Powered by Deep Web Technologies
Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

sustainability.umd.edu University of Maryland  

E-Print Network [OSTI]

sustainability.umd.edu University of Maryland Sustainability Progress Report 2013 terps leave small footprintsumd #12;sustainability.umd.edu umdumd ReportOverview University of Maryland fulfills its promise to be a national model of a Green University by measuring and publicly reporting its annual sustainability

Yorke, James

2

WorldCat UMD 2013 -2014 University Libraries lib.umd.edu/tl/guides/worldcatumd  

E-Print Network [OSTI]

) Basic search & results screen Use the Get Started tab to enter your search terms, then click Search: 1; it displays results ranked by whether UMD Libraries own it in addition to the relevance of your search terms.umd.edu Searching from off campus? Go to umaryland.worldcat.org & login at University of Maryland College Park

Gruner, Daniel S.

3

dining.umd.edu GLUTEN FREE  

E-Print Network [OSTI]

dining.umd.edu GLUTEN FREE INGREDIENTS CONTAIN NO WHEAT OR GLUTEN EAT SMART PROPERLY PORTIONED, LOWER IN CALORIES AND WELL BALANCED VEGETARIAN FREE OF MEAT, POULTRY AND FISH VEGAN FREE OF ALL ANIMAL CONTAIN NO TREE NUTS OR PEANUTS EAT SMART GLUTEN FREE VEGAN VEGETARIAN DAIRY NUTS PROPERLY PORTIONED

Hill, Wendell T.

4

ep.jhu.edu 20132014 Graduate Programs Engineering  

E-Print Network [OSTI]

ep.jhu.edu 2013­2014 Graduate Programs Engineering for Professionals WHITING SCHOOL OF ENGINEERING #12;Welcome to Johns Hopkins University's Engineering for Professionals (EP). As part of the Whiting School of Engineering, EP programs draw on Johns Hopkins' world-renowned strengths in research

von der Heydt, Rüdiger

5

Jonathan D. Cohen http://www.cs.jhu.edu/~cohen  

E-Print Network [OSTI]

simplification of complex, polygonal models. Designed and implemented a walkthrough system for massive models University New Engineering Building 224 Baltimore, MD 21218 cohen@cs.jhu.edu (410) 516-5308 EDUCATION Ph of Polygonal Models." Advisor: Dinesh Manocha. MS in Computer Science, 1994. University of North Carolina

Cohen, Jonathan

6

U-M Construction Forecast December 15, 2011 U-M Construction Forecast  

E-Print Network [OSTI]

U-M Construction Forecast December 15, 2011 U-M Construction Forecast Spring Fall 2012 As of December 15, 2011 Prepared by AEC Preliminary & Advisory #12;U-M Construction Forecast December 15, 2011 Overview Campus by campus Snapshot in time Not all projects Construction coordination efforts

Kamat, Vineet R.

7

Exploiting Nonlinear Dynamics for Novel Sensor Networks (UMD-DUKE)  

E-Print Network [OSTI]

Exploiting Nonlinear Dynamics for Novel Sensor Networks (UMD-DUKE) Network of nonlinear;Nonlinear Photonic Sensor Networks Adam B. Cohen (Phys, IREAP) Bhargava Ravoori (Phys, IREAP) Karl R properties #12;Nonlinear Optoelectronic time-delayed feedback loop MZ EOM RF in bias VDC laser photo

Anlage, Steven

8

Student Development Theory At UMD, we are concerned about each student's development. Education, personal values,  

E-Print Network [OSTI]

Student Development Theory At UMD, we are concerned about each student are all important aspects of a student's college experience. Instead of focusing students an opportunity for to grow as a whole person. We recognize that learning

Amin, S. Massoud

9

VEHICLE LEASE This form is an agreement between a University of Michigan (U-M) department and U-M Parking and Transportation  

E-Print Network [OSTI]

VEHICLE LEASE This form is an agreement between a University of Michigan (U-M) department and U-M Parking and Transportation Services (PTS) Fleet Services to lease a vehicle. Form-1470 or mail/deliver to 1213 Kipke Drive Zip 2002 Department Information U-M Vehicle # Shortcode Parking

Kirschner, Denise

10

Vehicle Signage Policy Outline the policy regarding signage on University of Michigan (U-M) vehicles.  

E-Print Network [OSTI]

Vehicle Signage Policy Objective Outline the policy regarding signage on University of Michigan (U-M) vehicles. Policy 1. All vehicles owned by U-M will be identified by a vehicle number, U-M decal and special municipal license plate issued by Fleet Services. 2. All signage on vehicles owned by U-M must be approved

Kirschner, Denise

11

Research Port 2013 -2014 University Libraries www.lib.umd.edu/tl/guides/research-port  

E-Print Network [OSTI]

Research Port 2013 - 2014 University Libraries www.lib.umd.edu/tl/guides/research-port What is Research Port? Research Port is an electronic portal that allows you to: Access subscription resources Research Port and also e-mail or save article citations. Log in to Research Port Start at the UM Libraries

Gruner, Daniel S.

12

NASA's DISCOVER-AQ and UMD's RAMMPP: Policy relevant science for improving air quality in Maryland  

E-Print Network [OSTI]

NASA's DISCOVER-AQ and UMD's RAMMPP: Policy relevant science for improving air quality in Maryland's air? · Krotkov (11 am) Using OMI (and OMPS) for SO2 emissions. · Kollonige ­ Model sensitivity & O3 In 2010, Maryland implemented the "Healthy Air Act" 4 #12;Power Plant Emissions in Maryland. The following

Jacob, Daniel J.

13

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT  

E-Print Network [OSTI]

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM IN ENVIRONMENTAL ENGINEERING AND SCIENCE 1. CIP Code 141401 2. Credential Level MHEC Approved 3. Program Length://www.onetonline.org/find/ SOC System: http://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 17

Ghosh, Somnath

14

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT  

E-Print Network [OSTI]

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM: ADVANCED CERTIFICATE FOR POST-MASTER'S STUDY IN ENVIRONMENTAL ENGINEERING, SCIENCE, AND MANAGEMENT 1. CIP-1053.00 Environmental Science Teachers, Postsecondary 172081.00 Environmental Engineers 119041.00 Architectural

Ghosh, Somnath

15

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT  

E-Print Network [OSTI]

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM-1053.00 Environmental Science Teachers, Postsecondary 172081.00 Environmental Engineers 119041.00 Architectural-MASTER'S CERTIFICATE IN ENVIRONMENTAL ENGINEERING 1. CIP Code 141401 2. Credential Level Credential Level 4 ­ Post

Ghosh, Somnath

16

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT  

E-Print Network [OSTI]

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM: GRADUATE CERTIFICATE IN ENVIRONMENTAL ENGINEERING 1. CIP Code 141401 2. Credential Level MHEC Approved 3://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 172081.00 Environmental Engineers 119041

Ghosh, Somnath

17

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT  

E-Print Network [OSTI]

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM-1053.00 Environmental Science Teachers, Postsecondary 172081.00 Environmental Engineers 119041.00 Architectural-MASTER'S CERTIFICATE IN CLIMATE CHANGE, ENERGY, AND ENVIRONMENTAL SUSTAINABILITY 1. CIP Code 030103 2. Credential Level

Ghosh, Somnath

18

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT  

E-Print Network [OSTI]

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM MASTER'S STUDY IN ENVIRONMENTAL PLANNING AND MANAGEMENT 1. CIP Code 141401 2. Credential Level MHEC://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 172081.00 Environmental Engineers 119041

Ghosh, Somnath

19

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT  

E-Print Network [OSTI]

http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM: GRADUATE CERTIFICATE IN ENVIRONMENTAL ENGINEERING, PLANNING AND MANAGEMENT 1. CIP Code 141401 2. Credential://www.onetonline.org/find/ SOC System: http://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 172081

Ghosh, Somnath

20

Vehicle Maintenance Policy Outline the policy regarding vehicle maintenance at University of Michigan (U-M).  

E-Print Network [OSTI]

Vehicle Maintenance Policy Objective Outline the policy regarding vehicle maintenance at University of Michigan (U-M). Policy 1. All maintenance performed on U-M vehicles must be coordinated through Garage to repair their fleet vehicles. 2. U-M vehicles leased through Fleet Services include routine maintenance

Kirschner, Denise

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

S A P D O C U M E N T N U M B E R S IF THE FINANCE  

E-Print Network [OSTI]

S A P D O C U M E N T N U M B E R S IF THE FINANCE DOCUMENT STARTS WITH AND IS AND DOC TYPE Transactions Enter Asset Transaction FB03 Any Finance or Sponsored Transactional Reports such as: CO Monthly long AB Automatic Clearing Automatic Clearing FB03 Any Finance or Sponsored Transactional Reports

Weaver, Harold A. "Hal"

22

Vehicle Use Policy Outline the policy regarding vehicle use at the University of Michigan (U-M).  

E-Print Network [OSTI]

Vehicle Use Policy Objective Outline the policy regarding vehicle use at the University of Michigan (U-M). Policy 1. Vehicles owned or leased and furnished by the U-M are to be used exclusively the direct supervision of a U-M staff member. 3. All vehicles must be parked on U-M property (owned or leased

Kirschner, Denise

23

Vehicle Maintenance Procedure Outline the procedure for vehicle maintenance at University of Michigan (U-M).  

E-Print Network [OSTI]

Vehicle Maintenance Procedure Objective Outline the procedure for vehicle maintenance at University of Michigan (U-M). Procedure 1. Your U-M vehicle has a mechanical and/or safety issue. 2. Contact Garage of the vehicle or if needed, have the vehicle towed to the maintenance facility. 4. If a loaner is needed while

Kirschner, Denise

24

Accident Procedure Outline the procedures for accidents involving University of Michigan (U-M) vehicles.  

E-Print Network [OSTI]

owned by U-M are covered by the U-M self insurance program administered by Risk Management. Procedure 1. An accident is defined as any incident that causes damage to people or property. 2. In the event. 4. If the accident causes personal injury to the driver, occupants and/or pedestrian, contact Risk

Kirschner, Denise

25

C O L L O Q U I U M M A T H E M A T I C U M VOL. LXIII 1992 FASC. 1  

E-Print Network [OSTI]

C O L L O Q U I U M M A T H E M A T I C U M VOL. LXIII 1992 FASC. 1 ERRATUM `A L'ARTICLE "SUR UN TH´EOR`EME DE DAY, UN TH´EOR`EME DE MAZUR­ORLICZ ET UNE G´EN´ERALISATION DE QUELQUES TH´EOR`EMES DE SILVERMAN telle correction. Pour achever la d´emonstration du Th´eor`eme 1, il suffit de montrer que f(x) = f

Chojnacki, Wojtek

26

P h y l u m Brachiopoda /. Emotby Pennington and StephenA. Stricker  

E-Print Network [OSTI]

Chapter 23 P h y l u m Brachiopoda /. Emotby Pennington and StephenA. Stricker Brachiopods or 'lamp(~ggo),Long and Stricker (1991) and Suicker (1999) and thereforewill not be dealt with in the present chapter. We

Pennington, J. Timothy

27

Visit us at robotics.umd.edu See our robot videos at www.youtube.com/umdrobotics  

E-Print Network [OSTI]

Visit us at robotics.umd.edu See our robot videos at www.youtube.com/umdrobotics Where are the robots? This information packet contains: · An overview map showing parking, buildings housing robotics of individual buildings to help you locate the robot labs. · Descriptions of each lab. In addition

Shapiro, Benjamin

28

Operator Licensing Policy Outline the policy to ensure proper licensure of operators at the University of Michigan (U-M)  

E-Print Network [OSTI]

at the University of Michigan (U-M) according to State of Michigan law. Policy 1. In order to operate a U-M vehicle, State of Michigan and federal guidelines require that the operator possess the appropriate vehicle

Kirschner, Denise

29

Seat Belt Use Policy Outline the policy regarding use of seat belt in University of Michigan (U-M) vehicles.  

E-Print Network [OSTI]

Seat Belt Use Policy Objective Outline the policy regarding use of seat belt in University of Michigan (U-M) vehicles. Vehicle Use Policy 1. Staff members are responsible to operate U-M vehicles are adhering to the seat belt use laws when operating a U-M vehicle. 3. State of Michigan seat belt laws

Kirschner, Denise

30

Vehicle Repair Policy Outline the policy regarding vehicle repair on University of Michigan (U-M) vehicles.  

E-Print Network [OSTI]

Vehicle Repair Policy Objective Outline the policy regarding vehicle repair on University of Michigan (U-M) vehicles. Policy 1. All vehicle repairs performed on U-M vehicles must be coordinated facility to repair their fleet vehicles. 2. U-M vehicles leased through Fleet Services include routine

Kirschner, Denise

31

Insurance Coverage Policy Outline the policy regarding insurance coverage on University of Michigan (U-M) vehicles.  

E-Print Network [OSTI]

-M are covered by the U-M self insurance program administered by Risk Management. 3. U-M vehicles owned insured and carries personal protection, residual liability and property protection insurance on all coverage through Risk Management. 5. U-M vehicles owned by the using department and not registered

Kirschner, Denise

32

M E M O R A N D U M OFFICE OF THE PROVOST  

E-Print Network [OSTI]

M E M O R A N D U M OFFICE OF THE PROVOST Professor Anthony C. Masi Provost James Administration Building TO: Faculty Deans FROM: Anthony C. Masi, Provost DATE: March 2011 SUBJECT that dossiers may more easily be submitted to national teaching award competitions. The Guidelines

Shoubridge, Eric

33

ACCELERATOR R&D S U M M A R Y  

E-Print Network [OSTI]

1 ACCELERATOR R&D P5 @ BNL 3/6/08 S U M M A R Y Medium & Longer Term [AARD = Advanced Accelerator R&D] #12;2 · Accelerators remain an essential component in Elementary Particle Physics Research · Accelerator capabilities are prominent in defining the frontiers of Elementary Particle Science · EPP2010

34

R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany  

E-Print Network [OSTI]

R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany (RESDIG Republic of Germany, German Alumni in Surabaya with supports from DAAD, GIZ and Goethe Institute. Through the cooperation and share experiences between Indonesia and Germany in renewable and sustainable

Peinke, Joachim

35

| A r g u m e n t o | En la variedad est la energa  

E-Print Network [OSTI]

| A r g u m e n t o | 22 En la variedad está la energía Como todos los recursos energéticos tienen; importación de gas natural licuado; centrales hidroeléctricas, y, por último, energía nuclear y recursos renovables. No existen soluciones únicas ni infalibles, pero algunas son más viables que otras. Sebastián

Catholic University of Chile (Universidad Católica de Chile)

36

Medical Certification Policy Outline the policy to ensure proper licensure of operators at the University of Michigan (U-M)  

E-Print Network [OSTI]

at the University of Michigan (U-M) according to State of Michigan law. Policy 1. In order to operate a U-M vehicle, State of Michigan and federal guidelines require that the operator possess the appropriate vehicle card) to operate. 3. Federal guidelines and State of Michigan law require operators of the following

Kirschner, Denise

37

Vehicle Rental Procedure Outline the procedure for renting motor pool vehicles at University of Michigan (U-M).  

E-Print Network [OSTI]

Vehicle Rental Procedure Objective Outline the procedure for renting motor pool vehicles at University of Michigan (U-M). Procedure 1. All policies pertaining to U-M vehicles also pertain to motor pool rental vehicles. 2. Motor pool vehicles can be reserved for a period of a few hours up to one year. 3

Kirschner, Denise

38

Loaner Vehicle Policy Outline the policy regarding issuance of loaner vehicles for University of Michigan (U-M)  

E-Print Network [OSTI]

Loaner Vehicle Policy Objective Outline the policy regarding issuance of loaner vehicles for University of Michigan (U-M) vehicles in the garage for maintenance. Vehicle Maintenance Policy 1. All maintenance performed on U-M vehicles must be coordinated through Garage Services. Exception: Both U

Kirschner, Denise

39

Accident Reporting Policy Outline the policy regarding accident reporting on University of Michigan (U-M) vehicles.  

E-Print Network [OSTI]

owned by U-M are covered by the U-M self insurance program administered by Risk Management. Policy 1. An accident is defined as any incident that causes damage to persons or property. 2. In the glove box of every

Kirschner, Denise

40

R e s u m e 1 o f 1 8 PATRICK S. SULLIVAN, REA, CPP  

E-Print Network [OSTI]

R e s u m e 1 o f 1 8 PATRICK S. SULLIVAN, REA, CPP E d u c a t i o n BA Harvard University, Biology/Ecology; 1989 P r o f e s s i o n a l L i c e n s e / C e r t i f i c a t i o n s State Action Reserve (CAR) California Air Resources Board (CARB), Accredited Lead Verifier (E.O. H-09-60) P r o

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

A U T U M N 2 0 1 4www.ucd.ie/ucdtoday 5.Alooktothe  

E-Print Network [OSTI]

A U T U M N 2 0 1 4www.ucd.ie/ucdtoday 5.Alooktothe biggerpicture ofresearch 7.Thenatural worldin Quinn, Bernadette Rafter, Eugene Roche, Mark Simpson, Craig Slattery, Barry Smyth, Conor Sweeney, Cathy

Pollastri, Gianluca

42

Rental Policy PTS Fleet Services has a rental pool for U-M departments that have a need to lease or rent a vehicle to  

E-Print Network [OSTI]

for U-M departments that have a need to lease or rent a vehicle to conduct University business both on and off campus. Vehicles may be rented student organizations may rent U-M vehicles as long as there is a U-M business

Kirschner, Denise

43

F R O M M E M O R A N D U M D A T E  

Office of Legacy Management (LM)

r F R O M : M E M O R A N D U M D A T E ----B--M S U B J E C T : A L T E R N A T E ' N A M E 8 --- ----a- O W N E R ( S ) --- Past ---...

44

Commercial Driver License Policy Outline the policy to ensure proper licensure of operators at the University of Michigan (U-M)  

E-Print Network [OSTI]

of operators at the University of Michigan (U-M) according to State of Michigan law. Policy 1. In order to operate a U-M vehicle, State of Michigan and federal guidelines require that the operator possess that are discussed in the operator licensing policy. 2. Federal guidelines and State of Michigan law require

Kirschner, Denise

45

K Y B E R N E T I K A --V O L U M E 4 6 ( 2 0 1 0 ) , N U M B E R 3 , P A G E S 5 5 2 5 6 1 ON HYPERPLANES AND SEMISPACES  

E-Print Network [OSTI]

of real numbers R{-} endowed with operations of idempotent addition ab := max(a, b) and multiplication abK Y B E R N E T I K A -- V O L U M E 4 6 ( 2 0 1 0 ) , N U M B E R 3 , P A G E S 5 5 2 ­ 5 6 1 ON HYPERPLANES AND SEMISPACES IN MAX­MIN CONVEX GEOMETRY Viorel Nitica and Sergei Sergeev The concept

Butkovic, Peter

46

FUEL DEVICE APPLICATION Use this application to request a fuel device to access the University of Michigan (U-M) Parking and Transportation  

E-Print Network [OSTI]

FUEL DEVICE APPLICATION Use this application to request a fuel device to access the University of Michigan (U-M) Parking and Transportation Services (PTS) service stations for fuel. A fuel device owned and managed by PTS Fleet Services equipped with an automated fuel device. Please read the Use

Kirschner, Denise

47

ALTERNATIVE FUEL VEHICLE (AFV) INFORMATION Over 98% of the U-M auto passenger fleet is flex fuel vehicles (FFV). A FFV is capable of operating on  

E-Print Network [OSTI]

ALTERNATIVE FUEL VEHICLE (AFV) INFORMATION Over 98% of the U-M auto passenger fleet is flex fuel of both. FFV's are equipped with an engine and fuel system designed specifically to be compatible with ethanol's chemical properties. FFV's qualify as alternative fuel vehicles under the Energy Policy Act

Kirschner, Denise

48

Page 6 T H E E N V I R O N M E N TA L F O R U M Managing Water Demand  

E-Print Network [OSTI]

Page 6 T H E E N V I R O N M E N TA L F O R U M Managing Water Demand: Price vs. Non to the effective management of water systems. Even green solutions or low-impact development techniques that seek-efficientfixturesanddrought- resistant plantings. "Water management has typically been approached as an engineering problem, rather than

Shapiro, Benjamin

49

v o l. 6 n o. 4 S u m m e r 2 0 0 4 School of Computer Science, Telecommunications & Information Systems  

E-Print Network [OSTI]

v o l. 6 n o. 4 S u m m e r 2 0 0 4 School of Computer Science, Telecommunications & Information picture company launched by CTI's digital cinema program, which shot its inaugural film, "Last Call-of-the-art digital cinema program. A new faculty member--Academy Award-winning sound editor David Stone--is working

Schaefer, Marcus

50

H U M A N R E S O U R C E S E R V I C E S M A N U A L INSTITUTION CODES  

E-Print Network [OSTI]

H U M A N R E S O U R C E S E R V I C E S M A N U A L INSTITUTION CODES INSTITUTION CODES University of New York City College 002688 #12;H U M A N R E S O U R C E S E R V I C E S M A N U A L at Indianapolis 001813 #12;H U M A N R E S O U R C E S E R V I C E S M A N U A L INSTITUTION CODES Inter American

51

Stress corrosion cracking: New experiments, new insights M I T E N E R G Y I N I T I AT I V E A U T U M N 2 0 1 2  

E-Print Network [OSTI]

% post-consumer recycled content, with the balance coming from responsibly managed sources. Energy. Economic pressures both in the United States and in other key economies around the world threaten T U M N 2 0 1 2 I N T H I S I S S U E Energy Futures Discovering solutions: Undergrads take the lead

Yildiz, Bilge

52

carey.jhu.edu 01 Handbook and  

E-Print Network [OSTI]

. . . . . . . . . . . . 38 Student Accounts. . . . . . . . . . . . . . . . 38 Student Assistance Program (JHSAP) 41 Student . . . . . . . . . . . . . . . . . . . . . . . 31 Immunization Law. . . . . . . . . . . . . . . 31 Inclement Weather Policy. . . . . . . . . . 32. . . . . . . . . . . . . . . . . 59 Veterans Assistance. . . . . . . . . . . . . . . 60 Waiver Exams

Connor, Ed

53

carey.jhu.edu 01 Handbook and  

E-Print Network [OSTI]

. . . . . . . . . . . . . . . . 42 Student Assistance Program (JHSAP) 45 Student Clubs and Organizations. . . . 46 Student Success . . . . . . . . . . . . . . . . . . . . . . . 33 Immunization Law. . . . . . . . . . . . . . . 33 Inclement Weather Policy. . . . . . . . . . 34 . . . . . . . . . . . . 41 State-Specific Information for Online Programs . . . . . . . . . . . . . . . 41 Student Accounts

von der Heydt, Rüdiger

54

carey.jhu.edu 01 Handbook and  

E-Print Network [OSTI]

. . . . . . . . . . . . . . 31 Student Accounts. . . . . . . . . . . . . . . . . . 31 Student Assistance Program (JHSAP) . . 34 . . . . . . . . . . . . . . . . . . . . . . . . . 25 Immunization Law. . . . . . . . . . . . . . . . . 25 Inclement Weather Policy or . . . . . . . . . 53 Degree Requests Veterans Assistance. . . . . . . . . . . . . . . . . 54 Waiver Exams

Connor, Ed

55

personal_data_form.doc 2011-07-27 T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A  

E-Print Network [OSTI]

personal_data_form.doc 2011-07-27 T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A - PERSONAL DATA FORM - IDENTIFICATION ­ Provide all information in this section EMPLOYEE ID PREFIX FIRST NAME CURRENT HOME ADDRESS CITY PROV/ST POSTAL/ZIP COUNTRY SIGNATURES SIGNATURE DATE (yyyy-mm-dd) * Personal

Michelson, David G.

56

U n i v e r s i t y C o r e C u r r i c u l u m What Does the New Core Mean for You?  

E-Print Network [OSTI]

U n i v e r s i t y C o r e C u r r i c u l u m What Does the New Core Mean for You? See Your New Core Program Evaluation Online The new University Core Curriculum goes into effect for all students beginning Summer Quarter, 2013. Students on the current Core will be moved to the new Core requirements

Carter, John

57

C O L L E G E O F H U M A N E C O L O G Y , C O R N E L L U N I V E R S I T Y Human Ecology  

E-Print Network [OSTI]

C O L L E G E O F H U M A N E C O L O G Y , C O R N E L L U N I V E R S I T Y Human Ecology 2005/VOLUME 32, NUMBER 3 #12;FEATURES Human Ecology HEALTHY PEOPLE, FAMILIES, COMMUNITIES COURTESYOFSHEILADANKO Volume 32, Number 3 March 2005 The New York State College of Human Ecology at Cornell University

Wang, Z. Jane

58

V O L U M E  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism inS-4500II Field EmissionFunctionalPortalV > 111 \il :^ a.7 V e

59

H A R T N E L L C O L L O Q U I U M A N E X P L O R A T I O N O F C O M M E R C I A L  

E-Print Network [OSTI]

H A R T N E L L C O L L O Q U I U M A N E X P L O R A T I O N O F C O M M E R C I A L L A W U N D E R T H E H I G H C O U R T O F C H I E F J U S T I C E F R E N C H Chief Justice French since 1986, Chief Justice French brought a wealth of commercial law experience to the High Court

Botea, Adi

60

wellness.umd.edu 1. Choose a balanced, energy-  

E-Print Network [OSTI]

sporting event 30. Play an instrument 31. Write a poem or story 32. Go ice skating at Wells Ice Rink 33

Gruner, Daniel S.

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

UMD Parking Rates & Fees 2012/13 2014/15  

E-Print Network [OSTI]

2012-13 Actual 2013-14 Proposed 2014-15 Green Permit $226.00 / yr $15.00 / wk $232.00 / yr $15.00 / wk $232.00 / yr $15.00 / wk Gold Permit $379.00 / yr $390.00 / yr $390.00 / yr White Permit Not Applicable $120

Amin, S. Massoud

62

S Y M P O S I U M Fundamentals  

E-Print Network [OSTI]

.3 Multiscale modelling of hydrogen embrittlement in zirconium alloys ­ retracted Jassel Majevadia1 · Mark, Villeurbanne, France MM 34.2 Hydrogen enhanced dislocation emission at a crack tip Yu Wang1·2 · Damien

Stummer, Wolfgang

63

B ALLR O O M AND SU R R O U ND IN G H ALLWAY S R O O M N U M B E R S Q UA R E FE E T S M A R T R O O M B A N Q U E T C L A S S R O O M L E C T U R E N O N P R O FI T R AT E P R O FI T R AT E  

E-Print Network [OSTI]

B ALLR O O M AND SU R R O U ND IN G H ALLWAY S R O O M N U M B E R S Q UA R E FE E T S M A R T R O O M B A N Q U E T C L A S S R O O M L E C T U R E N O N P R O FI T R AT E P R O FI T R AT E 1601 Hallway 3020 NO $245 $370 M E E T I N G R O O M S R O O M N U M B E R S Q UA R E FE E T S M A R T R O O M

Hutcheon, James M.

64

www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu  

E-Print Network [OSTI]

with a lighter orange core. Roots become woody when fully mature, but are excellent when harvested at their prime-drained soil that is free from rocks, clods, or debris. Raised beds work well for carrots. Soil pH should mulched, can last until winter. Nutrition: Rich in beta-carotene (converts to Vitamin A). Also a source

Hill, Wendell T.

65

www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu  

E-Print Network [OSTI]

, habanero, piquin, tabasco; and 3. Southwestern/Mexican varieties, such as numex, poblano, pasilla, mulatto

Hill, Wendell T.

66

VO L U M E 1 4 N U M B E R 4 FA L L 2 0 1 2 CLASS OF 2016 p. 8  

E-Print Network [OSTI]

treatments to maximize effectiveness in patient care FALL 2012 Diagnostic Imaging and Radiology Research UW Student Life 34 WIMR II 36 Healer's Journey 40 Larson's Perspective Addiction Medicine Fellowship Training future primary care providers to confront this serious issue Connecting Disciplines for Digestive Health

Wisconsin at Madison, University of

67

V O L U M E 4 5 N U M B E R 3 S P R I N G 2 0 0 7  

E-Print Network [OSTI]

, to phenomenol- ogy, to a new perspective on phenomenology called hermeneutic phenomenology, and to a fresh under

He, Chuan

68

D e t e r m i n a t i o n o f t h e l a y e r s t r u c t u r e o f e m b e d d e d s t r a i n e d I n G a A s m u l t i p l e q u a n t u m w e n t -b y h i g h r e s o l u t i o n x -r a y d i f f r a c t i o n  

E-Print Network [OSTI]

/ z D e t e r m i n a t i o n o f t h e l a y e r s t r u c t u r e o f e m b e d d e d s t r a i n e d I n G a A s m u l t i p l e q u a n t u m w e n t - b y h i g h r e s o l u t i o n x - r a y d i f f r a c t i o n W o o - Y o u n g C h o i a n d C H f t o n G . F o n d a d D e P O T m e n r

Choi, Woo-Young

69

A b s o r p t i o n s p e c t r o s c o p y o n r o o m t e m p e r a t u r e e x C I M I --t r a n s i t i o n s i n s t r a i n e d l a y e r l n G a A s / l n G a A l A s m u l t i q u a n t u m -w e H s t r u c t u r e s  

E-Print Network [OSTI]

A b s o r p t i o n s p e c t r o s c o p y o n r o o m t e m p e r a t u r e e x C I M I - - t r a n s i t i o n s i n s t r a i n e d l a y e r l n G a A s / l n G a A l A s m u l t i q u a n t u m - w e H s t r u c t u r e s Y . H |r a Y a m a , a ) W o o - Y o u n g C h d , L . H . P e n g , b

Choi, Woo-Young

70

Ra d io so n d e W o rk sh o p , 2 1 -2 3 M a y 2 0 0 2 , H a m p to n U n iv e rstiy , V irg in ia U N D E R S T A N D IN G A N D C O R R E C T IN G H U M ID IT Y M E A S U R E M E N T E R R O R S  

E-Print Network [OSTI]

Ra d io so n d e W o rk sh o p , 2 1 -2 3 M a y 2 0 0 2 , H a m p to n U n iv e rstiy , V irg in ia 1 U N D E R S T A N D IN G A N D C O R R E C T IN G H U M ID IT Y M E A S U R E M E N T E R R O R S F R O M V A IS A L A R S 8 0 A N D V IZ R A D IO S O N D E S J u n h o n g W a n g * N a tio n a l C

Wang, Junhong

71

International Journal of Computer Integrated Manufacturing *Corresponding author. Email: sandborn@umd.edu  

E-Print Network [OSTI]

Electronic Systems Varun J. Prabhakar and Peter Sandborn* Center for Advanced Life Cycle Engineering (CALCE procurement obsolescence, reliability concerns, and the risk of long-term supply-chain disruptions the procurement status of parts, managing purchase orders, and part database maintenance. In addition, part

Sandborn, Peter

72

WSC 2000 1http://www.isr.umd.edu/IPDPM/ Understanding the Impact of Equipment and  

E-Print Network [OSTI]

simulation applications Process, equipment or industrial engineers Operations engineer Lot Process Times # process chambers 2 Scheduling algorithm push OD time 15 sec Robot move time 6 sec W CVD cluster tool # process chambers 3 Scheduling algorithm pull OD time 12 sec Robot move time 5 sec TiN PVD Thickness 30 nm

Rubloff, Gary W.

73

UMD ADVANCE Program for Inclusive Excellence Interdisciplinary and Engaged Research Seed Grants 2013  

E-Print Network [OSTI]

-Friendly Communities: Investigating Needs and Preferences in a Racially/Ethnically Diverse, Low Income Community" Lori Simon-Rusinowitz Health Services Administration, SPHL "Quantifying Human Health Effects From Climate Change in an Integrated Assessment Model

Setiawan, Hendra

74

Institut de Mathematiques de Jussieu U.M.R. 7586 du C. N. R. S.  

