Sample records for umd jhu u-m

  1. sustainability.umd.edu University of Maryland

    E-Print Network [OSTI]

    Yorke, James

    sustainability.umd.edu University of Maryland Sustainability Progress Report 2013 terps leave small footprintsumd #12;sustainability.umd.edu umdumd ReportOverview University of Maryland fulfills its promise to be a national model of a Green University by measuring and publicly reporting its annual sustainability

  2. WorldCat UMD 2013 -2014 University Libraries lib.umd.edu/tl/guides/worldcatumd

    E-Print Network [OSTI]

    Gruner, Daniel S.

    ) Basic search & results screen Use the Get Started tab to enter your search terms, then click Search: 1; it displays results ranked by whether UMD Libraries own it in addition to the relevance of your search terms.umd.edu Searching from off campus? Go to umaryland.worldcat.org & login at University of Maryland College Park

  3. Jonathan D. Cohen http://www.cs.jhu.edu/~cohen

    E-Print Network [OSTI]

    Cohen, Jonathan

    simplification of complex, polygonal models. Designed and implemented a walkthrough system for massive models University New Engineering Building 224 Baltimore, MD 21218 cohen@cs.jhu.edu (410) 516-5308 EDUCATION Ph of Polygonal Models." Advisor: Dinesh Manocha. MS in Computer Science, 1994. University of North Carolina

  4. Next Steps for JHU Testbed design Jong Hyun Lim

    E-Print Network [OSTI]

    Amir, Yair

    University Baltimore, MD Email: ljh@cs.jhu.edu Proxy NSLU 1 Server (MIB.py) user.py tos.py PC (User) Tmote 1 of new testbed design is to enable a user to utilize the network communication capability of tos with remote motes or users. II. DESIGN GOAL The main design goal of this project is to utilize existing tos

  5. U-M Construction Forecast December 15, 2011 U-M Construction Forecast

    E-Print Network [OSTI]

    Kamat, Vineet R.

    U-M Construction Forecast December 15, 2011 U-M Construction Forecast Spring ­ Fall 2012 As of December 15, 2011 Prepared by AEC Preliminary & Advisory #12;U-M Construction Forecast December 15, 2011 Overview · Campus by campus · Snapshot in time ­ Not all projects · Construction coordination efforts

  6. Exploiting Nonlinear Dynamics for Novel Sensor Networks (UMD-DUKE)

    E-Print Network [OSTI]

    Anlage, Steven

    Exploiting Nonlinear Dynamics for Novel Sensor Networks (UMD-DUKE) · Network of nonlinear;Nonlinear Photonic Sensor Networks · Adam B. Cohen (Phys, IREAP) · Bhargava Ravoori (Phys, IREAP) · Karl R properties #12;Nonlinear Optoelectronic time-delayed feedback loop MZ EOM RF in bias VDC laser photo

  7. Vehicle Signage Policy Outline the policy regarding signage on University of Michigan (U-M) vehicles.

    E-Print Network [OSTI]

    Kirschner, Denise

    Vehicle Signage Policy Objective Outline the policy regarding signage on University of Michigan (U-M) vehicles. Policy 1. All vehicles owned by U-M will be identified by a vehicle number, U-M decal and special municipal license plate issued by Fleet Services. 2. All signage on vehicles owned by U-M must be approved

  8. VEHICLE LEASE This form is an agreement between a University of Michigan (U-M) department and U-M Parking and Transportation

    E-Print Network [OSTI]

    Kirschner, Denise

    VEHICLE LEASE This form is an agreement between a University of Michigan (U-M) department and U-M Parking and Transportation Services (PTS) Fleet Services to lease a vehicle. Form-1470 or mail/deliver to 1213 Kipke Drive Zip 2002 Department Information U-M Vehicle # Shortcode Parking

  9. http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT

    E-Print Network [OSTI]

    Ghosh, Somnath

    http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM IN ENVIRONMENTAL ENGINEERING AND SCIENCE 1. CIP Code 141401 2. Credential Level MHEC Approved 3. Program Length://www.onetonline.org/find/ SOC System: http://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 17

  10. http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT

    E-Print Network [OSTI]

    Ghosh, Somnath

    http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM: ADVANCED CERTIFICATE FOR POST-MASTER'S STUDY IN ENVIRONMENTAL ENGINEERING, SCIENCE, AND MANAGEMENT 1. CIP-1053.00 Environmental Science Teachers, Postsecondary 172081.00 Environmental Engineers 119041.00 Architectural

  11. http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT

    E-Print Network [OSTI]

    Ghosh, Somnath

    http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM-1053.00 Environmental Science Teachers, Postsecondary 172081.00 Environmental Engineers 119041.00 Architectural-MASTER'S CERTIFICATE IN ENVIRONMENTAL ENGINEERING 1. CIP Code 141401 2. Credential Level Credential Level 4 ­ Post

  12. http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT

    E-Print Network [OSTI]

    Ghosh, Somnath

    http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM: GRADUATE CERTIFICATE IN ENVIRONMENTAL ENGINEERING 1. CIP Code 141401 2. Credential Level MHEC Approved 3://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 172081.00 Environmental Engineers 119041

  13. http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT

    E-Print Network [OSTI]

    Ghosh, Somnath

    http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM-1053.00 Environmental Science Teachers, Postsecondary 172081.00 Environmental Engineers 119041.00 Architectural-MASTER'S CERTIFICATE IN CLIMATE CHANGE, ENERGY, AND ENVIRONMENTAL SUSTAINABILITY 1. CIP Code 030103 2. Credential Level

  14. http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT

    E-Print Network [OSTI]

    Ghosh, Somnath

    http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM MASTER'S STUDY IN ENVIRONMENTAL PLANNING AND MANAGEMENT 1. CIP Code 141401 2. Credential Level MHEC://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 172081.00 Environmental Engineers 119041

  15. http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM INTEGRITY RULES GAINFUL EMPLOYMENT

    E-Print Network [OSTI]

    Ghosh, Somnath

    http://ep.jhu.edu/graduate-degree-programs/environmental-engineering-science-and-management PROGRAM: GRADUATE CERTIFICATE IN ENVIRONMENTAL ENGINEERING, PLANNING AND MANAGEMENT 1. CIP Code 141401 2. Credential://www.onetonline.org/find/ SOC System: http://www.bls.gov/soc/ 17-3025.00 Environmental Engineering Technicians 172081

  16. Vehicle Maintenance Policy Outline the policy regarding vehicle maintenance at University of Michigan (U-M).

    E-Print Network [OSTI]

    Kirschner, Denise

    Vehicle Maintenance Policy Objective Outline the policy regarding vehicle maintenance at University of Michigan (U-M). Policy 1. All maintenance performed on U-M vehicles must be coordinated through Garage to repair their fleet vehicles. 2. U-M vehicles leased through Fleet Services include routine maintenance

  17. S A P D O C U M E N T N U M B E R S IF THE FINANCE

    E-Print Network [OSTI]

    Weaver, Harold A. "Hal"

    S A P D O C U M E N T N U M B E R S IF THE FINANCE DOCUMENT STARTS WITH AND IS AND DOC TYPE Transactions Enter Asset Transaction FB03 Any Finance or Sponsored Transactional Reports such as: CO Monthly long AB Automatic Clearing Automatic Clearing FB03 Any Finance or Sponsored Transactional Reports

  18. Vehicle Use Policy Outline the policy regarding vehicle use at the University of Michigan (U-M).

    E-Print Network [OSTI]

    Kirschner, Denise

    Vehicle Use Policy Objective Outline the policy regarding vehicle use at the University of Michigan (U-M). Policy 1. Vehicles owned or leased and furnished by the U-M are to be used exclusively the direct supervision of a U-M staff member. 3. All vehicles must be parked on U-M property (owned or leased

  19. Vehicle Maintenance Procedure Outline the procedure for vehicle maintenance at University of Michigan (U-M).

    E-Print Network [OSTI]

    Kirschner, Denise

    Vehicle Maintenance Procedure Objective Outline the procedure for vehicle maintenance at University of Michigan (U-M). Procedure 1. Your U-M vehicle has a mechanical and/or safety issue. 2. Contact Garage of the vehicle or if needed, have the vehicle towed to the maintenance facility. 4. If a loaner is needed while

  20. Accident Procedure Outline the procedures for accidents involving University of Michigan (U-M) vehicles.

    E-Print Network [OSTI]

    Kirschner, Denise

    owned by U-M are covered by the U-M self insurance program administered by Risk Management. Procedure 1. An accident is defined as any incident that causes damage to people or property. 2. In the event. 4. If the accident causes personal injury to the driver, occupants and/or pedestrian, contact Risk

  1. Operator Licensing Policy Outline the policy to ensure proper licensure of operators at the University of Michigan (U-M)

    E-Print Network [OSTI]

    Kirschner, Denise

    at the University of Michigan (U-M) according to State of Michigan law. Policy 1. In order to operate a U-M vehicle, State of Michigan and federal guidelines require that the operator possess the appropriate vehicle

  2. Seat Belt Use Policy Outline the policy regarding use of seat belt in University of Michigan (U-M) vehicles.

    E-Print Network [OSTI]

    Kirschner, Denise

    Seat Belt Use Policy Objective Outline the policy regarding use of seat belt in University of Michigan (U-M) vehicles. Vehicle Use Policy 1. Staff members are responsible to operate U-M vehicles are adhering to the seat belt use laws when operating a U-M vehicle. 3. State of Michigan seat belt laws

  3. Vehicle Repair Policy Outline the policy regarding vehicle repair on University of Michigan (U-M) vehicles.

    E-Print Network [OSTI]

    Kirschner, Denise

    Vehicle Repair Policy Objective Outline the policy regarding vehicle repair on University of Michigan (U-M) vehicles. Policy 1. All vehicle repairs performed on U-M vehicles must be coordinated facility to repair their fleet vehicles. 2. U-M vehicles leased through Fleet Services include routine

  4. Insurance Coverage Policy Outline the policy regarding insurance coverage on University of Michigan (U-M) vehicles.

    E-Print Network [OSTI]

    Kirschner, Denise

    -M are covered by the U-M self insurance program administered by Risk Management. 3. U-M vehicles owned insured and carries personal protection, residual liability and property protection insurance on all coverage through Risk Management. 5. U-M vehicles owned by the using department and not registered

  5. R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany

    E-Print Network [OSTI]

    Peinke, Joachim

    for energy program and projects · Experts related to Renewable Energy Technologies; e.g. biomass, small-hydro,R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany (RESDIG is organizing a two-day seminar on renewable energies and a two-day field-trip to some renewable energy projects

  6. Department ofElectricaland Computer Engineering M E M O R A N D U M

    E-Print Network [OSTI]

    Saskatchewan, University of

    Requirement Agriculture and Bio-resource Engineering 15 Chemical Engineering 12 Mechanical Engineering 15Department ofElectricaland Computer Engineering M E M O R A N D U M To: Gregory Marion, Chair, Department of Electrical and Computer Engineering Date: 1/14/2011 Re: Modification to Credit Unit Requirement

  7. M E M O R A N D U M OFFICE OF THE PROVOST

    E-Print Network [OSTI]

    Shoubridge, Eric

    M E M O R A N D U M OFFICE OF THE PROVOST Professor Anthony C. Masi Provost James Administration Building TO: Faculty Deans FROM: Anthony C. Masi, Provost DATE: March 2011 SUBJECT that dossiers may more easily be submitted to national teaching award competitions. The Guidelines

  8. h t t p : / / a l u m n i . w v u . e d u A L U M N I A S S O C I A T I O N

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    h t t p : / / a l u m n i . w v u . e d u A L U M N I A S S O C I A T I O N Strategic Plan #12;Strategic Plan A L U M N I A S S O C I A T I O N Strategic Plan Mission The WVU Alumni Association serves;Strategic Plan A L U M N I A S S O C I A T I O N Strategic Plan Vision The WVU Alumni Association strives

  9. MAMMALIAN SPECIES No. 706, pp. 19, 3 figs. Heterocephalus glaber. By Jennifer U. M. Jarvis and Paul W. Sherman

    E-Print Network [OSTI]

    Hayssen, Virginia

    MAMMALIAN SPECIES No. 706, pp. 1­9, 3 figs. Heterocephalus glaber. By Jennifer U. M. Jarvis the next day. Photograph by J. U. M. Jarvis. Heterocephalus Ru¨ppell, 1842 Heterocephalus Ru¨ppell, 1842 tail, no fur, 3 molars (sometimes 2), and digit 3 of forefoot markedly longer than digit 4. GENERAL

  10. Medical Certification Policy Outline the policy to ensure proper licensure of operators at the University of Michigan (U-M)

    E-Print Network [OSTI]

    Kirschner, Denise

    at the University of Michigan (U-M) according to State of Michigan law. Policy 1. In order to operate a U-M vehicle, State of Michigan and federal guidelines require that the operator possess the appropriate vehicle card) to operate. 3. Federal guidelines and State of Michigan law require operators of the following

  11. Vehicle Rental Procedure Outline the procedure for renting motor pool vehicles at University of Michigan (U-M).

    E-Print Network [OSTI]

    Kirschner, Denise

    Vehicle Rental Procedure Objective Outline the procedure for renting motor pool vehicles at University of Michigan (U-M). Procedure 1. All policies pertaining to U-M vehicles also pertain to motor pool rental vehicles. 2. Motor pool vehicles can be reserved for a period of a few hours up to one year. 3

  12. Loaner Vehicle Policy Outline the policy regarding issuance of loaner vehicles for University of Michigan (U-M)

    E-Print Network [OSTI]

    Kirschner, Denise

    Loaner Vehicle Policy Objective Outline the policy regarding issuance of loaner vehicles for University of Michigan (U-M) vehicles in the garage for maintenance. Vehicle Maintenance Policy 1. All maintenance performed on U-M vehicles must be coordinated through Garage Services. Exception: Both U

  13. Accident Reporting Policy Outline the policy regarding accident reporting on University of Michigan (U-M) vehicles.

    E-Print Network [OSTI]

    Kirschner, Denise

    owned by U-M are covered by the U-M self insurance program administered by Risk Management. Policy 1. An accident is defined as any incident that causes damage to persons or property. 2. In the glove box of every

  14. R e s u m e 1 o f 1 8 PATRICK S. SULLIVAN, REA, CPP

    E-Print Network [OSTI]

    R e s u m e 1 o f 1 8 PATRICK S. SULLIVAN, REA, CPP E d u c a t i o n BA ­ Harvard University, Biology/Ecology; 1989 P r o f e s s i o n a l L i c e n s e / C e r t i f i c a t i o n s State Action Reserve (CAR) California Air Resources Board (CARB), Accredited Lead Verifier (E.O. H-09-60) P r o

  15. S U B J E C T M E M O R A N D U M D K

    Office of Legacy Management (LM)

    ::6,: ;&-i4 ------e--w-- S U B J E C T : M E M O R A N D U M D K & & & o ---w--- --- --- O W N E R ( S ) -----s-B P a u tr ---...

  16. Rental Policy PTS Fleet Services has a rental pool for U-M departments that have a need to lease or rent a vehicle to

    E-Print Network [OSTI]

    Kirschner, Denise

    for U-M departments that have a need to lease or rent a vehicle to conduct University business both on and off campus. Vehicles may be rented student organizations may rent U-M vehicles as long as there is a U-M business

  17. F R O M M E M O R A N D U M D A T E

    Office of Legacy Management (LM)

    r F R O M : M E M O R A N D U M D A T E ----B--M S U B J E C T : A L T E R N A T E ' N A M E 8 --- ----a- O W N E R ( S ) --- Past ---...

  18. WEST TEXAS HISTORICAL ASSOCIATION VO L U M E X X I, IS S U E 1

    E-Print Network [OSTI]

    Rock, Chris

    WEST TEXAS HISTORICAL ASSOCIATION VO L U M E X X I, IS S U E 1 SP R I N G 2 0 1 4 THE CYCLONE 91st of Odessa has announced that the April 4-5, 2014 annual meeting of the West Texas Historical Association 2) #12;Page 2 The Cyclone From the President THE CELEBRATION OF PUBLIC HISTORY The West Texas

  19. Commercial Driver License Policy Outline the policy to ensure proper licensure of operators at the University of Michigan (U-M)

    E-Print Network [OSTI]

    Kirschner, Denise

    of operators at the University of Michigan (U-M) according to State of Michigan law. Policy 1. In order to operate a U-M vehicle, State of Michigan and federal guidelines require that the operator possess that are discussed in the operator licensing policy. 2. Federal guidelines and State of Michigan law require

  20. APA Guidelines for U/M SON Papers Using the 6th edition of the Publication Manual was released in July 2009. Students should now be using the

    E-Print Network [OSTI]

    Eustice, Ryan

    APA Guidelines for U/M SON Papers Using the 6th Edition APA's 6th edition of the Publication Manual in preparing papers. Faculty expect students to follow the guidelines in this document when writing scholarly are indented, boldface, lower case that end with period; see example of Level 1,2, & 3 headings in text on page

  1. The Michigan Almanac is a publication of the U-M Office of Budget and Planning with valuable assistance provided by

    E-Print Network [OSTI]

    Michigan, University of

    ! "#$!%&'#&()*!)+%)*)'! July 2013 #12;The Michigan Almanac is a publication of the U-M Office Nondiscrimination Policy Statement The University of Michigan, as an equal opportunity/affirmative action employer. The University of Michigan is committed to a policy of equal opportunity for all persons and does

  2. FUEL DEVICE APPLICATION Use this application to request a fuel device to access the University of Michigan (U-M) Parking and Transportation

    E-Print Network [OSTI]

    Kirschner, Denise

    FUEL DEVICE APPLICATION Use this application to request a fuel device to access the University of Michigan (U-M) Parking and Transportation Services (PTS) service stations for fuel. A fuel device owned and managed by PTS Fleet Services equipped with an automated fuel device. Please read the Use

  3. ALTERNATIVE FUEL VEHICLE (AFV) INFORMATION Over 98% of the U-M auto passenger fleet is flex fuel vehicles (FFV). A FFV is capable of operating on

    E-Print Network [OSTI]

    Kirschner, Denise

    ALTERNATIVE FUEL VEHICLE (AFV) INFORMATION Over 98% of the U-M auto passenger fleet is flex fuel of both. FFV's are equipped with an engine and fuel system designed specifically to be compatible with ethanol's chemical properties. FFV's qualify as alternative fuel vehicles under the Energy Policy Act

  4. v o l. 6 n o. 4 S u m m e r 2 0 0 4 School of Computer Science, Telecommunications & Information Systems

    E-Print Network [OSTI]

    Schaefer, Marcus

    v o l. 6 n o. 4 S u m m e r 2 0 0 4 School of Computer Science, Telecommunications & Information picture company launched by CTI's digital cinema program, which shot its inaugural film, "Last Call-of-the-art digital cinema program. A new faculty member--Academy Award-winning sound editor David Stone--is working

  5. WEST TEXAS HISTORICAL ASSOCIATION V O L U M E X X , S P E C I A L I S S U E

    E-Print Network [OSTI]

    Rock, Chris

    WEST TEXAS HISTORICAL ASSOCIATION V O L U M E X X , S P E C I A L I S S U E F A L L 2 0 1 3 Meeting will be held April 4-5, 2014 in Odessa, Texas. The conference will be held at the MCM Grande Hotel Western Trail Association of Texas sponsored a special session that outlined the grassroots project

