanar: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: ANALYSIS OF THE TRANSITION BETWEEN TWO COPLANAR WAVEGUIDE TRANSMISSION LINES Abdelnasser A. Eldek approaches for the transition between two coplanar...

  16. Comparative Analysis of Second Language Instruction and Motivation 

    E-Print Network [OSTI]

    Speights, Lara A.

    2010-07-14T23:59:59.000Z

    . And yet, our second language instruction continues to produce beginning-level speakers, while many other world players produce bilingual adults. The classroom environment is integral to understanding this discrepancy, and so this research compares high...

  17. analysis comparing microarrays: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Maize Human (partial) "I came into the class with little to no understanding of what genomics entailedGoals Full Genome Microarrays Data Analysis Bioinformatics RNA-free Teaching...

  18. Comparative genomic analysis as a tool for biologicaldiscovery

    SciTech Connect (OSTI)

    Nobrega, Marcelo A.; Pennacchio, Len A.

    2003-03-30T23:59:59.000Z

    Biology is a discipline rooted in comparisons. Comparative physiology has assembled a detailed catalogue of the biological similarities and differences between species, revealing insights into how life has adapted to fill a wide-range of environmental niches. For example, the oxygen and carbon dioxide carrying capacity of vertebrate has evolved to provide strong advantages for species respiring at sea level, at high elevation or within water. Comparative- anatomy, -biochemistry, -pharmacology, -immunology and -cell biology have provided the fundamental paradigms from which each discipline has grown.

  19. A Model of the Statistical Power of Comparative Genome Sequence Analysis

    E-Print Network [OSTI]

    Eddy, Sean

    A Model of the Statistical Power of Comparative Genome Sequence Analysis Sean R. Eddy Howard Hughes, Missouri, United States of America Comparative genome sequence analysis is powerful, but sequencing genomes is expensive. It is desirable to be able to predict how many genomes are needed for comparative genomics

  20. Comparative Analysis of Three Proposed Federal Renewable Electricity Standards

    SciTech Connect (OSTI)

    Sullivan, P.; Logan, J.; Bird, L.; Short, W.

    2009-05-01T23:59:59.000Z

    This paper analyzes potential impacts of proposed national renewable electricity standard (RES) legislation. An RES is a mandate requiring certain electricity retailers to provide a minimum share of their electricity sales from qualifying renewable power generation. The analysis focuses on draft bills introduced individually by Senator Jeff Bingaman and Representative Edward Markey, and jointly by Representative Henry Waxman and Markey. The analysis uses NREL's Regional Energy Deployment System (ReEDS) model to evaluate the impacts of the proposed RES requirements on the U.S. energy sector in four scenarios.

  1. Comparative promoter region analysis powered by CORG. Christoph Dieterich1

    E-Print Network [OSTI]

    Stadler, Peter F.

    are key players in gene regulation. They receive signals from various sources (e.g. cell surface receptors have included 5 species in our analysis pipeline (man, mouse, rat, fugu and zebrafish). We. Conclusions: The CORG platform is a versatile tool to support analyses of gene regulation in vertebrate

  2. Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU

    E-Print Network [OSTI]

    Ussery, David W.

    Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU Minimal genomes in bacterial Genera Dave Ussery European Conference on Synthetic Biology: Design 2007 #12;Comparative Microbial Genomics group Centerfor

  3. Scattering of particles by radiation fields: a comparative analysis

    E-Print Network [OSTI]

    Donato Bini; Andrea Geralico; Maria Haney; Robert T. Jantzen

    2014-08-22T23:59:59.000Z

    The features of the scattering of massive neutral particles propagating in the field of a gravitational plane wave are compared with those characterizing their interaction with an electromagnetic radiation field. The motion is geodesic in the former case, whereas in the case of an electromagnetic pulse it is accelerated by the radiation field filling the associated spacetime region. The interaction with the radiation field is modeled by a force term entering the equations of motion proportional to the 4-momentum density of radiation observed in the particle's rest frame. The corresponding classical scattering cross sections are evaluated too.

  4. Comparative sequence analysis for Brassica oleracea with similar sequences in B. rapa and Arabidopsis thaliana

    E-Print Network [OSTI]

    Qiu, Dan; Gao, Muqiang; Li, Genyi; Quiros, Carlos

    2009-01-01T23:59:59.000Z

    AND GENOMICS Comparative sequence analysis for Brassicaoleracea with similar sequences in B. rapa and Arabidopsisanalyzed them with similar sequences in A. thaliana and B.

  5. A comparative financial analysis of the automobile and public transportation in London

    E-Print Network [OSTI]

    Kothari, Tejus Jitendra

    2007-01-01T23:59:59.000Z

    Automobile systems and public transportation are often organized separately within government structure inhibiting a comparative analysis between the two modes. Further complicating the comparison is that in public ...

  6. Assigning protein functions by comparative genome analysis protein phylogenetic profiles

    DOE Patents [OSTI]

    Pellegrini, Matteo; Marcotte, Edward M.; Thompson, Michael J.; Eisenberg, David; Grothe, Robert; Yeates, Todd O.

    2003-05-13T23:59:59.000Z

    A computational method system, and computer program are provided for inferring functional links from genome sequences. One method is based on the observation that some pairs of proteins A' and B' have homologs in another organism fused into a single protein chain AB. A trans-genome comparison of sequences can reveal these AB sequences, which are Rosetta Stone sequences because they decipher an interaction between A' and B. Another method compares the genomic sequence of two or more organisms to create a phylogenetic profile for each protein indicating its presence or absence across all the genomes. The profile provides information regarding functional links between different families of proteins. In yet another method a combination of the above two methods is used to predict functional links.

  7. A comparative analysis of empirical calibrators for nebular metallicity

    E-Print Network [OSTI]

    Enrique Perez-Montero; Angeles I. Diaz

    2005-06-15T23:59:59.000Z

    We present a new analysis of the main empirical calibrators of oxygen abundance for ionised gas nebulae. With that aim we have compiled an extensive sample of objects with emission line data including the near IR [SIII] lines and the weak auroral lines which allow for the determination of the gas electron temperature. For all the objects the oxygen abundances have been derived in a homogeneus way, using the most recent sets of atomic coefficients and taking into the account the effect of particle density on the temperature of O$^+$. The residuals between directly and empirically-derived abundances as a function of abundance have been studied. A grid of photo-ionisation models, covering the range of physical properties of the gas, has been used to explain the origin of the uncertainties affecting each abundance calibrator. The range of validity for each abundance parameter has been identified and its average uncertainty has been quantified.

  8. A comparative critical analysis of modern task-parallel runtimes.

    SciTech Connect (OSTI)

    Wheeler, Kyle Bruce; Stark, Dylan; Murphy, Richard C. [Micron Technology, Inc., Boise, ID

    2012-12-01T23:59:59.000Z

    The rise in node-level parallelism has increased interest in task-based parallel runtimes for a wide array of application areas. Applications have a wide variety of task spawning patterns which frequently change during the course of application execution, based on the algorithm or solver kernel in use. Task scheduling and load balance regimes, however, are often highly optimized for specific patterns. This paper uses four basic task spawning patterns to quantify the impact of specific scheduling policy decisions on execution time. We compare the behavior of six publicly available tasking runtimes: Intel Cilk, Intel Threading Building Blocks (TBB), Intel OpenMP, GCC OpenMP, Qthreads, and High Performance ParalleX (HPX). With the exception of Qthreads, the runtimes prove to have schedulers that are highly sensitive to application structure. No runtime is able to provide the best performance in all cases, and those that do provide the best performance in some cases, unfortunately, provide extremely poor performance when application structure does not match the scheduler's assumptions.

  9. Comparative Analysis of Carbon Plasma in Arc and RF Reactors

    SciTech Connect (OSTI)

    Todorovic-Markovic, B.; Markovic, Z. ['Vinca' Institute of Nuclear Sciences, P.O.B. 522, 11001 Belgrade (Serbia and Montenegro); Mohai, I.; Szepvolgyi, J. [Research Laboratory of Materials and Environmental Chemistry, Chemical Research Center, Hungarian Academy of Sciences H-1525 Budapest, POB 17 (Hungary)

    2004-12-01T23:59:59.000Z

    Results on studies of molecular spectra emitted in the initial stages of fullerene formation during the processing of graphite powder in induction RF reactor and evaporation of graphite electrodes in arc reactor are presented in this paper. It was found that C2 radicals were dominant molecular species in both plasmas. C2 radicals have an important role in the process of fullerene synthesis. The rotational-vibrational temperatures of C2 and CN species were calculated by fitting the experimental spectra to the simulated ones. The results of optical emission study of C2 radicals generated in carbon arc plasma have shown that rotational temperature of C2 species depends on carbon concentration and current intensity significantly. The optical emission study of induction RF plasma and SEM analysis of graphite powder before and after plasma treatment have shown that evaporation of the processed graphite powder depends on feed rate and composition of gas phase significantly. Based on the obtained results, it was concluded that in the plasma region CN radicals could be formed by the reaction of C2 species with atomic nitrogen at smaller loads. At larger feed rate of graphite powder, CN species were produced by surface reaction of the hot carbon particles with nitrogen atoms. The presence of nitrogen in induction RF plasma reduces the fullerene yield significantly. The fullerene yield obtained in two different reactors was: 13% in arc reactor and 4.1% in induction RF reactor. However, the fullerene production rate was higher in induction RF reactor-6.4 g/h versus 1.7 g/h in arc reactor.

  10. Olive Tree-Ring Problematic Dating: A Comparative Analysis on Santorini (Greece)

    E-Print Network [OSTI]

    Olive Tree-Ring Problematic Dating: A Comparative Analysis on Santorini (Greece) Paolo Cherubini1-rings identification. Dendrochronological analyses of olive trees growing on the Aegean island Santorini (Greece) show: A Comparative Analysis on Santorini (Greece). PLoS ONE 8(1): e54730. doi:10.1371/journal.pone.0054730 Editor

  11. A model of the statistical power of comparative genome sequence analysis

    E-Print Network [OSTI]

    Eddy, Sean

    A model of the statistical power of comparative genome sequence analysis Sean R. Eddy Howard Hughes genome sequence analysis is powerful, but sequencing genomes is expensive. It is desirable to be able to predict how many genomes are needed to achieve a particular statistical power in comparative analyses

  12. A Comparative Look at MBU Hazard Analysis Brandon D. Owens and Nancy G. Leveson

    E-Print Network [OSTI]

    Leveson, Nancy

    of the problems inherent in the quantitative analysis of expected incident/accident frequency will be exploredA Comparative Look at MBU Hazard Analysis Techniques Brandon D. Owens and Nancy G. Leveson Complex analysis techniques for hazards in highly complex and unique systems such as spacecraft. As a result

  13. Comparative analysis of Erk phosphorylation suggests a mixed strategy for measuring phospho-form

    E-Print Network [OSTI]

    Gunawardena, Jeremy

    Comparative analysis of Erk phosphorylation suggests a mixed strategy for measuring phospho of the well- studied mitogen-activated protein kinase Erk2, with two phosphorylation sites. The MS methods

  14. Comparative Analysis of CFD ?P vs. Measured ?P for Compressed Flexible Ducts

    E-Print Network [OSTI]

    Ugursal, A.; Culp, C.H.

    Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Comparative Analysis of CFD [Delta]P vs. Measured [Delta]P for Compressed Flexible Ducts Ugursal, Ahmet;Culp, Charles ASHRAE Transactions; 2007...

  15. Identification of community power structure using the reputational approach: a comparative analysis of two Texas communities.

    E-Print Network [OSTI]

    Spiekerman, Ruth Danette Hill

    1968-01-01T23:59:59.000Z

    IDENTIFICATION OF COMMUNITY POWER STRUCTURE USING THE REPUTATIONAL APPROACH: A COMPARATIVE ANALYSIS OF TWO TEXAS COMMUNITIES A Thesis RUTH DANETTE HILL SPIEKERMAN Submitted to the Graduate College of Texas A&M University in partial... fulfillment of the requirements for the degree of MASTER OF SCIENCE August 1968 Major Subject: Sociology IDENTIFICATION OF COMMUNITY POWER STRUCTURE USING THE REPUTATIONAL APPROACH: A COMPARATIVE ANALYSIS OF TWO TEXAS COMMUNITIES A Thesis by RUTH...

  16. Comparative analysis of methods for determination of arsenic in coal and coal ash

    SciTech Connect (OSTI)

    Vukasinovic-Pesic, V.L.; Blagojevic, N.Z.; Rajakovic, L.V. [University of Montenegro, Podgorica (Montenegro)

    2009-07-01T23:59:59.000Z

    In this paper the comparative analysis of different methods for the preparation and analysis of arsenic content in coal and coal ash have been presented. The suggested method is coal digestion method, i.e., coal ash digestion using the mixture of acids: nitric and sulphuric in presence of vanadium-pentoxide as catalyzer. The comparative analysis of different recording techniques (AAS-GH, AAS-GF and ICP-AES) has also been presented. For arsenic recording the suggested technique is AAS-GF technique. The obtained results show that the method of high precision, high sensitivity and high reproductivity has been obtained.

  17. MULTIRRESOLUTION SURVEYING OF COMPLEX FAADES: A COMPARATIVE ANALYSIS BETWEEN DIGITAL PHOTOGRAMMETRY AND 3D LASER SCANNING

    E-Print Network [OSTI]

    Llanos, Diego R.

    similar buildings presenting a similar high complexity for ornamental details. 1. INTRODUCTIONMULTIRRESOLUTION SURVEYING OF COMPLEX FAÇADES: A COMPARATIVE ANALYSIS BETWEEN DIGITAL@usuarios.retecal.es, jmr@ega.uva.es b MoBiVA-DAVAP Group, Lab. 2.2, R+D Building, M.Delibes Campus, 47011 Valladolid, Spain

  18. Microfluidic single cell real-time PCR for comparative analysis of gene expression patterns

    E-Print Network [OSTI]

    Quake, Stephen R.

    Microfluidic single cell real-time PCR for comparative analysis of gene expression patterns collection. We present here a high-content microfluidic real-time platform as a powerful tool expression; dynamic assay; microfluidic; pluripotent INTRODUCTION Novel genomic technologies have paved

  19. Threat to the point: improving the value of comparative extinction risk analysis for conservation action

    E-Print Network [OSTI]

    Davidson, Ana

    Threat to the point: improving the value of comparative extinction risk analysis for conservation of such analyses for conservation practice has been questioned. One reason for underperformance may be that threats this problem by (i) reviewing the use of threats in this field and (ii) quanti- tatively investigating

  20. Comparative Analysis of Balanced Winnow and SVM in Large Scale Patent Categorization

    E-Print Network [OSTI]

    Steels, Luc

    Comparative Analysis of Balanced Winnow and SVM in Large Scale Patent Categorization Katrien Beuls techniques, a collection of 1.2 million patent applications is used to build a classifier that is able). Contrary to SVM, Balanced Winnow is frequently applied in today's patent categorization systems. Results

  1. Crossing innovation & product projects management: A comparative analysis in automotive industry

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Crossing innovation & product projects management: A comparative analysis in automotive industry in automotive industry INTRODUCTION Projectification and platform approaches have been two main transformation in the automotive industry. This sector provides an interesting empirical opportunity to study this question, since

  2. Comparative analysis of Fuzzy ART and ART-2A network clustering performance

    E-Print Network [OSTI]

    Kuhlen, Torsten

    are used as an example of high- dimensional input patterns, modelling ART properties by clusteringComparative analysis of Fuzzy ART and ART-2A network clustering performance Thomas Frank, Karl networks, capable of clustering arbitrary sequences of input patterns into stable recogni- tion codes. Many

  3. Predicting household occupancy for smart heating control: A comparative performance analysis of

    E-Print Network [OSTI]

    , energy management, smart home, energy efficiency, thermostat strategy, heating setback Corresponding, a heating control system may require some time to heat a home to a comfortable temperature after itsPredicting household occupancy for smart heating control: A comparative performance analysis

  4. Predicting household occupancy for smart heating control: A comparative performance analysis of

    E-Print Network [OSTI]

    , occupancy prediction, smart heating, energy management, smart home, energy efficiency Corresponding author.e. the household having too low a temperature when the residents come back home ­ triggering the heatingPredicting household occupancy for smart heating control: A comparative performance analysis

  5. An Automated Comparative Analysis of Seventeen Complete Microbial Arvind K. Bansal

    E-Print Network [OSTI]

    Bansal, Arvind K.

    #12;36 An Automated Comparative Analysis of Seventeen Complete Microbial Genomes Arvind K. Bansal Department of Mathematics and Computer Science, Kent State University, Kent, Ohio, USA As sequenced genomes become larger and sequencing becomes faster, there is a need to develop accurate automated genome

  6. Structural Design Optimization and Comparative Analysis of a New HighPerformance Robot Arm via Finite Element Analysis

    E-Print Network [OSTI]

    Whitcomb, Louis L.

    Structural Design Optimization and Comparative Analysis of a New High­Performance Robot Arm via, 1997 Abstract This paper reports the structural design of a new high­performance robot arm. Design Introduction Our goal is to design and build a robot arm for high performance tracking and force control

  7. COMPARATIVE ANALYSIS OF SELECTED EDDY CURRENT TRANSDUCERS FOR TITANIUM ALLOY EVALUATION

    SciTech Connect (OSTI)

    Chady, T.; Sikora, R.; Baniukiewicz, P.; Lopato, P.; Kowalczyk, J.; Psuj, G.; Caryk, M. [West Pomeranian University of Technology, Piastow 17, 70-310 Szczecin (Poland)

    2010-02-22T23:59:59.000Z

    Titanium alloy based details due to their mechanical properties continue to be in extensive use in various structures (mainly aerospace, automotive and petro-chemical industrial applications). In this paper comparative study of various types of eddy current NDT transducers for testing titanium elements was done. Probes of absolute, differential and array configurations were constructed and analyzed. Two and three dimensional numerical analysis (FEM) were done in order to find the best type and configuration of the proposed transducers.

  8. Methods for preparing comparative standards and field samples for neutron activation analysis of soil

    SciTech Connect (OSTI)

    Glasgow, D.C.; Dyer, F.F.; Robinson, L.

    1994-06-01T23:59:59.000Z

    One of the more difficult problems associated with comparative neutron activation analysis (CNAA) is the preparation of standards which are tailor-made to the desired irradiation and counting conditions. Frequently, there simply is not a suitable standard available commercially, or the resulting gamma spectrum is convoluted with interferences. In a recent soil analysis project, the need arose for standards which contained about 35 elements. In response, a computer spreadsheet was developed to calculate the appropriate amount of each element so that the resulting gamma spectrum is relatively free of interferences. Incorporated in the program are options for calculating all of the irradiation and counting parameters including activity produced, necessary flux/bombardment time, counting time, and appropriate source-to-detector distance. The result is multi-element standards for CNAA which have optimal concentrations. The program retains ease of use without sacrificing capability. In addition to optimized standard production, a novel soil homogenization technique was developed which is a low cost, highly efficient alternative to commercially available homogenization systems. Comparative neutron activation analysis for large scale projects has been made easier through these advancements. This paper contains details of the design and function of the NAA spreadsheet and innovative sample handling techniques.

  9. Comparative Analysis of the Effect of Different Alkaline Catalysts on Biodiesel Yield

    E-Print Network [OSTI]

    Cynthia Ofori-boateng; Ebenezer M. Kwofie; Moses Y. Mensah

    Abstract: A major challenge in the biodiesel industry is the comparatively high cost of raw materials for production. A cost build-up analysis of biodiesel production from J. curcas oil shows that catalyst alone contributes about 50.9 % of the total production cost. This paper aims at highlighting the effects of two different commonly used catalysts on the yield of biodiesel. Samples of biodiesel were produced by three different methods namely single stage transesterification (SST), double stage transesterification (DST) and foolproof (FP) processes in which sodium hydroxide (NaOH) and potassium hydroxide (KOH) were used. The effects of each catalyst on the production yield were analyzed and compared. NaOH gave production yields of 79%, 81% and 84 % for the SST, DST and FP processes respectively. KOH produced comparatively lower yields of 68%, 71 % and 75 % for SST, DST and fool proof processes respectively. Although the use of KOH slightly raises the cost of biodiesel production as compared to NaOH, the local production of KOH from cocoa husks could minimize the production cost. Abbreviations: BDF = Biodiesel fuel; PDF = Petroleum diesel fuel; DF = Diesel fuel Key words: Transesterification Alkaline catalysts Biodiesel yield Biodiesel KOH NaOH

  10. The Integrated Microbial Genomes (IMG) System: An Expanding Comparative Analysis Resource

    SciTech Connect (OSTI)

    Markowitz, Victor M.; Chen, I-Min A.; Palaniappan, Krishna; Chu, Ken; Szeto, Ernest; Grechkin, Yuri; Ratner, Anna; Anderson, Iain; Lykidis, Athanasios; Mavromatis, Konstantinos; Ivanova, Natalia N.; Kyrpides, Nikos C.

    2009-09-13T23:59:59.000Z

    The integrated microbial genomes (IMG) system serves as a community resource for comparative analysis of publicly available genomes in a comprehensive integrated context. IMG contains both draft and complete microbial genomes integrated with other publicly available genomes from all three domains of life, together with a large number of plasmids and viruses. IMG provides tools and viewers for analyzing and reviewing the annotations of genes and genomes in a comparative context. Since its first release in 2005, IMG's data content and analytical capabilities have been constantly expanded through regular releases. Several companion IMG systems have been set up in order to serve domain specific needs, such as expert review of genome annotations. IMG is available at .

  11. A comparative analysis of binding in ultralong-range Rydberg molecules

    E-Print Network [OSTI]

    Fey, Christian; Schmelcher, Peter; Rittenhouse, Seth T; Sadeghpour, Hossein R

    2015-01-01T23:59:59.000Z

    We perform a comparative analysis of different computational approaches employed to explore the electronic structure of ultralong-range Rydberg molecules. Employing the Fermi pseudopotential approach, where the interaction is approximated by an $s$-wave bare delta function potential, one encounters a non-convergent behavior in basis set diagonalization. Nevertheless, the energy shifts within the first order perturbation theory coincide with those obtained by an alternative approach relying on Green's function calculation with the quantum defect theory. A pseudopotential that yields exactly the results obtained with the quantum defect theory, i.e. beyond first order perturbation theory, is the regularized delta function potential. The origin of the discrepancies between the different approaches is analytically motivated.

  12. Comparative analysis of the life cycle impact assessment of available cement inventories in the EU

    SciTech Connect (OSTI)

    Josa, Alejandro [Technical University of Catalonia (UPC), School of Civil Engineering (ETSECCPB), C/Jordi Girona 1-3 Modul D2/C1, Barcelona 08034 (Spain)]. E-mail: alejandro.josa@upc.edu; Aguado, Antonio [Technical University of Catalonia (UPC), School of Civil Engineering (ETSECCPB), C/Jordi Girona 1-3 Modul D2/C1, Barcelona 08034 (Spain); Cardim, Arnaldo [Civil Engineering Department, Polytechnic School of Penambuco University, Rua Benfica, 455-Madalena, CEP 50.750-410 (Brazil); Byars, Ewan [Centre for Cement and Concrete, Department of Civil and Structural Engineering, University of Sheffield, Sir Frederick Mappin Building, Mappin Street, Sheffield S1 3JD (United Kingdom)

    2007-05-15T23:59:59.000Z

    Life cycle impact assessment (LCIA) is one of basic steps in life cycle assessment methodology (LCA). This paper presents a comparative study of the LCIA of different life cycle inventories (LCI) for EU cements. The analysis unit used is the manufacture of 1 kg of cement, from 'cradle to gate'. The impact categories considered are those resulting from the manufacture of cement and include greenhouse effects, acidification, eutrophication and summer and winter smog, amongst others. The results of the study highlighted some inconsistencies in existing inventories. As for the LCIA, the main environmental interventions related to cement manufacture were classified and characterised and their effect on different impact categories analysed. Differences observed in evaluation of the impact of cement type were essentially related to their clinker content.

  13. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    terns on safety and accident analysis since t h i s i s theACCIDENT ANALYSIS ACCIDENT, TRANSPORTATION SAFETY ANALYSISInformation Center Data Base RISK HAZARDS ANALYSIS ACCIDENT

  14. A comparative analysis of the cryo-compression and cryo-adsorption hydrogen storage methods

    SciTech Connect (OSTI)

    Petitpas, G [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benard, P [Universite du Quebec a Trois-Rivieres (Canada); Klebanoff, L E [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Xiao, J [Universite du Quebec a Trois-Rivieres (Canada); Aceves, S M [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2014-07-01T23:59:59.000Z

    While conventional low-pressure LH? dewars have existed for decades, advanced methods of cryogenic hydrogen storage have recently been developed. These advanced methods are cryo-compression and cryo-adsorption hydrogen storage, which operate best in the temperature range 30–100 K. We present a comparative analysis of both approaches for cryogenic hydrogen storage, examining how pressure and/or sorbent materials are used to effectively increase onboard H? density and dormancy. We start by reviewing some basic aspects of LH? properties and conventional means of storing it. From there we describe the cryo-compression and cryo-adsorption hydrogen storage methods, and then explore the relationship between them, clarifying the materials science and physics of the two approaches in trying to solve the same hydrogen storage task (~5–8 kg H?, typical of light duty vehicles). Assuming that the balance of plant and the available volume for the storage system in the vehicle are identical for both approaches, the comparison focuses on how the respective storage capacities, vessel weight and dormancy vary as a function of temperature, pressure and type of cryo-adsorption material (especially, powder MOF-5 and MIL-101). By performing a comparative analysis, we clarify the science of each approach individually, identify the regimes where the attributes of each can be maximized, elucidate the properties of these systems during refueling, and probe the possible benefits of a combined “hybrid” system with both cryo-adsorption and cryo-compression phenomena operating at the same time. In addition the relationships found between onboard H? capacity, pressure vessel and/or sorbent mass and dormancy as a function of rated pressure, type of sorbent material and fueling conditions are useful as general designing guidelines in future engineering efforts using these two hydrogen storage approaches.

  15. Comparative Fellowships

    E-Print Network [OSTI]

    Watkins, Joseph C.

    Comparative Genomics IGERT Graduate Fellowships & Training Integrative Graduate Education for genomics, including genotyping, sequencing, microarray research, and computers for biocomputing needs. · Genomic Analysis and Technology Core · Biotechnology Computing Facility · Protemics Analysis Lab · Bio5

  16. Comparative analysis of nonlinear dimensionality reduction techniques for breast MRI segmentation

    SciTech Connect (OSTI)

    Akhbardeh, Alireza; Jacobs, Michael A. [Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 (United States); Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 (United States) and Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 (United States)

    2012-04-15T23:59:59.000Z

    Purpose: Visualization of anatomical structures using radiological imaging methods is an important tool in medicine to differentiate normal from pathological tissue and can generate large amounts of data for a radiologist to read. Integrating these large data sets is difficult and time-consuming. A new approach uses both supervised and unsupervised advanced machine learning techniques to visualize and segment radiological data. This study describes the application of a novel hybrid scheme, based on combining wavelet transform and nonlinear dimensionality reduction (NLDR) methods, to breast magnetic resonance imaging (MRI) data using three well-established NLDR techniques, namely, ISOMAP, local linear embedding (LLE), and diffusion maps (DfM), to perform a comparative performance analysis. Methods: Twenty-five breast lesion subjects were scanned using a 3T scanner. MRI sequences used were T1-weighted, T2-weighted, diffusion-weighted imaging (DWI), and dynamic contrast-enhanced (DCE) imaging. The hybrid scheme consisted of two steps: preprocessing and postprocessing of the data. The preprocessing step was applied for B{sub 1} inhomogeneity correction, image registration, and wavelet-based image compression to match and denoise the data. In the postprocessing step, MRI parameters were considered data dimensions and the NLDR-based hybrid approach was applied to integrate the MRI parameters into a single image, termed the embedded image. This was achieved by mapping all pixel intensities from the higher dimension to a lower dimensional (embedded) space. For validation, the authors compared the hybrid NLDR with linear methods of principal component analysis (PCA) and multidimensional scaling (MDS) using synthetic data. For the clinical application, the authors used breast MRI data, comparison was performed using the postcontrast DCE MRI image and evaluating the congruence of the segmented lesions. Results: The NLDR-based hybrid approach was able to define and segment both synthetic and clinical data. In the synthetic data, the authors demonstrated the performance of the NLDR method compared with conventional linear DR methods. The NLDR approach enabled successful segmentation of the structures, whereas, in most cases, PCA and MDS failed. The NLDR approach was able to segment different breast tissue types with a high accuracy and the embedded image of the breast MRI data demonstrated fuzzy boundaries between the different types of breast tissue, i.e., fatty, glandular, and tissue with lesions (>86%). Conclusions: The proposed hybrid NLDR methods were able to segment clinical breast data with a high accuracy and construct an embedded image that visualized the contribution of different radiological parameters.

  17. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    SciTech Connect (OSTI)

    Zheng, Nina; Zhou, Nan; Fridley, David

    2010-09-01T23:59:59.000Z

    The past decade has seen the development of various scenarios describing long-term patterns of future Greenhouse Gas (GHG) emissions, with each new approach adding insights to our understanding of the changing dynamics of energy consumption and aggregate future energy trends. With the recent growing focus on China's energy use and emission mitigation potential, a range of Chinese outlook models have been developed across different institutions including in China's Energy Research Institute's 2050 China Energy and CO2 Emissions Report, McKinsey & Co's China's Green Revolution report, the UK Sussex Energy Group and Tyndall Centre's China's Energy Transition report, and the China-specific section of the IEA World Energy Outlook 2009. At the same time, the China Energy Group at Lawrence Berkeley National Laboratory (LBNL) has developed a bottom-up, end-use energy model for China with scenario analysis of energy and emission pathways out to 2050. A robust and credible energy and emission model will play a key role in informing policymakers by assessing efficiency policy impacts and understanding the dynamics of future energy consumption and energy saving and emission reduction potential. This is especially true for developing countries such as China, where uncertainties are greater while the economy continues to undergo rapid growth and industrialization. A slightly different assumption or storyline could result in significant discrepancies among different model results. Therefore, it is necessary to understand the key models in terms of their scope, methodologies, key driver assumptions and the associated findings. A comparative analysis of LBNL's energy end-use model scenarios with the five above studies was thus conducted to examine similarities and divergences in methodologies, scenario storylines, macroeconomic drivers and assumptions as well as aggregate energy and emission scenario results. Besides directly tracing different energy and CO{sub 2} savings potential back to the underlying strategies and combination of efficiency and abatement policy instruments represented by each scenario, this analysis also had other important but often overlooked findings.

  18. Scalability of Comparative Analysis, Novel Algorithms and Tools (MICW - Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    ScienceCinema (OSTI)

    Mavrommatis, Kostas [JGI

    2013-01-22T23:59:59.000Z

    DOE JGI's Kostas Mavrommatis, chair of the Scalability of Comparative Analysis, Novel Algorithms and Tools panel, at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  19. Scalability of Comparative Analysis, Novel Algorithms and Tools (MICW - Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    SciTech Connect (OSTI)

    Mavrommatis, Kostas [JGI] [JGI

    2011-10-12T23:59:59.000Z

    DOE JGI's Kostas Mavrommatis, chair of the Scalability of Comparative Analysis, Novel Algorithms and Tools panel, at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  20. The agglomerative role of transportation investment : a comparative analysis of Portuguese and American high-speed rail proposals

    E-Print Network [OSTI]

    Westrom, Ryan J. (Ryan Jeremy)

    2014-01-01T23:59:59.000Z

    This research uses a comparative analysis of High-Speed Rail (HSR) impacts from proposals in both Portugal and Illinois to understand the wider economic implications of these proposed transportation links and corollary ...

  1. Contributions to a revision of the Compsoneura capitellata species group (Myristicaceae) through comparative analysis of androecium morphology

    E-Print Network [OSTI]

    Mistry, Manoj Girish

    2002-01-01T23:59:59.000Z

    &M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE August 2002 Major Subject: Biology CONTRIBUTIONS TO A REVISION OF THE COMPS01VEURA CAP1TELLATA SPECIES GROUP (MYRISTICACEAE) THROUGH COMPARATIVE ANALYSIS... (Member) Edward Mc illiams (Member) Terry Thomas (Head of Department) August 2002 Major Subject: Biology ABSTRACT Contributions to a Revision of the Compsoneura capitellata Species Group (Myristicaceae) Through Comparative Analysis of Androecium...

  2. A comparative study of extraction methods for analysis of chloride in plant tissue by means of the Cotlove chloridometer

    E-Print Network [OSTI]

    Norris, Richard Eugene

    1976-01-01T23:59:59.000Z

    A COMPARATIVE STUDY OF EXTRACTION METHODS FOR ANALYSIS OF CHLORIDE IN PLANT TISSUE BY MEANS OF THE COTLOVE CHLORIDOMETER A Thesis by RICHARD EUGENE NORRIS Submitted to the Graduate College of Texas A&M University in partial fulfillment... of the requirement for the degree of MASTER OF SCIENCE December 1976 Major Subject: Horticulture A COMPARATIVE STUDY OF EXTRACTION METHODS FOR ANALYSIS OF CHLORIDE IN PLANT TISSUE BY MEANS OF THE COTLOVE CHLORIDOMETER A Thesis by RICHARD EUGENE NORP...

  3. Proceedings of the 1997 IEEE International Conference on Robotics and Automation Structural Design Optimization and Comparative Analysis of a New

    E-Print Network [OSTI]

    Whitcomb, Louis L.

    Optimization and Comparative Analysis of a New High­Performance Robot Arm via Finite Element Analysis Jaydeep Abstract This paper reports the structural design of a new high­ performance robot arm. Design objectives a robot arm for high perfor­ mance tracking and force control applications. This paper reports a first

  4. Comparative analysis of LWR and FBR spent fuels for nuclear forensics evaluation

    SciTech Connect (OSTI)

    Permana, Sidik; Suzuki, Mitsutoshi; Su'ud, Zaki [Department of Science and Technology for Nuclear Material Management (STNM), Japan Atomic Energy Agency (JAEA), 2-4 Shirane, Shirakata, Tokai Mura, Naka-gun, Ibaraki 319-1195 Nuclear Physics and Bio (Indonesia); Department of Science and Technology for Nuclear Material Management (STNM), Japan Atomic Energy Agency (JAEA), 2-4 Shirane, Shirakata, Tokai Mura, Naka-gun, Ibaraki 319-1195 (Japan); Nuclear Physics and Bio Physics Research Group, Department of Physics, Bandung Institute of Technology, Gedung Fisika, Jl. Ganesha 10, Bandung 40132 (Indonesia)

    2012-06-06T23:59:59.000Z

    Some interesting issues are attributed to nuclide compositions of spent fuels from thermal reactors as well as fast reactors such as a potential to reuse as recycled fuel, and a possible capability to be manage as a fuel for destructive devices. In addition, analysis on nuclear forensics which is related to spent fuel compositions becomes one of the interesting topics to evaluate the origin and the composition of spent fuels from the spent fuel foot-prints. Spent fuel compositions of different fuel types give some typical spent fuel foot prints and can be estimated the origin of source of those spent fuel compositions. Some technics or methods have been developing based on some science and technological capability including experimental and modeling or theoretical aspects of analyses. Some foot-print of nuclear forensics will identify the typical information of spent fuel compositions such as enrichment information, burnup or irradiation time, reactor types as well as the cooling time which is related to the age of spent fuels. This paper intends to evaluate the typical spent fuel compositions of light water (LWR) and fast breeder reactors (FBR) from the view point of some foot prints of nuclear forensics. An established depletion code of ORIGEN is adopted to analyze LWR spent fuel (SF) for several burnup constants and decay times. For analyzing some spent fuel compositions of FBR, some coupling codes such as SLAROM code, JOINT and CITATION codes including JFS-3-J-3.2R as nuclear data library have been adopted. Enriched U-235 fuel composition of oxide type is used for fresh fuel of LWR and a mixed oxide fuel (MOX) for FBR fresh fuel. Those MOX fuels of FBR come from the spent fuels of LWR. Some typical spent fuels from both LWR and FBR will be compared to distinguish some typical foot-prints of SF based on nuclear forensic analysis.

  5. Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU

    E-Print Network [OSTI]

    Ussery, David W.

    Comparative Microbial Genomics group Centerfor systematics - is it relevant to modern science? Istanbul, Turkey 8 August, 2008 - or - What can genomics tell us about Vibrio species? Discovering natural groups in Vibrio #12;Comparative Microbial Genomics

  6. Characterization of the mouse pancreatic islet proteome and comparative analysis with other mouse tissues

    SciTech Connect (OSTI)

    Petyuk, Vladislav A.; Qian, Weijun; Hinault, Charlotte; Gritsenko, Marina A.; Singhal, Mudita; Monroe, Matthew E.; Camp, David G.; Kulkarni, Rohit N.; Smith, Richard D.

    2008-08-01T23:59:59.000Z

    The pancreatic islets of Langerhans and insulin-producing beta cells in particular play a central role in the maintenance of glucose homeostasis and the islet dysfunction is associated with the pathogenesis of both type 1 and type 2 diabetes mellitus. To contribute to the understanding of the biology of the pancreatic islets we applied proteomic techniques based on liquid chromatography coupled with mass spectrometry. Here as an initial step we present the first comprehensive proteomic characterization of pancreas islets of the mouse, the commonly used animal model for diabetes research. Two-dimensional SCX LC/RP LC-MS/MS has been applied to characterize of the mouse islet proteome, resulting in the confident identification of 17,350 different tryptic peptides covering 2,612 proteins with at least two unique peptide identifications per protein. The dataset also allowed identification of a number of post-translational modifications including several modifications relevant to oxidative stress and phosphorylation. While many of the identified phosphorylation sites corroborates with previous known sites, the oxidative modifications observed on cysteinyl residues potentially reveal novel information related to the role of oxidation stress in islet functions. Comparative analysis of the islet proteome database with 15 available proteomic datasets from other mouse tissues and cells revealed a set of 68 proteins uniquely detected only in the pancreatic islets. Besides proteins with known functions, like islet secreted peptide hormones, this unique set contains a number of proteins with yet unknown functions. The resulting peptide and protein database will be available at ncrr.pnl.gov web site of the NCRR proteomic center (ncrr.pnl.gov).