E-Print Network [OSTI]

, had the right size and the necessary equipment, for green board lectures as well as for beamer presentations. In fact, most courses were given with the green board, which is more suitable for courses. The meals (at the guest house for breakfast and dinner, at the conference center for lunch and tea breaks

Waldschmidt, Michel

75

State of California E-Mail M e m o r a n d u m  

E-Print Network [OSTI]

of the 2013-2014 Sustainability Advisory Committee I am pleased to endorse the nominations and hereby appoint, the following individuals to membership on the Sustainability Advisory Committee for the period indicated. NAME Christine Theodoropoulos 2013-2015 Adrienne Greve Dean, Architecture & Env. Design Rafael Jimenez

Sze, Lawrence

76

July 18, 2014 M E M O R A N D U M  

E-Print Network [OSTI]

Westcott Building, 222 S. Copeland Avenue, P.O. Box 3061480, Tallahassee, Florida 32306-1480 Telephone: 850

McQuade, D. Tyler

77

Pagina 1 Curriculum Vitae di C U R R I C U L U M  

E-Print Network [OSTI]

: AGGIORNAMENTO UNI EN ISO 9001: 2008 LABORATORIO DI CREATIVITA' E INNOVAZIONE PER IL PERSONALE DELLE SEGRETERIE

78

Pagina 1 Curriculum Vitae di C U R R I C U L U M  

E-Print Network [OSTI]

sicurezza Nel 2009 - La norma ISO 9001: 2008 Nel 2009 ­ Meeting 2009 Nel 2008 ­ Quotidiano e straordinario

79

s y m p o s i u m 21 22 July 2011  

E-Print Network [OSTI]

Taylor Institute of Particle Technology, LFG University of Erlangen-Nuremberg Simple Approaches to Metal/Metal Chemistry, IMC Vienna University of Technology, Austria Silicide Nanoparticles in an amorphous Matrix as new-Nuremberg Synthesis of hierarchical Metal Oxide and Metal Sulphide Nanoparticles under solvothermal Conditions Martin

Gugat, Martin

80

Institut de Mathematiques de Jussieu U.M.R. 7586 du C. N. R. S.  

E-Print Network [OSTI]

it was decided that the Laos Government would host the ASEAN summit on November 5 and 6, 2012, and the ASEAN

Waldschmidt, Michel

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Institut de Mathematiques de Jussieu U.M.R. 7586 du C. N. R. S.  

E-Print Network [OSTI]

revitalisation de la recherche au Kurdistan" du mardi 14 au jeudi 16 d´ecembre 2010 `a Erbil, Kurdistan December 14 - 16, 2010, Erbil (Kurdistan, Iraq) International Conference on Revitalizing Research in Kurdistan´egional du Kurdistan (KRG) a organis´e une conf´erence internationale "Revitalizing Research in Kurdistan" du

Waldschmidt, Michel

82

V O L U M E 3 4 , P A R T 7 BRIGHAM YOUNG UNIVERSITY  

E-Print Network [OSTI]

of nearshore clastic sediment. These cyclic deposits exhibit a prograding clastic shoreline sequence of open Geology of the Standardville 7'12' Quadrangle, Carbon County, Utah. Harnblin 33 Stratigraphy and Depositional Environments of the Gebel el-Rus Area, Eastern Faiyum, Egypt

Seamons, Kent E.

83

S U M A R I O CARGAS DE HUNDIMIENTO POR PUNTA PARA PILOTES EN ROCA  

E-Print Network [OSTI]

87 ANÁLISIS DESCRIPTIVO DE LA "DIRECCI?N AMBIENTAL DE OBRA" EN LAS DECLARACIONES DE IMPACTO AMBIENTAL de Impacto Ambiental (EIA) es el Real Decreto Legislativo1 1302/19862 (actualmente derogado) por el "Dirección Ambiental de Obra" en las Declaraciones de Impacto Ambiental de proyectos de Ingeniería Civil

Espigares, Tíscar

84

Institut de Mathematiques de Jussieu U.M.R. 7586 du C. N. R. S.  

E-Print Network [OSTI]

'2011 organis´ee `a Konya du 20 au 23 juillet 2011 par Selcuk University (Department of Mathematics - dy2 = ±1. Le texte de mon expos´e est en ligne `a l'adresse http://www.math.jussieu.fr/miw/articles/pdf/BrahmaguptaFermatPellKonya

Waldschmidt, Michel

85

InnovationsV o l u m e I I s s u e I V  

E-Print Network [OSTI]

to do business and is an emerging technology powerhouse. How do we keep the momentum going? This may

86

M E M O R A N D U M To: IT Steering Committee  

E-Print Network [OSTI]

to marriage); information in #12;student education records that is protected under the Family Educational with these procedures over the past seventeen months, and your comments. INFORMATION TECHNOLOGY SECURITY PROCEDURES I of this information. Loss of data integrity, theft of data, and unauthorized or inadvertent disclosure could lead

Qiu, Weigang

87

s u m m e r 2 0 1 2 Copyright 2012. All rights reserved.  

E-Print Network [OSTI]

sinegal Chairman, Costco Wholesale susan scott Founder, Fierce, Inc. Center for leadership formation Wholesale illustrAtions:

Carter, John

88

State of California E-Mail M e m o r a n d u m  

E-Print Network [OSTI]

Design Kris McKinlay 2013-2015 Kathryn Marshall +Dean, Orfalea College of Business Fred DePiero 2013 officio Continuing (Registrar) Debbie Arseneau Ex officio Continuing (Associate Registrar - Systems) Shawn

Sze, Lawrence

89

State of California E-Mail M e m o r a n d u m  

E-Print Network [OSTI]

Notermann 2010-2012 Continuing +Dean, Architecture & Environmental Design Kathryn Marshall** 2009 (Associate Vice Provost for Systems and Resources) Cem Sunata Ex officio Continuing (Registrar) Debbie

Sze, Lawrence

90

4november 2009 s p e c t r u m  

E-Print Network [OSTI]

direkt am St. Martinsplatz 7 Tel: 0631-68011 Fax: 0631-66825 E-mail: fbi-kl@t-online.de www.flugbuero-fbi

Berns, Karsten

91

I M E M O R A N D U M T O  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou$ EGcG ENERGYELIkNATIONHEALXH: l ._ .r.,--I Is IL -M

92

M E M O R A N D U M D A T  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou$ EGcG ENERGYELIkNATIONHEALXH:LTS PlanLlr* Lr Lr FiH:

93

TO: FILE M E M O R A N D U M  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou$0.C. 20545 OCTTO: FILE FROM: I .- SUBJECT:3 749

94

State of California E-Mail M e m o r a n d u m  

E-Print Network [OSTI]

Beightler 2012-2014 Debbie Rice Executive Director, Human Resources Sally Anderson 2013-2015 Mary Shaffer (Campus 504/ADA Coord. ­ Dir., Employment Equity) Mary Shaffer* Ex officio Continuing (Campus 508 Director, Cal Poly Corporation John Lee 2013-2015 Sally Anderson Executive Dir., Human Resources (non

Sze, Lawrence

95

BIOPHYSICS DEPT. TELEPHONE DIRECTORY~ OCTOBER 2012 Note: area code is 410 unless otherwise noted  

E-Print Network [OSTI]

Gosse Mgosse1@jhu.edu 516-7324 110 Jenkins Hall Alexis C. Ham Aham2@jhu.edu 516-7324 110 Jenkins Hall

von der Heydt, Rüdiger

96

Model-based Querying in Sensor Networks Amol Deshpande, University of Maryland, http://www.cs.umd.edu/~amol  

E-Print Network [OSTI]

://db.lcs.mit.edu/madden SYNONYMS Approximate querying; Model-driven data acquisition DEFINITION The data generated by sensor is required to complement the sensor data. Models can help provide more robust interpretations of sensor readings: by accounting for spatial or temporal biases in the observed data, by identifying sensors

Deshpande, Amol

97

ISDRS 2007, December 12-14, 2007, College Park, MD, USA ISDRS 2007 http://www.ece.umd.edu/ISDRS  

E-Print Network [OSTI]

to its low-cost process and the ability to be integrated with standard bulk CMOS technology. However]. Although mainly fabricated on SOI substrates, e.g. [2], body-tied FinFET has also gained attention due, the lack of isolation layer underneath the transistor body allows the drain field to penetrate toward

Technische Universiteit Delft

98

h t t p : / / a l u m n i . w v u . e d u A L U M N I A S S O C I A T I O N  

E-Print Network [OSTI]

and capital resources of the Association including the organization's operating budget Maintain legal in all programs and services we provide. Stewardship--Identify and use resources efficiently and remain and the Association. Goal: Ensure that the organization's staffing, structure and resources are aligned with the goals

Mohaghegh, Shahab

99

V O L U M E 8 3 N U M B E R 1 S P R I N G 2 0 0 2 M A G A Z I N E  

E-Print Network [OSTI]

-7727. Vanderbilt University is commit- ted to principles of equal opportunity and affirmative action. Copyright a criminal is the appropriate legal consequence, does that mean we should do it? 27 Are Civil Liberties of the first in the country from a private institution to become involved with efforts to help transition

Simaan, Nabil

100

E X E C U T I V E S U M M A R Y E X E C U T I V E S U M M A R Y  

E-Print Network [OSTI]

has also devoted resources and expertise to a number of public policy areas, including education, Electricity Innovation Institute Mark Levine Lawrence Berkeley National Laboratory Michael Lubell American

Kammen, Daniel M.

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

I N S I D E I V O L U M E 4 8 I N U M B E R 5 I M A R C H 7 , 2 0 0 2  

E-Print Network [OSTI]

execu- tive Karen Nishi, HSBC Bank Cana- dapresidentand CEO Martin Glynn, B.C. Gas president and CEO appreciatetherichper- Advertising executive Karen Nishi HSBC President Martin Clynn plinary introduction to the social

Farrell, Anthony P.

102

State of California The Resources Agency of California M e m o r a n d u m  

E-Print Network [OSTI]

management, socioeconomics/fire protection, waste management and soil and water resources. Energy Commission Telephone: CALNET (916 ) 654-4640 From : California Energy Commission ­ Felicia Miller 1516 Ninth Street system engineering, waste management and soil and water resources. Data responses from the applicant were

103

D O C U M E N T D E T R AVA I L LE DESCARTES I  

E-Print Network [OSTI]

'EMPLOIS AAU MAROC :U MAROC : LA CONTRIBUTION DES CR?ALA CONTRIBUTION DES CR?ATIONSTIONS ET DISPET DISPARITIONS Maroc : la contribution des créations et disparitions d'entreprises RICHARD DUHAUTOIS richard'Industrie (Maroc) DOCUMENT DE TRAVAIL N° 54 janvier 2006 hal-00831539,version1-7Jun2013 #12;ISSN 1629-7997 ISBN 2

Boyer, Edmond

104

Research Council November 22, 2009 Page 1 M E M O R A N D U M  

E-Print Network [OSTI]

University of Massachusetts at Amherst To: James V. Staros, Provost Date: November 22, 2009 From: David R Challenges 1. Sharing the Load. The PIs on campus generate considerable revenue for the university. Policies for proposals over $250,000. The NIH profile should spell the details out clearly #12;Research Council

Massachusetts at Amherst, University of

105

Pagina 1 Curriculum Vitae di Rosella Favino Aprile 2013 C U R R I C U L U M  

E-Print Network [OSTI]

guida ITIL 3.0 e ISO/IEC 20000:2005, CObIT, PMI/PMBoK, ISO/IEC 27001:2005) Progettazione e in ambito ICT (rif. ITIL 3.0 e ISO 20000). Dal - al 2000 ­ 2005 Nome e indirizzo del datore di lavoro CGweb

106

Ronald and Eileen Weiser Professional Development Awards Fellows from Slovakia Pursuing Research at the U-M  

E-Print Network [OSTI]

with the Substance Abuse Section, Department of Psychiatry, the Addiction Research Center, and Addiction Treatment. Peter Krcho (MD, Ph.D.) is the director of the Neonatal Intensive Care Unit in the Pediatric Faculty

Eustice, Ryan

107

s P O L I C Y F O R U M s 52 s DARWIN s GIUGNO  

E-Print Network [OSTI]

quantità di energia solare catturata dalla Terra. I cam- biamenti dell'equilibrio energetico del pianeta

Colorado at Boulder, University of

108

August 30, 2010 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

109

November 1, 2011 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

110

May 1, 2013 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

111

February 1, 2011 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

112

S U M M E R 2 0 1 4 19 F E A T U R E  

E-Print Network [OSTI]

, and by the 1920s, enough similar cases surfaced that the disease was coined "sickle cell anemia." However, are affected by sickle cell disease (SCD)--a set of recessive, inherited blood disorders. (People of Latin), a Pittsburgh native who's quick to laugh, has the SC type of sickle cell disease, meaning her father and mother

Sibille, Etienne

113

AUGUST 2002 705H A N S T R U M E T A L . 2002 American Meteorological Society  

E-Print Network [OSTI]

-Season Tornadoes of California and Southern Australia BARRY N. HANSTRUM Bureau of Meteorology, Perth, Western Australia and Western Australia combined (gray) for each month for the 10 yr, 198796. FIG. 2. Map showing Australia, Australia GRAHAM A. MILLS Bureau of Meteorology Research Centre, Melbourne, Victoria, Australia

Doswell III, Charles A.

114

1 AUGUST 2000 2049M O U M A N D N A S H 2000 American Meteorological Society  

E-Print Network [OSTI]

to enhance mixing by at least an order of magnitude (Lueck and Osborn 1985; Lueck and Mudge 1997; Toole et al. It is a rocky outcrop on a shelf that is predominantly silt and sand. Typically, an equatorward coastal jet

Kurapov, Alexander

115

1 October 18, 2012 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

and seepage of CO2 · Risk assessment of geologic carbon sequestration sites · Compressed air energy storage to present. Organizing Committee member, TOUGH Symposium, 2006, 2012. Faculty Affiliate, Energy Resources Liu) of the 2009 Philomathia Forum on Energy and Environment, Berkeley-Stanford-Beijing Workshop

Ajo-Franklin, Jonathan

116

WEST TEXAS HISTORICAL ASSOCIATION VO L U M E X X I, IS S U E 1  

E-Print Network [OSTI]

commercial oilfield was completed in 1921 in Mitchell County with the discovery well of the Westbrook field at a depth of 2,498 feet. Prospectors discovered the Yates oilfield on October 28, 1926, in southeastern

Rock, Chris

117

C U R R I C U L U M V I T A E Dr. Rebecca Jo Safran  

E-Print Network [OSTI]

on Science and Technology and Department of Ecology and Evolutionary Biology September 2005 ­ December 2007, and S. Correa. Egg-yolk androgen and carotenoid deposition as a function of maternal social environment, ornamentation and patterns of parental care in the North American barn swallow. Journal of Avian Biology 41

Safran, Rebecca

118

C U R R I C U L U M V I T A E Dr. Rebecca Jo Safran  

E-Print Network [OSTI]

on Science and Technology and Department of Ecology and Evolutionary Biology September 2005 ­ December 2007 care in the North American barn swallow. Journal of Avian Biology In revision 3. Safran, R.J., K.J. McGraw, K.M. Pilz, and S. Correa. Egg-yolk androgen and carotenoid deposition as a function of maternal

Safran, Rebecca

119

C U R R I C U L U M V I T A E Dr. Rebecca Jo Safran  

E-Print Network [OSTI]

on Science and Technology and Department of Ecology and Evolutionary Biology September 2005 ­ December 2007 Behavior. 2. Maguire, S.E. M. Hau, and R.J. Safran. Paternity, ornamentation and patterns of parental care deposition as a function of maternal social environment in barn swallows Hirundo rustica. Journal of Avian

Safran, Rebecca

120

Vehicle Operator Policy Outline the requirements for vehicle operators at the University of Michigan (U-M).  

E-Print Network [OSTI]

Vehicle Operator Policy Objective Outline the requirements for vehicle operators at the University be authorized by the using department and adhere to the vehicle use and licensing policies. 4. Operators must have a valid driver license with no more than 6 points on their motor vehicle record (MVR). A valid

Kirschner, Denise

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Summer 2012 H O O D M U S E U M O F A R T  

E-Print Network [OSTI]

Departments as well as students active in sustainability practices on campus. Two other exhibitions staff is deeply com- mitted to this teaching process, and we continue to explore new and creative means. A case in point is the summer exhibition Looking Back at Earth: Contemporary Environmental Photography

Lotko, William

122

State Of California The Resources Agency of California M e m o r a n d u m  

E-Print Network [OSTI]

2008 From: California Energy Commission -Melissa Jon 1516 Ninth Street &FEECD.JUL 1 0 2008 Sacramento, 2008, Orange Grove Energy, L.P., a subsidiary of J Power USA Development Company Ltd. submitted an Application for Certification (AFC) for the proposed Orange Grove Project located in rural north San Diego

123

State of California California Natural Resources Agency M e m o r a n d u m  

E-Print Network [OSTI]

27, 2011 From : Reneé Webster-Hawkins Assistant Chief Counsel California Energy Commission 1516 Ninth Street Sacramento CA 95814-5512 rwebster@energy.state.ca.us (916) 654-3873 Subject: Request to Open a new Complaint & Investigation Proceeding The Chief Counsel's Office is in receipt of a document entitled

124

M E M O R A N D U M To: DOE Office of General Counsel From: William T. Miller  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department of Energy Low-Temperature Combustion DemonstratorEastLynn Dahlberg, .E M O R

125

F R O M M E M O R A N D U M D A T E  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou$ EGcG ENERGY MEASUREMENTS;/:4,4 (; .369s . c F O R

126

S U B J E C T M E M O R A N D U M D K  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou$0.C. 20545 OCT 28 1%AU62 &REFHRYO 4q.w)s . l

127

www.extension.ucr.edu S U M M E R A C A D E M Y  

E-Print Network [OSTI]

will leave with the practical, marketable skills sought after in today's competitive market. Opportunities. You'll be part of a creative, dynamic and high- energy group driven to succeed. And the salary you visual impact. HOW TO EARN THIS PROFESSIONAL ACHIEVEMENT AWARD: Complete10unitsofrequiredcourses

128

International V o l u m e 6 S p r i n g 2 0 0 5  

E-Print Network [OSTI]

Ambassadorial Posts LATIN AMERICA 38 MSU Joins 50th Anniversary Celebration of Brazilian Business School 39 Food Safety Training for Latin America Stepped Up AFRICA 40 NIH Grant Funds MSU Partnership with University MSU Renews Agreement with Chinese Academy of Agricultural Sciences ASIAN TSUNAMI 10 MSU Campus

129

NEW SOURCE PERFORMANCE STANDARDS -NOVEMBER15,1982 ------m m m u m ~ U U -k d -  

E-Print Network [OSTI]

and Steel Plants (N) 14. Sewage Treatment Plants (0) 15. Primary Copper Smelters (PI 16. Primary Zinc 11. Secondary Lead Smelters (L) 12. Secondary Brass and Bronze In ot Production Plants (Ms 13. Iron Smelters (Q) Affected facility a. Fluid catalytic cracking unit catalyst torsneratorsregenerators c. Fuel

130

T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 1 | N U M B E R 4 | A P R I L 7 , 2 0 0 5 UBC REPORTS  

E-Print Network [OSTI]

-- solar hot water tubes and natural ventilation systems, for example -- other equally costly equipment long-term energy costs," says Robinson. As a showcase of its own innovative features, such as remote sustainability researchers, businesses and pol- icy makers will practice -- and reap the benefits of -- what

Farrell, Anthony P.

131

UBC REPORTS T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 3 | N U M B E R 7 | J U L Y 5 , 2 0 0 7  

E-Print Network [OSTI]

-FLYING HONKERS 4 GMOs 5 DAMAGED GOODS PHOTO:MARTINDEE Lindsay Eltis, seen with image of a TB enzyme, wants). Lindsay Eltis, a microbiologist and biochemist, spent the first part of his career in soil bacteria the degraded cholesterol for fuel to survive. In most infections, the macrophage is the enemy. In TB it

Farrell, Anthony P.

132

T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 1 | N U M B E R 1 | J A N U A RY 1 0 , 2 0 0 5 UBC REPORTS  

E-Print Network [OSTI]

U A RY 1 0 , 2 0 0 5 UBC REPORTS 2 UBC in the News 3 Life-Saving Hospital Bed 5 Environmental Mine capsules directly to cancer tumours and diabetic ulcers holds enormous potential, says researcher. BY HIL there is insufficient leptin and the stimulus to eat more and con- serve energy gets activated. Kieffer believes

Farrell, Anthony P.

133

T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 4 9 | N U M B E R 3 | M A R C H 6 , 2 0 0 3 UBC REPORTS  

E-Print Network [OSTI]

ecosystem. Scientist Predicts Ocean Fisheries Disaster Daniel Pauly says we are destroying world fish stocks over troubled waters, says UBC Fisheries Centre Prof. Daniel Pauly, a vocal and influential critic these resources for no reason," he says. "This systematic overfishing will soon leave nothing in the ocean

Farrell, Anthony P.

134

T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 1 | N U M B E R 1 0 | O C T O B E R 6 , 2 0 0 5 UBC REPORTS  

E-Print Network [OSTI]

is a UBC website and innovative teaching tool created by Griffin and Jo McFetridge, who graduated with a MA 2003, Griffin, McFetridge and Buys were all working as sum- mer staff at the Faculty of Arts IT help desk. They hatched the idea of using 3-D gaming technology to animate long-ago worlds. For example

Farrell, Anthony P.

135

T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 2 | N U M B E R 4 | A P R I L 6 , 2 0 0 6 UBC REPORTS  

E-Print Network [OSTI]

source can be derived from pig manure. This versatile device is a hydrogen fuel cell, powered by the most-ordinated, large- scale demon- stration program, created to accelerate the commercialization of hydrogen and fuel cell technologies. The National Research Council's (NRC) Institute for Fuel Cell Innovation at UBC

Farrell, Anthony P.

136

Clark Hall Suite 208 3400 N Charles Street Baltimore MD 21218 410 516 8006 CBID.bme.jhu.edu Johns Hopkins Biomedical Engineering Teaching Faculty Position  

E-Print Network [OSTI]

Hopkins Biomedical Engineering Teaching Faculty Position Johns Hopkins University's Department of Biomedical Engineering is seeking a creative and motivated individual for a teaching track faculty position-graduate programs. Candidates should have completed a Ph.D. in biomedical engineering or a related field, although

Adams, Mark

137

*eboctor@jhmi.edu; phone 1 443 287 2975; http://musiic.lcsr.jhu.edu Precisely Shaped Acoustic Ablation of Tumors Utilizing Steerable  

E-Print Network [OSTI]

Ablation of Tumors Utilizing Steerable Needle and 3D Ultrasound Image Guidance Emad M. Boctor1 , Philipp for this device, proposing an innovative method for accurate tracking and tool registration with spatially-registered intraopera- tive three-dimensional US volumes, without relying on an external tracking device. This method

Webster III, Robert James

138

E-Print Network 3.0 - ames prince andrew Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ILLINOIS* Andrew... @umd.edu MAINE Andrew Nolan anolan@umd.edu MARYLAND* Anne Arundel County and Baltimore City Ricardo Quinteros req Source: Milchberg, Howard - Institute for...

139

Acta Astronautica 66 (2010) 391 --400 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

author. Tel.: +1 301 405 4454. E-mail addresses: shane@ssl.umd.edu (S.E. Jacobs), dakin@ssl.umd.edu (D

Akin, David

2010-01-01T23:59:59.000Z

140

Beyond the Classroom Living and Learning Program UNIV399F: Experiential Learning Seminar  

E-Print Network [OSTI]

-314-6623; E-mail: jriker@umd.edu Web: www.BeyondTheClassroom.umd.edu Casey Willson, Retail Industry of Maryland. Phone: 301-403-8300 ext. 12; E-mail: lwillson@mdsbdc.umd.edu Web: www.mdsbdc.umd.edu Teaching

Milchberg, Howard

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

ISDRS 2009, December 9-11, 2009, College Park, MD, USA ISDRS 2009 http://www.ece.umd.edu/ISDRS2009  

E-Print Network [OSTI]

] ATLAS user's manual : Device simulation software. Santa Clara, CA: Silvaco International, 2007. 978

Kumar, M. Jagadesh

142

HCIL Technical Report No. 99-23; http://www.cs.umd.edu/hcil Submitted to Transactions on Computer Human Interaction  

E-Print Network [OSTI]

/Machine Systems-- human factors; H.5.2 [Information Interfaces and Presentation]: User Interfaces-- evaluation/methodology and educational strategies, thanks to the many years of schooling that we all had to endure (Druin & Solomon, 1996; Papert, 1972; Solomon, 1986). All of this adds up to a large amount of personal experience about young

Golbeck, Jennifer

143

Effective: Saturday, November 15 (MD Football vs Michigan State) For more information visit transportation.umd.edu or call (301) 314-2255  

E-Print Network [OSTI]

12:00AM midnight. 122 Green Suspended Service will be suspended until 12:00AM midnight. Nite Ride Lackawanna St Lackawanna St Laguna Rd Muskogee St Muskogee St Laguna Rd Edgewood Rd Niagara Rd Locust Hill Dr

Hill, Wendell T.

144

University of Maryland Systems & Computer Architecture Group technical report UMD-SCA-TR-2000-01. Multi-Chain Prefetching: Exploiting Natural  

E-Print Network [OSTI]

-01. Multi-Chain Prefetching: Exploiting Natural Memory Parallelism in Pointer-Chasing Codes Nicholas Kohout

Yeung, Donald

145

HCIL Technical Report No. 98-07 (May 1998); http://www.cs.umd.edu/hcil 1 An Application Framework for  

E-Print Network [OSTI]

for Creating Simulation-Based Learning Environments Anne Rose*, David Eckard**, and Gary W. Rubloff+ Human-based learning environments called SimPLE (Simulated Processes in a Learning Environment). Environments developed simple and build complexity [11][13][14], and simulations that support "learning by doing"[2

Golbeck, Jennifer

146

HCIL Technical Report No. 99-07 (May 1999); http://www.cs.umd.edu/hcil Jazz: An Extensible 2D+Zooming Graphics Toolkit in Java  

E-Print Network [OSTI]

of energy has gone into building tools that support 3D graphics. This is largely due to the complexity of 3D+Zooming Graphics Toolkit in Java Benjamin B. Bederson, Britt McAlister Human-Computer Interaction Lab, Institute that supports applications using zooming object-oriented 2D graphics. It is built entirely in Java using Java2D

Golbeck, Jennifer

147

U S C S U m m e r P r o g r a m S 2 0 1 1 Future Physicians  

E-Print Network [OSTI]

, physiology, the biology of disease, and ethics; issues of patient care; and the politics of health care," and career options in health care. earn 3 USC UnitS Learn more and apply online: summer.usc.edu/college a reform. Talk with practicing physicians about preparing for medical school, "life as a resident

Rohs, Remo

148

March 5, 2014 M E M O R A N D U M--Updated June 16, 2014 for Tabs 17 and 22  

E-Print Network [OSTI]

in an independent manner. 211 Westcott Building, 222 S. Copeland Avenue, P.O. Box 3061480, Tallahassee, FL 32306

McQuade, D. Tyler

149

C u r r i c u l u m v i t a e Last name and first name Hartmann, Ulrich  

E-Print Network [OSTI]

Processing as of January 1, 1979: Authorized Officer of BKW AG as of January 1, 1979: Authorized Officer Description of my activity at the BKW (1967­1981) - setting up and management of the technical/scientific data

Luchsinger, Christof

150

N U M B E R S 5 1 T O 1 0 0 Index for Numbers 5i-ioo  

E-Print Network [OSTI]

BY THE FRIENDS OF THE BANCROFT LIBRARY THE FRIENDS OF THE BANCROFT LIBRARY UNIVERSITY OF CALIFORNIA, BERKELEY:8 Adventures ofTom Sawyer, The (Twain) 65:7; 75:12 Affolter, P., 72:4 Afonso V, King ofPortugal, 88:3 African, The (Hewlett) 72:4 Agricola, Georgius, 95:9-10 Agriculture, California, 67:2; 94:1 -2,12 Aguirre, Juan Bautista

California at Berkeley, University of

151

A l u m n i C a m p u s U n I G E S c H E H E n Argentinien, Spanien, Hannover  

E-Print Network [OSTI]

studierte in Aachen/Jülich Kerntechnik, anschlie- ?end in Berlin theoretische Mechanik und pro- movierte

Vollmer, Heribert

152

M E M O R A N D U M TO: Professor Alexandra Klass; Adjunct Professor Sara Peterson; and, Steven Lott,  

E-Print Network [OSTI]

property in UMore Park, portions of which are contaminated and may require remediation. The sources and power (CHP), and roof-mounted solar hot water and photovoltaics (PV).1 This memorandum focuses its, and III, respectively. I. Minnesota Public Utility Law's Framing Role for Energy Producers This memorandum

Netoff, Theoden

153

M E M O R A N D U M TO: Faculty, Staff and Students in the College of Pharmacy and Nutrition  

E-Print Network [OSTI]

of policies, procedures and processes to assist members of the University community to managing HSE issues.usask.ca/ohc/LSC/WRS%20Nov%202004.pdf. · University's Health, Safety and Environment Management System (HSEMS) ­ is a set of College facilities, appropriate HSE training courses taken). We are also working to develop a culture

Saskatchewan, University of

154

C I R AV O L U M E 3 3 , S P R I N G 2 0 1 0 Cooperative Institute for Research  

E-Print Network [OSTI]

/Director, ESRL Al Powell, Director, NOAA/NESDIS/STAR Graeme Stephens, Director of CIRA and University/ESRL Sonia Kreidenweis-Dandy, Professor, Colorado State Department of Atmospheric Science Graeme Stephens Center Transitioned to NCDC Operations Stan Kidder and Tom Vonder Haar isCCP It was always planned

Collett Jr., Jeffrey L.

155

C o m m u n i t y A l u m n i C a m p u s Fotoaktion Erinnerungen gesucht!  

E-Print Network [OSTI]

Kernenergieverwertung in schiffbau und schiffahrt mbh« in geesthacht. die aufnahme zeigt ihn 1957 im Kreise seiner

Vollmer, Heribert

156

A S U M M A R Y R E P O R T Toward Zero Deaths is a cooperative program, building partnerships between community groups and  

E-Print Network [OSTI]

to share information and to identify new approaches to reducing the number of fatalities and life changing for sharing information on progress made since 2001, for sharing best practices in the areas of engineering, brothers Matthew, Jacob, and Justin Backstrom were killed when their car was hit by a drunk driver near

Minnesota, University of

157

Musum national d'Histoire naturelle A R B O R E T U M D E C H E V R E L O U P  

E-Print Network [OSTI]

un arboretum, il a souffert lors de la seconde guerre mondiale. Replanté dans les années 1960, il et martres. UnE EnCLAVE DE nATURE DAns LA PLAinE DE VERsAiLLEs Par sa richesse et sa diversité mitoyen du parc du château de Versailles dans sa partie sud. Il s'adosse au nord à la forêt de Marly et à

158

Volu m e lXXI I, N u m b e r 2, fall 2009 IN ThIs Issue  

E-Print Network [OSTI]

in the glow of the high-temperature furnace that simulates concentrated sunlight for the CO2 -to-solar into gasoline. And while we're at it, let's make this gizmo solar powered. It's a great daydream, and grad

159

V O L U M E 7 , I S S U E 2 F E B R U A R Y 2 0 1 3 HumanRESOURCES  

E-Print Network [OSTI]

services: · Home energy audit · Attic insulation · Heater inspection, service, repair or replacement is on Tuesday, March 5, 2013, 10:00 a.m.­2:00 p.m. in Frist Multipurpose Rooms B and C. Schools, camps · Weather stripping and caulking · Refrigerator evaluation · Energy conservation education Opportu

Bou-Zeid, Elie

160

A l u m n i C a m p u sE N E R G I E (89 Kilometer nordwestlich  

E-Print Network [OSTI]

Wind- parks sind etwa die Erweite- rung des Pilotprojektes alpha ventus, der Park Borkum West (45 und 15 Insti- Einleitung Ziel der Bundesregierung ist es, bis zum Jahr 2030 Offshore- Windparks mit- wicklung fiel im Herbst 2008 mit dem Bau des Umspann- werks für das Offshore-Test- feld alpha ventus

Vollmer, Heribert

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

APPLICATION PACKET h u m a n r e s o u r c e s e r v i c e s  

E-Print Network [OSTI]

& Workforce Planning at 828-262-7429. We sincerely hope you will return the following application materials,Associate HR Director for Organizational Development andWorkforce Planning, Human Resource Services, Foun- ders the Appalachian State University campus. Develop a leadership pipeline for succession planning

Rose, Annkatrin

162

Virtual Remote Center of Motion Control for Needle Placement Robots  

E-Print Network [OSTI]

mechanical design but also the need for calibration and registration of the robot to the medical imager priorVirtual Remote Center of Motion Control for Needle Placement Robots Emad M. Boctor, Robert J@jhu.edu, GaborF@jhu.edu http://cisstweb.cs.jhu.edu Abstract. Surgical robots, including those with remote center

Boyer, Edmond

163

C o l l e g e o f C h a r l e s t o nC o l l e g e o f C h a r l e s t o n S u m m e r 2 0 1 4S u m m e r 2 0 1 4  

E-Print Network [OSTI]

funded REU projects with undergraduates in Utah for two three-week research expeditions, and has been con. To Apply: Applications can either be downloaded from the CIE website, http://international be submitted to Gabriela Peschiera, Assistant Director, Center for International Education, peschierag

Kasman, Alex

164

University of Maryland component of the Center for Multiscale Plasma Dynamics: Final Technical Report  

SciTech Connect (OSTI)

The Center for Multiscale Plasma Dynamics (CMPD) was a five-year Fusion Science Center. The University of Maryland (UMD) and UCLA were the host universities. This final technical report describes the physics results from the UMD CMPD.