  6. Page 6 T H E E N V I R O N M E N TA L F O R U M Managing Water Demand

    E-Print Network [OSTI]

    Shapiro, Benjamin

    as structural solutions, more emphasis on demand-side as well as supply-side management techniques, and a growPage 6 T H E E N V I R O N M E N TA L F O R U M Managing Water Demand: Price vs. Non-price demand management tech- niques." These would include actions such as requiring low-flow fixtures

  7. H U M A N R E S O U R C E S E R V I C E S M A N U A L INSTITUTION CODES

    E-Print Network [OSTI]

    H U M A N R E S O U R C E S E R V I C E S M A N U A L INSTITUTION CODES INSTITUTION CODES University of New York City College 002688 #12;H U M A N R E S O U R C E S E R V I C E S M A N U A L at Indianapolis 001813 #12;H U M A N R E S O U R C E S E R V I C E S M A N U A L INSTITUTION CODES Inter American

  8. Stress corrosion cracking: New experiments, new insights M I T E N E R G Y I N I T I AT I V E A U T U M N 2 0 1 2

    E-Print Network [OSTI]

    Yildiz, Bilge

    % post-consumer recycled content, with the balance coming from responsibly managed sources. Energy. Economic pressures both in the United States and in other key economies around the world threaten T U M N 2 0 1 2 I N T H I S I S S U E Energy Futures Discovering solutions: Undergrads take the lead

  9. Copyright 2005 Hafiz Abdur Rahman & Konstantin Beznosov T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A

    E-Print Network [OSTI]

    : · IT Infrastructure · Telecommunication Infrastructure · Water Supply · Electrical Power System · Oil and Gas · Road of Fault: e.g., "Electrical device failure" · Source Infrastructure: e.g., "IT Infrastructure" · Affected S H C O L U M B I A Analysis of Interdependencies between CITI and other Critical Infrastructures

  10. A M a g a z i n e f o r A l u m n i a n d F r i e n d s WINTER 2013 2020CSU President Tony Frank's

    E-Print Network [OSTI]

    A M a g a z i n e f o r A l u m n i a n d F r i e n d s WINTER 2013 CSU 2020CSU President Tony VIEW A Magazine for Alumni and Friends WINTER 2013 · NUMBER 62 Editorial Committee Chair ­ Tom Milligan

  11. E S T R A T G I A C o m m u n i s o m n i u m s a p i e n t i a

    E-Print Network [OSTI]

    Geffner, Hector

    UPF25 E S T R A T Č G I A ANYS C o m m u n i s o m n i u m s a p i e n t i a #12;© UNIVERSITAT POMPEU FABRA març del 2010 UPFGREC: 377-10/I #12;ÍÍNNDDEEXX Presentació de l'estratčgia `UPF25 ANYS' 3 La Universitat Pompeu Fabra: situació actual 5 Visió, valors i objectius d'`UPF25 ANYS' 13 Eix bŕsic de creació

  12. C O L L E G E O F H U M A N E C O L O G Y , C O R N E L L U N I V E R S I T Y Human Ecology

    E-Print Network [OSTI]

    Wang, Z. Jane

    C O L L E G E O F H U M A N E C O L O G Y , C O R N E L L U N I V E R S I T Y Human Ecology 2005/VOLUME 32, NUMBER 3 #12;FEATURES Human Ecology HEALTHY PEOPLE, FAMILIES, COMMUNITIES COURTESYOFSHEILADANKO Volume 32, Number 3 March 2005 The New York State College of Human Ecology at Cornell University

  13. V O L U M E

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron SpinPrincetonUsing Maps to Predict SolarJohnpotential-calcV > 111E

  14. Zlatko Tesanovic, Johns Hopkins University zbt@pha.jhu.edu http://www.pha.jhu.edu/~zbt

    E-Print Network [OSTI]

    Tesanovic, Zlatko

    in phenomenology of FePn Spin-Orbit Interplay and "Hidden Order" in FePn J. Kang and ZT, PRB 83, 020505 (2011) #12, and H.-P. Cheng, PRB 77, 220506 (2008) K. Kuroki et al, PRL 101, 087004 (2008) dxz odd parity even #12;Interactions in FeAs I V. Cvetkovic and ZT, PRB 80, 024512 (2009); J. Kang and ZT, PRB 83, 020505

  15. H A R T N E L L C O L L O Q U I U M A N E X P L O R A T I O N O F C O M M E R C I A L

    E-Print Network [OSTI]

    Botea, Adi

    H A R T N E L L C O L L O Q U I U M A N E X P L O R A T I O N O F C O M M E R C I A L L A W U N D E R T H E H I G H C O U R T O F C H I E F J U S T I C E F R E N C H Chief Justice French since 1986, Chief Justice French brought a wealth of commercial law experience to the High Court

  16. UMD Parking Rates & Fees 2012/13 2014/15

    E-Print Network [OSTI]

    Amin, S. Massoud

    2012-13 Actual 2013-14 Proposed 2014-15 Green Permit $226.00 / yr $15.00 / wk $232.00 / yr $15.00 / wk $232.00 / yr $15.00 / wk Gold Permit $379.00 / yr $390.00 / yr $390.00 / yr White Permit Not Applicable $120

  17. wellness.umd.edu 1. Choose a balanced, energy-

    E-Print Network [OSTI]

    Gruner, Daniel S.

    sporting event 30. Play an instrument 31. Write a poem or story 32. Go ice skating at Wells Ice Rink 33

  18. B ALLR O O M AND SU R R O U ND IN G H ALLWAY S R O O M N U M B E R S Q UA R E FE E T S M A R T R O O M B A N Q U E T C L A S S R O O M L E C T U R E N O N P R O FI T R AT E P R O FI T R AT E

    E-Print Network [OSTI]

    Hutcheon, James M.

    B ALLR O O M AND SU R R O U ND IN G H ALLWAY S R O O M N U M B E R S Q UA R E FE E T S M A R T R O O M B A N Q U E T C L A S S R O O M L E C T U R E N O N P R O FI T R AT E P R O FI T R AT E 1601 Hallway 3020 NO $245 $370 M E E T I N G R O O M S R O O M N U M B E R S Q UA R E FE E T S M A R T R O O M

  19. Jonathan Kirsch 2225 Sharon Road http://www.cs.jhu.edu/~jak

    E-Print Network [OSTI]

    Amir, Yair

    of the technologies deemed most relevant. #12;· Survivable SCADA March 2010 ­ Present Technical lead for project Acquisition (SCADA) systems for electricity distribution. Designed and implemented high-performance, multi, and iOS. Integrated replication engine with a large and widely-deployed Siemens SCADA product, resulting

  20. Type of Proposal: o New: Proposals submitted for the 1st time; new dollars to JHU.

    E-Print Network [OSTI]

    flexibility to determine spending categories and research direction. Grants are usually made in support. Activity Type: o Organized Research is described as all research and development activities utilize the same facilities as other research and development activities and where such activities

  1. Combined Central and Subspace Clustering for Computer Vision Applications Le Lu LELU@CS.JHU.EDU

    E-Print Network [OSTI]

    - tributed around multiple cluster centers inside each subspace. We propose a generalization of Kmeans such as Kmeans (Duda et al., 2000) or Expectation Maximization (EM) (Dempster et al., 1977). Appearing into multiple sub- spaces using GPCA and grouping the data inside each sub- space using Kmeans. This initial

  2. SPEECH RECOGNITION WITH SEGMENTAL CONDITIONAL RANDOM FIELDS: A SUMMARY OF THE JHU CLSP 2010 SUMMER WORKSHOP

    E-Print Network [OSTI]

    Hunt, Galen

    , modulation fea- tures, and whole word point-process models. The SCRF framework is able to appropriately might be the similarity between observed and expected formant tracks. The key characteristic of the SCRF

  3. CorrespondingAuthor:RajatMittal;mittal@jhu.edu To Appear in ASME Journal of Biomechanical Engineering

    E-Print Network [OSTI]

    Mittal, Rajat

    -pull. Introduction In swimming, the hand may be thought of as a quasi-airfoil (Bixler & Riewald, 2002). The drag tanks and Bixler and Riewald (2002) used computational fluid dynamic simulations of the hand and forearm

  4. Testbed Software for NSLU2 The JHU testbed software is developed to help users

    E-Print Network [OSTI]

    Amir, Yair

    testbed 3.0. Conventions The followings are the conventions defined by tos.py. Suppose you want three digits of TCP port implies TOS_NODE_ID of a mote. With the e 2 / 3 #12;Testbed Software for NSLU2 Suppose the mote's TOS_NODE_ID you want to read data from is 3. Then, by executing the following conetwork

  5. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    with a lighter orange core. Roots become woody when fully mature, but are excellent when harvested at their prime-drained soil that is free from rocks, clods, or debris. Raised beds work well for carrots. Soil pH should mulched, can last until winter. Nutrition: Rich in beta-carotene (converts to Vitamin A). Also a source

  6. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    plastic mulch muskmelons will produce larger and earlier harvests. Run a soaker hose or drip irrigation with a sharp hoe. Avoid any deep cultivation around plants. If not using black plastic mulch, cover soil line under the plastic, if possible. Most muskmelon cultivars are not well suited to small gardens

  7. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    containers 3 weeks before planting time. Seed or transplants can be planted through black plastic to hasten start to form. · Weeding ­Remove all young weed seedlings by hand or with a hoe and use a mulch around

  8. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    to produce stronger, more prolific plants. Black plastic mulch is an excellent garden aid for speeding growth. Try black plastic mulch, newspaper, straw, dry grass clippings or dried leaves. · Watering: Uniform-10-10 or equivalent per 10 ft. of row after first fruits set. · Weeding: Weeds can be controlled by the use of mulch

  9. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    before planting time. Seed or transplants can be planted through black plastic to hasten maturity. After a mulch around plants to keep weed seeds from germinating. · Specialdirections - Many squashes

  10. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    pea seeds between the folds of a moistened paper towel and place inside a clear, perforated plastic- slice off young weeds at the soil line or use a thick mulch to prevent weeds. · Watering ­ Keep the root

  11. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    -Remove all young weed seedlings by hand and use a mulch laid along each side of the row to keep weed. In refrigerator, store in a vented plastic bag. Nutrition: Beets contain small amounts of several vitamins

  12. www.growit.umd.edu Home and Garden Information Center 12005 Homewood Road Ellicott City, MD 21042 www.hgic.umd.edu

    E-Print Network [OSTI]

    Hill, Wendell T.

    feet or row after the first fruits form. · Watering - Black plastic mulch with a soaker hose or drip. Black plastic mulch will increase yields. · SpecialDirections - Warm to hot weather throughout, they must have well-drained soil. · Weeding - Maintain a weed-free bed by using a mulch to cover the soil

  13. V O L U M E 4 5 N U M B E R 3 S P R I N G 2 0 0 7

    E-Print Network [OSTI]

    He, Chuan

    at the University of Chicago Law School. #12;O 1 9 1 3 - 2 0 0 5 2 S P R I N G 2 0 0 7 Paul Ricoeur: Hermeneutics, to phenomenol- ogy, to a new perspective on phenomenology called hermeneutic phenomenology, and to a fresh under he included science in his theory of hermeneutics, i.e., his philosophy of how we interpret the signs

  14. VO L U M E 1 4 N U M B E R 4 FA L L 2 0 1 2 CLASS OF 2016 p. 8

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    treatments to maximize effectiveness in patient care FALL 2012 Diagnostic Imaging and Radiology Research UW Student Life 34 WIMR II 36 Healer's Journey 40 Larson's Perspective Addiction Medicine Fellowship Training future primary care providers to confront this serious issue Connecting Disciplines for Digestive Health

  15. Psychological Review V O L U M E 86 N U M B E R 3 MAY 1 9 7 9

    E-Print Network [OSTI]

    Bustamante, Fabián E.

    of Illinois, SI Gerty Drive, Cham- paign, Illinois 61820. between their representations in a multidi

  16. D e t e r m i n a t i o n o f t h e l a y e r s t r u c t u r e o f e m b e d d e d s t r a i n e d I n G a A s m u l t i p l e q u a n t u m w e n t -b y h i g h r e s o l u t i o n x -r a y d i f f r a c t i o n

    E-Print Network [OSTI]

    Choi, Woo-Young

    / z˘ D e t e r m i n a t i o n o f t h e l a y e r s t r u c t u r e o f e m b e d d e d s t r a i n e d I n G a A s m u l t i p l e q u a n t u m w e n t - b y h i g h r e s o l u t i o n x - r a y d i f f r a c t i o n W o o - Y o u n g C h o i a n d C H f t o n G . F o n d a d D e P O T m e n r

  17. A b s o r p t i o n s p e c t r o s c o p y o n r o o m t e m p e r a t u r e e x C I M I --t r a n s i t i o n s i n s t r a i n e d l a y e r l n G a A s / l n G a A l A s m u l t i q u a n t u m -w e H s t r u c t u r e s

    E-Print Network [OSTI]

    Choi, Woo-Young

    A b s o r p t i o n s p e c t r o s c o p y o n r o o m t e m p e r a t u r e e x C I M I - - t r a n s i t i o n s i n s t r a i n e d l a y e r l n G a A s / l n G a A l A s m u l t i q u a n t u m - w e H s t r u c t u r e s Y . H |r a Y a m a , a ) W o o - Y o u n g C h d , L . H . P e n g , b

  18. Ra d io so n d e W o rk sh o p , 2 1 -2 3 M a y 2 0 0 2 , H a m p to n U n iv e rstiy , V irg in ia U N D E R S T A N D IN G A N D C O R R E C T IN G H U M ID IT Y M E A S U R E M E N T E R R O R S

    E-Print Network [OSTI]

    Wang, Junhong

    Ra d io so n d e W o rk sh o p , 2 1 -2 3 M a y 2 0 0 2 , H a m p to n U n iv e rstiy , V irg in ia 1 U N D E R S T A N D IN G A N D C O R R E C T IN G H U M ID IT Y M E A S U R E M E N T E R R O R S F R O M V A IS A L A R S 8 0 A N D V IZ R A D IO S O N D E S J u n h o n g W a n g * N a tio n a l C

  19. WSC 2000 1http://www.isr.umd.edu/IPDPM/ Understanding the Impact of Equipment and

    E-Print Network [OSTI]

    Rubloff, Gary W.

    simulation applications Process, equipment or industrial engineers Operations engineer Lot Process Times # process chambers 2 Scheduling algorithm push OD time 15 sec Robot move time 6 sec W CVD cluster tool # process chambers 3 Scheduling algorithm pull OD time 12 sec Robot move time 5 sec TiN PVD Thickness 30 nm

  20. UMD College of Pharmacy, Pharmacy Practice and Pharmaceutical Laboratory Safety Plan

    E-Print Network [OSTI]

    Minnesota, University of

    requirements for containers of hazardous substances and equipment or work areas that generate harmful physical potential health hazards in laboratories. This plan is intended to meet the requirements of the federal Laboratory Safety Standard, formally known as "Occupational Exposure to Hazardous Chemicals in Laboratories

  1. State of California E-Mail M e m o r a n d u m

    E-Print Network [OSTI]

    Sze, Lawrence

    Design Kris McKinlay 2013-2015 Kathryn Marshall +Dean, Orfalea College of Business Fred DePiero 2013 officio Continuing (Registrar) Debbie Arseneau Ex officio Continuing (Associate Registrar - Systems) Shawn

  2. State of California E-Mail M e m o r a n d u m

    E-Print Network [OSTI]

    Sze, Lawrence

    Notermann 2010-2012 Continuing +Dean, Architecture & Environmental Design Kathryn Marshall** 2009 (Associate Vice Provost for Systems and Resources) Cem Sunata Ex officio Continuing (Registrar) Debbie

  3. s u m m e r 2 0 1 2 Copyright 2012. All rights reserved.

    E-Print Network [OSTI]

    Carter, John

    sinegal Chairman, Costco Wholesale susan scott Founder, Fierce, Inc. Center for leadership formation Wholesale illustrAtions:

  4. University of Maryland Institute for Advanced Computer Studies U M I A C S

    E-Print Network [OSTI]

    Gruner, Daniel S.

    data in an energy-efficient way makes sensors much more usable, and Deshpande also works to create energy efficient algo- rithms for sensor networks. Deshpande's methods n of searchers to communicate at the World Trade Center in 2001 and the chaos on the ground after Hurricane

  5. ACCELERATOR R&D S U M M A R Y

    E-Print Network [OSTI]

    &D] #12;2 · Accelerators remain an essential component in Elementary Particle Physics Research of accelerator science and technology by the elementary particle physics program. Particle accelerators continue accelerator technologies is vital to the future of accelerator based elementary particle physics as well

  6. V O L U M E 3 4 , P A R T 7 BRIGHAM YOUNG UNIVERSITY

    E-Print Network [OSTI]

    Seamons, Kent E.

    of nearshore clastic sediment. These cyclic deposits exhibit a prograding clastic shoreline sequence of open Geology of the Standardville 7'12' Quadrangle, Carbon County, Utah. Harnblin 33 Stratigraphy and Depositional Environments of the Gebel el-Rus Area, Eastern Faiyum, Egypt

  7. September 2013 C U R R I C U L U M V I T A

    E-Print Network [OSTI]

    Reif, John H.

    and Neuroscience, Duke University (2003-2008) Assistant Professor, Psychology, The Ohio State University (1999 and implicit positivity bias: Evidence for selectivity in spontaneous trait inference. Journal of Experimental and consequences of human behavioral mimicry. Annual Review of Psychology, Vol. 64, 285-308. (5) Yang, L.W., Hansen

  8. TEST OF A LIQUID ARGON CHAMBER WITH 20-u m RMS RESOLUTION

    E-Print Network [OSTI]

    Derenzo, S.E.; Kirschbaum, A.R.; Eberhard, P.H.; Ross, R.R.; Sclmitz, F.T.