  7. Comparative analysis of hole transport in compressively strained InSb and Ge quantum well heterostructures

    SciTech Connect (OSTI)

    Agrawal, Ashish; Barth, Michael; Madan, Himanshu; Datta, Suman [Department of Electrical Engineering, The Pennsylvania State University, University Park, Pennsylvania 16802 (United States); Lee, Yi-Jing; Lin, You-Ru; Wu, Cheng-Hsien; Ko, Chih-Hsin; Wann, Clement H. [Taiwan Semiconductor Manufacturing Company, Hsinchu 30078, Taiwan (China); Loubychev, Dmitri; Liu, Amy; Fastenau, Joel [IQE, Inc., Bethlehem, Pennsylvania 18015 (United States); Lindemuth, Jeff [Lake Shore Cryotronics, Westerville, Ohio 43082 (United States)

    2014-08-04T23:59:59.000Z

    Compressively strained InSb (s-InSb) and Ge (s-Ge) quantum well heterostructures are experimentally studied, with emphasis on understanding and comparing hole transport in these two-dimensional confined heterostructures. Magnetotransport measurements and bandstructure calculations indicate 2.5× lower effective mass for s-InSb compared to s-Ge quantum well at 1.9?×?10{sup 12}?cm{sup –2}. Advantage of strain-induced m* reduction is negated by higher phonon scattering, degrading hole transport at room temperature in s-InSb quantum well compared to s-Ge heterostructure. Consequently, effective injection velocity is superior in s-Ge compared to s-InSb. These results suggest s-Ge quantum well heterostructure is more favorable and promising p-channel candidate compared to s-InSb for future technology node.

  8. A comparative analysis of numerical simulation and analytical modeling of horizontal well cyclic steam injection 

    E-Print Network [OSTI]

    Ravago Bastardo, Delmira Cristina

    2005-08-29T23:59:59.000Z

    The main objective of this research is to compare the performance of cyclic steam injection using horizontal wells based on the analytical model developed by Gunadi against that based on numerical simulation. For comparison, ...

  9. Magnetism and magnetocaloric effect in multicomponent Laves-phase compounds: Study and comparative analysis

    SciTech Connect (OSTI)

    ?wik, J., E-mail: cwikjac@ml.pan.wroc.pl

    2014-01-15T23:59:59.000Z

    This paper presents a review and results of comparative study of the influence of Gd on some physical properties of (R{sub 0.9}R?{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} solid solutions with R=Dy, Ho and R?=Er, Ho and x varied from 0.05 to 0.15. Powder X-ray diffraction analysis performed at room temperature revealed that all studied solid solutions solidify with the formation of a Laves-phase MgCu{sub 2}-type structure (space group Fd?3m). The magnetization behavior and the magnetic transition are analyzed in terms of the Landau theory. The studies of magnetic properties and heat capacity showed that a relatively small Gd addition significantly increases T{sub C} of the compounds. The maximum percentage increase in T{sub C}, namely, ?43% was observed for (Ho{sub 0.9}Er{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2}. However, the highest temperature was noted for the (Dy{sub 0.9}Ho{sub 0.1}){sub 0.85}Gd{sub 0.15}Co{sub 2} solid solution; it is T{sub C}=183.4 K. Below the ordering temperature, all samples are ferrimagnetically ordered; at high temperatures, they are Curie–Weiss paramagnets. Moreover, a small Gd addition eliminates the field-induced magnetic transition near T{sub C} and, as consequence, transforms the nature of magnetic transition from the first- to second-order. The magnetocaloric effect has been estimated in terms of both isothermal magnetic entropy and adiabatic temperature changes. The highest adiabatic temperature change ?T{sub ad}=3 K and highest isothermal entropy change ?S{sub mag}=12.1 J/kg K were observed for (Ho{sub 0.9}Er{sub 0.1}){sub 0.95}Gd{sub 0.05}Co{sub 2} at ?90 K in magnetic fields of 2 T and 3 T, respectively. A decrease in the entropy change has been observed with increasing Gd content in all studied samples. The smallest values of ?S{sub mag} were observed for the (Dy{sub 0.9}Ho{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} solid solutions. Under an external field change of from 0 to 3 T, the maximum entropy change for (Dy{sub 0.9}Ho{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} compounds decreases from 6.9 at x=0.05–4.3 J/kg K at x=0.15. The refrigerant capacity for all solid solutions (with 0.05?x?0.15) is reported. The effect of increasing Gd content in the solid solutions on their magnetic and magnetocaloric properties is discussed. - Graphical abstract: Temperature dependencies of ?T{sub ad} induced by µ{sub 0}H=1 and 2 T in (a) (Ho{sub 0.9}Er{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} and (b) (Dy{sub 0.9}Er{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} solid solutions. Display Omitted.

  10. Critical gradient for internal erosion in earthen d ams : a comparative analysis of two predictive methodologies

    E-Print Network [OSTI]

    Donohue, Catherine, M. Eng. Massachusetts Institute of Technology

    2013-01-01T23:59:59.000Z

    Minimizing the uncertainty in predicting the critical gradient of a dam (i.e. the critical reservoir pool level) is important during the risk analysis of dams. Uncertainty leads to inexact relative risk in portfolio ...

  11. Comparative analysis of surface power system architectures for human Mars exploration

    E-Print Network [OSTI]

    Cooper, Chase Allen

    2009-01-01T23:59:59.000Z

    This thesis provides a comprehensive analysis of surface power generation and energy storage architectures for human Mars surface missions, including tracking and non-tracking photovoltaic power generation, nuclear fission ...

  12. Comparative analysis of remaining oil saturation in waterflood patterns based on analytical modeling and simulation

    E-Print Network [OSTI]

    Azimov, Anar Etibar

    2006-08-16T23:59:59.000Z

    development. While special core analysis, log-inject-log, and thermal-decay time-log-evaluation techniques are available, they provide only single-point values and a snapshot in time near a wellbore. Also, they can quickly add up to an expensive program...

  13. Comparative Analysis of Control Techniques for Efficiency Improvement in Electric Vehicles

    E-Print Network [OSTI]

    energy efficient and less polluting drive-train alternative to conventional internal combustion engine, University of Biskra, Biskra, Algeria Abstract--This paper presents system analysis, modeling and simulation dynamics and system architecture. Simulation tests have been carried out on a 37-kW EV that consists

  14. Comparative analysis of 11 different radioisotopes for palliative treatment of bone metastases by computational methods

    SciTech Connect (OSTI)

    Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, João Manuel R. S., E-mail: tavares@fe.up.pt [Instituto de Engenharia Mecânica e Gestão Industrial, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto Frias s/n, Porto 4200-465 (Portugal)

    2014-11-01T23:59:59.000Z

    Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bone metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.

  15. A Comparative Analysis of the Perceptions of Special Education Teachers Regarding Educative Activities To Further Develop Teaching Skills

    E-Print Network [OSTI]

    Arocha-Gill, Theresa A.

    2010-07-14T23:59:59.000Z

    A COMPARATIVE ANALYSIS OF THE PERCEPTIONS OF SPECIAL EDUCATION TEACHERS REGARDING EDUCATIVE ACTIVITIES TO FURTHER DEVELOP TEACHING SKILLS A Dissertation by THERESA AROCHA-GILL Submitted to the Office of Graduate Studies of Texas A&M University... DEVELOP TEACHING SKILLS A Dissertation by THERESA AROCHA-GILL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Co-Chairs of Committee, Homer...

  16. Comparative Analysis of Cement and Lateralite on the Engineering Properties of Niger Delta Soils for Pavement Construction

    E-Print Network [OSTI]

    Alayaki, F. M.; Al-Tabbaa, A.; Meshida, E. A.; Ayotamuno, M. J.

    2015-05-13T23:59:59.000Z

    .BJAST.2015.254 ISSN: 2231-0843 SCIENCEDOMAIN international www.sciencedomain.org Comparative Analysis of Cement and Lateralite on the Engineering Properties of Niger Delta Soils for Pavement Construction F. M. Alayaki1*, A. Al... :1 and then stabilize with cement. However high strength reduction of about 40% was noted when the stabilized mixture was soaked in water even with as much as 10% cement, thus suggested the protection of the pavement from water ingress. [5] Noted...

  17. Comparative analysis of compact heat exchangers for application as the intermediate heat exchanger for advanced nuclear reactors

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bartel, N.; Chen, M.; Utgikar, V. P.; Sun, X.; Kim, I. H.; Christensen, R.; Sabharwall, P.

    2015-07-01T23:59:59.000Z

    A comparative evaluation of alternative compact heat exchanger designs for use as the intermediate heat exchanger in advanced nuclear reactor systems is presented in this article. Candidate heat exchangers investigated included the Printed circuit heat exchanger (PCHE) and offset strip-fin heat exchanger (OSFHE). Both these heat exchangers offer high surface area to volume ratio (a measure of compactness [m2/m3]), high thermal effectiveness, and overall low pressure drop. Helium–helium heat exchanger designs for different heat exchanger types were developed for a 600 MW thermal advanced nuclear reactor. The wavy channel PCHE with a 15° pitch angle was found to offer optimummore »combination of heat transfer coefficient, compactness and pressure drop as compared to other alternatives. The principles of the comparative analysis presented here will be useful for heat exchanger evaluations in other applications as well.« less

  18. Comparative analysis of continuous-wave surface-plasma negative ion sources with various discharge geometry

    SciTech Connect (OSTI)

    Belchenko, Yu, E-mail: belchenko@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)] [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation); Sanin, A.; Sotnikov, O. [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation) [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation); Novosibirsk State University, Novosibirsk, 630090 (Russian Federation)

    2014-02-15T23:59:59.000Z

    Negative ion extraction from continuous-wave (CW) magnetron and semiplanotron discharges was studied and it was compared with that for the source with Penning electrode geometry. The CW negative ion beam up current to 13 mA was extracted from the magnetron source with emission aperture of 3.5 mm in diameter, while the beam with current up to 8 mA was obtained from the semiplanotron source modification. Characteristics of CW magnetron and semiplanotron sources are presented and analyzed.

  19. Comparative quantification and statistical analysis of ?? and ? precipitates in aluminum alloy AA7075-T651 by TEM and AFM

    SciTech Connect (OSTI)

    Garcia-Garcia, Adrian Luis, E-mail: agarciag@ipn.mx; Dominguez-Lopez, Ivan, E-mail: idominguezl@ipn.mx; Lopez-Jimenez, Luis, E-mail: llopez1002@ipn.mx; Barceinas-Sanchez, J.D. Oscar, E-mail: obarceinas@ipn.mx

    2014-01-15T23:59:59.000Z

    Quantification of nanometric precipitates in metallic alloys has been traditionally performed using transmission electron microscopy, which is nominally a low throughput technique. This work presents a comparative study of quantification of ?? and ? precipitates in aluminum alloy AA7075-T651 using transmission electron microscopy (TEM) and non-contact atomic force microscopy (AFM). AFM quantification was compared with 2-D stereological results reported elsewhere. Also, a method was developed, using specialized software, to characterize nanometric size precipitates observed in dark-field TEM micrographs. Statistical analysis of the quantification results from both measurement techniques supports the use of AFM for precipitate characterization. Once the precipitate stoichiometry has been determined by appropriate analytical techniques like TEM, as it is the case for ?? and ? in AA7075-T651, the relative ease with which specimens are prepared for AFM analysis could be advantageous in product and process development, and quality control, where a large number of samples are expected for analysis on a regular basis. - Highlights: • Nanometric MgZn{sub 2} precipitates in AA7075-T651 were characterized using AFM and TEM. • Phase-contrast AFM was used to differentiate metal matrix from MgZn{sub 2} precipitates. • TEM and AFM micrographs were analyzed using commercially available software. • AFM image analysis and TEM 2-D stereology render statistically equivalent results.

  20. Comparative analysis of thorium and uranium fuel for transuranic recycle in a sodium cooled Fast Reactor

    SciTech Connect (OSTI)

    C. Fiorina; N. E. Stauff; F. Franceschini; M. T. Wenner; A. Stanculescu; T. K. Kim; A. Cammi; M. E. Ricotti; R. N. Hill; T. A. Taiwo; M. Salvatores

    2013-12-01T23:59:59.000Z

    The present paper compares the reactor physics and transmutation performance of sodium-cooled Fast Reactors (FRs) for TRansUranic (TRU) burning with thorium (Th) or uranium (U) as fertile materials. The 1000 MWt Toshiba-Westinghouse Advanced Recycling Reactor (ARR) conceptual core has been used as benchmark for the comparison. Both burner and breakeven configurations sustained or started with a TRU supply, and assuming full actinide homogeneous recycle strategy, have been developed. State-of-the-art core physics tools have been employed to establish fuel inventory and reactor physics performances for equilibrium and transition cycles. Results show that Th fosters large improvements in the reactivity coefficients associated with coolant expansion and voiding, which enhances safety margins and, for a burner design, can be traded for maximizing the TRU burning rate. A trade-off of Th compared to U is the significantly larger fuel inventory required to achieve a breakeven design, which entails additional blankets at the detriment of core compactness as well as fuel manufacturing and separation requirements. The gamma field generated by the progeny of U-232 in the U bred from Th challenges fuel handling and manufacturing, but in case of full recycle, the high contents of Am and Cm in the transmutation fuel impose remote fuel operations regardless of the presence of U-232.

  1. A comparative analysis of numerical approaches to the mechanics of elastic sheets

    E-Print Network [OSTI]

    Michael Taylor; Benny Davidovitch; Zhanlong Qiu; Katia Bertoldi

    2014-11-25T23:59:59.000Z

    Numerically simulating deformations in thin elastic sheets is a challenging problem in computational mechanics due to destabilizing compressive stresses that result in wrinkling. Determining the location, structure, and evolution of wrinkles in these problems have important implications in design and is an area of increasing interest in the fields of physics and engineering. In this work, several numerical approaches previously proposed to model equilibrium deformations in thin elastic sheets are compared. These include standard finite element-based static post-buckling approaches as well as a recently proposed method based on dynamic relaxation, which are applied to the problem of an annular sheet with opposed tractions where wrinkling is a key feature. Numerical solutions are compared to analytic predictions, enabling a quantitative evaluation of the predictive power of the various methods. Results indicate that static finite element approaches are highly sensitive to initial imperfections, relying on \\textit{a priori} knowledge of the equilibrium wrinkling pattern to generate optimal results. In contrast, dynamic relaxation is much less sensitive to initial imperfections and can generate solutions for a wide variety of loading conditions without requiring knowledge of the equilibrium solution beforehand.

  2. Comparative life-cycle cost analysis for low-level mixed waste remediation alternatives

    SciTech Connect (OSTI)

    Jackson, J.A.; White, T.P.; Kloeber, J.M.; Toland, R.J.; Cain, J.P.; Buitrago, D.Y.

    1995-03-01T23:59:59.000Z

    The purpose of this study is two-fold: (1) to develop a generic, life-cycle cost model for evaluating low-level, mixed waste remediation alternatives, and (2) to apply the model specifically, to estimate remediation costs for a site similar to the Fernald Environmental Management Project near Cincinnati, OH. Life-cycle costs for vitrification, cementation, and dry removal process technologies are estimated. Since vitrification is in a conceptual phase, computer simulation is used to help characterize the support infrastructure of a large scale vitrification plant. Cost estimating relationships obtained from the simulation data, previous cost estimates, available process data, engineering judgment, and expert opinion all provide input to an Excel based spreadsheet for generating cash flow streams. Crystal Ball, an Excel add-on, was used for discounting cash flows for net present value analysis. The resulting LCC data was then analyzed using multi-attribute decision analysis techniques with cost and remediation time as criteria. The analytical framework presented allows alternatives to be evaluated in the context of budgetary, social, and political considerations. In general, the longer the remediation takes, the lower the net present value of the process. This is true because of the time value of money and large percentage of the costs attributed to storage or disposal.

  3. Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris

    SciTech Connect (OSTI)

    Berka, Randy M.; Grigoriev, Igor V.; Otillar, Robert; Salamov, Asaf; Grimwood, Jane; Reid, Ian; Ishmael, Nadeeza; John, Tricia; Darmond, Corinne; Moisan, Marie-Claude; Henrissat, Bernard; Coutinho, Pedro M.; Lombard, Vincent; Natvig, Donald O.; Lindquist, Erika; Schmutz, Jeremy; Lucas, Susan; Harris, Paul; Powlowski, Justin; Bellemare, Annie; Taylor, David; Butler, Gregory; de Vries, Ronald P.; Allijn, Iris E.; van den Brink, Joost; Ushinsky, Sophia; Storms, Reginald; Powell, Amy J.; Paulsen, Ian T.; Elbourne, Liam D. H.; Baker, Scott. E.; Magnuson, Jon; LaBoissiere, Sylvie; Clutterbuck, A. John; Martinez, Diego; Wogulis, Mark; Lopez de Leon, Alfredo; Rey, Michael W.; Tsang, Adrian

    2011-05-16T23:59:59.000Z

    Thermostable enzymes and thermophilic cell factories may afford economic advantages in the production of many chemicals and biomass-based fuels. Here we describe and compare the genomes of two thermophilic fungi, Myceliophthora thermophila and Thielavia terrestris. To our knowledge, these genomes are the first described for thermophilic eukaryotes and the first complete telomere-to-telomere genomes for filamentous fungi. Genome analyses and experimental data suggest that both thermophiles are capable of hydrolyzing all major polysaccharides found in biomass. Examination of transcriptome data and secreted proteins suggests that the two fungi use shared approaches in the hydrolysis of cellulose and xylan but distinct mechanisms in pectin degradation. Characterization of the biomass-hydrolyzing activity of recombinant enzymes suggests that these organisms are highly efficient in biomass decomposition at both moderate and high temperatures. Furthermore, we present evidence suggesting that aside from representing a potential reservoir of thermostable enzymes, thermophilic fungi are amenable to manipulation using classical and molecular genetics.

  4. Comparative analysis of environmental impacts of maize-biogas and photovoltaics on a land use basis

    SciTech Connect (OSTI)

    Graebig, Markus; Fenner, Richard [Centre for Sustainable Development, Department of Engineering, University of Cambridge (United Kingdom); Bringezu, Stefan [Wuppertal Institute for Climate, Environment and Energy. P.B. 100480, 42004 Wuppertal (Germany)

    2010-07-15T23:59:59.000Z

    This study aims to stimulate the discussion on how to optimize a sustainable energy mix from an environmental perspective and how to apply existing renewable energy sources in the most efficient way. Ground-mounted photovoltaics (PV) and the maize-biogas-electricity route are compared with regard to their potential to mitigate environmental pressure, assuming that a given agricultural area is available for energy production. Existing life cycle assessment (LCA) studies are taken as a basis to analyse environmental impacts of those technologies in relation to conventional technology for power and heat generation. The life-cycle-wide mitigation potential per area used is calculated for the impact categories non-renewable energy input, green house gas (GHG) emissions, acidification and eutrophication. The environmental performance of each system depends on the scenario that is assumed for end energy use (electricity and heat supply have been contemplated). In all scenarios under consideration, PV turns out to be superior to biogas in almost all studied impact categories. Even when maize is used for electricity production in connection with very efficient heat usage, and reduced PV performance is assumed to account for intermittence, PV can still mitigate about four times the amount of green house gas emissions and non-renewable energy input compared to maize-biogas. Soil erosion, which can be entirely avoided with PV, exceeds soil renewal rates roughly 20-fold on maize fields. Regarding the overall Eco-indicator 99 (H) score under most favourable assumptions for the maize-biogas route, PV has still a more than 100% higher potential to mitigate environmental burden. At present, the key advantages of biogas are its price and its availability without intermittence. In the long run, and with respect to more efficient land use, biogas might preferably be produced from organic waste or manure, whereas PV should be integrated into buildings and infrastructures. (author)

  5. Comparative Wakefield Analysis of a First Prototype of a DDS Structure for CLIC Main Linac

    E-Print Network [OSTI]

    D'Elia, A; Khan, V F; Grudiev, A; Wuensch, W

    2011-01-01T23:59:59.000Z

    A Damped Detuned Structure (DDS) for CLIC main linac has been proposed as an alternative to the present baseline design which is based on heavy damping. A first prototype, CLIC_DDS_A, for high power tests has been already designed and is under construction. It is also foreseen to design a further prototype, CLIC_DDS_B, to test both the wakefield suppression and high power performances. Wakefield calculations for DDS are, in the early design stage, based on single infinitely periodic cells. Though cell-to-cell interaction is taken into account to calculate the wakefields, it is important to study full structure properties using computational tools. In particular this is fundamental for defining the input parameters for the HOM coupler that is crucial for the performances of DDS. In the following a full analysis of wakefields and impedances based on simulations conducted with finite difference based electromagnetic computer code GdfidL will be presented.

  6. Gene co-expression network analysis in Rhodobacter capsulatus and application to comparative expression analysis of Rhodobacter sphaeroides

    SciTech Connect (OSTI)

    Pena-Castillo, Lourdes; Mercer, Ryan; Gurinovich, Anastasia; Callister, Stephen J.; Wright, Aaron T.; Westbye, Alexander; Beatty, J. T.; Lang, Andrew S.

    2014-08-28T23:59:59.000Z

    The genus Rhodobacter contains purple nonsulfur bacteria found mostly in freshwater environments. Representative strains of two Rhodobacter species, R. capsulatus and R. sphaeroides, have had their genomes fully sequenced and both have been the subject of transcriptional profiling studies. Gene co-expression networks can be used to identify modules of genes with similar expression profiles. Functional analysis of gene modules can then associate co-expressed genes with biological pathways, and network statistics can determine the degree of module preservation in related networks. In this paper, we constructed an R. capsulatus gene co-expression network, performed functional analysis of identified gene modules, and investigated preservation of these modules in R. capsulatus proteomics data and in R. sphaeroides transcriptomics data. Results: The analysis identified 40 gene co-expression modules in R. capsulatus. Investigation of the module gene contents and expression profiles revealed patterns that were validated based on previous studies supporting the biological relevance of these modules. We identified two R. capsulatus gene modules preserved in the protein abundance data. We also identified several gene modules preserved between both Rhodobacter species, which indicate that these cellular processes are conserved between the species and are candidates for functional information transfer between species. Many gene modules were non-preserved, providing insight into processes that differentiate the two species. In addition, using Local Network Similarity (LNS), a recently proposed metric for expression divergence, we assessed the expression conservation of between-species pairs of orthologs, and within-species gene-protein expression profiles. Conclusions: Our analyses provide new sources of information for functional annotation in R. capsulatus because uncharacterized genes in modules are now connected with groups of genes that constitute a joint functional annotation. We identified R. capsulatus modules enriched with genes for ribosomal proteins, porphyrin and bacteriochlorophyll anabolism, and biosynthesis of secondary metabolites to be preserved in R. sphaeroides whereas modules related to RcGTA production and signalling showed lack of preservation in R. sphaeroides. In addition, we demonstrated that network statistics may also be applied within-species to identify congruence between mRNA expression and protein abundance data for which simple correlation measurements have previously had mixed results.

  7. Mixed-waste treatment -- What about the residuals? A comparative analysis of MSO and incineration

    SciTech Connect (OSTI)

    NONE

    1993-06-01T23:59:59.000Z

    This report examines the issues concerning final waste forms, or residuals, that result from the treatment of mixed waste in molten salt oxidation (MSO) and incinerator systems. MSO is a technology with the potential to treat a certain segment of the waste streams at US Department of Energy (DOE) sites. MSO was compared with incineration because incineration is the best demonstrated available technology (BDAT) for the same waste streams. The Grand Junction Projects Office (GJPO) and Oak Ridge National Laboratory (ORNL) prepared this report for the DOE Office of Environmental Restoration (OER). The goals of this study are to objectively evaluate the anticipated residuals from MSO and incineration, examine regulatory issues for these final waste forms, and determine secondary treatment options. This report, developed to address concerns that MSO residuals present unique disposal difficulties, is part of a larger effort to successfully implement MSO as a treatment technology for mixed and hazardous waste. A Peer Review Panel reviewed the MSO technology in November 1991, and the implementation effort is ongoing under the guidance of the MSO Task Force.

  8. Comparative Analysis of Non-thermal Emissions and Study of Electron Transport in a Solar Flare

    E-Print Network [OSTI]

    T. Minoshima; T. Yokoyama; N. Mitani

    2007-10-02T23:59:59.000Z

    We study the non-thermal emissions in a solar flare occurring on 2003 May 29 by using RHESSI hard X-ray (HXR) and Nobeyama microwave observations. This flare shows several typical behaviors of the HXR and microwave emissions: time delay of microwave peaks relative to HXR peaks, loop-top microwave and footpoint HXR sources, and a harder electron energy distribution inferred from the microwave spectrum than from the HXR spectrum. In addition, we found that the time profile of the spectral index of the higher-energy ($\\gsim 100$ keV) HXRs is similar to that of the microwaves, and is delayed from that of the lower-energy ($\\lsim 100$ keV) HXRs. We interpret these observations in terms of an electron transport model called {\\TPP}. We numerically solved the spatially-homogeneous {\\FP} equation to determine electron evolution in energy and pitch-angle space. By comparing the behaviors of the HXR and microwave emissions predicted by the model with the observations, we discuss the pitch-angle distribution of the electrons injected into the flare site. We found that the observed spectral variations can qualitatively be explained if the injected electrons have a pitch-angle distribution concentrated perpendicular to the magnetic field lines rather than isotropic distribution.

  9. Comparative genome analysis of Bacillus cereus group genomes withBacillus subtilis

    SciTech Connect (OSTI)

    Anderson, Iain; Sorokin, Alexei; Kapatral, Vinayak; Reznik, Gary; Bhattacharya, Anamitra; Mikhailova, Natalia; Burd, Henry; Joukov, Victor; Kaznadzey, Denis; Walunas, Theresa; D'Souza, Mark; Larsen, Niels; Pusch,Gordon; Liolios, Konstantinos; Grechkin, Yuri; Lapidus, Alla; Goltsman,Eugene; Chu, Lien; Fonstein, Michael; Ehrlich, S. Dusko; Overbeek, Ross; Kyrpides, Nikos; Ivanova, Natalia

    2005-09-14T23:59:59.000Z

    Genome features of the Bacillus cereus group genomes (representative strains of Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis sub spp israelensis) were analyzed and compared with the Bacillus subtilis genome. A core set of 1,381 protein families among the four Bacillus genomes, with an additional set of 933 families common to the B. cereus group, was identified. Differences in signal transduction pathways, membrane transporters, cell surface structures, cell wall, and S-layer proteins suggesting differences in their phenotype were identified. The B. cereus group has signal transduction systems including a tyrosine kinase related to two-component system histidine kinases from B. subtilis. A model for regulation of the stress responsive sigma factor sigmaB in the B. cereus group different from the well studied regulation in B. subtilis has been proposed. Despite a high degree of chromosomal synteny among these genomes, significant differences in cell wall and spore coat proteins that contribute to the survival and adaptation in specific hosts has been identified.

  10. Comparative analysis of energy data bases for the industrial and commercial sectors

    SciTech Connect (OSTI)

    Roop, J.M.; Belzer, D.B.; Bohn, A.A.

    1986-12-01T23:59:59.000Z

    Energy data bases for the industrial and commercial sectors were analyzed to determine how valuable this data might be for policy analysis. The approach is the same for both end-use sectors: first a descrption or overview of relevant data bases identifies the available data; the coverage and methods used to generate the data are then explained; the data are then characterized and examples are provided for the major data sets under consideration. A final step assesses the data bases under consideration and draws conclusions. There are a variety of data bases considered for each of the end-use sectors included in this report. Data bases for the industrial sector include the National Energy Accounts, process-derived data bases such as the Drexel data base and data obtained from industry trade associations. For the commercial sector, three types of data bases are analyzed: the Nonresidential Building Energy Consumption Surveys, Dodge Construction Data and the Building Owners and Manager's Association Experience Exchange Report.

  11. Comparative analysis of discharges into Lake Michigan, Phase I - Southern Lake Michigan.

    SciTech Connect (OSTI)

    Veil, J. A.; Elcock, D.; Gasper, J. R.; Environmental Science Division

    2008-06-30T23:59:59.000Z

    BP Products North America Inc. (BP) owns and operates a petroleum refinery located on approximately 1,700 acres in Whiting, East Chicago, and Hammond, Indiana, near the southern tip of Lake Michigan. BP provided funding to Purdue University-Calumet Water Institute (Purdue) and Argonne National Laboratory (Argonne) to conduct studies related to wastewater treatment and discharges. Purdue and Argonne are working jointly to identify and characterize technologies that BP could use to meet the previous discharge permit limits for total suspended solids (TSS) and ammonia after refinery modernization. In addition to the technology characterization work, Argonne conducted a separate project task, which is the subject of this report. In Phase I of a two-part study, Argonne estimated the current levels of discharge to southern Lake Michigan from significant point and nonpoint sources in Illinois, Indiana, and portions of Michigan. The study does not consider all of the chemicals that are discharged. Rather, it is narrowly focused on a selected group of pollutants, referred to as the 'target pollutants'. These include: TSS, ammonia, total and hexavalent chromium, mercury, vanadium, and selenium. In Phase II of the study, Argonne will expand the analysis to cover the entire Lake Michigan drainage basin.

  12. Health impact assessment of Roma housing policies in Central and Eastern Europe: A comparative analysis

    SciTech Connect (OSTI)

    Molnar, Agnes, E-mail: molnar.agnes@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary); Adam, Balazs, E-mail: adam.balazs@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary); Antova, Temenujka, E-mail: t.antova@ncphp.government.bg [National Center of Public Health Protection, 15, Ivan Ev. Geshov blvd, 1431 Sofia (Bulgaria); Bosak, Lubos, E-mail: bosak@centrum.sk [Department of Public Health, Faculty of Health Care and Social Work, Trnava University, 1 Univerzitne namestie, 917 00 Trnava (Slovakia); Dimitrov, Plamen, E-mail: p.dimitrov@ncphp.government.bg [National Center of Public Health Protection, 15, Ivan Ev. Geshov blvd, 1431 Sofia (Bulgaria); Mileva, Hristina, E-mail: hmileva@yahoo.com [Ministry of Health, 5 Sveta Nedelya Square, 1000 Sofia (Bulgaria); Pekarcikova, Jarmila, E-mail: jkorcova@truni.sk [Department of Public Health, Faculty of Health Care and Social Work, Trnava University, 1 Univerzitne namestie, 917 00 Trnava (Slovakia); Zurlyte, Ingrida, E-mail: ingrida@post.omnitel.net [State Environmental Health Center, Kalvariju str. 153, 08221 Vilnius (Lithuania); Gulis, Gabriel, E-mail: GGulis@health.sdu.dk [Unit for Health Promotion Research, University of Southern Denmark, Niels Bohrs Vej 9, 6700 Esbjerg (Denmark); Adany, Roza, E-mail: adany.roza@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary); Kosa, Karolina, E-mail: karolina.kosa@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary)

    2012-02-15T23:59:59.000Z

    Marginalised Roma communities in European countries live in substandard housing conditions the improvement of which has been one of the major issues of the Decade of Roma Inclusion, the ongoing intergovernmental European Roma programme. The paper presents EU-funded health impact assessments of national Roma housing policies and programmes in 3 Central and Eastern European countries in light of the evaluation of a completed local project in a fourth CEE country so as to compare predicted effects to observed ones. Housing was predicted to have beneficial health effects by improving indoor and outdoor conditions, access to services, and socioeconomic conditions. Negative impacts were predicted only in terms of maintenance expenses and housing tenure. However, observed impacts of the completed local project did not fully support predictions especially in terms of social networks, satisfaction with housing and neighbourhood, and inhabitant safety. In order to improve the predictive value of HIA, more evidence should be produced by the careful evaluation of locally implemented housing projects. In addition, current evidence is in favour of planning Roma housing projects at the local rather than at the national level in alignment with the principle of subsidiarity. - Highlights: Black-Right-Pointing-Pointer Predictive validity of HIA of national Roma housing policies - in light of current evidence - is low. Black-Right-Pointing-Pointer Implemented housing projects should be comprehensively evaluated to improve reliability of HIA. Black-Right-Pointing-Pointer Roma housing projects should be planned at the local rather than at the national level. Black-Right-Pointing-Pointer HIA should be used to plan Roma housing projects at the local level.

  13. CFN, A User-oriented Nanoscience Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    * Energy * Materials * Coatings * Composites Industrial interest General Electric Raytheon ExxonMobil NEI Corporation Proto Mfg. Inc. Perpetual Technologies Brentronics A & A...

  14. User Oriented Access to Secure Biomedical Resources through the Grid

    E-Print Network [OSTI]

    Sinnott, R.O.

    Sinnott,R.O. Ajayi,O. Stell,A.J. Watt,J.P. Jiang,J. Life Science Grid Conference, Yokohama, Japan, October 2006

  15. Genetic analysis of inflorescence and plant height components in sorghum (Panicoidae) and comparative genetics with rice (Oryzoidae)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Dong [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab. and Inst. of Bioinformatics; Kong, Wenqian [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab. and Dept. of Crop and Soil Sciences; Robertson, Jon [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Goff, Valorie H [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Epps, Ethan [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Kerr, Alexandra [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Mills, Gabriel [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Cromwell, Jay [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Lugin, Yelena [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Phillips, Christine [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Paterson, Andrew H [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab., Inst. of Bioinformatics, Dept. of Crop and Soil Sciences, Dept. of Plant Biology, Dept. of Genetics

    2015-12-01T23:59:59.000Z

    Domestication has played an important role in shaping characteristics of the inflorescence and plant height in cultivated cereals. Taking advantage of meta-analysis of QTLs, phylogenetic analyses in 502 diverse sorghum accessions, GWAS in a sorghum association panel (n = 354) and comparative data, we provide insight into the genetic basis of the domestication traits in sorghum and rice. We performed genome-wide association studies (GWAS) on 6 traits related to inflorescence morphology and 6 traits related to plant height in sorghum, comparing the genomic regions implicated in these traits by GWAS and QTL mapping, respectively. In a search for signatures of selection, we identify genomic regions that may contribute to sorghum domestication regarding plant height, flowering time and pericarp color. Comparative studies across taxa show functionally conserved ‘hotspots’ in sorghum and rice for awn presence and pericarp color that do not appear to reflect corresponding single genes but may indicate co-regulated clusters of genes. We also reveal homoeologous regions retaining similar functions for plant height and flowering time since genome duplication an estimated 70 million years ago or more in a common ancestor of cereals. In most such homoeologous QTL pairs, only one QTL interval exhibits strong selection signals in modern sorghum. Intersections among QTL, GWAS and comparative data advance knowledge of genetic determinants of inflorescence and plant height components in sorghum, and add new dimensions to comparisons between sorghum and rice.

  16. A Cost Benefit Analysis of a V2G-Capable Electric School Bus Compared to a Traditional Diesel School Bus

    E-Print Network [OSTI]

    Firestone, Jeremy

    A Cost Benefit Analysis of a V2G-Capable Electric School Bus Compared to a Traditional Diesel analysis of a V2G-capable electric school bus compared to a traditional diesel school bus. Applied Energy 19716 Abstract Fuel expenses, diesel exhaust health externalities, and climate change are concerns

  17. Comparative Evaluation of Generalized River/Reservoir System Models

    E-Print Network [OSTI]

    Wurbs, Ralph A.

    This report reviews user-oriented generalized reservoir/river system models. The terms reservoir/river system, reservoir system, reservoir operation, or river basin management "model" or "modeling system" are used synonymously to refer to computer...

  18. Comparative Performance Analysis of IADR Operating in Natural Gas-Fired and Waste-Heat CHP Modes

    SciTech Connect (OSTI)

    Petrov, Andrei Y [ORNL; Sand, James R [ORNL; Zaltash, Abdolreza [ORNL

    2006-01-01T23:59:59.000Z

    Fuel utilization can be dramatically improved through effective recycle of 'waste' heat produced as a by-product of on-site or near-site power generation technologies. Development of modular compact cooling, heating, and power (CHP) systems for end-use applications in commercial and institutional buildings is a key part of the Department of Energy's (DOE) energy policy. To effectively use the thermal energy from a wide variety of sources which is normally discarded to the ambient, many components such as heat exchangers, boilers, absorption chillers, and desiccant dehumidification systems must be further developed. Recently a compact, cost-effective, and energy-efficient integrated active-desiccant vapor-compression hybrid rooftop (IADR) unit has been introduced in the market. It combines the advantages of an advanced direct-expansion cooling system with the dehumidification capability of an active desiccant wheel. The aim of this study is to compare the efficiency of the IADR operation in baseline mode, when desiccant wheel regeneration is driven by a natural gas burner, and in CHP mode, when the waste heat recovered from microturbine exhaust gas is used for desiccant regeneration. Comparative analysis shows an excellent potential for more efficient use of the desiccant dehumidification as part of a CHP system and the importance of proper sizing of the CHP components. The most crucial factor in exploiting the efficiency of this application is the maximum use of thermal energy recovered for heating of regeneration air.