Dorland, William [University of Maryland

2014-11-18T23:59:59.000Z

165

Single-shot, space-and time-resolved measurement of rotational wavepacket revivals  

E-Print Network [OSTI]

and Technology,University of Maryland,College Park, MD 20742 yhchen@umd.edu, milch@ipst.umd.edu Abstract, oxygen, and nitrous oxide. Unlike previous optical techniques for probing molecular alignment in gases

Milchberg, Howard

166

T e c h n i c a l M e m o r a n d u m \\\\owl\\masterplan\\2\\6 Master Plan\\Land and Building Use.doc  

E-Print Network [OSTI]

Baltimore, MD 21202 410/347-8500 Fax 410/347-8519 Architecture and Engineering Heery International 999 Engineering LRE Engineering 1475 Peachtree Street, Suite 220 Atlanta, GA 30309 404/888-8800 Fax 404 and services. In the course of the Plan development, five issues pertaining to land use have clearly

Arnold, Jonathan

167

P H Y S I K A L I S C H E S K O L L O Q U I U M E I N LA D U N G  

E-Print Network [OSTI]

system are determined. Amongst such characteristics are the optimal mix of wind and solar power and Dept. of Mathematics Aarhus University, Dänemark über Thinking backwards: a 100% renewable power system in Europe, and transitional pathways towards it (combined challenges for theoretical system engineering

Oldenburg, Carl von Ossietzky Universität

168

P H Y S I K A L I S C H E S K O L L O Q U I U M E I N L A D U N G  

E-Print Network [OSTI]

modelling, flow around buildings, and wind energy. Another frequently used method is to use LES generated, if the main energy containing eddies are well resolved by the grid, the turbulent transport by the SGS eddies of neutral and stable stratified flows, where the typical eddy size is much smaller than for pure

Oldenburg, Carl von Ossietzky Universität

169

P H Y S I K A L I S C H E S K O L L O Q U I U M E I N LA D U N G  

E-Print Network [OSTI]

-crystalline Si thin film solar cells bare the potential to overcome limits of the Si thin-film solar cell based thin film solar cells towards large scale application. Einladender: Prof. Dr. Carsten Agert #12;- and nanostructures for silicon based thin-film photovoltaics" Thin-film silicon based technologies bare the potential

Peinke, Joachim

170

1 | D O C U M E N T S U P P L Y S E R V I C E S --U S E R G U I D E Document Supply Services  

E-Print Network [OSTI]

read the login help on the main DSS webpage. 2. Enter a word, phrase, ISBN/ISSN in the Search Term ...................................................................................................................................................2 Requesting an item--search and request--menu ............................................................................................................................................12 Search

171

A l u m n i C a m p u s N E U E M A T E R I A L I E N Ionen und Autos  

E-Print Network [OSTI]

- fähiger Energiespeicher. WAS DIE MOBILIT?T VON ELEKTROAUTOS MIT DER MOBILIT?T VON LITHIUM wieder ein- schränkt. Selbstverständlich muss der Energiespeicher auch sicher sein. Gut ein Jahr ist nun- zellen hatten dazu geführt, dass in mehreren Flugzeugen der Energiespeicher in Flam- men aufging. Ein

Vollmer, Heribert

172

P H Y S I K A L I S C H E S K O L L O Q U I U M E I N LA D U N G  

E-Print Network [OSTI]

of optoelectronic devices. Consequently, this method has been used for various analy- ses of the spatial emission information about the waveguide properties in op- erating optoelectronic devices. The conceptual idea

Oldenburg, Carl von Ossietzky Universität

173

*Correspondence to: M. Cristofol, U.M.R. 6632, Centre de MatheH matiques et d'Informatique de l'Univer-siteH de Provence, 39, rue F. Joliot-Curie, 13453 Marseille Cedex 13, France  

E-Print Network [OSTI]

of x , belonging to ¸(1), satisfying 0( \\ " inf VZ \\AA ess( (x ))) > " sup VZ \\AA ess( (x ))(#R 0( \\ " inf VZ \\AA ess( (x ))) > " sup VZ \\AA ess( (x ))(#R 0( \\ " inf VZ \\AA ess( (x ))) > " sup VZ \\AA ess( (x ))(#R In the domain K we have ( , , )"( (x), (x), (x)) where

Christofol, Michel

174

e n g e n i o u s s p r i n g 2 0 0 2 a l u m n i p r o f i l e  

E-Print Network [OSTI]

, Supersonic Wave Drag of Thin Airfoils, an important exami- nation in radical aerodynamics, he went on to collect numerous awards, including the National Medal of Technology for the construction of the first

175

O P E N I N G T H E VA U LT S : M U M M I E S From deep within The Field Museum's vaults comes the mysterious world of mummies.  

E-Print Network [OSTI]

individuals into the afterlife · Stone mummy masks and false tomb doors from Egypt · 3D printed casts

Makovicky, Peter

176

12 S U M M E R 2 0 0 5 w w w . i m a g i n g n o t e s . c o m THE BAD NEWS IN ELECTRICAL ENERGY  

E-Print Network [OSTI]

of establishing 1,000 megawatts of con- centrating solar power (CSP) to supply electricity to the southwestern States by 2015. Mining for Solar Resources CSP technologies concentrate sunlight to provide heat to conventional power cy- clessuchassteam-Rankineturbines,which are typical of coal-fired power plants

Perez, Richard R.

177

-~--~-----------------------l P!"-,/I/(/ Physics Report". V,II, 22. ,\\',', 10. 1996./ip ,'~,-H77, Truns/dteJ]'rnm Fi;:,ika P/u;:,m,\\: V"I. 22. Nil. 10. 1996. {lP, 960-970,  

E-Print Network [OSTI]

infinitesimal space-time trans- lations; space rotations; and Galilean boosts', elements of the ten and second theorems in the next section, we find the symmetry of an infinite continuous group for an ideal compressible fluid Lagrangian in Section 3 and for MHD in Section 5. These symmetries give rise to Ertel

Morrison, Philip J.,

178

T e c h n i c a l M e m o r a n d u m \\\\owl\\masterplan\\1\\5 Prelim MP\\Alternative Concepts.doc  

E-Print Network [OSTI]

, the desired objectives for the designs remained constant. Each scheme was based on the interconnectivity

Arnold, Jonathan

179

M a r i t i m e M u s e u m o f S a n D i e g o Bruce M. Howe, Ph.D.  

E-Print Network [OSTI]

and Chair of the Department of Ocean and Resources Engineering at the University of Hawaii at Manoa. Howe. Duennebier, Ph.D. Rhett Butler, Ph.D. Roger B. Lukas, Ph.D. School of Ocean and Earth Science andTechnology University of Hawaii at Manoa Bruce Howe received the B.S. in Mechanical Engineering and M.S. in Engineering

Frandsen, Jannette B.

180

T e c h n i c a l M e m o r a n d u m F:\\2\\Appendix\\appendix table of contents.doc  

E-Print Network [OSTI]

/876-7797 Academic Programming Paulien & Associates 899 Logan Street, Suite 508 Denver, CO 80203-3156 303 University of Georgia The appendix includes documents or articles of interest corresponding to elements of Veterinary Medicine a. Request for consideration of a Major Academic Capital Project b. "White Paper

Arnold, Jonathan

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

S u m m e r 2 0 0 8 V o l . 1 0 N o . 3 Because the digital media landscape is expanding and evolving rapidly, so, too, must the approach and focus  

E-Print Network [OSTI]

has introduced its newest college to replace the former School of Computer Science, Telecommunications information technology majors, such as computer science, security, information systems, networking and software engineering; and the School of Cinema and Interactive Media (CIM), which features digital arts

Schaefer, Marcus

182

T e c h n i c a l M e m o r a n d u m F:\\1\\2 Goals\\Institutional Mission & Strategic Plan (2A).doc  

E-Print Network [OSTI]

Baltimore, MD 21202 410/347-8500 Fax 410/347-8519 Architecture and Engineering Heery International 999 Engineering LRE Engineering 1475 Peachtree Street, Suite 220 Atlanta, GA 30309 404/888-8800 Fax 404, and public service, the university is actively involved in the economic, social, and cultural development

Arnold, Jonathan

183

DEPARTMENT OF CHEMICAL & BIOLOGICAL ENGINEERING T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A  

E-Print Network [OSTI]

REPORT iii Executive Summary The main goal of this project is to design a mobile biodiesel production that the biodiesel production plant must be sized to fit into a standard truck-trailer with dimensions 8 feet wide M B I A The Design of a Portable Biodiesel Plant CHBE 452/453/454 Submitted to: Dr. Jim Lim Date

184

T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A Linking North America with  

E-Print Network [OSTI]

and HSBC Chair in Asian Research and Dr. Alison Bailey, China Links director, with support from faculty

Handy, Todd C.

185

Chesapeake Bay Baltimore Beltway  

E-Print Network [OSTI]

International Airport www.bwiairport.com Maryland Transit Administration www.mtamaryland.com Baltimore Fun Guide Marsh BWI / Marshall Airport I-895 JHU Homewood Campus JHU East Baltimore Campus Ellicott City to Philadelphia 2 hours Baltimore to New York City 3.5 hours J Boston· New York City· Philadelphia· Washington, D

Niebur, Ernst

186

E-Print Network 3.0 - ann butler zimrin Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Somerset, Talbot... , and Philadelphia Counties Derrick Davis ddavis74@umd.edu Allegheny, Armstrong, Beaver, Butler, Fayette, ... Source: Milchberg, Howard - Institute for Physical...

187

Reduction and Reoxidation of Soils During & After Uranium Bioremediation; Implications for Long-Term Uraninite Stability & Bioremediation Scheme Implementation  

SciTech Connect (OSTI)

This research focuses on the conditions and rates under which uranium will be remobilized after it has been precipitated biologically, and what alterations can be implemented to increase its long-term stability in groundwater after the injection of an electron donor has been discontinued. Furthermore, this research addresses short-term iron reoxidation as a mechanism to enhance/extend uranium bioremediation under iron reduction, without its remobilization. The research to date has focused on long term column experiments involving the biological removal of uranium from groundwater under iron and sulfate reducing conditions. Aquifer sediment was collected from the background area of the Old Rifle UMTRA site and dried and sieved (<2 mm) before being packed into four 15 cm long x 5 cm diameter glass columns. The initial porosity of each column ranged from 0.33 to 0.40. Prior to biostimulation of the columns, 30 mM bicarbonate (purged with CO2/N2 gas, 20:80 ratio) was pumped through the columns to flush out the natural uranium present in the sediment. After the natural uranium was flushed out of the system, 20 uM of uranyl acetate was added to the 30 mM bicarbonate influent media. The column was operated for 11 days to ensure that the effluent U(VI) concentration was equal to the influent U(VI) concentration (no removal of U(VI) occurred before biostimulation). The start of the biostimulation experiment was facilitated by the addition of one pore volume of a growth culture containing the Fe(III) and U(VI) reducing microorganism, Geobacter metallireducens. Flow to the columns was suspended for 24 hours, after which pumping was resumed with acetate (2.8-3.0 mM), as well as trace vitamins and minerals, supplied to the feed media. The columns were operated at 22 +/- 1 degrees C, upright and under up-flow conditions at a rate of 0.2 ml/min (equivalent to a linear groundwater travel time of approximately 135 m/yr). Water samples from column inlets and outlets were collected and analyzed for acetate, U(VI), Fe(II), Br-, NO3- and SO42-. Iron reduction and U(VI) removal was detected in all four columns after three days of column operation with acetate in the inflow. The Fe(II) concentration at the effluent of the columns increased at a rate of 16.6 (+/-1.9) uM/d until leveling off after 10 days of column operation. The pseudo steady-state Fe(II) concentration at the effluent for each column ranged 130 uM to 170 uM. Uranium removal reached steady-state conditions after approximately 23 days of column operation with removal of between 58% to 77% of the initial 20 uM U(VI) added at the influent of the column.

Jaffe, Peter R.

2005-06-01T23:59:59.000Z

188

*DEEP team: S.Faber,G.Illingworth,D.C.Koo,R.Guhathakurta,K.Denda,K.Gebhardt,A.C.Phillips,L.Simard,C.Willmer,M.Im(UCSC) and partners in UC Berkeley, U.Chicago, JHU, and Caltech evolution for E/S0s at z < 1, contrary to the theoretical models and some obser  

E-Print Network [OSTI]

. For more information on DEEP, check our web site at http://www.ucolick.org/~deep/home.html 4. Conclusion*DEEP team: S.Faber,G.Illingworth,D.C.Koo,R.Guhathakurta,K.Denda,K.Gebhardt,A for a reduced set of DEEP data in the Groth strip. models based on CDM dominated universe predict that 50

189

CMSC 311101 (Fall 1995) Professor: TA  

E-Print Network [OSTI]

CMSC 311­101 (Fall 1995) Professor: TA: Dr. Jeff Hollingsworth Shekhar Patankar 4161 AV Williams 1109 A V Williams (40) 5­2708 hollings@cs.umd.edu shekhar@cs.umd.edu Office Hours: Tu 1:00­2:30 W 10

Hollingsworth, Jeffrey K.

190

CMSC 714 (Fall 2010) Dr. Jeff Hollingsworth  

E-Print Network [OSTI]

CMSC 714 (Fall 2010) Professor: Dr. Jeff Hollingsworth 4155 AV Williams (40) 5-2708 hollings@cs.umd.edu Office Hours: Tu/Th 11:00-12:00 TA: Derek Monner 1112 AV Williams dmonner@cs.umd.edu Office Hours: TBA

Hollingsworth, Jeffrey K.

191

Green Dining Internship Opportunities: Fall 2013 Are you passionate about composting? Waste reduction? Local and sustainable food?  

E-Print Network [OSTI]

Green Dining Internship Opportunities: Fall 2013 Are you passionate about composting? Waste UMD students? Then, we are looking for you! UMD Dining Services Green Dining is seeking two interns to assist with the Green Dining Program. Learn more about Green Dining here: http

Hill, Wendell T.

192

IEEE TRANSACTIONS ON INFORMATION FORENSICS AND SECURITY, VOL. 7, NO. 4, AUGUST 2012 1315 Temporal Forensics and Anti-Forensics for Motion  

E-Print Network [OSTI]

-mail: mcstamm@umd.edu; kjrliu@umd.edu). W. S. Lin is with the Intel Corporation, Hillsboro, OR 97124 USA (e, Member, IEEE, and K. J. Ray Liu, Fellow, IEEE Abstract--Due to the ease with which digital information of this manuscript and approving it for publication was Dr. Alex ChiChung Kot. M. C. Stamm and K. J. R. Liu

Liu, K. J. Ray

193

Mobile Collaboration: Collaboratively Reading and Creating Children's Stories on Mobile Devices  

E-Print Network [OSTI]

Mobile Collaboration: Collaboratively Reading and Creating Children's Stories on Mobile Devices 20742 allisond@umiacs.umd.edu, mona@cs.umd.edu ABSTRACT This paper discusses design iterations of Mobile Stories ­ a mobile technology that empowers children to collaboratively read and create stories. We

Golbeck, Jennifer

194

Statistical Characterization of Complex Enclosures with Distributed Ports  

E-Print Network [OSTI]

Statistical Characterization of Complex Enclosures with Distributed Ports Thomas M. Antonsen Jr. #1 anlage@umd.edu 4 edott@umd.edu Abstract--A statistical model, the Random Coupling Model, that describes of the effectiveness of shielding in the presence of apertures. I. INTRODUCTION A statistical approach is often taken

Anlage, Steven

195

Convergence Guarantees for a Decentralized Algorithm Achieving Pareto Optimality  

E-Print Network [OSTI]

Park, MD 20742, USA amenon@umd.edu, baras@umd.edu interactions between different wind turbines. By scheduling a certain noise parameter to go to zero along iterations of this algorithm, conditions, consider the problem of maximizing the total power production of a wind farm [8]. Aerodynamic Research

Baras, John S.

196

Information-Theoretic Analysis of an Energy Harvesting Communication System  

E-Print Network [OSTI]

Information-Theoretic Analysis of an Energy Harvesting Communication System Omur Ozel Sennur Ulukus@umd.edu ulukus@umd.edu Abstract--In energy harvesting communication systems, an exogenous recharge process supplies energy for the data trans- mission and arriving energy can be buffered in a battery before

Ulukus, Sennur

197

Where Eagles FlyTM CHARLES COUNTY  

E-Print Network [OSTI]

with the development of new energetic systems, CECD's expansion calls for the creation of other areas of excellenceWhere Eagles FlyTM CHARLES COUNTY MARYLAND CENTER FOR ENERGETIC CONCEPTS DEVELOPMENT Dr. D. K Phone 301.405.5294 Fax 301.314.9477 dkanand@umd.edu Website: www.cecd.umd.edu ENERGETICS TECHNOLOGY

Maryland at College Park, University of

198

Energy State Amplification in an Energy Harvesting Communication System  

E-Print Network [OSTI]

Energy State Amplification in an Energy Harvesting Communication System Omur Ozel Sennur Ulukus@umd.edu ulukus@umd.edu Abstract--In energy harvesting communication systems, the energy required for message transmission is maintained by an exogenous energy arrival process independent of the message. This links

Ulukus, Sennur

199

Spring 2006 CS 649 1 Sensor Networks  

E-Print Network [OSTI]

Terzis http://hinrg.cs.jhu.edu/wsn06/ #12;Outline Spring 2006 CS 649 2 (Simple) Radio Power loss models Reality (More) Radio Power loss models #12;Motivation Spring 2006 CS 649 3 Communication between nodes

Amir, Yair

200

The Econometrics of Data Combination Geert Ridder  

E-Print Network [OSTI]

The Econometrics of Data Combination Geert Ridder Department of Economics, University of Southern University,Baltimore E-mail: moffitt@jhu.edu Chapter for the Handbook of Econometrics April 1, 2005 We thank

Weaver, Harold A. "Hal"

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Johns Hopkins University, 2013 All rights reserved.  

E-Print Network [OSTI]

-Campus Housing Office: http://www.jhu.edu/hds/offcampus/ If eligible (US Citizens), complete Number) : http://www.ssa.gov/ssnumber/. Consider registering with their national, utilities (BGE (electric and gas), internet, etc. International postdoctoral fellows

Ghosh, Somnath

202

National Aeronautics and Space Administration thVIIaeMpacS  

E-Print Network [OSTI]

581g Artwork (Lynette Cook/NASA); 38) Dreath Star (NASA/G. Bacon); 43) Transiting planets (NASA/Tim Pyle); 45) Habitable Zones (NASA/Kepler); 61) Solar Probe (JHU/APL); 73) Bacterium (NASA/Jodi Blum); 81

203

Uncoupling at the GABA(A) receptor with chronic ethanol in the rat medial septum/diagonal band (MS/DB)  

E-Print Network [OSTI]

an uncoupling of the potentiation seen with rnidazolam (0. I and 1. 0 liM), loreclezole (10 [uM), or allopregnanolone (0. I uM) to 3 uM GABA. However, the higher concentration of allopregnanolone (1.0 [uM) did show potentiation of the 3 uM GABA response...

Wallace, Kathleen Allison

2012-06-07T23:59:59.000Z

204

a l u m n e m a g a s i n u d g i v e t a f a a r h u s u n i v e r s i t e t n r . 3 d e c e m b e r 2 0 1 0  

E-Print Network [OSTI]

r 2 0 1 0 Et nødvEndigt ondE? tema om krig nobelpris til au-forsker på sporet af tycho brahe nye uge blev et dansk-tjekkisk forskerteam meget klogere på, hvordan den danske astronom Tycho Brahe Copydan-aftaler tycho nobel forsidefoto: joe rosenthal Læs mere om billedet på side 24. indholdnr. 3

205

I N D I V I D U A L T A X P A Y E R I D E N T I F I C A T I O N N U M B E R U N D E R S T A N D I N G YO U R  

E-Print Network [OSTI]

-476-9413 Tokyo, Japan 81-3-3224-5466 #12;delayed until they obtain the identification number. If a dependent SSN for IRS Individual Taxpayer Identification Number. You may complete and sign a Form W-7 for a minor authorized by the IRS. How Can I get a Form W-7? - Call 1-800-TAX-FORM (continental U.S. only). Bulk

Wechsler, Risa H.

206

F R E M O N T I A 1V O L U M E 3 7 : 4 / 3 8 : 1 , O C T O B E R 2 0 0 9 / J A N U A R Y 2 0 1 0 THE COVER: An image from each of our nine featured public gardens of California native plants conveys the beauty and  

E-Print Network [OSTI]

in Kings Canyon. Could it still be found there? MARTHA WALKER CALIFORNIA NATIVE HABITAT GARDEN: CELEBRATING CONTENTS THE COVER: An image from each of our nine featured public gardens of California native plants is the alkaline rain pool, home to some of our rarest Atriplex species. THE ART AND SCIENCE OF CALIFORNIA NATIVE

Parker, V. Thomas

207

T h e P e n n S T a T e S T r a T e g i c P l a n 2 0 0 9 1 0 t h r o u g h 2 0 1 3 1 4 e x e c u T i v e S u m m a r y Priorities for Excellence  

E-Print Network [OSTI]

Farmers' high School, has grown into a large and tremendously diverse university. It is today among many constitu- ents--while becoming more efficient and effective. Despite obvious challenges pursuit of excel- lence. Penn State is a very efficient institution that has accomplished great things

Lee, Dongwon

208

13S C I D A C R E V I E W S U M M E R 2 0 0 9 W W W . S C I D A C R E V I E W . O R G LASER P LASM A PART ICLE ACCELERATORS  

E-Print Network [OSTI]

A PART ICLE ACCELERATORS Compared to conventional particle accelerators, plasmas can sustain accelerating simulations provide physical insight into the development of next-generation accelerators that use laser-driven plasma waves. These plasma- based accelerators offer a path to more compact, ultra-fast particle

Knowles, David William

209

F A C U L T Y O F N E W S L E T T E R I M C G I L L U N I V E R S I T Y I 2 0 0 4 -2 0 0 5 I V O L U M E 8 4 , N O . 1  

E-Print Network [OSTI]

on the university's main campus. The event was held to honor the 100 year legacy of dentistry at McGill, bringing Swan Dr. Bruce Ward, Mrs. Karin Ward, Dr. Scott Stewart Dr. Bruce Ward, Mrs. Karin Ward, Dr. Scott-r) Dr. George Harasymowycz, Dean Lund, Mr. Alan Edwards (l-r) Dr. Norman Miller, Dr. Bruce Kennedy Dr

Barthelat, Francois

210

U N I V E R S I T Y O F T O R O N T O A P P L I E D S C I E N C E & E N G I N E E R I N G V O L U M E 8  

E-Print Network [OSTI]

a Nano-tech Revolution 18 Leading the Drive to Green Products 19 Alumni Build a Hydrogen Powerhouse Cool

211

Montana State University, Bozeman, Montana 59717-2580 C U M U L AT I V E G R A D E P O I N T AV E R A G E C A L C U L AT I O N  

E-Print Network [OSTI]

: _______________________________________________________________________________________ G PA C A L C U L AT I O N To calculate your cumulative GPA, divide the total number of quality points by the total number of quality hours. (Quality Points ÷ Quality Hours = GPA). This calculation number of quarter credits and total number of quarter quality points by 1.5 each. If changing semester

Maxwell, Bruce D.

212

HKR CONNECTIONS C H O O L O F H U M A N K I N E T I C S A N D R E C R E A T I O N N E W S L E T T E RFA L L I S S U E 2 0 1 2 To qualify as a firefighter,  

E-Print Network [OSTI]

floor versus a concrete floor." The protocol AHS decided to follow is the Canadian Forces Fire Marshal to a national award for PE alumnae Debbie Shortall (BPE, B.Ed.) knew at an early age she wanted to be a physical

Oyet, Alwell

213

S M I T H S O N I A N C O N T R I B U T I O N S T O Z O O L O G Y N U M B E R 5 9 2 Shore Flies of the Belizean Cays  

E-Print Network [OSTI]

cynocephala Kertesz 12 Tribe GASTROPINI Cresson 15 Genus Gastrops Williston 15 4. Gastrops niger Williston 15. Ptilomyia parva (Williston) 20 9. Ptilomyia mabelae (Cresson) 20 Tribe HECAMEDINI Mathis 20 Genus (Pseudohecamede) adustum Mathis 20 11. Allotrichoma {Pseudohecamede) abdominale (Williston) 21 Genus Diphuia

Mathis, Wayne N.

214

2 0 1 3 | P E N N S T A T E N U R S I N G P A G E 2 0 1 3 A M A G A Z I N E F O R A L U M N I & F R I E N D S  

E-Print Network [OSTI]

for cutting-edge practice in a reformed health care delivery system. Through innovative research translated the highly complex care environment our providers are entering and the importance of the health care team to meet the changing demands of the health care delivery system and the many patients who rely on expert

218

T H E M A G A Z I N E O F T H E U N I V E R S I T Y O F M I N N E S O T A A L U M N I A S S O C I A T I O N JANUARY FEBRUARY 2005 $2.95  

E-Print Network [OSTI]

Human Nature Meets Mother Nature Power People Professor Massoud Amin knows the human side of electricity they cracked under the searing sun. Then electricity reached these small villages. With new wells, pumps children received a better education. A tractor parts factory and other businesses came to the area

Amin, S. Massoud

219

U n i v e r s i t y o f P i t t s b u r g h R u s s i a n S u m m e r L a n g u a g e I n s t i t u t e  

E-Print Network [OSTI]

Hall Galleria 1:00-2:15 Classes 2:30 Lecture: Jonathan Harris "The First Steps of the Putin Presidency

Sibille, Etienne

220

www.ucis.pitt.edu/ursymposium/ U n i v e r s i t y o f P i t t s b u r g h R u s s i a n S u m m e r L a n g u a g e I n s t i t u t e  

E-Print Network [OSTI]

President Putin" Everyone (required) 1700 Posvar Hall 3:30 BCS Film What is a Man Without a Moustache (2005

Sibille, Etienne

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

U n i v e r s i t y o f P i t t s b u r g h R u s s i a n S u m m e r L a n g u a g e I n s t i t u t e  

E-Print Network [OSTI]

:30 Lecture: Dr. Jonathan Harris, "Putin's Perceptions of Threat and Opportunity" Everyone (required) 1700

Jiang, Huiqiang

222

CMSC 412101 (Spring 1996) Professor: TA: TA  

E-Print Network [OSTI]

CMSC 412­101 (Spring 1996) Professor: TA: TA: Dr. Jeff Hollingsworth Charles Lin Alex Kaplunovich 4161 AV Williams 1109 A V Williams 1109 A V Williams (40) 5­2708 hollings@cs.umd.edu clin

Hollingsworth, Jeffrey K.

223

CMSC 412 (Spring 2002) Professor: TA: TA  

E-Print Network [OSTI]

CMSC 412 (Spring 2002) Professor: TA: TA: Dr. Jeff Hollingsworth Abdel-Hameed Badawy Cemal Yilmaz 4161 AV Williams 1151 A V Williams 1151 A V Williams (40) 5-2708 hollings@cs.umd.edu absalam

Hollingsworth, Jeffrey K.

224

Wind Resource Assessment in Europe Using Emergy  

E-Print Network [OSTI]

umd-5707.pdf Wind power, 2013. http://www.thewindpower.net/sustainability evaluation of a wind power generation system,sustainability of wind power: An emergy analysis of Chinese

Paudel, Subodh; Santarelli, Massimo; Martin, Viktoria; Lacarriere, Bruno; Le Corre, Olivier

2014-01-01T23:59:59.000Z

225

High-end-Computer System Performance: Science and Engineering - Final Report  

SciTech Connect (OSTI)

This report summarizes the research conducted as part of the UMD effort of the multi-site PERC project. This project developed and enhanced the Dyninst instrumentation system and the Active Harmony auto-tuning framework.

Hollingsworth, Jeffrey K.

2012-01-27T23:59:59.000Z

226

Physics 122 Fundamentals of Physics II Syllabus for Fall 2012  

E-Print Network [OSTI]

Physics 122 ­ Fundamentals of Physics II Syllabus for Fall 2012 Course description The second)-405-4993 Office hours : TBD Website http://elms.umd.edu The syllabus and schedule can be also found at: http

Lathrop, Daniel P.

227

Appears in Proceedings of the 10th Annual International Conference on Parallel Architectures and Compilation Techniques, Barcelona, Spain, September 2001.  

E-Print Network [OSTI]

of Inter-Chain Memory Parallelism for Pointer-Chasing Codes Nicholas Kohout Seungryul Choi Dongkeun Kim, College Park Univ. of Maryland, College Park nicholas.j.kohout@intel.com choi@cs.umd.edu fdongkeun

Yeung, Donald

228

Graph Summarization with Bounded Error Saket Navlakha  

E-Print Network [OSTI]

of Maryland College Park, MD, USA-20742 saket@cs.umd.edu Rajeev Rastogi Yahoo! Labs Bangalore, India rrastogi@yahoo-inc Graphs are a fundamental abstraction that have been em- ployed for centuries to model real-world systems

Gruner, Daniel S.

229

Spring 2012 Who's Who and What's What  

E-Print Network [OSTI]

of the guide is frequently updated as new information is provided. We welcome updates to listed information and and Development (rmalone@umd.edu, x52509) with updates. #12;TABLE OF CONTENTS Academic Administrators Contact..............................................................................................4 Education

Li, Teng

230

Who's Who and What's What Where do I get information about...?  