    2008-01-01T23:59:59.000Z

    electronics to build chambers with spacings of , "'rJ about 40 fJ-m to increase the signal to noise and hence reliability

  9. S u m m e r 2 0 1 3 Table of Contents

    E-Print Network [OSTI]

    Aalberts, Daniel P.

    received a joint PhD from Yale's Department of Anthropology and Forestry School, and will be teaching Center. We'll welcome him back in September 2014, just as our policy expert Professor Pia Kohler embarks and pushing the College to establish more aggressive goals for reducing our use of energy and other resources

  10. University of Maryland Institute for Advanced Computer Studies U M I A C S

    E-Print Network [OSTI]

    Gruner, Daniel S.

    but particularly subject to security risks. even power outages can cause data loss. "Unfortunately, electronic Joseph JaJa, professor of electrical and computer engineering and a member of the UMIACS Laboratory

  11. mXBP1u mXBP1s ATF6c XBP1s

    E-Print Network [OSTI]

    Virginia Tech

    , & Devices Space & Atmospheric Science Antennas & Propagation Optics & Photonics Networks & Cybersecurity. The department has additional emerg- ing areas of strength in autonomous sys- tems, biomedical applications

  12. Institut de Mathematiques de Jussieu U.M.R. 7586 du C. N. R. S.

    E-Print Network [OSTI]

    Waldschmidt, Michel

    revitalisation de la recherche au Kurdistan" du mardi 14 au jeudi 16 d´ecembre 2010 `a Erbil, Kurdistan December 14 - 16, 2010, Erbil (Kurdistan, Iraq) International Conference on Revitalizing Research in Kurdistan´egional du Kurdistan (KRG) a organis´e une conf´erence internationale "Revitalizing Research in Kurdistan" du

  13. M E M O R A N D U M To: IT Steering Committee

    E-Print Network [OSTI]

    Qiu, Weigang

    to marriage); information in #12;student education records that is protected under the Family Educational with these procedures over the past seventeen months, and your comments. INFORMATION TECHNOLOGY SECURITY PROCEDURES I of this information. Loss of data integrity, theft of data, and unauthorized or inadvertent disclosure could lead

  14. 4november 2009 s p e c t r u m

    E-Print Network [OSTI]

    Berns, Karsten

    direkt am St. Martinsplatz 7 Tel: 0631-68011 Fax: 0631-66825 E-mail: fbi-kl@t-online.de www.flugbuero-fbi

  15. Pagina 1 Curriculum Vitae di C U R R I C U L U M

    E-Print Network [OSTI]

    : AGGIORNAMENTO UNI EN ISO 9001: 2008 LABORATORIO DI CREATIVITA' E INNOVAZIONE PER IL PERSONALE DELLE SEGRETERIE

  16. Pagina 1 Curriculum Vitae di C U R R I C U L U M

    E-Print Network [OSTI]

    sicurezza Nel 2009 - La norma ISO 9001: 2008 Nel 2009 ­ Meeting 2009 Nel 2008 ­ Quotidiano e straordinario

  17. State of California E-Mail M e m o r a n d u m

    E-Print Network [OSTI]

    Sze, Lawrence

    Beightler 2012-2014 Debbie Rice Executive Director, Human Resources Sally Anderson 2013-2015 Mary Shaffer (Campus 504/ADA Coord. ­ Dir., Employment Equity) Mary Shaffer* Ex officio Continuing (Campus 508 Director, Cal Poly Corporation John Lee 2013-2015 Sally Anderson Executive Dir., Human Resources (non

  18. v o l u m e 2 n o . 1 105 2011 International Mycological Association

    E-Print Network [OSTI]

    , Johannes de Gruyter27 , Eveline Guého-Kellermann28 , Liang-Dong Guo10 , DavidS.Hibbett29 ,Seung-BeomHong30

  19. TO: FILE M E M O R A N D U M

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling7 AugustAFRICAN3uj: ;;I : T'ncZl' lO--23,TO:3

  20. I M E M O R A N D U M T O

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF INDUSTRIES,L? .-I I ,Is I I THEI) cL

  1. M E M O R A N D U M D A T

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF INDUSTRIES,L? .-I I2 m.m\Ll 1vr* LriH:

  2. Faculty Host: Prof. Somnath Ghosh, 203 Latrobe, 410-516-7833, sghosh20@jhu.edu Prof. Kevin Hemker, 223-C Latrobe, 410-516-6451, hemker@jhu.edu

    E-Print Network [OSTI]

    Ghosh, Somnath

    and fatigue in aerospace titanium alloys and nickel-based superalloys, strengthening mechanisms in automotive in Metallic Alloys and Importance for ICME The national initiative on Integrated Computational Materials aluminum alloys, and nanocluster strengthening in ferritic stainless steels for nuclear applications. He

  3. 550.777: The Probabilistic Method Professor Lenore Cowen JHU Math Sciences, Spring 1995 Scribe: Heather Park

    E-Print Network [OSTI]

    Cowen, Lenore

    or paper, rock, scissors. Definition 2 F it(T ) = max oe F it(T; oe) Properties: 1. F it(T ) â?? 0 Proof. For example, in the Rock, Scissors, Paper game, where rock crushes scissors, scissors cut paper, and paper covers rock, F it(T ) = 2\\Gamma1 = 1 for the rankings: rock, scissors, paper or scissors, paper, rock

  4. Prof M. Leite, mleite@umd.edu, 2123 CHE Building, 301-405-0231 Department of Materials Science and Engineering

    E-Print Network [OSTI]

    Rubloff, Gary W.

    (transport in semiconductors) Solar cell operation Solar cell design (introduction to simulation) PV technologies: Monocrystalline solar cells, III-V, III-nitrides, Thin-films a-Si, CdTe, CIGS, Light trapping/down conversion, hot-carrier cells Organic PV Characterization: IV, electrical measurements, optical, lifetime

  5. By Leigh Tracy, UMD Dietetic Intern Always on the go? Never have time to eat? Here are a

    E-Print Network [OSTI]

    Gruner, Daniel S.

    seeds 3 Tbsp. peanuts, raw Protein Bean dip Canned tuna or salmon (in water) White chicken or turkey

  6. Model-based Querying in Sensor Networks Amol Deshpande, University of Maryland, http://www.cs.umd.edu/~amol

    E-Print Network [OSTI]

    Deshpande, Amol

    ://db.lcs.mit.edu/madden SYNONYMS Approximate querying; Model-driven data acquisition DEFINITION The data generated by sensor is required to complement the sensor data. Models can help provide more robust interpretations of sensor readings: by accounting for spatial or temporal biases in the observed data, by identifying sensors

  7. ISDRS 2007, December 12-14, 2007, College Park, MD, USA ISDRS 2007 http://www.ece.umd.edu/ISDRS

    E-Print Network [OSTI]

    Technische Universiteit Delft

    to its low-cost process and the ability to be integrated with standard bulk CMOS technology. However]. Although mainly fabricated on SOI substrates, e.g. [2], body-tied FinFET has also gained attention due, the lack of isolation layer underneath the transistor body allows the drain field to penetrate toward

  8. E X E C U T I V E S U M M A R Y E X E C U T I V E S U M M A R Y

    E-Print Network [OSTI]

    Kammen, Daniel M.

    has also devoted resources and expertise to a number of public policy areas, including education, Electricity Innovation Institute Mark Levine Lawrence Berkeley National Laboratory Michael Lubell American

  9. I M K L I N I K U M I M K L I N I K U MI M K L I N I K U M NOCH MEHR KULTUR IM KLINIKUM

    E-Print Network [OSTI]

    Gollisch, Tim

    neuen Country-Songs und mit immer mehr eigenen Stücken. Echtes Western Feeling in der Osthalle. SONNTAG, Valse Musette, rasante Balkan-Rhyth- men oder lyrische Klänge ­ Ulrike Dangendorf schafft tönende Bilder

  10. A l u m n i C a m p u si n h a l t i m p r e s s u m Eine Freundin Tanzanias

    E-Print Network [OSTI]

    Vollmer, Heribert

    neue Krebsmedikamente Küstenschutz und Windkraft auf See Karriere ­ Köpfe ­ Konzerne Prominente Alumni

  11. V O L U M E 8 3 N U M B E R 1 S P R I N G 2 0 0 2 M A G A Z I N E

    E-Print Network [OSTI]

    Simaan, Nabil

    -7727. Vanderbilt University is commit- ted to principles of equal opportunity and affirmative action. Copyright a criminal is the appropriate legal consequence, does that mean we should do it? 27 Are Civil Liberties of the first in the country from a private institution to become involved with efforts to help transition

  12. C U R R I C U L U M V I T A E Dr. Rebecca Jo Safran

    E-Print Network [OSTI]

    Safran, Rebecca

    on Science and Technology and Department of Ecology and Evolutionary Biology September 2005 ­ December 2007, and S. Correa. Egg-yolk androgen and carotenoid deposition as a function of maternal social environment, ornamentation and patterns of parental care in the North American barn swallow. Journal of Avian Biology 41

  13. C U R R I C U L U M V I T A E Dr. Rebecca Jo Safran

    E-Print Network [OSTI]

    Safran, Rebecca

    on Science and Technology and Department of Ecology and Evolutionary Biology September 2005 ­ December 2007 care in the North American barn swallow. Journal of Avian Biology In revision 3. Safran, R.J., K.J. McGraw, K.M. Pilz, and S. Correa. Egg-yolk androgen and carotenoid deposition as a function of maternal

  14. C U R R I C U L U M V I T A E Dr. Rebecca Jo Safran

    E-Print Network [OSTI]

    Safran, Rebecca

    on Science and Technology and Department of Ecology and Evolutionary Biology September 2005 ­ December 2007 Behavior. 2. Maguire, S.E. M. Hau, and R.J. Safran. Paternity, ornamentation and patterns of parental care deposition as a function of maternal social environment in barn swallows Hirundo rustica. Journal of Avian

  15. AUGUST 2002 705H A N S T R U M E T A L . 2002 American Meteorological Society

    E-Print Network [OSTI]

    Doswell III, Charles A.

    -Season Tornadoes of California and Southern Australia BARRY N. HANSTRUM Bureau of Meteorology, Perth, Western Australia and Western Australia combined (gray) for each month for the 10 yr, 1987­96. FIG. 2. Map showing Australia, Australia GRAHAM A. MILLS Bureau of Meteorology Research Centre, Melbourne, Victoria, Australia

  16. 1 AUGUST 2000 2049M O U M A N D N A S H 2000 American Meteorological Society

    E-Print Network [OSTI]

    Kurapov, Alexander

    to enhance mixing by at least an order of magnitude (Lueck and Osborn 1985; Lueck and Mudge 1997; Toole et al. It is a rocky outcrop on a shelf that is predominantly silt and sand. Typically, an equatorward coastal jet

  17. Pagina 1 Curriculum Vitae di Rosella Favino Aprile 2013 C U R R I C U L U M

    E-Print Network [OSTI]

    guida ITIL 3.0 e ISO/IEC 20000:2005, CObIT, PMI/PMBoK, ISO/IEC 27001:2005) Progettazione e in ambito ICT (rif. ITIL 3.0 e ISO 20000). Dal - al 2000 ­ 2005 Nome e indirizzo del datore di lavoro CGweb

  18. C u r r i c u l u m V i t a e Robert E. Bilby

    E-Print Network [OSTI]

    . Bisson. Nutrient enrichment of riparian ecosystems by spawning salmon ($20,720) 1997 Washington salmon on N and C stable isotope signatures in stream biota. ($3500) 1996 Washington Forest Protection

  19. A l u m n i C a m p u s Dr. Sriram Venkatachalam wurde 1982 in

    E-Print Network [OSTI]

    Vollmer, Heribert

    Universität Hannover zur effi- zienten Dimensionierung von offshore-Wind- energie (Research at Alpha Ventus) im Teilprojekt »Seegangsbelastung auf offshore- Windenergieanlagen« eingebunden. Die Bundesregierung hat das Ziel, bis zum Jahr 2030 offshore-Windparks in Nord- und ostsee mit einer

  20. State of California The Resources Agency of California M e m o r a n d u m

    E-Print Network [OSTI]

    , 2008 staff filed data requests in the technical areas of air quality, alternatives, biological resources, cultural resources, hazardous materials management, public health, socioeconomics, transmission and the applicant included air quality, alternatives, biological resources, cultural resources, hazardous materials

  1. NEW SOURCE PERFORMANCE STANDARDS -NOVEMBER15,1982 ------m m m u m ~ U U -k d -

    E-Print Network [OSTI]

    (D) 1. Fossil-Fuel Fired Steam 2. Fossil-Fuel Fired Steam Generators (Da) 3. Incinerators (municipal Smelters (Q) Affected facility a. Fluid catalytic cracking unit catalyst torsneratorsregenerators c. Fuel gas combustion device ( § GO.100) d. Claus sulfur recovery plants (> 20 LTD/day) Storage capacity

  2. D O C U M E N T D E T R AVA I L LE DESCARTES I

    E-Print Network [OSTI]

    Boyer, Edmond

    'EMPLOIS AAU MAROC :U MAROC : LA CONTRIBUTION DES CR�ALA CONTRIBUTION DES CR�ATIONSTIONS ET DISPET DISPARITIONS Maroc : la contribution des créations et disparitions d'entreprises RICHARD DUHAUTOIS richard'Industrie (Maroc) DOCUMENT DE TRAVAIL N° 54 janvier 2006 hal-00831539,version1-7Jun2013 #12;ISSN 1629-7997 ISBN 2

  3. 1 October 18, 2012 C U R R I C U L U M V I T A E

    E-Print Network [OSTI]

    Ajo-Franklin, Jonathan

    experiments of double-diffusive convection in magma bodies RESEARCH INTERESTS · Geologic Carbon Sequestration · Injection of CO2 for carbon sequestration and enhanced gas recovery (CSEGR) · Near-surface leakage and seepage of CO2 · Risk assessment of geologic carbon sequestration sites · Compressed air energy storage

  4. S U M M E R 2 0 1 4 19 F E A T U R E

    E-Print Network [OSTI]

    Sibille, Etienne

    , and by the 1920s, enough similar cases surfaced that the disease was coined "sickle cell anemia." However

  5. Ronald and Eileen Weiser Professional Development Awards Fellows from Slovakia Pursuing Research at the U-M

    E-Print Network [OSTI]

    Eustice, Ryan

    with the Substance Abuse Section, Department of Psychiatry, the Addiction Research Center, and Addiction Treatment. Peter Krcho (MD, Ph.D.) is the director of the Neonatal Intensive Care Unit in the Pediatric Faculty

  6. s P O L I C Y F O R U M s 52 s DARWIN s GIUGNO

    E-Print Network [OSTI]

    Colorado at Boulder, University of

    quantitĂ  di energia solare catturata dalla Terra. I cam- biamenti dell'equilibrio energetico del pianeta

  7. August 30, 2010 C U R R I C U L U M V I T A E

    E-Print Network [OSTI]

    Burns, John A.

    , VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

  8. November 1, 2011 C U R R I C U L U M V I T A E

    E-Print Network [OSTI]

    Burns, John A.

    , VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

  9. May 1, 2013 C U R R I C U L U M V I T A E

    E-Print Network [OSTI]

    Burns, John A.

    , VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

  10. February 1, 2011 C U R R I C U L U M V I T A E

    E-Print Network [OSTI]

    Burns, John A.

    , VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

  11. Vehicle Operator Policy Outline the requirements for vehicle operators at the University of Michigan (U-M).

    E-Print Network [OSTI]

    Kirschner, Denise

    Vehicle Operator Policy Objective Outline the requirements for vehicle operators at the University be authorized by the using department and adhere to the vehicle use and licensing policies. 4. Operators must have a valid driver license with no more than 6 points on their motor vehicle record (MVR). A valid

  12. 44 EDUCATION NEXT / S U M M E R 2 0 1 2 educationnext.org Ze'ev Wurman

    E-Print Network [OSTI]

    Wilson, W. Stephen

    the Common Core standards are more numerous than California's. Fordham's review does not unequivocally say standards "fewer, higher, and clearer" than most state standards today? Can you pro- vide some specific standards may in fact be clearer and more demanding than many, though not all, of the state standards

  13. www.extension.ucr.edu S U M M E R A C A D E M Y

    E-Print Network [OSTI]

    will leave with the practical, marketable skills sought after in today's competitive market. Opportunities. You'll be part of a creative, dynamic and high- energy group driven to succeed. And the salary you visual impact. HOW TO EARN THIS PROFESSIONAL ACHIEVEMENT AWARD: Complete10unitsofrequiredcourses

  14. International V o l u m e 6 S p r i n g 2 0 0 5

    E-Print Network [OSTI]

    Ambassadorial Posts LATIN AMERICA 38 MSU Joins 50th Anniversary Celebration of Brazilian Business School 39 Food Safety Training for Latin America Stepped Up AFRICA 40 NIH Grant Funds MSU Partnership with University MSU Renews Agreement with Chinese Academy of Agricultural Sciences ASIAN TSUNAMI 10 MSU Campus

  15. S U M M E R 2 0 1 1www.ucd.ie/ucdtoday 5Socialmediaandmigrant

    E-Print Network [OSTI]

    . It is composed of found materials (specifications and notes from the school's technical workshops) and a perspex practical request to "make it work" to the eureka moments when a discovery is made. the permanent exhibition now on view in the ucd School of Physics. unlike any portrait exhibition you have ever seen

  16. M E M O R A N D U M To: DOE Office of General Counsel From: William T. Miller

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment ofLetterEconomy andTermsDepartment1| Department ofEnergy .E M O R A

  17. F R O M M E M O R A N D U M D A T E

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNew 1325.8.Enaineer;/:4,4 (; ...)369s 7' c

  18. T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 1 | N U M B E R 3 | M A R C H 3 , 2 0 0 5 UBC REPORTS

    E-Print Network [OSTI]

    Farrell, Anthony P.

    engineering, MEMS technology has been used to make sensing devices that control airbag deployment in cars

  19. UBC REPORTS T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 3 | N U M B E R 7 | J U L Y 5 , 2 0 0 7

    E-Print Network [OSTI]

    Farrell, Anthony P.

    . TB bacilli are unusual in that they can survive in macrophages ­ large immune cells that normally to make enzymes that degrade the cholesterol found in macrophage cell membranes. The bacilli use the degraded cholesterol for fuel to survive. In most infections, the macrophage is the enemy. In TB it

  20. T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 1 | N U M B E R 4 | A P R I L 7 , 2 0 0 5 UBC REPORTS

    E-Print Network [OSTI]

    Farrell, Anthony P.

    , such as central air-conditioning and heating systems are not required. As a result, tenants are spared significant long-term energy costs," says Robinson. As a showcase of its own innovative features, such as remote therapeutic potential of implantable sponge. PHOTO:MARTINDEE PHOTO:MARTINDEE 23rd ANNUAL CASE DISTRICT VIII

  1. T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 4 9 | N U M B E R 2 | F E B R U A RY 6 , 2 0 0 3 UBC REPORTS

    E-Print Network [OSTI]

    Farrell, Anthony P.

    Sewage 5 Legalize Marijuana 7 Fighting Print Journals "Valentine's Day can be brutal..." Rhyannon O on some level," Long says. "Because we all grow up well-versed in the language of the heterosexual

  2. T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A V O L U M E 5 2 | N U M B E R 4 | A P R I L 6 , 2 0 0 6 UBC REPORTS

    E-Print Network [OSTI]

    Farrell, Anthony P.

    source can be derived from pig manure. This versatile device is a hydrogen fuel cell, powered by the most cell technologies. The National Research Council's (NRC) Institute for Fuel Cell Innovation at UBC hydrogen run campus vehicles, cell phones BY HIL ARY THOMSON Almost everyone knows Pogo `Possum's famous

  3. Genome sequence and rapid evolution of the rice pathogen Xanthomonas oryzae pv. oryzae PXO99A.

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    L Salzberg* 1 , Daniel D Sommer 1 , Michael C Schatz 1 ,salzberg@umd.edu; Daniel D Sommer - dsommer@umiacs.umd.edu;

  4. Acta Astronautica 66 (2010) 391 --400 Contents lists available at ScienceDirect

    E-Print Network [OSTI]

    Akin, David

    2010-01-01T23:59:59.000Z

    author. Tel.: +1 301 405 4454. E-mail addresses: shane@ssl.umd.edu (S.E. Jacobs), dakin@ssl.umd.edu (D

  5. Effective: Saturday, November 15 (MD Football vs Michigan State) For more information visit transportation.umd.edu or call (301) 314-2255

    E-Print Network [OSTI]

    Hill, Wendell T.