  19. Comparative Analysis of a Transition Region Bright Point with a Blinker and Coronal Bright Point Using Multiple EIS Emission Lines

    E-Print Network [OSTI]

    Orange, N Brice; Chesny, David L; Patel, Maulik; Hesterly, Katie; Preuss, Lauren; Neira, Chantale; Turner, Niescja E

    2015-01-01T23:59:59.000Z

    Since their discovery twenty year ago, transition region bright points (TRBPs) have never been observed spectroscopically. Bright point properties have not been compared with similar transition region and coronal structures. In this work we have investigated three transient quiet Sun brightenings including a TRBP, a coronal BP (CBP) and a blinker. We use time-series observations of the extreme ultraviolet emission lines of a wide range of temperature T (log T = 5.3 - 6.4) from the EUV imaging spectrometer (EIS) onboard the Hinode satellite. We present the EIS temperature maps and Doppler maps, which are compared with magnetograms from the Michelson Doppler Imager (MDI) onboard the SOHO satellite. Doppler velocities of the TR BP and blinker are <,25 km s$^{-1}$, which is typical of transient TR phenomena. The Dopper velocities of the CBP were found to be < 20 km s^{-1} with exception of those measured at log T = 6.2 where a distinct bi-directional jet is observed. From an EM loci analysis we find evidenc...

  20. Environmental Conservation: page 1 of 9 C Foundation for Environmental Conservation 2013 doi:10.1017/S0376892913000015 Rethinking property rights: comparative analysis of conservation

    E-Print Network [OSTI]

    Rissman, Adena

    Environmental Conservation: page 1 of 9 C Foundation for Environmental Conservation 2013 doi:10 INTRODUCTION Property is central to environmental conservation (Naughton- Treves&Sanderson1995.1017/S0376892913000015 Rethinking property rights: comparative analysis of conservation easements

  1. Imaging Hydrated Microbial Extracellular Polymers: Comparative...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hydrated Microbial Extracellular Polymers: Comparative Analysis by Electron Microscopy . Imaging Hydrated Microbial Extracellular Polymers: Comparative Analysis by Electron...

  2. A comparative analysis of the attitudes of present male students toward selected environmental factors of Texas A&M University

    E-Print Network [OSTI]

    Blum, Maryann Baird

    1965-01-01T23:59:59.000Z

    for the Statement The Grading System Defined in the Catalog and Used by Most Professors Is Fair 13. Comparative Percentages for the Statement The Recent Ruling Which Makes Corps Membership Optional' Will Improve ABdi 14. Comparative Percentages...

  3. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    Wind Power Capital Cost Assumptions (Base-Case Analysis).27. Wind Power Capital Cost Assumptions (Base-Case Analysis)wind cost assumptions employed in most of the RPS analyses

  4. Is it Worth it? A Comparative Analysis of Cost-Benefit Projections for State Renewables Portfolio Standards

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2006-01-01T23:59:59.000Z

    wind costs; the uncertainties involved with predicting these two inputs highlight the importance of performing scenario analysis.

  5. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    detailed wholesale electricity price projections as a modelelectricity bills, and renewable energy certificate (REC) prices. Developing a consistent set of metrics for comparing cost projections

  6. ECONOMICS WITHIN SOCIAL STUDIES: A COMPARATIVE ANALYSIS OF STUDENT PERFORMANCE ON THE 2012 KANSAS HISTORY-GOVERNMENT ASSESSMENT

    E-Print Network [OSTI]

    Deplazes, Svetlana

    2014-05-31T23:59:59.000Z

    research questions in order to: (1) determine the level of student knowledge of assessed economic indicators and concepts; (2) investigate how student demographics relate to economic understanding; (3) compare test results in economics with those in other...

  7. Designing an experimenters database using the Nijssen Information Analysis Methodology (NIAM)

    SciTech Connect (OSTI)

    Eaton, M.J.

    1990-01-01T23:59:59.000Z

    This paper presents a discussion of the use of the Nijssen Information Analysis Methodology (NIAM) in the design of an experimenters database. This database is used by physicists and technicians to describe the configuration and diagnostic systems used on Sandia National Laboratories Particle Beam Fusion Accelerator II (PBFA II). The design of this database presented some unique challenges because of the large degree of flexibility required to enable timely response to changing experimental configurations. The NIAM user-oriented technique proved to be invaluable in translating experimenter's requirements into an information model and then to a normalized relational design.

  8. A comparative molecular analysis of water-filled limestone sinkholes in north-eastern Mexicoemi_2324 226..240

    E-Print Network [OSTI]

    Science and Engineering, Colorado School of Mines, Golden, CO 80401, USA. 2 Department of geological. Summary Sistema Zacatón in north-eastern Mexico is host to several deep, water-filled, anoxic, karstic (Huber et al., 2007) and soil (Roesch et al., 2007) samples. Comparative methods that exploit the large

  9. Electric industry restructuring and environmental issues: A comparative analysis of the experience in California, New York, and Wisconsin

    SciTech Connect (OSTI)

    Fang, J.M.; Galen, P.S.

    1996-08-01T23:59:59.000Z

    Since the California Public Utilities Commission (CPUC) issued its April 20, 1994, Blue Book proposal to restructure the regulation of electric utilities in California to allow more competition, over 40 states have initiated similar activities. The question of how major public policy objectives such as environmental protection, energy efficiency, renewable energy, and assistance to low-income customers can be sustained in the new competitive environment is also an important element being considered. Because many other states will undergo restructuring in the future, the experience of the {open_quotes}early adopter{close_quotes} states in addressing public policy objectives in their electric service industry restructuring processes can provide useful information to other states. The Competitive Resource Strategies Program of the U.S. Department of Energy`s (DOE`s) Office of Utility Technologies, is interested in documenting and disseminating the experience of the pioneering states. The Center for Energy Analysis and Applications of the National Renewable Energy Laboratory assisted the Office of Utility Technologies in this effort with a project on the treatment of environmental issues in electric industry restructuring.

  10. Weighing the Costs and Benefits of Renewables Portfolio Standards:A Comparative Analysis of State-Level Policy Impact Projections

    SciTech Connect (OSTI)

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-16T23:59:59.000Z

    State renewables portfolio standards (RPS) have emerged as one of the most important policy drivers of renewable energy capacity expansion in the U.S. Collectively, these policies now apply to roughly 40% of U.S. electricity load, and may have substantial impacts on electricity markets, ratepayers, and local economies. As RPS policies have been proposed or adopted in an increasing number of states, a growing number of studies have attempted to quantify the potential impacts of these policies, focusing primarily on projecting cost impacts, but sometimes also estimating macroeconomic and environmental effects. This report synthesizes and analyzes the results and methodologies of 28 distinct state or utility-level RPS cost impact analyses completed since 1998. Together, these studies model proposed or adopted RPS policies in 18 different states. We highlight the key findings of these studies on the costs and benefits of RPS policies, examine the sensitivity of projected costs to model assumptions, assess the attributes of different modeling approaches, and suggest possible areas of improvement for future RPS analysis.

  11. Test Comparability

    E-Print Network [OSTI]

    Keller, Christine; Shulenburger, David E.

    2010-01-01T23:59:59.000Z

    KU ScholarWorks | http://kuscholarworks.ku.edu Test Comparability 2010 by Christine Keller and David Shulenburger This work has been made available by the University of Kansas Libraries’ Office of Scholarly Communication and Copyright. Please... and Shulenburger, David. “Test comparability,” with Christine Keller in the Letters section of Change, September/October 2010, p. 6. Published version: http://www.changemag.org/Archives/Back%20 Issues/September-October%202010/letters-to-editor.html Terms of Use...

  12. A Comparative SWOT Analysis of the National Agricultural Extension Program Organization to Determine Best-Fit Program Model: A Case Study of the North West and South West Regions of Cameroon.

    E-Print Network [OSTI]

    Nyambi, Gwendoline

    2012-07-16T23:59:59.000Z

    A COMPARATIVE SWOT ANALYSIS OF THE NATIONAL AGRICULTURAL EXTENSION PROGRAM ORGANIZATION TO DETERMINE BEST-FIT PROGRAM MODEL: A CASE STUDY OF THE NORTH WEST AND SOUTH WEST REGIONS OF CAMEROON A Dissertation by GWENDOLINE NA-AH NYAMBI... A Comparative SWOT Analysis of the National Agricultural Extension Program Organization to Determine Best-Fit Program Model: A Case Study of the North West and South West Regions of Cameroon Copyright 2012 Gwendoline Na-ah Nyambi A COMPARATIVE...

  13. Comparative Analysis of GALLEX-GNO Solar Neutrino Data and SOHO/MDI Helioseismology Data; Further Evidence for Rotational Modulation of the Solar Neutrino Flux

    E-Print Network [OSTI]

    Peter A. Sturrock; Mark A. Weber

    2001-03-10T23:59:59.000Z

    We carry out a comparative analysis of the GALLEX-GNO solar neutrino data and estimates of the solar internal rotation rate derived from the MDI helioseismology experiment on the SOHO spacecraft. We introduce a statistic, which we evaluate as a function of radius and latitude, that is a measure of the degree of "resonance" of oscillations in the neutrino flux and the synodic solar rotation rate at that radius and latitude. A map of this statistic indicates that the probable location is deep in the convection zone near the equator. We also examine the integral of this statistic over the equatorial section of the convection zone. This provides a measure of the likelihood that the variability of the solar neutrino flux, as measured by the GALLEX-GNO data, has its origin in the equatorial section of the convection zone. We apply the shuffle test, randomly reassigning measurements among runs, to estimate the significance of the value of the statistic computed from the actual data. This test implies that the result is significant at the 0.2% level. When, for comparison, we repeat this analysis for the radiative zone, we find that the integral resonance statistic is not significant. These results support earlier evidence for rotational modulation of the solar neutrino flux.

  14. Policy Analysis Comparative Analysis of the

    E-Print Network [OSTI]

    Jaramillo, Paulina

    sector (2). As a response to concerns over petroleum consumption, interest in alternative transportation, Tepper School of Business, and Department of Engineering and Public Policy, Carnegie Mellon University its energy security, and at the same time significantly reducing its GHG emissions, neither CTL nor

  15. Comparative life-cycle energy payback analysis of multi-junction a-SiGe and nanocrystalline/a-Si modules

    SciTech Connect (OSTI)

    Fthenakis, V.; Kim, H.

    2010-07-15T23:59:59.000Z

    Despite the publicity of nanotechnologies in high tech industries including the photovoltaic sector, their life-cycle energy use and related environmental impacts are understood only to a limited degree as their production is mostly immature. We investigated the life-cycle energy implications of amorphous silicon (a-Si) PV designs using a nanocrystalline silicon (nc-Si) bottom layer in the context of a comparative, prospective life-cycle analysis framework. Three R and D options using nc-Si bottom layer were evaluated and compared to the current triple-junction a-Si design, i.e., a-Si/a-SiGe/a-SiGe. The life-cycle energy demand to deposit nc-Si was estimated from parametric analyses of film thickness, deposition rate, precursor gas usage, and power for generating gas plasma. We found that extended deposition time and increased gas usages associated to the relatively high thickness of nc-Si lead to a larger primary energy demand for the nc-Si bottom layer designs, than the current triple-junction a-Si. Assuming an 8% conversion efficiency, the energy payback time of those R and D designs will be 0.7-0.9 years, close to that of currently commercial triple-junction a-Si design, 0.8 years. Future scenario analyses show that if nc-Si film is deposited at a higher rate (i.e., 2-3 nm/s), and at the same time the conversion efficiency reaches 10%, the energy-payback time could drop by 30%.

  16. Comparative Analysis of Natural Convection Flows Simulated by both the Conservation and Incompressible Forms of the Navier-Stokes Equations in a Differentially-Heated Square Cavity

    SciTech Connect (OSTI)

    Richard C. Martineau; Ray A. Berry; Aurélia Esteve; Kurt D. Hamman; Dana A. Knoll; Ryosuke Park; William Taitano

    2009-01-01T23:59:59.000Z

    This report illustrates a comparative study to analyze the physical differences between numerical simulations obtained with both the conservation and incompressible forms of the Navier-Stokes equations for natural convection flows in simple geometries. The purpose of this study is to quantify how the incompressible flow assumption (which is based upon constant density advection, divergence-free flow, and the Boussinesq gravitational body force approximation) differs from the conservation form (which only assumes that the fluid is a continuum) when solving flows driven by gravity acting upon density variations resulting from local temperature gradients. Driving this study is the common use of the incompressible flow assumption in fluid flow simulations for nuclear power applications in natural convection flows subjected to a high heat flux (large temperature differences). A series of simulations were conducted on two-dimensional, differentially-heated rectangular geometries and modeled with both hydrodynamic formulations. From these simulations, the selected characterization parameters of maximum Nusselt number, average Nusselt number, and normalized pressure reduction were calculated. Comparisons of these parameters were made with available benchmark solutions for air with the ideal gas assumption at both low and high heat fluxes. Additionally, we generated body force, velocity, and divergence of velocity distributions to provide a basis for further analysis. The simulations and analysis were then extended to include helium at the Very High Temperature gas-cooled Reactor (VHTR) normal operating conditions. Our results show that the consequences of incorporating the incompressible flow assumption in high heat flux situations may lead to unrepresentative results. The results question the use of the incompressible flow assumption for simulating fluid flow in an operating nuclear reactor, where large temperature variations are present. The results show that the use of the incompressible flow assumption with the Boussinesq gravitational body force approximation should be restricted to flows where the density change of a fluid particle along a pathline is negligible.

  17. Subclavian Vein Versus Arm Vein for Totally Implantable Central Venous Port for Patients with Head and Neck Cancer: A Retrospective Comparative Analysis

    SciTech Connect (OSTI)

    Akahane, Akio, E-mail: a.akahane@gmail.com; Sone, Miyuki; Ehara, Shigeru; Kato, Kenichi; Tanaka, Ryoichi; Nakasato, Tatsuhiko [Iwate Medical University School of Medicine, Department of Radiology (Japan)

    2011-12-15T23:59:59.000Z

    Purpose: This study was designed to compare central venous ports (CVP) from two different routes of venous access-the subclavian vein and arm vein-in terms of safety for patients with head and neck cancer (HNC). Methods: Patients with HNC who underwent image-guided implantations of CVPs were retrospectively evaluated. All CVPs were implanted under local anesthesia. Primary outcome measurements were rates and types of adverse events (AEs). Secondary outcomes included technical success and rate and reason of CVP removal. Results: A total of 162 patients (subclavian port group, 47; arm port group, 115) were included in this study. Technical success was achieved in all patients. The median follow-up period was 94 (range, 1-891) days. Two patients in the subclavian port group experienced periprocedural complications. Postprocedural AEs were observed in 8.5 and 22.6% of the subclavian port and arm port group patients, respectively (P = 0.044). Phlebitis and system occlusions were observed only in the arm port group. The rate of infection was not significantly different between the two groups. The CVP was removed in 34 and 39.1% of the subclavian port and arm port patients, respectively. Conclusions: Both subclavian and arm CVPs are feasible in patients with HNC. AEs were more frequent in the arm port group; thus, the arm port is not recommended as the first choice for patients with HNC. However, further experience is needed to improve the placement technique and the maintenance of CVPs and a prospective analysis is warranted.

  18. Comparative DNA microarray analysis of human monocyte derived dendritic cells and MUTZ-3 cells exposed to the moderate skin sensitizer cinnamaldehyde

    SciTech Connect (OSTI)

    Python, Francois [Experimental Product Safety, Procter and Gamble Co., Cosmital SA, Marly (Switzerland); Goebel, Carsten [Product Safety, Human Safety Assessment, Procter and Gamble Service GmbH, Darmstadt (Germany); Aeby, Pierre [Experimental Product Safety, Procter and Gamble Co., Cosmital SA, Marly (Switzerland)], E-mail: pierre_aeby@bluewin.ch

    2009-09-15T23:59:59.000Z

    The number of studies involved in the development of in vitro skin sensitization tests has increased since the adoption of the EU 7th amendment to the cosmetics directive proposing to ban animal testing for cosmetic ingredients by 2013. Several studies have recently demonstrated that sensitizers induce a relevant up-regulation of activation markers such as CD86, CD54, IL-8 or IL-1{beta} in human myeloid cell lines (e.g., U937, MUTZ-3, THP-1) or in human peripheral blood monocyte-derived dendritic cells (PBMDCs). The present study aimed at the identification of new dendritic cell activation markers in order to further improve the in vitro evaluation of the sensitizing potential of chemicals. We have compared the gene expression profiles of PBMDCs and the human cell line MUTZ-3 after a 24-h exposure to the moderate sensitizer cinnamaldehyde. A list of 80 genes modulated in both cell types was obtained and a set of candidate marker genes was selected for further analysis. Cells were exposed to selected sensitizers and non-sensitizers for 24 h and gene expression was analyzed by quantitative real-time reverse transcriptase-polymerase chain reaction. Results indicated that PIR, TRIM16 and two Nrf2-regulated genes, CES1 and NQO1, are modulated by most sensitizers. Up-regulation of these genes could also be observed in our recently published DC-activation test with U937 cells. Due to their role in DC activation, these new genes may help to further refine the in vitro approaches for the screening of the sensitizing properties of a chemical.

  19. A Comparative Analysis of Residential Energy Use for 2009 IECC Code Compliance and 2001 IECC Compliance with 2006 NAECA Appliance Standards for Selected Climate Zones in Texas 

    E-Print Network [OSTI]

    Mukhopadhyay, J.; Baltazar, J. C.; Liu, Z.; Haberl, J.; Culp, C.; Yazdani, B.

    2010-01-01T23:59:59.000Z

    single-family residential construction. The analysis uses a DOE-2 simulation for five locations in Texas (Houston, Brownsville, Dallas/Fort Worth, El Paso and Amarillo). The analysis shows that a code – compliant house built to the specifications...

  20. A Web-based user-oriented tool for universal kitchen design

    E-Print Network [OSTI]

    Ma, Xiaoyi, 1975-

    2002-01-01T23:59:59.000Z

    Economic constraints to the professional design practice limit customized solutions to the very wealthy, and thus most of the kitchens in current development housing projects are still generic. With aging baby boomers and ...

  1. From Ontology to NL: Generation of Multilingual User-Oriented Environmental Reports

    E-Print Network [OSTI]

    related in particular to (i) environmental data (e.g., temperature, wind speed, birch pollen, CO2); (ii linguistically-oriented knowledge structures--as, e.g., the Upper Model [1] or the MIAKT ontology [2 as starting point for generation The three layers of our knowledge representation model are implemented in OWL

  2. User-oriented simulation of HVDC control in a transient stability program

    SciTech Connect (OSTI)

    Provix, P.; Gingras, J.P.; Soulier, D.; Valette, A.

    1985-07-01T23:59:59.000Z

    In view of the wide variety of HVDC controls, which can differ from one application to another, their simulation in transient-stability programs poses a specific problem. The simulation method described in this paper allows HVDC system representation in transient-stability programs by means of user-defined block diagrams for the control functions. The user enters the control specifications in the form of a data file which can be accessed by any users. Thus a bank of models is created which can be easily updated. An example of model creation using this method is also shown.

  3. User-oriented Security Supporting Inter-disciplinary Life Science Research across the Grid

    E-Print Network [OSTI]

    Sinnott, R.O.

    Sinnott,R.O. Ajayi,O. Jiang,J. Stell,A.J. Watt,J. Special Issue on Life Science Grids, New Generation Computing Journal, May 2007

  4. A comparative analysis of drilling results obtained with oil mud vs. water-base mud at High Island block A-270

    SciTech Connect (OSTI)

    Nance, W.B.; Garrett, M.M.; Gault, A.D.; Kortlang, W.F.; Muncy, D.D.

    1983-02-01T23:59:59.000Z

    Three wells on the High Island A-270B platform were drilled with water base muds and three were drilled with inverted emulsion oil muds. The drilling performance of these two mud types was compared for the six wells. Overall drilling costs were significantly lower with the oil muds due to the elimination of differential pressure pipe and casing sticking.

  5. In Proceedings of the International Symposium on Performance Analysis of Systems and Software (ISPASS 2006). Comparing Multinomial and K-Means Clustering for SimPoint

    E-Print Network [OSTI]

    Calder, Bradley

    (ISPASS 2006). Comparing Multinomial and K-Means Clustering for SimPoint Greg Hamerly Erez Perelman Brad represent an accurate picture of the complete execution of the program. SimPoint is based on the k-means of us- ing k-means and multinomial clustering for SimPoint. We show that k-means performs better than

  6. Comparative analysis of the high-order harmonic generation in the laser ablation plasmas prepared on the surfaces of complex and atomic targets

    SciTech Connect (OSTI)

    Ganeev, R. A. [Scientific Association Akadempribor, Academy of Sciences of Uzbekistan, Akademgorodok, Tashkent 100125 (Uzbekistan); Institute for Solid State Physics, University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8581 (Japan); Milosevic, D. B. [Faculty of Science, University of Sarajevo, Zmaja od Bosne 35, 71000 Sarajevo (Bosnia and Herzegowina); Max-Born-Institut, Max-Born-Strasse 2a, 12489 Berlin (Germany)

    2008-07-15T23:59:59.000Z

    We analyzed high-order harmonic generation from the plasma plumes prepared on the surfaces of complex targets. The studies of In-Ag targets showed that the characteristics of the high-order harmonics from the double-target plume were the same as those from the single-target plasmas. For the chromium-tellurium plasma, the enhancements of the 29th and 27th harmonics were obtained, thus indicating the appearance of the enhancement properties from both components of the double-target plasma. These comparative studies also showed higher enhancement of a single harmonic in the case of atomic plasma (Sb) with regard to the molecular one (InSb). The additional component can only decrease the enhancement factor of the medium, due to the change of the oscillator strength and spectral distribution of the transitions involved in the resonance enhancement of the specific harmonic order. The theoretical calculations have shown the enhancement of specific harmonics for the Sb, Te, and Cr plasmas in the double-target configurations.

  7. Comparative Survival Study (CSS) of Hatchery PIT-tagged Spring/Summer Chinook; Migration Years 1997-2000 Mark/Recapture Activities and Bootstrap Analysis, 2002 Annual Report.

    SciTech Connect (OSTI)

    Berggren Thomas J.; Franzoni, Henry; Basham, Larry R. (Columbia Basin Fish and Wildlife Authority, Fish Passage Center, Portland, OR)

    2005-04-01T23:59:59.000Z

    The Comparative Survival Study (CSS) was initiated in 1996 as a multi-year program of the fishery agencies and tribes to estimate survival rates over different life stages for spring and summer chinook (hereafter, chinook) produced in major hatcheries in the Snake River basin and from selected hatcheries in the lower Columbia River. Much of the information evaluated in the CSS is derived from fish tagged with Passive Integrated Transponder (PIT) tags. A comparison of survival rates of chinook marked in two different regions (which differ in the number of dams chinook have to migrate through) provides insight into the effects of the Snake/Columbia hydroelectric system (hydrosystem). The CSS also compares the smolt-to-adult survival rates (SARs) for Snake River chinook that were transported versus those that migrated in-river to below Bonneville Dam. Additional comparisons can be made within in-river experiences as well comparison between the different collector projects from which smolts are transported. CSS also compares these survival rates for wild Snake River spring and summer chinook. These comparisons generate information regarding the relative effects of the current management actions used to recover this listed species. Scientists and managers have recently emphasized the importance of delayed hydrosystem mortality to long-term management decisions. Delayed hydrosystem mortality may be related to the smolts experience in the Federal Columbia River Power System, and could occur for both smolts that migrate in-river and smolts that are transported. The CSS PIT tag information on in-river survival rates and smolt-to-adult survival rates (SARs) of transported and in-river fish are relevant to estimation of ''D'', which partially describes delayed hydrosystem mortality. The parameter D is the differential survival rate of transported fish relative to fish that migrate in-river, as measured from below Bonneville Dam to adults returning to Lower Granite Dam. When D = 1, there is no difference in survival rate after hydrosystem passage. When D < 1, then transported smolts die at a greater rate after release below Bonneville Dam than smolts that have migrated in-river to below Bonneville Dam. While the relative survival rates of transported and in-river migrants are important, the SARs must be also be sufficient to allow the salmon to persist and recover (Mundy et al. 1994). Decreased SARs could result from delayed hydrosystem mortality for either transported or in-river migrants, or both. Major objectives of the CSS include: (1) development of a long-term index of transport SAR to in-river SAR for Snake River hatchery and wild spring and summer chinook smolts measured at Lower Granite Dam; (2) develop a long-term index of survival rates from release of smolts at Snake River hatcheries to return of adults to the hatcheries; (3) compute and compare the overall SARs for selected upriver and downriver spring and summer chinook hatchery and wild stocks; and (4) begin a time series of SARs for use in hypothesis testing and in the regional long-term monitoring and evaluation program. Primary CSS focus in this report is for wild and hatchery spring/summer chinook that outmigrated in 1997 to 2000 and returned in 2003. Another goal of CSS was to help resolve uncertainty concerning marking, handling and bypass effects associated with control fish used in National Marine Fisheries Service's (NMFS) transportation research and evaluation. Significant concern had been raised that the designated control groups, which were collected, marked and released at dams, did not experience the same conditions as the in-river migrants which were not collected and bypassed under existing management, and that the estimated ratios of SARs of transported fish to SARs of control fish may be biased (Mundy et al. 1994). Instead of marking at the dams, as traditionally done for NMFS transportation evaluations, CSS began marking sufficient numbers of fish at the hatcheries and defining in-river groups from the detection histories at the dams (e.g., total

  8. Comparative Genomics Analysis and Phenotypic Characterization of Shewanella putrefaciens W3-18-1: Anaerobic Respiration, Bacterial Microcompartments, and Lateral Flagella

    SciTech Connect (OSTI)

    Qiu, D.; Tu, Q.; He, Zhili; Zhou, Jizhong

    2010-05-17T23:59:59.000Z

    Respiratory versatility and psychrophily are the hallmarks of Shewanella. The ability to utilize a wide range of electron acceptors for respiration is due to the large number of c-type cytochrome genes present in the genome of Shewanella strains. More recently the dissimilatory metal reduction of Shewanella species has been extensively and intensively studied for potential applications in the bioremediation of radioactive wastes of groundwater and subsurface environments. Multiple Shewanella genome sequences are now available in the public databases (Fredrickson et al., 2008). Most of the sequenced Shewanella strains were isolated from marine environments and this genus was believed to be of marine origin (Hau and Gralnick, 2007). However, the well-characterized model strain, S. oneidensis MR-1, was isolated from the freshwater lake sediment of Lake Oneida, New York (Myers and Nealson, 1988) and similar bacteria have also been isolated from other freshwater environments (Venkateswaran et al., 1999). Here we comparatively analyzed the genome sequence and physiological characteristics of S. putrefaciens W3-18-1 and S. oneidensis MR-1, isolated from the marine and freshwater lake sediments, respectively. The anaerobic respirations, carbon source utilization, and cell motility have been experimentally investigated. Large scale horizontal gene transfers have been revealed and the genetic divergence between these two strains was considered to be critical to the bacterial adaptation to specific habitats, freshwater or marine sediments.

  9. airway epithelium compared: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    comparative analysis could be asked to explain why the period of an oscillating ... Weld, Daniel S. 1987-11-01 132 Comparative Smootheology Mathematics Websites Summary: erent...

  10. Using wavelet analysis to compare the QCD prediction and experimental data on $R_{e^+e^-}$ and to determine parameters of the charmonium states above the $D\\bar D$ threshold

    E-Print Network [OSTI]

    Henner, V K; Belozerova, T S

    2015-01-01T23:59:59.000Z

    The first part of our analysis uses the wavelet method to compare the Quantum Chromodynamic (QCD) prediction for the ratio of hadronic to muon cross sections in electron-positron collisions, $R$, with experimental data for $R$ over a center of mass energy range up to 7.5 GeV. A direct comparison of the raw experimental data and the QCD prediction is difficult because the data have a wide range of structures and large statistical errors and the QCD description contains sharp quark-antiquark thresholds. However, a meaningful comparison can be made if a type of "smearing" procedure is used to smooth out rapid variations in both the theoretical and experimental values of $R$. A wavelet analysis (WA) can be used to achieve this smearing effect. In the second part of the analysis we concentrate on the 3.0 - 6.0 GeV energy region containing the relatively wide charmonium resonances $\\psi(1^-)$. We use the wavelet methodology to distinguish these resonances from experimental noise, background and from each other, and...

  11. Using wavelet analysis to compare the QCD prediction and experimental data on $R_{e^+e^-}$ and to determine parameters of the charmonium states above the $D\\bar D$ threshold

    E-Print Network [OSTI]

    V. K. Henner; C. L. Davis; T. S. Belozerova

    2015-06-12T23:59:59.000Z

    The first part of our analysis uses the wavelet method to compare the Quantum Chromodynamic (QCD) prediction for the ratio of hadronic to muon cross sections in electron-positron collisions, $R$, with experimental data for $R$ over a center of mass energy range up to 7.5 GeV. A direct comparison of the raw experimental data and the QCD prediction is difficult because the data have a wide range of structures and large statistical errors and the QCD description contains sharp quark-antiquark thresholds. However, a meaningful comparison can be made if a type of "smearing" procedure is used to smooth out rapid variations in both the theoretical and experimental values of $R$. A wavelet analysis (WA) can be used to achieve this smearing effect. In the second part of the analysis we concentrate on the 3.0 - 6.0 GeV energy region containing the relatively wide charmonium resonances $\\psi(1^-)$. We use the wavelet methodology to distinguish these resonances from experimental noise, background and from each other, and are thus able to determine more reliably the parameters of these states. These two analyses are examples of the usefulness of WA in extracting information in a model independent way from high energy physics data.

  12. Healthcare Policy Modeling, Simulation, and Analysis: COMPARE

    E-Print Network [OSTI]

    individual or group that is seriously interested in improving the health care system -- including reform are important issues for the American public, the healthcare industry, policy analysts assess the intended and unintended consequences of such reforms. Until now, it has been practically

  13. A Comparative Analysis of Influenza Vaccination Programs

    E-Print Network [OSTI]

    Bansal, Shweta

    , Texas, United States of America, 2 UBC Centre for Disease Control, University of British Columbia and Molecular Biology, University of Texas Austin, Austin, Texas, United States of America, 4 External Faculty, Santa Fe Institute, Santa Fe, New Mexico, United States of America Funding: We acknowledge the financial

  14. Comparative analysis of properties of channels of deuteron and tritium production in {sup 16}Op collisions at a projectile momentum of 3.25 GeV/c per nucleon

    SciTech Connect (OSTI)

    Olimov, K., E-mail: olimov@uzsci.net [Uzbek Academy of Sciences, Physical Technical Institute, Scientific Production Association Physics-Sun (Uzbekistan); Glagolev, V. V. [Joint Institute for Nuclear Research (Russian Federation); Gulamov, K. G.; Kurbanov, A.; Lutpullaev, S. L.; Olimov, A. K.; Petrov, V. I.; Yuldashev, A. A. [Uzbek Academy of Sciences, Physical Technical Institute, Scientific Production Association Physics-Sun (Uzbekistan)

    2014-12-15T23:59:59.000Z

    The results of a comparative analysis of channels involving the inclusive production of deuterons and tritons in {sup 16}Op collisions at a projectile momentum of 3.25 GeV/c per nucleon are presented. The mechanisms governing proton, deuteron, and triton production in the fragmentation of oxygen nuclei are found to be independent. It is shown that the observed proton-multiplicity correlations are associated predominantly with the character of the primary event of a proton-nucleon collision in {sup 16}Op interactions. It is found that, in reactions involving triton production, the contributions of processes leading to an increase in the mean proton multiplicity (n ? p + ?{sup ?} and np ? pn) and processes leading to its decrease (p ? n + ?{sup +}) compensate each other.

  15. Comparative genomics and bioenergetics Jose Castresana *

    E-Print Network [OSTI]

    Castresana, Jose

    Review Comparative genomics and bioenergetics Jose Castresana * European Molecular Biology conclusions about the phylogenetic distribution and evolution of bioenergetic pathways to be drawn conservation used by prokaryotes. In addition, a thorough phylogenetic analysis of other bioenergetic protein

  16. Mechanical code comparator

    DOE Patents [OSTI]

    Peter, Frank J. (Albuquerque, NM); Dalton, Larry J. (Bernalillo, NM); Plummer, David W. (Albuquerque, NM)

    2002-01-01T23:59:59.000Z

    A new class of mechanical code comparators is described which have broad potential for application in safety, surety, and security applications. These devices can be implemented as micro-scale electromechanical systems that isolate a secure or otherwise controlled device until an access code is entered. This access code is converted into a series of mechanical inputs to the mechanical code comparator, which compares the access code to a pre-input combination, entered previously into the mechanical code comparator by an operator at the system security control point. These devices provide extremely high levels of robust security. Being totally mechanical in operation, an access control system properly based on such devices cannot be circumvented by software attack alone.

  17. Comparing greenhouse gasses

    E-Print Network [OSTI]

    Reilly, John M.; Babiker, Mustafa H.M.; Mayer, Monika.

    Controlling multiple substances that jointly contribute to climate warming requires some method to compare the effects of the different gases because the physical properties (radiative effects, and persistence in the ...

  18. Blackbody comparator for thermocouple calibration

    SciTech Connect (OSTI)

    Ojanen, M.; Hahtela, O. M.; Heinonen, M. [Centre for Metrology and Accreditation (MIKES), P.O.Box 9, FI-02151 Espoo (Finland)

    2013-09-11T23:59:59.000Z

    MIKES is developing a measurement set-up for calibrating thermocouples in the temperature range 960 °C - 1500 °C. The calibration method is based on direct comparison of thermocouples and radiation thermometers. We have designed a graphite blackbody comparator cell, which is operated in a horizontal single-zone tube furnace. The cell includes two blackbody cavities for radiation temperature measurements. The cavities have openings on opposite sides of the cell, allowing simultaneous measurement with two radiation thermometers. The design of the comparator allows three thermocouples to be calibrated simultaneously. The thermocouples to be calibrated are inserted in thermometer wells around one of the measurement cavities. We characterize the blackbody comparator in terms of repeatability, temperature distribution and emissivity. Finally, we validate the uncertainty analysis by comparing calibration results obtained for type B and S thermocouples to the calibration results reported by Technical Research Institute of Sweden (SP), and MIKES. The agreement in the temperature range 1000 °C - 1500 °C is within 0.90 °C, the average deviation being 0.17 °C.

  19. Comparative Analysis of the 15.5kD Box C/D snoRNP Core Protein in the Primitive Eukaryote Giardia lamblia Reveals Unique Structural and Functional Features

    SciTech Connect (OSTI)

    Biswas, Shyamasri; Buhrman, Greg; Gagnon, Keith; Mattos, Carla; Brown, II, Bernard A.; Maxwell, E. Stuart (NCSU); (UTSMC)

    2012-07-11T23:59:59.000Z

    Box C/D ribonucleoproteins (RNP) guide the 2'-O-methylation of targeted nucleotides in archaeal and eukaryotic rRNAs. The archaeal L7Ae and eukaryotic 15.5kD box C/D RNP core protein homologues initiate RNP assembly by recognizing kink-turn (K-turn) motifs. The crystal structure of the 15.5kD core protein from the primitive eukaryote Giardia lamblia is described here to a resolution of 1.8 {angstrom}. The Giardia 15.5kD protein exhibits the typical {alpha}-{beta}-{alpha} sandwich fold exhibited by both archaeal L7Ae and eukaryotic 15.5kD proteins. Characteristic of eukaryotic homologues, the Giardia 15.5kD protein binds the K-turn motif but not the variant K-loop motif. The highly conserved residues of loop 9, critical for RNA binding, also exhibit conformations similar to those of the human 15.5kD protein when bound to the K-turn motif. However, comparative sequence analysis indicated a distinct evolutionary position between Archaea and Eukarya. Indeed, assessment of the Giardia 15.5kD protein in denaturing experiments demonstrated an intermediate stability in protein structure when compared with that of the eukaryotic mouse 15.5kD and archaeal Methanocaldococcus jannaschii L7Ae proteins. Most notable was the ability of the Giardia 15.5kD protein to assemble in vitro a catalytically active chimeric box C/D RNP utilizing the archaeal M. jannaschii Nop56/58 and fibrillarin core proteins. In contrast, a catalytically competent chimeric RNP could not be assembled using the mouse 15.5kD protein. Collectively, these analyses suggest that the G. lamblia 15.5kD protein occupies a unique position in the evolution of this box C/D RNP core protein retaining structural and functional features characteristic of both archaeal L7Ae and higher eukaryotic 15.5kD homologues.

  20. Multi-scale comparative spectral analysis of satellite total solar irradiance measurements from 2003 to 2013 reveals a planetary modulation of solar activity and its non-linear dependence on the 11-year solar cycle

    E-Print Network [OSTI]

    Nicola Scafetta; Richard C. Willson

    2013-11-26T23:59:59.000Z

    Herein we adopt a multi-scale dynamical spectral analysis technique to compare and study the dynamical evolution of the harmonic components of the overlapping ACRIMSAT/ACRIM3, SOHO/VIRGO and SORCE/TIM total solar irradiance (TSI) records during 2003.15 to 2013.16 in solar cycles 23 and 24. The three TSI time series present highly correlated patterns. Significant power spectral peaks are common to these records and are observed at the following periods: 0.070 year, 0.097 year, 0.20 year, 0.25 year, 0.30-0.34 year, 0.39 year. Less certain spectral peaks occur at about 0.55 year, 0.60-0.65 year and 0.7-0.9 year. Four main frequency periods at 24.8 days (0.068 year), 27.3 days (0.075 year), at 34-35 days (0.093-0.096 year) and 36-38 days (0.099-0.104 year) characterize the solar rotation cycle. The amplitude of these oscillations, in particular of those with periods larger than 0.5 year, appears to be modulated by the 11-year solar cycle. Similar harmonics have been found in other solar indices. The observed periodicities are found highly coherent with the spring, orbital and synodic periods of Mercury, Venus, Earth and Jupiter. We conclude that solar activity is likely modulated by planetary gravitational and electromagnetic forces acting on the sun. The strength of the sun's response to planetary forcing depends non-linearly on the state of internal solar dynamics: planetary-sun coupling effects are enhanced during solar activity maxima and attenuated during minima.