E-Print Network [OSTI]

of the guide is frequently updated as new information is provided. We welcome updates to listed information and and Development (rmalone@umd.edu, x52509) with updates. #12;TABLE OF CONTENTS Academic Administrators Contact ...............................................................................4 Education

Milchberg, Howard

231

Scheduling for Quality of Service based Service Di erentiation Saswati Sarkar 1 and Leandros Tassiulas 2  

E-Print Network [OSTI]

Scheduling for Quality of Service based Service Di#11;erentiation Saswati Sarkar 1 and Leandros, College Park, leandros@isr.umd.edu #3; Address all correspondence to Saswati Sarkar We consider a utility

Sarkar, Saswati

232

Performance Characteristics of MAUI: An Intelligent Memory System Architecture  

E-Print Network [OSTI]

Park, Maryland silio@Glue.umd.edu Bruce Jacob University of Maryland Department of Electrical or commercial advantage and that copies bear this notice and the full citation on the first page. To copy

Jacob, Bruce

233

Let There Be Light! The Future of Memory Systems is Photonics and 3D Stacking  

E-Print Network [OSTI]

National Lab {phhargrove,jshalf}@lbl.gov Bruce Jacob University of Maryland bji@umd.edu K. Scott Hemmert are not made or distributed for profit or commercial advantage and that copies bear this notice and the full

Bergman, Keren

234

A l u m n i N e w s l e t t e r I n d i a n a U n i v e r s i t y D e p a r t m e n t o f S l a v i c L a n g u a g e s a n d L i t e r a t u r e s  

E-Print Network [OSTI]

of the Slavic languages and Romanian and Hungarian. Cooper published two books this year: Slavic Scriptures

Indiana University

235

inside Stanford medicineV o l u m e 6 , N o . 8 A p r i l 2 1, 2 0 1 4 P u b l i s h e d b y t h e O f f i c e o f C o m m u n i c a t i o n & P u b l i c A f f a i r s  

E-Print Network [OSTI]

, Stanford neurosci- entist Craig Garner, PhD, was in a dilemma. His lab's research on Down syndrome had just and restore normal learning abili- ties in mice with the equivalent of Down syndrome. It was an exciting that a compound could help restore learning abilities in children with Down syndrome, advance the findings from

Bogyo, Matthew

236

A l u m n i N e w s l e t t e r I n d i a n a U n i v e r s i t y D e p a r t m e n t o f S l a v i c L a n g u a g e s a n d L i t e r a t u r e s  

E-Print Network [OSTI]

for reorganization and for authorizing the hiring of energetic and versatile new faculty. Along these lines we have of TSAA, signed a six-year partnership agreement. The major features of the grant include new courses using distance-education tech- nology and a new six-week course, "Global Environmental Problems

Indiana University

237

Preprint of the paper submitted to the 4 t h I FA C -S y m p o s i u m o n M e c h a t r o n i c S y s t e m s H e i d e l b e r g , G e r m a n y , S e p t e m b e r 1 2 t h -1 4 t h , 2 0 0 6  

E-Print Network [OSTI]

made them attractive for miniaturised and micro-technical systems (Dario, et al., 1997). The SMA MACROSCOPIC SMA WIRE BUNDLE ACTUATOR/SENSOR SYSTEM: DESIGN, MEASUREMENT, CONTROL APPROACH Robert Kratz, Maximilian Stelzer, and Oskar von Stryk Simulation and Systems Optimization Group Department of Computer

Stryk, Oskar von

238

f a l l 2 0 1 4 | i T H E M A G A Z I N E O F T H E U N I V E R S I T Y O F T E X A S S C H O O L O F L A W f a l l 2 0 1 4 | v o l u m e 1 3  

E-Print Network [OSTI]

f a l l 2 0 1 4 | i T H E M A G A Z I N E O F T H E U N I V E R S I T Y O F T E X A S S C H O O L O John H. Massey, '66 Alumni Association President Bruce Broillet, '74 ut law magazine Editor Maria FROM THE DEAN L AST YEAR THE LAW school undertook a strategic-planning exercise. We formed a committee

John, Lizy Kurian

239

Risk-Mitigated Optimal Power Flow for Wind Powered Grids Emma Sjodin, Dennice F. Gayme and Ufuk Topcu  

E-Print Network [OSTI]

." High grid penetrations of solar or wind power pose a number of operational challenges and it is widely transmission capacity [10]. Until now, the power industry has dealt with potential failures using deterministic, Baltimore, MD, USA, 21218. dennice@jhu.edu U. Topcu is with Control and Dynamical Systems at the California

Low, Steven H.

240

S:\\Registration & Records\\Term Communications\\2012 Fall\\Fall 2012 Freshmen Registration Document.docx 1 of 1 JOHNS HOPKINS UNIVERSITY  

E-Print Network [OSTI]

information about registering for classes in ISIS Self-Service for Students. If you should have any (PRIOR TO JULY 2ND ISIS for Students: you will be automatically logged out after 5 minutes of inactivity is accurately set-up for ISIS for Students. a. Go to isis.jhu.edu b. Click on "browser requirements" near

Connor, Ed

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Standard Syllabi and Grading Policy  

E-Print Network [OSTI]

Standard Syllabi and Grading Policy Professor and Executive Vice Dean Phil Phan The Johns Hopkins Is a Syllabus #12;· All the current Carey standard syllabi are listed online http://carey.jhu.edu/standard_syllabi · Carey standard syllabus templates are available online http

von der Heydt, Rüdiger

242

Baltimorethan you expect. f Baltimore's many nicknames,  

E-Print Network [OSTI]

performing at JHU's Chinese New Year celebration; Honfest; painted window screen of Patterson Park. I think that's why Baltimore is such a good place to live." -- John Waters, baltimore film director imitation of stone that covers brick roW homes throughout baltimore, as "the polyester of brick." #12;film

Niebur, Ernst

243

On Local Algorithms for Topology Control and Routing in Ad Hoc Networks  

E-Print Network [OSTI]

On Local Algorithms for Topology Control and Routing in Ad Hoc Networks Lujun Jia and Rajmohan 3400 N. Charles Street Baltimore, MD 21218, USA scheideler@cs.jhu.edu Abstract An ad hoc network. Indeed, an important task of an ad hoc network is to determine an appropri­ ate topology over which high

Chan, Agnes Hui

244

arXiv:astro-ph/0106481v126Jun2001 MASSIVE DATASETS IN ASTRONOMY  

E-Print Network [OSTI]

arXiv:astro-ph/0106481v126Jun2001 Chapter 1 MASSIVE DATASETS IN ASTRONOMY Robert J. Brunner, S 21218 USA szalay@pha.jhu.edu Abstract Astronomy has a long history of acquiring, systematizing archives and services representing a new in- formation infrastructure for astronomy of the 21st century

Prince, Thomas A.

245

Assignment 6: Heat Transfer Page 1 of 8 600.112: Introduction to Programming  

E-Print Network [OSTI]

Assignment 6: Heat Transfer Page 1 of 8 600.112: Introduction to Programming for Scientists and Engineers Assignment 6: Heat Transfer Peter H. Fr¨ohlich phf@cs.jhu.edu Joanne Selinski joanne to Programming for Scientists and Engineers is all about heat transfer and how to simulate it. There are three

Fröhlich, Peter

246

Martin Peng*, Charles Neumeyer NSTX National Team  

E-Print Network [OSTI]

30 Injector Voltage Toroidal Current Injector current SN 106488 kAkVmWbkAkA n = 1 oscillations n=1 oscillations related to reconnection mechanisms (U Wash, PPPL) (JHU) #12;Plasmas with Beam Heating Can Surpass Moderate plasma current High p ~ 1 H-mode with Edge-Localized Modes Induction voltage reduced to

Princeton Plasma Physics Laboratory

247

ALGORITHMICPARTIALANALOG-TO-DIGITALCONVERSION IN MIXED-SIGNAL ARRAY PROCESSORS  

E-Print Network [OSTI]

ALGORITHMICPARTIALANALOG-TO-DIGITALCONVERSION IN MIXED-SIGNAL ARRAY PROCESSORS Roman Genov',2and,Baltimore, MD 21218-2686 E-mail: roman@eecg.toronto.edu,gert@jhu.edu ABSTRACT We present an algorithmic analog with digital post-accumulation, and row-cumulative ADC with analog pre-accumulation. Simulation results

Genov, Roman

248

ALGORITHMIC PARTIAL ANALOG-TO-DIGITAL CONVERSION IN MIXED-SIGNAL ARRAY PROCESSORS  

E-Print Network [OSTI]

ALGORITHMIC PARTIAL ANALOG-TO-DIGITAL CONVERSION IN MIXED-SIGNAL ARRAY PROCESSORS Roman Genov, Baltimore, MD 21218-2686 E-mail: roman@eecg.toronto.edu, gert@jhu.edu ABSTRACT We present an algorithmic presentation of bit-serial inputs in descending binary order. The architecture combines algorithmic conversion

Cauwenberghs, Gert

249

CHARGE-BASED MOS CORRELATED DOUBLE SAMPLING COMPARATOR AND FOLDING CIRCUIT  

E-Print Network [OSTI]

CHARGE-BASED MOS CORRELATED DOUBLE SAMPLING COMPARATOR AND FOLDING CIRCUIT Roman Genov and Gert 21218-2686 E-mail: roman,gert¡ @bach.ece.jhu.edu ABSTRACT A novel charge-based comparator and folding circuit are pre- sented. Correlated double sampling comparison is performed using a log-domain integrator

Cauwenberghs, Gert

250

Stochastic Mixed-Signal VLSI Architecture for High-Dimensional Kernel Machines  

E-Print Network [OSTI]

Stochastic Mixed-Signal VLSI Architecture for High-Dimensional Kernel Machines Roman Genov and Gert roman,gert¡ @jhu.edu Abstract A mixed-signal paradigm is presented for high-resolution parallel inner processing. At the core of the externally digital architecture is a high-density, low-power analog array

Cauwenberghs, Gert

251

Advances in Neural Information Processing Systems: MIT Press, vol. 14, 2002 Stochastic Mixed-Signal VLSI Architecture for  

E-Print Network [OSTI]

-Signal VLSI Architecture for High-Dimensional Kernel Machines Roman Genov and Gert Cauwenberghs Department architecture, with inputs pre- sented in bit-serial fashion, and matrix elements stored locally in bit of Electrical and Computer Engineering Johns Hopkins University, Baltimore, MD 21218 roman,gert¡ @jhu

Genov, Roman

252

History Effects and Verification Christian Skalka and Scott Smith  

E-Print Network [OSTI]

. Verification consists of checking to make sure that histories are well-formed, i.e. the sequence of eventsHistory Effects and Verification Christian Skalka and Scott Smith The University of Vermont skalka@cs.uvm.edu The Johns Hopkins University, scott@cs.jhu.edu Abstract. This paper shows how type effect systems can

Smith, Scott F.

253

Operations with the new FUSE observatory: three-axis control with one reaction wheel  

E-Print Network [OSTI]

control system, particularly those of gyroscopes and reaction wheels, have made science operations in all three axes. Jitter values of no more than ±1 arcsecond in pitch, ±10 arcsecond in yaw, and ±1-516-8503; fax 410-516-5494; http://fuse.pha.jhu.edu #12;The FUSE Attitude Control System (ACS) contains two sets

254

A Visibility Matching Tone Reproduction Operator for High Dynamic Range Scenes  

E-Print Network [OSTI]

Author's current address: Silicon Graphics, Inc., Mountain View, CA. Author's current address: JHU. In photography or video, chemistry or electronics, together with a human actively controlling the scene lighting;display medium. In synthetic image generation, our goal is to avoid active control of lighting and camera

255

Recent Advances in Synchronous-Clock One-Way-Travel-Time Acoustic Navigation  

E-Print Network [OSTI]

Engineering University of Michigan, Ann Arbor, MI 48109 Email: eustice@umich.edu tDepartment of Mechanical Engineering Johns Hopkins University, Baltimore, MD 21218 Email: llw@jhu.edu +Department of Applied Ocean], [2], on the hull of a surface ship [3], or on sea-ice [4]. With a maximum acoustic range of 5-10 km

Whitcomb, Louis L.

256

Recent Advances in Synchronous-Clock One-Way-Travel-Time Acoustic Navigation  

E-Print Network [OSTI]

University of Michigan, Ann Arbor, MI 48109 Email: eustice@umich.edu Department of Mechanical Engineering Johns Hopkins University, Baltimore, MD 21218 Email: llw@jhu.edu Department of Applied Ocean Physics [1], [2], on the hull of a surface ship [3], or on sea-ice [4]. With a maximum acoustic range of 5

Eustice, Ryan

257

Toward Extraplanetary Under-Ice Exploration  

E-Print Network [OSTI]

.jhu@gmail.com Ryan Eustice Department of Naval Architecture and Marine Engineering University of Michigan Ann Arbor Toward Extraplanetary Under-Ice@whoi.edu, rsohn@whoi.edu, ssingh@whoi.edu Taichi Sato Ocean Research Institute University of Tokyo Nakano, Tokyo

Eustice, Ryan

258

Certified Bitcoins Giuseppe Ateniese1,2  

E-Print Network [OSTI]

Certified Bitcoins Giuseppe Ateniese1,2 , Antonio Faonio1 , Bernardo Magri1 , and Breno de Medeiros University, USA ateniese@cs.jhu.edu 3 Google, Inc. breno@google.com Abstract. Bitcoin is a peer-to-peer (p2p (called the Blockchain). A critical component of Bitcoin's success is the decentralized nature of its

259

Zerocoin: Anonymous Distributed E-Cash from Bitcoin Ian Miers, Christina Garman, Matthew Green, Aviel D. Rubin  

E-Print Network [OSTI]

Zerocoin: Anonymous Distributed E-Cash from Bitcoin Ian Miers, Christina Garman, Matthew Green, cgarman, mgreen, rubin}@cs.jhu.edu Abstract--Bitcoin is the first e-cash system to see widespread adoption. While Bitcoin offers the potential for new types of financial interaction, it has significant

Amir, Yair

260

Financial Administrative Training Learning Solutions  

E-Print Network [OSTI]

Petty Cash Purchasing Purchasing Policies and Procedures Establishing Shopping Cart Settings Shopping ME23N Display Purchase Order Purchasing from the Internal Supply Store Equipment Purchasing (JHU) Sponsored Projects Intro to Sponsored Projects Business Ethics Training for Foreign Field Offices Business

Weaver, Harold A. "Hal"

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

S:\\Registration & Records\\Term Communications\\2014 Spring\\Spring 2014 UG Registration.docx 1 of 2 JOHNS HOPKINS UNIVERSITY  

E-Print Network [OSTI]

.jhu.edu 2. Sign in with your JHED ID and enter your password 3. Under Registration, select SearchS:\\Registration & Records\\Term Communications\\2014 Spring\\Spring 2014 UG Registration.docx 1 for Classes 4. Select Spring 2014 from the dropdown 5. After searching for and finding your class, check

Weaver, Harold A. "Hal"

262

S:\\Registration & Records\\Term Communications\\2013 Fall\\FA 13 NEW GR Registration.docx page 1 of 2 JOHNS HOPKINS UNIVERSITY  

E-Print Network [OSTI]

. Select the academic period (Fall 2013), enter the course number, and then click Search 6. To choose yourS:\\Registration & Records\\Term Communications\\2013 Fall\\FA 13 NEW GR Registration.docx page 1 of 2 your JHED ID, go to my.jhu.edu and search under "People" (upper right hand side). Type in your name

Weaver, Harold A. "Hal"

263

S:\\Registration & Records\\Term Communications\\2014 Spring\\Spring 2014 UG Registration.docx 1 of 2 JOHNS HOPKINS UNIVERSITY  

E-Print Network [OSTI]

.jhu.edu 2. Sign in with your JHED ID and enter your password 3. Under Registration, select SearchS:\\Registration & Records\\Term Communications\\2014 Spring\\Spring 2014 UG Registration.docx 1 for Classes 4. Select Spring 2015 from the dropdown 5. After searching for and finding your class, check

Weaver, Harold A. "Hal"

264

S:\\Registration & Records\\Term Communications\\UG Creating Your JHEDOutlook Live.docx rev 03.2012 1 of 1 Johns Hopkins University  

E-Print Network [OSTI]

S:\\Registration & Records\\Term Communications\\UG Creating Your JHEDOutlook Live.docx rev 03 YOUR JHED PASSWORD 1. Go to my.jhu.edu 2. Click First time JHED user? [under New Visitor] 3. Enter. Do not try to search for yourself ­ if you have not received the email "Your Johns Hopkins Login ID

Weaver, Harold A. "Hal"

265

S:\\Registration & Records\\Term Communications\\2013 Summer\\UG Engineering Innovation Registration Information rev 04.2013.docx Johns Hopkins University  

E-Print Network [OSTI]

S:\\Registration & Records\\Term Communications\\2013 Summer\\UG Engineering Innovation Registration PASSWORD 1. Go to my.jhu.edu 2. Click First time JHED user? [under New Visitor] 3. Enter your Login ID (LID) in the First Time Login box. This is the JHED Login ID you just received via email. Do not try to search

Weaver, Harold A. "Hal"

266

S:\\Registration & Records\\Term Communications\\2014 Fall\\UG FA 14 WEB Registration.docx 1 of 2 JOHNS HOPKINS UNIVERSITY  

E-Print Network [OSTI]

S:\\Registration & Records\\Term Communications\\2014 Fall\\UG FA 14 WEB Registration.docx 1 of 2. To add courses to My Cart: 1. Go to isis.jhu.edu 2. Sign in with your JHED ID and enter your password 3. Under Registration, select Search for Classes 4. Select Fall 2014 from the dropdown 5. After

Weaver, Harold A. "Hal"

267

S:\\Registration & Records\\Term Communications\\2012 Fall\\GR Fall 2012 WEB Instructions.docx 1 of 2 JOHNS HOPKINS UNIVERSITY  

E-Print Network [OSTI]

the academic period Fall 2013, enter the course number, and then click Search 6. To choose your preferredS:\\Registration & Records\\Term Communications\\2012 Fall\\GR Fall 2012 WEB Instructions.docx 1 of 2 to complete whatever transactions you wish to process.) 1. Go to isis.jhu.edu 2. Sign In and enter your JHED

Weaver, Harold A. "Hal"

268

The Johns Hopkins University Center for Astrophysical Sciences  

E-Print Network [OSTI]

spectrograph for the Apache Point Observatory APO 3.5-m telescope. Theoretical and observational astronomy, the APO 3.5-m telescope, and observatories around the world. 2. PERSONNEL CAS has made a major visitors are S. Beaulieu, L. Dressel, A. Kinney, and T. Hartquist. M. Allen has left JHU. J. Daniels has

269

An Architecture for Scaling NVO Services to TeraGrid Roy Williams, Caltech  

E-Print Network [OSTI]

Jacob, JPL Ray Plante, NCSA Alex Szalay, JHU The term "cyberinfrastructure" has been adopted by the US framework". One of the largest awards in this program is the TeraGrid, a link- age of large supercomputer and control services on the TeraGrid infrastructure, with all the power and flexi- bility, but also

Williams, Roy

270

Bosnian Croatian Serbian Language Program  

E-Print Network [OSTI]

Bosnian Croatian Serbian Language Program U M Department of Slavic Languages and Literatures In the past 10 years the program of Bosnian/Croatian/Serbian at U-M has constantly been expanding

Eustice, Ryan

271

Mo, tuyo, suyo, cuyo, un paradigme ? Introduction  

E-Print Network [OSTI]

/ mea (latinisme) > mía T?U(M) > túo > tuyo T?A(M) > túa > tuya S?U(M) > súo > suyo S?A(M) > súa > suya

Paris-Sud XI, Université de

272

When Innovation Matters: An Analysis of Innovation in a Social Learning Game. Ryan Carr, Eric Raboin, Austin Parker, Dana Nau  

E-Print Network [OSTI]

When Innovation Matters: An Analysis of Innovation in a Social Learning Game. Ryan Carr, Eric within a culture by looking at "innovate" moves in the Cultaptation Project's social learning game (Boyd, 20742, USA {carr2,eraboin,austinjp,nau}@cs.umd.edu Abstract This paper examines the value of innovation

Nau, Dana S.

273

Light Collages: Lighting Design for Effective Visualization Chang Ha Lee Xuejun Hao Amitabh Varshney  

E-Print Network [OSTI]

Light Collages: Lighting Design for Effective Visualization Chang Ha Lee Xuejun Hao Amitabh 20742 {chlee, hao, varshney}@cs.umd.edu ABSTRACT We introduce Light Collages ­ a lighting design system perception of features with lighting that is locally consistent and globally inconsistent. Inspired

Varshney, Amitabh

274

Competitive Performance Assessment of Dynamic Vehicle Routing Technologies  

E-Print Network [OSTI]

the load. On the demand side, the motivation for this work is two-fold. The growing demand for customer-responsive@wam.umd.edu and Patrick Jaillet Massachusetts Institute of Technology Department of Civil & Environmental Engineering. In this environment, demands arrive randomly over time and are described by pick up, delivery locations and hard time

275

Int. J. Reliability and Safety, Vol. 2, No. 4, 2008 265 A comparison of statistical approaches for assessing  

E-Print Network [OSTI]

Int. J. Reliability and Safety, Vol. 2, No. 4, 2008 265 A comparison of statistical approaches for assessing reliability Jason Matthew Aughenbaugh* Applied Research Laboratories, University of Texas, MD 20742, USA E-mail: jwh2@umd.edu Abstract: Reliability estimates are useful for making design

Herrmann, Jeffrey W.

276

Personal Media Exploration with Semantic Regions Hyunmo Kang  

E-Print Network [OSTI]

@cs.umd.edu ABSTRACT Computer users deal with large amount of personal media data and they often face problems mental models toward the personal media data. A prototype personal media exploring application, Media of personal media data such as images, audio clips, videos, web pages, emails, and various document files

Golbeck, Jennifer

277

D E P A R T M E N T O F M E C H A N I C A L E N G I N E E R I N G A . J A M E S C L A R K S C H O O L O F E N G I N E E R I N G  

E-Print Network [OSTI]

NEURO-IMAGING, MODELING, SIMULATION AND EXPERIMENTAL VALIDATION OF BLAST RELATED TRAUMATIC BRAIN INJURY.cecd.umd.edu #12;1 FOREWORD Blast-associated brain trauma is the signature injury of the Iraq and Afghanistan wars (TBI). The most common cause of these catastrophic injuries has been exposure to blasts associated

Maryland at College Park, University of

278

Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok Veeraraghvan,  

E-Print Network [OSTI]

Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok, CMU MIT Media Lab Coded Computational ImagingCoded Computational Imaging Course WebPage : http://www.umiacs.umd.edu/~aagrawal/CVPR10Tutorial/index.html #12;Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan

Agrawal, Amit

279

Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok Veeraraghvan,  

E-Print Network [OSTI]

Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok, CMU MIT Media Lab Coded Computational ImagingCoded Computational Imaging Course WebPage : http://www.umiacs.umd.edu/~aagrawal/CVPR10Tutorial/index.html #12;Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit

Agrawal, Amit

280

Short-Term Generation Asset Valuation Chung-Li Tseng, Graydon Barz  

E-Print Network [OSTI]

Short-Term Generation Asset Valuation Chung-Li Tseng, Graydon Barz Department of Civil Engineering 94305, USA chungli@eng.umd.edu, gbarz@leland.stanford.edu Abstract In this paper we present a method for valuing a power plant over a short-term period using Monte Carlo sim- ulation. The power plant valuation

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

6/24/2004 1 W CVD Simulation Chang, Adomaitis, Kidder, and Rubloff, 2000 Annual AIChE Meeting  

E-Print Network [OSTI]

Development, and Parameter Identification H. -Y. Chang* and R. A. Adomaitis ISR and Department of Chemical properties in bulk gas phase are constant · No buoyancy or wafer rotation induced flow (Gr = 1.99; Ra = 1 Identification Procedure Simulation Approach MWRtools: www.ench/umd.edu/software/MWRtools Parameter Estimation

Rubloff, Gary W.

282

The viscous potential free surface flows in a moving domain of infinite depth without surface tension  

E-Print Network [OSTI]

. It turns out that the new system is the viscous version of the water wave equations and the dissipation@cscamm.umd.edu. 1 #12;(1) The kinematic condition: We represent the free boundary by z - (x, y, t) = 0. Since (t + v

Yorke, James

283

J. Heidrich et al. (Eds.): PROFES 2013, LNCS 7983, pp. 184198, 2013. Springer-Verlag Berlin Heidelberg 2013  

E-Print Network [OSTI]

, Constanza Lampasona2 , and Alexis Eduardo Ocampo Ramírez3 1 Fraunhofer Center for Experimental Software@fc-md.umd.edu 2 Fraunhofer Institute for Experimental Software Engineering Kaiserslautern, Germany constanza.lampasona@iese.fraunhofer IT and software are becoming central drivers for innovation and growth for many organizations, and business

Basili, Victor R.

284

Mind Perception and Objectification 1 Running Head: Mind Perception and Objectification  

E-Print Network [OSTI]

Mind Perception and Objectification 1 Running Head: Mind Perception and Objectification More than a Body: Mind Perception and the Nature of Objectification Kurt Gray1, Joshua Knobe2, Mark Sheskin2, Paul@umd.edu #12;Mind Perception and Objectification 2 Abstract According to models of objectification, viewing

Knobe, Joshua

285

Modeling Carrier Behavior in Sequential Auction Transportation Markets  

E-Print Network [OSTI]

Modeling Carrier Behavior in Sequential Auction Transportation Markets M. A. Figliozzi, University ______________________________________________________________________________ August 10-15, 2003 2 Title: Modeling Carrier Behavior in Sequential Auction Transportation Markets Miguel Phone: 301-405-0752 Fax: 301-405-2585 eMail: masmah@umd.edu Abstract Online markets for transportation

Bertini, Robert L.

286

INFSCI 2140 Information Storage and Retrieval  

E-Print Network [OSTI]

#12;5 User Interaction in a Boolean System Enter search statement View results (postings for terms in a Ranked Output System Enter search statement View ranked list Strategies ­ Add or delete terms from previews can help to choose the right set of query terms Essential if the search could be slow (UMD movie

Brusilovsky, Peter

287

New Approaches to Help Users Get Started with Visual Interfaces: Multi-Layered Interfaces and Integrated Initial Guidance  

E-Print Network [OSTI]

New Approaches to Help Users Get Started with Visual Interfaces: Multi-Layered Interfaces, plaisant, ben}@cs.umd.edu Abstract We are investigating new ways to help users learn to use public access of interfaces using multi-layered design and a new help method called Integrated Initial Guidance. Multi

Golbeck, Jennifer

288

Collod-Broud & Boileau The Marfan Mutation Database  

E-Print Network [OSTI]

Collod-Broud & Boileau The Marfan Mutation Database Gwenalle Collod-Broud1 and Catherine Boileau created, in 1995, a mutation database named "UMD-FBN1". The database follows the guidelines on mutation databases of the Hugo Mutation Database Initiative and gives access to a software package that provides

Paris-Sud XI, Universit de

289

Energy Harvesting Diamond Channel with Energy Cooperation  

E-Print Network [OSTI]

Energy Harvesting Diamond Channel with Energy Cooperation Berk Gurakan Sennur Ulukus Department@umd.edu Abstract--We consider the energy harvesting diamond channel, where the source and two relays harvest energy the option of wirelessly transferring some of its energy to the relays via energy cooperation. We find

Ulukus, Sennur

290

Raydiance Ultra-Short Pulse Laser Platform: Gateway to the Light Age  

E-Print Network [OSTI]

/Rutgers · EpiRay · Army TATRC · UTSW · Wilmer, UMD · Synthetic Genomics · Navy #12;15 U.S. Food and Drug/implant procedures #12;17 Oncology Experimentation · FDA Research Group · Effects of non-destructive irradiation

Van Stryland, Eric

291

Algorithmic Aspects of Capacity in Wireless Networks V.S. Anil Kumar  

E-Print Network [OSTI]

and Analysis Center (NISAC), Los Alamos National Laboratory, MS M997, P.O. Box 1663, Los Alamos, NM 87545, Email: mmarathe@vbi.vt.edu Department of Computer Science, University of Maryland, College Park, MD 20742. Email: sri@cs.umd.edu.Most of the work was done while visiting Los Alamos National lab- oratory

Srinivasan, Aravind

292

EndtoEnd PacketScheduling in Wireless Adhoc Networks V.S. ANIL KUMAR 1 MADHAV V. MARATHE 1 SRINIVASAN PARTHASARATHY 2  

E-Print Network [OSTI]

and Analysis Center (NISAC), Los Alamos National Labo­ ratory, MS M997, P.O. Box 1663, Los Alamos, NM 87545­7405­ENG­36. 3 Department of Computer Science, University of Maryland, College Park, MD 20742. Most of the work was done while visiting Los Alamos National laboratory. Email: sri@cs.umd.edu. 4 Department

Srinivasan, Aravind

293

Space Systems Laboratory! U N I V E R S I T Y O F  

E-Print Network [OSTI]

Space Systems Laboratory! U N I V E R S I T Y O F MARYLAND 1 Robotic Frontiers ! David L. Akin! Space Systems Laboratory! University of Maryland,! College Park! #12;Space Systems Laboratory! U N I V E R S I T Y O F MARYLAND 2 Overview of the UMd Space Systems Lab! Dexterous Robotics! Human Systems

Akin, David

294

Who Wants to Know? Question-asking and Answering Practices among Facebook Users  

E-Print Network [OSTI]

Who Wants to Know? Question-asking and Answering Practices among Facebook Users Rebecca Gray1@umd.edu ABSTRACT Research has identified a link between Facebook use and bridging social capital, which speaks through which Facebook may help individuals mobilize these embedded informational and support resources

Michigan, University of

295

A Cheat-Proof Game Theoretic Demand Response Scheme for Smart Grids  

E-Print Network [OSTI]

A Cheat-Proof Game Theoretic Demand Response Scheme for Smart Grids Yan Chen, W. Sabrina Lin, Feng}@umd.edu Abstract--While demand response has achieved promising results on making the power grid more efficient and reliable, the additional dynamics and flexibility brought by demand response also increase the uncertainty

Liu, K. J. Ray

296

A Graphical Interface for Speech-Based Retrieval Laura Slaughter, Douglas W. Oard, Vernon L. Warnick, Julie L. Harding and Galen J. Wilkerson  

E-Print Network [OSTI]

selection interface for speech-based retrieval [5]. Search controls in the upper left allow specificationA Graphical Interface for Speech-Based Retrieval Laura Slaughter, Douglas W. Oard, Vernon L}@glue.umd.edu ABSTRACT This paper describes preliminary usability testing for a graphical interface designed

Oard, Doug

297

PREPRINT: Nonoutsourceable Scratch-Off Puzzles to Discourage Bitcoin Mining Coalitions  

E-Print Network [OSTI]

PREPRINT: Nonoutsourceable Scratch-Off Puzzles to Discourage Bitcoin Mining Coalitions Andrew://cs.umd.edu/~amiller/nonoutsourceable.pdf. ABSTRACT An implicit goal of Bitcoin's reward structure is to diffuse network influence over a diverse, decentralized population of individual participants. Indeed, Bitcoin's security claims rely on no single entity

Katz, Jonathan

298

Exploring Pet Video Chat: The Remote Awareness and Interaction Needs of Families with Dogs and Cats  

E-Print Network [OSTI]

1 Exploring Pet Video Chat: The Remote Awareness and Interaction Needs of Families with Dogs College Park, MD, USA golbeck@cs.umd.edu ABSTRACT Many people have pets such as dogs and cats that they would consider to be family. Along with this comes a need to stay aware of one's pet and, possibly

Golbeck, Jennifer

299

Optimal Planning with Global Numerical State Constraints Franc Ivankovic, Patrik Haslum, Sylvie Thiebaux, Vikas Shivashankar and Dana S. Nau  

E-Print Network [OSTI]

, transport systems and water net- works. Smart use of this information, using automated plan- ningOptimal Planning with Global Numerical State Constraints Franc Ivankovic, Patrik Haslum, Sylvie Thi.last@anu.edu.au {svikas,nau}@cs.umd.edu Abstract Automating the operations of infrastructure networks such as energy grids

Thibaux, Sylvie

300

Extremely local MR representations: Youngmi Hur1 & Amos Ron2  

E-Print Network [OSTI]

Extremely local MR representations: L-CAMP Youngmi Hur1 & Amos Ron2 Workshop on sparse representations: UMD, May 2005 1 Math, UW-Madison 2 CS, UW-Madison #12;Wavelet and framelet constructions History of all local MR representations #12;L-CAMP: Extremely local MR constructions Bird's view of the CAP

Maryland at College Park, University of

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Annual Performance Report AFOSR Grant Number F496200110374  

E-Print Network [OSTI]

between the UMD and Sandia Approaches to Modeling of Complicated Cavities 11 III.1.c Advanced Theoretical Protection 22 III.2.c Experimental Studies of Pulsed RF Interference on IC 26 MOSFETs, Inverters the probability distribution function of electric field on an electronic component inside a partially shielded

Hassam, Adil

302

Register File Partitioning with Constraint Programming  

E-Print Network [OSTI]

have also great effect on the energy consumption of the processor [4]. RFs must have less ports and}@eng.umd.edu Abstract-- Highly parallel processors call for high bandwidth register access. One solution is to use multi-port lower the maximum clock frequency of the processor. Therefore, partitioning the multi-port register file

Bhattacharyya, Shuvra S.

303

A network that responds to water resource issues by advancing knowledge through research, education and Extension projects.  

E-Print Network [OSTI]

-405-8042 Phone 301-314-9091 Fax dparker@arec.umd.edu Co-Chair Elect, CSL Dr. Kitt Farrell-Poe University Cooperative Extension Florida A&M University 202-J Perry-Paige Bldg., S. Tallahassee, FL 32307 850

304

Exploratory Search Interfaces to Support Image Discovery  

E-Print Network [OSTI]

Director (1983-2000), Human-Computer Interaction Lab Professor, Department of Computer Science MemberExploratory Search Interfaces to Support Image Discovery Ben Shneiderman ben@cs.umd.edu Founding;Interdisciplinary research community - Computer Science & Psychology - Information Studies & Education (www

Shneiderman, Ben

305

Demonstrations CHI 2000 , 1-6 APRIL 2000 Simulation Based Learning Environments  

E-Print Network [OSTI]

Demonstrations CHI 2000 , 1-6 APRIL 2000 Simulation Based Learning Environments and the Use://www.cs.umd.edu/hcil ABSTRACT We have developed an application framework for constructing simulation-based learning environments, Learning, Engineering, Education SimpLE pairs the power and flexibility of a generic simulation package

Rubloff, Gary W.