    12:00AM midnight. 122 Green Suspended Service will be suspended until 12:00AM midnight. Nite Ride Lackawanna St Lackawanna St Laguna Rd Muskogee St Muskogee St Laguna Rd Edgewood Rd Niagara Rd Locust Hill Dr

  6. HCIL Technical Report No. 98-07 (May 1998); http://www.cs.umd.edu/hcil 1 An Application Framework for

    E-Print Network [OSTI]

    Golbeck, Jennifer

    for Creating Simulation-Based Learning Environments Anne Rose*, David Eckard**, and Gary W. Rubloff+ Human-based learning environments called SimPLE (Simulated Processes in a Learning Environment). Environments developed simple and build complexity [11][13][14], and · simulations that support "learning by doing"[2

  7. HCIL Technical Report No. 99-07 (May 1999); http://www.cs.umd.edu/hcil Jazz: An Extensible 2D+Zooming Graphics Toolkit in Java

    E-Print Network [OSTI]

    Golbeck, Jennifer

    of energy has gone into building tools that support 3D graphics. This is largely due to the complexity of 3D+Zooming Graphics Toolkit in Java Benjamin B. Bederson, Britt McAlister Human-Computer Interaction Lab, Institute that supports applications using zooming object-oriented 2D graphics. It is built entirely in Java using Java2D

  8. University of Maryland Systems & Computer Architecture Group technical report UMD-SCA-TR-2000-01. Multi-Chain Prefetching: Exploiting Natural

    E-Print Network [OSTI]

    Yeung, Donald

    -01. Multi-Chain Prefetching: Exploiting Natural Memory Parallelism in Pointer-Chasing Codes Nicholas Kohout

  9. Beyond the Classroom Living and Learning Program UNIV399F: Experiential Learning Seminar

    E-Print Network [OSTI]

    Milchberg, Howard

    -314-6623; E-mail: jriker@umd.edu Web: www.BeyondTheClassroom.umd.edu · Casey Willson, Retail Industry of Maryland. Phone: 301-403-8300 ext. 12; E-mail: lwillson@mdsbdc.umd.edu Web: www.mdsbdc.umd.edu · Teaching

  10. 8 a~ 1 u u m n 1~4u..eII&q I Volume 7,Number 1 Fall 1993

    E-Print Network [OSTI]

    's Electromagnetics Group. Kit provides secretarial support to Professor Kong, seven research staffand visiting -- Behind the Scenes in RLE's Electromagnetics Group "I love my work," Kit-Wah Lai speaks enthusiastically scientists, and almost twenty students. In the group's fast-paced environment, Kit manages her many tasks

  11. A l u m n i C a m p u sE N E R G I E (89 Kilometer nordwestlich

    E-Print Network [OSTI]

    Vollmer, Heribert

    Referenzprojekt für die Ent- wicklung der Offshore-Wind- energie besondere Bedeutung zu. Derzeit laufen in der Aus und 15 Insti- Einleitung Ziel der Bundesregierung ist es, bis zum Jahr 2030 Offshore- Windparks mit- wicklung fiel im Herbst 2008 mit dem Bau des Umspann- werks für das Offshore-Test- feld alpha ventus

  12. U S C S U m m e r P r o g r a m S 2 0 1 1 Future Physicians

    E-Print Network [OSTI]

    Rohs, Remo

    , physiology, the biology of disease, and ethics; issues of patient care; and the politics of health care," and career options in health care. earn 3 USC UnitS Learn more and apply online: summer.usc.edu/college a reform. Talk with practicing physicians about preparing for medical school, "life as a resident

  13. 1 J U L Y 2 0 0 9 V O L U M E 106 NU M B E R

    E-Print Network [OSTI]

    Wu, Junqiao

    -nitride semiconductors. The electronic structure, carrier dynamics, optical transitions, defect physics, doping disparity value of the InN bandgap provides a basis for a consistent description of the electronic structure of In. . . . . . . . . . . . . . . . . . . . . . . 2 B. Band structure. . . . . . . . . . . . . . . . . . . . . . . . . . 4 1. k·p calculations

  14. C I R AV O L U M E 3 3 , S P R I N G 2 0 1 0 Cooperative Institute for Research

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    /Director, ESRL Al Powell, Director, NOAA/NESDIS/STAR Graeme Stephens, Director of CIRA and University/ESRL Sonia Kreidenweis-Dandy, Professor, Colorado State Department of Atmospheric Science Graeme Stephens Center Transitioned to NCDC Operations Stan Kidder and Tom Vonder Haar isCCP It was always planned

  15. C u r r i c u l u m v i t a e Last name and first name Hartmann, Ulrich

    E-Print Network [OSTI]

    Luchsinger, Christof

    Processing as of January 1, 1979: Authorized Officer of BKW AG as of January 1, 1979: Authorized Officer Description of my activity at the BKW (1967­1981) - setting up and management of the technical/scientific data

  16. A l u m n i C a m p u s E N E R G I E und Lignocellulose heimischer

    E-Print Network [OSTI]

    Vollmer, Heribert

    Nichtnahrungsmittelpflanzen für die Produktion von Biogas einsetzen. Derzeit installierte Biogasanlagen nutzen zumeist den

  17. A S U M M A R Y R E P O R T Toward Zero Deaths is a cooperative program, building partnerships between community groups and

    E-Print Network [OSTI]

    Minnesota, University of

    to share information and to identify new approaches to reducing the number of fatalities and life changing for sharing information on progress made since 2001, for sharing best practices in the areas of engineering, brothers Matthew, Jacob, and Justin Backstrom were killed when their car was hit by a drunk driver near

  18. M E M O R A N D U M TO: Professor Alexandra Klass; Adjunct Professor Sara Peterson; and, Steven Lott,

    E-Print Network [OSTI]

    Netoff, Theoden

    of renewable energy that will be part of the UMore Park development include wind, biogas-fueled combined heat

  19. Musum national d'Histoire naturelle A R B O R E T U M D E C H E V R E L O U P

    E-Print Network [OSTI]

    un arboretum, il a souffert lors de la seconde guerre mondiale. Replanté dans les années 1960, il et martres. UnE EnCLAVE DE nATURE DAns LA PLAinE DE VERsAiLLEs Par sa richesse et sa diversité mitoyen du parc du château de Versailles dans sa partie sud. Il s'adosse au nord à la forêt de Marly et à

  20. V O L U M E 7 , I S S U E 2 F E B R U A R Y 2 0 1 3 HumanRESOURCES

    E-Print Network [OSTI]

    Bou-Zeid, Elie

    services: · Home energy audit · Attic insulation · Heater inspection, service, repair or replacement is on Tuesday, March 5, 2013, 10:00 a.m.­2:00 p.m. in Frist Multipurpose Rooms B and C. Schools, camps · Weather stripping and caulking · Refrigerator evaluation · Energy conservation education Opportu

  1. I s s u e 3 0 S u m m e r 2 0 0 6 Q u o t a b l e ...

    E-Print Network [OSTI]

    Edwards, Paul N.

    . He also works closely with the University Library in its leader- ship role within the University-GRID and the Connection Project. Finholt has played important roles in major national collaboratory efforts Library. For more, see page 7. N o t a b l e ... Showing Initiative: Public Spirit in Action Four master

  2. 9 A C C E S S N U M B E R 2 5 , F A L L 2 0 0 4

    E-Print Network [OSTI]

    Handy, Susan L.

    the effects of these social regulations? Have individual companies or entire industries suffered economic is now expanding the regulatory arena with the US's first-ever rules to reduce greenhouse gas emissions (see Figure 1). If perform- ance and size had been held constant from 1985

  3. DECEMBER 2000 2151S C H U M A C H E R A N D H O U Z E 2000 American Meteorological Society

    E-Print Network [OSTI]

    -dimensional distribution of latent heating in the Tropics (Simpson et al. 1988). To achieve this goal, the low, Clouds and Earth's Radiant Energy System, and Lightning Imaging Sensor. The PR is crucial to the mission. The reflectivity profile in each beam is corrected for attenuation by a hybrid method based on the method

  4. April 22, 2011 Institute for Quantum Matter

    E-Print Network [OSTI]

    von der Heydt, Rüdiger

    Spectroscopy · Neutron (SNS, NIST) · THz photon (JHU) · Micro waves (JHU) · Raman (JHU) · Angle Resolved Photo #12;Spectroscopy at National facilities Spallation Neutron Source, ORNL Advanced Light Source, LBNL NIST Center for Neutron Research #12;Accomplishments 2008-present · The Experimental Frontier ­ Cold

  5. Virtual Remote Center of Motion Control for Needle Placement Robots

    E-Print Network [OSTI]

    Boyer, Edmond

    mechanical design but also the need for calibration and registration of the robot to the medical imager priorVirtual Remote Center of Motion Control for Needle Placement Robots Emad M. Boctor, Robert J@jhu.edu, GaborF@jhu.edu http://cisstweb.cs.jhu.edu Abstract. Surgical robots, including those with remote center

  6. GrayWulf: Scalable Clustered Architecture for Data Intensive Computing Alexander S. Szalay1

    E-Print Network [OSTI]

    Burns, Randal

    , Gordon Bell2 , Jan Vandenberg1 , Alainna Wonders1 , Randal Burns1 , Dan Fay2 , Jim Heasley3 , Tony Hey2@jhu.edu, alainna@pha.jhu.edu, randal@cs.jhu.edu, dan.fay@microsoft.com, heasley@ifa.hawaii.edu, tony.hey

  7. Psychological Review0 Copyright 1977 C_J by the American Psychological Association, Inc. V O L U M E 84 N U M B E R 5 S E P T E M B E R 1 9 7 7

    E-Print Network [OSTI]

    , reliable, binary electronic components that are designed to operate by executing very quickly a long series be realized easily with those component parts in most systems, and we should expect the same to be true to electronic devices--on the order of a few milliseconds at the very fastest--we should expect there to be time

  8. S A N T A F E I N S T I T U T E W I N T E R 2 0 0 3 V O L U M E 1 8 N U M B E R 1 Tracingevolutionarypathways

    E-Print Network [OSTI]

    article we discuss entrepreneur Jim Rutt's work with Doyne Farmer's group on risk analysis. Finally, we

  9. C o l l e g e o f C h a r l e s t o nC o l l e g e o f C h a r l e s t o n S u m m e r 2 0 1 4S u m m e r 2 0 1 4

    E-Print Network [OSTI]

    Kasman, Alex

    funded REU projects with undergraduates in Utah for two three-week research expeditions, and has been con. To Apply: Applications can either be downloaded from the CIE website, http://international be submitted to Gabriela Peschiera, Assistant Director, Center for International Education, peschierag

  10. University of Maryland component of the Center for Multiscale Plasma Dynamics: Final Technical Report

    SciTech Connect (OSTI)

    Dorland, William [University of Maryland

    2014-11-18T23:59:59.000Z

    The Center for Multiscale Plasma Dynamics (CMPD) was a five-year Fusion Science Center. The University of Maryland (UMD) and UCLA were the host universities. This final technical report describes the physics results from the UMD CMPD.

  11. Title of Thesis: POLARIZATION-INSENSITIVE TECHNIQUES FOR OPTICAL SIGNAL PROCESSING

    E-Print Network [OSTI]

    Murphy, Thomas E.

    of my research. Also, Arash Komaei and Kuldeep Amarnath, both UMD graduate students, helped me with some

  12. GRADUATE STUDY IN THE COMPUTER AND MATHEMATICAL SCIENCES

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    GRADUATE STUDY IN THE COMPUTER AND MATHEMATICAL SCIENCES: A SURVIVAL MANUAL Dianne Prost O'Leary://www.cs.umd.edu/users/oleary oleary@cs.umd.edu c 1996,1999,2009 1 Introduction Dianne Prost O'Leary http parents, Raymond and Anne Prost, for support and guidance. Dianne O'Leary oleary@cs.umd.edu Homepage

  13. Logo Recognition Using Geometric Invariants David S. Doermann, Ehud Rivlin and Isaac Weiss

    E-Print Network [OSTI]

    Rivlin, Ehud

    Logo Recognition Using Geometric Invariants David S. Doermann, Ehud Rivlin and Isaac Weiss Document@cfar.umd.edu,ehud@cfar.umd.edu,weiss@cfar.umd.edu Abstract The problem of logo recognition is of great the source of the document and its generality as a recognition problem. By recognizing the logo we obtain

  14. O P E N I N G T H E VA U LT S : M U M M I E S From deep within The Field Museum's vaults comes the mysterious world of mummies.

    E-Print Network [OSTI]

    Makovicky, Peter

    individuals into the afterlife · Stone mummy masks and false tomb doors from Egypt · 3D printed casts

  15. e n g e n i o u s w i n t e r 2 0 0 3 a l u m n i p r o f i l e s

    E-Print Network [OSTI]

    Haile, Sossina M.

    of technologies in her first three years at GE, includ- ing cycle analysis of microturbines, experimental testing

  16. M a r i t i m e M u s e u m o f S a n D i e g o Bruce M. Howe, Ph.D.

    E-Print Network [OSTI]

    Frandsen, Jannette B.

    and Chair of the Department of Ocean and Resources Engineering at the University of Hawaii at Manoa. Howe. Duennebier, Ph.D. Rhett Butler, Ph.D. Roger B. Lukas, Ph.D. School of Ocean and Earth Science andTechnology University of Hawaii at Manoa Bruce Howe received the B.S. in Mechanical Engineering and M.S. in Engineering

  17. T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A Software Engineering

    E-Print Network [OSTI]

    Engineering at ECE 4 SE faculty profile (cont-d) · Contributions to industry standards ­ IEEE · Guide (cont-d) · Ongoing research projects ­ HCI · Glove-Talk · Iamascope · MusiKalscope ­ Online for Modeling and Simulation · Advanced Object-Orientation · Software Project Management · Computer Graphics

  18. 12 S U M M E R 2 0 0 5 w w w . i m a g i n g n o t e s . c o m THE BAD NEWS IN ELECTRICAL ENERGY

    E-Print Network [OSTI]

    Perez, Richard R.

    technologies that are based on flat-surface collectors, such as rooftop solar-electric systems and solar water heaters. In contrast, CSP requires "direct-normal" solar radiation -- the component of sunlight-scale generation of electricity from renewable resources. One of the primary renewable energy resources is solar

  19. ACCOUJTS OF CHENICAL RESEARCH"Registered in US.Patent and Trademark Office;Copyright 1983 by the American Chemical Society V O L U M E 1 6

    E-Print Network [OSTI]

    Berry, R. Stephen

    ACCOUJTS OF CHENICAL RESEARCH"Registered in US.Patent and Trademark Office;Copyright 1983 the performance of the Nuclear Regulatory Commission and its predecessors, and how scientific and technical ig

  20. e n g e n i o u s s p r i n g 2 0 0 2 a l u m n i p r o f i l e

    E-Print Network [OSTI]

    , Supersonic Wave Drag of Thin Airfoils, an important exami- nation in radical aerodynamics, he went on to collect numerous awards, including the National Medal of Technology for the construction of the first

  1. S O U T H E A ST D R U M A N D C R OA K E R F I S H E R I E S Southeast Drum

    E-Print Network [OSTI]

    sig- nificant increases in commercial landings did not occur until the 1950's when the pet food industry began harvesting them in the northern Gulf of Mexico. In recent years the recreational harvest of Mexico peaked in 1956 at over 32,000 t, more than 20,000 t above that of 1953. This increase for the most

  2. QUANTITATIVE FINANCE VO L U M E 1 (2001) 397413 RE S E A R C H PA P E R INSTITUTE O F PHYSICS PUBLISHING quant.iop.org

    E-Print Network [OSTI]

    Fernandez, Thomas

    2001-01-01T23:59:59.000Z

    . Introduction Some financial and commodity market traders study market price history with a view to predicting markets to predict future price levels and enhance trading profitability. We have previously shown future price changes in order to enhance trading profitability. This study is known as technical analysis

  3. *Correspondence to: M. Cristofol, U.M.R. 6632, Centre de MatheH matiques et d'Informatique de l'Univer-siteH de Provence, 39, rue F. Joliot-Curie, 13453 Marseille Cedex 13, France

    E-Print Network [OSTI]

    Christofol, Michel

    of x , belonging to ¸(1), satisfying 0( \\ " inf VZ \\AA ess( (x ))) > " sup VZ \\AA ess( (x ))(#R 0( \\ " inf VZ \\AA ess( (x ))) > " sup VZ \\AA ess( (x ))(#R 0( \\ " inf VZ \\AA ess( (x ))) > " sup VZ \\AA ess( (x ))(#R In the domain K we have ( , , )"( (x), (x), (x)) where

  4. F A C U L T Y O F S C I E N C E A L U M N I M A G A Z I N E VOLUME 17, No 2, FALL 2006

    E-Print Network [OSTI]

    Machel, Hans

    (Biological Sciences) Botanical Society of America Merit Award · Nat Rutter (Earth and Atmospher- ic Sciences Tako Koning proves The Science of Teaching Super Communication Investing in the Future S C I E N C E www.science.ualberta.ca do mix Oil and water Salmon Killer Ties that Bind #12;S C I E N C E contours2

  5. V o l u m e 1 6 , F a l l 2 0 0 1m e 1 6 , F a l lF a llm e 1 6 , F a l l Neighbors in Need

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    Ultraviolet-B Radiation Measurements and Research................................................8 Members imagery and products available to the surrounding six Cen- tral American countries (Panama, Nicaragua

  6. A l u m n i C a m p u s N E U E M A T E R I A L I E N Strom aus Abwrme

    E-Print Network [OSTI]

    Vollmer, Heribert

    energieautark zu betreiben, wenn im System erzeugte Wärme nicht nutzlos an die Umgebung abgegeben wird. Die

  7. 1 | D O C U M E N T S U P P L Y S E R V I C E S --U S E R G U I D E Document Supply Services

    E-Print Network [OSTI]

    read the login help on the main DSS webpage. 2. Enter a word, phrase, ISBN/ISSN in the Search Term ...................................................................................................................................................2 Requesting an item--search and request--menu ............................................................................................................................................12 Search

  8. P H Y S I K A L I S C H E S K O L L O Q U I U M E I N LA D U N G

    E-Print Network [OSTI]

    Peinke, Joachim

    -crystalline Si thin film solar cells bare the potential to overcome limits of the Si thin-film solar cell based thin film solar cells towards large scale application. Einladender: Prof. Dr. Carsten Agert #12; chemical vapour deposition) equipment which was developed and scaled-up for flat panel display applications

  9. T e c h n i c a l M e m o r a n d u m F:\\2\\Appendix\\appendix table of contents.doc

    E-Print Network [OSTI]

    Arnold, Jonathan

    /876-7797 Academic Programming Paulien & Associates 899 Logan Street, Suite 508 Denver, CO 80203-3156 303 University of Georgia The appendix includes documents or articles of interest corresponding to elements of Veterinary Medicine a. Request for consideration of a Major Academic Capital Project b. "White Paper

  10. S u m m e r 2 0 0 8 V o l . 1 0 N o . 3 Because the digital media landscape is expanding and evolving rapidly, so, too, must the approach and focus

    E-Print Network [OSTI]

    Schaefer, Marcus

    has introduced its newest college to replace the former School of Computer Science, Telecommunications information technology majors, such as computer science, security, information systems, networking and software engineering; and the School of Cinema and Interactive Media (CIM), which features digital arts

  11. C e n t r u m v o o r W i s k u n d e e n I n f o r m a t i c a Modelling, Analysis and Simulation

    E-Print Network [OSTI]

    Frank, Jason

    The Hamiltonian particle-mesh (HPM) method is generalized to the spherical shallow water equations, utilizing7 2AZ, England ABSTRACT The Hamiltonian particle-mesh (HPM) method is generalized to the spherical the Hamiltonian particle-mesh (HPM) method of Frank, Gottwald & Reich [6, 5] to the shallow water equations

  12. Export Control Basics The Johns Hopkins University Community

    E-Print Network [OSTI]

    Connor, Ed

    Export Control Basics for The Johns Hopkins University Community Export Controls at JHU address Introduction to Export Controls and to contact JHU's Export Control Officer whenever they expect to be involved with any of these issues: Frank Barker, Export Control Officer Wyman Park Center W-400 410-516-0415 fwb

  13. Citation: K. Nakamura et al. (Particle Data Group), JP G 37, 075021 (2010) and 2011 partial update for the 2012 edition (URL: http://pdg.lbl.gov) (1620) I(JP) = 1

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    Resonances 1970 APSELL 69 PRL 23 884 S.P. Apsell et al. (BRAN, UMD, SYRA+) BARTSCH 69 PL 28B 439 J. Bartsch

  14. Citation: J. Beringer et al. (Particle Data Group), PR D86, 010001 (2012) (URL: http://pdg.lbl.gov) (1620) I(JP) = 1

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    .P. Apsell et al. (BRAN, UMD, SYRA+) BARTSCH 69 PL 28B 439 J. Bartsch et al. (AACH, BERL, CERN+) HTTP

  15. Citation: K. Nakamura et al. (Particle Data Group), JPG 37, 075021 (2010) (URL: http://pdg.lbl.gov) (1620) I(JP) = 1

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    .P. Apsell et al. (BRAN, UMD, SYRA+) BARTSCH 69 PL 28B 439 J. Bartsch et al. (AACH, BERL, CERN+) HTTP

  16. *DEEP team: S.Faber,G.Illingworth,D.C.Koo,R.Guhathakurta,K.Denda,K.Gebhardt,A.C.Phillips,L.Simard,C.Willmer,M.Im(UCSC) and partners in UC Berkeley, U.Chicago, JHU, and Caltech evolution for E/S0s at z < 1, contrary to the theoretical models and some obser

    E-Print Network [OSTI]

    . For more information on DEEP, check our web site at http://www.ucolick.org/~deep/home.html 4. Conclusion*DEEP team: S.Faber,G.Illingworth,D.C.Koo,R.Guhathakurta,K.Denda,K.Gebhardt,A for a reduced set of DEEP data in the Groth strip. models based on CDM dominated universe predict that 50

  17. Reduction and Reoxidation of Soils During & After Uranium Bioremediation; Implications for Long-Term Uraninite Stability & Bioremediation Scheme Implementation

    SciTech Connect (OSTI)

    Jaffe, Peter R.