  1. Ferroelectric optical image comparator

    DOE Patents [OSTI]

    Butler, M.A.; Land, C.E.; Martin, S.J.; Pfeifer, K.B.

    1993-11-30T23:59:59.000Z

    A ferroelectric optical image comparator has a lead lanthanum zirconate titanate thin-film device which is constructed with a semi-transparent or transparent conductive first electrode on one side of the thin film, a conductive metal second electrode on the other side of the thin film, and the second electrode is in contact with a nonconducting substrate. A photoinduced current in the device represents the dot product between a stored image and an image projected onto the first electrode. One-dimensional autocorrelations are performed by measuring this current while displacing the projected image. 7 figures.

  2. Energy Supplier Obligations and White Certificate Schemes: Comparative...

    Open Energy Info (EERE)

    Results in the European Union Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Energy Supplier Obligations and White Certificate Schemes: Comparative Analysis of Results...

  3. Reference set of regulons in Desulfovibrionales inferred by comparative genomics approach

    E-Print Network [OSTI]

    Kazakov, A.E.

    2011-01-01T23:59:59.000Z

    inferred by comparative genomics approach 1 Lawrenceout large-scale comparative genomics analysis of regulatoryEnvironmental Research, Genomics:GTL Foundational Science

  4. Comparative genomics of metabolic capacities of regulons controlled by cis-regulatory RNA motifs in bacteria

    E-Print Network [OSTI]

    Sun, Eric I; Leyn, Semen A; Kazanov, Marat D; Saier, Milton H; Novichkov, Pavel S; Rodionov, Dmitry A

    2013-01-01T23:59:59.000Z

    RH, Breaker RR: Comparative genomics reveals 104 candidateof transporters. BMC Genomics 2008, 9:330. 16. Green NJ,in proteobacteria: comparative genomics analysis. FEMS

  5. COMPARING ALASKA'S OIL PRODUCTION TAXES: INCENTIVES AND ASSUMPTIONS1

    E-Print Network [OSTI]

    Pantaleone, Jim

    context of Alaska oil production taxes, comparing MAPA and ACES to the original petroleum profits tax (PPT1 COMPARING ALASKA'S OIL PRODUCTION TAXES: INCENTIVES AND ASSUMPTIONS1 Matthew Berman In a recent analysis comparing the current oil production tax, More Alaska Production Act (MAPA, also known as SB 21

  6. Supplemental Data. Graeber et al. (2011). A Guideline to Family-wide Comparative State-of-the-art qRT-PCR Analysis Exemplified with a Brassicaceae Cross-species

    E-Print Network [OSTI]

    Leubner, Gerhard

    Supplemental Data. Graeber et al. (2011). A Guideline to Family-wide Comparative State-of-the-art q Methods #12;Supplemental Data. Graeber et al. Plant Cell. (2011): PLANTCELL/2011/084103 2 Supplemental. Graeber et al. Plant Cell. (2011): PLANTCELL/2011/084103 3 Supplemental Table 1. Sequence similarities

  7. Comparing and Contrasting Health and

    E-Print Network [OSTI]

    Entekhabi, Dara

    / private partnership Institutional Change In Health: · The Affordable Care Act (ACA) · The recognitionComparing and Contrasting Health and Transportation as Complex Sociotechnical Systems System: Comparing and Contrasting Health and Transportation as Complex Sociotechnical Systems Ideas about

  8. Comparative Survival Study (CSS) of Hatchery PIT-tagged Spring/Summer Chinook; Migration Years 1997-2002 Mark/Recapture Activities and Bootstrap Analysis, 2003-2004 Biennial Report.

    SciTech Connect (OSTI)

    Berggren, Thomas J.; Franzoni, Henry; Basham, Larry R. (Columbia Basin Fish and Wildlife Authority, Fish Passage Center, Portland, OR)

    2003-11-01T23:59:59.000Z

    The Comparative Survival Study (CSS) was initiated in 1996 as a multi-year program of the fishery agencies and tribes to estimate survival rates over different life stages for spring and summer Chinook (hereafter, Chinook) produced in major hatcheries in the Snake River basin and from selected hatcheries in the lower Columbia River. Much of the information evaluated in the CSS is derived from fish tagged with Passive Integrated Transponder (PIT) tags. A comparison of survival rates of Chinook marked in two different regions (which differ in the number of dams Chinook have to migrate through) provides insight into the effects of the Snake/Columbia hydroelectric system (hydrosystem). The CSS also compares the smolt-to-adult survival rates (SARs) for Snake River Chinook that were transported versus those that migrated in-river to below Bonneville Dam. Additional comparisons can be made within in-river experiences as well as comparison between the different collector projects from which smolts are transported. CSS also compares survival rates for wild Snake River spring and summer Chinook. These comparisons generate information regarding the relative effects of the current management actions used to recover this listed species. Scientists and managers have recently emphasized the importance of delayed hydrosystem mortality to long-term management decisions. Delayed hydrosystem mortality may be related to the smolts experience in the Federal Columbia River Power System, and could occur for both smolts that migrate in-river and smolts that are transported. The CSS PIT tag information on in-river survival rates and smolt-to-adult survival rates (SARs) of transported and in-river fish are relevant to estimation of ''D'', which partially describes delayed hydrosystem mortality. The parameter D is the differential survival rate of transported fish relative to fish that migrate in-river, as measured from below Bonneville Dam to adults returning to Lower Granite Dam. When D = 1, there is no difference in survival rate after hydrosystem passage. When D < 1, then transported smolts die at a greater rate after release below Bonneville Dam than smolts that have migrated in-river to below Bonneville Dam Major objectives of the CSS include: (1) development of a long-term index of transport SAR to in-river SAR for Snake River hatchery and wild spring and summer Chinook smolts measured at Lower Granite Dam; (2) develop a long-term index of survival rates from release of smolts at Snake River hatcheries to return of adults to the hatcheries; (3) compute and compare the overall SARs for selected upriver and downriver spring and summer Chinook hatchery and wild stocks; and (4) begin a time series of SARs for use in hypothesis testing and in the regional long-term monitoring and evaluation program. Primary CSS focus in this report is for wild and hatchery spring/summer Chinook that outmigrated in 1997 to 2002 and their respective adult returns through 2004.

  9. Direct comparative study on the energy level alignments in unoccupied/occupied states of organic semiconductor/electrode interface by constructing in-situ photoemission spectroscopy and Ar gas cluster ion beam sputtering integrated analysis system

    SciTech Connect (OSTI)

    Yun, Dong-Jin, E-mail: Dongjin.yun@samsung.com; Chung, JaeGwan; Kim, Yongsu; Park, Sung-Hoon; Kim, Seong-Heon; Heo, Sung [Analytical Science Laboratory of Samsung Advanced Institute of Technology, PO Box 14-1, Yongin 446-712 (Korea, Republic of)

    2014-10-21T23:59:59.000Z

    Through the installation of electron gun and photon detector, an in-situ photoemission and damage-free sputtering integrated analysis system is completely constructed. Therefore, this system enables to accurately characterize the energy level alignments including unoccupied/occupied molecular orbital (LUMO/HOMO) levels at interface region of organic semiconductor/electrode according to depth position. Based on Ultraviolet Photoemission Spectroscopy (UPS), Inverse Photoemission Spectroscopy (IPES), and reflective electron energy loss spectroscopy, the occupied/unoccupied state of in-situ deposited Tris[4-(carbazol-9-yl)phenyl]amine (TCTA) organic semiconductors on Au (E{sub LUMO}: 2.51?eV and E{sub HOMO}: 1.35?eV) and Ti (E{sub LUMO}: 2.19?eV and E{sub HOMO}: 1.69?eV) electrodes are investigated, and the variation of energy level alignments according to work function of electrode (Au: 4.81?eV and Ti: 4.19?eV) is clearly verified. Subsequently, under the same analysis condition, the unoccupied/occupied states at bulk region of TCTA/Au structures are characterized using different Ar gas cluster ion beam (Ar GCIB) and Ar ion sputtering processes, respectively. While the Ar ion sputtering process critically distorts both occupied and unoccupied states in UPS/IPES spectra, the Ar GCIB sputtering process does not give rise to damage on them. Therefore, we clearly confirm that the in-situ photoemission spectroscopy in combination with Ar GCIB sputtering allows of investigating accurate energy level alignments at bulk/interface region as well as surface region of organic semiconductor/electrode structure.

  10. Harbour Island: The Comparative Archaeology of a Maritime Community

    E-Print Network [OSTI]

    Hatch, Heather E

    2013-08-01T23:59:59.000Z

    assemblages of maritime communities that indicate maritimity. Analysis relies on Stanley South's artifact classification system and his Carolina Artifact pattern. The nine properties are compared among themselves as well as with four other sites from...

  11. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    5.A.6 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURE for REPORTING PHYSICAL PLANT AND ENVIRONMENTAL CONDITIONS ABNORMALITIES AT THE COMPARATIVE MEDICINE LABORATORY ANIMAL investigator to keep her/him informed of the progress or resolution of the problem. #12;

  12. ALGORITHMS FOR CONSTRUCTING COMPARATIVE MAPS

    E-Print Network [OSTI]

    Kleinberg, Jon

    (i.e. that the segments are homeologous). The construction of comparative maps between the genomes and phylogenetic relationships among species as well as fundamental principles of genome evolution. Comparative maps allow us to use structural and functional information about one genome to make predictions about

  13. Dairy Analytics and Nutrient Analysis (DANA) Prototype System User Manual

    SciTech Connect (OSTI)

    Sam Alessi; Dennis Keiser

    2012-10-01T23:59:59.000Z

    This document is a user manual for the Dairy Analytics and Nutrient Analysis (DANA) model. DANA provides an analysis of dairy anaerobic digestion technology and allows users to calculate biogas production, co-product valuation, capital costs, expenses, revenue and financial metrics, for user customizable scenarios, dairy and digester types. The model provides results for three anaerobic digester types; Covered Lagoons, Modified Plug Flow, and Complete Mix, and three main energy production technologies; electricity generation, renewable natural gas generation, and compressed natural gas generation. Additional options include different dairy types, bedding types, backend treatment type as well as numerous production, and economic parameters. DANA’s goal is to extend the National Market Value of Anaerobic Digester Products analysis (informa economics, 2012; Innovation Center, 2011) to include a greater and more flexible set of regional digester scenarios and to provide a modular framework for creation of a tool to support farmer and investor needs. Users can set up scenarios from combinations of existing parameters or add new parameters, run the model and view a variety of reports, charts and tables that are automatically produced and delivered over the web interface. DANA is based in the INL’s analysis architecture entitled Generalized Environment for Modeling Systems (GEMS) , which offers extensive collaboration, analysis, and integration opportunities and greatly speeds the ability construct highly scalable web delivered user-oriented decision tools. DANA’s approach uses server-based data processing and web-based user interfaces, rather a client-based spreadsheet approach. This offers a number of benefits over the client-based approach. Server processing and storage can scale up to handle a very large number of scenarios, so that analysis of county, even field level, across the whole U.S., can be performed. Server based databases allow dairy and digester parameters be held and managed in a single managed data repository, while allows users to customize standard values and perform individual analysis. Server-based calculations can be easily extended, versions and upgrades managed, and any changes are immediately available to all users. This user manual describes how to use and/or modify input database tables, run DANA, view and modify reports.

  14. Enhancer Identification through Comparative Genomics

    E-Print Network [OSTI]

    Visel, Axel; Bristow, James; Pennacchio, Len A.

    2006-01-01T23:59:59.000Z

    through Comparative Genomics Axel Visel, James Bristow andWalnut Creek, CA 94598 USA. Genomics Division, MS 84-171,Len A. Pennacchio, Genomics Division, One Cyclotron Road, MS

  15. 4, 43254360, 2007 Comparing model

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    HESSD 4, 4325­4360, 2007 Comparing model performance in the Rhine basin A. H. te Linde et al. Title different atmospheric forcing data sets A. H. te Linde 1 , J. C. J. H. Aerts 1 , R. T. W. L. Hurkmans 2 Correspondence to: A. H. te Linde (aline.te.linde@ivm.vu.nl) 4325 #12;HESSD 4, 4325­4360, 2007 Comparing model

  16. COMPARING FOREST MANAGEMENT PRACTICES UNDER

    E-Print Network [OSTI]

    COMPARING FOREST MANAGEMENT PRACTICES UNDER COMMUNITY-BASED AND CONVENTIONAL TENURES IN BRITISH OF MASTER OF RESOURCE MANAGEMENT In the School of Resource and Environmental Management © David Mealiea 2011 of Canada, this work may be reproduced, without authorization, under the conditions for Fair Dealing

  17. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    4.A.7 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURES LUNAR PIXIMUS MACHINE 1.0 Purpose This procedure outlines precautions, maintenance and use of the Lunar PIXImus Machine housed in room 310 BEB. 2.0 Scope This procedure applies to all CMLAF and principal investigator staff. 3

  18. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    3.E.1 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURES for ACCESS, and the correct way to leave the facility. 2.0 Scope: This procedure applies to all CMLAF staff, maintenance, ENTRY, AND EXIT PROCEDURES FOR THE ANIMAL BIOSAFETY SUITE ROOM 305 BEB 1.0 Purpose: The Biosafety suite

  19. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    5.A.4 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURE for CRITICAL Plant and maintenance personnel as well as CMLAF personnel that will be notified. 3.0 Procedure ALARM RESPONSE PROCEDURE FOR CHILLED WATER PLANT 1.0 Purpose: This SOP outlines the procedure

  20. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    1.E.1 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURE for ENTRY RODENT FACILITY 1. I have read, understand, and will follow the Standard Operating Procedures listed: This procedure applies to all CMLAF, principal investigator and maintenance personnel 3.0 Procedure: 3

  1. Comparative Study of Vented vs. Unvented Crawlspaces

    SciTech Connect (OSTI)

    Biswas, Kaushik [ORNL; Christian, Jeffrey E [ORNL; Gehl, Anthony C [ORNL

    2011-10-01T23:59:59.000Z

    There has been a significant amount of research in the area of building energy efficiency and durability. However, well-documented quantitative information on the impact of crawlspaces on the performance of residential structures is lacking. The objective of this study was to evaluate and compare the effects of two crawlspace strategies on the whole-house performance of a pair of houses in a mixed humid climate. These houses were built with advanced envelope systems to provide energy savings of 50% or more compared to traditional 2010 new construction. One crawlspace contains insulated walls and is sealed and semi-conditioned. The other is a traditional vented crawlspace with insulation in the crawlspace ceiling. The vented (traditional) crawlspace contains fiberglass batts installed in the floor chase cavities above the crawl, while the sealed and insulated crawlspace contains foil-faced polyisocyanurate foam insulation on the interior side of the masonry walls. Various sensors to measure temperatures, heat flux through crawlspace walls and ceiling, and relative humidity were installed in the two crawlspaces. Data from these sensors have been analyzed to compare the performance of the two crawlspace designs. The analysis results indicated that the sealed and insulated crawlspace design is better than the traditional vented crawlspace in the mixed humid climate.

  2. Lessons from a Comparative Analysis of California and PJM Electricity

    E-Print Network [OSTI]

    Delaware, University of

    .4 Market Performance Before the State's Crisis:1998-1999......................11 2.4.1 Wholesale Market.1.1 High Wholesale Prices.................................................................15 3..................................................................................16 3.2.1 Mismatch: Wholesale and Retail Electricity Prices.....................17 3.2.2 Lack

  3. Fast food in a Chinese provincial city: a comparative analysis 

    E-Print Network [OSTI]

    Zhu, Haiying

    2006-08-16T23:59:59.000Z

    More than a decade ago American fast food entered the Chinese market. Since then the number of fast food and organized chain restaurants in China has multiplied. Chinese consumers, especially those who live in large urban ...

  4. Fast food in a Chinese provincial city: a comparative analysis

    E-Print Network [OSTI]

    Zhu, Haiying

    2006-08-16T23:59:59.000Z

    ), the attributes of criterion with which consumers differentiate between fast food restaurants are found to include: taste, price, nutrition, cleanliness, environment, speed of service, convenient location, fashion & novelty, friendliness, and variety of menu..., service, cleanliness, and general appearance. Considering the comprehension skills of students, I included only 15 multiple choice questions, making the questionnaire much shorter than the one I administered to consumers. The questionnaire was designed...

  5. Comparative analysis of aviation safety information feedback systems

    E-Print Network [OSTI]

    Funahashi, Yoshifuru

    2010-01-01T23:59:59.000Z

    In the aviation system, there are several feedback systems to prevent an accident. First of all, the accident and serious incident reporting and investigation system is established by the Chicago Convention. In general, ...

  6. Comparative Usability Study of Two Space Logistics Analysis Tools

    E-Print Network [OSTI]

    Lee, Chairwoo

    Future space exploration missions and campaigns will require sophisticated tools to help plan and analyze logistics. To encourage their use, space logistics tools must be usable: a design concept encompassing terms such ...

  7. Comparative Analysis of Second Language Instruction and Motivation

    E-Print Network [OSTI]

    Speights, Lara A.

    2010-07-14T23:59:59.000Z

    school second language instruction in Buenos Aires, Argentina and College Station, Texas. The purpose of this study is to explain theoretical and motivational pedagogical strategies, as well as to understand the differences in motivation and how...

  8. RESEARCH ARTICLE Open Access Comparative analysis of missing value imputation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    algorithms is a complex task, we observed that k-means approach is more efficient to conserve gene obtained by classical clustering methods, e.g., hierarchical clustering [19], k-means clustering [20 the quality of the imputation method and the gene cluster stability. Even if the comparison between clustering

  9. Accuracy of Contemporary Parametric Software Estimation Models: A Comparative Analysis

    E-Print Network [OSTI]

    Tomkins, Andrew

    with delays and being costly and error- prone. Inaccurate estimation of project resources is considered as one the costs, schedule and the resources for IT projects. Software estimation is the process of predicting the effort, duration and cost required to develop a software system [2]. Estimators often rely on one or more

  10. analysis comparing responses: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    tax revenues of the Consolidated Budget of Ukraine took place. With Approval of the Budgetary Code the situation slightly improved as far as local finances are concerned. As a...

  11. Using IMG: Comparative Analysis with the Integrated Microbial Genomes System

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    for genome annotation: PRIAM. Nucleic Acids Research 31 (RPS-BLAST against the PRIAM database (12), as a complementBLAST computations. Computation COG PRIAM Tool Low- Maximum

  12. Comparative analysis of sesame varieties from diverse climates

    E-Print Network [OSTI]

    Nwe, Tin

    1986-01-01T23:59:59.000Z

    -LP-3-4 Pa lorna Eva U. S. A. U. S. A. U. S. A. U. S. A. U. S. A. Yambio Bakibo Bura Jar Sudan Sudan Sudan Sudan 12 2. Days to first flowering - They were calculated by observing the number of days from planting to the first bloom. 3..., SW-16, and SB-9-LP-3-4, produced the heaviest seed while the varieties, Jar and Kyemachaung produced the lightest. Judian, Nedawletthe, Pope Pye, Yegyaw, Gwataya, UCR-3-RA-12, Paloma, Eva, Yambio, Bakibo, and Bura, produced seed that were medium...

  13. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    E-Print Network [OSTI]

    Riley, Robert W.

    2011-01-01T23:59:59.000Z

    lack carbohydrate metabolism enzymes 9,1893 clusters 190,095 proteins •?Protein kinase Aldo_ket_red GMC_oxred_C Aldo-keto reductase Oxidoreductase, possible cellobiose dehydrogenase •?Brown rots (BR) virtually lack

  14. COMPARATIVE STATISTICAL ANALYSIS OF TEST PARTS MANUFACTURED IN PRODUCTION

    E-Print Network [OSTI]

    Gilsinn, David E.

    measured using a laser ball bar instrument. Twenty-one copies of the part were produced and measured to actual part error uncertainties. Keywords: coordinate measuring machine, drilling, error uncertainties, laser ball bar, machine tools, machine tool errors, milling, Monte Carlo, propagation of uncertainty

  15. A comparative analysis of area navigation systems for general aviation

    E-Print Network [OSTI]

    Dodge, Steven Malcolm

    1973-01-01T23:59:59.000Z

    Within the next decade area navigation is to become the primary method of air navigation within the United States. There are numerous radio navigation systems that offer the capabilities of area navigation to general ...

  16. Comparative analysis of proteome and transcriptome variation in mouse

    E-Print Network [OSTI]

    2011-01-01T23:59:59.000Z

    Ghazalpour 1 * . , Brian Bennett 1. , Vladislav A. PetyukNat Genet 41: 166–167. 12. Bennett BJ, Farber CR, Orozco L,Citation: Ghazalpour A, Bennett B, Petyuk VA, Orozco L,

  17. ccsd00001953, A comparative analysis of the electron energy

    E-Print Network [OSTI]

    -1027, 11801 M#19;exico D. F., MEXICO E-mail: cgt@nuclear.inin.mx Abstract. To establish the electron energy

  18. Comparative Genomic Analysis of Human Fungal Pathogens Causing Paracoccidioidomycosis

    E-Print Network [OSTI]

    Holder, Jason W.

    Paracoccidioides is a fungal pathogen and the cause of paracoccidioidomycosis, a health-threatening human systemic mycosis endemic to Latin America. Infection by Paracoccidioides, a dimorphic fungus in the order Onygenales, ...

  19. Comparative DNA Sequence Analysis of Wheat and Rice Genomes

    E-Print Network [OSTI]

    Gill, Kulvinder

    . Gill,4 David E. Matthews,5 Gerard R. Lazo,5 Shiaoman Chao,5 Olin D. Anderson,5 Hugh Edwards,6 Anna M,8 Nora L.V. Lapitan,8 Jose L. Gonzalez-Hernandez,9 James A. Anderson,9 Khwaja Hossain,10 Venu. Gill,12 Camille Steber,12 Mary K. Walker-Simmons,13 Patrick E. McGuire,14 and Calvin O. Qualset14 1

  20. Comparative genomics and evolution of eukaryotic phospholipidbiosynthesis

    SciTech Connect (OSTI)

    Lykidis, Athanasios

    2006-12-01T23:59:59.000Z

    Phospholipid biosynthetic enzymes produce diverse molecular structures and are often present in multiple forms encoded by different genes. This work utilizes comparative genomics and phylogenetics for exploring the distribution, structure and evolution of phospholipid biosynthetic genes and pathways in 26 eukaryotic genomes. Although the basic structure of the pathways was formed early in eukaryotic evolution, the emerging picture indicates that individual enzyme families followed unique evolutionary courses. For example, choline and ethanolamine kinases and cytidylyltransferases emerged in ancestral eukaryotes, whereas, multiple forms of the corresponding phosphatidyltransferases evolved mainly in a lineage specific manner. Furthermore, several unicellular eukaryotes maintain bacterial-type enzymes and reactions for the synthesis of phosphatidylglycerol and cardiolipin. Also, base-exchange phosphatidylserine synthases are widespread and ancestral enzymes. The multiplicity of phospholipid biosynthetic enzymes has been largely generated by gene expansion in a lineage specific manner. Thus, these observations suggest that phospholipid biosynthesis has been an actively evolving system. Finally, comparative genomic analysis indicates the existence of novel phosphatidyltransferases and provides a candidate for the uncharacterized eukaryotic phosphatidylglycerol phosphate phosphatase.

  1. Comparative and Functional Genomics Comp Funct Genom 2003; 4: 239245.

    E-Print Network [OSTI]

    Wurtele, Eve Syrkin

    Comparative and Functional Genomics Comp Funct Genom 2003; 4: 239­245. Published online 1 April://www.botany.iastate.edu/mash/metnetex/metabolicnetex.html) is pub- licly available software in development for analysis of genome-wide RNA, protein and metabolite in the post-genome era is to understand how interactions among molecules in a cell determine its form

  2. A Comparative Life Cycle Assessment of Petroleum and

    E-Print Network [OSTI]

    Illinois at Chicago, University of

    A Comparative Life Cycle Assessment of Petroleum and Soybean-Based Lubricants S H E L I E A . M I L assessment examining soybean and petroleum-based lubricants is compiled using Monte Carlo analysis to assess in this paper suggests that such potential exists. Over two billion gallons (7.5 billion liters) of petroleum

  3. Comparing systemic risk in European government bonds and national indices

    E-Print Network [OSTI]

    Jurczyk, Jan; Morgenstern, Ingo

    2015-01-01T23:59:59.000Z

    It has been shown, that the systemic risk contained in financial markets can be indicated by the change of cross-correlation between different indices and stocks. This change is tracked by using principle component analysis (PCA). We use this technique to investigate the systemic risk contained in European economy by comparing government long term bonds and indices.

  4. Cetane Performance and Chemistry Comparing Conventional Fuels...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Performance and Chemistry Comparing Conventional Fuels and Fuels Derived from Heavy Crude Sources Cetane Performance and Chemistry Comparing Conventional Fuels and Fuels...

  5. VISTA - computational tools for comparative genomics

    E-Print Network [OSTI]

    Frazer, Kelly A.; Pachter, Lior; Poliakov, Alexander; Rubin, Edward M.; Dubchak, Inna

    2004-01-01T23:59:59.000Z

    tools for comparative genomics Kelly A. Frazer 1 , LiorBerkeley, CA, 94720 Genomics Division, Lawrence Berkeleymultiple comparative genomics tools and provides users with

  6. OrthoCluster: A New Tool for Mining Synteny Blocks and Applications in Comparative Genomics

    E-Print Network [OSTI]

    Pei, Jian

    OrthoCluster: A New Tool for Mining Synteny Blocks and Applications in Comparative Genomics Xinghuo, jpei, wangk}@cs.sfu.ca {iav, mnesbitt, chenn}@sfu.ca ABSTRACT By comparing genomes among both closely and distally re- lated species, comparative genomics analysis characterizes structures and functions

  7. OrthoCluster: A New Tool for Mining Synteny Blocks and Applications in Comparative Genomics

    E-Print Network [OSTI]

    Wang, Ke

    OrthoCluster: A New Tool for Mining Synteny Blocks and Applications in Comparative Genomics Xinghuo, jpei, wangk}@cs.sfu.ca {iav, chenn}@sfu.ca, mattjnesbitt@alumni.sfu.ca ABSTRACT By comparing genomes among both closely and distally re- lated species, comparative genomics analysis characterizes

  8. Comparing materials used in mist eliminators

    SciTech Connect (OSTI)

    Looney, B.; Baleno, B.; Boles, G.L.; Telow, J. [Solvay Advanced Polyers (United States)

    2007-11-15T23:59:59.000Z

    Wet flue gas desulfurization (FGD) systems, or wet scrubbers, are notoriously capital - and maintenance-intensive. Mist eliminators are an integral part of most wet FGD systems. These are available in a variety of materials - polypropylene, fiberglass reinforced polymer (FRP), polysulfone and stainless steel. The article discusses the material properties, performance attributes and relative cost differences associated with each of these four materials. It describes the common problems with mist eliminators - fouling and corrosion. These can be minimised by routine cleaning and use of chemical additives to prevent deposition. An analysis was carried out to compare the four materials at APS Cholla power plant. As a result the facility is retrofitting its remaining wet scrubber towers in Unit 2 with mist eliminators constructed from polysulfone as each of the current ones of the existing polypropylene needs replacing. Polysulfone is cheaper to clean and components require replacing less frequently than polypropylene. Switching from stainless steel to polypropylene has proved advantageous on 22 wet scrubbers operated by PPL Montana. 5 figs. 2 tabs.

  9. Insights into C4 metabolism from comparative deep sequencing

    E-Print Network [OSTI]

    Burgess, Steven J.; Hibberd, Julian M.

    2015-06-05T23:59:59.000Z

    subtypes: insights from comparative transcriptome analysis of NAD-ME, NADP-219 ME, and PEP-CK C4 species. J. Exp. Bot. 2014, 65:3579–93. 220 12. Brautigam A, Kajala K, Wullenweber J, Sommer M, Gagneul D, Weber KL, Carr KM, Gowik U, Mass J, 221 Lercher... 11 16. Wang Y, Bräutigam A, Weber APM, Zhu X-G: Three distinct biochemical subtypes of C4 235 photosynthesis? A modelling analysis. J. Exp. Bot. 2014, 65:3567–78. 236 17. Sommer M, Bräutigam A, Weber APM: The dicotyledonous NAD malic enzyme C4...

  10. COMPARATIVE COSTS OF CALIFORNIA CENTRAL STATION ELECTRICITY

    E-Print Network [OSTI]

    CALIFORNIA ENERGY COMMISSION COMPARATIVE COSTS OF CALIFORNIA CENTRAL STATION ELECTRICITY GENERATIONCann Please use the following citation for this report: Klein, Joel. 2009. Comparative Costs of California............................................................................................................................1 Changes in the Cost of Generation Model

  11. COMPARATIVE COSTS OF CALIFORNIA CENTRAL STATION ELECTRICITY

    E-Print Network [OSTI]

    Laughlin, Robert B.

    CALIFORNIA ENERGY COMMISSION COMPARATIVE COSTS OF CALIFORNIA CENTRAL STATION ELECTRICITY GENERATION and Anitha Rednam, Comparative Costs of California Central Station Electricity Generation Technologies................................................................................................... 1 CHAPTER 1: Summary of Technology Costs

  12. Educational Poverty in a Comparative Perspective

    E-Print Network [OSTI]

    Moeller, Ralf

    Educational Poverty in a Comparative Perspective: Theoretical and Empirical Implications SFB 882 Ferger Educational Poverty in a Comparative Perspective: Theoretical and Empirical Implications SFB 882 and Education: An International Comparison of Educational Poverty" This project studies the determinants

  13. INVITED: Comparative Microbial Genomics Giri Narasimhan

    E-Print Network [OSTI]

    Narasimhan, Giri

    INVITED: Comparative Microbial Genomics Giri Narasimhan Bioinformatics Research Group (Bio, comparative genomics holds the keys to decipher and mine this wealth of information. We discuss the diverse ways in which the availability of comparative genomics data allows us to answer more questions

  14. A Statistical Framework for Spatial Comparative Genomics

    E-Print Network [OSTI]

    A Statistical Framework for Spatial Comparative Genomics Rose Hoberman May 2007 CMU-CS-07, or the U.S. Government. #12;Keywords: spatial comparative genomics, comparative genomics, gene clusters, max-gap clusters, gene teams, whole genome duplication, paralogons, synteny, ortholog detection #12

  15. Comparative phosphoproteomics reveals components of host cell...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    only hyper-cytotoxic but also were phagocytosed at much higher rates compared to the wild type parent strain. To elucidate the cellular signaling underlying this enhanced...

  16. MicrobesOnline: an integrated portal for comparative and functional genomics

    E-Print Network [OSTI]

    Dehal, Paramvir S.

    Since 2003, MicrobesOnline (http://www.microbesonline.org) has been providing a community resource for comparative and functional genome analysis. The portal includes over 1000 complete genomes of bacteria, archaea and ...

  17. A Framework for Comparative Assessments of Energy Efficiency Policy Measures

    SciTech Connect (OSTI)

    Blum, Helcio; Atkinson, Barbara; Lekov, Alex

    2011-05-24T23:59:59.000Z

    When policy makers propose new policies, there is a need to assess the costs and benefits of the proposed policy measures, to compare them to existing and alternative policies, and to rank them according to their effectiveness. In the case of equipment energy efficiency regulations, comparing the effects of a range of alternative policy measures requires evaluating their effects on consumers’ budgets, on national energy consumption and economics, and on the environment. Such an approach should be able to represent in a single framework the particularities of each policy measure and provide comparable results. This report presents an integrated methodological framework to assess prospectively the energy, economic, and environmental impacts of energy efficiency policy measures. The framework builds on the premise that the comparative assessment of energy efficiency policy measures should (a) rely on a common set of primary data and parameters, (b) follow a single functional approach to estimate the energy, economic, and emissions savings resulting from each assessed measure, and (c) present results through a set of comparable indicators. This framework elaborates on models that the U.S. Department of Energy (DOE) has used in support of its rulemakings on mandatory energy efficiency standards. In addition to a rigorous analysis of the impacts of mandatory standards, DOE compares the projected results of alternative policy measures to those projected to be achieved by the standards. The framework extends such an approach to provide a broad, generic methodology, with no geographic or sectoral limitations, that is useful for evaluating any type of equipment energy efficiency market intervention. The report concludes with a demonstration of how to use the framework to compare the impacts estimated for twelve policy measures focusing on increasing the energy efficiency of gas furnaces in the United States.

  18. Comparative guide to emerging diagnostic tools for large commercial HVAC systems

    SciTech Connect (OSTI)

    Friedman, Hannah; Piette, Mary Ann

    2001-05-01T23:59:59.000Z

    This guide compares emerging diagnostic software tools that aid detection and diagnosis of operational problems for large HVAC systems. We have evaluated six tools for use with energy management control system (EMCS) or other monitoring data. The diagnostic tools summarize relevant performance metrics, display plots for manual analysis, and perform automated diagnostic procedures. Our comparative analysis presents nine summary tables with supporting explanatory text and includes sample diagnostic screens for each tool.

  19. International Master's Program in Comparative Social Research

    E-Print Network [OSTI]

    Greifswald, Ernst-Moritz-Arndt-Universität

    . Academic skills ­ in particular, the ability to write scientific articles based on the analysis for top students. · Professional, program-specific staffing. · Academic orientation, with additionalD programs in collaboration with the HSE academic PhD program. 2. Skills of applied research analysis

  20. Assembly free comparative genomics of short-read sequence data discovers the needles in the haystack

    E-Print Network [OSTI]

    Assembly free comparative genomics of short-read sequence data discovers the needles of Biological Sciences, Texas Tech University, Lubbock, TX 79409, USA Abstract Most comparative genomic analyses an assembly free analysis of SRS data that discovers sequence variants among focal genomes by tabulating

  1. Simulation of Distributed Search Engines: Comparing Term, Document and Hybrid Distribution1

    E-Print Network [OSTI]

    Waterloo, University of

    Simulation of Distributed Search Engines: Comparing Term, Document and Hybrid Distribution1 Andrew as a course project for `CS 856 Advanced Topics in Distributed Computing - Performance Modeling and Analysis' taught by Professor Johnny Wong in Winter 2008. #12;Simulation of Distributed Search Engines: Comparing

  2. Security Patterns: Comparing Modeling Approaches Armstrong NHLABATSI

    E-Print Network [OSTI]

    Jurjens, Jan

    Security Patterns: Comparing Modeling Approaches Armstrong NHLABATSI ** , Arosha BANDARA the challenges of developing secure software systems remains an active research area in software engineering. Current research efforts have resulted in the documentation of recurring security problems as security

  3. A Framework for Comparative Assessments of Energy Efficiency Policy Measures

    E-Print Network [OSTI]

    Blum, Helcio

    2012-01-01T23:59:59.000Z

    premise that the comparative assessment of energy efficiencypremise that the comparative assessment of energy efficiency

  4. Sequencing and comparing whole mitochondrial genomes ofanimals

    SciTech Connect (OSTI)

    Boore, Jeffrey L.; Macey, J. Robert; Medina, Monica

    2005-04-22T23:59:59.000Z

    Comparing complete animal mitochondrial genome sequences is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. Not only are they much more informative than shorter sequences of individual genes for inferring evolutionary relatedness, but these data also provide sets of genome-level characters, such as the relative arrangements of genes, that can be especially powerful. We describe here the protocols commonly used for physically isolating mtDNA, for amplifying these by PCR or RCA, for cloning,sequencing, assembly, validation, and gene annotation, and for comparing both sequences and gene arrangements. On several topics, we offer general observations based on our experiences to date with determining and comparing complete mtDNA sequences.

  5. Economic analysis

    SciTech Connect (OSTI)

    None

    1980-06-01T23:59:59.000Z

    The Energy Policy and Conservation Act (EPCA) mandated that minimum energy efficiency standards be established for classes of refrigerators and refrigerator-freezers, freezers, clothes dryers, water heaters, room air conditioners, home heating equipment, kitchen ranges and ovens, central air conditioners, and furnaces. EPCA requires that standards be designed to achieve the maximum improvement in energy efficiency that is technologically feasible and economically justified. Following the introductory chapter, Chapter Two describes the methodology used in the economic analysis and its relationship to legislative criteria for consumer product efficiency assessment; details how the CPES Value Model systematically compared and evaluated the economic impacts of regulation on the consumer, manufacturer and Nation. Chapter Three briefly displays the results of the analysis and lists the proposed performance standards by product class. Chapter Four describes the reasons for developing a baseline forecast, characterizes the baseline scenario from which regulatory impacts were calculated and summarizes the primary models, data sources and assumptions used in the baseline formulations. Chapter Five summarizes the methodology used to calculate regulatory impacts; describes the impacts of energy performance standards relative to the baseline discussed in Chapter Four. Also discussed are regional standards and other program alternatives to performance standards. Chapter Six describes the procedure for balancing consumer, manufacturer, and national impacts to select standard levels. Details of models and data bases used in the analysis are included in Appendices A through K.

  6. Abduction Compared with Negation by Failure

    E-Print Network [OSTI]

    Koehn, Philipp

    Abduction Compared with Negation by Failure K. Eshghi * Hewlett Packard Laboratories programming can be extended to include abduction with integrity constraints. In the resulting extension for negation by failure, which generalises the stable model semantics of negation by failure. The abductive

  7. Protein Models Comparator Scalable Bioinformatics Computing on

    E-Print Network [OSTI]

    Krasnogor, Natalio

    of parameters of energy functions used in template-free modelling and refinement. Although many protein Engine cloud platform and is a showcase of how the emerging PaaS (Platform as a Service) technology could, the predicted structure is compared against the target native structure. This type of evaluation is performed

  8. IPE results as compared with NUREG-1150

    SciTech Connect (OSTI)

    Pratt, W.T.; Lehner, J. [Brookhaven National Lab., Upton, NY (United States); Camp, A. [Sandia National Lab., Albuqurque, NM (United States); Chow, E. [Nuclear Regulatory Commission, Rockville, MD (United States)

    1995-12-31T23:59:59.000Z

    In 1990, the NRC published NUREG-1150 which assessed the risks for five U.S. nuclear power plants. This paper provides a comparison of the results and perspectives obtained from the NUREG-1150 study to those obtained form the Individual Plant Examination (IPE) program. Specifically, results and perspectives on core damage frequency and containment performance are compared.