306

Sources of Poultry and Supplies for Small Flocks -2007 prepared by  

E-Print Network [OSTI]

Sources of Poultry and Supplies for Small Flocks - 2007 prepared by Dr. Nick Zimmermann Animal://ansc.umd.edu/faculty/nzpub.htm The commercial sources of poultry, eggs, and chicks listed are from National Poultry Improvement Plan (NPIP purchase poultry or eggs. This list is provided to small flock owners as a partial source and does

Hamza, Iqbal

307

Patricia Burchat Department of Physics  

E-Print Network [OSTI]

Patricia Burchat Department of Physics Stanford University Dark Matter, Dark Energy: Mysteries University Dark Matter, Dark Energy: Mysteries of the Universe Dark Energy 70% Dark Matter 26% Ordinary://janus.astro.umd.edu/javadir/orbits/ssv.html Planetary Motion Credit: The Astronomy Workshop A collection of interactive web-based programs

Osheroff, Douglas D.

308

Integration of Data ow Optimization Techniques into a Software Radio Design Framework  

E-Print Network [OSTI]

Integration of Data ow Optimization Techniques into a Software Radio Design Framework George F, plishker, ssb}@umd.edu Laboratory for Telecommunications Sciences University of Maryland College Park@comsec.com Abstract--Application speci c design frameworks, such as GNU Radio for software de ned radio, facilitate

Bhattacharyya, Shuvra S.

309

306 IEEE JOURNAL ON SELECTED AREAS IN COMMUNICATIONS, VOL. 25, NO. 2, FEBRUARY 2007 Lifetime Maximization via Cooperative Nodes and  

E-Print Network [OSTI]

locations and energy levels among distributed nodes. First, a lifetime maximization problem via cooperative is with the Department of Electrical and Computer Engineer- ing and the Institute for Systems Research, University of Maryland, College Park, MD 20742 USA (email: kjrliu@eng.umd.edu). Z. Han is with the Department

Liu, K. J. Ray

310

In GIS'13: C. Knoblock, P. Krger, J. Krumm, M. Schneider, and P. Widmayer (eds), Proceedings of the 21st ACM SIG-SPATIAL International Conference on Advances in Geographic Information Systems, pp. 542-545, Orlando, FL, Nov. 2013.  

E-Print Network [OSTI]

, University of Maryland College Park, MD 20742 USA {marco, hjs}@cs.umd.edu ABSTRACT Determining geographic is granted without fee provided that copies are not made or distributed for profit or commercial advantage of Washington" when it appears in a list containing the values [Washington, Idaho, Oregon] (which are all names

Samet, Hanan

311

Maternal-neonatal carnitine relationships in swine, and the effect of dietary carnitine on young pig performance  

E-Print Network [OSTI]

and 236. 1 uM, respectively. By d 4, TCN had decreased (P&. 01) to 149. 7 uM. TCN gradually increased throughout the remainder of lactation reaching 273. 1 uM on d 28. The percent esterified carnitine (ECN) on d 0, 1 and 2 was high (84. 0, 88. 6 and 83..., 4X, respectively), but decreased to 54. 7X on d 21. Pig serum TCN was low initially (31. 6 uM), but increased dramatically (P&. 01) with the onset of nursing (53. 6 uM on d 1). TCN remained fairly stable from d 2 until weaning, ranging from 49...

Izard, Ryan Sylvester

2012-06-07T23:59:59.000Z

312

L e s s d e p e n d e n c e o n f o r e i g n o i l , a n d e v e n t u a l t r a n s i t i o n t o a n e m i s s i o n s -f r e e , p e t r o l e u m -f r e e v e h i c l e  

E-Print Network [OSTI]

. . . . . . . . . . . . . . . . . . . . . . . . 75 III.9 Oak Ridge National Laboratory: Enabling High-Efficiency Ethanol Engines . . . . . . .

313

Under consideration for publication in J. Functional Programming 1 Types and Trace Effects of Higher Order  

E-Print Network [OSTI]

, if a program is sending and receiving data over an SSL socket, the relevant events are opening and closing be: ssl_open("snork.cs.jhu.edu",4434); ssl_hs_begin(4434); ssl_hs_success(4434); ssl_put(4434); ssl_get(4434); ssl_open("moo.cs.uvm.edu",4435); ssl_hs_begin(4434); ssl_put(4435); ssl_close(4434); ssl

Skalka, Christian

314

Universitt Bonn -Institut fr Politische Wissenschaft und Soziologie Prof. Dr. Uwe Holtz -Am Hofgarten 15, 53113 Bonn -uholtz@aol.com -www.uni-bonn.de/~uholtz  

E-Print Network [OSTI]

« International Politics » Here you'll find the article written by the Indian Nobel prize winner Amartya Sen Amartya Sen In the summer of 1997, I was asked by a leading Japanese newspaper what I thought was the most of Democracy 10.3 (1999) 3-17 (http://muse.jhu.edu/demo/jod/10.3sen.html) Democracy as a Universal Value

Franz, Sven Oliver

315

Botswanafeaturing the VICTORIA FALLS  

E-Print Network [OSTI]

.alumni.jhu.edu AUGUST 6-19, 2015 #12;Victoria Falls N A T U R A L B E A U T Y | B O U N T I F U L W I L D L I F E | R IBotswanafeaturing the OKAVANGO DELTA plus VICTORIA FALLS AHI: 800-323-7373 www'll begin our journey with a visit to powerful Victoria Falls in Zambia, where you will take a sunset cruise

Weaver, Harold A. "Hal"

316

S:\\Registration & Records\\Term Communications\\GR Creating Your JHED-Outlook Live.docx 1 of 1 Johns Hopkins University  

E-Print Network [OSTI]

S:\\Registration & Records\\Term Communications\\GR Creating Your JHED-Outlook Live.docx 1 of 1 Johns-mail help@jhmi.edu 1. Go to CREATE YOUR JHED PASSWORD: my.jhu.edu 2. Click First time JHED user? 3. Enter. Do not try to search for yourself! If you have not received the email "Your Johns Hopkins JHED Login

Weaver, Harold A. "Hal"

317

magazine of the gerald j. and dorothy r. friedman school of nutrition science and policy SUMMER 2011 VOL. 12 NO. 2 PLUS: GENES AND DIET n INNOVATIONS IN AFRICA n FEEDING YOUR PET  

E-Print Network [OSTI]

SUMMER 2011 VOL. 12 NO. 2 PLUS: GENES AND DIET n INNOVATIONS IN AFRICA n FEEDING YOUR PET Power PlayGOING ALL OUT TO SAVE MUSCLE #12;Tufts Prints Green Printed on 25% post-consumer waste recycled paper. Please recycle. 2 tufts nutrition s u m m e r 2 011 vo l u m e 1 2 n o. 2 s u m m e r 2 0 1 1 editor

Dennett, Daniel

318

1368 IEEE TRANSACTIONS ON INFORMATION FORENSICS AND SECURITY, VOL. 7, NO. 4, AUGUST 2012 Indirect Reciprocity Security Game for Large-Scale  

E-Print Network [OSTI]

@umd.edu). W. S. Lin is with Intel, Hillsboro, OR 97124-5961 USA (e-mail: w.sabrina. lin@gmail.com). Color, IEEE, W. Sabrina Lin, Student Member, IEEE, and K. J. Ray Liu, Fellow, IEEE Abstract--Radio nodes can (e-mail: lxiao@xmu.edu. cn). Y. Chen and K. J. R. Liu are with the Department of Electrical

Liu, K. J. Ray

319

Airborne Infrared Target Tracking with the Nintendo Wii Remote Sensor  

E-Print Network [OSTI]

to target. 3.2 Design Rather than design for a particular distance, the highest-output available infrared source was selected for the beacon: a 500 W quartz tungsten halogen incandescent lamp. Determining the radiant power in the detectable spectrum...://terpconnect.umd.edu/ toh/models/Blackbody.html. [17] Forsythe, W. and Worthing, A., \\The Properties of Tungsten and the Character- istics of Tungsten Lamps," Astrophysics Journal , Vol. 61, April 1925, pp. 146{ 185. 34 ...

Beckett, Andrew 1984-

2012-11-12T23:59:59.000Z

320

The Florida State University Tallahassee, Florida 32306-1480  

E-Print Network [OSTI]

314 Westcott Building (850) 644-6876 FAX (850) 644-3375 October 14, 2004 M E M O R A N D U M To: Deans

Sura, Philip

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Leveraging Post-Translational Phosphopantetheinylation as a Versatile Biochemical Tool /  

E-Print Network [OSTI]

calf intestinal phosphatase (CIP) (Worthington Biochemicals,dissociation constants. CIP (100 U at 3800 U/mL) was addedconcentration. Incubation of CIP-treated and untreated Sfp

Kosa, Nicolas M.

2013-01-01T23:59:59.000Z

322

atomic-scale dynamical structures: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

presentee et method . . . . . . . . . . . . . . . . . . . . . 10 1.2 Dynamic SSI problem in earthquake engineering, Structures et Materiaux - CNRS U.M.R. 8579...

323

annual gaston labat: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

phones: lift receiver (Automatic connection to U-M Police Department Kamat, Vineet R. 33 Annual Report 2000 Annual Report 2000 Engineering Websites Summary: The Arctic...

324

E-Print Network 3.0 - analysis software applications Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

U M B I A Software Engineering Summary: Required Requirements Engineering Software Engineering Prjct Economic Analysis of Engineering... Security - Design of Distributed...

325

Preventative Maintenance (PM) Policy Outline the policy regarding preventative vehicle maintenance on University of Michigan (U-  

E-Print Network [OSTI]

Preventative Maintenance (PM) Policy Objective Outline the policy regarding preventative vehicle maintenance on University of Michigan (U- M) vehicles. Policy 1. All maintenance performed on U-M vehicles their own campus maintenance facility to repair their fleet vehicles. 2. To ensure proper stewardship of U

Kirschner, Denise

326

Environmental Reporting for the University of Michigan Ann Arbor  

E-Print Network [OSTI]

Environmental Reporting for the University of Michigan Ann Arbor Campus: the U-M Environmental Data;#12;Environmental Reporting for the University of Michigan Ann Arbor Campus: The U-M Environmental Data Repository;DOCUMENT DESCRIPTION ENVIRONMENTAL REPORTING FOR THE UNIVERSITY OF MICHIGAN ANN ARBOR CAMPUS: THE U

Eustice, Ryan

327

Validation of Pisum sativum agglutinin fluorescent marker for stallion spermatozoal acrosomes with transmission electron microscopy  

E-Print Network [OSTI]

. Either 1 uM or 10 uM A23187 (a calcium ionophore) was added to each ejaculate and incubated for 1,2 and 3 hours at two different temperatures (37C? and 22C?). Raw semen or extender were fixed at time zero to serve as baseline controls. Other untreated...

Carrell, Betty Pauline

2012-06-07T23:59:59.000Z

328

Combinatorial signaling microenvironments for manipulating cell fate  

E-Print Network [OSTI]

six days with either 1000 U/mL LIF or 10 -6 M all-trans-retinoic acid (Sigma).six days with either 1000 U/mL LIF or 10 -6 M all-trans-retinoic acid (Sigma).

Flaim, Christopher Jason

2006-01-01T23:59:59.000Z

329

Computer Science Computer Science?  

E-Print Network [OSTI]

Michigan Autonomous Aerial Vehicles, UM::Autonomy, U-M Programming, U-M Solar Car, Hybrid RacingComputer Science @ Michigan Life as a CS Student What is Computer Science? Computer science is shaping the future. A degree in computer science can help shape yours. Michigan CS students have

Eustice, Ryan

330

THE ROLE OF FERRIC IRON UPTAKE REGULATOR (FUR) PROTEIN ON IRON REGULATION IN COXIELLA BURNETII  

E-Print Network [OSTI]

at 37?C for overnight. These cultures were then subcultured in 5mL media with either 50uM ferrous chloride or 200uM deferoxamine, an iron chelator until an OD600 of 0.45-0.55 was reached and the assay performed. Plasmids/Strain#7;Description#7;Source#7... Solution, 98mM KH2PO4, 270mM KCl, 26.8mM NaCl, 40mM MgCl, 0.2mM glucose, 2x spermine, 2x erythritol, 2x para-aminobenzoic acid, 2x NADH, 2x adenine, 2x hypoxanthine, 2x uracil) (Beare, personal communication) with 0uM, 10uM or 50uM iron sulfate. After...

Wilson, Mary J

2006-08-16T23:59:59.000Z

331

Nuclear space power safety and facility guidelines study  

SciTech Connect (OSTI)

This report addresses safety guidelines for space nuclear reactor power missions and was prepared by The Johns Hopkins University Applied Physics Laboratory (JHU/APL) under a Department of Energy grant, DE-FG01-94NE32180 dated 27 September 1994. This grant was based on a proposal submitted by the JHU/APL in response to an {open_quotes}Invitation for Proposals Designed to Support Federal Agencies and Commercial Interests in Meeting Special Power and Propulsion Needs for Future Space Missions{close_quotes}. The United States has not launched a nuclear reactor since SNAP 10A in April 1965 although many Radioisotope Thermoelectric Generators (RTGs) have been launched. An RTG powered system is planned for launch as part of the Cassini mission to Saturn in 1997. Recently the Ballistic Missile Defense Office (BMDO) sponsored the Nuclear Electric Propulsion Space Test Program (NEPSTP) which was to demonstrate and evaluate the Russian-built TOPAZ II nuclear reactor as a power source in space. As of late 1993 the flight portion of this program was canceled but work to investigate the attributes of the reactor were continued but at a reduced level. While the future of space nuclear power systems is uncertain there are potential space missions which would require space nuclear power systems. The differences between space nuclear power systems and RTG devices are sufficient that safety and facility requirements warrant a review in the context of the unique features of a space nuclear reactor power system.

Mehlman, W.F.

1995-09-11T23:59:59.000Z

332

The vibrational and rotational structure of the 2400 to 1950 A? absorption spectrum of sulfur dioxide  

E-Print Network [OSTI]

0. $ ? Vs TBE YiaUSXOKtf U ? m sm U M A L M W of thb 2400 to 1950 2 Ammwim mmmm m s u m m m a m A. BisMrtatiim % James Willbom Biggs, Jfe. Submitted to the Gra4taata Sdtotd tdt HA* Agricultural and Maofcudoal Qtlltc* %ff I'M* 3*i partial... fulfillment of' %hm r*tuir??Mi*s f?r %ift ??' m m m m m m & m s t Major Sttfejoott Rupeio* THE VIBRATIONAL AND ROTATIONAL STRUCTURE OP THE 2400 TO 1950 A ABSORPTION SPECTRUM OP SULFUR DIOXIDE A Dissertation 37 James Willborn Riggs, Jr. Approved...

Riggs, James Willborn

1958-01-01T23:59:59.000Z

333

Reducing Zero-point Systematics in Dark Energy Supernova Experiments  

E-Print Network [OSTI]

Schmidt, B . P. 2003, i n Supernovae a n d G a m m a - R a ynumber of observed supernovae, m a x i m u m surveyObservations of type l a Supernovae (SNe la) have allowed

Faccioli, Lorenzo

2011-01-01T23:59:59.000Z

334

Microsoft PowerPoint - Columbia_River_Corridor_Rev_2_v2.ppt ...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

install additional wells l u m b i a R . add t o a e s - 100 N Area (contain strontium-90) Drill injection, monitoring wells to support apatite barrier to support apatite...

335

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network [OSTI]

of Environmental Earth and Ocean Sciences, University of Massachusetts, 100 Morrissey Blvd., Boston, MA 02125, USA Keywords: Potential evapotranspiration Daily evapotranspiration Net radiation Florida s u m m a r y We

336

Annual Security and Fire Safety Report | 2010 public safety  

E-Print Network [OSTI]

Annual Security and Fire Safety Report | 2010 col u m bia univer sity public safety #12;Contents A Message from the Vice President for Public Safety.............................................1 The Clery .............................................................................................................2 The Department of Public Safety

Kim, Philip

337

attacks outcomes lessons: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0 20 40 60 80 100 u m b e r o f o u t c o m e s positive outcome... Underestimation of timber fraction resulted in significant heat loss ? 23% Terraced Timber frame York > AD1B...

338

E-Print Network 3.0 - associzione termotecnica italiana Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

di Milano Collection: Computer Technologies and Information Sciences 2 Pagina 1 Curriculum Vitae di Franco Marinoni C U R R I C U L U M Summary: E-mail franco.marinoni@polomi.it...

339

E-Print Network 3.0 - ambiental asociados con Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

26 S U M A R I O CARGAS DE HUNDIMIENTO POR PUNTA PARA PILOTES EN ROCA Summary: estudio de impacto ambiental y de la DIA. Con este fin se realiza un anlisis sobre la presencia de...

340

E-Print Network 3.0 - ambiental causada por Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ecology 14 S U M A R I O CARGAS DE HUNDIMIENTO POR PUNTA PARA PILOTES EN ROCA Summary: de Impacto Ambiental (EIA) es el Real Decreto Legislativo1 130219862 (actualmente derogado)...

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

E-Print Network 3.0 - ambiental por dimensiones Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ecology 7 S U M A R I O CARGAS DE HUNDIMIENTO POR PUNTA PARA PILOTES EN ROCA Summary: de Impacto Ambiental (EIA) es el Real Decreto Legislativo1 130219862 (actualmente derogado)...

342

DEPARTMENT OWNED EQUIPMENT INFORMATION Use this form to provide the required information for your department owned equipment to University of Michigan  

E-Print Network [OSTI]

information for your department owned equipment to University of Michigan (U-M) Parking and Transportation Plate Parking and Transportation Services (PTS) 1213 Kipke Drive Ann Arbor, Michigan 48109

Kirschner, Denise

343

Moving Violation Policy Outline the policy regarding moving violations issued to operators in University of Michigan  

E-Print Network [OSTI]

to operators in University of Michigan (U-M) vehicles. Vehicle Use Policy 1. Staff members are responsible 1. Operators must be properly licensed according to the laws of the State of Michigan and federal

Kirschner, Denise

344

Definition of a Balancing Point for Electricity Transmission Contracts  

E-Print Network [OSTI]

406080 100 Nodes sorted by maximum relative cross price response M a xim u m re la tiv e cr o ss pr ic e re sp o ns e (Lines are labelled according to the number of generation nodes considered) M a xim u m re la tiv e cr o ss pr ic e re sp o... ns e M a xim u m re la tiv e cr o ss pr ic e re sp o ns e M a xim u m re la tiv e cr o ss pr ic e re sp o ns e Figure5: Effect of the number of generation nodes considered on the shape of the curve representing the maximum relative...

Olmos, Luis; Neuhoff, Karsten

2004-06-16T23:59:59.000Z

345

E-Print Network 3.0 - antiparasitaria utilizando larvas Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences and Ecology 78 P h y l u m Brachiopoda . Emotby Pennington and StephenA. Stricker Summary: . DEVELOPMENTAND FORM OF BRACHIOPOD LARVAE The Lingulacea are composed of...

346

E-Print Network 3.0 - atra molina bivalvia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Biology and Medicine 76 P h y l u m Brachiopoda . Emotby Pennington and StephenA. Stricker Summary: Brachiopodr, Hutchinson, London. Stanley, S.M. (1977). Trends, rates and...

347

E-Print Network 3.0 - aegypyti larvae rolinicina Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences and Ecology 55 P h y l u m Brachiopoda . Emotby Pennington and StephenA. Stricker Summary: . DEVELOPMENTAND FORM OF BRACHIOPOD LARVAE The Lingulacea are composed of...

348

antifungal susceptibility testing: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

flavors. Bernard, C; DeTar, C; Levkova, L; Gottlieb, S; Heller, U M; Hetrick, J E; Osborn, J; Renner, D B; Toussaint, D; Sugar, R 2007-01-01 99 The 2+1 flavor topological...

349

2.1E Supplement  

E-Print Network [OSTI]

V-T VIS-TRANS-SCH VOLUME WASTE-HEAT-USE WEEK-SCHEDULE W-SCHConsumption Gas Heat P u m p Waste Heat Recovery Gas Heat PDefault Sizing Waste Heat Use Simulation Strategy Curves

Winkelmann, F.C.

2010-01-01T23:59:59.000Z

350

BMP4 sufficiency to induce choroid plexus epithelial fate from embryonic stem cell-derived neuroepithelial progenitors  

E-Print Network [OSTI]

incubated with 8 uM Vybrant CFDA-SE Cell Tracker dye (LifeRiver) followed by Vybrant CFDA-SE dye labeling as describedonly those cells that were CFDA-SE/Hoechst colabelled and

2012-01-01T23:59:59.000Z

351

E-Print Network 3.0 - alborz mountains northern Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Variation of Moho depth in the central part of the Alborz Mountains, northern Iran A. Radjaee,1 D... form 2009 September 9 S U M M A R Y The Alborz Mountains of northern...

352

PRELIMINARY THERMAL AND THERMOMECH-ANICAL MODELING FOR THE NEAR SURFACE TEST FACILITY HEATER EXPERIMANTS AT HANFORD: Appendix D  

E-Print Network [OSTI]

Heater Experiments at Hanford V O L U M E II (Appendix D) TENG-48 and for Rockwell Hanford Operations a Department ofFACILITY HEATER EXPERIMENTS AT HANFORD Volume 2 (Appendix D)

Chan, T.

2011-01-01T23:59:59.000Z

353

administered cadmium tracer: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

G A N D B O H U M I L V Sargassum fluitans biomass was accompanied by the release of hydrogen protons from the biomass. The uptake the overall biosorption rate of cadmium ions in...

354

A report by Civic Enterprises and the National Peace Corps Association in partnership with Peter D. Hart Research Associates  

E-Print Network [OSTI]

. Hart Research Associates By: John M. Bridgeland, Harris Wofford, Kevin F.F. Quigley, Jessica A. Milano PASSPORTS--ONE STAMPED AMERICAN,PASSPORTS--ONE STAMPED AMERICAN, T H E O T H E R H U M A N B E I N G . W E A R ET H E O T H E R H U M A N B E I N G . W E A R E MEMBERS OF THE SAME GREAT RACE, BUTMEMBERS

Fraden, Seth

355

In vitro regulation of porcine Leydig cell steroidogenesis by insulin-like growth factor I (IGF-I) and the phorbol ester 12-myristate-13- acetate (PMA)  

E-Print Network [OSTI]

LH-stimulated T, Pe and E production. Forskolin (100 uM) stimulated (P c . 05) T and Pe production and this effect was augmented by IGF-I (25 ng/ml). Co-treatment with IGF-I (25 ng/ml) also enhanced dibutyryl cyclic AMP f(Bu)2cAMP]-stimulated T and Pe... porcine Leydig cells were treated with medium alone (Control), PMA (. 000001 to 10 uM), pLH (10 ng/ml) or a combination of PMA and pLH. Addition of PMA alone, at the higher concentrations (, 001 to 10 uM), stimulated (P s F 05) both T and Pe production...

French, Joseph Thomas

2012-06-07T23:59:59.000Z

356

A Grid of NLTE Line-Blanketed Model Atmospheres of Early B-type Stars  

E-Print Network [OSTI]

We have constructed a comprehensive grid of 1540 metal line-blanketed, NLTE, plane-parallel, hydrostatic model atmospheres for the basic parameters appropriate to early B-type stars. The BSTAR2006 grid considers 16 values of effective temperatures, 15,000 K grid complements our earlier OSTAR2002 grid of O-type stars (Lanz & Hubeny, 2003, ApJS, 146, 417). The paper contains a description of the BSTAR2006 grid and some illustrative examples and comparisons. NLTE ionization fractions, bolometric corrections, radiative accelerations, and effective gravities are obtained over the parameter range covered by the grid. By extrapolating radiative accelerations, we have determined an improved estimate of the Eddington limit in absence of rotation between 55,000 and 15,000 K. The complete BSTAR2006 grid is available at the TLUSTY website (http://nova.astro.umd.edu).

Thierry Lanz; Ivan Hubeny

2006-11-29T23:59:59.000Z

357

Oxypurine uptake and metabolism in Neurospora crassa  

E-Print Network [OSTI]

analogues were obta1ned from Sigma Chemical Co. Glass fiber filters (2. 5 cm) and DE-81 cellulose discs were purchased from Whatman Inc. Membran I 1lters (. 45 um pore size) were from Gelman Inc. [ I4C] puri ne uptake and incorporation into 6T...M MgC12, and O. lmM dithiothreitol (OTT), pH=7. 5 L&4C]. Purine concentrations ranged from 2. 5uM to 250uM. Specific activity of radio- active purines was usually 10 ~Ci/umole. Assays were initiated by the addition of the enzyme extract to give a...

Garber, Theodore Lee

2012-06-07T23:59:59.000Z

358

From Domestic Farce to Abolitionist Satire: Reinhold Solger's Reframing of the Union (1860)  

E-Print Network [OSTI]

, and to marry only with her uncle's consent. (Sterling's name, which suggests a person o f excellent character, already signals Solger's unequivocal choice o f husband for Emily.) W h e n Sterling secretly visits Emily that evening, Humdrum also arrives; like... not by Sterl ing but by S a m b o , the coachman, who climbs through a window to fetch Sally, a female slave in Olivebranch's household, and escape with her to the N o r t h ; H u m d r u m flees, only to be captured by members o f the Vig ilance C o m m i...

Vanchena, Lorie A.

2005-01-01T23:59:59.000Z

359

625 E. Liberty St. Ann Arbor, MI 48104 (734) 615-8230 graham.umich.edu November 2013  

E-Print Network [OSTI]

Hydraulic Fracturing in Michigan Integrated Assessment Discussion Points 1. What is being done? A holistic evaluation of the impacts of hydraulic fracturing in Michigan through a research-based partnership of University of Michigan (U-M) institutes, centers, and faculty. Hydraulic fracturing has the potential

Kamat, Vineet R.

360

University of Toronto FACULTY OF APPLIED SCIENCE AND ENGINEERING  

E-Print Network [OSTI]

and Engineering (FASE) Mr. Renzo Basset, Director of Technical Services, Department of Civil Engineering ProfessorUniversity of Toronto FACULTY OF APPLIED SCIENCE AND ENGINEERING OFFICE OF THE DEAN M E M O R A N D U M 2007/08-02 TO: Faculty, Staff and Students Members of the Department of Civil Engineering FROM

Prodiæ, Aleksandar

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Cadmium Biosorption Rate in Protonated Sargassum Biomass  

E-Print Network [OSTI]

Cadmium Biosorption Rate in Protonated Sargassum Biomass J I N B A I Y A N G A N D B O H U M I L V Sargassum fluitans biomass was accompanied by the release of hydrogen protons from the biomass. The uptake the overall biosorption rate of cadmium ions in flat seaweed biomass particles. The overall biosorption

Volesky, Bohumil

362

Suckermouth catfishes (aka "plecos") are very popular in the aquarium trade due to their hardiness and longevity. As a result, this group of species has joined the ranks of the many  

E-Print Network [OSTI]

: Suckermouth Catfish 1 Science: Acoustic Invasion 2 More Science: Chytrid Vector 2 Reevaluating `Away -Field: Vermiculated sailfin catfish #12;V o l u m e 5 , I s s u e 2 ­ P g . 2 Science: Acoustic Invasion In natural in comparison to urban noise pollution. Human-related noise pollution arises from a variety of sources

Jawitz, James W.

363

I N S T I T U T F U R I N F O R M A T I K Automotive Architecture Framework  

E-Print Network [OSTI]

T U M I N S T I T U T F ¨U R I N F O R M A T I K Automotive Architecture Framework: Towards Automotive Architecture Framework: Towards a Holistic and Standardised System Architecture Description architecture development for the automotive industry. It outlines best practices and methods and introduces

Broy, Manfred

364

PALEOZOIC TRACE FOSSILS FROM THE KUFRA BASIN, LIBYA  

E-Print Network [OSTI]

PALEOZOIC TRACE FOSSILS FROM THE KUFRA BASIN, LIBYA BRIAN R. TURNER AND MICHAEL J. BENTONPaleozoicsuccessionin the southeastern part ofthe Kufra Basin, Libya, comprises a sequence of sedimentary facies up to 250 m thick THEK u m BASINin southeast Libya (Figure 1)occupiesan area of about 400,000km2and is filled

Benton, Michael

365

E-Print Network 3.0 - advantageous metal ion Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ion Exchange in Biosorption S I L K E S C H I E W E R A N D B O H U M I L V O... heavy metals often through ion exchange. This biosorption can be used for purification of...

366

Condensation Particle Counter  

E-Print Network [OSTI]

Model 3007 Condensation Particle Counter Operation and Service Manual 1930035, Revision C August 2002 P a r t i c l e I n s t r u m e n t s #12;#12;Model 3007 Condensation Particle Counter Operation............................................................................V 1. UNPACKING AND PARTS IDENTIFICATION..................................1 Unpacking the Condensation

Weber, Rodney

367

Positioning the performance of public service. When management tools are in conflict : the case of urban water management  

E-Print Network [OSTI]

the conflict between new and existing performance management tools in a large urban public service3 . We usePositioning the performance of public service. When management tools are in conflict : the case of urban water management Marie Tsanga Tabi, U.M.R Cemagref-ENGEES "Management of Public Services", 1 quai

Paris-Sud XI, Université de

368

IOP PUBLISHING and INTERNATIONAL ATOMIC ENERGY AGENCY NUCLEAR FUSION Nucl. Fusion 49 (2009) 104010 (12pp) doi:10.1088/0029-5515/49/10/104010  

E-Print Network [OSTI]

IOP PUBLISHING and INTERNATIONAL ATOMIC ENERGY AGENCY NUCLEAR FUSION Nucl. Fusion 49 (2009) 104010. Zwingmann CEA, IRFM, F-13108 St Paul-lez-Durance, France 1 Associazione EURATOM-ENEA sulla Fusione, C;Nucl. Fusion 49 (2009) 104010 G. Giruzzi et al 9 LJAD, U.M.R. C.N.R.S. No 6621, Universit´e de Nice

?cole Normale Supérieure

369

Practicum Handbook A Guide for Teacher Candidates, Associate Teachers,  

E-Print Network [OSTI]

: #12;P R A C T I C U M H A N D B O O K 13 Roles & Responsibilities of Candidates The structure theoretical, practical, and experiential knowledge in the understanding and resolution of professional issues that go beyond immediate pressures of daily practice, and who has a disposition to work in collaboration

Abolmaesumi, Purang

370

The significance of local water resources captured in small reservoirs for crop production A global-scale analysis  

E-Print Network [OSTI]

modelling Food security Crop yield s u m m a r y Rainwater harvesting, broadly defined as the collection significance, rainwater harvesting in small reser- voirs has previously been overlooked in large data and other physical datasets to explore the potential role of small, localized rainwater harvesting

Douglas, Ellen M.

371

G. Vlad et al. THEORY OF FUSION PLASMAS -Varenna, Italy, 28/8-1/9, 2006 1 Interaction of fast particles and  

E-Print Network [OSTI]

G. Vlad et al. THEORY OF FUSION PLASMAS - Varenna, Italy, 28/8-1/9, 2006 1 Interaction of fast. Shinohara, M. Ishikawa and M. Takechi (JT-60U); M. Schneider (CRONOS codes) #12;G. Vlad et al. THEORY et al. THEORY OF FUSION PLASMAS - Varenna, Italy, 28/8-1/9, 2006 3 Introduction - 1 · Next generation

Vlad, Gregorio

372

EMPLOYEE FUEL ACCESS APPLICATION Use this application to request access for employees to use the campus service stations in conjunction with a fuel  

E-Print Network [OSTI]

EMPLOYEE FUEL ACCESS APPLICATION Use this application to request access for employees to use the campus service stations in conjunction with a fuel access device. In order to obtain fuel from for access. Employee access is not required for the U-M fleet vehicle equipped with an automated fuel device

Kirschner, Denise

373

OCTOBER 2010 SPECIAL INSTRUCTIONS TO DESIGNERS SID-S SUSTAINABLE PRODUCTS PORTFOLIO  

E-Print Network [OSTI]

by the Sustainability Team at the University of Michigan (U-M) Department of Architecture, Engineering & ConstructionSID-S OCTOBER 2010 SPECIAL INSTRUCTIONS TO DESIGNERS SID-S SUSTAINABLE PRODUCTS PORTFOLIO Page 1 of 2 SUSTAINABLE PRODUCTS PORTFOLIO General The Sustainable Products Portfolio (SPP) is maintained

Kamat, Vineet R.