    2005-06-01T23:59:59.000Z

    This research focuses on the conditions and rates under which uranium will be remobilized after it has been precipitated biologically, and what alterations can be implemented to increase its long-term stability in groundwater after the injection of an electron donor has been discontinued. Furthermore, this research addresses short-term iron reoxidation as a mechanism to enhance/extend uranium bioremediation under iron reduction, without its remobilization. The research to date has focused on long term column experiments involving the biological removal of uranium from groundwater under iron and sulfate reducing conditions. Aquifer sediment was collected from the background area of the Old Rifle UMTRA site and dried and sieved (<2 mm) before being packed into four 15 cm long x 5 cm diameter glass columns. The initial porosity of each column ranged from 0.33 to 0.40. Prior to biostimulation of the columns, 30 mM bicarbonate (purged with CO2/N2 gas, 20:80 ratio) was pumped through the columns to flush out the natural uranium present in the sediment. After the natural uranium was flushed out of the system, 20 uM of uranyl acetate was added to the 30 mM bicarbonate influent media. The column was operated for 11 days to ensure that the effluent U(VI) concentration was equal to the influent U(VI) concentration (no removal of U(VI) occurred before biostimulation). The start of the biostimulation experiment was facilitated by the addition of one pore volume of a growth culture containing the Fe(III) and U(VI) reducing microorganism, Geobacter metallireducens. Flow to the columns was suspended for 24 hours, after which pumping was resumed with acetate (2.8-3.0 mM), as well as trace vitamins and minerals, supplied to the feed media. The columns were operated at 22 +/- 1 degrees C, upright and under up-flow conditions at a rate of 0.2 ml/min (equivalent to a linear groundwater travel time of approximately 135 m/yr). Water samples from column inlets and outlets were collected and analyzed for acetate, U(VI), Fe(II), Br-, NO3- and SO42-. Iron reduction and U(VI) removal was detected in all four columns after three days of column operation with acetate in the inflow. The Fe(II) concentration at the effluent of the columns increased at a rate of 16.6 (+/-1.9) uM/d until leveling off after 10 days of column operation. The pseudo steady-state Fe(II) concentration at the effluent for each column ranged 130 uM to 170 uM. Uranium removal reached steady-state conditions after approximately 23 days of column operation with removal of between 58% to 77% of the initial 20 uM U(VI) added at the influent of the column.

  18. Green Dining Internship Opportunities: Fall 2013 Are you passionate about composting? Waste reduction? Local and sustainable food?

    E-Print Network [OSTI]

    Hill, Wendell T.

    Green Dining Internship Opportunities: Fall 2013 Are you passionate about composting? Waste UMD students? Then, we are looking for you! UMD Dining Services Green Dining is seeking two interns to assist with the Green Dining Program. Learn more about Green Dining here: http

  19. Where Eagles FlyTM CHARLES COUNTY

    E-Print Network [OSTI]

    Maryland at College Park, University of

    with the development of new energetic systems, CECD's expansion calls for the creation of other areas of excellenceWhere Eagles FlyTM CHARLES COUNTY MARYLAND CENTER FOR ENERGETIC CONCEPTS DEVELOPMENT Dr. D. K Phone 301.405.5294 Fax 301.314.9477 dkanand@umd.edu Website: www.cecd.umd.edu ENERGETICS TECHNOLOGY

  20. Interfaces and Tools for the Library of Congress National Digital Library Program Gary Marchionini, Catherine Plaisant, and Anita Komlodi

    E-Print Network [OSTI]

    Golbeck, Jennifer

    Interfaces and Tools for the Library of Congress National Digital Library Program Gary Marchionini and Digital Library Research Group {march, komlodi}@glue.umd.edu, plaisant@cs.umd.edu Abstract This paper describes a collaborative effort to explore user needs in a digital library, develop interface prototypes

  1. Dollars and Sense: Will Your Idea Make Money?

    E-Print Network [OSTI]

    Rubloff, Gary W.

    · Requirement for BPC Competition #12;www.va.umd.edu Components: Assumptions · Sales Projections ­ Pricing #12;www.va.umd.edu Income Statement · Top Line (Revenues) ­ Price ­ Units Sold ­ Product Lines ­ Goods ­ Costs = Profits Year 1 Year 2 Year 3 Year 4 Year 5 Price 100$ 105$ 110$ 116$ 122$ Units Sold 2000 10000

  2. Information-Theoretic Analysis of an Energy Harvesting Communication System

    E-Print Network [OSTI]

    Ulukus, Sennur

    Information-Theoretic Analysis of an Energy Harvesting Communication System Omur Ozel Sennur Ulukus@umd.edu ulukus@umd.edu Abstract--In energy harvesting communication systems, an exogenous recharge process supplies energy for the data trans- mission and arriving energy can be buffered in a battery before

  3. CMSC/AMSC 498D Spring 2012 Deblurring Digital Images

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    ://www.cs.umd.edu/users/oleary/c498/ Prof. Dianne P. O'Leary: Room 3271 A.V. Williams Building oleary@cs.umd.edu Office Hours: Tuesday. O'Leary, Deblurring Images: Matrices, Spectra, and Filtering, SIAM Press, Philadelphia, 2006

  4. Spring 2006 CS 649 1 Sensor Networks

    E-Print Network [OSTI]

    Amir, Yair

    Terzis http://hinrg.cs.jhu.edu/wsn06/ #12;Outline Spring 2006 CS 649 2 · (Simple) Radio Power loss models · Reality · (More) Radio Power loss models #12;Motivation Spring 2006 CS 649 3 · Communication between nodes

  5. The Econometrics of Data Combination Geert Ridder

    E-Print Network [OSTI]

    Weaver, Harold A. "Hal"

    The Econometrics of Data Combination Geert Ridder Department of Economics, University of Southern University,Baltimore E-mail: moffitt@jhu.edu Chapter for the Handbook of Econometrics April 1, 2005 We thank

  6. National Aeronautics and Space Administration thVIIaeMpacS

    E-Print Network [OSTI]

    581g Artwork (Lynette Cook/NASA); 38) Dreath Star (NASA/G. Bacon); 43) Transiting planets (NASA/Tim Pyle); 45) Habitable Zones (NASA/Kepler); 61) Solar Probe (JHU/APL); 73) Bacterium (NASA/Jodi Blum); 81

  7. Montana State University, Bozeman, Montana 59717-2580 C U M U L AT I V E G R A D E P O I N T AV E R A G E C A L C U L AT I O N

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    : _______________________________________________________________________________________ G PA C A L C U L AT I O N To calculate your cumulative GPA, divide the total number of quality points by the total number of quality hours. (Quality Points Ă· Quality Hours = GPA). This calculation number of quarter credits and total number of quarter quality points by 1.5 each. If changing semester

  8. HKR CONNECTIONS C H O O L O F H U M A N K I N E T I C S A N D R E C R E A T I O N N E W S L E T T E RFA L L I S S U E 2 0 1 2 To qualify as a firefighter,

    E-Print Network [OSTI]

    Oyet, Alwell

    floor versus a concrete floor." The protocol AHS decided to follow is the Canadian Forces Fire Marshal to a national award for PE alumnae Debbie Shortall (BPE, B.Ed.) knew at an early age she wanted to be a physical

  9. V O L U M E 59, NU M B E R 1 P H Y S I C A L R E V I E W L E T T E R S Observation of Spin Diffusion in Zero-Field Magnetic Resonance

    E-Print Network [OSTI]

    Suter, Dieter

    zero-field magnetic resonance, namely the potential for structure determination in solids without for a time ft, after which one component is converted back into population by a second pulse. The remainin gcoherence s decay over a time of the order of the spin-spin relaxation time Tz. During the mixing time rm

  10. a l u m n e m a g a s i n u d g i v e t a f a a r h u s u n i v e r s i t e t n r . 3 d e c e m b e r 2 0 1 0

    E-Print Network [OSTI]

    levede og døde. side 5 Leder 4 Kort nyt 5 t E m a o m k r i g Aldrig mere Irak 10 Få danske soldater har

  11. T H E M A G A Z I N E O F T H E U N I V E R S I T Y O F M I N N E S O T A A L U M N I A S S O C I A T I O N JANUARY FEBRUARY 2005 $2.95

    E-Print Network [OSTI]

    Amin, S. Massoud

    Human Nature Meets Mother Nature Power People Professor Massoud Amin knows the human side of electricity they cracked under the searing sun. Then electricity reached these small villages. With new wells, pumps children received a better education. A tractor parts factory and other businesses came to the area

  12. U N I V E R S I T Y O F V E R M O N T C O L L E G E O F M E D I C I N E V E R M O N T S U M M E R 2 0 1 4

    E-Print Network [OSTI]

    Hayden, Nancy J.

    incorrectly in the 2013 Year-in-Review issue of Vermont Medicine. In March 2013, Dr. Abajian was givenXtras in this issue: · 2014 UVM Research Report · The Given Building 50 years ago · Full Match Day coverage Integrated Curriculum to "Dr. Moo," our rst-year medical students this fall will nd UVM to be the perfect

  13. 2 0 1 3 | P E N N S T A T E N U R S I N G P A G E 2 0 1 3 A M A G A Z I N E F O R A L U M N I & F R I E N D S

    E-Print Network [OSTI]

    for cutting-edge practice in a reformed health care delivery system. Through innovative research translated the highly complex care environment our providers are entering and the importance of the health care team to meet the changing demands of the health care delivery system and the many patients who rely on expert

  14. S M I T H S O N I A N C O N T R I B U T I O N S T O Z O O L O G Y N U M B E R 333 The Leafmining Moths

    E-Print Network [OSTI]

    Mathis, Wayne N.

    's annual report, Smithsonian Year. SERIES COVER DESIGN: The coral Montastrea cavemosa (Linnaeus). Library ; no. 333) Bibliography: p. 1. Cameraria--Classification. 2. Cameraria--Host plants. 3. Fagaceae--Diseases and pests. 4. Insects--Classification. 5. Insects--California--Classification. I. Davis, Donald Ray, joint

  15. a l u m n e m a g a s i n u d g i v e t a f a a r h u s u n i v e r s i t e t n r . 1 a p r i l 2 0 1 1

    E-Print Network [OSTI]

    adresse, fřdselsdato og ĺr. Private skal ikke melde adressećndringer i Danmark. Samboende alumner modtager luften pluralism Hvor tolerante er vi egentlig i Danmark og i de řvrige EU-lande? Det tager et nyt

  16. D E P A R T M E N T O F E N T O M O L O G Y P H O N E A N D F A X N U M B E R S Updated 7.1.2012 Please contact Teresa Gold at 845-2510 or t-gold@tamu.edu with any changes. Thank you.

    E-Print Network [OSTI]

    (Brownfield) (806)637-8792 637-2588 Siders, Kerry (Levelland) (806)894-2406 897-3104 Swart, James (Commerce

  17. D E P A R T M E N T O F E N T O M O L O G Y P H O N E A N D F A X N U M B E R S Updated 7.1.2010 Please contact ANGIE ROLLINS at 845-2516 or akrollings@ag.tamu.edu with any changes. Thank you.

    E-Print Network [OSTI]

    Behmer, Spencer T.

    City) (432)354-2477 354-2544 Vacant (Dimmitt) (806)647-4116 647-3218 Russell, Scott (Brownfield) (806

  18. D E P A R T M E N T O F E N T O M O L O G Y P H O N E A N D F A X N U M B E R S Updated 7.1.2010 Please contact ANGIE ROLLINS at 845-2516 or akrollings@ag.tamu.edu with any changes. Thank you.

    E-Print Network [OSTI]

    Behmer, Spencer T.

    City) (432)354-2477 354-2544 Niño, Emilio (Dimmitt) (806)647-4116 647-3218 Russell, Scott (Brownfield

  19. The Immense Impact of Bill Gates Sr. T H E U N I V E R S I T Y O F W A S H I N G T O N A L U M N I M A G A Z I N E J U N E 13

    E-Print Network [OSTI]

    Hochberg, Michael

    the scenic UW Seattle campus. UWalum.com/dawgdash From Home Runs to 10K Runs-- Outdoor Fun with the UWAA You long! lids.com #1 Dad! On the golf course, in the stands or about town, your dad looks smart Game? Get the hottest outdoor games on the market! This exciting bean bag game, known as "bags

  20. F A C U L T Y O F H U M A N I T I E S U N I V E R S I T Y O F C O P E N H A G E N

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    what you had been would have appeared to them to be otherwise." Lewis Carroll: Alice in Wonderland tel indispensable. And to Sophie Swerts Knudsen and Sanne Larsen ­ thank you for listening, for the motivational

  1. Host cell factors involved in retrovirus replication and disease pathogenesis

    E-Print Network [OSTI]

    Seidel, Shannon Beth

    2012-01-01T23:59:59.000Z

    suspension through a 70uM cell strainer and incubated in ACKa 70uM nylon mesh cell strainer and washed through usingrun through a 70uM cell strainer into cell culture media (

  2. INSTITUTE OF PHYSICS PUBLISHING JOURNAL OF MICROMECHANICS AND MICROENGINEERING J. Micromech. Microeng. 16 (2006) 832842 doi:10.1088/0960-1317/16/4/021

    E-Print Network [OSTI]

    Rubloff, Gary W.

    2006-01-01T23:59:59.000Z

    , USA E-mail: marcelwp@ccs.nrl.navy.mil and ghodssi@eng.umd.edu Received 31 October 2005, in final form, the advantages of MEMS (low- power, potential for wavelength and polarization insensitivity, material

  3. Global and Regional Solutions Directorate

    E-Print Network [OSTI]

    Homes, Christopher C.

    at Pacific NW National Lab (PNNL) ­ Founding Director Joint Global Change Research Institute (PNNL/UMd) ­ ALD (PNNL) ­ Environmental and Health Sciences Directorate; Emerging Technologies ­ Chief Scientist ­ Atmospheric Radiation Measurement Program ­ Director ­ PNNL Global Studies Program ­ Other (PNNL): Center

  4. Spring 2012 Who's Who and What's What

    E-Print Network [OSTI]

    Li, Teng

    of the guide is frequently updated as new information is provided. We welcome updates to listed information and and Development (rmalone@umd.edu, x52509) with updates. #12;TABLE OF CONTENTS Academic Administrators Contact..............................................................................................4 Education

  5. Who's Who and What's What Where do I get information about...?

    E-Print Network [OSTI]

    Milchberg, Howard

    of the guide is frequently updated as new information is provided. We welcome updates to listed information and and Development (rmalone@umd.edu, x52509) with updates. #12;TABLE OF CONTENTS Academic Administrators Contact ...............................................................................4 Education

  6. Physics 122 Fundamentals of Physics II Syllabus for Fall 2012

    E-Print Network [OSTI]

    Lathrop, Daniel P.

    Physics 122 ­ Fundamentals of Physics II Syllabus for Fall 2012 Course description The second)-405-4993 Office hours : TBD Website http://elms.umd.edu The syllabus and schedule can be also found at: http

  7. confirm your academic major choice and know the requirements and career fields related to your major using Graduation Planner, create the a course plan for your remaining degree requirements

    E-Print Network [OSTI]

    Netoff, Theoden

    & Learning Goals Achieved credits more information at www.d.umn.edu/roadmap The University of Minnesota is an equal opportunity educator and employer. UMD Student Success Roadmap & Learning Goals 60 credits 90

  8. An Overview of Visualization techniques for the Analysis of Large datasets

    E-Print Network [OSTI]

    Gorban, Alexander N.

    ://www.cs.umd.edu/hcil/ #12;Visible Human - animation #12;Information Visualization · Compact graphical presentation ­ Large: ­ animation ­ software visualisation ­ visualisation environments ­ volume rendering and visualization ­ computer graphics ­ visual programming ­ image processing ­ virtual reality ­ Scientific Visualisation

  9. High-end-Computer System Performance: Science and Engineering - Final Report

    SciTech Connect (OSTI)

    Hollingsworth, Jeffrey K.

    2012-01-27T23:59:59.000Z

    This report summarizes the research conducted as part of the UMD effort of the multi-site PERC project. This project developed and enhanced the Dyninst instrumentation system and the Active Harmony auto-tuning framework.

  10. Appears in Proceedings of the 10th Annual International Conference on Parallel Architectures and Compilation Techniques, Barcelona, Spain, September 2001.