  9. Original article Neisseria Base: a comparative genomics

    E-Print Network [OSTI]

    Jordan, King

    Original article Neisseria Base: a comparative genomics database for Neisseria meningitidis Lee S, septicemia and in some cases pneumonia. Genomic studies hold great promise for N. meningitidis research genomics database and genome browser that houses and displays publicly available N. meningitidis genomes

  10. A Novel Approach for Comparative Genomics

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A Novel Approach for Comparative Genomics & Annotation Transfer Alban MANCHERON Raluca URICARU Eric is genome comparison good for?" Genome comparison is crucial for genome annotation, regulatory motifs identification, and vaccine design aims at finding genomic regions either specific to or in one

  11. Hindawi Publishing Corporation Comparative and Functional Genomics

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    Hindawi Publishing Corporation Comparative and Functional Genomics Volume 2007, Article ID 47304, 7 pages doi:10.1155/2007/47304 Meeting Report eGenomics: Cataloguing Our Complete Genome Collection III, Michigan State University, East Lansing, MI 48824, USA 3 The Institute for Genomic Research, 9712 Medical

  12. COMPARATIVE MEDICINE AND LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    COMPARATIVE MEDICINE AND LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURES For Guillotine Maintenance at the CMLAF 1.0 Purpose: This procedure details the rationale and justification for the use of the guillotine 2.0 Scope: This procedure applies to all CMLAF staff as well as research staff using

  13. THE COMPARATIVE VALUE OF BIOLOGICAL CARBON SEQUESTRATION

    E-Print Network [OSTI]

    McCarl, Bruce A.

    THE COMPARATIVE VALUE OF BIOLOGICAL CARBON SEQUESTRATION BRUCE A. MCCARL, BRIAN C. MURRAY, AND UWE A. SCHNEIDER A. Abstract Carbon sequestration via forests and agricultural soils saturates over time to sequestration because of (1) an ecosystems limited ability to take up carbon which we will call saturation

  14. COMPUTATIONAL COMPARATIVE GENOMICS: GENES, REGULATION, EVOLUTION

    E-Print Network [OSTI]

    Kellis, Manolis

    COMPUTATIONAL COMPARATIVE GENOMICS: GENES, REGULATION, EVOLUTION by Manolis (Kellis) Kamvysselis B.S. Electrical Engineering and Computer Science; M. Eng. Computer Science and Engineering Massachusetts Institute at the Massachusetts Institute of Technology June 2003 © 2003 Massachusetts Institute of Technology All rights reserved

  15. BIOINFORMATICS Comparative Evaluation of Reverse Engineering Gene

    E-Print Network [OSTI]

    Babu, M. Madan

    BIOINFORMATICS Comparative Evaluation of Reverse Engineering Gene Regulatory Networks of Statistics, University of Dortmund, Germany ABSTRACT Motivation: An important problem in systems biology into account. This suggests that the higher computational costs of infe- rence with BNs over GGMs and RNs

  16. Alternative future scenarios for the SPS comparative assessment

    SciTech Connect (OSTI)

    Ayres, R.U.; Ridker, R.G.; Watson, W.D. Jr.; Arnold, J.; Tayi, G.

    1980-08-01T23:59:59.000Z

    The objective of the comparative assessment is to develop an initial understanding of the SPS with respect to a limited set of energy alternatives. A comparative methodology report describes the multi-step process in the comparative assessment. The first step is the selection and characterization of alternative energy systems. Terrestrial alternatives are selected, and their cost, performance, and environmental and social attributes are specified for use in the comparison with the SPS in the post-2000 era. Data on alternative technologies were sought from previous research and from other comparisons. The object of this study is to provide a futures framework for evaluating SPS (i.e., factor prices, primary energy prices, and energy demands for the US from 1980 to 2030). The economic/energy interactions are discussed, and a number of specific modelling schemes that have been used for long-range forecasting purposes are described. This discussion provides the rationale for the choice of a specific model and methodology, which is described. Long-range cost assumptions used in the forecast are detailed, and the basis for the selection of specific scenarios follows. Results of the analysis are detailed. (WHK)

  17. Comparing Computer Run Time of Building Simulation Programs

    E-Print Network [OSTI]

    Hong, Tianzhen

    2008-01-01T23:59:59.000Z

    an approach to comparing computer run time of buildingthe purpose of comparing computer run time. Modelers shouldATIONAL L ABORATORY Comparing Computer Run Time of Building

  18. Solar central receiver systems comparative economics

    SciTech Connect (OSTI)

    Eicker, P J

    1980-04-01T23:59:59.000Z

    Several major conceptual design studies of solar central receiver systems and components have been completed in the last year. The results of these studies are used to compare the projected cost of electric power generation using central receiver systems with that of more conventional power generation. The cost estimate for a molten salt central receiver system is given. Levelized busbar energy cost is shown as a function of annual capacity factor indicating the fraction of the cost due to each of the subsystems. The estimated levelized busbar energy cost for a central receiver (70 to 90 mills per kilowatt hour) is compared with the levelized busbar energy cost for a new coal fired Rankine cycle plant. Sensitivities to the initial cost of coal and the delta fuel escalation are shown. (WHK)

  19. Comparing Efficiency Projections (released in AEO2010)

    Reports and Publications (EIA)

    2010-01-01T23:59:59.000Z

    Realized improvements in energy efficiency generally rely on a combination of technology and economics. The figure below illustrates the role of technology assumptions in the Annual Energy Outlook 2010 projections for energy efficiency in the residential and commercial buildings sector. Projected energy consumption in the Reference case is compared with projections in the Best Available Technology, High Technology, and 2009 Technology cases and an estimate based on an assumption of no change in efficiency for building shells and equipment.

  20. Compare My Energy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof EnergyInnovationin UrbanCityCoatedCommunityCompacTecMenlo Avenue SuiteA1 SunCompare

  1. How We Compare - HPMC Occupational Health Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh School football Highdefault SignInstitute /DoDepartment ofHowCompare

  2. Modeling Time in Computing: A Taxonomy and a Comparative Survey

    E-Print Network [OSTI]

    Carlo A. Furia; Dino Mandrioli; Angelo Morzenti; Matteo Rossi

    2010-10-11T23:59:59.000Z

    The increasing relevance of areas such as real-time and embedded systems, pervasive computing, hybrid systems control, and biological and social systems modeling is bringing a growing attention to the temporal aspects of computing, not only in the computer science domain, but also in more traditional fields of engineering. This article surveys various approaches to the formal modeling and analysis of the temporal features of computer-based systems, with a level of detail that is suitable also for non-specialists. In doing so, it provides a unifying framework, rather than just a comprehensive list of formalisms. The paper first lays out some key dimensions along which the various formalisms can be evaluated and compared. Then, a significant sample of formalisms for time modeling in computing are presented and discussed according to these dimensions. The adopted perspective is, to some extent, historical, going from "traditional" models and formalisms to more modern ones.

  3. Mandatory Photovoltaic System Cost Analysis

    Broader source: Energy.gov [DOE]

    The Arizona Corporation Commission requires electric utilities to conduct a cost/benefit analysis to compare the cost of line extension with the cost of installing a stand-alone photovoltaic (PV)...

  4. Multi-Metric Sustainability Analysis

    SciTech Connect (OSTI)

    Cowlin, S.; Heimiller, D.; Macknick, J.; Mann, M.; Pless, J.; Munoz, D.

    2014-12-01T23:59:59.000Z

    A readily accessible framework that allows for evaluating impacts and comparing tradeoffs among factors in energy policy, expansion planning, and investment decision making is lacking. Recognizing this, the Joint Institute for Strategic Energy Analysis (JISEA) funded an exploration of multi-metric sustainability analysis (MMSA) to provide energy decision makers with a means to make more comprehensive comparisons of energy technologies. The resulting MMSA tool lets decision makers simultaneously compare technologies and potential deployment locations.

  5. Comparing Scales of Environmental Effects from Gasoline and Ethanol Production

    SciTech Connect (OSTI)

    Parish, Esther S [ORNL; Kline, Keith L [ORNL; Dale, Virginia H [ORNL; Efroymson, Rebecca Ann [ORNL; McBride, Allen [ORNL; Johnson, Timothy L [U.S. Environmental Protection Agency, Raleigh, North Carolina; Hilliard, Michael R [ORNL; Bielicki, Dr Jeffrey M [University of Minnesota

    2013-01-01T23:59:59.000Z

    Understanding the environmental effects of alternative fuel production is critical to characterizing the sustainability of energy resources to inform policy and regulatory decisions. The magnitudes of these environmental effects vary according to the intensity and scale of fuel production along each step of the supply chain. We compare the scales (i.e., spatial extent and temporal duration) of ethanol and gasoline production processes and environmental effects based on a literature review, and then synthesize the scale differences on space-time diagrams. Comprehensive assessment of any fuel-production system is a moving target, and our analysis shows that decisions regarding the selection of spatial and temporal boundaries of analysis have tremendous influences on the comparisons. Effects that strongly differentiate gasoline and ethanol supply chains in terms of scale are associated with when and where energy resources are formed and how they are extracted. Although both gasoline and ethanol production may result in negative environmental effects, this study indicates that ethanol production traced through a supply chain may impact less area and result in more easily reversed effects of a shorter duration than gasoline production.

  6. A comparative assessment of the economics of plutonium disposition

    SciTech Connect (OSTI)

    Williams, K.A.; Miller, J.W.; Reid, R.L.

    1997-04-01T23:59:59.000Z

    The US Department of Energy office of Fissile Materials Disposition (DOE/MD) has been evaluating three technologies for the disposition of approximately 50 metric tons of surplus plutonium from defense-related programs: reactors, immobilization, and deep boreholes. As part of the process supporting an early CY 1997 Record of Decision (ROD), a comprehensive assessment of technical viability, cost, and schedule has been conducted by DOE/MD and its national laboratory contractors. Oak Ridge National Laboratory has managed and coordinated the life-cycle cost (LCC) assessment effort for this program. This paper discusses the economic analysis methodology and the results prior to ROD. A secondary intent of the paper is to discuss major technical and economic issues that impact cost and schedule. To evaluate the economics of these technologies on an equitable basis, a set of cost-estimating guidelines and a common cost-estimating format were utilized by all three technology teams. This paper also includes the major economic analysis assumptions and the comparative constant-dollar and discounted-dollar LCCs.

  7. Comparative costs and benefits of hydrogen vehicles

    SciTech Connect (OSTI)

    Berry, G.D. [Lawrence Livermore National Lab., CA (United States)

    1996-10-01T23:59:59.000Z

    The costs and benefits of hydrogen as a vehicle fuel are compared to gasoline, natural gas, and battery-powered vehicles. Costs, energy, efficiency, and tail-pipe and full fuel cycle emissions of air pollutants and greenhouse gases were estimated for hydrogen from a broad range of delivery pathways and scales: from individual vehicle refueling systems to large stations refueling 300 cars/day. Hydrogen production from natural gas, methanol, and ammonia, as well as water electrolysis based on alkaline or polymer electrolytes and steam electrolysis using solid oxide electrolytes are considered. These estimates were compared to estimates for competing fuels and vehicles, and used to construct oil use, air pollutant, and greenhouse gas emission scenarios for the U.S. passenger car fleet from 2005-2050. Fuel costs need not be an overriding concern in evaluating the suitability of hydrogen as a fuel for passenger vehicles. The combined emissions and oil import reduction benefits of hydrogen cars are estimated to be significant, valued at up to {approximately}$400/yr for each hydrogen car when primarily clean energy sources are used for hydrogen production. These benefits alone, however, become tenuous as the basis supporting a compelling rationale for hydrogen fueled vehicles, if efficient, advanced fossil-fuel hybrid electric vehicles (HEV`s) can achieve actual on-road emissions at or below ULEV standards in the 2005-2015 timeframe. It appears a robust rationale for hydrogen fuel and vehicles will need to also consider unique, strategic, and long-range benefits of hydrogen vehicles which can be achieved through the use of production, storage, delivery, and utilization methods for hydrogen which are unique among fuels: efficient use of intermittent renewable energy sources, (e,g, wind, solar), small-scale feasibility, fuel production at or near the point of use, electrolytic production, diverse storage technologies, and electrochemical conversion to electricity.

  8. Comparing quantum black holes and naked singularities

    E-Print Network [OSTI]

    T. P. Singh

    2000-12-21T23:59:59.000Z

    There are models of gravitational collapse in classical general relativity which admit the formation of naked singularities as well as black holes. These include fluid models as well as models with scalar fields as matter. Even if fluid models were to be regarded as unphysical in their matter content, the remaining class of models (based on scalar fields) generically admit the formation of visible regions of finite but arbitrarily high curvature. Hence it is of interest to ask, from the point of view of astrophysics, as to what a stellar collapse leading to a naked singularity (or to a visible region of very high curvature) will look like, to a far away observer. The emission of energy during such a process may be divided into three phases - (i) the classical phase, during which matter and gravity can both be treated according to the laws of classical physics, (ii) the semiclassical phase, when gravity is treated classically but matter behaves as a quantum field, and (iii) the quantum gravitational phase. In this review, we first give a summary of the status of naked singularities in classical relativity, and then report some recent results comparing the semiclassical phase of black holes with the semiclassical phase of spherical collapse leading to a naked singularity. In particular, we ask how the quantum particle creation during the collapse leading to a naked singularity compares with the Hawking radiation from a star collapsing to form a black hole. It turns out that there is a fundamental difference between the two cases. A spherical naked star emits only about one Planck energy during its semiclassical phase, and the further evolution can only be determined by the laws of quantum gravity. This contrasts with the semiclassical evaporation of a black hole.

  9. Panel 1 - comparative evaluation of deposition technologies

    SciTech Connect (OSTI)

    Fenske, G.R.; Stodolsky, F. [Argonne National Lab., IL (United States); Benson, D.K.; Pitts, R.J. [National Renewable Energy Lab., Golden, CO (United States); Bhat, D.G. [GTE Valenite Corp., Troy, MI (United States); Yulin Chen [Allison Gas Turbine Division, GM, Indianapolis, IN (United States); Gat, R.; Sunkara, M.K. [Case Western Reserve Univ., Cleveland, OH (United States); Kelly, M. [Stanford Univ., CA (United States); Lawler, J.E. [Univ. of Wisconsin, Madison (United States); Nagle, D.C. [Martin Marietta Labs., Baltimore, MD (United States); Outka, D. [Sandia National Laboratories, Livermore, CA (United States); Revankar, G.S. [Deere & Co., Moline, IL (United States); Subramaniam, V.V. [Ohio State Univ., Columbus (United States); Wilbur, P.J. [Colorado State Univ., Fort Collins (United States); Mingshow Wong [Northwestern Univ., Evanston, IL (United States); Woolam, W.E. [Southwest Research Inst., Arlington, VA (United States)

    1993-01-01T23:59:59.000Z

    This working group attempted to evaluate/compare the different types of deposition techniques currently under investigation for depositing diamond and diamond-like carbon films. A table lists the broad types of techniques that were considered for depositing diamond and diamond-like carbon films. After some discussion, it was agreed that any evaluation of the various techniques would be dependent on the end application. Thus the next action was to list the different areas where diamond and DLC films could find applications in transportation. These application areas are listed in a table. The table intentionally does not go into great detail on applications because that subject is dealt with specifically by Panel No. 4 - Applications To Transportation. The next action concentrated on identifying critical issues or limitations that need to be considered in evaluating the different processes. An attempt was then made to rank different broad categories of deposition techniques currently available or under development based on the four application areas and the limitations. These rankings/evaluations are given for diamond and DLC techniques. Finally, the working group tried to identify critical development and research issues that need to be incorporated into developing a long-term program that focuses on diamond/DLC coatings for transportation needs. 5 tabs.

  10. Coal based electric generation comparative technologies report

    SciTech Connect (OSTI)

    Not Available

    1989-10-26T23:59:59.000Z

    Ohio Clean Fuels, Inc., (OCF) has licensed technology that involves Co-Processing (Co-Pro) poor grade (high sulfur) coal and residual oil feedstocks to produce clean liquid fuels on a commercial scale. Stone Webster is requested to perform a comparative technologies report for grassroot plants utilizing coal as a base fuel. In the case of Co-Processing technology the plant considered is the nth plant in a series of applications. This report presents the results of an economic comparison of this technology with other power generation technologies that use coal. Technologies evaluated were:Co-Processing integrated with simple cycle combustion turbine generators, (CSC); Co-Processing integrated with combined cycle combustion turbine generators, (CCC); pulverized coal-fired boiler with flue gas desulfurization and steam turbine generator, (PC) and Circulating fluidized bed boiler and steam turbine generator, (CFB). Conceptual designs were developed. Designs were based on approximately equivalent net electrical output for each technology. A base case of 310 MWe net for each technology was established. Sensitivity analyses at other net electrical output sizes varying from 220 MWe's to 1770 MWe's were also performed. 4 figs., 9 tabs.

  11. Comparative Review of a Dozen National Energy Plans: Focus on Renewable and Efficient Energy

    SciTech Connect (OSTI)

    Logan, J.; James, T. L.

    2009-03-01T23:59:59.000Z

    Dozens of groups have submitted energy, environmental, and economic recovery plans for consideration by the Obama administration and the 111th Congress. This report provides a comparative analysis of 12 national proposals, focusing especially on energy efficiency (EE) and renewable energy (RE) market and policy issues.

  12. Results of Comparing Bandwidth Usage and Latency: Service Location Protocol and Jini

    E-Print Network [OSTI]

    Barbeau, Michel

    Results of Comparing Bandwidth Usage and Latency: Service Location Protocol and Jini Javier Govea. This paper focuses on analyzing and evaluating two of these limitations, bandwidth usage and latency, of two present the results of our bandwidth usage analysis and the results a comparison of latency of SLP

  13. Reference set of regulons in Desulfovibrionales inferred by comparative genomics approach

    SciTech Connect (OSTI)

    Kazakov, A.E.; Rodionov, D.A.; Price, M.N.; Arkin, A.P.; Dubchak, I.; Novichkov, P.S.

    2010-11-15T23:59:59.000Z

    in this study, we carried out large-scale comparative genomics analysis of regulatory interactions in Desulfovibrio vulgaris and 12 related genomes from Desulfovibrionales order using our recently developed web server RegPredict (http://regpredict.lbl.gov). An overall reference collection of 26 Desulfovibrionales regulogs can be accessed through RegPrecise database (http://regpredict.lbl.gov).

  14. Are all Social Networks Structurally Similar? A Comparative Study using Network Statistics and

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Are all Social Networks Structurally Similar? A Comparative Study using Network Statistics--The modern age has seen an exponential growth of social network data available on the web. Analysis social networks and how they are different from other networks such as protein interaction networks

  15. Comparing halo bias from abundance and clustering

    E-Print Network [OSTI]

    Hoffmann, Kai; Gaztanaga, Enrique

    2015-01-01T23:59:59.000Z

    We model the abundance of haloes in the $\\sim(3 \\ \\text{Gpc}/h)^3$ volume of the MICE Grand Challenge simulation by fitting the universal mass function with an improved Jack-Knife error covariance estimator that matches theory predictions. We present unifying relations between different fitting models and new predictions for linear ($b_1$) and non-linear ($c_2$ and $c_3$) halo clustering bias. Different mass function fits show strong variations in their overall poor performance when including the low mass range ($M_h \\lesssim 3 \\ 10^{12} \\ M_{\\odot}/h$) in the analysis, which indicates noisy friends-of-friends halo detection given the MICE resolution ($m_p \\simeq 3 \\ 10^{10} \\ M_{\\odot}$/h). Together with fits from the literature we find an overall variance in the amplitudes of around $10%$ in the low mass and up to $50%$ in the high mass (galaxy cluster) range ($M_h > 10^{14} \\ M_{\\odot}/h$). These variations propagate into a $10%$ change in $b_1$ predictions and a $50%$ change in $c_2$ or $c_3$. Despite the...

  16. Assays for mammalian tyrosinase: a comparative study

    SciTech Connect (OSTI)

    Jara, J.R.; Solano, F.; Lozano, J.A.

    1988-01-01T23:59:59.000Z

    This work describes a comparative study of the tyrosinase activity determined using three methods which are the most extensively employed; two radiometric assays using L-tyrosine as substrate (tyrosine hydroxylase and melanin formation activities) and one spectrophotometric assay using L-dopa (dopa oxidase activity). The three methods were simultaneously employed to measure the activities of the soluble, melanosomal, and microsomal tyrosinase isozymes from Harding-Passey mouse melanoma through their purification processes. The aim of this study was to find any correlation among the tyrosinase activities measured by the three different assays and to determine whether that correlation varied with the isozyme and its degree of purification. The results show that mammalian tyrosinase has a greater turnover number for L-dopa than for L-tyrosine. Thus, enzyme activity, expressed as mumol of substrate transformed per min, is higher in assays using L-dopa as substrate than those using L-tyrosine. Moreover, the percentage of hydroxylated L-tyrosine that is converted into melanin is low and is affected by several factors, apparently decreasing the tyrosinase activity measured by the melanin formation assay. Bearing these considerations in mind, average interassay factors are proposed. Their values are 10 to transform melanin formation into tyrosine hydroxylase activity, 100 to transform tyrosine hydroxylase into dopa oxidase activity, and 1,000 to transform melanin formation into dopa oxidase activity. Variations in these values due to the presence in the tyrosinase preparations of either inhibitors or regulatory factors in melanogenesis independent of tyrosinase are also discussed.

  17. Computational methods and analyses in comparative genomics and epigenomics

    E-Print Network [OSTI]

    Peng, Qian

    2012-01-01T23:59:59.000Z

    promise of comparative genomics in mammals. Science, 286,homology relationships. Genomics, Dehal, P. and Boore, J.to plant comparative genomics. Genome Research, 13(5), 999–

  18. MicrobesOnline: an integrated portal for comparative functional genomics

    E-Print Network [OSTI]

    Joachimiak, Marcin P.

    2014-01-01T23:59:59.000Z

    comparative functional genomics Marcin P. Joachimiak 1,2 ,for comparative functional genomics of bacteria and archaea.publicly avail- able functional genomics data from published

  19. Microbes Online: an integrated portal for comparative functional genomics

    E-Print Network [OSTI]

    Arkin, Adam P.

    2014-01-01T23:59:59.000Z

    comparative functional genomics of bacteria, archaea, fungifor comparative functional genomics Paramvir S. Dehal 1,2* (and Environmental Research, Genomics:GTL program through

  20. Sandia Energy - Study Compares Floating-Platform Options for...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Study Compares Floating-Platform Options for Offshore Vertical-Axis Wind Turbines Home Renewable Energy Energy Partnership News Wind Energy News & Events Study Compares...

  1. A Comparative Study on Emerging Electric Vehicle Technology Assessments

    SciTech Connect (OSTI)

    Ford, Jonathan [Sentech, Inc.; Khowailed, Gannate [Sentech, Inc.; Blackburn, Julia [Sentech, Inc.; Sikes, Karen [Sentech, Inc.

    2011-03-01T23:59:59.000Z

    Numerous organizations have published reports in recent years that investigate the ever changing world of electric vehicle (EV) technologies and their potential effects on society. Specifically, projections have been made on greenhouse gas (GHG) emissions associated with these vehicles and how they compare to conventional vehicles or hybrid electric vehicles (HEVs). Similar projections have been made on the volumes of oil that these vehicles can displace by consuming large amounts of grid electricity instead of petroleum-based fuels. Finally, the projected rate that these new vehicle fleets will enter the market varies significantly among organizations. New ideas, technologies, and possibilities are introduced often, and projected values are likely to be refined as industry announcements continue to be made. As a result, over time, a multitude of projections for GHG emissions, oil displacement, and market penetration associated with various EV technologies has resulted in a wide range of possible future outcomes. This leaves the reader with two key questions: (1) Why does such a collective range in projected values exist in these reports? (2) What assumptions have the greatest impact on the outcomes presented in these reports? Since it is impractical for an average reader to review and interpret all the various vehicle technology reports published to date, Sentech Inc. and the Oak Ridge National Laboratory have conducted a comparative study to make these interpretations. The primary objective of this comparative study is to present a snapshot of all major projections made on GHG emissions, oil displacement, or market penetration rates of EV technologies. From the extensive data found in relevant publications, the key assumptions that drive each report's analysis are identified and 'apples-to-apples' comparisons between all major report conclusions are attempted. The general approach that was taken in this comparative study is comprised of six primary steps: (1) Search Relevant Literature - An extensive search of recent analyses that address the environmental impacts, market penetration rates, and oil displacement potential of various EV technologies was conducted; (2) Consolidate Studies - Upon completion of the literature search, a list of analyses that have sufficient data for comparison and that should be included in the study was compiled; (3) Identify Key Assumptions - Disparity in conclusions very likely originates from disparity in simple assumptions. In order to compare 'apples-to-apples,' key assumptions were identified in each study to provide the basis for comparing analyses; (4) Extract Information - Each selected report was reviewed, and information on key assumptions and data points was extracted; (5) Overlay Data Points - Visual representations of the comprehensive conclusions were prepared to identify general trends and outliers; and (6) Draw Final Conclusions - Once all comparisons are made to the greatest possible extent, the final conclusions were draw on what major factors lead to the variation in results among studies.

  2. Report Comparing the Impacts of Northeast Hurricanes Now Available

    Broader source: Energy.gov [DOE]

    The report "Comparing the Impacts of Northeast Hurricanes on Energy Infrastructure" is now available for download.

  3. Comparing Bacterial Genomes by Searching their Common Intervals

    E-Print Network [OSTI]

    Fertin, Guillaume

    Comparing Bacterial Genomes by Searching their Common Intervals S´ebastien Angibaud, Damien. Comparing bacterial genomes implies the use of a dedicated measure. It relies on comparing circular genomes genomes that takes into account duplications. Its application on a concrete case, comparing E. coli and V

  4. Exploratory Analysis of Motor Carrier Accident Risk And Daily Driving Patterns

    E-Print Network [OSTI]

    Jovanis, Paul P.; Kaneko, Tetsuya; Lin, Tzuoo-Din

    1991-01-01T23:59:59.000Z

    in a Sleeper Berth," Accident Analysis and Prevention. 1988,Survival Theory," Accident Analysis and Prevention, Vol. 21,most of the analyses with accident data compared actual

  5. Harmonic propagation on an electric distribution system: Field measurements compared with computer simulation

    SciTech Connect (OSTI)

    Williams, S.M. (Naval Postgraduate School, Monterey, CA (United States)); Brownfield, G.T. (Union Electric Co., St. Louis, MO (United States)); Duffus, J.W. (Univ. of Missouri, Columbia, MO (United States). Power Electronics Research Center)

    1993-04-01T23:59:59.000Z

    Power electronic loads are occupying an increasing fraction of the total load on distribution feeders. Coincidentally, there is a greater use of power factor correction capacitors on the distribution system. These two factors can present poor operating conditions in the form of high harmonic levels propagating through a distribution system. Electric utility engineers are facing an ever increasing number of situations which require the analysis of the propagation of harmonics on a distribution system. HARMFLO was developed by EPRI for use in the analysis of harmonics on a power system. However, for a typical analysis of a distribution system, data for some of the parameters required by HARMFLO are not available. Furthermore, exact load information is usually not available. Harmonic levels determined from field tests on a distribution system are compared to results of HARMFLO simulations to determine if this analysis tool can be expected to provide useful results despite the lack of exact information for load modeling and other system parameters.

  6. COMPARING THE IDENTIFICATION OF RECOMMENDATIONS BY DIFFERENT ACCIDENT

    E-Print Network [OSTI]

    Johnson, Chris

    will be identified for similar incidents. Accident analysis methods can also help to reduce individual bias

  7. A comparative review of accident studies from recent assessments of emergency planning zone boundaries

    SciTech Connect (OSTI)

    Mueller, C.J.; Kier, P.H.; Folga, S.M.

    1997-04-01T23:59:59.000Z

    Hazards assessments and accompanying accident and human health and risk calculations are routinely done to establish Emergency Planning Zone (EPZ) boundaries for facilities managing hazardous and/or radioactive materials. This paper reviews the underlying US DOE guidance, assesses the degree of conformance to the guidance in recent hazards assessments performed to support selection of EPZ boundaries, and compares the consistency of the accident analysis approaches and underlying key assumptions. Recommendations are made on the basis of these reviews, as well as from knowledge of the approaches used in safety assessments performed in support of safety analysis reports (SARs) and environmental impact statements (EISs).

  8. ORIGINAL ARTICLE Comparative genomics of two newly isolated

    E-Print Network [OSTI]

    Alvarez-Cohen, Lisa

    ORIGINAL ARTICLE Comparative genomics of two newly isolated Dehalococcoides strains of Microbiology, Cornell University, Ithaca, NY, USA Comparative genomics of Dehalococcoides strains and an enrichment were performed using a microarray targeting genes from all available sequenced genomes

  9. Phytozome: A Comparative Platform for Green Plant Genomics

    E-Print Network [OSTI]

    Goodstein, David M.

    2012-01-01T23:59:59.000Z

    a growing plant comparative genomics resource. Nucleic AcidsL.A. (2011) The Sol Genomics Network (solgenomics.net):for comparative plant genomics. Nucleic Acids Res, 36, D959-

  10. Hydrogen Analysis

    Broader source: Energy.gov (indexed) [DOE]

    A H2A: Hydrogen Analysis Margaret K. Mann DOE Hydrogen, Fuel Cells, and Infrastructure Technologies Program Systems Analysis Workshop July 28-29, 2004 Washington, D.C. H2A Charter...

  11. Comparing Emissions Benefits from Regulating Heavy Vehicle Idling...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    from Regulating Heavy Vehicle Idling Comparing Emissions Benefits from Regulating Heavy Vehicle Idling 2005 Diesel Engine Emissions Reduction (DEER) Conference...

  12. How can we compare or add up our energy consumption?

    Reports and Publications (EIA)

    2012-01-01T23:59:59.000Z

    Energy in Brief article on the use of energy conversion factors to compare energy usage from different fuels.

  13. The genome of the green anole lizard and a comparative analysis with birds and mammals

    E-Print Network [OSTI]

    Lander, Eric S.

    The evolution of the amniotic egg was one of the great evolutionary innovations in the history of life, freeing vertebrates from an obligatory connection to water and thus permitting the conquest of terrestrial environments. ...

  14. Comparative analysis of the secondary electron yield from carbon nanoparticles and pure water medium

    E-Print Network [OSTI]

    Verkhovtsev, Alexey; de Vera, Pablo; Surdutovich, Eugene; Guatelli, Susanna; Korol, Andrei V; Rosenfeld, Anatoly; Solov'yov, Andrey V

    2015-01-01T23:59:59.000Z

    The production of secondary electrons generated by carbon nanoparticles and pure water medium irradiated by fast protons is studied by means of model approaches and Monte Carlo simulations. It is demonstrated that due to a prominent collective response to an external field, the nanoparticles embedded in the medium enhance the yield of low-energy electrons. The maximal enhancement is observed for electrons in the energy range where plasmons, which are excited in the nanoparticles, play the dominant role. Electron yield from a solid carbon nanoparticle composed of fullerite, a crystalline form of C60 fullerene, is demonstrated to be several times higher than that from liquid water. Decay of plasmon excitations in carbon-based nanosystems thus represents a mechanism of increase of the low-energy electron yield, similar to the case of sensitizing metal nanoparticles. This observation gives a hint for investigation of novel types of sensitizers to be composed of metallic and organic parts.

  15. Eco- vs. productive efficiency: A new approach to effective and comparative performance analysis

    E-Print Network [OSTI]

    Chen, Chien-Ming Chen; Delmas, Magali A; Montes, Maria J.

    2010-01-01T23:59:59.000Z

    social performance: an efficiency perspective. Institute offunctions, and Nerlovian efficiency. Journal of Optimization1978. Measuring the efficiency of decision making units.

  16. The communicative strategies of Church of Christ campaigning missionaries: an ethnography and comparative analysis

    E-Print Network [OSTI]

    McCormick, Charlie Taylor

    1994-01-01T23:59:59.000Z

    divided into five parts: recruitment, selection, training, on-site adjustment and productivity, and reentry (Austin l 988: 73). This is little more than the same three steps of the traditional rite of passage cast in the language of the community... in which it is being described. Recruitment and selection refer to the separation of the campaigner from the community as the campaigner agrees to participate in the mission experience. Training, on-site adjustment, and productivity refer...

  17. A survey and comparative analysis of selected university outdoor recreation/education centers

    E-Print Network [OSTI]

    Brewer, Randy Carter

    1984-01-01T23:59:59.000Z

    of the survey schedule can be found in Appendix A. Methods of Data Collection The method of data collection utilized in this study was the on-site personal interview. As a method of data collection in survey studies, the personal interview has been held...- search technique was an on-site population status survey based on a 3x2x2 classification scheme using an interview data collection technique. It was concluded that major outdoor recreation/education centers (O'RECs) develop on the basis of individual...

  18. Symbionts Commonly Provide Broad Spectrum Resistance to Viruses in Insects: A Comparative Analysis of Wolbachia Strains

    E-Print Network [OSTI]

    Martinez, Julien; Longdon, Ben; Bauer, Simone; Chan, Yuk-Sang; Miller, Wolfgang J.; Bourtzis, Kostas; Teixeira, Luis; Jiggins, Francis M.

    2014-09-18T23:59:59.000Z

    , 3Department of Environmental and Natural Resources Management, University of Patras, Agrinio, Greece, 4 Biomedical Sciences Research Center ‘‘Alexander Fleming’’, Vari, Greece, 5 Insect Pest Control Laboratory, Joint FAO/IAEA Division of Nuclear... Techniques in Food and Agriculture, Vienna, Austria, 6 Instituto Gulbenkian de Cieˆncia, Oeiras, Portugal Abstract In the last decade, bacterial symbionts have been shown to play an important role in protecting hosts against pathogens. Wolbachia, a widespread...

  19. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    descriptors on RESERVES, RESOURCE ASSESSMENT, e t c . With tDEPOSITS AMD RESERVES RESOURCE ASSESSMENT RESOURCE POTENTIALDescriptors RESERVES RESOURCE ASSESSMENT RESOURCE POTENTIAL

  20. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    PLANTATIONS FIGURE 2 BIOGAS PROCESS TL'BIOGAS _ANAERQBICf o r Other Data Bases >BIOGAS/TI,DE,ID BIO(W)GAS/TI,DE,IDSEARCHES Methane (or Biogas) Production from Agricultural

  1. The Politics of Access to Higher Education in Argentina and Brazil: A comparative analysis

    E-Print Network [OSTI]

    Fernandes Nogueira, Jaana Flavia

    2013-01-01T23:59:59.000Z

    In: XII National Meeting of Didactics and Teaching Practice.In: XI National Meeting on Didactics and Teaching Practices.

  2. Comparative genomic analysis of fungal genomes reveals intron-rich ancestors

    E-Print Network [OSTI]

    Stajich, Jason E; Dietrich, Fred S; Roy, Scott W

    2007-01-01T23:59:59.000Z

    previously proposed meth- ods. Dollo parsimony assumes aNYK. Results for all meth- ods are given in Additional dataa convergence of the four meth- ods on better estimates (and

  3. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    of natural gas and wind generation capacity shares.of natural gas and wind generation capacity shares. Figureof Power Generation Output Biomass/waste Wind Power Solar

  4. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    having similar installed capacity fuel mix assumptions asthe total 2030 and 2050 installed capacity, the CIS and AISfuel mix of the installed capacity is similar to scenarios

  5. Next Steps for Realizing Fusion Power and Comparative Analysis of Roadmaps

    E-Print Network [OSTI]

    Abdou, Mohamed

    Programs Mohamed Abdou With Alice Ying, Neil Morley and input from the FNST Community Related publications Energy Nashville, TN 29 August 2012 M. Abdou TOFE August 2012 #12;Renewed Interest in "Roadmapping the key features in USA, EU, and China roadmaps. 2M. Abdou TOFE August 2012 #12;Outline 1. Recent Interest

  6. A comparative analysis of technological learning systems in emerging rotorcraft companies

    E-Print Network [OSTI]

    Gan, Thiam Soon

    2011-01-01T23:59:59.000Z

    The aim of this research is to understand how emerging rotorcraft companies in various countries accomplished technological learning over the last sixty years. Owing to its unique products and growing market demand, ...

  7. The Financial Trilemma in China and a Comparative Analysis with India

    E-Print Network [OSTI]

    Aizenman, Joshua; Sengupta, Rajeswari

    2012-01-01T23:59:59.000Z

    openness policy of both China and India and the Chinn-ItoTrilemma policy objectives for China and India respectively,deregulation policies were introduced in India in the 1990s,

  8. A novel method for comparative analysis of retinal specialization traits from topographic maps

    E-Print Network [OSTI]

    Johnsen, Sönke

    , The Univ. of Western Australia, Crawley, WA, Australia Olaf R. P. Bininda-Emonds $ AG Systematik, The Univ. of Western Australia, Crawley, WA, Australia Esteban Fern ´andez-Juricic $Dept. of Biological of the brain. Photoreceptor cells are responsible for absorbing light energy or photons and transforming

  9. Comparative analysis of automotive powertrain choices for the near to mid-term future

    E-Print Network [OSTI]

    Kasseris, Emmanuel P

    2006-01-01T23:59:59.000Z

    This thesis attempts a technological assessment of automotive powertrain technologies for the near to mid term future. The powertrain types to be assessed include naturally aspirated gasoline engines, turbocharged gasoline ...