374

Geophys. J. Int. (1997) 129,439-449 Shear-wave anisotropy and the stress field from borehole recordings  

E-Print Network [OSTI]

Geophys. J. Int. (1997) 129,439-449 Shear-wave anisotropy and the stress field from borehole of Earth Sciences, University of Southern California, Los Angeles, CA 90089-0740, USA Accepted 1997 January 16. Received 1997 January 14; in original form 1995 August 30. S U M M A R Y 53 local earthquakes

Edinburgh, University of

375

UBC Social Ecological Economic Development Studies (SEEDS) Student Report Joshua Power  

E-Print Network [OSTI]

the UBC LCA Project which aims to support the development of the field of life cycle assessment (LCA Summary This study, a life cycle assessment (LCA) of the Earth Sciences Building (ESB) serves t y o f B r i t i s h C o l u m b i a Life Cycle Assessment: Earth Sciences Building #12;ii Executive

376

LITHIUM LITERATURE REVIEW: LITHIUM'S PROPERTIES AND INTERACTIONS  

Office of Scientific and Technical Information (OSTI)

analyses, t h e h i g h p u r i t y gases were passed through a column o f anhydrous magnesium p e r c h l o r a t e . wet gases o f 50% r e l a t i v e h u m i d i t y a t room...

377

Microscale effects of light on redox zonation in seagrass sediments  

E-Print Network [OSTI]

+) (uM) 2 0 and Fe (II+) 0rM) 2 Fig. 9. Average profiles of oxygen, iron, and sulfide for site Z2 initial concentrations (a) and after 6 hours of light exposure (b) (Note in (b), Fe ' is below detection limits). 30 In the two averaged profiles shown...

Hebert, Andrew Brian

2012-06-07T23:59:59.000Z

378

Geophys. J. Int. (2009) 176, 431442 doi: 10.1111/j.1365-246X.2008.03975.x GJIGeomagnetism,rockmagnetismandpalaeomagnetism  

E-Print Network [OSTI]

a geothermal gradient of 25.4 ± 8 K km-1 . Key words: Electrical properties; Magnetotelluric; Marine to a man-made source of energy is measured, are also sometimes used (e.g. Gomez- Trevino & Edwards 1983; H form 2007 November 25 S U M M A R Y Marine magnetotelluric (MT) and marine controlled-source

Constable, Steve

379

Construction of the noncommutative complex ball  

SciTech Connect (OSTI)

We describe the construction of the noncommutative complex ball whose commutative analog is the Hermitian symmetric space D = SU(m, 1)/U(m), with the method of coherent state quantization. In the commutative limit, we obtain the standard manifold. We also consider a quantum field theory model on the noncommutative manifold.

Wang, Zhituo, E-mail: zhituo@mat.uniroma3.it [Dipartimento di Matematica, Universit di Roma Tre Largo S. L. Murialdo 1, 00146 Roma (Italy)

2014-09-15T23:59:59.000Z

380

SPECTRA OF CRITICAL EXPONENTS IN NONLINEAR HEAT EQUATIONS WITH ABSORPTION  

E-Print Network [OSTI]

SPECTRA OF CRITICAL EXPONENTS IN NONLINEAR HEAT EQUATIONS WITH ABSORPTION V.A. GALAKTIONOV AND P of the classical porous medium equation with absorption u t = #1;u m u p in R N #2; R+ change their large-time behaviour at the critical absorption exponent p 0 = m+2=N . We show that, actually, there exists an in#12

Bath, University of

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


382

A Revision of the Genera Pelomyia Williston  

E-Print Network [OSTI]

A Revision of the Genera Pelomyia Williston and Masoniella Vockeroth (Diptera: Tethinidae) GEORGE A O G Y · N U M B E R 6 1 9 A Revision of the Genera Pelomyia Williston and Masoniella Vockeroth. Mathis. A Revision of the Genera Pelomyia Williston and Masoniella Vockeroth (Diptera: Tethinidae

Mathis, Wayne N.

383

the university of michigan 2007 annual environmental report  

E-Print Network [OSTI]

the university of michigan 2007 annual environmental report #12;table of contentsU-M 2007 Annual Environmental Report Figures 3 Executive Summary 4 Introduction 6 The Move Toward Sustainability 8 Environmental Reporting at the University of Michigan 8 Report Objectives 9 Report Element and Scope 9 Environmental

Eustice, Ryan

384

michigan architecture 20082009  

E-Print Network [OSTI]

2008­2009 michigan architecture Programs + Courses #12;#12;2008­2009 ARCHITECTURE PROGRAMS + COURSE This bulletin provides an overview of policies, procedures, degree options, and courses for the U-M architecture of Architecture + Urban Planning 2150 Art + Architecture Building 2000 Bonisteel Boulevard Ann Arbor, MI 48109

Kamat, Vineet R.

385

BERKSHIRE ENCYCLOPEDIA OF SUSTAINABILITY  

E-Print Network [OSTI]

BERKSHIRE ENCYCLOPEDIA OF SUSTAINABILITY V O L U M E S 1-10 A ground-breaking interdisciplinary@berkshirepublishing.com | Tel +1 413 528 0206 19 April, 2012 In the 10-volume Berkshire Encyclopedia of Sustainability, experts, regional sustainability issues, and resource and ecosystem management. The ten volumes are available

Kammen, Daniel M.

386

STUDENT ORGANIZATION VEHICLE RENTAL FORM Use this form in conjunction with a vehicle reservation form to request a rental vehicle from University of Michigan  

E-Print Network [OSTI]

STUDENT ORGANIZATION VEHICLE RENTAL FORM Use this form in conjunction with a vehicle reservation form to request a rental vehicle from University of Michigan (U-M) Parking and Transportation Services Services to confirm vehicle availability before submitting a request. Form Instructions: Complete each

Kirschner, Denise

387

MOTOR VEHICLE RECORD AUTHORIZATION This form authorizes Parking and Transportation (PTS) Fleet Services to conduct a motor vehicle record check to  

E-Print Network [OSTI]

MOTOR VEHICLE RECORD AUTHORIZATION This form authorizes Parking and Transportation (PTS) Fleet Services to conduct a motor vehicle record check to verify eligibility to operate University of Michigan (U-M) vehicles. Form Instructions: Complete each section of the form Print and fax

Kirschner, Denise

388

A graphical method to study suspended sediment dynamics during flood events in the Wadi Sebdou, NW Algeria (19732004)  

E-Print Network [OSTI]

A graphical method to study suspended sediment dynamics during flood events in the Wadi Sebdou, NW sediment concentration Semiarid watershed Flood Wadi Algeria s u m m a r y Small sub-basins are numerous period (19732004) was analyzed at the outlet of the Wadi Sebdou basin (256 km2 ) in northwest Algeria

389

Modeling Multi-Metal Ion Exchange in Biosorption  

E-Print Network [OSTI]

, may serve as a means for purifying industrial wastewaters that contain toxic heavy metal ions heavy metals often through ion exchange. This biosorption can be used for purification of metalModeling Multi-Metal Ion Exchange in Biosorption S I L K E S C H I E W E R A N D B O H U M I L V O

Volesky, Bohumil

390

Spring 2002 ASME/API Gas Lift Workshop, February 5-6, 2002, Houston, Texas.  

E-Print Network [OSTI]

the fluid density, u (m/s) the fluid flowing velocity and a (m/s) the speed of sound in the fluid. The speed of sound in the fluid is equivalent to the propagation speed of the pressure pulse generated. A typical effective. The use of pressure pulse technology for production testing, giving production rate of gas-liquid

Gudmundsson, Jon Steinar

391

Geophys. J. Int. (2010) 182, 843864 doi: 10.1111/j.1365-246X.2010.04674.x GJIMineralphysics,rheology,heatflowandvolcanology  

E-Print Network [OSTI]

by gas content as well as gas compressibility, both of which vary according to different processes collapses the gas volume near the base of the erupting column for slow eruptions. Once compaction ceases S U M M A R Y Volcanic eruptions involve high-speed turbulent flows of gas and magma mixtures in which

392

Geophys. J. Int. (2011) doi: 10.1111/j.1365-246X.2011.05105.x GJIGeomagnetism,rockmagnetismandpalaeomagnetism  

E-Print Network [OSTI]

,rockmagnetismandpalaeomagnetism A marine electromagnetic survey to detect gas hydrate at Hydrate Ridge, Oregon K. A. Weitemeyer,1 S; in original form 2010 April 8 S U M M A R Y Gas hydrates are a potential energy resource and hazard of controlled source electromagnetic (CSEM) and magnetotelluric (MT) methods to map gas hydrate and free gas

Constable, Steve

393

E-Print Network 3.0 - alouette satellites Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RESEARCH FOREST T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A Summary: of a micro-hydro electric generation facility on the North Alouette River were put on hold due...

394

Changes in sources and storage in a karst aquifer during a transition from drought to wet conditions  

E-Print Network [OSTI]

, and used inverse geochemical modeling (PHREEQC) to con- strain controls on groundwater compositions during more storage. ? 2012 Elsevier B.V. All rights reserved. 1. Introduction Karst groundwater systems Keywords: Karst Drought Telogenetic Edwards aquifer Groundwater Texas s u m m a r y Understanding

Banner, Jay L.

395

Final Scientific/Technical Report  

SciTech Connect (OSTI)

JHU/APL conducted solid propellant fire characterization tests in warm, humid, ambient conditions near sea level. Yttria and ceria surrogate materials were placed in the fires. The substrates simulating ground surfaces were concrete from a Kennedy Space Center launch pad, and steel covered with a protective ablative material representing a launch platform. In-situ instrumentation consisted of witness materials, thermocouples, air handlers, filters, and cascade impactors; remote instrumentation consisted of optical cameras and spectrometers. Test and analysis team members included the Naval Air Warfare Center Aircraft Division, Sandia National Laboratories (SNL), Alliant Techsystems, and the Johns Hopkins University. Test data were analyzed, reported, and delivered, including plume rise and transport captured on video. Derivation of the alumina particle size distributions formed the basis for condensing vapor and agglomeration estimates. Assessment of alumina mass in the plume, along with the surrogate fraction from filter forensics, provided an estimate of airborne surrogate mass. Technical interchange meetings were held with SNL and the Jet Propulsion Laboratory. Specifications for the fire environment were developed and delivered. A thermochemistry model that simultaneously provides the maximum temperature and heat flux was developed and delivered. An SPIE paper on 3D pyrometry of the fire was written and presented.

Chang, Yale [JHU/APL; Thomas, Michael E. [JHU/APL; Siegrist, Karen M. [JHU/APL; Lennon, Andrew M. [JHU/APL; Hunter, Lawrence W. [JHU/APL; Oguz, Hasan O. [JHU/APL

2014-07-01T23:59:59.000Z

396

On the Cosmic Evolution of Fe/Mg in QSO Absorption Line Systems  

E-Print Network [OSTI]

We investigate the variation of the ratio of the equivalent widths of the FeII$\\lambda$2600 line to the MgII$\\lambda\\lambda$2796,2803 doublet as a function of redshift in a large sample of absorption lines drawn from the JHU-SDSS Absorption Line Catalog. We find that despite large scatter, the observed ratio shows a trend where the equivalent width ratio $\\mathcal{R}\\equiv W_{\\rm FeII}/W_{\\rm MgII}$ decreases monotonically with increasing redshift $z$ over the range $0.55 \\le z \\le 1.90$. Selecting the subset of absorbers where the signal-to-noise ratio of the MgII equivalent width $W_{\\rm MgII}\\ge$3 and modeling the equivalent width ratio distribution as a gaussian, we find that the mean of the gaussian distribution varies as $\\mathcal{R}\\propto (-0.045\\pm0.005)z$. We discuss various possible reasons for the trend. A monotonic trend in the Fe/Mg abundance ratio is predicted by a simple model where the abundances of Mg and Fe in the absorbing clouds are assumed to be the result of supernova ejecta and where t...

Dey, Arjun; Rubin, Kate H R; Zhu, Guangtun Ben; Suresh, Joshua

2015-01-01T23:59:59.000Z

397

Multi-University Southeast INIE Consortium  

SciTech Connect (OSTI)

2 Project Summary: The Multi-University Southeast INIE Consortium (MUSIC) was established in response to the US Department of Energys (DOE) Innovations in Nuclear Infrastructure and Education (INIE) program. MUSIC was established as a consortium composed of academic members and national laboratory partners. The members of MUSIC are the nuclear engineering programs and research reactors of Georgia Institute of Technology (GIT), North Carolina State University (NCSU), University of Maryland (UMD), University of South Carolina (USC), and University of Tennessee (UTK). The University of Florida (UF), and South Carolina State University (SCSU) were added to the MUSIC membership in the second year. In addition, to ensure proper coordination between the academic community and the nations premier research and development centers in the fields of nuclear science and engineering, MUSIC created strategic partnerships with Oak Ridge National Laboratory (ORNL) including the Spallation Neutron Source (SNS) project and the Joint Institute for Neutron Scattering (JINS), and the National Institute of Standards and Technology (NIST). A partnership was also created with the Armed Forces Radiobiology Research Institute (AFRRI) with the aim of utilizing their reactor in research if funding becomes available. Consequently, there are three university research reactors (URRs) within MUSIC, which are located at NCSU (1-MW PULSTAR), UMD (0.25-MW TRIGA) and UF (0.10-MW Argonaut), and the AFRRI reactor (1-MW TRIGA MARK F). The overall objectives of MUSIC are: a) Demonstrate that University Research Reactors (URR) can be used as modern and innovative instruments of research in the basic and applied sciences, which include applications in fundamental physics, materials science and engineering, nondestructive examination, elemental analysis, and contributions to research in the health and medical sciences, b) Establish a strong technical collaboration between the nuclear engineering faculty and the MUSIC URRs. This will be achieved by involving the faculty in the development of state-of-the-art research facilities at the URRs and subsequently, in the utilization of these facilities, c) Facilitate the use of the URRs by the science and engineering faculty within the individual institutions and by the general community of science and engineering, d) Develop a far-reaching educational component that is capable of addressing the needs of the nuclear science and engineering community. Specifically, the aim of this component will be to perform public outreach activities, contribute to the active recruitment of the next generation of nuclear professionals, strengthen the education of nuclear engineering students, and promote nuclear engineering education for minority students.

Ayman Hawari; Nolan Hertel; Mohamed Al-Sheikhly; Laurence Miller; Abdel-Moeze Bayoumi; Ali Haghighat; Kenneth Lewis

2010-12-29T23:59:59.000Z

398

AN INVESTIGATION OF SEDIMENT TRANSPORT BEHIND THE TEXAS CITY DIKE  

E-Print Network [OSTI]

.1 1 10 100 1000 Particle Size (m) 0 2 4 6 8 10 12 14 16 18 20 22 24 Vo l u m e ( % ) Averaged Result-1A-77-80, Tuesday, September 12, 2006 1:39:12 PM Averaged Result-1A-80-86, Tuesday, September 12, 2006 1:47:08 PM... 16 18 20 22 24 Vo l u m e ( % ) Averaged Result-1A-141-150, Tuesday, September 12, 2006 2:34:19 PM Averaged Result-1A-151-160, Tuesday, September 12, 2006 2:40:45 PM Averaged Result-1A-161-170, Tuesday, September 12, 2006 2:47:37 PM Averaged...

Taylor, April

2007-09-17T23:59:59.000Z

399

A modification of the carry-propagation-free adder in a redundant binary multiplier  

E-Print Network [OSTI]

multiplier uses 00, 01, and 11 as 0, 1, and 22 c IZ c ?2 c IE IZ IZ IZ IZ IZ W W c IS IS IS c IS Fig. 9. A Block Diagram of the CLA 23 1, respectively. This modified SD number representation eliminates the need for zs and ys(see Fig. 7), which... 39 C. Th. . Modified IZ Cell D. The Previous IZ Cell E. The lS Cell 41 APPEiVDIX THE EXTRACTED SPICE SOURCE FILES A. The Modified CPF Adder Cell Ml 4 5 6 7 CMOSP L=2. 0U W=6. 0U M2 1 8 4 7 CMOSP L=2, 0U W=6. 0U M3 9 5 1 7 CMOSP L=2. 0U W=6...

Park, Jinsoo

2012-06-07T23:59:59.000Z

400

The Ether Extract and the Chloroform Extract of Soils.  

E-Print Network [OSTI]

KNJJUG................................................................................................................Mailing Clerk STATE AGRICULTURAL EXPERIMENT STATIONS. H U M T 9 L 3L H G U . 9 Z R 11 3J X C I T P P T L I 0 Y uUM T 9 L U 9 0. B. A U P s S 3 D D ...................................................... Austin t 3 T S D T L . L D 1u U M T 9 L U 9 i 3 P P... n R r . 0 T J ......................................................Brownwood A U O O 3J J 3U L T 9 U o V H 9 3 I S P D S 9 T X Z w R dU L T ...................................................... Austin DIRECTOR OF EXPERIMENT STATIONS. B. l U...

Fraps, G. S.; Rather, J. B.

1913-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Continuous Commissioning of the Austin City Hall  

E-Print Network [OSTI]

areas. AHUs 5, 6 and 9 have cooling and reheat coils on the mixed air duct to maintain the discharge air temperature, as seen on Figure 2. The VFD modulates to maintain the duct static pressure setpoint. AHUs 1, 2, 3, 4 and 7 have the main preheat...?t possess duct static pressure sensors. Of all 10 major AHUs, AHUs 1 and 9 are required to run 24/7. H o t W a t e r P u m p 2 H o t W a t e r P u m p 1 H o t W a t e r R e t u r n H o t W a t e r S u p p l y B o i l e r B y p a s s V...

Yagua, C.; Zhou, J.; Wei, G.; Deng, S.; Turner, D.; Parker, J.

402

Questions  

E-Print Network [OSTI]

N o t e t h a t t h e sam e p h e n o m e n o n o c c u r s w h e n t h e rea l n u m b er s are re ga r de d a s a su bfie ld o f t h e c o m p l e x fi e ld ,. a n d it a l so o ccu...

CamScanner

2014-06-17T23:59:59.000Z

403

If a government or NGO (a nongovernmental, nonprofit organization) of a developing country decides that infor-  

E-Print Network [OSTI]

Upon U N D E R D E V E L O P M E N T Edwin Blake University of Cape Town edwin@cs.uct.ac.za Editor: Gary Marsden u University of Cape Town u gaz@acm.org F u O u R u U u M ©Dan Blake is a professor in the department of computer science at the University of Cape Town, South Africa

Blake, Edwin

404

BANCROFTIANA NE W S L E T T E R O F T H E FR I E N D S O F T H E BA N C R O F T LI B R A RY  

E-Print Network [OSTI]

BANCROFTIANA NE W S L E T T E R O F T H E FR I E N D S O F T H E BA N C R O F T LI B R A RY N U M B-1836. In the role of offi- cial artist, Lewis had accompanied Tho- mas L. McKenney, Superintendent of the Bureau the portraits when he returned to Detroit. Learning that McKenney planned to publish a "Portrait Gallery

California at Berkeley, University of

405

GM Project G.6 R -1 October 2000 Administration on Aging. 1997.Demographic Changes. U.S. Department of Health and  

E-Print Network [OSTI]

://www.aoa.gov/factsheets/Transportation.html. American Health Care Association. 1997. The Nursing Home Facility Sourcebook: Facts and Trends 1997. p. 7. American Health Care Association. 1998. "The Looming Crisis." http://www.ahca.org/secure/nfres.htm and http.S. Department of Health and H u m a n S e r v i c e s . W a s h i n g t o n , D . C . http

406

Differential Effects of Insulin Resistance on Leucine and Glucose Kinetics in Obesity  

E-Print Network [OSTI]

of primed, constant infusions of D-[6,6-ZHz]glucose and L-[1-13C]leucine. Each subject participated in two insulin clamp studies on separate days, at infusion rates of 10 and 40 mU (m2 . minI"'. producing plasma)-', respectively), and its decline in response to insulin infusion was also comparable (8% and 10% during the 10-m

Wurtman, Richard

407

Depositional facies and environments of the lower Mineral Wells formation, Pennsylvanian Strawn group, north central Texas  

E-Print Network [OSTI]

Or Q 0 v) X Q &, Q VI C OI c Id Q 0 C VI c e ? '2 mn. po ? 0eO ~e e. & W omocp Emetic gw o m c U m v) m ? ?o 0 m g) ? xc 0 Q 'VI ? VI C C 0 m c ae "Qm a)c E hc Ol- CLc 0 E0p (Bcm&m ops LL ? omId? 35 the naked eye (Wright, 1985). Silty...

Bradshaw, Susan Elizabeth

1996-01-01T23:59:59.000Z

408

The effect of burning, under proper grazing, on bluestem pastures in the Flint Hills of Kansas in relation to the botanical, chemical, and nutritional composition of the vegetation  

E-Print Network [OSTI]

s ........................................ M+ Steer G r a d e s ...................................... 52 S U M M A R Y .................................................. 56 LITERATURE CITED ........................................ ..60 Page I. Precipitation by month and year...-soil relationships on the pastures Anderson and F l y (1955) delineated six range sites. Plate 1 shows these sites. Site 1 presented the largest comparable grass sampling area among all the pastures. All other sites with the possible exception of Site 2 make up...

Smith, Edgar F.

2013-10-04T23:59:59.000Z

409

A disease of swine caused by a chromobacterium species  

E-Print Network [OSTI]

?Pa(y.?h.b.PO< TABLE OF CONTENTS x? pPOTa?mrOpaP O9, 1gs,'s, w'us,1 VS r9Q6M6V'w4, Q?uM ?g6?'w,uM 9's 864 V,,8 1,swQgV,1 JQ,?g6us?S g8 sAg8,? p4 A's w68sg1,Q,1 65 su55gwg'84 gM? J6Q4'8w, 56Q ' 1gss,Q4'4g68 JQ6V?,M 56Q 49, 56??6Ag8C Q,'s68s7 ?'? p4 'JJ,'Qs 's '8... 'wu4, 6Q w9Q68gw J8,uM68g'? ls 49gs CQ6uJ 6 5 1gs,'s,s gs Q,?'4g? ,?S J66Q?S u81,Qs4661 g8 sAg8, _T g4 A's w68sg1,Q,1 1,sgQ'V?, 46 g8?,s4gC'4, 49, w681g4g68? ?V? O9, 1gs,'s, '?s6 6wwuQs g8 9uM'8s '81 49,Q,56Q, 9's J 6ssgV?, JuV?gw 9,'?49 'sJ,w4s...

Sippel, William Lawrence

1955-01-01T23:59:59.000Z

410

Microsoft Word - winter.doc  

U.S. Energy Information Administration (EIA) Indexed Site

9, 1998 http:www.eia.doe.gov A v e r a g e T e m p e r a t u r e f o r F o u r M a jo r G a s C o n s u m in g M e t r o A r e a s 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 1 0 1 9 8 1...

411

Microsoft Word - winter.doc  

U.S. Energy Information Administration (EIA) Indexed Site

0, 1998 http:www.eia.doe.gov A v e r a g e T e m p e r a tu r e fo r F o u r M a jo r G a s C o n s u m in g M e tr o A r e a s 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 1 0 1 9 8 1 0...

412

Microsoft Word - winter.doc  

U.S. Energy Information Administration (EIA) Indexed Site

7, 1998 http:www.eia.doe.gov A v e r a g e T e m p e r a t u r e fo r F o u r M a jo r G a s C o n s u m in g M e t r o A r e a s 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 1 0 1 9 8 1...

413

Exploratory energy research program at the University of Michigan. Progress report  

SciTech Connect (OSTI)

A DOE grant to the University of Michigan for an Exploratory Energy Research Program is being used by the U-M Office of Energy Research (OER) to support faculty research and grad student research assistantships. Progress on activity during the first six months of the program is described and brief status reports on 20 energy-related faculty research projects in the physical, engineering, biological, and behavioral sciences are presented.

Kerr, W.

1980-12-08T23:59:59.000Z

414

CLIMATE CHANGE E D U C A T I O N  

E-Print Network [OSTI]

2 0 1 2 CLIMATE CHANGE E D U C A T I O N S Y M P O S I U M February 23, 2012 1 p.m.-5 p.m. Michigan change education and discuss how best to teach about climate change within a variety of educational students with useful information about the scholarship of teaching climate change, research and job

415

Status: Checked out and editable. Level 0 Data  

E-Print Network [OSTI]

wind direction) w Wind speed w m/s mm/s, cm/s Vertical wind speed Tsonic Sonic temperature °C K, cK, c Variables u Wind speed u m/s mm/s, cm/s Horizontal wind speed (usually oriented into prevailing wind direction) v Wind speed v m/s mm/s, cm/s Horizontal wind speed (usually oriented lateral/cross to prevailing

416

The Effect of Energy Prices on Operation and Investment in OECD Countries: Evidence from the Vintage Capital Model  

E-Print Network [OSTI]

www.electricitypolicy.org.uk E P R G W O R K IN G P A P E R N O N -T E C H N IC A L S U M M A R Y The Effect of Energy Prices on Operation and Investment in OECD Countries: Evidence from the Vintage Capital Model EPRG Working Paper... 0922 Cambridge Working Paper in Economics 0933 Jevgenijs Steinbuks, Andreia Meshreky, and Karsten Neuhoff Empirical analysis of the effect of energy prices on energy use has been so far limited by the ability of econometric models to reflect...

Steinbuks, J; Meshreky, A; Neuhoff, Karsten

417

The gestation-dependent variation in aflatoxin B? activation by rat liver microsomes  

E-Print Network [OSTI]

females activated AFBt 21'/o to 28/o more, respectively, than male and female controls at the 100uM AFBt dose. In the Salmonella mediated mutagenicity assay, microsomes from the 10-day pregnant female activated AFB& only 2/o greater than the female... control and 71/o less than the male control at the lowest level of activation and highest AFB~ dose tested; microsomes from the 20-day pregnant female produced a nonmutagenic response. When AFBt was used as a test toxin in the embryo culture assay...

Wall, Florence Elizabeth

2012-06-07T23:59:59.000Z

418

Turbercidin metabolism in Neurospora crassa  

E-Print Network [OSTI]

of 14C incorporated into the acid-soluble nucleotide pools of germinated pvr-l, tub conidia incubated with 10 nM [8- 4C] adenosine, 2 pCi/uMol for 20 min 22 g d l g N d~p md' ppl mented with tubercidin (to 100 uM) Anion-exchange elution profile... f ~N d' ppl d with tubercidin (to 100 nial) . Top row (left to right) Ryr-l, tubR ungerminated conidia, conidia germinated 60 min, conidia germinated 4 h. Bottom row (left to right) wild type ungerminated conidia, conidia germinated 60 min...

Lyda, Timothy Stuart

1982-01-01T23:59:59.000Z

419

Age-Related Increases in the Shoulder Strength of High School Wrestlers  

E-Print Network [OSTI]

) 0 ) "s 's -c m n 1 ity ) CO cIS TJ O m .. o ta n' CO c oo .2 > c 3 "5 O g i l l - ^ * CO "D . t TJ ro 5 " TJ CM " d' ^ .2 ^ "TO A 0) a ^ "ni CO... en H CO 8 oo CO CM CM H -H f^ lO CM f^ cy 2 C) CO CM +H CO CO s CO CM -H in CO 2 CD iL L- C O p O COS Z 5 CD U. U . .^ m u. u. c - E CO GO >E '" o o o < OO...

Housh, Terry J.; Hughes, Rommie J.; Johnson, Glen O.; Housh, Dona J.; Wagner, Loree L.; Weir, Joseph P.; Evans, Sharon A.

1990-01-01T23:59:59.000Z

420

Rev. Introduction to Environmental Science  

E-Print Network [OSTI]

chapters discuss the water cycle, water pollution, and managing of aquatic resources. In similar fash ion, a chapter on the atmosphere, weather, and cli mate is followed by chapters on air pollution and air-quality management. The final four chapters... is diverse and broad, but lacks the rigor and depth characteristic of biological science textbooks. Part I I , making up over one-half of the text, treats 5 6 8 THE QUARTERLY REVIEW OF BIOLOGY V O L U M E 6 1 environmental quality and management. Three...

Armitage, Kenneth

1986-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Dynamics of the UK Natural Gas Industry: System Dynamics Modelling and Long-Term Energy Policy Analysis  

E-Print Network [OSTI]

www.eprg.group.cam.ac.uk E P R G W O R K IN G P A P E R N O N -T E C H N IC A L S U M M A R Y DYNAMICS OF THE UK NATURAL GAS INDUSTRY: SYSTEM DYNAMICS MODELLING AND LONG-TERM ENERGY POLICY ANALYSIS EPRG Working Paper 0913... Cambridge Working Paper in Economics 0922 Kong Chyong Chi , David M. Reiner and William J. Nuttall The UK offshore natural gas and oil industry has a long and successful history and has been said to represent the pride of UK...

Chi, K C; Reiner, David; Nuttall, William J

422

Evaluation of permanent magnets for high temperature operations  

E-Print Network [OSTI]

250 276 300 25 60 0 Temperature ( C) Fig. B. Tractive Force per unit Volume of Ni Cylinder vs. Temperature for barium ferrite. 'I. 2 1. 'I 'I. O O. e 0. 6 0. 7 Unannaallad ~ m g 0. 4 0. 6 OA 0. 3 0. 2 0. 1 0. 0 Cooling A noalls 24... 425 4% 0 75 '100125150175200225250275 0 Temperature ( C) 0 20 a 30 + 10 x 40 v SO Fig. lla. Tractive Force per unit Volume of Ni Cylinder vs. Temperature for Alnico 8, annealled from 0 to 50 hours in 10 hour steps. M E u m m 0 &i 'o 0 8 u...

Van Hees, Elizabeth

2012-06-07T23:59:59.000Z

423

Effect of environmental exposure on the stiffness and energy loss properties of nitrile elastomers  

E-Print Network [OSTI]

. Power Sections The design and utilization of power sections has been extensively d o c u m e n t e d . 2 ' 3 ' 4 ' 5 ' 6 , 7 The downhole power sections consist of a metal tube lined with an elastomer compound, stator, and a metal rotor. Figure 2... furnace CO .E o ~^ V) CD > CO CO 0) Q_ o o u _D _Q C O _Q L_ O (J o CO CD Q_ CO c 0) c E CD U L_ 0 c cr 1 in Table VI Compression Modulus for Three Types of Carbon Black Compound Compression modulus (MPa) M - 3 a 7.1 M...

Colmenero, Michael Adam

1994-01-01T23:59:59.000Z

424

Notes 02. Dynamic response of second order mechanical systems  

E-Print Network [OSTI]

frequency. Is this response the maximum ever expected? Explain. Recall that system periodic response is () ( )cos( ) s Xt XHr t ?=?+ Solution. From the amplitude of FRF () 2 22 1 () 1(2) s X Hr X rr? == ?+ Set r=r a = 1.2 and |X... that u=m e/M, where m is the imbalance mass and e is its radial location ( ) 2 cosM XDXKXMu t++=?? #0;#5;#0;#5; #0;#5; Recall that system periodic response is () ( )cos( )Xt uHr t ?=?+ a) What is the value of damping ? necessary so...

San Andres, Luis

2008-01-01T23:59:59.000Z

425

Glucose oxidation in heart-type fatty acid binding protein null mice  

E-Print Network [OSTI]

of Genetics Faculty, James R. Wild August 2006 Major Subject: Genetics iii ABSTRACT Glucose Oxidation in Heart-Type Fatty Acid Binding Protein Null Mice. (August 2006) Sean Adhikari, B.S., University of Washington Chair of Advisory... was incubated in media solely containing the above reagents, and the other muscle was incubated in media containing the above reagents supplemented with either 1 mM palmitic acid, 2 mU/mL insulin (Humulin R), 2 mM AICAR, 0.5 mM 2,4- dinitrophenol (DNP), or a...