    E-Print Network [OSTI]

    Yeung, Donald

    of Inter-Chain Memory Parallelism for Pointer-Chasing Codes Nicholas Kohout Seungryul Choi Dongkeun Kim, College Park Univ. of Maryland, College Park nicholas.j.kohout@intel.com choi@cs.umd.edu fdongkeun

  11. Scheduling for Quality of Service based Service Di erentiation Saswati Sarkar 1 and Leandros Tassiulas 2

    E-Print Network [OSTI]

    Sarkar, Saswati

    Scheduling for Quality of Service based Service Di#11;erentiation Saswati Sarkar 1 and Leandros, College Park, leandros@isr.umd.edu #3; Address all correspondence to Saswati Sarkar We consider a utility

  12. Performance Characteristics of MAUI: An Intelligent Memory System Architecture

    E-Print Network [OSTI]

    Jacob, Bruce

    Park, Maryland silio@Glue.umd.edu Bruce Jacob University of Maryland Department of Electrical or commercial advantage and that copies bear this notice and the full citation on the first page. To copy

  13. Let There Be Light! The Future of Memory Systems is Photonics and 3D Stacking

    E-Print Network [OSTI]

    Bergman, Keren

    National Lab {phhargrove,jshalf}@lbl.gov Bruce Jacob University of Maryland bji@umd.edu K. Scott Hemmert are not made or distributed for profit or commercial advantage and that copies bear this notice and the full

  14. Skill, teamwork save severely burned dog F o r A n d A b o u t A l u m n i A n d F r i e n d s O f T h e U G A C o l l e g e O f Ve t e r i n a r y M e d i c i n e F a l l 2 0 0 1

    E-Print Network [OSTI]

    Hall, Daniel

    diagnose and prevent diseases, de-termine cause of death, and advance re-search. The specially designed air that was doused with gasoline and set on fire by a 17-year old Atlanta boy. Honey was first taken to the Atlanta

  15. Preprint of the paper submitted to the 4 t h I FA C -S y m p o s i u m o n M e c h a t r o n i c S y s t e m s H e i d e l b e r g , G e r m a n y , S e p t e m b e r 1 2 t h -1 4 t h , 2 0 0 6

    E-Print Network [OSTI]

    Stryk, Oskar von

    . An experimental setup has been designed to develop the model for the control approach. After a presentation MACROSCOPIC SMA WIRE BUNDLE ACTUATOR/SENSOR SYSTEM: DESIGN, MEASUREMENT, CONTROL APPROACH Robert Kratz a high power- to-weight ratio. In addition, the new model allows using the actuator as a linear position

  16. A . J A M E S C L A R K S C H O O L O F E N G I N E E R I N G CIVILReMARKSC I V I L A N D E N V I R O N M E N T A L E N G I N E E R I N G [ c i v i l . u m d . e d u

    E-Print Network [OSTI]

    Aydilek, Ahmet

    harvesting devices to power sensor network, high-speed wireless sensing ability and advanced data analysis, including remote sensing capability, piezo paint acoustic emission sensors, wind and solar based energy bridges plagued with fatigue cracking problems, the current system will be focused on fatigue condition

  17. A l u m n i N e w s l e t t e r I n d i a n a U n i v e r s i t y D e p a r t m e n t o f S l a v i c L a n g u a g e s a n d L i t e r a t u r e s

    E-Print Network [OSTI]

    Indiana University

    for reorganization and for authorizing the hiring of energetic and versatile new faculty. Along these lines we have of TSAA, signed a six-year partnership agreement. The major features of the grant include new courses using distance-education tech- nology and a new six-week course, "Global Environmental Problems

  18. f a l l 2 0 1 4 | i T H E M A G A Z I N E O F T H E U N I V E R S I T Y O F T E X A S S C H O O L O F L A W f a l l 2 0 1 4 | v o l u m e 1 3

    E-Print Network [OSTI]

    John, Lizy Kurian

    f a l l 2 0 1 4 | i T H E M A G A Z I N E O F T H E U N I V E R S I T Y O F T E X A S S C H O O L O John H. Massey, '66 Alumni Association President Bruce Broillet, '74 ut law magazine Editor Maria FROM THE DEAN L AST YEAR THE LAW school undertook a strategic-planning exercise. We formed a committee

  19. inside Stanford medicineV o l u m e 5 , N o . 17 S e p t e m b e r 2 3 , 2 0 1 3 P u b l i s h e d b y t h e O f f i c e o f C o m m u n i c a t i o n & P u b l i c A f f a i r s

    E-Print Network [OSTI]

    Bogyo, Matthew

    as TOS, is not straightforward. "There's no one blood test or radiographic test or physical exam finding the kind of long-term overuse that creates thoracic outlet syndrome. Sishc's TOS, Lee determined to his col- lege diving career. The tricky part about TOS, Lee said, is not just mak- ing the diagnosis

  20. I-129 Export Control Certification: What Is "Part 6", and Why-When-How Do We Answer It?

    E-Print Network [OSTI]

    Connor, Ed

    I-129 Export Control Certification: What Is "Part 6", and Why-When-How Do We Answer It? (Links with "export controls" at JHU, which involve an area of Federal regulation with which you may not be familiar. Part 6 can be accurately completed only with thoughtful input from the hiring department and the Export

  1. 6-hour data downloads Ultra-Efficient data collection protocol (Koala)

    E-Print Network [OSTI]

    Amir, Yair

    Density (ind/ m2) Soil Temperature Volumetric Soil Water Content Motivation BT 2 BT 1 RB 1 RB 2 BT1 ­ present ·Stations: 19 ·Location: JHU, Baltimore MD ·Sensors ·Soil {Temperature, Moisture} ·Ambient ·Stations: 31 ·Location: Carney, MD (co-located) near a CO2 flux tower ·Sensors ·Soil CO2 ·Soil {Temperature

  2. Supply Shocks and the Persistence of Ination Martin Sommer

    E-Print Network [OSTI]

    Niebur, Ernst

    Supply Shocks and the Persistence of Ination Martin Sommer¤ October 17, 2002 Abstract This paper JEL Classi...cation: E31, E52, E58, E65 ¤ Martin Sommer, Department of Economics, Johns Hopkins University, Baltimore, MD 21218. E-mail: Sommer@jhu.edu. I am grateful to Laurence Ball, Christopher Carroll

  3. A Visibility Matching Tone Reproduction Operator for High Dynamic Range Scenes

    E-Print Network [OSTI]

    IBM T.J. Watson Research Center Christine Piatko National Institute for Standards and Technology Author's current address: Silicon Graphics, Inc., Mountain View, CA. Author's current address: JHU Center Christine Piatko National Institute for Standards and Technology ABSTRACT We present a tone

  4. Certified Bitcoins Giuseppe Ateniese1,2

    E-Print Network [OSTI]

    Certified Bitcoins Giuseppe Ateniese1,2 , Antonio Faonio1 , Bernardo Magri1 , and Breno de Medeiros University, USA ateniese@cs.jhu.edu 3 Google, Inc. breno@google.com Abstract. Bitcoin is a peer-to-peer (p2p (called the Blockchain). A critical component of Bitcoin's success is the decentralized nature of its

  5. Zerocoin: Anonymous Distributed E-Cash from Bitcoin Ian Miers, Christina Garman, Matthew Green, Aviel D. Rubin

    E-Print Network [OSTI]

    Amir, Yair

    Zerocoin: Anonymous Distributed E-Cash from Bitcoin Ian Miers, Christina Garman, Matthew Green, cgarman, mgreen, rubin}@cs.jhu.edu Abstract--Bitcoin is the first e-cash system to see widespread adoption. While Bitcoin offers the potential for new types of financial interaction, it has significant

  6. The Johns Hopkins University Center for Astrophysical Sciences

    E-Print Network [OSTI]

    spectrograph for the Apache Point Observatory APO 3.5-m telescope. Theoretical and observational astronomy, the APO 3.5-m telescope, and observatories around the world. 2. PERSONNEL CAS has made a major visitors are S. Beaulieu, L. Dressel, A. Kinney, and T. Hartquist. M. Allen has left JHU. J. Daniels has

  7. http://ijr.sagepub.com/ Robotics Research

    E-Print Network [OSTI]

    Simaan, Nabil

    , Gregory S. Chirikjian and Allison M. Okamura Nonholonomic Modeling of Needle Steering Published by: http://www.me.jhu.edu/ Nonholonomic Modeling of Needle Steering Abstract As a flexible needle with a bevel tip is pushed through soft kinematics, control, and path planning, an ap- propriately designed needle can be steered through tissue

  8. Martin Peng*, Charles Neumeyer NSTX National Team

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    30 Injector Voltage Toroidal Current Injector current SN 106488 kAkVmWbkAkA n = 1 oscillations n=1 oscillations related to reconnection mechanisms (U Wash, PPPL) (JHU) #12;Plasmas with Beam Heating Can Surpass · Moderate plasma current · High p ~ 1 · H-mode with Edge-Localized Modes · Induction voltage reduced to

  9. Nucleophilic Metal Complexes as Acylation Catalysts: Solvent-Dependent

    E-Print Network [OSTI]

    Lectka, Thomas

    @jhunix.hcf.jhu.edu Received October 14, 1999 ABSTRACT Catalytic acylation using complex transition metal salts MCo(CO)4, D.; Drury, III.; W. J.; Cox, C.; Lectka, T. J. Org. Chem. 1998, 63, 4568. (3) Complexes MCo(CO)4 (1

  10. S:\\Registration & Records\\ZZZZWeb Page Postings\\UG Specials Registration Information rev 04.2012.docx Johns Hopkins University

    E-Print Network [OSTI]

    von der Heydt, Rüdiger

    .jhu.edu 2. Click First time JHED user? [under New Visitor] 3. Enter your Login ID (LID) in the First Time Login box. This is the JHED Login ID you just received via email. Do not try to search for yourself. Enter your date of birth and the last 5 digits of your Government ID (SSN). International Students

  11. History Effects and Verification Christian Skalka and Scott Smith

    E-Print Network [OSTI]

    Smith, Scott F.

    over an SSL socket, the relevant events are opening and closing of sockets, and reading and writing of data packets. An example event his- tory produced by a program run could be: ssl_open("snork.cs.jhu.edu",4434); ssl_hs_begin(4434); ssl_hs_success(4434); ssl_put(4434); ssl_get(4434); ssl

  12. JOHNS HOPKINS MAGAZINE The professor is already inspiring undergraduates in his acting and directing classes.

    E-Print Network [OSTI]

    von der Heydt, Rüdiger

    or wish to visit from another university, JHU invites you to explore our wide range of undergraduate Happier Endings 12 Artifact The Cosmic Web 14 Forefront The Case of the Bivalve Epicure 26 Evidence Pulitzer 67 Golomb's Gambits Word Changes DEPARTMENTSFRONT 68 Giving Making Waves to Fight Cancer 70

  13. Advances on Matroid Secretary Problems: Free Order Model and Laminar Case

    E-Print Network [OSTI]

    Jaillet, Patrick

    ´e A. Soto2 , and Rico Zenklusen3 1 Dept. of Electrical Engineering and Computer Science, MIT jaillet. of Applied Mathematics and Statistics, Johns Hopkins University ricoz@jhu.edu Abstract. The best involved method and analysis [12] that leads to a 16000/3-approximation. This is arguably the most involved

  14. S:\\Registration & Records\\Term Communications\\2012 Fall\\Fall 2012 Freshmen Registration Document.docx 1 of 1 JOHNS HOPKINS UNIVERSITY

    E-Print Network [OSTI]

    Connor, Ed

    information about registering for classes in ISIS Self-Service for Students. If you should have any (PRIOR TO JULY 2ND ISIS for Students: you will be automatically logged out after 5 minutes of inactivity is accurately set-up for ISIS for Students. a. Go to isis.jhu.edu b. Click on "browser requirements" near

  15. Recent Advances in Synchronous-Clock One-Way-Travel-Time Acoustic Navigation

    E-Print Network [OSTI]

    Whitcomb, Louis L.

    Engineering University of Michigan, Ann Arbor, MI 48109 Email: eustice@umich.edu tDepartment of Mechanical Engineering Johns Hopkins University, Baltimore, MD 21218 Email: llw@jhu.edu +Department of Applied Ocean], [2], on the hull of a surface ship [3], or on sea-ice [4]. With a maximum acoustic range of 5-10 km

  16. Recent Advances in Synchronous-Clock One-Way-Travel-Time Acoustic Navigation

    E-Print Network [OSTI]

    Eustice, Ryan

    University of Michigan, Ann Arbor, MI 48109 Email: eustice@umich.edu Department of Mechanical Engineering Johns Hopkins University, Baltimore, MD 21218 Email: llw@jhu.edu Department of Applied Ocean Physics [1], [2], on the hull of a surface ship [3], or on sea-ice [4]. With a maximum acoustic range of 5

  17. Toward Extraplanetary Under-Ice Exploration

    E-Print Network [OSTI]

    Eustice, Ryan

    .jhu@gmail.com Ryan Eustice Department of Naval Architecture and Marine Engineering University of Michigan Ann Arbor· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Toward Extraplanetary Under-Ice@whoi.edu, rsohn@whoi.edu, ssingh@whoi.edu Taichi Sato Ocean Research Institute University of Tokyo Nakano, Tokyo

  18. Optimal resolution in Fresnel incoherent correlation holographic fluorescence microscopy

    E-Print Network [OSTI]

    Rosen, Joseph

    Optimal resolution in Fresnel incoherent correlation holographic fluorescence microscopy Gary, Israel 4 rosen@ee.bgu.ac.il *gbrooker@jhu.edu Abstract: Fresnel Incoherent Correlation Holography (FINCH. Rosen and G. Brooker, "Digital spatially incoherent Fresnel holography," Opt. Lett. 32(8), 912­914 (2007

  19. Assignment 6: Heat Transfer Page 1 of 8 600.112: Introduction to Programming

    E-Print Network [OSTI]

    Fröhlich, Peter

    Assignment 6: Heat Transfer Page 1 of 8 600.112: Introduction to Programming for Scientists and Engineers Assignment 6: Heat Transfer Peter H. Fr¨ohlich phf@cs.jhu.edu Joanne Selinski joanne to Programming for Scientists and Engineers is all about heat transfer and how to simulate it. There are three

  20. Bosnian Croatian Serbian Language Program

    E-Print Network [OSTI]

    Eustice, Ryan

    Bosnian · Croatian · Serbian Language Program U M Department of Slavic Languages and Literatures In the past 10 years the program of Bosnian/Croatian/Serbian at U-M has constantly been expanding

  1. IN THIS ISSUE 2 3D Printing

    E-Print Network [OSTI]

    Hill, Wendell T.

    IN THIS ISSUE 2 3D Printing in McKeldin 3 Saving WMUC Radio 4 You Did What?!? 7 Dance at UMD, in this issue. Our Terrapin Learning Commons is embracing all things digital, and the acquisition of a 3D printer allows any student the op- portunity to make their visions a reality. This little addition

  2. Pathbased Inductive Synthesis for Program Inversion Saurabh Srivastava

    E-Print Network [OSTI]

    Srivastava, Saurabh

    Park jfoster@cs.umd.edu Abstract In this paper, we investigate the problem of semi­automated in 14 programs such as compressors (e.g., Lempel­Ziv­Welch), encoders (e.g., UUEn­ code), and arithmetic for programs such as compressors or encoders. Counterexample­guided inductive syn­ thesis [33] requires

  3. Path-based Inductive Synthesis for Program Inversion Saurabh Srivastava

    E-Print Network [OSTI]

    Chauduri, Swarat

    Park jfoster@cs.umd.edu Abstract In this paper, we investigate the problem of semi-automated in 14 programs such as compressors (e.g., Lempel-Ziv-Welch), encoders (e.g., UUEn- code), and arithmetic for programs such as compressors or encoders. Counterexample-guided inductive syn- thesis [33] requires

  4. Exploring Pet Video Chat: The Remote Awareness and Interaction Needs of Families with Dogs and Cats

    E-Print Network [OSTI]

    Golbeck, Jennifer

    1 Exploring Pet Video Chat: The Remote Awareness and Interaction Needs of Families with Dogs College Park, MD, USA golbeck@cs.umd.edu ABSTRACT Many people have pets such as dogs and cats that they would consider to be family. Along with this comes a need to stay aware of one's pet and, possibly

  5. Kenneth R. Fleischmann, Clay Templeton, and Jordan Boyd-Graber. Modeling Diverse Standpoints in Text Classification: Learning to Be Human by Modeling Human Values. iConference, 2011.

    E-Print Network [OSTI]

    Boyd-Graber, Jordan

    Kenneth R. Fleischmann, Clay Templeton, and Jordan Boyd-Graber. Modeling Diverse Standpoints{Fleischmann:Templeton:Boyd-Graber-2011, Author = {Kenneth R. Fleischmann and Clay Templeton and Jordan Boyd-Graber}, Booktitle = {i Hornbake Building, South Wing College Park, MD 20742-4345 kfleisch@umd.edu Thomas Clay Templeton University

  6. Who Wants to Know? Question-asking and Answering Practices among Facebook Users

    E-Print Network [OSTI]

    Michigan, University of

    Who Wants to Know? Question-asking and Answering Practices among Facebook Users Rebecca Gray1@umd.edu ABSTRACT Research has identified a link between Facebook use and bridging social capital, which speaks through which Facebook may help individuals mobilize these embedded informational and support resources

  7. A Cheat-Proof Game Theoretic Demand Response Scheme for Smart Grids

    E-Print Network [OSTI]

    Liu, K. J. Ray

    A Cheat-Proof Game Theoretic Demand Response Scheme for Smart Grids Yan Chen, W. Sabrina Lin, Feng}@umd.edu Abstract--While demand response has achieved promising results on making the power grid more efficient and reliable, the additional dynamics and flexibility brought by demand response also increase the uncertainty

  8. Relay Placement for Minimizing Congestion in Wireless Backbone Networks*

    E-Print Network [OSTI]

    Shayman, Mark A.