  10. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    scenario, CIS also has smaller coal generation while AIShas the lowest coal generation of all scenarios, suggestingCIS also has smaller coal generation while AIS has the

  11. Multispecies comparative analysis of a mammalian-specific genomic domain encoding secretory proteins

    E-Print Network [OSTI]

    Miller, Webb

    proteins Monique Rijnkels,a, * Laura Elnitski,b,c Webb Miller,b,d and Jeffrey M. Rosena a Department- velopment. Caseins constitute the major nutritional proteins in milk and supply basic amino acids, calcium

  12. Comparative Analysis Between US NRC Requirements and US DOE Orders - 13402

    SciTech Connect (OSTI)

    Chakraborti, Sayan [MRIGlobal, 425 Volker Blvd, Kansas City, MO 64110 (United States)] [MRIGlobal, 425 Volker Blvd, Kansas City, MO 64110 (United States); Stone, Lynn; Hyatt, Jeannette [Savannah River Nuclear Solutions (United States)] [Savannah River Nuclear Solutions (United States)

    2013-07-01T23:59:59.000Z

    Small modular reactor (SMR) is a nuclear reactor design approach that is expected to herald in a new era of clean energy in the U.S. These reactors are less than one-third the size of conventional large nuclear power reactors, and have factory-fabricated components that may be transported by rail or truck to a site selected to house a small nuclear reactor. To facilitate the licensing of these smaller nuclear reactor designs, the Nuclear Regulatory Commission (NRC) is in the process of developing a regulatory infrastructure to support licensing review of these unique reactor designs. As part of these activities, the NRC has been meeting with the Department of Energy (DOE) and with individual SMR designers to discuss potential policy, licensing, and key technical differences in SMR designs. It is anticipated by the NRC that such licensing interaction and guidance early in the design process will contribute towards minimizing complexity while adding stability and predictability in the licensing and subsequent regulation of new reactor designs such as SMRs. In conjunction with the current NRC initiative of developing the SMR licensing process, early communication and collaboration in the identification and resolution of any potential technical and licensing differences between NRC requirements and similar requirements applicable at DOE sites would help to expedite demonstration and implementation of SMR technology in the US. In order to foster such early communication, Savannah River Nuclear Solutions (SRNS) has begun taking the first steps in identifying and evaluating potential licensing gaps that may exist between NRC and DOE requirements in siting SMRs at DOE sites. A comparison between the existing NRC regulations for Early Site Permits and the DOE Orders was undertaken to establish the degree of correlation between NRC requirements and compliance methods in place at DOE sites. The ability to use existing data and information to expedite the development of the Environmental Report is being evaluated at the Savannah River Site as a case study for application across the DOE Complex. This paper will present areas of direct correlation as well as those where the need for site specific data for either DOE operations or NRC compliance warrant additional interaction between the agencies. Areas where further refinement of the SMR technologies may drive collaborative development of revised regulations through such means as industry consensus standards will also be highlighted. Both NRC and DOE have requirements that mandate public involvement in their processes. The importance and value of early engagement with the public as well as collaborating regulatory agencies is of critical importance when deploying new technologies. (authors)

  13. A comparative analysis of early Medieval shipwrecks from the southern shores of the Baltic Sea

    E-Print Network [OSTI]

    Indruszewski, George

    1996-01-01T23:59:59.000Z

    mit nordischen Seeleuten und Schiffsbauern, da8 die Technologie, Dber die sie verfQgten, such lokal benutzt werden konnte, warm der Bedarf es verlangte. " S. McGrail, Ancient Boats in N. W. Europe. The archaeology of water transport to AD 1500...

  14. Comparative local analysis of metabolites, lipids and proteins in intact fish tissues by LAESI mass

    E-Print Network [OSTI]

    Vertes, Akos

    - ceuticals, e.g., antibiotics3 and contraceptives,4 to agrochemicals.5 Matrix-assisted laser desorption

  15. The climate impacts of high-speed rail and air transportation : a global comparative analysis

    E-Print Network [OSTI]

    Clewlow, Regina Ruby Lee

    2012-01-01T23:59:59.000Z

    Growing concerns about the energy use and climate impacts of the transportation sector have prompted policymakers to consider a variety of options to meet the future mobility needs of the world's population, while ...

  16. Comparative Performance Analysis of the Algorithms for Detecting Periodically Expressed Genes

    E-Print Network [OSTI]

    Agyepong, Kwadwo

    2012-10-19T23:59:59.000Z

    .5) Where, R = N 1X l=0 2 6 4 cos(!tl) 2 cos(!tl) sin(!tl) sin(!tl) cos(!tl) sin(!tl) 2 3 7 5 : (2.6) and r = N 1X l=0 2 6 4 cos(!tl) sin(!tl) 3 7 5 yl: (2.7) The ordinary least squares periodogram can then be de ned as: LSP... . . . . . . . . . . . . . . . . . . 26 3. Simulation on Spellman’s Yeast Data . . . . . . . . . 31 B. Discussion and Conclusions . . . . . . . . . . . . . . . . . 37 REFERENCES : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : 39 APPENDIX A...

  17. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    Methane (or Biogas) Production from Agricultural Hastes ThisAGRICULTURAL WASTES f HANI MANURES I BIOMASS BlOf ( BIO* BIOMASS PLANTATIONS FIGURE 2 BIOGAS

  18. Comparative analysis of energy consumption trends in cohousing and alternate housing arrangements

    E-Print Network [OSTI]

    Brown, Jason R. (Jason Robert), 1975-

    2004-01-01T23:59:59.000Z

    The sizes of both single-family and multifamily homes have grown steadily in the United States over the last fifty years. During this time, despite more efficient production processes, energy consumption in the country ...

  19. Disparities in Injury Mortality Between Uganda and the United States: Comparative Analysis of a Neglected Disease

    E-Print Network [OSTI]

    2011-01-01T23:59:59.000Z

    in the United States. Age-standardized death rates indicateinjury deaths in the United States and reports crude ratesdeath rate (rate ratio, or RR) was higher in Kampala than in SF (2.3) or the United States (

  20. A Comparative Analysis of Bangladeshi and Pakistani Educational Attainment in London Secondary Schools

    E-Print Network [OSTI]

    Sunder, Divya; Uddin, Layli

    2007-01-01T23:59:59.000Z

    Vol. 21(1), 216-235. Platt, L. (2005). Migration and socialindigenous populations (Platt, 2005). Particular minority

  1. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    the extent to which carbon capture and sequestration (CCS)McKinsey counts on carbon capture and sequestration in theinto consideration carbon capture and sequestration in the

  2. Comparative analysis of inflammation induced by aspergillus.fumigatus and chlamydia.trachomatis

    E-Print Network [OSTI]

    Said, Najwane

    2010-01-01T23:59:59.000Z

    inflammatory diseases such as gout, pseudogout, silicosis,signal” such as ATP or gout crystals, or an intracellularinflammatory diseases, such as gout, are now successfully

  3. A Comparative Analysis of Architecture Frameworks Antony Tang Jun Han Pin Chen

    E-Print Network [OSTI]

    Han, Jun

    - architect's role in the system development life cycle is often unclear. Architect could take on roles

  4. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    International Energy Agency (IEA). 2009. World EnergyChina-specific section of the IEA World Energy Outlook 2009.while LBNL, McKinsey and IEA all employed bottom-up modeling

  5. Socially Responsible Investing : a comparative analysis of environmental, social, governance, reputational and labor factors

    E-Print Network [OSTI]

    Balasubramaniam, Arun, S.M. Massachusetts Institute of Technology

    2011-01-01T23:59:59.000Z

    Socially Responsible Investing (SRI) aims to deliver competitive investment returns while fostering social good. It aims achieves its objective by including a firm's corporate social performance (CSP) in its investment d ...

  6. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    Agency (IEA). 2009. World Energy Outlook 2009. Paris: OECDsection of the IEA World Energy Outlook 2009. At the sameEnergy Agency (IEA)’s World Energy Outlook (WEO) 2009, which

  7. Mammalian Comparative Sequence Analysis of the Agrp Christopher B. Kaelin1

    E-Print Network [OSTI]

    Sidow, Arend

    by states of negative energy balance. The molecular mechanisms underlying Agrp regulation, however, remain, California, United States of America, 2 Department of Genome Sciences, University of Washington, Seattle, Washington, United States of America, 3 Department of Pathology, Stanford University, Stanford, California

  8. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    power dispatch prioritizing renewable and non-fossil fuel in the LBNL model.power dispatch prioritizing renewable and non-fossil fuel in the LBNL model.

  9. IDENTIFYING HEALTHY ALCOHOL CUSTOMS: A CULTURAL ANALYSIS COMPARING THE ITALIAN AND AMERICAN ALCOHOL CULTURES

    E-Print Network [OSTI]

    Williams, Cindy 1989-

    2011-08-15T23:59:59.000Z

    indicating Italy‘s ability to limit the probability for unhealthy drinking habits that lead to issues such as drunkenness or alcoholism. Comparison of these data prompted this research. The research aims to highlight the underlying cultural values that lead...

  10. Comparative analysis of electrical and mechanical fault signatures in induction motors 

    E-Print Network [OSTI]

    Venugopal, Arvind Madabushi

    2005-02-17T23:59:59.000Z

    . . . . . . . . . . . . . . . . . . 83 3. Two Broken Rotor Bars . . . . . . . . . . . . . . . . . 88 4. Four Broken Rotor Bars . . . . . . . . . . . . . . . . . 103 C. Fault III: Air-Gap Eccentricity . . . . . . . . . . . . . . . . 114 1. Air-Gap Eccentricity - Case 1... . . . . . . . . . . . . . . 114 2. Air-Gap Eccentricity - Case 2 . . . . . . . . . . . . . . 125 D. Fault IV: Mechanical Imbalance . . . . . . . . . . . . . . . 136 E. Summary of the Comparison Based on the Load Levels . . 147 F. Summary of the Comparison Based on Motor Ratings...

  11. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    59 Proved crude oil reserves 1947-1979 Proved crude oil reserves in the Louor-48 Statesand oil and gas statistical information (reserve estimates

  12. A comparative analysis of numerical simulation and analytical modeling of horizontal well cyclic steam injection

    E-Print Network [OSTI]

    Ravago Bastardo, Delmira Cristina

    2005-08-29T23:59:59.000Z

    APPENDIX C ECONOMIDES JOSHI COLD PRODUCTIVITY INDEX ??.......215 VITA???????????????????????????.................216 16 17 18 19 20 21 22 23 24 ix 25 LIST OF TABLES Page Table 3...

  13. SBVR vs OCL: A Comparative Analysis of Standards Imran Sarwar Bajwa, Behzad Bordbar, Mark Lee

    E-Print Network [OSTI]

    Lee, Mark

    . Similarly, in business modelling, designers have to model business processes using business constraints (business rules). Constraints are the key components in the skeleton of business or software models. A designer has to write constraints to semantically compliment business models or UML models and finally

  14. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    which carbon capture and sequestration (CCS) technology isCarbon No - CCS examined in Capture & separate CIS with CCS Sequestration (CCS) scenario Technologytechnologies in the industrial sector. McKinsey counts on carbon capture

  15. The Politics of Access to Higher Education in Argentina and Brazil: A comparative analysis

    E-Print Network [OSTI]

    Fernandes Nogueira, Jaana Flavia

    2013-01-01T23:59:59.000Z

    the political economy of globalization in the Americas.the political economy of globalization in the Americas.globalization, and higher education: political economy and

  16. Comparative Oncogenomic Analysis of Copy Number Alterations in Human and Zebrafish Tumors Enables Cancer Driver Discovery

    E-Print Network [OSTI]

    Zhang, GuangJun

    The identification of cancer drivers is a major goal of current cancer research. Finding driver genes within large chromosomal events is especially challenging because such alterations encompass many genes. Previously, we ...

  17. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes

    E-Print Network [OSTI]

    Kellis, Manolis

    Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating ...

  18. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    g y METHANE AND I IAGR] AGRICULTURAL WASTES f HANI MANURES IProduction from Agricultural Wastes• NTIS on the other handproduction from agricultural wastes); nuclear energy and the

  19. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    to assess the potential impact of CCS, and used to compareindustrial abatement potential to CCS, fuel switching andwith CCS scenario assumptions abatement potential of only

  20. A comparative analysis of friendship patterns and teacher perceptions: racial differences during integration

    E-Print Network [OSTI]

    Coonrod, Susan Ty Masters

    1977-01-01T23:59:59.000Z

    , Elenor 1958 Human Relationships. New York: Longmans Green. Bonney, Meri E. 1943 "Personality Traits of Socially Successful and Unsuccessful Children. " Journal of Educational Psychology 34:449-472. 38 Bonney 1947a Meri E. "Sociometric Study... of the Relationship of Some Factors to Mutual Friendships on the Elementary, Secondary, and College Levels. " Sociom try 9: 21-47. Bonney, Meri E. 1947b "A Study of Personality Traits. " Sociometry 9: 154. Bonney, Meri E. 1948 "Sociometr ic Study of Agreement...

  1. Comparative analysis of electrical and mechanical fault signatures in induction motors

    E-Print Network [OSTI]

    Venugopal, Arvind Madabushi

    2005-02-17T23:59:59.000Z

    of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: Alexander G. Parlos (Chair of Committee) John M. Vance (Member) Edgar Sanchez-Sinencio (Member) Dennis L. O?Neal (Interim Head of Department) December 2003 Major Subject...

  2. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    with generally lower hydropower generation and much higherFired Units NG Fired CC Hydropower Nuclear Power Solar WindCoal Fired NG Fired CC Hydropower Nuclear Power Solar Wind

  3. Gunavarman (367-431): A Comparative Analysis of the Biographies found in the Chinese Tripitaka

    E-Print Network [OSTI]

    Stache-Rosen, Valentina

    Chiao Lu, by Tsche Ching, 730 A.D. F T 2157 Cheng Yuan Hsin Ting Che Chiao Mu Lu, by Y~n Chao, 7th century -1- G T 2034 Li Tai San Pao Chi, by Fei Chang-fang, S97 A.D. T 2149 Ta Tang Nei Tien Lu, by Tao Hauan, 7th century T 2 I 3 I Fan I Ming I Chi... . 60 In the North the Sutras became separated and could no~ be united and then the old arrangement was adhered to. 3. Pu~sha nei chiai china (Sutra on the internal rules of a Bodhi­ sattva, Nj 1082). This is in the above catalogue. 4. Yu-po-sha wu...

  4. An overview and comparative analysis of United States Army Corps of Engineers partnering in construction

    E-Print Network [OSTI]

    Rock, Timothy Patrick

    1992-01-01T23:59:59.000Z

    available to them through the use of partnering. Partnering has already provided many users great dividends and appears to do equally well in private and public sectors. (Schreiner, 1991;IGemens, 1991;Lipscomb, 1989; Mosley, 1990, 1991;Jones, 1991;Abeln... C. 6/Limits C. 7/Partner C. crim act C. 9/Maintain C. 10/Chan in C. 1 f/Se/ection C. 12/Relations C. 13/Assi nment C14. /Resolution C. 15/Start C. 16a/Man ower C. feb/C/ran e C. 16c/Wilhn ness C. 16d/Cost C. 17/Trust C. 1 8/Innovation...

  5. The Politics of Access to Higher Education in Argentina and Brazil: A comparative analysis

    E-Print Network [OSTI]

    Fernandes Nogueira, Jaana Flavia

    2013-01-01T23:59:59.000Z

    superior e universidade no Brasil. Lopez, E. M. T. ; Faria500 anos de educação no Brasil. 4a ed. Belo Horizonte:Públicas. Madrid: Siglo XXI. Brasil. MEC (2004). Sistema

  6. Comparative SILAC Proteomic Analysis of Trypanosoma brucei Bloodstream and Procyclic Lifecycle Stages

    E-Print Network [OSTI]

    Schnaufer, Achim

    , University of Texas-Houston Medical School, United States of America Received February 7, 2012; Accepted Chemistry and Drug Discovery, College of Life Sciences, University of Dundee, Dundee, United Kingdom to identify 3959 proteins and quantify SILAC ratios for 3553 proteins with a false discovery rate of 0

  7. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    tic tape suppliers include TULSA, for Petroleum Abstracts;Nordic) IFI Plenum TULSA IAA STAR FIGURE 1 searcher's d i sconprehen- 9ive sources, TULSA rod API, are a v a i l a b l

  8. IDENTIFICATION AND COMPARATIVE GENOMIC ANALYSIS OF SIGNALING AND REGULATORY COMPONENTS IN THE DIATOM THALASSIOSIRA PSEUDONANA1

    E-Print Network [OSTI]

    Berges, John A.

    the globe. The first whole-genome sequence from a diatom species, Thalassiosira pseu- donana Hasle et

  9. India and China: A Comparative Analysis of Mobile Phones in Agriculture

    E-Print Network [OSTI]

    Bonthu, Prashanthi

    2014-05-31T23:59:59.000Z

    In 2010, China and India were named the first and second largest mobile phone markets in the world based on their number of subscribers. India and China have focused on extending their telecommunication services into rural areas for socio...

  10. A Comparable Systems Analysis Of San Francisco's BART: Lessons For Automated Highway Systems

    E-Print Network [OSTI]

    Hickman, Mark D.

    1994-01-01T23:59:59.000Z

    safety, reliability, and maintenance were identified and investigated. It appears that sound system engineeringreliability, maintenance, and personnel training - Review of engineering tests to ensure compliance to safety

  11. Comparative Analysis of the Morphology and Materials Properties of Pinniped Vibrissae

    E-Print Network [OSTI]

    Ginter, Carly C.

    2012-02-14T23:59:59.000Z

    and Kaminski 1995; Hyv?rinen 1989; Newby et al. 1970). Newby et al. (1970) observed lactating mother harbor seals that were determined to be blind by their opaque corneas. Lactation is energetically demanding, with female harbor seals losing 80... 1995; Newby et al. 1970). Experimental evidence has shown that phocid seals rely heavily upon their vibrissae to follow hydrodynamic trails (Dehnhardt et al. 1998a; Dehnhardt et al. 2001; Schulte-Pelkum et al. 2007; Wieskotten et al. 2010a, 2010b...

  12. Annotation and comparative analysis of the glycoside hydrolase genes in Brachypodium distachyon

    E-Print Network [OSTI]

    Tyler, Ludmila; Bragg, Jennifer N; Wu, Jiajie; Yang, Xiaohan; Tuskan, Gerald A; Vogel, John P

    2010-01-01T23:59:59.000Z

    looks like a class II protein but lacks the signal peptideIV proteins, this protein also lacks CRD and CTE regions.xylanase inhibi- tor proteins (XIPs) that lack chitinolytic

  13. Comparative analysis of dinoflagellate chloroplast genomes reveals rRNA and tRNA genes

    E-Print Network [OSTI]

    Barbrook, Adrian C; Santucci, Nicole; Plenderleith, Lindsey J; Hiller, Roger G; Howe, Christopher J

    2006-11-23T23:59:59.000Z

    GCAUCGGCUAA-CUCCGUGCCAGCAGCCGCGGUAAG-ACGGAGGAUGC Nephroselmis olivacea GCAUCGGCUAA-CUCCGUGCCAGCAGCCGCGGUAAG-ACGGAGGAUGC Chlorella vulgaris GCAUCGGCUAA-CUCUGUGCCAGCAGCCGCGGUAAG-ACAGAGGAUGC Pyrenomonas salina GCAUCGGCUAA...

  14. Explaining unexpected electoral openings in authoritarian systems : a comparative analysis of parliamentary elections

    E-Print Network [OSTI]

    Vaidyanathan, Karthik

    2010-01-01T23:59:59.000Z

    Dekmejian, Richard Hrair. 1971. Egypt under Nasir: A StudyS. 2002. The Politics of Egypt: State-Society Relationship.Ebeid, Mona. 2001. “Egypt’s 2000 Parliamentary Elections. ”

  15. Comparative analysis of piezophilic bacteria : the search for adaptations to life in the deep sea

    E-Print Network [OSTI]

    Kerman, Ian McKenzie

    2008-01-01T23:59:59.000Z

    C. R. (1993). Pathways of protein folding. Annual review of1994). Volume changes on protein folding. Structure (London,side chain volume upon protein folding. Amino Acid Changes

  16. A comparative analysis of operational codes for King Hussein I and King Abdullah II 

    E-Print Network [OSTI]

    Sparling, Dwain Leland

    2013-02-22T23:59:59.000Z

    After King Abdullah II inherited the throne from King Hussein I at a very critical transition point in 1999, it became necessary for a study to rigorously examine the fundamental characteristics of each leaders' outlooks on the political realm...

  17. Athletic behavior and achievement orientations of female adolescents: a black-white comparative analysis

    E-Print Network [OSTI]

    Butler, James A

    1976-01-01T23:59:59.000Z

    , not work. Edwards (1973) has noted that, in the past, concepts such as recreation (used mostly by physical educators), play, and games have been used synonymously with sport. However, these concepts hold quite distinct meanings. Huizinga (1958) defined... play as "free activities standing quite consciously outside of ordinary life as being not serious. . . confined to its own proper boundaries. . . and carried out ac- cording to fixed rules. " Callois (1961) argues against Huizinga's definition...

  18. A comparative analysis of emissions from bagasse charcoal and wood charcoal

    E-Print Network [OSTI]

    Ramírez, Andrés, 1982-

    2005-01-01T23:59:59.000Z

    Haiti is the poorest country in the Western hemisphere and is in need of cheap cooking fuel source. Currently, lump charcoal, the cooking fuel of Haiti, is made by carbonizing trees in ditches before selling the charcoal ...

  19. Mechanisms of neutrinoless double-beta decay: A comparative analysis of several nuclei

    SciTech Connect (OSTI)

    Ali, A. [DESY, Deutsches Elektronen-Synchrotron (Germany); Borisov, A. V., E-mail: borisov@phys.msu.r [Moscow State University (Russian Federation); Zhuridov, D. V. [Scuola Normale Superiore (Italy)

    2010-12-15T23:59:59.000Z

    The neutrinoless double beta decay of several nuclei that are of interest from the experimental point of view ({sup 76}Ge, {sup 82}Se, {sup 100}Mo, {sup 130}Te, and {sup 136}Xe) is investigated on the basis of a general Lorentzinvariant effective Lagrangian describing physics effects beyond the Standard Model. The half-lives and angular-correlation coefficients for electrons are calculated for various decay mechanisms associated, in particular, with the exchange of Majorana neutrinos, supersymmetric particles (with R-parity violation), leptoquarks, and right-handed W{sub R} bosons. The effect of theoretical uncertainties in the values of relevant nuclear matrix elements on decay features is considered.

  20. A Comparative Analysis of Predicting Energy Savings from Energy Service Projects

    E-Print Network [OSTI]

    Kim, Amy A

    2014-05-01T23:59:59.000Z

    Implementation of energy service projects continue to increase as building owners are faced with higher utility bills, rigorous environmental regulations, and shrinking capital allocation for such projects. Different techniques and guidelines...

  1. Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis

    E-Print Network [OSTI]

    Conceicao, Ines C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patricia

    2011-01-01T23:59:59.000Z

    the B. anynana BACs analyzed. Sequence around Butterfly WingVolume 6 | Issue 8 | e23778 Sequence around Butterfly Wingmori . Each B. anynana BAC sequence is represented, with the

  2. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    and technology trends, total energy consumption and carbonof energy consumption and aggregate future energy trends.

  3. Corporate social responsibility in Brazil : a comparative analysis of two paper companies

    E-Print Network [OSTI]

    Nascimento, Ana Paula M. do, 1966-

    2004-01-01T23:59:59.000Z

    If being socially responsible can result in short or long-term economic benefits, then why do not all companies adopt corporate social responsibility (CSR) practices? This thesis draws on general assumptions from illustrative ...

  4. Dynamics of chiral oscillations - A comparative analysis with spin-flipping

    E-Print Network [OSTI]

    Alex E. Bernardini

    2013-01-04T23:59:59.000Z

    Chiral oscillation as well as spin flipping effects correspond to quantum phenomena of fundamental importance in the context of particle physics and, in particular, of neutrino physics. From the point of view of first quantized theories, we are specifically interested in appointing the differences between chirality and helicity by obtaining their dynamic equations for a fermionic Dirac-type particle (neutrino). We also identify both effects when the non-minimal coupling with an external (electro)magnetic field in the neutrino interacting Lagrangian is taken into account. We demonstrate that, however, there is no constraint between chiral oscillations, when it takes place in vacuum, and the process of spin flipping related to the helicity quantum number, which does not take place in vacuum. To conclude, we show that the origin of chiral oscillations (in vacuum) can be interpreted as position very rapid oscillation projections onto the longitudinal direction of momentum.

  5. A Comparative Analysis of Congestion Management Schemes under a Unified Framework

    E-Print Network [OSTI]

    approaches in use: England and Wales, Norway, Sweden, PJM and California. We develop a unified framework

  6. Comparative analysis of remaining oil saturation in waterflood patterns based on analytical modeling and simulation 

    E-Print Network [OSTI]

    Azimov, Anar Etibar

    2006-08-16T23:59:59.000Z

    In assessing the economic viability of a waterflood project, a key parameter is the remaining oil saturation (ROS) within each pattern unit. This information helps in identifying the areas with the highest ROS and thus ...

  7. WebinSitu: A Comparative Analysis of Blind and Sighted Browsing Behavior

    E-Print Network [OSTI]

    Wobbrock, Jacob O.

    . Cavender, Jeremy T. Brudvik, Jacob O. Wobbrock and Richard E. Ladner Computer Science and Engineering or commercial advantage and that copies bear this notice and the full citation on the first page. To copy

  8. Comparative Analysis of the Cost Models Used for Estimating Renovation Costs of Universities in Texas

    E-Print Network [OSTI]

    Faquih, Yaquta Fakhruddin

    2010-10-12T23:59:59.000Z

    Facility managers use various cost models and techniques to estimate the cost of renovating a building and to secure the required funds needed for building renovation. A literature search indicates that these techniques offer both advantages...

  9. The Politics of Access to Higher Education in Argentina and Brazil: A comparative analysis

    E-Print Network [OSTI]

    Fernandes Nogueira, Jaana Flavia

    2013-01-01T23:59:59.000Z

    education ?? In Argentina and Brazil, policies to grantpopulation. In Argentina and Brazil these policies changedto look at the policies adopted by Argentina and Brazil to

  10. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    2050 China Energy and CO2 Emissions Report, McKinsey & Co'sChina’s cumulative CO2 emissions given the global cumulativeBaseline LBNL CIS Total CO2 Emissions (Mt CO2) LBNL CIS with

  11. CILC Studies with Comparative Analysis to Existing Plants L2.MPO.P7.06

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o . C l a r k C o'IUHopper3CHOS2,2,

  12. Comparative Analysis of Alternative Means for Removing Noncondensable Gases from Flashed-Steam Geothermal Power Plants

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model, clickInformationNew York:GovernorCommons Capital* NREL/SR-550-28329 Martin

  13. The Comparative Logistics Project www.ed-w.info

    E-Print Network [OSTI]

    Brock, David

    The Comparative Logistics Project www.ed-w.info The Impact of e-Commerce on the Japanese Raw Fish Supply Chain Edmund W. Schuster and Kazunari Watanabe #12;The Comparative Logistics Project www in the Japanese market #12;The Comparative Logistics Project www.ed-w.info 1. Introduction (continued) · E

  14. RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach

    SciTech Connect (OSTI)

    Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna

    2010-05-26T23:59:59.000Z

    RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at http://regpredict.lbl.gov.

  15. SAFETY ANALYSIS QUANTITATIVE ANALYSIS ON

    E-Print Network [OSTI]

    Wang, Yinhai

    1 TOPIC C2 SAFETY ANALYSIS AND POLICY QUANTITATIVE ANALYSIS ON ANGLE-ACCIDENT RISK AT SIGNALIZED-2700 Tel: (206) 543-9639 Fax: (206) 543-5965 Email: nihan@u.washington.edu #12;2 Quantitative Analysis on Angle-Accident Risk at Signalized Intersections Abstract: This paper demonstrates how a new modeling

  16. SYNTHESIS OF SAFETY ANALYSIS AND FIRE HAZARD ANALYSIS METHODOLOGIES

    SciTech Connect (OSTI)

    Coutts, D

    2007-04-17T23:59:59.000Z

    Successful implementation of both the nuclear safety program and fire protection program is best accomplished using a coordinated process that relies on sound technical approaches. When systematically prepared, the documented safety analysis (DSA) and fire hazard analysis (FHA) can present a consistent technical basis that streamlines implementation. If not coordinated, the DSA and FHA can present inconsistent conclusions, which can create unnecessary confusion and can promulgate a negative safety perception. This paper will compare the scope, purpose, and analysis techniques for DSAs and FHAs. It will also consolidate several lessons-learned papers on this topic, which were prepared in the 1990s.

  17. Image Analysis

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Recognition Image Analysis and Recognition Snapshot1498121slicesqResedison Fibers permeating imaged material (Courtesy: Bale, Loring, Perciano and Ushizima) Imagery coming from...

  18. Comparing classical and Bayesian methods for predicting hurricane landfall rates

    E-Print Network [OSTI]

    Hall, T; Hall, Tim; Jewson, Stephen

    2006-01-01T23:59:59.000Z

    We compare classical and Bayesian methods for fitting the poisson distribution to the number of hurricanes making landfall on sections of the US coastline.

  19. atrium comparing architectural: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on two key technological pillars resource consumption, improved reliability and lower latency, compared to current metro network Lpez, V-ctor 129 Design of 64 bit...

  20. Comparative genomics reveals diversity among xanthomonads infecting tomato and pepper

    E-Print Network [OSTI]

    2011-01-01T23:59:59.000Z

    Potnis et al. : Comparative genomics reveals diversity amongtomato and pepper. BMC Genomics Submit your next manuscriptpv. syringae Potnis et al. BMC Genomics 2011, 12:146 http://

  1. Comparing the Primary Electron Transfer Process in Organic Photovoltai...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Comparing the Primary Electron Transfer Process in Organic Photovoltaic Heterojunctions with Photosynthetic Reaction Centers October 4, 2011 at 3pm36-428 Garry Rumbles National...

  2. How Energy-Efficient Light Bulbs Compare with Traditional Incandescent...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    used light fixtures or bulbs with models that have earned the ENERGY STAR, you can save 75 each year. Compared to traditional incandescents, energy-efficient lightbulbs...

  3. Comparative Study on the Sulfur Tolerance and Carbon Resistance...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on the Sulfur Tolerance and Carbon Resistance of Supported Noble Metal Catalysts in Steam Reforming of Liquid Comparative Study on the Sulfur Tolerance and Carbon Resistance of...

  4. Comparative Investigation of Benzene Steam Reforming over Spinel...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Investigation of Benzene Steam Reforming over Spinel Supported Rh and Ir Catalysts. Comparative Investigation of Benzene Steam Reforming over Spinel Supported Rh and Ir Catalysts....

  5. Comparative systems biology across an evolutionary gradient within...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    systems biology across an evolutionary gradient within the Shewanella genus . Comparative systems biology across an evolutionary gradient within the Shewanella genus . Abstract: To...

  6. Comparing Supply-Side Specifications in Models of Global Agriculture and the Food System

    SciTech Connect (OSTI)

    Robinson, Sherman; van Meijl, Hans; Willenbockel, Dirk; Valin, Hugo; Fujimori, Shinichiro; Masui, Toshihiko; Sands, Ronald; Wise, Marshall A.; Calvin, Katherine V.; Havlik, Petr; Mason d'Croz, Daniel; Tabeau, Andrzej; Kavallari, Aikaterini; Schmitz, Christoph; Dietrich, Jan P.; von Lampe, Martin

    2014-01-01T23:59:59.000Z

    This paper compares the theoretical specification of production and technical change across the partial equilibrium (PE) and computable general equilibrium (CGE) models of the global agricultural and food system included in the AgMIP model comparison study. The two modeling approaches have different theoretical underpinnings concerning the scope of economic activity they capture and how they represent technology and the behavior of supply and demand in markets. This paper focuses on their different specifications of technology and supply behavior, comparing their theoretical and empirical treatments. While the models differ widely in their specifications of technology, both within and between the PE and CGE classes of models, we find that the theoretical responsiveness of supply to changes in prices can be similar, depending on parameter choices that define the behavior of supply functions over the domain of applicability defined by the common scenarios used in the AgMIP comparisons. In particular, we compare the theoretical specification of supply in CGE models with neoclassical production functions and PE models that focus on land and crop yields in agriculture. In practice, however, comparability of results given parameter choices is an empirical question, and the models differ in their sensitivity to variations in specification. To illustrate the issues, sensitivity analysis is done with one global CGE model, MAGNET, to indicate how the results vary with different specification of technical change, and how they compare with the results from PE models.

  7. Original article Comparative study of forestomach digestion in llamas

    E-Print Network [OSTI]

    Boyer, Edmond

    Original article Comparative study of forestomach digestion in llamas and sheep JP Dulphy C-Genès-Champanelle, France (Received 3 June 1997; accepted 30 October 1997) Summary ― To compare digestion, the digestibilities of DM, OM and NDF were significantly higher in llamas: respectively, + 2.7, 3.6 and 5

  8. Comparing the Expressive Power of Access Control Mahesh V. Tripunitara

    E-Print Network [OSTI]

    Li, Ninghui

    Comparing the Expressive Power of Access Control Models Mahesh V. Tripunitara tripunit the expressive power of access control models is rec- ognized as a fundamental problem in computer security the expressive power of access control models into a single context and to compare such models to one another

  9. Conservation Screening Curves to Compare Efficiency Investments to Power Plants

    E-Print Network [OSTI]

    methodology to compare supply and demand-side resources. The screening curve approach supplements with load curve approach supplements with load shape information the data contained in a supply curve of conservedLBL-27286 Conservation Screening Curves to Compare Efficiency Investments to Power Plants Jonathan

  10. avian comparative genomics: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    comparative genomics First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Comparative genomics CiteSeer...

  11. Data Mining in Learning Classifier Systems: Comparing XCS with GAssist

    E-Print Network [OSTI]

    Bacardit, Jaume

    Data Mining in Learning Classifier Systems: Comparing XCS with GAssist Jaume Bacardit and Martin V) 333­2346 Fax: (217) 244­5705 #12; Data Mining in Learning Classifier Systems: Comparing XCS be distinguished in data mining including data volume, search space size and type, complexity of the concept, noise

  12. aspergillus microarray comparative: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Gene Expression Analysis & R Tutorial 12;DNA Microarrays An R Tutorial Functional Genomics Qiu, Weigang 6 Microarray submissions to Experibase MIT - DSpace Summary: Experibase...

  13. Comparative Probabilistic-Deterministic Studies and RVT based...

    Office of Environmental Management (EM)

    SSI and SSSI Responses of Nuclear Structures for Different Soil Site Conditions Application of Random Vibration Theory Methodology for Seismic Soil-Structure Interaction Analysis...

  14. OIL ANALYSIS LAB TRIVECTOR ANALYSIS

    E-Print Network [OSTI]

    OIL ANALYSIS LAB TRIVECTOR ANALYSIS This test method is a good routine test for the overall condition of the oil, the cleanliness, and can indicate the presence of wear metals that could be coming of magnetic metal particles within the oil. This may represent metals being worn from components (i

  15. Comparative Life-cycle Air Emissions of Coal, Domestic Natural Gas, LNG, and SNG for Electricity Generation

    E-Print Network [OSTI]

    Jaramillo, Paulina

    1 Comparative Life-cycle Air Emissions of Coal, Domestic Natural Gas, LNG, and SNG for Electricity from the LNG life-cycle. Notice that local distribution of natural gas falls outside our analysis boundary. Figure 1S: Domestic Natural Gas Life-cycle. Figure 2S: LNG Life-cycle. Processing Transmission

  16. Computational Analysis of Shrouded Wind Turbine Configurations

    E-Print Network [OSTI]

    Alonso, Juan J.

    Computational Analysis of Shrouded Wind Turbine Configurations Aniket C. Aranake Vinod K. Lakshminarayan Karthik Duraisamy Computational analysis of diuser-augmented turbines is performed using high-dimensional simulations of shrouded wind turbines are performed for selected shroud geometries. The results are compared

  17. Financial Analysis

    Broader source: Energy.gov [DOE]

    The first step in financing a street lighting retrofit is a detailed financial analysis. Because street lighting systems are designed to last ten or twenty years, or even longer, all aspects of first costs, ongoing expenses, and long-term savings are important. While a preliminary or first-level analysis can be used to determine such things as simple payback, rate of return, and cost of light, the results may neglect a number of important economic considerations, such as the time value of money, additional savings and expenses and their relative timing, and future energy price escalations. Hence a first-level analysis does not typically provide the end user with sufficient details to make a fully informed decision. For this reason, the Illuminating Engineering Society (IES) recommends a full life cycle cost/benefit analysis (LCCBA).

  18. Cost analysis guidelines

    SciTech Connect (OSTI)

    Strait, R.S.