Adhikari, Sean

2006-10-30T23:59:59.000Z

426

Designing the Future Energy System for Cleaner Air: A National Laboratory Perspective  

E-Print Network [OSTI]

responsibilities includeenergy conservation, energy-related researchand domestic energy production. DOE sponsors more research in the physical sciences than any other U.S. federal agency, the majority of which is conducted through its system of National... Through Efficiency Conference, Dallas, Texas Nov. 18-20 9372 287 226 155 117 82 26 0 50 100 150 200 250 300 350 400 E l e c t r i c i t y C o n s u m p t i o n ( T W h ) End Use Commercial Buildings Site Electricity Consumption (2008) Lighting MELs...

Cale, J.

2014-01-01T23:59:59.000Z

427

The use of oils in insect management in cotton in the blacklands of Texas  

E-Print Network [OSTI]

fleahopper (CFH), u m B, :. riatus (Reuter); the tarnished plant bug (TPB), ~ :' olaris (Palisot de Beauvois); the boll weevil, /~ho gLus g~~i Boheman, the bollworm, Heliothis gga (Boddie), the tobacco budworm, Hy~l'ops y~Bce~ (F. ), and the pink b*11 o... (DeSoto Incorporated, Harahan, La. ) by oil volume; 4) 46. 75 liters water-CSO/ha (10:1) plus 5% Armul 535 by oil volume; 5) methomyl at 0. 14 kg [AI]/ha in 4. 68 liters Orchex 796/ ha; 6) methomyl at 0. 14 kg [AI]/ha in 4. 68 liters CSO/ha and 7...

McCaa, James Patrick

2012-06-07T23:59:59.000Z

428

Volume 66, Numbers 3&4 (Complete)  

E-Print Network [OSTI]

Tyacke. Woodbridge, Suffolk: Boydell Press, 2006. xiv + 254 pp. + 1 illus. $85.00. Review by P. G. st a n w o o d , un i v e r s i t y o f Br i t i s h co l u m B i a . Nicholas Tyacke is well known to literary and church historians? and to all... EVENTEENTH- ENTURY EWS FALL - WINTER 2008 Vol. 66 Nos. 3&4 Including THE NEO-LATIN NEWS Vol. 56, Nos. 3&4 Se v e n t e e n t h -Ce n t u r y ne w S VOLUME 66, Nos. 3&4 FALL...

Dickson, Donald

2008-01-01T23:59:59.000Z

429

Innovative Energy Efficient Industrial Ventilation  

E-Print Network [OSTI]

?, a law of physics, shows why electricity savings can be high (Figure 5). 0 10 20 30 40 50 60 70 80 90 100 0 102030405060708090100 Air volume [CFM %] Power [H.P. %] P o w e r [ H .P . % ] A i r v o l u m e [ C FM %] C F M = 50 % of b l ast... and dust could settle. An on-demand dust collecting system solves this problem by using a PLC (industrial computer) which calculates necessary air volume based on information from the sensors. The PLC is adjusting the RPM of the fan accordingly...

Litomisky, A.

2005-01-01T23:59:59.000Z

430

Clean Fleet Final Report  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home PageEmerging FuelsRelated4Rogue ValleyValley of the1 S u m m a

431

Comparison of CNG and LNG Technologies for Transportation Applications  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home PageEmerging FuelsRelated4Rogue ValleyValley of the1 S u m m a

432

Compressed Natural Gas and Liquefied Petroleum Gas Conversions: The National Renewable Energy Laboratory's Experience  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home PageEmerging FuelsRelated4Rogue ValleyValley of the1 S u m m

433

Contact information for the U.S. Department of Energy's Clean Cities program staff and for the coordinators of the nearly 100 local Clean Cities coalitions across the country.  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home PageEmerging FuelsRelated4Rogue ValleyValley of the1 S u m

434

Costs Associated With Compressed Natural Gas Vehicle Fueling Infrastructure  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home PageEmerging FuelsRelated4Rogue ValleyValley of the1 S u mCosts

435

Subjects: Trematoda And Trematode Diseases, Part 4: Supergenera and Genera E-G  

E-Print Network [OSTI]

.--Yamaguti, S. , 1958a, 642-643 (in- cludes M i ? ? ? p ? ? ? p h i u m, Patagifer, Episthmium, Echinochasmus, Stephano- prora, Monilifer). ?Yamashita, J. , 1938f, 875,876,877. (ECHINOCHASMUS) Bashkirova, E. L, 1941b, 256, 258(subg. of Echinochasmus.... cochensi Skrjabin, ?. I. ; & Bashkirova, E . ?. , 1956a, 602(for cohensi Rao, 1951). cohensi Krishna Rao.M.S., 1951b, 215-216, figs. l-3(Larus argentatus; i ? t e s t i ? e; Canada). --Leonov, V. ?. , 1956a, 74. colymbi Oshmarin, P. G. , 1950b, 166...

Doss, Mildred A.; Roach, Katharine F.; Breen, Virginia L.

1965-01-01T23:59:59.000Z

436

PROBING THE LOW-REDSHIFT STAR FORMATION RATE AS A FUNCTION OF METALLICITY THROUGH THE LOCAL ENVIRONMENTS OF TYPE II SUPERNOVAE  

SciTech Connect (OSTI)

Type II supernovae (SNe) can be used as a star formation tracer to probe the metallicity distribution of global low-redshift star formation. We present oxygen and iron abundance distributions of Type II SN progenitor regions that avoid many previous sources of bias. Because iron abundance, rather than oxygen abundance, is of key importance for the late stage evolution of the massive stars that are the progenitors of core-collapse supernovae, and because iron enrichment lags oxygen enrichment, we find a general conversion from oxygen abundance to iron abundance. The distributions we present here are the best yet observational standard of comparison for evaluating how different classes of supernovae depend on progenitor metallicity. We spectroscopically measure the gas-phase oxygen abundance near a representative subsample of the hosts of Type II SNe from the first-year Palomar Transient Factory (PTF) SN search, using a combination of Sloan Digital Sky Survey (SDSS) spectra near the SN location (9 hosts) and new longslit spectroscopy (25 hosts). The median metallicity of these 34 hosts at or near the SN location is 12+log(O/H) = 8.65, with a median error of 0.09. The median host galaxy stellar mass from fits to SDSS photometry is 10{sup 9.9} M{sub Sun }. They do not show a systematic offset in metallicity or mass from a redshift-matched sample of the MPA/JHU value-added catalog. In contrast to previous SN host metallicity studies, this sample is drawn from a single survey. It is also drawn from an areal rather than a targeted survey, so SNe in the lowest-mass galaxies are not systematically excluded. Indeed, the PTF SN search has a slight bias toward following up transients in low mass galaxies. The progenitor region metallicity distribution we find is statistically indistinguishable from the metallicity distribution of Type II SN hosts found by targeted surveys and by samples from multiple surveys with different selection functions. Using the relationship between iron and oxygen abundances found for Milky Way disk, bulge, and halo stars, we translate our distribution of Type II SN environments as a function of oxygen abundance into an estimate of the iron abundance, since iron varies more steeply than oxygen. We find that though this sample spans only 0.65 dex in oxygen abundance, the gap between the iron and oxygen abundance is 50% wider at the low-metallicity end of our sample than at the high-metallicity end.

Stoll, R.; Stanek, K. Z.; Pogge, R. W. [Department of Astronomy, Ohio State University, 140 West 18th Avenue, Columbus, OH 43210-1173 (United States); Prieto, J. L. [Department of Astrophysical Sciences, Princeton University, 4 Ivy Lane, Peyton Hall, Princeton, NJ 08544 (United States)

2013-08-10T23:59:59.000Z

437

Characterization of U(VI) Sorption-Desorption Processes and Model Upscaling  

SciTech Connect (OSTI)

The objectives of the overall collaborative EMSP effort (with which this project is associated) were to characterize sorption and desorption processes of U(VI) on pristine and contaminated Hanford sediments over a range of sediment facies and materials properties and to relate such characterization both to fundamental molecular-scale understanding and field-scale models of geochemistry and mass transfer. The research was intended to provide new insights on the mechanisms of U(VI) retardation at Hanford, and to allow the development of approaches by which laboratory-developed geochemical models could be upscaled for defensible field-scale predictions of uranium transport in the environment. Within this broader context, objectives of the JHU-based project were to test hypotheses regarding the coupled roles of adsorption and impermeable-zone diffusion in controlling the fate and transport of U(VI) species under conditions of comparatively short-term exposure. In particular, this work tested the following hypotheses: (1) the primary adsorption processes in the Hanford sediment over the pH range of 7 to 10 are surface complexation reactions of aqueous U(VI) hydroxycarbonate and carbonate complexes with amphoteric edge sites on detrital phyllosilicates in the silt/clay size fraction; (2) macroscopic adsorption intensity (at given aqueous conditions) is a function of mineral composition and aquatic chemistry; and (3) equilibrium sorption and desorption to apply in short-term, laboratory-spiked pristine sediments; and (4) interparticle diffusion can be fully understood in terms of a model that couples molecular diffusion of uranium species in the porewater with equilibrium sorption under the relevant aqueous conditions. The primary focus of the work was on developing and applying both models and experiments to test the applicability of "local equilibrium" assumptions in the modeling interpretation of sorption retarded interparticle diffusion, as relevant to processes of U(VI) diffusion in silt/clay layers. Batch isotherm experiments were first used to confirm sorption isotherms under the intended test conditions and diffusion cell experiments were then conducted to explore the diffusion hypotheses. Important new information was obtained about the role of aqueous calcium and solid calcium carbonate in controlling sorption equilibrium with Hanford sediments. The retarded interparticle diffusion model with local sorption equilibrium was shown to very successfully simulate diffusion at high aqueous concentration of U(VI). By contrast, however, diffusion data obtained at low concentration suggested nonequilibrium of sorption even at diffusion time scales. Such nonequilibrium effects at low concentration are likely to be the result of sorption retarded intraparticle diffusion, and strong U(VI) sorption in the low concentration range.

Bai, Jing; Dong, Wenming; Ball, William P.

2006-10-12T23:59:59.000Z

438

Fabrication development for the Advanced Neutron Source Reactor  

SciTech Connect (OSTI)

This report presents the fuel fabrication development for the Advanced Neutron Source (ANS) reactor. The fuel element is similar to that successfully fabricated and used in the High Flux Isotope Reactor (HFIR) for many years, but there are two significant differences that require some development. The fuel compound is U{sub 3}Si{sub 2} rather than U{sub 3}O{sub 8}, and the fuel is graded in the axial as well as the radial direction. Both of these changes can be accomplished with a straightforward extension of the HFIR technology. The ANS also requires some improvements in inspection technology and somewhat more stringent acceptance criteria. Early indications were that the fuel fabrication and inspection technology would produce a reactor core meeting the requirements of the ANS for the low volume fraction loadings needed for the highly enriched uranium design (up to 1.7 Mg U/m{sup 3}). Near the end of the development work, higher volume fractions were fabricated that would be required for a lower- enrichment uranium core. Again, results look encouraging for loadings up to {approx}3.5 Mg U/m{sup 3}; however, much less evaluation was done for the higher loadings.

Pace, B.W. [Babcock and Wilcox, Lynchburg, VA (United States); Copeland, G.L. [Oak Ridge National Lab., TN (United States)

1995-08-01T23:59:59.000Z

439

Controls on the sulfur cycle in estuarine sediments on the Central Texas coast  

E-Print Network [OSTI]

y S um m e r 0 - 1 4 102 85- 129 13 G en er a ll y c ons t an t w it h de pth 14 0 . 7- 26 3 Dr ops to 0 a t 9 c m S u m m e r 0 - 20 136 65- 576 5 P eak at 5 c m 42 27- 58 9 P e ak a t 9 cm F a l l 0 - 20 39 1 7 - 7 3 1 9 No dis c e... r na bl e pa tt e r n 15. 5 0 . 9 - 5 3 3 D ec r eas es w it h de pt h S u m m e r 0- 8 13. 5 6 - 2 0 1 I n v e r s e p eak at 5 cm 31 . 5 - 5 7 S ma ll i nv e r s e pe a k at 5 cm F a l l 0 - 16 20 4- 36 15 I n c reas es w it h...

Thomson, Heather

2009-06-02T23:59:59.000Z

440

Population genetic structure of Conophthorus ponderosae Hopkins (Coleoptera: Scolytidae) inferred from mitochondrial DNA haplotypes  

E-Print Network [OSTI]

1 AP PENDIX A Ha p l e t t e r L oc al i t y E S C S p e c i e s 20 0- 30 0k m > 90 0k m H o s t S u bs pe c i e s S ubge ne r a S e c t i o n AD U t ah : D a gg et C o . A s h l e y N F 1 H C . po nd er o s a e JV P . po nd er o s a s c o p u... l o r u m P i n us P o n d e r os ae AD U t ah : D a gg et C o . A s h l e y N F 1 H C . po nd er o s a e JV P . po nd er o s a s c o p u l o r u m P i n us P o n d e r os ae AD U t ah : D a gg et C o . A s h l e y N F 1 H C . po nd er o s a...

Menard, Katrina Louise

2006-10-30T23:59:59.000Z

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Lithospermic acid B protects beta-cells from cytokine-induced apoptosis by alleviating apoptotic pathways and activating anti-apoptotic pathways of Nrf2-HO-1 and Sirt1  

SciTech Connect (OSTI)

Lithospermic acid B (LAB) has been reported to protect OLETF rats, an established type 2 diabetic animal model, from the development of diabetes-related vascular complications. We investigated whether magnesium lithospermate B (LAB) has a protective role under cytokine-induced apoptosis in INS-1 cells in vitro and whether it slows the development of diabetes in OLETF rats in vivo. Pretreatment with 50 {mu}M LAB significantly reduced the 1000 U/mL INF-{gamma} and 100 U/mL IL-1{beta}-induced INS-1 cell death. LAB significantly alleviated cytokine-induced phosphorylations of p38 and JNK in accordance with a decrease in cleaved caspase-3 activity in beta-cells. LAB also protected against the cytokine-induced caspase-3 apoptotic pathway via significant activation of Nrf2-HO (heme-oxigenase)-1 and Sirt1 expression. OLETF rats treated with 40 mg/kg/day LAB showed a significant improvement in glucose tolerance compared to untreated OLETF control rats in vivo. Our results suggest that the cytoprotective effects of LAB on pancreatic {beta}-cells are related with both alleviating apoptotic pathways and activating anti-apoptotic pathways of Nrf2-HO-1 and Sirt1.

Lee, Byung-Wan; Chun, Sung Wan; Kim, Soo Hyun; Lee, Yongho; Kang, Eun Seok; Cha, Bong-Soo; Lee, Hyun Chul, E-mail: endohclee@yuhs.ac

2011-04-01T23:59:59.000Z

442

Initiation of the TLR4 signal transduction network : deeper understanding for better therapeutics.  

SciTech Connect (OSTI)

The innate immune system represents our first line of defense against microbial pathogens, and in many cases is activated by recognition of pathogen cellular components (dsRNA, flagella, LPS, etc.) by cell surface membrane proteins known as toll-like receptors (TLRs). As the initial trigger for innate immune response activation, TLRs also represent a means by which we can effectively control or modulate inflammatory responses. This proposal focused on TLR4, which is the cell-surface receptor primarily responsible for initiating the innate immune response to lipopolysaccharide (LPS), a major component of the outer membrane envelope of gram-negative bacteria. The goal was to better understand TLR4 activation and associated membrane proximal events, in order to enhance the design of small molecule therapeutics to modulate immune activation. Our approach was to reconstitute the receptor in biomimetic systems in-vitro to allow study of the structure and dynamics with biophysical methods. Structural studies were initiated in the first year but were halted after the crystal structure of the dimerized receptor was published early in the second year of the program. Methods were developed to determine the association constant for oligomerization of the soluble receptor. LPS-induced oligomerization was observed to be a strong function of buffer conditions. In 20 mM Tris pH 8.0 with 200 mM NaCl, the onset of receptor oligomerization occurred at 0.2 uM TLR4/MD2 with E coli LPS Ra mutant in excess. However, in the presence of 0.5 uM CD14 and 0.5 uM LBP, the onset of receptor oligomerization was observed to be less than 10 nM TLR4/MD2. Several methods were pursued to study LPS-induced oligomerization of the membrane-bound receptor, including CryoEM, FRET, colocalization and codiffusion followed by TIRF, and fluorescence correlation spectroscopy. However, there approaches met with only limited success.

Branda, Steven S. (Sandia National Laboratories, Livermore, CA); Hayden, Carl C. (Sandia National Laboratories, Livermore, CA); Sherman, Michael Y. (University of Texas Medical Branch, Galveston, TX); Sasaki, Darryl Yoshio (Sandia National Laboratories, Livermore, CA); Sale, Kenneth L. (Sandia National Laboratories, Livermore, CA); Kent, Michael Stuart

2010-09-01T23:59:59.000Z

443

Final Progress Report submitted via the DOE Energy Link (E-Link) in June 2009 [Collaborative Research: Decadal-to-Centennial Climate & Climate Change Studies with Enhanced Variable and Uniform Resolution GCMs Using Advanced Numerical Techniques  

SciTech Connect (OSTI)

The joint U.S-Canadian project has been devoted to: (a) decadal climate studies using developed state-of-the-art GCMs (General Circulation Models) with enhanced variable and uniform resolution; (b) development and implementation of advanced numerical techniques; (c) research in parallel computing and associated numerical methods; (d) atmospheric chemistry experiments related to climate issues; (e) validation of regional climate modeling strategies for nested- and stretched-grid models. The variable-resolution stretched-grid (SG) GCMs produce accurate and cost-efficient regional climate simulations with mesoscale resolution. The advantage of the stretched grid approach is that it allows us to preserve the high quality of both global and regional circulations while providing consistent interactions between global and regional scales and phenomena. The major accomplishment for the project has been the successful international SGMIP-1 and SGMIP-2 (Stretched-Grid Model Intercomparison Project, phase-1 and phase-2) based on this research developments and activities. The SGMIP provides unique high-resolution regional and global multi-model ensembles beneficial for regional climate modeling and broader modeling community. The U.S SGMIP simulations have been produced using SciDAC ORNL supercomputers. The results of the successful SGMIP multi-model ensemble simulations of the U.S. climate are available at the SGMIP web site (http://essic.umd.edu/~foxrab/sgmip.html) and through the link to the WMO/WCRP/WGNE web site: http://collaboration.cmc.ec.gc.ca/science/wgne. Collaborations with other international participants M. Deque (Meteo-France) and J. McGregor (CSIRO, Australia) and their centers and groups have been beneficial for the strong joint effort, especially for the SGMIP activities. The WMO/WCRP/WGNE endorsed the SGMIP activities in 2004-2008. This project reflects a trend in the modeling and broader communities to move towards regional and sub-regional assessments and applications important for the U.S. and Canadian public, business and policy decision makers, as well as for international collaborations on regional, and especially climate related issues.

Fox-Rabinovitz, M; Cote, J

2009-10-09T23:59:59.000Z

444

Synchrotron studies of narrow band materials  

SciTech Connect (OSTI)

Since last year, we have had three 3-week blocks of beamtime, in April and November 1991 and February 1992, on the Ames/Montana beamline at the Wisconsin Synchrotron Radiation Center (SRC). These runs continued our program on high temperature superconductors, heavy Fermion and related uranium and rare earth materials, and started some work on transition metal oxides. We have also had beamtime at the Brookhaven NSLS, 5 days of beamtime on the Dragon monochromator, beamline U4B, studying resonant photoemission of transition metal oxides using photon energies around the transition metal 2p edges. Data from past runs has been analyzed, and in some cases combined with photoemission and bremsstrahlung isochromat spectroscopy (BIS) data taken in the home U-M lab. 1 fig.

Not Available

1992-01-01T23:59:59.000Z

445

Synchrotron studies of narrow band materials. Progress report, July 1, 1991--June 30, 1992  

SciTech Connect (OSTI)

Since last year, we have had three 3-week blocks of beamtime, in April and November 1991 and February 1992, on the Ames/Montana beamline at the Wisconsin Synchrotron Radiation Center (SRC). These runs continued our program on high temperature superconductors, heavy Fermion and related uranium and rare earth materials, and started some work on transition metal oxides. We have also had beamtime at the Brookhaven NSLS, 5 days of beamtime on the Dragon monochromator, beamline U4B, studying resonant photoemission of transition metal oxides using photon energies around the transition metal 2p edges. Data from past runs has been analyzed, and in some cases combined with photoemission and bremsstrahlung isochromat spectroscopy (BIS) data taken in the home U-M lab. 1 fig.

Not Available

1992-07-01T23:59:59.000Z

446

Simulations of Design Modifications in Military Health Facilities  

E-Print Network [OSTI]

the military population. Civilian medical 0 1 2 3 4 5 6 7 8 9 10 50+ 40-49 30-39 20-29 1-19 N u m b e r o f Faci litie s Age (years) 6 leadership, such as former Assistant Secretaries of Defense for Health Affairs, Dr. W... --------------------------------------------------------------------------------------------------------------------------------- ENGLISH MULTIPLIED BY GIVES METRIC MULTIPLIED BY GIVES ENGLISH 1 1.000000 1.000000 2 1.000000 1.000000 3 BTU 0.293000 WH 3.412969 BTU 4 BTU/HR 0.293000 WATT 3.412969 BTU/HR 5 BTU/LB-F 4183.830078 J/KG-K 0.000239 BTU/LB-F 6 BTU/HR-SQFT-F 5.678260 W/M2-K 0...

Kiss, Christopher William

2012-07-16T23:59:59.000Z

447

Characterization of Sclerotinia minor populations in Texas  

E-Print Network [OSTI]

F: [HEX] GCTCCTGTATACCATGTCTTG R: GGACTTTCGGACATGATGAT 117-4 AF77924 (TAC) 6 C(TAC)3 F: [HEX] TCAAGTACAGCATTTGC R: TTCCAGTCATTACCTACTAC 6-2 AF377901 (TTTTTC) 2 (TTTTTG)2 (TTTTTC) F: GGGGGAAAGGGATAAAGAAAAG R: CAGACAGGATTATAAGCTTGGTCAC... 20 18 16 14 12 10 8 6 4 2 0 N u m b e r o f I s o l a t e s (c) (d) 6 0 . 0 1 - 6 5 5 5 . 0 1 - 6 0 5 0 . 0 1 - 5 5 5 . 0 1 - 1 0 . 4 5 . 0 1 - 5 0 4 0 . 0 1 - 4 5 3 5 . 0 1 - 4 0 3 0 . 0 1 - 3 5 2 5 . 0 1 - 3 0 2 0 . 0 1 - 2 5 1 5 . 0...

Henry, Merribeth Annette

2009-06-02T23:59:59.000Z

448

Receding Horizon Covariance Control  

E-Print Network [OSTI]

is an embedded submanifold of Rn. An integral curve x(t) of f is a trajectory in M tangent to the vector eld at all points along the curve, i.e. f(x(t)) = _x(t). For every initial condition x0 2 M there exists an > 0 and a neighborhood U of x0 such that x0... is taken into an integral curve x(t) by the ow, which is the map given by : ( ; ) U !M . We adopt the shorthand (t; x0) =: t(x0) = x(t). It is known that t : U ! t(U) is a di eomorphism onto its image satisfying 0(x) = x, t+s(x) = t s...

Wendel, Eric

2012-10-19T23:59:59.000Z

449

Rev. of Articles in American Studies, 1954-63: A Cumulation of the Annual Bibliographies from AMERICAN QUARTERLY, ed. by Henning Cohen  

E-Print Network [OSTI]

eac t ions in world perspective, a n d the remain ing two, " H a r r y S. T r u m a n a n d Hi s Cri t ics : the 1948 Progressives and the Origins of t he Cold W a r , " by F r a n k Ross Pe terson , a n d " J o h n Collier and the American Ind ian... d i a n agrar ian versus commercial dichotomyto early Amer ican po l i t i ca l a l i g n m e n t s . J B T H E P R O G R E S S I V E E R A I N M I N N E S O T A , 1899-1918. By Carl H. Chrislock. St. Pau l : Minneso ta Historical Society. 1971...

Levine, Stuart

1973-01-01T23:59:59.000Z

450

i k i u p 2 e s F y d e l l 2 v k e  

E-Print Network [OSTI]

2 i k i u p 2 e s F y d e l l 2 v k e h v i s 2 v k e v k e 2 f i l l y 2 g h i n o o k r i n e v i l l e 2 e s F u l i n 2 v k e i s t 2 v k e u m m i t 2 v k e i l k 2 v k e i m t u s t u s D 2 v k e v v 2 v k e u t t l e 2 v k e r y s t k 2 e s F g r e s e n t 2 v k

451

U N I V E R S I T Y O F R O C H E S T E R , O N E U N I V E R S I T Y --O N E P L A N 2 0 0 8 C A M P U S M A S T E R P L A N  

E-Print Network [OSTI]

U N I V E R S I T Y O F R O C H E S T E R , O N E U N I V E R S I T Y -- O N E P L A N 2 0 0 8 C A M P U S M A S T E R P L A N E x e c u t i v e S u m m a r y #12;U N I V E R S I T Y O F R O C H E S T E R , O N E U N I V E R S I T Y -- O N E P L A N Copyright 2008 AYERS | SAINT | GROSS All Rights

Portman, Douglas

452

Sta te a n d E v e n ts fo r W e b Se r v ic e s: A C o m p a r iso n o f F iv e W S-R e so u r c e F r a m e w o r k a n d W S-N o tific a tio n  

E-Print Network [OSTI]

Sta te a n d E v e n ts fo r W e b Se r v ic e s: A C o m p a r iso n o f F iv e W S-R e so u r c e F r a m e w o r k a n d W S-N o tific a tio n Im p le m e n ta tio n s M a rty H u m p h re y , G le n n W a sso n D e p a rtm e n t o f C o m p u te r S c ie n c e , U n iv e rsity o f V irg in ia , C

Humphrey, Marty

453

Oceanography Vol.22, No.264 By E r i c P. c h a s s i g N E t, h a r l E y E . h u r l B u rt, E . J o s E Ph M E t zg E r ,  

E-Print Network [OSTI]

Oceanography Vol.22, No.264 By E r i c P. c h a s s i g N E t, h a r l E y E . h u r l B u rt, E . J o s E Ph M E t zg E r , o l E M a rt i N s M E d sta d, J a M E s a . c u M M i N g s , g E o r g E r . h a l l i w E l l , r a i N E r B l E c k , r E My B a r a i l l E , a l a N J . wa l lc r a f

454

Semiempirical range and stopping power values for heavy ions  

E-Print Network [OSTI]

0 CO CCI CO O O O rn UJ O r mU. m ~ ~ ~ OOOOO cl N O I N 4 O' ICI N w ~ Q ~ N ~ U 0 Q If Cl CO 0' M 0' In ICI ~ ~ 0 000 ~ ~ ~ Ln or o o Lnr o UO N Z O' pCI rn N w ~ ~ ~ ~ Q 4 ~ 0 N CCI OI 0 0 r UI Cr rll m ~ ~ N 0 m... O ~ ~ N U'. r co I ~ ~ N 0 O UO CO CO Q N N ~ ~ nd NI 0 0 ILI C3 CO 0 0 t CO r UJ O' rh ~ ~ cn 0 N 'Z \\ ~ CO m rn m ~ ~ U, 0 N CO cn N N ~ ~ 0 0 U I I 4 I ? 4 4 G V 4 a a LU N IU UJ CO O Lf 0 UJ...

Schilling, Ralph Franklin, III

2012-06-07T23:59:59.000Z

455

Convergence and divergence of Fourier series  

E-Print Network [OSTI]

of Theorem 26, in euob gros@ of terse cormsgonaing to Q ~ f cs /~ Ie g substitute C ~ X for g ~ Vc bEIFQ e, series ~ Pt~ &J l~g' ~ ~ es before~ ecgi p~~ 4 ~ m ghenevey 'I gAgf' - &. &~j-c+& ~ 4 gA, k. . -- f, ZA~&g; The serums stiD. oonverges nnifon...myles"aqua~, c~pcpg apop CXQFtQSQ $2VXQ8 M 'eKISR) go eexPop cap. cog. e~~bax s~j go qu~g~ ~~ ~ ssxag go alloy ~c~s, ", pnr ~g~~y s~ ~ jacuzzi ~seps~g a~ oq. ~~ng l @amuse aa~gv ~u m~ ao ~~~ucTsa e &, so. , '3 '3 t &~% ~Q pQO ~EBS 0$ SQ...

Bryant, Jack Douglas

2012-06-07T23:59:59.000Z

456

Reconstruction of a multimode entangled state using a two-photon phase-sensitive linear amplifier  

E-Print Network [OSTI]

field and is given by the following: 2b2???d2bnW~b1 ,b2 , . . . ,bn,0!F)j51n Wc~a j ,b j ;t !G , ~4! l probability Wc(a j ,b j ;t) is given by @ ua jucos~q j2w j/2!2AGub jucos~u0 j2w j/2!#2 @N j11/22uM ju#~G21 ! u0 j2w j/2!#2 ! G . ~5! field..., Phys. Rev. A 51, 4963 ~1995!; W. Vogel, D.-G. Welsch, and L. Leine, J. Opt. Soc. Am. B 4, 1633 ~1987!. @12# L.G. Lutterbach and L. Davidovich, Phys. Rev. Lett. 78, 2547 ~1997!. @13# U. Leonhardt and H. Paul, Phys. Rev. Lett. 72, 4086 ~1994!; K...

Ahmad, M.; Qamar, S.; Zubairy, M. Suhail

2003-01-01T23:59:59.000Z

457

A New Approach to Optimizing Fired Heaters  

E-Print Network [OSTI]

by adjusting the stack damper. In the past, this scheme has not worked successfully as it was not implemented correctly. In today?s world with improved instrumentation and controls, this scheme can be implemented on DCS system or in a standalone PLC... t B u r n e r s F u e l g a s T y p i c a l D r a f t C o n t r o l & I n s t r u m e n t a t i o n P T P I C P r o c e s s F l u i d O u t l e t P I P A H H P T P T I / P Z S L A T A I C T o D C S / P L C E x i s t i n g D C S / P L C F T O 2...

Garg, A.

2010-01-01T23:59:59.000Z

458

Ocean thermal plantships for production of ammonia as the hydrogen carrier.  

SciTech Connect (OSTI)

Conventional petroleum, natural gas, and coal are the primary sources of energy that have underpinned modern civilization. Their continued availability in the projected quantities required and the impacts of emission of greenhouse gases (GHGs) on the environment are issues at the forefront of world concerns. New primary sources of energy are being sought that would significantly reduce the emissions of GHGs. One such primary source that can help supply energy, water, and fertilizer without GHG emissions is available in the heretofore unexploited thermal gradients of the tropical oceans. The world's oceans are the largest natural collector and reservoir of solar energy. The potential of ocean energy is limitless for producing base-load electric power or ammonia as the hydrogen carrier and fresh water from seawater. However, until now, ocean energy has been virtually untapped. The general perception is that ocean thermal energy is limited to tropical countries. Therefore, the full potential of at-sea production of (1) ammonia as a hydrogen carrier and (2) desalinated water has not been adequately evaluated. Using ocean thermal plantships for the at-sea co-production of ammonia as a hydrogen carrier and desalinated water offer potential energy, environmental, and economic benefits that support the development of the technology. The introduction of a new widespread solution to our projected energy supply requires lead times of a decade or more. Although continuation of the ocean thermal program from the 1970s would likely have put us in a mitigating position in the early 2000s, we still have a window of opportunity to dedicate some of our conventional energy sources to the development of this renewable energy by the time new sources would be critically needed. The primary objective of this project is to evaluate the technical and economic viability of ocean thermal plantships for the production of ammonia as the hydrogen carrier. This objective is achieved by completing project tasks that consist of updating the John Hopkins University/Applied Physics Laboratory (JHU/APL) pilot plantship design and extrapolating it to commercial plantships, evaluating a new energy-efficient ammonia synthesis process, evaluating the co-production of desalinated water on plantships, and developing a conceptual design of a satellite plantships system for commercial-scale ammonia production. In addition, an industrial workshop was organized to present the results and develop future goals for commercialization of ocean thermal plantships by 2015. The following goals, arranged in chronological order, were examined at the workshop: (1) Global displacement of petroleum-fuel-based (diesel, fuel oil, naphtha) power generation for freeing up these fuels for transportation, chemical feedstock, and other high-valued uses; (2) At-sea production of desalinated water for regions of critical water shortages; (3) Displacement of carbon-based feed stocks and energy for production of ammonia fertilizers; (4) Development of hydrogen supply to allow economic processing of heavy crude oils and upgrading oil sands; (5) Development of ammonia-fueled distributed energy to displace natural-gas fueled power generation to free up natural gas for higher-value uses and the mitigation of issues associated with imported liquefied natural gas (LNG); and (6) Use of ammonia as a hydrogen carrier for transportation.