    Relay Placement for Minimizing Congestion in Wireless Backbone Networks* Abhishek Kashyap, Fangting Park MD 20742 Email: {kashyap, ftsun, shayman}@glue.umd.edu Abstract-- Wireless optical networks are being increasingly used in the backbone of hierarchical ad hoc networks. We consider the problem

  9. PREPRINT: Nonoutsourceable Scratch-Off Puzzles to Discourage Bitcoin Mining Coalitions

    E-Print Network [OSTI]

    Katz, Jonathan

    PREPRINT: Nonoutsourceable Scratch-Off Puzzles to Discourage Bitcoin Mining Coalitions Andrew://cs.umd.edu/~amiller/nonoutsourceable.pdf. ABSTRACT An implicit goal of Bitcoin's reward structure is to diffuse network influence over a diverse, decentralized population of individual participants. Indeed, Bitcoin's security claims rely on no single entity

  10. Ensemble transform Kalman-Bucy filters Javier Amezcua 1

    E-Print Network [OSTI]

    Reich, Sebastian

    1 Ensemble transform Kalman-Bucy filters Javier Amezcua 1 jamezcua@atmos.umd.edu Kayo Ide 1 2 3 4 Meteorological Society. #12;2 Abstract Two recent works have adapted the Kalman-Bucy filter into an ensemble of these alternatives are discussed. Finally, the performance of our ensemble transform Kalman-Bucy implementations

  11. Exploratory Search Interfaces to Support Image Discovery

    E-Print Network [OSTI]

    Shneiderman, Ben

    Director (1983-2000), Human-Computer Interaction Lab Professor, Department of Computer Science MemberExploratory Search Interfaces to Support Image Discovery Ben Shneiderman ben@cs.umd.edu Founding;Interdisciplinary research community - Computer Science & Psychology - Information Studies & Education (www

  12. Experimental Study of Curvature-based Control Laws for Obstacle Avoidance

    E-Print Network [OSTI]

    Zhang, Fumin

    , krishna}@isr.umd.edu Abstract-- A novel curvature-based steering control law is introduced to produce- thermore, with appropriate dynamic model, the algorithm produces an explicit control law for the robot, a recent development in this category is to keep the robot moving at a constant speed with steering control

  13. SPRING 2007 METRICSMECHANICAL ENGINEERING

    E-Print Network [OSTI]

    Li, Teng

    OF ENGINEERING, UNIVERSITY OF MARYLAND. Department Works Globally to Share Knowledge & Expertise IN THIS ISSUE: 2SPRING 2007 METRICSMECHANICAL ENGINEERING A. JAMES CLARK SCHOOL of ENGINEERING www.enme.umd.edu A NEWSLETTER FOR ALUMNI AND FRIENDS OF THE DEPARTMENT OF MECHANICAL ENGINEERING AT THE A. JAMES CLARK SCHOOL

  14. Mind Perception and Objectification 1 Running Head: Mind Perception and Objectification

    E-Print Network [OSTI]

    Knobe, Joshua

    Mind Perception and Objectification 1 Running Head: Mind Perception and Objectification More than a Body: Mind Perception and the Nature of Objectification Kurt Gray1, Joshua Knobe2, Mark Sheskin2, Paul@umd.edu #12;Mind Perception and Objectification 2 Abstract According to models of objectification, viewing

  15. Office of Disability Support Service 0106 Shoemaker

    E-Print Network [OSTI]

    Li, Teng

    in academic achievement. The following is a brief description of types of academic learning disabilities concepts can also be impacted. Disorder of Written Expression a type of learning disability in which.counseling.umd.edu/DSS A Guide to Services for Students with a Learning Disability (Revised 4.28.14) #12;2 Do I Have A Learning

  16. GEO-LOCATION ESTIMATION FROM ELECTRICAL NETWORK FREQUENCY SIGNALS Ravi Garg, Adi Hajj-Ahmad, and Min Wu

    E-Print Network [OSTI]

    Wu, Min

    GEO-LOCATION ESTIMATION FROM ELECTRICAL NETWORK FREQUENCY SIGNALS Ravi Garg, Adi Hajj-Ahmad, and Min Wu {ravig, adiha, minwu}@umd.edu University of Maryland, College Park, MD, USA. ABSTRACT Electric data collected across different locations in the eastern grid of the United States to understand

  17. DRUPAL INSTRUCTIONS To EDIT a Page

    E-Print Network [OSTI]

    Shapiro, Benjamin

    DRUPAL INSTRUCTIONS To EDIT a Page: 1. Go to your http web address/login and log in using your UMD in older sites. - Tables MUST be created inside of Drupal and should not be more than 625px wide. Please do not forget. This also applies to documents like pdf and Word. To Insert an Image: 1. Click your

  18. Geophysical and Astrophysical Fluid Dynamics, Vol. 101, Nos. 56, OctoberDecember 2007, 469487

    E-Print Network [OSTI]

    Lathrop, Daniel P.

    Geophysical and Astrophysical Fluid Dynamics, Vol. 101, Nos. 5­6, October­December 2007, 469, USA zInstitute of Geophysics, University of Go¨ ttingen, Friedrich-Hund-Platz 1, D-37077 Go¨ ttingen (though later work by Banka and *Corresponding author. Email: dpl@complex.umd.edu Geophysical

  19. Demonstrations CHI 2000 , 1-6 APRIL 2000 Simulation Based Learning Environments

    E-Print Network [OSTI]

    Rubloff, Gary W.

    Demonstrations CHI 2000 , 1-6 APRIL 2000 Simulation Based Learning Environments and the Use://www.cs.umd.edu/hcil ABSTRACT We have developed an application framework for constructing simulation-based learning environments, Learning, Engineering, Education SimpLE pairs the power and flexibility of a generic simulation package

  20. Energy Harvesting Diamond Channel with Energy Cooperation

    E-Print Network [OSTI]

    Ulukus, Sennur

    Energy Harvesting Diamond Channel with Energy Cooperation Berk Gurakan Sennur Ulukus Department@umd.edu Abstract--We consider the energy harvesting diamond channel, where the source and two relays harvest energy the option of wirelessly transferring some of its energy to the relays via energy cooperation. We find

  1. Exposure In Wireless Sensor Networks: Theory And Practical Solutions

    E-Print Network [OSTI]

    Exposure In Wireless Sensor Networks: Theory And Practical Solutions Seapahn Megerian1 , Farinaz}@cs.ucla.edu, farinaz@eecs.berkeley.edu, gangqu@eng.umd.edu, gforce@ucla.edu Abstract Wireless ad-hoc sensor networks behavior of exposure and the proposed algorithm for its calculation. Keywords: wireless sensor network

  2. Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok Veeraraghvan,

    E-Print Network [OSTI]

    Agrawal, Amit

    Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok, CMU MIT Media Lab Coded Computational ImagingCoded Computational Imaging Course WebPage : http://www.umiacs.umd.edu/~aagrawal/CVPR10Tutorial/index.html #12;Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan

  3. Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok Veeraraghvan,

    E-Print Network [OSTI]

    Agrawal, Amit

    Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit Agrawal, Ashok, CMU MIT Media Lab Coded Computational ImagingCoded Computational Imaging Course WebPage : http://www.umiacs.umd.edu/~aagrawal/CVPR10Tutorial/index.html #12;Coded Computational Imaging Agrawal, Veeraraghavan, Narasimhan & Mohan Amit

  4. Short-Term Generation Asset Valuation Chung-Li Tseng, Graydon Barz

    E-Print Network [OSTI]

    Short-Term Generation Asset Valuation Chung-Li Tseng, Graydon Barz Department of Civil Engineering 94305, USA chungli@eng.umd.edu, gbarz@leland.stanford.edu Abstract In this paper we present a method for valuing a power plant over a short-term period using Monte Carlo sim- ulation. The power plant valuation

  5. Outage Analysis of Multi-node Amplify-and-Forward Relay Networks

    E-Print Network [OSTI]

    Liu, K. J. Ray

    Outage Analysis of Multi-node Amplify-and-Forward Relay Networks Karim G. Seddik, Ahmed K. Sadek, Weifeng Su , and K. J. Ray Liu Department of Electrical and Computer Engineering, and Institute}@eng.umd.edu Department of Electrical Engineering, State University of New York (SUNY) at Buffalo, Buffalo, NY 14260, USA

  6. Light Collages: Lighting Design for Effective Visualization Chang Ha Lee Xuejun Hao Amitabh Varshney

    E-Print Network [OSTI]

    Varshney, Amitabh

    Light Collages: Lighting Design for Effective Visualization Chang Ha Lee Xuejun Hao Amitabh 20742 {chlee, hao, varshney}@cs.umd.edu ABSTRACT We introduce Light Collages ­ a lighting design system perception of features with lighting that is locally consistent and globally inconsistent. Inspired

  7. Measuring Productivity on High Performance Computers Marvin Zelkowitz1,2

    E-Print Network [OSTI]

    Basili, Victor R.

    Measuring Productivity on High Performance Computers Marvin Zelkowitz1,2 Victor Basili1,2 Sima, lorin, hollings, nakamura}@cs.umd.edu Abstract In the high performance computing domain, the speed of concern to high performance computing developers. In this paper we will discuss the problems of defining

  8. Collod-Broud & Boileau The Marfan Mutation Database

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Collod-Béroud & Boileau The Marfan Mutation Database Gwenaëlle Collod-Béroud1 and Catherine Boileau created, in 1995, a mutation database named "UMD-FBN1". The database follows the guidelines on mutation databases of the Hugo Mutation Database Initiative and gives access to a software package that provides

  9. Aerosol remote sensing over land: A comparison of satellite retrievals using different algorithms and instruments

    E-Print Network [OSTI]

    Li, Zhanqing

    Federal Environmental Agency, Spittelauer Lände 5, 1090 Wien, Austria h Earth System Science Interdisciplinary Center, University of Maryland (UMD), 2114C Computer and Space Sciences Building, MD 20742, USA on the analysis of backscattered solar light is presented for a single scene over central Europe on October 13th

  10. INFSCI 2140 Information Storage and Retrieval

    E-Print Network [OSTI]

    Brusilovsky, Peter

    #12;5 User Interaction in a Boolean System Enter search statement View results (postings for terms in a Ranked Output System Enter search statement View ranked list Strategies ­ Add or delete terms from previews can help to choose the right set of query terms Essential if the search could be slow (UMD movie

  11. The viscous potential free surface flows in a moving domain of infinite depth without surface tension

    E-Print Network [OSTI]

    Yorke, James

    . It turns out that the new system is the viscous version of the water wave equations and the dissipation@cscamm.umd.edu. 1 #12;(1) The kinematic condition: We represent the free boundary by z - (x, y, t) = 0. Since (t + v

  12. Hyperbolic Dynamics Todd Fisher

    E-Print Network [OSTI]

    Fisher, Todd

    Hyperbolic Dynamics Todd Fisher tfisher@math.umd.edu Department of Mathematics University of Maryland, College Park Hyperbolic Dynamics ­ p. 1/3 #12;What is a dynamical system? Phase space X, elements possible states Hyperbolic Dynamics ­ p. 2/3 #12;What is a dynamical system? Phase space X, elements

  13. System Designs for Adaptive, Distributed Network Monitoring and Control

    E-Print Network [OSTI]

    Baras, John S.

    1 System Designs for Adaptive, Distributed Network Monitoring and Control H. Li, S. Yang, H. Xi.umd.edu Abstract We present system designs for adaptive, distributed network monitoring and control. The ideas are to distribute some processing intelligence to network elements, and to design a dynamic interface

  14. Trust-aware State Estimation Under False Data Injection in Distributed Sensor Networks

    E-Print Network [OSTI]

    Baras, John S.

    1 Trust-aware State Estimation Under False Data Injection in Distributed Sensor Networks Shanshan of nodes and the volatility of the network. In this paper, we focus on robust distributed state estimation Engineering University of Maryland, College Park, MD, 20742 Email: {sszheng,tjiang,baras}@umd.edu Abstract--Distributed

  15. Understanding Single-Handed Mobile Device Interaction Amy K. Karlson, Benjamin B. Bederson

    E-Print Network [OSTI]

    Golbeck, Jennifer

    }@cs.umd.edu Jose L. Contreras-Vidal Cognitive-Motor Behavior Laboratory Kinesiology Department University with increasing numbers of functions, features, and applications. Unfortunately these divergent trends with this goal in mind. Small, light phones that are easy to control with one hand are unfriendly to thumbs due

  16. Drug-Target Interaction Prediction for Drug Repurposing with Probabilistic Similarity Logic

    E-Print Network [OSTI]

    Getoor, Lise

    Drug-Target Interaction Prediction for Drug Repurposing with Probabilistic Similarity Logic Shobeir, USA getoor@cs.umd.edu ABSTRACT The high development cost and low success rate of drug dis- covery from appro- ved drugs. Computational methods can be effective in focu- sing efforts for such drug repurposing

  17. Raydiance Ultra-Short Pulse Laser Platform: Gateway to the Light Age

    E-Print Network [OSTI]

    Van Stryland, Eric

    /Rutgers · EpiRay · Army TATRC · UTSW · Wilmer, UMD · Synthetic Genomics · Navy #12;15 U.S. Food and Drug/implant procedures #12;17 Oncology Experimentation · FDA Research Group · Effects of non-destructive irradiation

  18. Space Systems Laboratory! U N I V E R S I T Y O F

    E-Print Network [OSTI]

    Akin, David

    Space Systems Laboratory! U N I V E R S I T Y O F MARYLAND 1 Robotic Frontiers ! David L. Akin! Space Systems Laboratory! University of Maryland,! College Park! #12;Space Systems Laboratory! U N I V E R S I T Y O F MARYLAND 2 Overview of the UMd Space Systems Lab! Dexterous Robotics! Human Systems

  19. Optimal Planning with Global Numerical State Constraints Franc Ivankovic, Patrik Haslum, Sylvie Thiebaux, Vikas Shivashankar and Dana S. Nau

    E-Print Network [OSTI]

    Thiébaux, Sylvie

    , transport systems and water net- works. Smart use of this information, using automated plan- ningOptimal Planning with Global Numerical State Constraints Franc Ivankovic, Patrik Haslum, Sylvie Thi.last@anu.edu.au {svikas,nau}@cs.umd.edu Abstract Automating the operations of infrastructure networks such as energy grids

  20. Sources of Poultry and Supplies for Small Flocks -2007 prepared by

    E-Print Network [OSTI]

    Hamza, Iqbal

    .ansc.umd.edu/faculty/nzpub.htm) These Agents are volunteers who will take the required samples, test them and provide the NPIP health certification forms for a fee. #12;Page 2 of 6 *Show quality POULTRY SOURCES Egg Production Clearview Stock Farm Uconn Poultry Farm Welp, Inc. Turkey Bolton Turkey Farm Burr Farm, Inc. Clearview Stock Farm & Hatchery

  1. Extremely local MR representations: Youngmi Hur1 & Amos Ron2

    E-Print Network [OSTI]

    Maryland at College Park, University of

    Extremely local MR representations: L-CAMP Youngmi Hur1 & Amos Ron2 Workshop on sparse representations: UMD, May 2005 1 Math, UW-Madison 2 CS, UW-Madison #12;Wavelet and framelet constructions History of all local MR representations #12;L-CAMP: Extremely local MR constructions Bird's view of the CAP

  2. Annual Performance Report AFOSR Grant Number F496200110374

    E-Print Network [OSTI]

    Hassam, Adil

    between the UMD and Sandia Approaches to Modeling of Complicated Cavities 11 III.1.c Advanced Theoretical Protection 22 III.2.c Experimental Studies of Pulsed RF Interference on IC 26 MOSFETs, Inverters the probability distribution function of electric field on an electronic component inside a partially shielded

  3. Indexing Point Triples Via Triangle Geometry Charles B. Cranston and Hanan Samet

    E-Print Network [OSTI]

    Samet, Hanan

    n 3. Maps provide a means of maintaining a database of car- tographic information. Although maps, mobile data management, moving-object and moving-framework databases, and location-based services. One of Maryland, College Park zben,hjs @cs.umd.edu Abstract Database search for images containing icons with spe

  4. Dianne Prost O'Leary Computer Science Department Phone: (301) 405-2678

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    Dianne Prost O'Leary Professor Computer Science Department Phone: (301) 405-2678 and Institute Programmer at a university computing center Summer, 1971 April 24, 2014 1 D. P. O'Leary #12;II. Research are organized by field at http://www.cs.umd.edu/users/oleary/res12/. Books Authored [B2] Dianne P. O'Leary

  5. BioMed Central Page 1 of 14

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    fragments Elena Zotenko1,3, Rezarta Islamaj Dogan1,3, W John Wilbur3, Dianne P O'Leary1,2 and Teresa M@mail.nih.gov; W John Wilbur - wilbur@mail.nih.gov; Dianne P O'Leary - oleary@cs.umd.edu; Teresa M Przytycka

  6. Dianne P. O'Leary Women in Engineering Presentation May 3, 2003 8 Rules for

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    1 Dianne P. O'Leary Women in Engineering Presentation May 3, 2003 8 Rules for Career Success Dianne P. O'Leary University of Maryland Dianne P. O'Leary Women in Engineering Presentation May 3, 2003 principles. Perhaps others will find a similar exercise helpful. Dianne O'Leary oleary@cs.umd.edu Dianne P. O'Leary

  7. REGULARIZATION BY TRUNCATED TOTAL LEAST SQUARES R. D. FIERRO, G. H. GOLUB, P. C. HANSEN, AND D. P. O'LEARY

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    . O'LEARY¶ SIAM J. SCI. COMPUT. c 1997 Society for Industrial and Applied Mathematics Vol. 18, No. 4 Park, MD 20742 (oleary@cs.umd.edu). 1223 #12;1224 R. D. FIERRO, G. H. GOLUB, P. C. HANSEN, AND D. P. O'LEARY

  8. RESTORING IMAGES DEGRADED BY SPATIALLY VARIANT JAMES G. NAGY AND DIANNE P. O'LEARY

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    RESTORING IMAGES DEGRADED BY SPATIALLY VARIANT BLUR JAMES G. NAGY AND DIANNE P. O'LEARY SIAM J. SCI of Maryland, College Park, MD 20742 (oleary@cs.umd.edu). 1063 #12;1064 JAMES G. NAGY AND DIANNE P. O'LEARY

  9. Population balance modeling -an application in particle technology

    E-Print Network [OSTI]

    Ehrman, Sheryl H.

    in industry · Design problem, sneak peak · Particle collection using cyclones · Aerosol topics ­ size distributions ­ aggregates and fractals ­ coagulation/breakup · Population balance equations · Discrete and University of Maryland Link to Matlab: www.glue.umd.edu/~sehrman/popbal.htm #12;Outline · Aerosol reactors

  10. Integration of Local and Global Shape Analysis for Logo Classification Jan Neumanna

    E-Print Network [OSTI]

    Samet, Hanan

    Integration of Local and Global Shape Analysis for Logo Classification Jan Neumanna , Hanan Sameta@cs.umd.edu, ayas@il.ibm.com A comparison is made of global and local methods for the shape analysis of logos a similarity metric on the logos. As representatives for the two classes of methods, we use the negative shape

  11. 306 IEEE JOURNAL ON SELECTED AREAS IN COMMUNICATIONS, VOL. 25, NO. 2, FEBRUARY 2007 Lifetime Maximization via Cooperative Nodes and

    E-Print Network [OSTI]

    Liu, K. J. Ray

    locations and energy levels among distributed nodes. First, a lifetime maximization problem via cooperative is with the Department of Electrical and Computer Engineer- ing and the Institute for Systems Research, University of Maryland, College Park, MD 20742 USA (email: kjrliu@eng.umd.edu). Z. Han is with the Department

  12. Toward Resilient Security in Wireless Sensor Networks # Hao Yang # , Fan Ye + , Yuan Yuan # , Songwu Lu # , William Arbaugh #

    E-Print Network [OSTI]

    Lu, Songwu

    networks, location­based security, resiliency, node compromise, en­route filtering, key distributionToward Resilient Security in Wireless Sensor Networks # Hao Yang # , Fan Ye + , Yuan Yuan@us.ibm.com {yuanyuan,waa}@cs.umd.edu ABSTRACT Node compromise poses severe security threats in wireless sensor networks

  13. Preventing Wormhole Attacks Using Physical Layer Authentication

    E-Print Network [OSTI]

    Baras, John S.

    performance overhead and requires no additional hardware. We provide analytical and simulation based performance evaluation of the security of our scheme. I. INTRODUCTION The rapid progress of wireless}@umd.edu Abstract--Mobile ad-hoc networks (MANETs) are a key en- abler of pervasive computing. Constrained resources

  14. In GIS'13: C. Knoblock, P. Krger, J. Krumm, M. Schneider, and P. Widmayer (eds), Proceedings of the 21st ACM SIG-SPATIAL International Conference on Advances in Geographic Information Systems, pp. 542-545, Orlando, FL, Nov. 2013.