    1996-01-10T23:59:59.000Z

    The first phase of the Depleted Uranium Hexafluoride Management Program (Program)--management strategy selection--consists of several program elements: Technology Assessment, Engineering Analysis, Cost Analysis, and preparation of an Environmental Impact Statement (EIS). Cost Analysis will estimate the life-cycle costs associated with each of the long-term management strategy alternatives for depleted uranium hexafluoride (UF6). The scope of Cost Analysis will include all major expenditures, from the planning and design stages through decontamination and decommissioning. The costs will be estimated at a scoping or preconceptual design level and are intended to assist decision makers in comparing alternatives for further consideration. They will not be absolute costs or bid-document costs. The purpose of the Cost Analysis Guidelines is to establish a consistent approach to analyzing of cost alternatives for managing Department of Energy`s (DOE`s) stocks of depleted uranium hexafluoride (DUF6). The component modules that make up the DUF6 management program differ substantially in operational maintenance, process-options, requirements for R and D, equipment, facilities, regulatory compliance, (O and M), and operations risk. To facilitate a consistent and equitable comparison of costs, the guidelines offer common definitions, assumptions or basis, and limitations integrated with a standard approach to the analysis. Further, the goal is to evaluate total net life-cycle costs and display them in a way that gives DOE the capability to evaluate a variety of overall DUF6 management strategies, including commercial potential. The cost estimates reflect the preconceptual level of the designs. They will be appropriate for distinguishing among management strategies.

  19. COMPARATIVE HEALTH IMPACT ASSESSMENTS ON FECAL SLUDGE MANAGEMENT PRACTICES

    E-Print Network [OSTI]

    Richner, Heinz

    i COMPARATIVE HEALTH IMPACT ASSESSMENTS ON FECAL SLUDGE MANAGEMENT PRACTICES: A CASE STUDY OF KLONG Fecal sludge (FS) is widely acknowledged as a major source of infectious pathogens. However, the proper

  20. Comparing Control Constructs by Typing Double-barrelled CPS Transforms

    E-Print Network [OSTI]

    Thielecke, Hayo

    Comparing Control Constructs by Typing Double-barrelled CPS Transforms Hayo Thielecke School Kingdom Copyright 2000 ACM 0-89791-88-6/97/05 ..$5.00 the bare essentials of labelling and jumping, so

  1. Distributed Kalman filtering compared to Fourier domain preconditioned conjugate gradient

    E-Print Network [OSTI]

    Greer, Julia R.

    Distributed Kalman filtering compared to Fourier domain preconditioned conjugate gradient for laser of the tomography problem. The second algorithm is the distributed Kalman filter (DKF) developed by Massioni et al

  2. Comparative Dynamics of Leucine Methyl Groups in FMOC-Leucine...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Dynamics of Leucine Methyl Groups in FMOC-Leucine and in a ProteinHydrophobic Core Probed by Solid-State Deuteron Comparative Dynamics of Leucine Methyl Groups in FMOC-Leucine and...

  3. Comparing the Performance of SunDiesel and Conventional Diesel...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    the Performance of SunDiesel and Conventional Diesel in a Light-Duty Vehicle and Engines Comparing the Performance of SunDiesel and Conventional Diesel in a Light-Duty Vehicle and...

  4. Comparative toxicities of two common agricultural chemicals to toads

    E-Print Network [OSTI]

    Cowman, Deborah Fay

    1997-01-01T23:59:59.000Z

    Amphibians are limited in their movements compared to other terrestrial vertebrates and are therefore at risk of having entire local populations destroyed by agricultural pesticides. This study provides basic toxicological information about two toad...

  5. Comparative genomics reveals evidence of marine adaptation in Salinispora species.

    E-Print Network [OSTI]

    Penn, Kevin; Jensen, Paul R

    2012-01-01T23:59:59.000Z

    Orcutt B, et al: Ecological genomics of marine roseobacters.1037-1042. Penn and Jensen BMC Genomics 2012, 13:86 http://and Jensen: Comparative genomics reveals evidence of marine

  6. array ii comparing: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    I I I I IIIIIIIIIIIIIIIIIIIII I II I I I II I I I II I I 292 STEAM RECEIVER MODELS FOR SOLAR DISH CONCENTRATORS: TWO MODELS COMPARED Energy Storage, Conversion and Utilization...

  7. Comparative vs. Absolute Performance Assessment with Environmental Sustainability Metrics

    E-Print Network [OSTI]

    High, Karen

    Comparative vs. Absolute Performance Assessment with Environmental Sustainability Metrics Xun Jin Different goals and potential audiences determine that two types of environmental performance assessments metrics can be partitioned into two camps. One suite of metrics aim to assess the environmental

  8. Exploration of N-terminal methionine excision via comparative proteogenomics

    E-Print Network [OSTI]

    Bonissone, Stefano Romoli

    2010-01-01T23:59:59.000Z

    xii Chapter 1 N-Terminal Methionine Excision . . . .1.1 N-Terminal Methionine Excision . 1.2 N-End rule and1.3 NME and other N-terminal PTMs 1.4 Comparative

  9. Comparative case studies of health reform in England

    E-Print Network [OSTI]

    Birmingham, University of

    Comparative case studies of health reform in England Report submitted to the Department of Health........................................................................................14 1.1 Presenting the Health System Reform policy agenda...................................14 1 ..........................................................................................64 Demand Side Reform.........................................

  10. Comparative genomics boosts target prediction for bacterial small RNAs

    E-Print Network [OSTI]

    Will, Sebastian

    RNA, for Comparative Prediction Algorithm for sRNA Tar- gets). Furthermore, CopraRNA precisely predicts the sB, which is a major regulator of amino acid metabolism and directly controls 1% of all Salmonella enterica

  11. azithromycin sr compared: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    It is desirable to be able to predict how many genomes are needed for comparative genomics, and at what evolutionary distances. Here I describe a simple mathematical model for...

  12. Algal Harvesting for Biodiesel Production: Comparing Centrifugation and Electrocoagulation

    E-Print Network [OSTI]

    Kovalcik, Derek John

    2013-08-09T23:59:59.000Z

    Electrocoagulation was compared to centrifugation at pilot scale for harvesting Nannochloris oculata and Nannochloropsis salina for biodiesel production. The pilot scale testing is a proof of concept and no optimization was conducted. Testing used...

  13. A comparative study of DNA polymerase alpha isolation

    E-Print Network [OSTI]

    Cernosek, Zina

    1987-01-01T23:59:59.000Z

    A COMPARATIVE STUDY OF DNA POLYMERASE ALPHA ISOLATION A Thesis by ZINA CERNOSEK Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE May 1987 Major Subject...: Genetics A COMPARATIVE STUDY OF DNA POLYMERASE ALPHA ISOLATION A Thesis by ZINA CERNOSEK Approved as to style and content by: David L s ee (Chair of Committee) Jam E. Womack (Memb ) oren C. Skow (Member) Gerald R. Bratton (Head of Department...

  14. Particle Simulation of Coulomb Collisions: Comparing the Methods of Takizuka & Abe and Nanbu

    SciTech Connect (OSTI)

    Wang, C; Lin, T; Caflisch, R; Cohen, B; Dimits, A

    2007-05-22T23:59:59.000Z

    The interactions of charged particles in a plasma are in a plasma is governed by the long-range Coulomb collision. We compare two widely used Monte Carlo models for Coulomb collisions. One was developed by Takizuka and Abe in 1977, the other was developed by Nanbu in 1997. We perform deterministic and stochastic error analysis with respect to particle number and time step. The two models produce similar stochastic errors, but Nanbu's model gives smaller time step errors. Error comparisons between these two methods are presented.

  15. A comparative study of recreation programs at MHMR halfway houses in Texas

    E-Print Network [OSTI]

    McCann, Eileen Mary

    1986-01-01T23:59:59.000Z

    minimum restr ictions upon them leading a normal life. However, the roots of the WHAR Authority of Br azos Valley can be traced back to 1955 when a three year pilot proJect establishing a youth development courcil was implemented. The pr oJect pr... Authority of Brazos Valley. An explanation of how a halfway house f unct iona is included. An analysis of what is current ly provided in each district was conducted and compared with the Brazos Valley' s Hal f way House, Nary Lake. A telephone survey...

  16. Quantitative Methods for Comparing Different HVAC Control Schemes

    E-Print Network [OSTI]

    Aswani, Anil; Taneja, Jay; Krioukov, Andrew; Culler, David; Tomlin, Claire

    2012-01-01T23:59:59.000Z

    Experimentally comparing the energy usage and comfort characteristics of different controllers in heating, ventilation, and air-conditioning (HVAC) systems is difficult because variations in weather and occupancy conditions preclude the possibility of establishing equivalent experimental conditions across the order of hours, days, and weeks. This paper is concerned with defining quantitative metrics of energy usage and occupant comfort, which can be computed and compared in a rigorous manner that is capable of determining whether differences between controllers are statistically significant in the presence of such environmental fluctuations. Experimental case studies are presented that compare two alternative controllers (a schedule controller and a hybrid system learning-based model predictive controller) to the default controller in a building-wide HVAC system. Lastly, we discuss how our proposed methodology may also be able to quantify the efficiency of other building automation systems.

  17. The SLAC Comparator for the Calibration of Digital Leveling Equipment

    SciTech Connect (OSTI)

    Gassner, G.L.; Ruland, R.E.; /SLAC

    2006-11-07T23:59:59.000Z

    At SLAC digital levels are used for precise leveling, both for setting out and monitoring. A very high precision of 30 {micro}m is required, which can only be achieved by regularly calibrating the leveling equipment. The calibration facility is also used for detailed investigations to refine the SLAC leveling procedure. In this paper the setup of the SLAC vertical comparator is described. In order to also perform traditional staff calibration a CCD camera was integrated into the SLAC comparator. Finally an overview of further investigations of our leveling equipment is presented.

  18. Visualization and Analysis in Support of Fusion Science

    SciTech Connect (OSTI)

    Sanderson, Allen R. [Scientific Computing and Imaging Institute] [Scientific Computing and Imaging Institute

    2012-10-01T23:59:59.000Z

    This report summarizes the results of the award for “Visualization and Analysis in Support of Fusion Science.” With this award our main efforts have been to develop and deploy visualization and analysis tools in three areas 1) magnetic field line analysis 2) query based visualization and 3) comparative visualization.

  19. Comparing Price Forecast Accuracy of Natural Gas Models andFutures Markets

    SciTech Connect (OSTI)

    Wong-Parodi, Gabrielle; Dale, Larry; Lekov, Alex

    2005-06-30T23:59:59.000Z

    The purpose of this article is to compare the accuracy of forecasts for natural gas prices as reported by the Energy Information Administration's Short-Term Energy Outlook (STEO) and the futures market for the period from 1998 to 2003. The analysis tabulates the existing data and develops a statistical comparison of the error between STEO and U.S. wellhead natural gas prices and between Henry Hub and U.S. wellhead spot prices. The results indicate that, on average, Henry Hub is a better predictor of natural gas prices with an average error of 0.23 and a standard deviation of 1.22 than STEO with an average error of -0.52 and a standard deviation of 1.36. This analysis suggests that as the futures market continues to report longer forward prices (currently out to five years), it may be of interest to economic modelers to compare the accuracy of their models to the futures market. The authors would especially like to thank Doug Hale of the Energy Information Administration for supporting and reviewing this work.

  20. Comparing the health impacts of different sources of energy. Keynote address

    SciTech Connect (OSTI)

    Hamilton, L.D.

    1981-01-01T23:59:59.000Z

    Assessing health impacts of different energy sources requires synthesis of research results from any different disciplines into a rational framework. Information is often scanty; qualitatively different risks, or energy systems with substantially different end uses, must be put on a common footing. Historically institutional constraints have inhibited agencies from making incisive comparisons necessary for formulating energy policy; this has exacerbated public controversy over appropriate energy sources. Risk assessment methods reviewed include examples drawn from work of the Biomedical and Environmental Assessment Division at Brookhaven National Laboratory and elsewhere. Uncertainty over the mechanism and size of air pollution health damage is addressed through a probabilistic health-damage function, using sulfate-particle exposure as an indicator. This facilitates intercomparison through analysis of each step in the whole fuel cycle between a typical coal and nuclear powerplant. Occupational health impacts, a significant fraction of overall damage, are illustrated by accident trends in coal mining. In broadening comparisons to include new technologies, one must include the impact of manufacturing the energy-producing device as part of an expanded fuel cycle, via input/output methods. Throughout the analysis, uncertainties must be made explicit in the results, including uncertainty of data and uncertainty in choice of appropriate models and methods. No single method of comparative risk assessment is fully satisfactory; each has its limitations. One needs to compare several methods if decision-making is to be realistic.

  1. A comparative assessment of the economics of plutonium disposition including comparison with other nuclear fuel cycles

    SciTech Connect (OSTI)

    Williams, K.A.; Miller, J.W.; Reid, R.L.

    1997-05-01T23:59:59.000Z

    DOE has been evaluating three technologies for the disposition of approximately 50 metric tons of surplus plutonium from defense-related programs: reactors, immobilization, and deep boreholes. As part of the process supporting an early CY 1997 Record of Decision (ROD), a comprehensive assessment of technical viability, cost, and schedule has been conducted. Oak Ridge National Laboratory has managed and coordinated the life-cycle cost (LCC) assessment effort for this program. This paper discusses the economic analysis methodology and the results prior to ROD. Other objectives of the paper are to discuss major technical and economic issues that impact plutonium disposition cost and schedule. Also to compare the economics of a once-through weapons-derived MOX nuclear fuel cycle to other fuel cycles, such as those utilizing spent fuel reprocessing. To evaluate the economics of these technologies on an equitable basis, a set of cost estimating guidelines and a common cost-estimating format were utilized by all three technology teams. This paper also includes the major economic analysis assumptions and the comparative constant-dollar and discounted-dollar LCCs.

  2. Exports and productivity --Comparable evidence for 14 countries

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Exports and productivity -- Comparable evidence for 14 countries N° 2007-36 Décembre 2007 The International Study Group on Exports and Productivity Flora BELLONE Université de Nice ­ Sophia Antipolis Liza Lionel NESTA OFCE-DRIC Stefano SCHIAVO OFCE-DRIC hal-00973116,version1-3Apr2014 #12;Exports

  3. FLOATING GATE COMPARATOR WITH AUTOMATIC OFFSET MANIPULATION FUNCTIONALITY

    E-Print Network [OSTI]

    Maryland at College Park, University of

    , including analog-to- digital converters, memories, dynamic logic, and sense am- plifiers. A comparator. The injection mechanism has been extensively described in the literature [7, 8], and the injection feedback constant current configurations. An accurate model in [10] suggests that injection current Iinj = Is exp

  4. RESEARCH Open Access A comparative study of ethanol production using

    E-Print Network [OSTI]

    California at Riverside, University of

    bioenergy research centers (Great Lakes Bioenergy Research Center (GLBRC), Joint BioEnergy Institute (JBEI) and BioEnergy Science Center (BESC)) has given us a unique opportunity to compare the performance of three Engineering and Materials Science, Department of Energy (DOE) Great Lakes Bioenergy Research Center (GLBRC

  5. Comparing Online Community Structure of Patients of Chronic Diseases

    E-Print Network [OSTI]

    Maddali, Hanuma Teja; Margolis, Peter

    2015-01-01T23:59:59.000Z

    In this paper we compare the social network structure of people talking about Crohn's disease, Cystic Fibrosis, and Type 1 diabetes on Facebook and Twitter. We find that the Crohn's community's contributors are most emotional on Facebook and Twitter and most negative on Twitter, while the T1D community's communication network structure is most cohesive.

  6. artery comparing finite: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary: Comparing semigroup and monoid presentations for finite monoids C.M. Campbell, J.D. Mitchell and N@st-and.ac.uk, jamesm@mcs.st-and.ac.uk, nik@mcs.st-and.ac.uk It is known...

  7. A Comparative Study of Impairments Aware Optical Networks Planning Tools

    E-Print Network [OSTI]

    Politècnica de Catalunya, Universitat

    to the modulation format and/or transmission rates. Transparent networks can also contribute to lower powerA Comparative Study of Impairments Aware Optical Networks Planning Tools Siamak Azodolmolky Email: pareta@ac.upc.edu Abstract--Transparent and translucent optical networks are widely considered

  8. Comparing Control Constructs by Double-barrelled CPS Hayo Thielecke

    E-Print Network [OSTI]

    Thielecke, Hayo

    Comparing Control Constructs by Double-barrelled CPS Hayo Thielecke (h classical in the source of the CPS transform break the linearity of continuation use in the target. Keywords operators to the bare essentials of labelling and jumping, so that there are no longer any distracting

  9. CO2 Storage and Sink Enhancements: Developing Comparable Economics

    E-Print Network [OSTI]

    CO2 Storage and Sink Enhancements: Developing Comparable Economics B.R. Bock1 , R.G. Rhudy2 , and H technologies and practices under development for CO2 storage and sink enhancement, including options. For the geologic and ocean storage options, CO2 capture costs from another project were added to the costs of CO2

  10. Comparative Study Of Local Descriptors For Measuring Object Taxonomy

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Comparative Study Of Local Descriptors For Measuring Object Taxonomy B. Hemery1 H. Laurent2 B automatically an object taxonomy. In order to answer this question, we use the Caltech256 benchmark which provides a large object taxonomy used as reference. This study shows that SIFT, differential invariants

  11. Consensus alignment server for reliable comparative modeling with distant templates

    E-Print Network [OSTI]

    Vajda, Sandor

    Consensus alignment server for reliable comparative modeling with distant templates Jahnavi C; Accepted April 26, 2004 ABSTRACT Consensus is a server developed to produce high- quality alignments different align- ment methods, the server produces a consensus alignment, with a reliability measure

  12. The SLAC Vertical Comparator for the Calibration of Digital Levels

    SciTech Connect (OSTI)

    Woschitz, Helmut; /Graz U.; Gassner, Georg; Ruland, Robert; /SLAC

    2006-12-06T23:59:59.000Z

    Digital levels replaced spirit levels in most fields of precise height measurements because of the automation of the height readings. Three manufacturers offer digital levels with a single reading resolution of 10 {micro}m, and for all of them systematic effects are known. In Europe several facilities for system calibration of digital levels using vertical comparators were established within the last decade. However, there still was no system calibration facility in North America. In order to guarantee the accuracy required for the alignment of experiments at the Stanford Linear Accelerator Center (SLAC) a calibration facility for the system calibration of digital levels was built. In this paper the setup of the SLAC vertical comparator is described in detail and its standard uncertainty is derived. In order to perform traditional rod calibration of conventional line-scaled rods, a CCD camera was integrated into the SLAC comparator. The CCD camera setup is also briefly described. To demonstrate the capabilities of the comparator, results of system and rod calibration are shown.

  13. Comparing the Effects of Mutualism and Competition on Industrial Districts

    E-Print Network [OSTI]

    Hoyle, Rebecca B.

    stations. The diversity of industries situated in the region include food processing industries, oil refining, chemical and bio-chemical produc- tion facilities, as well as heavy industrial facilitiesComparing the Effects of Mutualism and Competition on Industrial Districts Christopher J.K. Knighta

  14. Comparative Study of Switched Reluctance Motors Performances for Two Current

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of machines as high torque ripple, high acoustic noise and vibration limit their industrial applications [1Comparative Study of Switched Reluctance Motors Performances for Two Current Distributions a 3-phase, 6-slot, and 4-pole Mutually Coupled Switched Reluctance Motor (MCSRM 6/4) with new current

  15. ORIGINAL ARTICLE Comparative genomics-guided loop-mediated isothermal

    E-Print Network [OSTI]

    Hsiang, Tom

    ORIGINAL ARTICLE Comparative genomics-guided loop-mediated isothermal amplification sequencing and analytical techniques, genomic sequence data of prok- aryotes are accumulating at a very rapid pace. As of October 2008, there are 873 complete and pub- lished genome sequences, as well as 2025

  16. Comparative and Functional Genomics Comp Funct Genom 2003; 4: 3136.

    E-Print Network [OSTI]

    Allen, John F.

    Comparative and Functional Genomics Comp Funct Genom 2003; 4: 31­36. Published online in Wiley and mitochondria contain genomes John F. Allen* Plant Biochemistry, Center for Chemistry and Chemical Engineering that the nucleotide sequences of mitochondrial and chloroplast genomes would provide the answer has proved unfounded

  17. Sun-Sentinel How Florida's nuclear plants compare to Japan's

    E-Print Network [OSTI]

    Belogay, Eugene A.

    Sun-Sentinel How Florida's nuclear plants compare to Japan's By Julie Patel March 17, 2011 01:35 PM What went wrong at the Fukushima nuclear plant in Japan and how are Florida's nuclear plants prepared to deal with similar problems? Nuclear operators in Florida say the biggest risk their plants face is from

  18. A Comprehensive and Comparative Metric for Information Security

    E-Print Network [OSTI]

    Breu, Ruth

    A Comprehensive and Comparative Metric for Information Security Steffen Weiß1 , Oliver Weissmann2 security GmbH, Germany Abstract Measurement of information security is important for organizations , Falko Dressler1* 1 Dept. of Computer Science 7, University of Erlangen, Germany 2 atsec information

  19. Comparative efficiencies of solar energy collectors Laboratoire de Technologie Optique

    E-Print Network [OSTI]

    Boyer, Edmond

    57 Comparative efficiencies of solar energy collectors M. Duban Laboratoire de Technologie Optique the solar energy during a day or a year, independant of their dimensions, the amount of energy collected seuils K = 0 et K = 0,5 (K étant le rapport entre 1'energie minimum nécessaire pour un fonctionnement

  20. Comparative Influences of Various Protein Feeds on Laying Hens

    E-Print Network [OSTI]

    Sherwood, R. M. (Ross Madison)

    1924-01-01T23:59:59.000Z

    ...................................................... 5 Experiment 1-Comparative Value of Meat Scrap. Tankzge 2nd Cotton- ................................ . seed Meal for Laying Hens 6 ............................ Time. Objects. Stock Used. Feeds Used G Prices of Feeds... of Meat Scrap with Cottonseed Meal For Laying Hens ........................................ 16 ............................ Time. Object. Stock Used. Feeds Used 16 Prices of Feeds ................................................ 17 Results of.the Test...

  1. Comparing the Parix and PVM parallel programming environments

    E-Print Network [OSTI]

    Amsterdam, Universiteit van

    1 Comparing the Parix and PVM parallel programming environments A.G. Hoekstra, P.M.A. Sloot, and L Genericity of parallel programming environments, enabling development of portable parallel programs environments are important issues if a choice between programming environments has to be made. We propose

  2. Termination Checking: Comparing Structural Recursion and Sized Types by Examples

    E-Print Network [OSTI]

    Abel, Andreas

    Termination Checking: Comparing Structural Recursion and Sized Types by Examples David Thibodeau Decemer 3, 2011 Abstract Termination is an important property for programs and is necessary for formal proofs to make sense. In order to make sure that a program using recursion is terminating, one can use

  3. A Multivariate Probabilistic Method for Comparing Two Clinical Datasets

    E-Print Network [OSTI]

    Hauskrecht, Milos

    A Multivariate Probabilistic Method for Comparing Two Clinical Datasets Yuriy Sverchkov yus24@pitt a concise and math- ematically grounded description of multivariate differences between a pair of clinical (ICUs), or within the same ICU during different periods, may show systematically different outcomes

  4. Migration, rural development, poverty and food security: a comparative perspective

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Migration, rural development, poverty and food security: a comparative perspective Thomas Lacroix rural underdevelopment, poverty and food insecurity in rural areas? The case studies provide mixed poverty, even for non-migrant households. In the countries benefiting from temporary migration schemes

  5. SOW AND PIGLET NUTRITION Comparative utilization of horse-bean

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    II. - SOW AND PIGLET NUTRITION Comparative utilization of horse-bean and soybean oil) Total substitution of soybean oil-meal by whole horse-bean in diets offered to multiparous sows during on barley, supplemented with protein either in form of soyabean oil-meal (o soybeangroup) or horse-bean

  6. Comparative Life-Cycle Air Emissions of Coal, Domestic Natural

    E-Print Network [OSTI]

    Jaramillo, Paulina

    come domestically from the production of synthetic natural gas (SNG) via coal gasification- methanation gasification technologies that use coal to produce SNG. This National Gasification Strategy callsComparative Life-Cycle Air Emissions of Coal, Domestic Natural Gas, LNG, and SNG for Electricity

  7. Defect in lung growth* Comparative study of three diagnostic criteria.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Defect in lung growth* Comparative study of three diagnostic criteria. P. DECHELOTTE, A. LABBE, O and fetuses (49 pathological cases and 25 controls) to detect defects in lung growth. In each case lung disease. RA count is low in lung hypoplasia but is not an entirely reliable diagnostic criterion since

  8. HumanMouse Gene Identification by Comparative Evidence Integration and

    E-Print Network [OSTI]

    Pavlovic, Vladimir

    The identification of genes in the human genome remains a challenge, as the actual predictions appear to disagree of genes in the human genome by using a reference, such as mouse genome. However, this comparative genome. In particular, it is not clear whether the mouse is at the correct evolutionary distance from

  9. A Comparative Evaluation of XML Difference Algorithms with Genomic Data

    E-Print Network [OSTI]

    Paton, Norman

    A Comparative Evaluation of XML Difference Algorithms with Genomic Data Cornelia Hedeler and Norman, UK {chedeler,npaton}@cs.manchester.ac.uk Abstract. Genome sequence data and annotations are subject difference algorithms, namely X-Diff, JXyDiff and 3DM, can be used to identify and document genome changes

  10. Data Mining in Learning Classifier Systems: Comparing XCS with GAssist

    E-Print Network [OSTI]

    Bacardit, Jaume

    Data Mining in Learning Classifier Systems: Comparing XCS with GAssist Jaume Bacardit1 and Martin V several structural properties of the underlying datasets. 1 Introduction Successful data mining mining including data volume, search space size and type, complexity of the concept, noise in the data

  11. absorption spectrometry comparing: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    absorption spectrometry comparing First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Determination of...

  12. COMPARATIVE STUDY AMONG HYBRID GROUND SOURCE HEAT PUMP SYSTEM, COMPLETE GROUND SOURCE HEAT PUMP AND CONVENTIONAL HVAC SYSTEM

    SciTech Connect (OSTI)

    Jiang Zhu; Yong X. Tao

    2011-11-01T23:59:59.000Z

    In this paper, a hotel with hybrid geothermal heat pump system (HyGSHP) in the Pensacola is selected and simulated by the transient simulation software package TRNSYS [1]. To verify the simulation results, the validations are conducted by using the monthly average entering water temperature, monthly facility consumption data, and etc. And three types of HVAC systems are compared based on the same building model and HVAC system capacity. The results are presented to show the advantages and disadvantages of HyGSHP compared with the other two systems in terms of energy consumptions, life cycle cost analysis.

  13. Centrales au gaz et Energies renouvelables: comparer des pommes avec des pommes

    SciTech Connect (OSTI)

    Bolinger, Mark; Wiser, Ryan; Golove, William

    2003-10-20T23:59:59.000Z

    The fundamental conclusion that we draw from this analysis is that one should not to base itself blindly on forecasts prices of natural gas when one compare contracts at price fixes with producers of renewable energy with contracts at variable prices with promoters power stations with gas. Indeed, forecasts of the prices of gas do not succeed not to enter the associated costs with the covering of the risk, that they are connected to the negative pressure against the cover, with the CAPM, with costs of transaction or with unspecified combination of three. Thus, insofar as price stability to length term is developed, better way of comparing the two choices would be to have recourse to the data on the prices in the long term natural gas, and not with forecasts of the prices. During three last years at least, the use of these prices in the long term would have besides license to correct a methodological error who, obviously, seem to have supported unduly, and of relatively important way, power stations with natural gas compared to their competitors of renewable energies.

  14. Comparative environmental impact and efficiency assessment of selected hydrogen production methods

    SciTech Connect (OSTI)

    Ozbilen, Ahmet, E-mail: Ahmet.Ozbilen@uoit.ca; Dincer, Ibrahim, E-mail: Ibrahim.Dincer@uoit.ca; Rosen, Marc A., E-mail: Marc.Rosen@uoit.ca

    2013-09-15T23:59:59.000Z

    The environmental impacts of various hydrogen production processes are evaluated and compared, considering several energy sources and using life cycle analysis. The results indicate that hydrogen produced by thermochemical water decomposition cycles are more environmentally benign options compared to conventional steam reforming of natural gas. The nuclear based four-step Cu–Cl cycle has the lowest global warming potential (0.559 kg CO{sub 2}-eq per kg hydrogen production), mainly because it requires the lowest quantity of energy of the considered processes. The acidification potential results show that biomass gasification has the highest impact on environment, while wind based electrolysis has the lowest. The relation is also investigated between efficiency and environmental impacts. -- Highlights: • Environmental performance of nuclear-based hydrogen production is investigated. • The GWP and AP results are compared with various hydrogen production processes. • Nuclear based 4-step Cu–Cl cycle is found to be an environmentally benign process. • Wind-based electrolysis has the lowest AP value.

  15. Comparative studies of diverged members of the phosphotriesterase family 

    E-Print Network [OSTI]

    Arriens, Cristina Gale

    2013-02-22T23:59:59.000Z

    -ndel ponl-sap pon I -Gsap pon1-sap* pon1-sap+ CGGCTTCCGCATATGGCGAAGCTGATTGCG GCTCTTCCGCATTAGAGCTCACAGTAAAGAGC GGTGGTTGCTCTTCCGCATTAGAGCTCACAGT AAAGAGC GCTCTTCTCTGTTAGAGACAGTAAAGAGC CGGCTTATGGCATGGGTGCGCTCTTCTCTGTTA GAGACAGTAAAGAGC Reactions were... Technologies Lab of the Institute of Developmental /k Molecular for analysis. The sequencing protocol was repeated using internal primers PON I-201a and PONI-201 to obtain the complete sequence of the gene. INTRODUCTION OF RESTRICTION SITES Primers PONI-sap...

  16. Comparative genomics of the core and accessory genomes of 48 Sinorhizobium strains comprising five genospecies

    E-Print Network [OSTI]

    2013-01-01T23:59:59.000Z

    annotation and comparative genomics. Database (Oxford) 2009,et al. : Comparative genomics of the core and accessoryComparative genomics of the core and accessory genomes of 48

  17. A Novel Candidate Vaccine for Cytauxzoonosis Inferred from Comparative Apicomplexan Genomics

    E-Print Network [OSTI]

    2013-01-01T23:59:59.000Z

    from Comparative Apicomplexan Genomics Jaime L. Tarigo 1 ,the use of comparative genomics to computationally andthe use of comparative genomics as an accelerated path to

  18. Comparative assessment of health and safety impacts of coal use

    SciTech Connect (OSTI)

    Not Available

    1980-03-01T23:59:59.000Z

    Increasing the use of coal to replace oil and gas consumption is considered beneficial for economic and political reasons. The evaluation of this report, however, is that the shift to coal can involve significant health, safety, and environmental impacts compared to those from oil and natural gas systems, which are considerably less adverse than those of any coal energy system in use today. An evaluation and comparison of the potential impacts from the various alternative coal technologies would be useful to both governmental and industrial policy planners and would provide them with information relevant to a decision on assistance, incentives, and prioritization among the energy technologies. It is, therefore, the main objective of this report to review the key health, safety, and environmental impacts of some promising coal energy technologies and to compare them.

  19. JD/LLM in International and Comparative Law

    E-Print Network [OSTI]

    Reif, John H.

    (919) 613-7020 admissions@law.duke.edu www.law.duke.edu/admis l a u n c h y o u r g l o b a l l aw p r a c t i c e h e r e APPLY NOW law.duke.edu/admis/degreeprograms/jd-llm/ Early Application Deadlines 11@ JD/LLM in International and Comparative Law Duke Law Admissions Duke University School of Law

  20. Comparative cytotaxonomy in the tribe Bovini studied by banding techniques

    E-Print Network [OSTI]

    Rich, Donna Carol

    1986-01-01T23:59:59.000Z

    Committee: Dr. James E. Womack Chromosomes of eight species of the tribe Bovini were studied by G ? banding, C ? banding and silver staining techniques. The results of this comparative cytogenetic study support the theory that Robertsonian fusion... in the tribe Bovini whose species appear to differ by a series of centromeric fusions. The phylogenetic tree derived from the cytogenetic data of this study is not consistent with morphological and behavioral trees previously described for the tribe Bovini...

  1. An Energy Efficient Asynchronous Time-Domain Comparator

    E-Print Network [OSTI]

    Gao, Yang

    2013-04-26T23:59:59.000Z

    Approved by: Chair of Committee, Edgar Sanchez-Sinencio Committee Members, Sergiy Butenko Kamran Entesari Mi Lu Head of Department, Chanan Singh May 2013 Major Subject: Electrical Engineering Copyright 2013Yang Gao ii ABSTRACT...-domain comparators. iii DEDICATION To my parents and my beloved wife Qi iv ACKNOWLEDGEMENTS First, I would like to express my sincere thanks to my advisor, Dr. Edgar Sanchez-Sinencio for guidance, support and encouragement throughout my...

  2. Comparative Performance of Heat Pumps and R&D Requirements

    E-Print Network [OSTI]

    Ally, M. R.

    COMPARATIVE PERFORMANCE OF HEAT PUMPS AND R&D REQUIREMENTS M. R. ALLY Research Staff Member Energy Divisi.on Oak Ridge National Laboratory Oak Ridge, Tennessee INTRODUCTION One of the major programs conducted by the U.S. Department... of Energy's Office of Industrial Programs is the Industrial Heat Pump Program. The objective of this program is to develop and advance heat pump technology to help American industry use its energy resources more efficiently. It involves using heat pumps...

  3. Simulation of aerosol dynamics: a comparative review of mathematical models

    SciTech Connect (OSTI)

    Seigneur, C.; Hudischewskyj, A.B.; Seinfeld, J.H.; Whitby, K.T.; Whitby, E.R.

    1986-01-01T23:59:59.000Z

    Three modeling approaches used are based-continuous, discrete (sectional), and parameterized representations of the aerosol size distribution. Simulations of coagulation and condensation are performed with the three models for clear, hazy, and urban atmospheric conditions. Relative accuracies and computational costs are compared. Reference for the comparison is the continuous approach. The results of the study provide useful information for the selection of an aerosol model, depending on the accuracy requirements and computational constraints associated with a specific application.

  4. Mode Shape Estimation Algorithms Under Ambient Conditions: A Comparative Review

    SciTech Connect (OSTI)

    Dosiek, Luke; Zhou, Ning; Pierre, John W.; Huang, Zhenyu; Trudnowski, Daniel J.

    2013-05-01T23:59:59.000Z

    Abstract—This paper provides a comparative review of five existing ambient electromechanical mode shape estimation algorithms, i.e., the Transfer Function (TF), Spectral, Frequency Domain Decomposition (FDD), Channel Matching, and Subspace Methods. It is also shown that the TF Method is a general approach to estimating mode shape and that the Spectral, FDD, and Channel Matching Methods are actually special cases of it. Additionally, some of the variations of the Subspace Method are reviewed and the Numerical algorithm for Subspace State Space System IDentification (N4SID) is implemented. The five algorithms are then compared using data simulated from a 17-machine model of the Western Electricity Coordinating Council (WECC) under ambient conditions with both low and high damping, as well as during the case where ambient data is disrupted by an oscillatory ringdown. The performance of the algorithms is compared using the statistics from Monte Carlo Simulations and results from measured WECC data, and a discussion of the practical issues surrounding their implementation, including cases where power system probing is an option, is provided. The paper concludes with some recommendations as to the appropriate use of the various techniques. Index Terms—Electromechanical mode shape, small-signal stability, phasor measurement units (PMU), system identification, N4SID, subspace.

  5. Methodology for Validating Building Energy Analysis Simulations

    SciTech Connect (OSTI)

    Judkoff, R.; Wortman, D.; O'Doherty, B.; Burch, J.

    2008-04-01T23:59:59.000Z

    The objective of this report was to develop a validation methodology for building energy analysis simulations, collect high-quality, unambiguous empirical data for validation, and apply the validation methodology to the DOE-2.1, BLAST-2MRT, BLAST-3.0, DEROB-3, DEROB-4, and SUNCAT 2.4 computer programs. This report covers background information, literature survey, validation methodology, comparative studies, analytical verification, empirical validation, comparative evaluation of codes, and conclusions.

  6. Economic Analysis of Policy Effects Analysis Platform

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Economic Analysis of Policy Effects Analysis Platform March 24, 2015 Jason Hansen, PhD Idaho National Laboratory This presentation does not contain any proprietary, confidential,...