Panchal, C.B.; Pandolfini, P. P.; Kumm, W. H.; Energy Systems; Johns Hopkins Univ.; Arctic Energies, Ltd.

2009-12-02T23:59:59.000Z

459

National Geo-Database for Biofuel Simulations and Regional Analysis of Biorefinery Siting Based on Cellulosic Feedstock Grown on Marginal Lands  

SciTech Connect (OSTI)

The goal of this project undertaken by GLBRC (Great Lakes Bioenergy Research Center) Area 4 (Sustainability) modelers is to develop a national capability to model feedstock supply, ethanol production, and biogeochemical impacts of cellulosic biofuels. The results of this project contribute to sustainability goals of the GLBRC; i.e. to contribute to developing a sustainable bioenergy economy: one that is profitable to farmers and refiners, acceptable to society, and environmentally sound. A sustainable bioenergy economy will also contribute, in a fundamental way, to meeting national objectives on energy security and climate mitigation. The specific objectives of this study are to: (1) develop a spatially explicit national geodatabase for conducting biofuel simulation studies and (4) locate possible sites for the establishment of cellulosic ethanol biorefineries. To address the first objective, we developed SENGBEM (Spatially Explicit National Geodatabase for Biofuel and Environmental Modeling), a 60-m resolution geodatabase of the conterminous USA containing data on: (1) climate, (2) soils, (3) topography, (4) hydrography, (5) land cover/ land use (LCLU), and (6) ancillary data (e.g., road networks, federal and state lands, national and state parks, etc.). A unique feature of SENGBEM is its 2008-2010 crop rotation data, a crucially important component for simulating productivity and biogeochemical cycles as well as land-use changes associated with biofuel cropping. ARRA support for this project and to the PNNL Joint Global Change Research Institute enabled us to create an advanced computing infrastructure to execute millions of simulations, conduct post-processing calculations, store input and output data, and visualize results. These computing resources included two components installed at the Research Data Center of the University of Maryland. The first resource was 'deltac': an 8-core Linux server, dedicated to county-level and state-level simulations and PostgreSQL database hosting. The second resource was the DOE-JGCRI 'Evergreen' cluster, capable of executing millions of simulations in relatively short periods. ARRA funding also supported a PhD student from UMD who worked on creating the geodatabases and executing some of the simulations in this study. Using a physically based classification of marginal lands, we simulated production of cellulosic feedstocks from perennial mixtures grown on these lands in the US Midwest. Marginal lands in the western states of the US Midwest appear to have significant potential to supply feedstocks to a cellulosic biofuel industry. Similar results were obtained with simulations of N-fertilized perennial mixtures. A detailed spatial analysis allowed for the identification of possible locations for the establishment of 34 cellulosic ethanol biorefineries with an annual production capacity of 5.6 billion gallons. In summary, we have reported on the development of a spatially explicit national geodatabase to conduct biofuel simulation studies and provided simulation results on the potential of perennial cropping systems to serve as feedstocks for the production of cellulosic ethanol. To accomplish this, we have employed sophisticated spatial analysis methods in combination with the process-based biogeochemical model EPIC. The results of this study will be submitted to the USDOE Bioenergy Knowledge Discovery Framework as a way to contribute to the development of a sustainable bioenergy industry. This work provided the opportunity to test the hypothesis that marginal lands can serve as sources of cellulosic feedstocks and thus contribute to avoid potential conflicts between bioenergy and food production systems. This work, we believe, opens the door for further analysis on the characteristics of cellulosic feedstocks as major contributors to the development of a sustainable bioenergy economy.

Izaurralde, Roberto C.; Zhang, Xuesong; Sahajpal, Ritvik; Manowitz, David H.

2012-04-01T23:59:59.000Z

460

FINAL REPORT  

SciTech Connect (OSTI)

Excellent progress was made in standardizing three complementary methods: Magnetic resonance imaging, x-ray micro CT, and MALDI imaging linear ion trap mass spectroscopy to image biomass and chemical, anatomical and functional changes that occur during pretreatment and hydrolysis. Magnetic resonance microscopy provides excellent images with as low as 5 uM resolution with hydrated biomass samples. We visualized dramatic changes in signal associated with the hydrolysis of the carbohydrates by strong acids. Quantitative diffusion approaches were used to probe more subtle structural changes in biomass. Diffusion tensor calculations reflect diffusion anisotropy and fractional anisotropy maps clearly show the longer range diffusion within the vessels compared to within the fiber cells. The diffusion is increased along the cell walls of the vessels. Suggesting that further research with NMR imaging should be pursued. X-ray CT provides excellent images at as low as 3.5 uM resolution from dried biomass. Small increases in surface area, and decreases in local density have been quantified in with wood after mild pretreatments; these changes are expected to be underestimates of the hydrated wood, due to the ~12% shrinkage that occurs upon drying untreated wood. MALDI-MS spectra show high ion intensities at most mass to charge ratios in untreated and pretreated woody material. MALDI-MSn is required to improve specificity and reduce background for imaging. MALDI-TOF is not specific enough for carbohydrate identification. Using MALDI-LIT/MSn we can readily identify oligomeric glucans and xylans and their fragmentation patterns as well as those of the glucuronic acid side chains of birch 4-O-methyl glucuronxylan. Imaging of glucan and xylan oligomers show that many contain isobaric ions with different distributions, indicating again that MSn is needed for accurate imaging of lignocellulosic materials. We are now starting to integrate the three imaging methods by using the same set of biomass samples imaged with all three methods, and using common analytical software to quantify parameters from the three dimensional images. In addition to the proposed experiments, we conducted imaging studies with a novel TOF-SIMS instrument available through collaborations with the AMOLF goup led by Ron Heeren at the FOM Institute in Amersterdam, Netherlands. ToF-SIMS was used to image intact cross sections of Populus stems with high spatial resolution, chemically selectivity. ToF-SIMS images were correlated with fluorescence microscopy which allowed for more positive ion identification.

PETER, GARY F. [UNIVERSITY OF FLORIDA] [UNIVERSITY OF FLORIDA

2014-07-16T23:59:59.000Z

Note: This page contains sample records for the topic "umd jhu u-m" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Prognostic Significance of Carbohydrate Antigen 19-9 in Unresectable Locally Advanced Pancreatic Cancer Treated With Dose-Escalated Intensity Modulated Radiation Therapy and Concurrent Full-Dose Gemcitabine: Analysis of a Prospective Phase 1/2 Dose Escalation Study  

SciTech Connect (OSTI)

Purpose: Although established in the postresection setting, the prognostic value of carbohydrate antigen 19-9 (CA19-9) in unresectable locally advanced pancreatic cancer (LAPC) is less clear. We examined the prognostic utility of CA19-9 in patients with unresectable LAPC treated on a prospective trial of intensity modulated radiation therapy (IMRT) dose escalation with concurrent gemcitabine. Methods and Materials: Forty-six patients with unresectable LAPC were treated at the University of Michigan on a phase 1/2 trial of IMRT dose escalation with concurrent gemcitabine. CA19-9 was obtained at baseline and during routine follow-up. Cox models were used to assess the effect of baseline factors on freedom from local progression (FFLP), distant progression (FFDP), progression-free survival (PFS), and overall survival (OS). Stepwise forward regression was used to build multivariate predictive models for each endpoint. Results: Thirty-eight patients were eligible for the present analysis. On univariate analysis, baseline CA19-9 and age predicted OS, CA19-9 at baseline and 3 months predicted PFS, gross tumor volume (GTV) and black race predicted FFLP, and CA19-9 at 3 months predicted FFDP. On stepwise multivariate regression modeling, baseline CA19-9, age, and female sex predicted OS; baseline CA19-9 and female sex predicted both PFS and FFDP; and GTV predicted FFLP. Patients with baseline CA19-9 ?90 U/mL had improved OS (median 23.0 vs 11.1 months, HR 2.88, P<.01) and PFS (14.4 vs 7.0 months, HR 3.61, P=.001). CA19-9 progression over 90 U/mL was prognostic for both OS (HR 3.65, P=.001) and PFS (HR 3.04, P=.001), and it was a stronger predictor of death than either local progression (HR 1.46, P=.42) or distant progression (HR 3.31, P=.004). Conclusions: In patients with unresectable LAPC undergoing definitive chemoradiation therapy, baseline CA19-9 was independently prognostic even after established prognostic factors were controlled for, whereas CA19-9 progression strongly predicted disease progression and death. Future trials should stratify by baseline CA19-9 and incorporate CA19-9 progression as a criterion for progressive disease.

Vainshtein, Jeffrey M., E-mail: jvainsh@med.umich.edu [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Schipper, Matthew [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States)] [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Zalupski, Mark M. [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States)] [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States); Lawrence, Theodore S. [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States)] [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Abrams, Ross [Department of Radiation Oncology, Rush Medical Center, Chicago, Illinois (United States)] [Department of Radiation Oncology, Rush Medical Center, Chicago, Illinois (United States); Francis, Isaac R. [Department of Radiology, University of Michigan, Ann Arbor, Michigan (United States)] [Department of Radiology, University of Michigan, Ann Arbor, Michigan (United States); Khan, Gazala [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States)] [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States); Leslie, William [Division of Hematology Oncology, Department of Internal Medicine, Rush Medical Center, Chicago, Illinois (United States)] [Division of Hematology Oncology, Department of Internal Medicine, Rush Medical Center, Chicago, Illinois (United States); Ben-Josef, Edgar [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States)] [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States)

2013-05-01T23:59:59.000Z

462

Deformation Behavior of Sub-micron and Micron Sized Alumina Particles in Compression.  

SciTech Connect (OSTI)

The ability to integrate ceramics with other materials has been limited due to high temperature (>800degC) ceramic processing. Recently, researchers demonstrated a novel process , aerosol deposition (AD), to fabricate ceramic films at room temperature (RT). In this process, sub - micro n sized ceramic particles are accelerated by pressurized gas, impacted on the substrate, plastically deformed, and form a dense film under vacuum. This AD process eliminates high temperature processing thereby enabling new coatings and device integration, in which ceramics can be deposited on metals, plastics, and glass. However, k nowledge in fundamental mechanisms for ceramic particle s to deform and form a dense ceramic film is still needed and is essential in advancing this novel RT technology. In this wo rk, a combination of experimentation and atomistic simulation was used to determine the deformation behavior of sub - micron sized ceramic particle s ; this is the first fundamental step needed to explain coating formation in the AD process . High purity, singl e crystal, alpha alumina particles with nominal size s of 0.3 um and 3.0 um were examined. Particle characterization, using transmission electron microscopy (TEM ), showed that the 0.3 u m particles were relatively defect - free single crystals whereas 3.0 u m p articles were highly defective single crystals or particles contained low angle grain boundaries. Sub - micron sized Al 2 O 3 particles exhibited ductile failure in compression. In situ compression experiments showed 0.3um particles deformed plastically, fractured, and became polycrystalline. Moreover, dislocation activit y was observed within the se particles during compression . These sub - micron sized Al 2 O 3 particles exhibited large accum ulated strain (2 - 3 times those of micron - sized particles) before first fracture. I n agreement with the findings from experimentation , a tomistic simulation s of nano - Al 2 O 3 particles showed dislocation slip and significant plastic deformation during compressi on . On the other hand, the micron sized Al 2 O 3 particles exhibited brittle f racture in compression. In situ compression experiments showed 3um Al 2 O 3 particles fractured into pieces without observable plastic deformation in compression. Particle deformation behaviors will be used to inform Al 2 O 3 coating deposition parameters and particle - particle bonding in the consolidated Al 2 O 3 coatings.

Sarobol, Pylin; Chandross, Michael E.; Carroll, Jay; Mook, William; Boyce, Brad; Kotula, Paul G.; McKenzie, Bonnie B.; Bufford, Daniel Charles; Hall, Aaron Christopher.

2014-09-01T23:59:59.000Z

463

Evidence for Multiple Modes of Uranium Immobilization by an Anaerobic Bacterium  

SciTech Connect (OSTI)

ABSTRACT Microbial reduction of hexavalent uranium has been studied widely for its potential role in bioremediation and removal of soluble U(VI) from contaminated groundwater. More recently, some microorganisms have been examined for their role in immobilization of U(VI) via precipitation of uranyl phosphate minerals mediated by microbial phosphate release, alleviating the requirement for long-term redox control. Here, we investigated the mechanism of U(VI) removal mediated by an environmental isolate, strain UFO1, that is indigenous to the Field Research Center (FRC) in Oak Ridge, TN and has been detected in U(VI)-contaminated sediments. U(VI) removal was examined in the presence and absence of the electron-shuttling moiety, anthraquinone-2,6-disulfonate (AQDS). Cell suspensions were capable of the near complete removal of 100 uM U(VI) from solution within 48 hours; U(VI) removal was not dependent on the presence of an exogenous electron donor or AQDS, although AQDS increased the rate of U(VI) removal. Profiles of ortho-phosphate concentration over time suggested phosphate liberation from cells. However, X-ray Absorption Near Edge Structure (XANES) spectroscopic measurements indicated that U(IV) was the predominant oxidation state of uranium in cell suspensions in both the absence and presence of 100 uM AQDS. Extended X-ray Absorption Fine Structure spectroscopy (EXAFS) measurements indicated that 20% of the cell-associated precipitates in a U(VI)-treated suspension that lacked AQDS had spectral characteristics consistent with a uranyl phosphate solid phase. EXAFS fits further show that that U(IV) is present dominantly as a monomeric sorbed complex. TEM-EDS confirmed the presence of uranyl phosphate with a U:P ratio consistent with autunite (1:1). These results suggest that strain UFO1 has the ability to mediate U(VI) removal from solution via both reductive and phosphate precipitation mechanisms, and may potentially be useful for the remediation of U-contaminated sediments at the FRC.

Allison E. Ray; John R. Bargar; Alice C. Dohnalkova; Vaidee Sivaswamy; Yoshiko Fujita; Timothy S. Magnuson

2011-05-01T23:59:59.000Z

464

Diffusive Release of Uranium from Contaminated Sediments into Capillary Fringe Pore Water  

SciTech Connect (OSTI)

We investigated the dynamics of U release between pore water fractions, during river stage changes from two contaminated capillary fringe sediments. Samples were from 7.0 m and 7.6 m below ground surface (bgs) in the Hanford 300 area. Sediments were packed into columns and saturated with Hanford groundwater for three to 84 days. After specified times, > 48 m radius (calculated) sediment pores were drained, followed by draining pores to 15 m radius. U release in the first two weeks was similar between sediments and pore sizes with a range of 4.4 to 5.6 M U in the 14 day sample. The 7.0 m bgs sediment U declined in the larger pores to 0.22 M at day 84, whereas the small pores released U to 6.7 M at day 84. The 7.6 m bgs sediment released 1.4 M on day 84, in the large pores, but continuously released U from the smaller pores (13.2 uM on day 84). The continuous release of U has resulted in a diffusion gradient from the smaller to larger pores. The observed differences in U pore-water concentrations between the two sediment samples were attributed to co-precipitation of U with carbonates. A mineral phase in the sediments was also identified as an U-carbonate species, similar to rutherfordine [UO2(CO3)].

Rod, Kenton A.; Wellman, Dawn M.; Flury, Markus; Pierce, Eric M.; Harsh, James B.

2012-09-13T23:59:59.000Z

465

Preliminary LEU fuel cycle analyses for the Belgian BR2 reactor  

SciTech Connect (OSTI)

Fuel cycle calculations have been performed with reference HEU fuel and LEU fuel using Cd wires or boron as burnable absorbers. The /sup 235/U content in the LEU element has increased 20% to 480g compared to the reference HEU element. The number of fuel plates has remained unchanged while the fuel meat thickness has increased to 0.76 mm from 0.51 mm. The LEU meat density is 5.1 Mg U/m/sup 3/. The reference fuel cycle was a 31 element core operating at 56 MW with a 19.8 day cycle length and eight fresh elements loaded per cycle. Comparable fuel cycle characteristics can be achieved using the proposed LEU fuel element with either Cd wires or boron burnable absorbers. The neutron flux for E/sub n/ > 1 eV changes very little (<5%) in LEU relative to HEU cores. Thermal flux reductions are 5 to 10% in non-fueled positions, and 20 to 30% in fuel elements.

Deen, J.R.; Snelgrove, J.L.

1986-01-01T23:59:59.000Z

466

Council on East Asian Libraries Statistics 2006-2007 For North American Institutions  

E-Print Network [OSTI]

://www.arl.org/bm~doc/07ssurvey_final.pdf> Holdings of East Asian Materials of North American Institutions as of June 30, T o t a l Vol u m e s in Lib r a r y I n s t i t u t io n s JP N K OR N- CJ K TOTA LCHN JPN K OR N-CJ K TOTALCHN J PN KOR N-CJK TO TA LCHN JPN K OR N... 12865 210 0 1 7 5 5 0 16 , 720 B ri g h a m Youn g 5 0 042 15088 8 19 9 0 73 , 329 2089 3 33 453 0 2,875 0 0 0 0 0 208 9 3 3 3 453 0 2,875 52131 1 5421 8652 0 76,204 Britis h Columb i a 295242 148352 24913 761 6 3 544,07 0 4811 4797 455 0 1 0 , 0 6 3 0 0...

Doll, Vickie; Hsu, Calvin; Simpson, Fung-yin Kuo

2008-02-01T23:59:59.000Z

467

Inverse sensitivity analysis of SISO and MIMO systems using Maletinsky's spline-type modulation function method  

E-Print Network [OSTI]

Method section. Rewritting equation (3-17) to include all k modulations yields x=[ Z, U ] (b) (3-1 8) where 17 M(x, ttt)?. , M(x, 6)k 2 M(x, 8)k, M(x, v)x, . . . M(x v) M(x, @)k 2 M(x, e)k 2 . . M(x "", @)k 2 Recall from equation (3-7) M (x ', g)z... ? (-1)' M(x, e ' )x Thus, U, X and Z may be written as M(u, e )k i -M(u, v )x i . . . (-1) uM(u, v ') M(u, a' ')?2 -M(u, 8 ')k e . . . (-1) "M(u, e' ") (3- I 9a) M(x, @)k M(x, e)k e (3-1 9b) 18 -M(x, g )k t M(x, e )k t . . . ( 1) M(x, ttf x ) -M(x...

Smith, Cherri Imelda

1987-01-01T23:59:59.000Z

468

High Energy Theory Workshops and Visitors at the Michigan Center for Theoretical Physics FY14  

SciTech Connect (OSTI)

The workshop was held from September 23-25, 2013 on the University of Michigan campus. Local organizers were Dragan Huterer, Katherine Freese, and Heidi Wu (University of Michigan). Marilena Lo Verde (University of Chicago) also served as an external organizer. This workshop sought to gather experimentalists and theorists to discuss and define directions in cosmology research after the 1st year release of Planck data. The workshop included 35 invited (non-U-M) cosmologists, most of them relatively junior. The workshop was notable for spirited discussion of various theoretical ideas and experimental developments, and particularly on how one could test theory with ongoing and future experiments. In our follow-up poll, 95% of participants reported that interactions with other participants at the workshop may lead to further collaboration. Most participants (again about 95%) reported that they are very satisfied with the quality of the program, information they received, and the logistical support. Slides are available on line at: http://www.umich.edu/~mctp/SciPrgPgs/events/2013/CAP13/program.html. The YHET visitor program invited weekly young visitors to the University of Michigan campus to present their work. This year 23 participants came under the program. Slides are available on line for talks when applicable: http://mctp.physics.lsa.umich.edu/brown-bag-seminar-history/winter 2014 and http://mctp.physics.lsa.umich.edu/brown-bag-seminar-history/fall-2013.

Pierce, Aaron T. [University of Michigan

2014-04-01T23:59:59.000Z

469

Description and Drawings of the Human Leg  

E-Print Network [OSTI]

. Os Cuneiform Externa. 85. Os Scaphoid. 86. A. D o r s a l i s P e d i s . 87. A. P l a n t a r i s m e d i a l i s . 88. A. L a t e r a l i s . 89. Aponeurosis p l a n t a r i s . 90. 1st metatarsal bone. 91. 5th M e t a t a r s a l bone. 92.... M. F l e x o r d i g i t o r u m b r e v i s . 90. M. Adductor H a l l u c i s . 95. F l e x o r H a l l u c i s b r e v i s . 96. M. Extensor H a l l u c i s b r e v i s . 97. M. Extensor digitorum b r e v i s . 98. Abductor d i g i t i q u i n...

Bigger, John Dinsmore

1909-01-01T23:59:59.000Z

470

Specifications of Futures and Options Contracts  

E-Print Network [OSTI]

mechanisms and changes in futures contract specifications. Mark Welch, John Robinson and David P. Anderson* 2 ( c o n t i n u e d o n n e x t p a ge ) T a bl e 1 . C o n t r a c t s p e c i fi c a t i o n s f or a g r i c u l t u r a l c ro p a n d l iv e... s t o ck f u t u r e s . C om m o di t y & s i z e o f c o n t r a c t T i c k e r s y m b o l T r a d i n g h o u r s ( c e n t r a l t i m e ) M o nt h s t ra d e d P r i c e quo t e s M i n i m u m p r i c e fluc t u a t i on D a i l y l i m i...

Welch, Mark; Robinson, John; Anderson, David P.

2009-06-01T23:59:59.000Z

471

Wave variability and wave spectra for wind generated gravity waves  

E-Print Network [OSTI]

\\?\\jP\\-P7 cJ)srwJ cJ7 usr)c7(L s{ U)s{7((s) /? 6? /sJy(sy \\yi a)9 h? h9 Urcq s{ cJ7 Cyj?7)(jcL s{ n\\Pj{s)yj\\e m7)?7P7L] a)9 n9 U? m7((7 s{ $J7 n\\Pj{s)yj\\ ns_d\\yLe '7f v)P7\\y(] cJ7 m7\\uJ 0)s(jsy ms\\)ie \\yi scJ7) s{{ju7( s{ cJ7 C9 2? ^)_L ns)d( s{ 0...Jc \\yi f\\?7 d7)jsi (lr\\)7i j( (rww7(c7i9 ?c j( {sryi cJ\\c cJ7 _\\)wjy\\P d)s-\\-jPjcL ij(c)j-rcjsy s{ f\\?7 J7jwJc( {sPPsf( h\\LP7jwJW( ij(c)j-rcjsy uPs(7PL9 $Jj( usyuPr(jsy j( -\\(7i rdsy ob )7us)i( s{ \\-src 100 f\\?7( 7\\uJ dPr( (7?7)\\P 7Sc)\\ Psyw )7us)i( c...

Bretschneider, Charles L.

1959-01-01T23:59:59.000Z

472

Heavy dense QCD and nuclear matter from an effective lattice theory  

E-Print Network [OSTI]

A three-dimensional effective lattice theory of Polyakov loops is derived from QCD by expansions in the fundamental character of the gauge action, u, and the hopping parameter, \\kappa, whose action is correct to \\kappa^n u^m with n+m=4. At finite baryon density, the effective theory has a sign problem which meets all criteria to be simulated by complex Langevin as well as by Monte Carlo on small volumes. The theory is valid for the thermodynamics of heavy quarks, where its predictions agree with simulations of full QCD at zero and imaginary chemical potential. In its region of convergence, it is moreover amenable to perturbative calculations in the small effective couplings. In this work we study the challenging cold and dense regime. We find unambiguous evidence for the nuclear liquid gas transition once the baryon chemical potential approaches the baryon mass, and calculate the nuclear equation of state. In particular, we find a negative binding energy per nucleon causing the condensation, whose absolute value decreases exponentially as mesons get heavier. For decreasing meson mass, we observe a first order liquid gas transition with an endpoint at some finite temperature, as well as gap between the onset of isospin and baryon condensation.

Jens Langelage; Mathias Neuman; Owe Philipsen

2014-03-17T23:59:59.000Z

473

TREKisM Issue 54  

E-Print Network [OSTI]

I N U M M 0 C S L N J K IRK A R o L A VON MEN E Y R ARB I L I H RAE I X V L R E MHO C T POI L E L E C I N A J GSA RNA 0 U 0 P S A E S L U P MIL I S L RNA I L 0 H T P T K MUD 0 A N S W T R N I A T PAC A M M H H L R S A E 0 GAR T H DOE S BRA I N A UNA... Y U TTl C M H R L V ERR P ORE YON S K V K R N T P H H B 0 K COP S SOL I E R F Y D L X A L CAD E T U T B T H U CAR U H U 0 C N lOB 0 lOR 0 NAN FDA L TAU lOB I L NIH 0 S ADD R F G G N M RAE P E Y N T M N Y K S U LAP R I N 0 U A T L 0 0 S U L M H X F...

1987-01-01T23:59:59.000Z

474

Case Studies on Domestic Servants: Reflections on Rural Poverty  

E-Print Network [OSTI]

r e n has been a l t e r e d t o m a i n t a i n a n o n y m i t y . 3. Overview on Nepelese Rura' Poverty As an o v e r w h e l m i n g l y a g r a r i a n c o u n t r y w i t h o v e r 93 p a r c e n t ( U n i c e f , 1992; X I I ) o f t h e e c o... m i l y K u m g a m e Ketee ( g i r l ) does m o s t o f her w o r k , c l e a n i n g d i s h e s , w a s h i n g c l o t h e s end f i l l i n g a n d f e r r y i n g w a t e r j a r s t o t h e k i t c h e n on t h e t o p f l o o r . The d i m p...

Shah, Saubhagya

1993-01-01T23:59:59.000Z

475

Gluon condensates and c, b quark masses from quarkonia ratios of moments  

E-Print Network [OSTI]

We extract (for the first time) the ratio of the gluon condensate / expressed in terms of the liquid instanton radius rho_c from charmonium moments sum rules by examining the effects of in the determinations of both rho_c and the running MS mass m_c(m_c). Using a global analysis of selected ratios of moments at different Q^2=0, 4m_c^2 and 8m_c^2 and taking from 0.06 GeV^4, where the estimate of rho_c is almost independent of , we deduce: rho_c=0.98(21) GeV^{-1} which corresponds to = (31+- 13) GeV^2 . The value of m_c(m_c) is less affected (within the errors) by the variation of , where a common solution from different moments are reached for greater than 0.02 GeV^4. Using the values of =0.06(2) GeV^4 from some other channels and the previous value of , we deduce: m_c(m_c)=1260(18) MeV and m_b(m_b)=4173(10) MeV, where an estimate of the 4-loops contribution has been included. Our analysis indicates that the errors in the determinations of the charm quark mass without taking into account the ones of the gluon condensates have been underestimated. To that accuracy, one can deduce the running light and heavy quark masses and their ratios evaluated at M_Z, where it is remarkable to notice the approximate equalities: m_s/m_u= m_b/m_s= m_t/m_b= 51(4), which might reveal some eventual underlying novel symmetry of the quark mass matrix in some Grand Unified Theories.

Stephan Narison

2011-10-13T23:59:59.000Z

476

Testing Minimal Universal Extra Dimensions Using Higgs Boson Searches at the LHC  

E-Print Network [OSTI]

Large Hadron Collider (LHC) searches for the SM Higgs boson provide a powerful limit on models involving Universal Extra Dimensions (UED) where the Higgs production is enhanced. We have evaluated all one-loop diagrams for Higgs production from gluon fusion and decay to two photons within "minimal" UED (mUED), independently confirming previous results, and we have evaluated enhancement factors for Higgs boson production and decay over the mUED parameter space. Using these we have derived limits on the parameter space, combining data from both ATLAS and CMS collaborations for the most recent 7 TeV and 8 TeV LHC data. We have performed a rigorous statistical combination of several Higgs boson search channels which is important because mUED signatures from the Higgs boson are not universally enhanced. We have found that 1/R 1000 GeV) around m_h = 118 GeV are left. The latter is likely to be excluded as more data becomes available whereas the region around 125 GeV is where the recently discovered Higgs-like particle was observed and therefore where the exclusion limit is weaker. It is worth stressing that mUED predicts an enhancement for all channels for Higgs production by gluon fusion and decay while the vector boson fusion process WW/ZZ -> h -> AA is generically suppressed and WW/ZZ -> h -> WW*/ZZ* is standard. Therefore, as more 8 TeV LHC data becomes available, the information on individual Higgs boson production and decay processes provided by the CMS and ATLAS experiments can be effectively used to favour mUED or exclude it further.

Genevieve Belanger; Alexander Belyaev; Matthew Brown; Mitsuru Kakizaki; Alexander Pukhov

2012-12-13T23:59:59.000Z

477

Enhanced vector borne disease surveillance of California Culex mosquito populations reveals spatial and species-specific barriers of infection.  

SciTech Connect (OSTI)

Monitor i ng in f ectio n s in v ect o rs su c h as m osquit o es, s a nd fl i es, tsetse fl i es, a nd ticks to i denti f y hu m a n path o gens m a y s e r v e as a n ear l y w arn i ng det e ction system t o dir e ct loc a l g o v er n ment dise a se pr e v en t i v e m easu r e s . One major hurdle i n de t ection is the abi l i t y to scre e n l arge n u mbers of v e c t ors for h uman patho g ens w i thout t h e u s e of ge n o t y pe - s p ecific m o lecu l ar tec h nique s . N e x t genera t ion s equ e nc i ng (NG S ) pr o v i des a n unbi a sed p latfo r m capab l e of identi f y i ng k n o w n a n d unk n o w n p ath o ge n s circula t ing w i thin a v e ctor p opul a tion, but utili z ing t h is te c h nolo g y i s tim e - con s u ming a n d cos t l y for v ecto r -b o rne disease su r v e illan c e pr o gra m s. T o addr e s s this w e d e v e lop e d cos t -eff e ct i v e Ilumina(r) R NA- S eq l i bra r y p r epara t ion m e thodol o gies i n con j u n ction w i t h an automa t ed c ompu t at i onal a n a l y sis pipel i n e to ch a racter i ze t h e microbial popula t ions c ircula t i n g in Cu l e x m o squit o e s (Cul e x qui n quef a s c iatu s , C ul e x quinq u efasc i atus / pip i ens co m pl e x h y bri d s, and C u l e x ta r salis ) t hroug h out Californ i a. W e assembled 2 0 n o vel a n d w e l l -do c ume n ted a r b o v i ruses repres e nting mem b e rs of B u n y a v ir i da e , F l a v i virid a e, If a virida e , Meson i v i rida e , Nid o v iri d ae, O rtho m y x o virid a e, Pa r v o v iri d ae, Re o virid a e, R h a b d o v i rid a e, T y m o v iri d ae, a s w ell as s e v e r al u n assi g n e d v irus e s . In addit i o n, w e m app e d mRNA s pecies to d i vergent s peci e s of t r y panos o ma a nd pl a s modium eu k a r yotic parasit e s and cha r a c terized t he p r oka r yot i c microb i al c o mposit i on to i d enti f y bacteri a l tran s c r ipts der i v ed from wolba c hia, clo s tridi u m, m y c oplas m a, fusoba c terium and c am p y l o bacter bac t er i al spec i e s . W e utilized the s e mic r obial transcri p tomes pre s e nt in g e ogra p hical l y defined Cul e x po p ul a tions to defi n e spatial and m osqui t o specie s -spec i fic ba r r iers of i n fecti o n. T he v i r ome and microbi o me c o mpos i tion id e ntified in e ach mosqui t o p o ol pr o v i ded suf f icient resolut i on to dete r m i ne both the mosq u ito species and the g e o graphic regi o n in Californ i a w h e re t h e mosqui t o po o l orig i n ated. T his d a ta pr o v i des ins i ght in t o the compl e x i t y of microb i al spec i es cir c ulati n g in med i cal l y i mport a nt Culex mosqui t oes a nd t h eir potent i al im p act o n t he tran s missi o n of v ector-b o rne human / veter i na r y p a t hogens in C a liforn i a.

VanderNoot, Victoria A.; Curtis, Deanna Joy; Koh, Chung-Yan; Brodsky, Benjamin H [Sandia National Laboratories, Albuquerque, NM; Lane, Todd

2014-08-01T23:59:59.000Z