  7. Data Analysis

    SciTech Connect (OSTI)

    Powell, Danny H [ORNL] [ORNL; Elwood Jr, Robert H [ORNL] [ORNL

    2011-01-01T23:59:59.000Z

    Analysis of the material protection, control, and accountability (MPC&A) system is necessary to understand the limits and vulnerabilities of the system to internal threats. A self-appraisal helps the facility be prepared to respond to internal threats and reduce the risk of theft or diversion of nuclear material. The material control and accountability (MC&A) system effectiveness tool (MSET) fault tree was developed to depict the failure of the MPC&A system as a result of poor practices and random failures in the MC&A system. It can also be employed as a basis for assessing deliberate threats against a facility. MSET uses fault tree analysis, which is a top-down approach to examining system failure. The analysis starts with identifying a potential undesirable event called a 'top event' and then determining the ways it can occur (e.g., 'Fail To Maintain Nuclear Materials Under The Purview Of The MC&A System'). The analysis proceeds by determining how the top event can be caused by individual or combined lower level faults or failures. These faults, which are the causes of the top event, are 'connected' through logic gates. The MSET model uses AND-gates and OR-gates and propagates the effect of event failure using Boolean algebra. To enable the fault tree analysis calculations, the basic events in the fault tree are populated with probability risk values derived by conversion of questionnaire data to numeric values. The basic events are treated as independent variables. This assumption affects the Boolean algebraic calculations used to calculate results. All the necessary calculations are built into the fault tree codes, but it is often useful to estimate the probabilities manually as a check on code functioning. The probability of failure of a given basic event is the probability that the basic event primary question fails to meet the performance metric for that question. The failure probability is related to how well the facility performs the task identified in that basic event over time (not just one performance or exercise). Fault tree calculations provide a failure probability for the top event in the fault tree. The basic fault tree calculations establish a baseline relative risk value for the system. This probability depicts relative risk, not absolute risk. Subsequent calculations are made to evaluate the change in relative risk that would occur if system performance is improved or degraded. During the development effort of MSET, the fault tree analysis program used was SAPHIRE. SAPHIRE is an acronym for 'Systems Analysis Programs for Hands-on Integrated Reliability Evaluations.' Version 1 of the SAPHIRE code was sponsored by the Nuclear Regulatory Commission in 1987 as an innovative way to draw, edit, and analyze graphical fault trees primarily for safe operation of nuclear power reactors. When the fault tree calculations are performed, the fault tree analysis program will produce several reports that can be used to analyze the MPC&A system. SAPHIRE produces reports showing risk importance factors for all basic events in the operational MC&A system. The risk importance information is used to examine the potential impacts when performance of certain basic events increases or decreases. The initial results produced by the SAPHIRE program are considered relative risk values. None of the results can be interpreted as absolute risk values since the basic event probability values represent estimates of risk associated with the performance of MPC&A tasks throughout the material balance area (MBA). The RRR for a basic event represents the decrease in total system risk that would result from improvement of that one event to a perfect performance level. Improvement of the basic event with the greatest RRR value produces a greater decrease in total system risk than improvement of any other basic event. Basic events with the greatest potential for system risk reduction are assigned performance improvement values, and new fault tree calculations show the improvement in total system risk. The ope

  8. Comparative study of variational chaos indicators and ODEs' numerical integrators

    E-Print Network [OSTI]

    Luciano A. Darriba; Nicolás P. Maffione; Pablo M. Cincotta; Claudia M. Giordano

    2012-05-08T23:59:59.000Z

    The reader can find in the literature a lot of different techniques to study the dynamics of a given system and also, many suitable numerical integrators to compute them. Notwithstanding the recent work of Maffione et al. (2011a) for mappings, a detailed comparison among the widespread indicators of chaos in a general system is still lacking. Such a comparison could lead to select the most efficient algorithms given a certain dynamical problem. Furthermore, in order to choose the appropriate numerical integrators to compute them, more comparative studies among numerical integrators are also needed. This work deals with both problems. We first extend the work of Maffione et al. (2011) for mappings to the 2D H\\'enon & Heiles (1964) potential, and compare several variational indicators of chaos: the Lyapunov Indicator (LI); the Mean Exponential Growth Factor of Nearby Orbits (MEGNO); the Smaller Alignment Index (SALI) and its generalized version, the Generalized Alignment Index (GALI); the Fast Lyapunov Indicator (FLI) and its variant, the Orthogonal Fast Lyapunov Indicator (OFLI); the Spectral Distance (D) and the Dynamical Spectras of Stretching Numbers (SSNs). We also include in the record the Relative Lyapunov Indicator (RLI), which is not a variational indicator as the others. Then, we test a numerical technique to integrate Ordinary Differential Equations (ODEs) based on the Taylor method implemented by Jorba & Zou (2005) (called taylor), and we compare its performance with other two well-known efficient integrators: the Prince & Dormand (1981) implementation of a Runge-Kutta of order 7-8 (DOPRI8) and a Bulirsch-St\\"oer implementation. These tests are run under two very different systems from the complexity of their equations point of view: a triaxial galactic potential model and a perturbed 3D quartic oscillator.

  9. A comparative assessment of waste incinerators in the UK

    SciTech Connect (OSTI)

    Nixon, J.D., E-mail: j.nixon@kingston.ac.uk [Sustainable Environment Research Group, School of Engineering and Applied Science, Aston University, Aston Triangle, Birmingham B4 7ET (United Kingdom); Wright, D.G.; Dey, P.K. [Aston Business School, Aston University, Aston Triangle, Birmingham B4 7ET (United Kingdom); Ghosh, S.K. [Mechanical Engineering Department, Centre for Quality Management System, Jadavpur University, Kolkata 700 032 (India); Davies, P.A. [Sustainable Environment Research Group, School of Engineering and Applied Science, Aston University, Aston Triangle, Birmingham B4 7ET (United Kingdom)

    2013-11-15T23:59:59.000Z

    Highlights: • We evaluate operational municipal solid waste incinerators in the UK. • The supply chain of four case study plants are examined and compared in detail. • Technical, financial and operational data has been gathered for the four plants. • We suggest the best business practices for waste incinerators. • Appropriate strategy choices are the major difficulties for waste to energy plants. - Abstract: The uptake in Europe of Energy from Waste (EfW) incinerator plants has increased rapidly in recent years. In the UK, 25 municipal waste incinerators with energy recovery are now in operation; however, their waste supply chains and business practices vary significantly. With over a hundred more plant developments being considered it is important to establish best business practices for ensuring efficient environmental and operational performance. By reviewing the 25 plants we identify four suitable case study plants to compare technologies (moving grate, fluidised bed and rotary kiln), plant economics and operations. Using data collected from annual reports and through interviews and site visits we provide recommendations for improving the supply chain for waste incinerators and highlight the current issues and challenges faced by the industry. We find that plants using moving grate have a high availability of 87–92%. However, compared to the fluidised bed and rotary kiln, quantities of bottom ash and emissions of hydrogen chloride and carbon monoxide are high. The uptake of integrated recycling practices, combined heat and power, and post incineration non-ferrous metal collections needs to be increased among EfW incinerators in the UK. We conclude that one of the major difficulties encountered by waste facilities is the appropriate selection of technology, capacity, site, waste suppliers and heat consumers. This study will be of particular value to EfW plant developers, government authorities and researchers working within the sector of waste management.

  10. Framework for a comparative environmental assessment of drilling fluids

    SciTech Connect (OSTI)

    Meinhold, A.F.

    1998-11-01T23:59:59.000Z

    During the drilling of an oil or gas well, drilling fluid (or mud) is used to maintain well control and to remove drill cuttings from the hole. In response to effluent limitation guidelines promulgated by the US Environmental Protection Agency (EPA) for discharge of drilling wastes offshore, alternatives to water and oil-based muds have been developed. These synthetic-based muds (SBMs) are more efficient than water-based muds (WBMs) for drilling difficult and complex formation intervals and have lower toxicity and smaller environmental impacts than diesel or conventional mineral oil-based muds (OBMs). A third category of drilling fluids, derived from petroleum and called enhanced mineral oils (EMOs), also have these advantages over the traditionally used OBMs and WBMs. EPA recognizes that SBMs and EMOs are new classes of drilling fluids, but their regulatory status is unclear. To address this uncertainty, EPA is following an innovative presumptive rulemaking process that will develop final regulations for SBM discharges offshore in less than three years. This report develops a framework for a comparative risk assessment for the discharge of SBMs and EMOs, to help support a risk-based, integrated approach to regulatory decision making. The framework will help identify potential impacts and benefits associated with the use of SBMs, EMOs, WBMs, and OBMs; identify areas where additional data are needed; and support early decision-making in the absence of complete data. As additional data becomes available, the framework can support a full quantitative comparative assessment. Detailed data are provided to support a comparative assessment in the areas of occupational and public health impacts.

  11. Integrated immunoisolation and protein analysis of circulating exosomes using microfluidic technology

    E-Print Network [OSTI]

    He, Mei; Crow, Jennifer; Roth, Marc; Zeng, Yong; Godwin, Andrew K.

    2014-08-06T23:59:59.000Z

    new microfluidic approach to streamline and expedite the exosome analysis pipeline by integrating specific immunoisolation and targeted protein analysis of circulating exosomes. Compared to the conventional methods, our approach enables selective...

  12. Comparing strategies: State funding of capital projects versus water conservation

    E-Print Network [OSTI]

    Finch, Dr. Calvin

    2013-01-01T23:59:59.000Z

    10 tx H2O Winter 2013 Column by Dr. Calvin Finch, Water Conservation and Technology Center director COMPARING STRATEGIES State funding of capital projects versus water conservation The Texas Legislature seems intent on helping local water... purveyors #30;nance a portion of the water supply projects described in the #18;#25;#28;#18; state water plan (Water for Texas #31;#28;#29;#31;). #31;e plan says that #17;#18;#24;.#27; billion is needed from the state to meet our water needs...

  13. SASSI Analytical Methods Compared with SHAKE Results | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR -DepartmentRetailEnergy RoleAnalytical Methods Compared

  14. Comparing Well-Defined Manganese, Iron, Cobalt, and Nickel Ketone

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms AboutRESEARCHHydrosilylation Catalysts Comparing Well-Defined

  15. A Markovian analysis of semiconductor manufacturing processes

    E-Print Network [OSTI]

    Schultz, Kent Eugene

    1991-01-01T23:59:59.000Z

    conclusions drawn from these results are outlined in Chapter V. Since the measurement equipment used to measure the post etch line width was of interest, the two critical dimension (CD) measurement machines were compared using standard statistical tests... REVIEW A. Control Charts B. Markovian Analysis C. Hypothesis Testing D. Models and Contingency Tables 3 9 12 14 METHODOLOGY 21 A. Data. Collection and Analysis B. Sparse Contingency Tables C. Testing I' or Independence D. Testing for first...

  16. Very Fast Chip-level Thermal Analysis

    E-Print Network [OSTI]

    K. Nakabayashi; T. Nakabayashi; K. Nakajima

    2008-01-07T23:59:59.000Z

    We present a new technique of VLSI chip-level thermal analysis. We extend a newly developed method of solving two dimensional Laplace equations to thermal analysis of four adjacent materials on a mother board. We implement our technique in C and compare its performance to that of a commercial CAD tool. Our experimental results show that our program runs 5.8 and 8.9 times faster while keeping smaller residuals by 5 and 1 order of magnitude, respectively.

  17. Steam generation in line-focus solar collectors: a comparative assessment of thermal performance, operating stability, and cost issues

    SciTech Connect (OSTI)

    Murphy, L.M.; May, E.K.

    1982-04-01T23:59:59.000Z

    The engineering and system benefits of using direct steam (in situ) generation in line-focus collectors are assessed. The major emphasis of the analysis is a detailed thermal performance comparison of in situ systems (which utilize unfired boilers). The analysis model developed for this study is discussed in detail. An analysis of potential flow stability problems is also provided along with a cursory cost analysis and an assessment of freeze protection, safety, and control issues. Results indicated a significant thermal performance advantage over the more conventional oil and flash systems and the flow stability does not appear to be a significant problem. In particular, at steam temperatures of 220/sup 0/C (430/sup 0/F) under the chosen set of assumptions, annual delivered energy predictions indicate that the in situ system can deliver 15% more energy than an oil system and 12% more energy than a flash system, with all of the systems using the same collector field. Further, the in situ system may result in a 10% capital cost reduction. Other advantages include improvement in simpler control when compared with flash systems, and fluid handling and safety enhancement when compared with oil systems.

  18. RAMS (Risk Analysis - Modular System) methodology

    SciTech Connect (OSTI)

    Stenner, R.D.; Strenge, D.L.; Buck, J.W. [and others

    1996-10-01T23:59:59.000Z

    The Risk Analysis - Modular System (RAMS) was developed to serve as a broad scope risk analysis tool for the Risk Assessment of the Hanford Mission (RAHM) studies. The RAHM element provides risk analysis support for Hanford Strategic Analysis and Mission Planning activities. The RAHM also provides risk analysis support for the Hanford 10-Year Plan development activities. The RAMS tool draws from a collection of specifically designed databases and modular risk analysis methodologies and models. RAMS is a flexible modular system that can be focused on targeted risk analysis needs. It is specifically designed to address risks associated with overall strategy, technical alternative, and `what if` questions regarding the Hanford cleanup mission. RAMS is set up to address both near-term and long-term risk issues. Consistency is very important for any comparative risk analysis, and RAMS is designed to efficiently and consistently compare risks and produce risk reduction estimates. There is a wide range of output information that can be generated by RAMS. These outputs can be detailed by individual contaminants, waste forms, transport pathways, exposure scenarios, individuals, populations, etc. However, they can also be in rolled-up form to support high-level strategy decisions.

  19. NREL: Energy Analysis - Market Analysis

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Saleshttp://www.fnal.gov/directorate/nalcal/nalcal02_07_05_files/nalcal.gifNRELPower SystemsDebbieJessicaLiz TorresMarket Analysis

  20. Comparative study of nuclear effects in polarized electron scattering from 3He

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ethier, Jacob James; Melnitchouk, Wally

    2013-11-01T23:59:59.000Z

    We present a detailed analysis of nuclear effects in inclusive electron scattering from polarized 3He nuclei for polarization asymmetries, structure functions and their moments, both in the nucleon resonance and deep-inelastic regions. We compare the results of calculations within the weak binding approximation at finite Q2 with the effective polarization ansatz often used in experimental data analyses, and explore the impact of ? components in the nuclear wave function and nucleon off-shell corrections on extractions of the free neutron structure. Using the same framework we also make predictions for the Q2 dependence of quasielastic scattering from polarized 3He, data onmore »which can be used to constrain the spin-dependent nuclear smearing functions in 3He.« less

  1. A comparative study of conventionally sintered and microwave sintered nickel zinc ferrite

    SciTech Connect (OSTI)

    Rani, Rekha [Electroceramics Research Lab, GVM Girls College, Sonepat-131001, India and School of Physics and Materials Science, Thapar University, Patiala-147004 (India); Juneja, J. K. [Department of Physics, Hindu College, Sonepat-131001 (India); Raina, K. K. [School of Physics and Materials Science, Thapar University, Patiala-147004 (India); Kotnala, R. K. [National Physical Laboratory, New Delhi -110012 (India); Prakash, Chandra, E-mail: cprakash2014@gmail.com [Solid State Physics Laboratory, Timarpur, Delhi - 110054 (India)

    2014-04-24T23:59:59.000Z

    For the present work, nickel zinc ferrite having compositional formula Ni{sub 0.8}Zn{sub 0.2}Fe{sub 2}O{sub 4} was synthesized by conventional solid state method and sintered in conventional and microwave furnaces. Pellets were sintered with very short soaking time of 10 min at 1150 °C in microwave furnace whereas 4 hrs of soaking time was selected for conventional sintering at 1200 °C. Phase formation was confirmed by X-ray diffraction analysis technique. Scanning electron micrographs were taken for microstructural study. Dielectric properties were studied as a function of temperature. To study magnetic behavior, M-H hysteresis loops were recorded for both samples. It is observed that microwave sintered sample could obtain comparable properties to the conventionally sintered one in lesser soaking time at lower sintering temperature.

  2. Comparative study of nuclear effects in polarized electron scattering from 3He

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ethier, Jacob James; Melnitchouk, Wally [JLAB

    2013-11-01T23:59:59.000Z

    We present a detailed analysis of nuclear effects in inclusive electron scattering from polarized 3He nuclei for polarization asymmetries, structure functions and their moments, both in the nucleon resonance and deep-inelastic regions. We compare the results of calculations within the weak binding approximation at finite Q2 with the effective polarization ansatz often used in experimental data analyses, and explore the impact of ? components in the nuclear wave function and nucleon off-shell corrections on extractions of the free neutron structure. Using the same framework we also make predictions for the Q2 dependence of quasielastic scattering from polarized 3He, data on which can be used to constrain the spin-dependent nuclear smearing functions in 3He.

  3. Hazard Analysis Database report

    SciTech Connect (OSTI)

    Niemi, B.J.

    1997-08-12T23:59:59.000Z

    This document describes and defines the Hazard Analysis Database for the Tank Waste Remediation System Final Safety Analysis Report.

  4. Hazard analysis results report

    SciTech Connect (OSTI)

    Niemi, B.J., Westinghouse Hanford

    1996-09-30T23:59:59.000Z

    This document describes and defines the Hazard Analysis Results for the Tank Waste Remediation System Final Safety Analysis Report.

  5. Comparative Cost Estimates Caliente Rail Corridor Summary Report

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved:AdministrationAnalysisDarby/%2AO 474.2 Chg U.S. S p e c t i RFire

  6. Reevaluation of the Coding Potential and Proteomic Analysis of...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    many unlikely ORFs and obtain a simplified map of the RhCMV genome. This comparative genomics analysis eliminated many genes previously characterized as RhCMV-specific while...

  7. analysis plan gunnison: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Compared s of the State 71 90 92 94 95... Zeghidi, Khaled 1978-01-01 102 Implementing a Hazard Analysis Critical Control Points plan for a Packaging Company CiteSeer Summary:...

  8. analysis plan ambrosia: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Compared s of the State 71 90 92 94 95... Zeghidi, Khaled 1978-01-01 110 Implementing a Hazard Analysis Critical Control Points plan for a Packaging Company CiteSeer Summary:...

  9. TILT POUR TRIALS AND ANALYSIS Bob Bryant1

    E-Print Network [OSTI]

    Beckermann, Christoph

    TILT POUR TRIALS AND ANALYSIS Bob Bryant1 , Kent D. Carlson2 , Shouzhu Ou2 , Christoph Beckermann2 reduce inclusion severity, compared to standard techniques. Bryant, R., Carlson, K.D., Ou, S

  10. Guidance for Environmental Background Analysis Volume III: Groundwater

    E-Print Network [OSTI]

    Guidance for Environmental Background Analysis Volume III: Groundwater Prepared for: Naval This guidance document provides instructions for characterizing groundwater background conditions and comparing datasets representing groundwater impacted by an actual or potential chemical release to appropriate

  11. Comparative Assessment of Direct Drive High Temperature Superconducting Generators in Multi-Megawatt Class Wind Turbines

    SciTech Connect (OSTI)

    Maples, B.; Hand, M.; Musial, W.

    2010-10-01T23:59:59.000Z

    This paper summarizes the work completed under the CRADA between NREL and American Superconductor (AMSC). The CRADA combined NREL and AMSC resources to benchmark high temperature superconducting direct drive (HTSDD) generator technology by integrating the technologies into a conceptual wind turbine design, and comparing the design to geared drive and permanent magnet direct drive (PMDD) wind turbine configurations. Analysis was accomplished by upgrading the NREL Wind Turbine Design Cost and Scaling Model to represent geared and PMDD turbines at machine ratings up to 10 MW and then comparing cost and mass figures of AMSC's HTSDD wind turbine designs to theoretical geared and PMDD turbine designs at 3.1, 6, and 10 MW sizes. Based on the cost and performance data supplied by AMSC, HTSDD technology has good potential to compete successfully as an alternative technology to PMDD and geared technology turbines in the multi megawatt classes. In addition, data suggests the economics of HTSDD turbines improve with increasing size, although several uncertainties remain for all machines in the 6 to 10 MW class.

  12. Comparing Server Energy Use and Efficiency Using Small Sample Sizes

    SciTech Connect (OSTI)

    Coles, Henry C.; Qin, Yong; Price, Phillip N.

    2014-11-01T23:59:59.000Z

    This report documents a demonstration that compared the energy consumption and efficiency of a limited sample size of server-type IT equipment from different manufacturers by measuring power at the server power supply power cords. The results are specific to the equipment and methods used. However, it is hoped that those responsible for IT equipment selection can used the methods described to choose models that optimize energy use efficiency. The demonstration was conducted in a data center at Lawrence Berkeley National Laboratory in Berkeley, California. It was performed with five servers of similar mechanical and electronic specifications; three from Intel and one each from Dell and Supermicro. Server IT equipment is constructed using commodity components, server manufacturer-designed assemblies, and control systems. Server compute efficiency is constrained by the commodity component specifications and integration requirements. The design freedom, outside of the commodity component constraints, provides room for the manufacturer to offer a product with competitive efficiency that meets market needs at a compelling price. A goal of the demonstration was to compare and quantify the server efficiency for three different brands. The efficiency is defined as the average compute rate (computations per unit of time) divided by the average energy consumption rate. The research team used an industry standard benchmark software package to provide a repeatable software load to obtain the compute rate and provide a variety of power consumption levels. Energy use when the servers were in an idle state (not providing computing work) were also measured. At high server compute loads, all brands, using the same key components (processors and memory), had similar results; therefore, from these results, it could not be concluded that one brand is more efficient than the other brands. The test results show that the power consumption variability caused by the key components as a group is similar to all other components as a group. However, some differences were observed. The Supermicro server used 27 percent more power at idle compared to the other brands. The Intel server had a power supply control feature called cold redundancy, and the data suggest that cold redundancy can provide energy savings at low power levels. Test and evaluation methods that might be used by others having limited resources for IT equipment evaluation are explained in the report.

  13. COMPARING THE EFFECT OF RADIATIVE TRANSFER SCHEMES ON CONVECTION SIMULATIONS

    SciTech Connect (OSTI)

    Tanner, Joel D.; Basu, Sarbani; Demarque, Pierre [Astronomy Department, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States)

    2012-11-10T23:59:59.000Z

    We examine the effect of different radiative transfer schemes on the properties of three-dimensional (3D) simulations of near-surface stellar convection in the superadiabatic layer, where energy transport transitions from fully convective to fully radiative. We employ two radiative transfer schemes that fundamentally differ in the way they cover the 3D domain. The first solver approximates domain coverage with moments, while the second solver samples the 3D domain with ray integrations. By comparing simulations that differ only in their respective radiative transfer methods, we are able to isolate the effect that radiative efficiency has on the structure of the superadiabatic layer. We find the simulations to be in good general agreement, but they show distinct differences in the thermal structure in the superadiabatic layer and atmosphere.

  14. Phytozome: a Tool for Green Plant Comparative Genomics

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Phytozome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst green plants. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of release v4.0, Phytozome provides access to nine sequenced and annotated green plant genomes, eight of which have been clustered into gene families at six evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, TAIR, JGI are hyper-linked and searchable. [Copied from the Overview at http://www.phytozome.net/Phytozome_info.php

  15. Our Environment in Hot Water: Comparing Water Heaters, A Life Cycle Approach Comparing Tank and Tankless Water Heaters in California

    SciTech Connect (OSTI)

    Lu, Alison; McMahon, James; Masanet, Eric; Lutz, Jim

    2008-08-13T23:59:59.000Z

    Residential water heating is a large source of energy use in California homes. This project took a life cycle approach to comparing tank and tankless water heaters in Northern and Southern California. Information about the life cycle phases was calculated using the European Union?s Methodology study for EcoDesign of Energy-using Products (MEEUP) and the National Renewable Energy Laboratory?s Life Cycle Inventory (NREL LCI) database. In a unit-to-unit comparison, it was found that tankless water heaters would lessen impacts of water heating by reducing annual energy use by 2800 MJ/year (16% compared to tank), and reducing global warming emissions by 175 kg CO2 eqv./year (18% reduction). Overall, the production and combustion of natural gas in the use phase had the largest impact. Total waste, VOCs, PAHs, particulate matter, and heavy-metals-to-air categories were also affected relatively strongly by manufacturing processes. It was estimated that tankless water heater users would have to use 10 more gallons of hot water a day (an increased usage of approximately 20%) to have the same impact as tank water heaters. The project results suggest that if a higher percentage of Californians used tankless water heaters, environmental impacts caused by water heating would be smaller.

  16. Backup Power Cost of Ownership Analysis and Incumbent Technology Comparison

    SciTech Connect (OSTI)

    Kurtz, J.; Saur, G.; Sprik, S.; Ainscough, C.

    2014-09-01T23:59:59.000Z

    This cost of ownership analysis identifies the factors impacting the value proposition for fuel cell backup power and presents the estimated annualized cost of ownership for fuel cell backup power systems compared with the incumbent technologies of battery and diesel generator systems. The analysis compares three different backup power technologies (diesel, battery, and fuel cell) operating in similar circumstances in four run time scenarios (8, 52, 72, and 176 hours).

  17. Uncertainty analysis

    SciTech Connect (OSTI)

    Thomas, R.E.

    1982-03-01T23:59:59.000Z

    An evaluation is made of the suitability of analytical and statistical sampling methods for making uncertainty analyses. The adjoint method is found to be well-suited for obtaining sensitivity coefficients for computer programs involving large numbers of equations and input parameters. For this purpose the Latin Hypercube Sampling method is found to be inferior to conventional experimental designs. The Latin hypercube method can be used to estimate output probability density functions, but requires supplementary rank transformations followed by stepwise regression to obtain uncertainty information on individual input parameters. A simple Cork and Bottle problem is used to illustrate the efficiency of the adjoint method relative to certain statistical sampling methods. For linear models of the form Ax=b it is shown that a complete adjoint sensitivity analysis can be made without formulating and solving the adjoint problem. This can be done either by using a special type of statistical sampling or by reformulating the primal problem and using suitable linear programming software.

  18. Multipole analysis of kaon photoproduction data

    E-Print Network [OSTI]

    Ron L. Workman

    2011-05-27T23:59:59.000Z

    Methods used in the multipole analysis of low-energy pion-photoproduction data have been tested against the database of kaon-photoproduction measurements. Results for some multipoles are in qualitative agreement with existing phenomenological models, while others are unstable, given the present database. These findings are compared to those of previous studies.

  19. Apparatus and method for comparing corresponding acoustic resonances in liquids

    DOE Patents [OSTI]

    Sinha, Dipen N. (Los Almos, NM)

    1999-01-01T23:59:59.000Z

    Apparatus and method for comparing corresponding acoustic resonances in liquids. The present invention permits the measurement of certain characteristics of liquids which affect the speed of sound therein. For example, a direct correlation between the octane rating of gasoline and the speed of sound in a gasoline sample has been experimentally observed. Therefore, changes in the speed of sound therein can be utilized as a sensitive parameter for determining changes in composition of a liquid sample. The present apparatus establishes interference patterns inside of a liquid without requiring the use of very thin, rigorously parallel ceramic discs, but rather uses readily available piezoelectric transducers attached to the outside surface of the usual container for the liquid and located on the same side thereof in the vicinity of one another. That is, various receptacle geometries may be employed, and the driving and receiving transducers may be located on the same side of the receptacle. The cell may also be constructed of any material that is inert to the liquid under investigation. A single-transducer embodiment, where the same transducer provides the excitation to the sample container and receives signals impressed therein, is also described.

  20. (Pulsed atmospheric fluidized bed combustion (PAFBC)). [Comparing PAFBC vs. AFBC

    SciTech Connect (OSTI)

    Not Available

    1989-05-01T23:59:59.000Z

    The fourth Quarterly Technical Progress Report presents the results of work accomplished during the period February 6 through April 30, 1989. the overall objective of the program is the development of a pulsed atmospheric, fluidized bed combustion (PAFBC) technology to burn coal and to provide heat and steam to commercial, institutional, and small industrial applications at a reasonable price in an environmentally acceptable manner. During this past quarter, a baseline for comparing PAFBC vs. AFBC performance was established and the initial series of PAFBC coal-fired combustion tests was completed. The AFBC baseline was representative of bubbling bed units with the exception of emissions which were somewhat higher and attributable to the size constraints of the AFBC unit. However, it still provided a valid baseline for referencing and optimizing PAFBC performance. Initial coal combustion tests in the pulsed fluid-bed verified enhanced performance in comparison to the non-pulsed beds, providing reduced NO{sub x}, CO, and SO{sub 2} emissions as well as higher steam generation rates and considerably lower entrainment losses. 9 figs., 4 tabs.

  1. Apparatus and method for comparing corresponding acoustic resonances in liquids

    DOE Patents [OSTI]

    Sinha, D.N.

    1999-03-23T23:59:59.000Z

    Apparatus and method are disclosed for comparing corresponding acoustic resonances in liquids. The present invention permits the measurement of certain characteristics of liquids which affect the speed of sound therein. For example, a direct correlation between the octane rating of gasoline and the speed of sound in a gasoline sample has been experimentally observed. Therefore, changes in the speed of sound therein can be utilized as a sensitive parameter for determining changes in composition of a liquid sample. The present apparatus establishes interference patterns inside of a liquid without requiring the use of very thin, rigorously parallel ceramic discs, but rather uses readily available piezoelectric transducers attached to the outside surface of the usual container for the liquid and located on the same side thereof in the vicinity of one another. That is, various receptacle geometries may be employed, and the driving and receiving transducers may be located on the same side of the receptacle. The cell may also be constructed of any material that is inert to the liquid under investigation. A single-transducer embodiment, where the same transducer provides the excitation to the sample container and receives signals impressed therein, is also described. 5 figs.

  2. Wavelet based characterization of ex vivo vertebral trabecular bone structure with 3T MRI compared to microCT

    SciTech Connect (OSTI)

    Krug, R; Carballido-Gamio, J; Burghardt, A; Haase, S; Sedat, J W; Moss, W C; Majumdar, S

    2005-04-11T23:59:59.000Z

    Trabecular bone structure and bone density contribute to the strength of bone and are important in the study of osteoporosis. Wavelets are a powerful tool to characterize and quantify texture in an image. In this study the thickness of trabecular bone was analyzed in 8 cylindrical cores of the vertebral spine. Images were obtained from 3 Tesla (T) magnetic resonance imaging (MRI) and micro-computed tomography ({micro}CT). Results from the wavelet based analysis of trabecular bone were compared with standard two-dimensional structural parameters (analogous to bone histomorphometry) obtained using mean intercept length (MR images) and direct 3D distance transformation methods ({micro}CT images). Additionally, the bone volume fraction was determined from MR images. We conclude that the wavelet based analyses delivers comparable results to the established MR histomorphometric measurements. The average deviation in trabecular thickness was less than one pixel size between the wavelet and the standard approach for both MR and {micro}CT analysis. Since the wavelet based method is less sensitive to image noise, we see an advantage of wavelet analysis of trabecular bone for MR imaging when going to higher resolution.

  3. Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology

    E-Print Network [OSTI]

    Ussery, David W.

    Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology Visualisation of Large Amounts of Data Dave Ussery 27 February, 2008 #12;Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology #12;Comparative Microbial Genomics group

  4. arXiv:1102.0242v3[astro-ph.SR]24Jun2012 A Bayesian approach to comparing theoretic models to observational data

    E-Print Network [OSTI]

    California at Berkeley, University of

    arXiv:1102.0242v3[astro-ph.SR]24Jun2012 A Bayesian approach to comparing theoretic models of theoretical models and observational data. From a statistical perspective, there are many challenges- porate into our analysis regarding Classical statistics. The thermal heat flux is proportional to the non

  5. Comparative Analysis of Simulated Annealing (SA) and Simplified Generalized SA (SGSA) for Estimation Optimal of Parametric Functional in CATIVIC

    SciTech Connect (OSTI)

    Freitez, Juan A. [Centro de Investigacion de Procesos, UNEXPO, Barquisimeto, Edo. Lara, Venezuela, Zip 3001 (Venezuela, Bolivarian Republic of); Sanchez, Morella; Ruette, Fernando [Laboratorio de Quimica Computacional, Centro de Quimica, Instituto Venezolano de Investigaciones Cientificas, Apartado 21827, Caracas, 1020-A (Venezuela, Bolivarian Republic of)

    2009-08-13T23:59:59.000Z

    Application of simulated annealing (SA) and simplified GSA (SGSA) techniques for parameter optimization of parametric quantum chemistry method (CATIVIC) was performed. A set of organic molecules were selected for test these techniques. Comparison of the algorithms was carried out for error function minimization with respect to experimental values. Results show that SGSA is more efficient than SA with respect to computer time. Accuracy is similar in both methods; however, there are important differences in the final set of parameters.

  6. Techniques for Profile Binning and Analysis of Eigenvector Composite Spectra: Comparing Hbeta and MgII 2800 as Virial Estimators

    E-Print Network [OSTI]

    Sulentic, Jack W; del Olmo, Ascension; Plauchu-Frayn, Ilse

    2013-01-01T23:59:59.000Z

    We review the basic techniques for extracting information about quasar structure and kinematics from the broad emission lines in quasars. We consider which lines can most effectively serve as virial estimators of black hole mass. At low redshift the Balmer lines,particularly broad H beta, are the lines of choice. For redshifts greater than 0.7 - 0.8 one can follow H beta into the IR windows or find an H beta surrogate. We explain why UV CIV 1549 is not a safe virial estimator and how MgII 2800 serves as the best virial surrogate for H beta up to the highest redshift quasar known at z ~ 7. We show how spectral binning in a parameter space context (4DE1) makes possible a more effective comparison of H beta and MgII. It also helps to derive more accurate mass estimates from appropriately binned spectra and, finally, to map the dispersion in black hole mass and Eddington ratio across the quasar population. FWHM MgII is about 20% smaller than FWHM H beta in the majority of type 1 AGN requiring correction when comp...

  7. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    impacts We converted other cost metrics to ¢/kWh retail ratePower System Operating Costs: Summary and Perspective onA. Bibliography of RPS Cost Studies Studies listed in

  8. Underfloor vs. overhead: a comparative analysis of air distribution systems using the EnergyPlus simulation software

    E-Print Network [OSTI]

    Daly, A.

    2006-01-01T23:59:59.000Z

    HeatTransfer, TC-SouthWall-G8, ! - Object Index. WALL, ! -Index. MeasuredUFADSolarFraction, TC-SouthWall-G8, SF-SouthWall-G8[]; ! - Object Index. ! - Object Index.

  9. Comparative analysis of United States and French nuclear power plant siting and construction regulatory policies and their economic consequences

    E-Print Network [OSTI]

    Golay, Michael Warren.

    1977-01-01T23:59:59.000Z

    Despite the substantial commitments of time and money which are devoted to the nuclear power plant siting process, the effectiveness of the system in providing a balanced evaluation of the technical, environmental and ...

  10. Behavioral Response to Hydrogen Fuel Cell Vehicles and Refueling: A Comparative Analysis of Short- and Long-Term Exposure

    E-Print Network [OSTI]

    Martin, Elliot; Shaheen, Susan; Lipman, Timothy; Lidicker, Jeffery

    2008-01-01T23:59:59.000Z

    on the attitude towards hydrogen fuel cell buses in the CUTEBEHAVIORAL RESPONSE TO HYDROGEN FUEL CELL VEHICLES ANDBEHAVIORAL RESPONSE TO HYDROGEN FUEL CELL VEHICLES AND

  11. The Methanosarcina barkeri genome: comparative analysis with Methanosarcina acetivorans and Methanosarcina mazei reveals extensive rearrangement within methanosarcinal genomes

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    GRIT database schema. Primary keys are capitalized, foreignArrows indicate foreign key primary key relationships FigureGRIT database schema. Primary keys are capitalized, foreign

  12. Comparative analysis of polycyclic aromatic sulfur heterocycles isolated from four shale oils. [Polycyclic aromatic sulfur heterocycles; thiophenes

    SciTech Connect (OSTI)

    Willey, C.; Pelroy, R.; Stewart, D.

    1981-12-01T23:59:59.000Z

    This report describes the isolation of sulfur heterocycle fractions from four shale oils (Paraho, Geokinetics, Occidental, and Rio Blanco), the use of capillary column gas chromatography and mass spectrometry for the identification of individual mixture components, and a reverse (Ames) and forward mutation assay with Salmonella typhimurium to screen for possible health hazards. The major components of the Polycyclic Aromatic Sulfur Heterocycles (PASH) fractions for all four shale oils were found to be two- to three-ringed parent and alkylated thiophene compounds. In all cases the PASH fractions showed no more specific mutagenic response than the neutral PAC fractions from which they were isolated. The only mutagenic response which was detected in the PASH fractions was for the Rio Blanco shale oil and showed specific mutagenic response similar to the neutral PAC fraction from which it was isolated. Finally, the forward mutation 8-azaguanine test was apparently more sensitive than the Ames histidine reversion test in detecting mutagenic activity for the chemical fractions from the shale oils.

  13. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    24 Wholesale Energy and Capacity Price Changes Projected byImpacts to Alternative Wholesale Electric Price Scenarios..24 Effect of Wholesale Market Price Reductions on RPS Rate

  14. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    EIA). 2005. Annual Energy Outlook 2005 with Projections toEIA). 2006a. Annual Energy Outlook 2006 with Projections tosuch as from the EIA’s Annual Energy Outlook or the EPRI/DOE

  15. Using the BEopt Automated Residential Simulation Test Suite to Enable Comparative Analysis Between Energy Simulation Engines: Preprint

    SciTech Connect (OSTI)

    Tabares-Velasco, P. C.; Maguire, J.; Horowitz, S.; Christensen, C.

    2014-09-01T23:59:59.000Z

    Verification and validation are crucial software quality control procedures when developing and implementing models. This is particularly important as a variety of stakeholders rely on accurate predictions from building simulation programs. This study uses the BEopt Automated Residential Simulation Test Suite (BARTS) to facilitate comparison of two energy simulation engines across various building components and includes models that isolate the impacts of specific building components on annual energy consumption. As a case study, BARTS has been used to identify important discrepancies between the engines for several components of the building models; these discrepancies are caused by differences in the models used by the engines or coding errors.

  16. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    gas, rather than coal, generation. One reason that somelikelihood that coal-fired generation will set wholesalegeneration displaces coal-fired generation. Since the study

  17. Is it Worth it? A Comparative Analysis of Cost-Benefit Projections for State Renewables Portfolio Standards

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2006-01-01T23:59:59.000Z

    likelihood that coal-fired generation will set wholesalethat RPS generation may increasingly displace coal-fired and

  18. The impact of oxygen on the transcriptome of recombinant S. cerevisiae and P. pastoris - a comparative analysis

    E-Print Network [OSTI]

    2011-01-01T23:59:59.000Z

    P, Lang C, et al: Protein folding and conformational stresseffects of trehalose on protein folding in vitro and ininterrelated with correct protein folding and secretion. It

  19. Flux and flexibility : a comparative institutional analysis of evolving university-industry relationships in MIT, Cambridge and Tokyo

    E-Print Network [OSTI]

    Hatakenaka, Sachi, 1961-

    2002-01-01T23:59:59.000Z

    University-industry relationships are in a state of flux. They represent important strategic issues for universities, for industry, and for governments alike. This confluence of interests has led to experimentation in which ...

  20. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    outside of the electricity sector (this potential impact isonly report changes in electricity sector generation (i.e.gas used in the electricity sector; these effects (where