    E-Print Network [OSTI]

    Samet, Hanan

    , University of Maryland College Park, MD 20742 USA {marco, hjs}@cs.umd.edu ABSTRACT Determining geographic is granted without fee provided that copies are not made or distributed for profit or commercial advantage of Washington" when it appears in a list containing the values [Washington, Idaho, Oregon] (which are all names

  15. L e s s d e p e n d e n c e o n f o r e i g n o i l , a n d e v e n t u a l t r a n s i t i o n t o a n e m i s s i o n s -f r e e , p e t r o l e u m -f r e e v e h i c l e

    E-Print Network [OSTI]

    . . . . . . . . . . . . . . . . . . . . . . . . 75 III.9 Oak Ridge National Laboratory: Enabling High-Efficiency Ethanol Engines . . . . . . .

  16. Predation and interspecific competition for S?c?h?i?z?a?p?h?i?s? g?r?a?m?i?n?u?m? (Rondani) (Homoptera:Aphididae) by C?o?c?c?i?n?e?l?l?a? s?e?p?t?e?m?p?u?n?c?t?a?t?a? L. and H?i?p?p?o?d?a?m?i?a? c?o?n?v?e?r?g?e?n?s? Guerin-Meneville (Coleoptera:Coccinellidae)

    E-Print Network [OSTI]

    Edwards, Jeffrey Michael

    1992-01-01T23:59:59.000Z

    7 from India, France, Italy, Norway, and Sweden were received by the United States Department of Agriculture-Agricultural Research Service-Beneficial Insects Research Laboratory (USDA-ARS-BIRL) (Moorestown, New Jersey). A rearing program..., Quesada and Debach 1973). Introductions of R. cardinalis and C. ~leer ae have also been effective in other countries (Debach 1964, Quesada and Debach 1973). Natural enemies in existing ecosystems can be studied by removing enemies from study sites by a...

  17. Botswanafeaturing the VICTORIA FALLS

    E-Print Network [OSTI]

    Weaver, Harold A. "Hal"

    .alumni.jhu.edu AUGUST 6-19, 2015 #12;Victoria Falls N A T U R A L B E A U T Y | B O U N T I F U L W I L D L I F E | R IBotswanafeaturing the OKAVANGO DELTA plus VICTORIA FALLS AHI: 800-323-7373 www'll begin our journey with a visit to powerful Victoria Falls in Zambia, where you will take a sunset cruise

  18. S:\\Registration & Records\\Term Communications\\UG Creating Your JHED-Outlook Live.docx rev 08.2012 1 of 1 Johns Hopkins University

    E-Print Network [OSTI]

    Connor, Ed

    S:\\Registration & Records\\Term Communications\\UG Creating Your JHED-Outlook Live.docx rev 08.2012 1 JHED PASSWORD my.jhu.edu 2. Click First time JHED user? [under New Visitor] 3. Enter your Login ID (LID) in the First Time Login box. This is the JHED Login ID you just received via email. Do not try to search

  19. Under consideration for publication in J. Functional Programming 1 Types and Trace Effects of Higher Order

    E-Print Network [OSTI]

    Skalka, Christian

    , if a program is sending and receiving data over an SSL socket, the relevant events are opening and closing be: ssl_open("snork.cs.jhu.edu",4434); ssl_hs_begin(4434); ssl_hs_success(4434); ssl_put(4434); ssl_get(4434); ssl_open("moo.cs.uvm.edu",4435); ssl_hs_begin(4434); ssl_put(4435); ssl_close(4434); ssl

  20. atomic-scale dynamical structures: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    presentee et method . . . . . . . . . . . . . . . . . . . . . 10 1.2 Dynamic SSI problem in earthquake engineering, Structures et Materiaux - CNRS U.M.R. 8579...

  1. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Kyusyhu University

    E-Print Network [OSTI]

    Weng, Lin

    -Killing form of g , (the inner poduct of the highest long root is t,wo.) then d ~ mg Z : J U ( m )J a ( n - m

  2. Elastic Metal Alloy Refrigerants: Thermoelastic Cooling

    SciTech Connect (OSTI)

    None

    2010-10-01T23:59:59.000Z

    BEETIT Project: UMD is developing an energy-efficient cooling system that eliminates the need for synthetic refrigerants that harm the environment. More than 90% of the cooling and refrigeration systems in the U.S. today use vapor compression systems which rely on liquid to vapor phase transformation of synthetic refrigerants to absorb or release heat. Thermoelastic cooling systems, however, use a solid-state material—an elastic shape memory metal alloy—as a refrigerant and a solid to solid phase transformation to absorb or release heat. UMD is developing and testing shape memory alloys and a cooling device that alternately absorbs or creates heat in much the same way as a vapor compression system, but with significantly less energy and a smaller operational footprint.

  3. Combinatorial signaling microenvironments for manipulating cell fate

    E-Print Network [OSTI]

    Flaim, Christopher Jason

    2006-01-01T23:59:59.000Z

    six days with either 1000 U/mL LIF or 10 -6 M all-trans-retinoic acid (Sigma).six days with either 1000 U/mL LIF or 10 -6 M all-trans-retinoic acid (Sigma).

  4. COMMISSIONING APRIL, 2012 PAGE 1 OF 3

    E-Print Network [OSTI]

    Kamat, Vineet R.

    SID-G COMMISSIONING SID-G APRIL, 2012 PAGE 1 OF 3 COMMISSIONING Scope Most projects, especially those with extensive mechanical and electrical systems, will undergo a U-M building commissioning (Cx support this process. Related Documents U-M Building Commissioning Documents: Full Project Commissioning

  5. Current Experiments in Particle Physics (September 1996)

    E-Print Network [OSTI]

    Armstrong, F.E.

    2010-01-01T23:59:59.000Z

    R A D A M A N T E , F . (Trieste U. ) C E R N - P S - 2 0 6R-92-08 G R I O N , N . (Trieste U. ) T R I U M F - 6 2 4 KE - 0 0 2 G R I O N , N . (Trieste U . ) T R I U M F - 6 5 3

  6. Current Experiments in Particle Physics (September 1996)

    E-Print Network [OSTI]

    Galic, H.

    2011-01-01T23:59:59.000Z

    R A D A M A N T E , F . (Trieste U. ) C E R N - P S - 2 0 6R-92-08 G R I O N , N . (Trieste U. ) T R I U M F - 6 2 4 KE - 0 0 2 G R I O N , N . (Trieste U . ) T R I U M F - 6 5 3

  7. LITHIUM LITERATURE REVIEW: LITHIUM'S PROPERTIES AND INTERACTIONS

    Office of Scientific and Technical Information (OSTI)

    Showing t h e E f f e c t o f Temperature on L i q u i d L i t h i u m Absorption o f Hydrogen Reaction P r o f i l e s o f 100-125 Mesh L i t h i u m Metal Exposed t o C i r c u l...

  8. Preventative Maintenance (PM) Policy Outline the policy regarding preventative vehicle maintenance on University of Michigan (U-

    E-Print Network [OSTI]

    Kirschner, Denise

    Preventative Maintenance (PM) Policy Objective Outline the policy regarding preventative vehicle maintenance on University of Michigan (U- M) vehicles. Policy 1. All maintenance performed on U-M vehicles their own campus maintenance facility to repair their fleet vehicles. 2. To ensure proper stewardship of U

  9. Response of Salt Marsh Ponds to Eutropication Austin N. Ritter1,3

    E-Print Network [OSTI]

    Vallino, Joseph J.

    Response of Salt Marsh Ponds to Eutropication Austin N. Ritter1,3 , David Dodge1 , Linda A. Deegan2 examined the response of New England salt marsh ponds to nutrient loading via flooding tidal water as part of nutrient (70 uM nitrate and 4uM phosphate). Our results indicate that gross nitrate processing in salt

  10. A study of the principal factors contributing to the load supporting capacity of straight shaft cast-in-place concrete piles in clay 

    E-Print Network [OSTI]

    Dubose, Lawrence A.

    1956-01-01T23:59:59.000Z

    . Interface friction of pile and penetrated medium ............... ................ ............. 16 a. Transmission of stress from pile to soil m e d i u m ............. ...... ........... 17 b. Factors affecting shear strength of soil m e d i u m... Page D. Magnitude of strain necessary to mobilize skin friction ................... ........... ......... 28 E. Comparison of tension and compression load capacities ................................... . ??? 28 F. Distribution of load between skin...

  11. Environmental Reporting for the University of Michigan Ann Arbor

    E-Print Network [OSTI]

    Eustice, Ryan

    Environmental Reporting for the University of Michigan Ann Arbor Campus: the U-M Environmental Data;#12;Environmental Reporting for the University of Michigan Ann Arbor Campus: The U-M Environmental Data Repository;DOCUMENT DESCRIPTION ENVIRONMENTAL REPORTING FOR THE UNIVERSITY OF MICHIGAN ANN ARBOR CAMPUS: THE U

  12. Nuclear space power safety and facility guidelines study

    SciTech Connect (OSTI)

    Mehlman, W.F.

    1995-09-11T23:59:59.000Z

    This report addresses safety guidelines for space nuclear reactor power missions and was prepared by The Johns Hopkins University Applied Physics Laboratory (JHU/APL) under a Department of Energy grant, DE-FG01-94NE32180 dated 27 September 1994. This grant was based on a proposal submitted by the JHU/APL in response to an {open_quotes}Invitation for Proposals Designed to Support Federal Agencies and Commercial Interests in Meeting Special Power and Propulsion Needs for Future Space Missions{close_quotes}. The United States has not launched a nuclear reactor since SNAP 10A in April 1965 although many Radioisotope Thermoelectric Generators (RTGs) have been launched. An RTG powered system is planned for launch as part of the Cassini mission to Saturn in 1997. Recently the Ballistic Missile Defense Office (BMDO) sponsored the Nuclear Electric Propulsion Space Test Program (NEPSTP) which was to demonstrate and evaluate the Russian-built TOPAZ II nuclear reactor as a power source in space. As of late 1993 the flight portion of this program was canceled but work to investigate the attributes of the reactor were continued but at a reduced level. While the future of space nuclear power systems is uncertain there are potential space missions which would require space nuclear power systems. The differences between space nuclear power systems and RTG devices are sufficient that safety and facility requirements warrant a review in the context of the unique features of a space nuclear reactor power system.

  13. A modification of the carry-propagation-free adder in a redundant binary multiplier 

    E-Print Network [OSTI]

    Park, Jinsoo

    1990-01-01T23:59:59.000Z

    12 0 172. 0F C53 10 0 106. 0F C54 1 0 1073. 0F B. The Previous CPF Adder Cell Ml 4 5 6 7 CiXIOSP L=2. 0U W=6. 0U M2 1 8 4 7 CMOSP L=2. 0U W=6. 0U M3 9 5 1 7 CMOSP L=2. 0U W=6. 0U M4 10 11 9 7 CMOSP L=2. 0U W=6. 0U M5 6 5 0 12 CAIOSiV L=2. 0U W... 175. 0F C60 16 0 106. 0F C61 26 0 102. 0F C62 14 0 166. 0F C63 10 0 179. 0F C64 I 0 1257. 0F C. The Modified IZ Cell Ml 4 5 6 7 CMOSP L=2. 0U W=3. 0U M2 5 6 4 7 CMOSP L=2. 0U W=3. 0U M3 4 5 8 9 CMOSN L=2. 0U W=3. 0U M4 1 6 8 7 CMOSP L=2. 0U W...

  14. 10 20 30 40 50

    E-Print Network [OSTI]

    Lyuu, Yuh-Dauh

    de f g dh i jk glm n gop g m q gn rnm st u m l i g vt F w R #3 T f$ V$S W YA F de f g dh i jk glm n gop g m q gn rnm st u m l i g vt F w w #12 jk glm n gop g m q gn rnm st u m l i g vt F w £¤ £ ¶ £ ¦ � y¢ ¦ � ! © S ½ V R #3

  15. antifungal susceptibility testing: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    flavors. Bernard, C; DeTar, C; Levkova, L; Gottlieb, S; Heller, U M; Hetrick, J E; Osborn, J; Renner, D B; Toussaint, D; Sugar, R 2007-01-01 99 The 2+1 flavor topological...

  16. BMP4 sufficiency to induce choroid plexus epithelial fate from embryonic stem cell-derived neuroepithelial progenitors

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    incubated with 8 uM Vybrant CFDA-SE Cell Tracker dye (LifeRiver) followed by Vybrant CFDA-SE dye labeling as describedonly those cells that were CFDA-SE/Hoechst colabelled and

  17. attacks outcomes lessons: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    0 20 40 60 80 100 u m b e r o f o u t c o m e s positive outcome... Underestimation of timber fraction resulted in significant heat loss ? 23% Terraced Timber frame York > AD1B...

  18. CURRENT EXPERIMENTS IN ELEMENTARY PARTICLE PHYSICS - March 1987

    E-Print Network [OSTI]

    Wohl, C.G.

    2010-01-01T23:59:59.000Z

    Stueclier. K H Stupperifh TRIESTE U M Budinich. F Liello. Ei. G Rinaudo. A Romero TRIESTE II E Caslolli. L Lanceri. PE Menichctti, G Rinaudo TRIESTE U E Castelli. P Checchia. P

  19. Rose Murphy Research Associate

    E-Print Network [OSTI]

    for All Electrification and Development in Rural Bangladesh C P R C O M M E N T A R Y N o . 2 · S U M M E .................................................................................................. 14 Difficulties of Electrification in Developing Countries ........................ 16 II

  20. DEPARTMENT OWNED EQUIPMENT INFORMATION Use this form to provide the required information for your department owned equipment to University of Michigan

    E-Print Network [OSTI]

    Kirschner, Denise

    information for your department owned equipment to University of Michigan (U-M) Parking and Transportation Plate Parking and Transportation Services (PTS) · 1213 Kipke Drive · Ann Arbor, Michigan 48109

  1. Moving Violation Policy Outline the policy regarding moving violations issued to operators in University of Michigan

    E-Print Network [OSTI]

    Kirschner, Denise

    to operators in University of Michigan (U-M) vehicles. Vehicle Use Policy 1. Staff members are responsible 1. Operators must be properly licensed according to the laws of the State of Michigan and federal

  2. 2.1E Supplement

    E-Print Network [OSTI]

    Winkelmann, F.C.

    2010-01-01T23:59:59.000Z

    V-T VIS-TRANS-SCH VOLUME WASTE-HEAT-USE •WEEK-SCHEDULE W-SCHConsumption Gas Heat P u m p Waste Heat Recovery Gas Heat PDefault Sizing Waste Heat Use Simulation Strategy Curves •

  3. Field boundary layer characteristics as modified by clams in habitats of varying survival rates

    E-Print Network [OSTI]

    Profile u (m s-1) y(m) Q (m3 s-1) Vertical Jet + = Q UU -Vertical jets in crossflow have been shown as those in the jets-in-crossflow literature. Hypothesis and Objective · Hypothesis: Clam presence

  4. Reducing Zero-point Systematics in Dark Energy Supernova Experiments

    E-Print Network [OSTI]

    Faccioli, Lorenzo

    2011-01-01T23:59:59.000Z

    Schmidt, B . P. 2003, i n Supernovae a n d G a m m a - R a ynumber of observed supernovae, m a x i m u m surveyObservations of type l a Supernovae (SNe la) have allowed

  5. Definition of a Balancing Point for Electricity Transmission Contracts

    E-Print Network [OSTI]

    Olmos, Luis; Neuhoff, Karsten

    2004-06-16T23:59:59.000Z

    406080 100 Nodes sorted by maximum relative cross price response M a xim u m re la tiv e cr o ss pr ic e re sp o ns e (Lines are labelled according to the number of generation nodes considered) M a xim u m re la tiv e cr o ss pr ic e re sp o... ns e M a xim u m re la tiv e cr o ss pr ic e re sp o ns e M a xim u m re la tiv e cr o ss pr ic e re sp o ns e Figure5: Effect of the number of generation nodes considered on the shape of the curve representing the maximum relative...

  6. administered cadmium tracer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    G A N D B O H U M I L V Sargassum fluitans biomass was accompanied by the release of hydrogen protons from the biomass. The uptake the overall biosorption rate of cadmium ions in...

  7. A report by Civic Enterprises and the National Peace Corps Association in partnership with Peter D. Hart Research Associates

    E-Print Network [OSTI]

    Fraden, Seth

    . Hart Research Associates By: John M. Bridgeland, Harris Wofford, Kevin F.F. Quigley, Jessica A. Milano PASSPORTS--ONE STAMPED AMERICAN,PASSPORTS--ONE STAMPED AMERICAN, T H E O T H E R H U M A N B E I N G . W E A R ET H E O T H E R H U M A N B E I N G . W E A R E MEMBERS OF THE SAME GREAT RACE, BUTMEMBERS

  8. Overview of 75 years of Smittium research, establishing a new genus for Smittium culisetae, and prospects for future revisions of the ‘Smittium’ clade

    E-Print Network [OSTI]

    Wang, Yan; Tretter, Eric D.; Lichtwardt, Robert W.; White, Merlin Milton

    2012-07-01T23:59:59.000Z

    10 44 26 13 2 Sm it ti u m co m m u n e K S- 2- 21 Ye s K U M YC O L / R W L C h ir o n o m id ae U n it ed St at es 31 5 10 44 26 12 JQ 30 29 01 Sm it ti u m cf . cu li ci s N O R -2 5- W 10 N M M W M o sq u it o N o rw ay 57 4 JQ 30 28 66 JQ 30 29... Sm it ti u m tr on ad or iu m A R G -2 4- 2F Ye s L C F P ar ah ep ta gy ia sp . A rg en ti n a 32 5 10 44 25 82 JQ 30 29 04 Sm it ti u m sp . in d et . 2f A S- 22 -1 5 Ye s A S C ri co to pu s sp . N ew Z ea la n d 36 7 JQ 30 28 58 JQ 30 29 36 Sm...

  9. From Domestic Farce to Abolitionist Satire: Reinhold Solger's Reframing of the Union (1860)

    E-Print Network [OSTI]

    Vanchena, Lorie A.

    2005-01-01T23:59:59.000Z

    , and to marry only with her uncle's consent. (Sterling's name, which suggests a person o f excellent character, already signals Solger's unequivocal choice o f husband for Emily.) W h e n Sterling secretly visits Emily that evening, Humdrum also arrives; like... not by Sterl ing but by S a m b o , the coachman, who climbs through a window to fetch Sally, a female slave in Olivebranch's household, and escape with her to the N o r t h ; H u m d r u m flees, only to be captured by members o f the Vig­ ilance C o m m i...

  10. Towards a Robust, Efficient Dispenser Photocathode: the Effect of Recesiation on Quantum Efficiency

    SciTech Connect (OSTI)

    Montgomery, Eric J.; Pan Zhigang; Leung, Jessica; Feldman, Donald W.; O'Shea, Patrick G. [Institute for Research in Electronics and Applied Physics, University of MD, College Park, MD 20742 (United States); Jensen, Kevin L. [Code 6843, ESTD, Naval Research Laboratory, Washington D.C. 20375-5347 (United States)

    2009-01-22T23:59:59.000Z

    Future electron accelerators and Free Electron Lasers (FELs) require high brightness electron sources; photocathodes for such devices are challenged to maintain long life and high electron emission efficiency (high quantum efficiency, or QE). The UMD dispenser photocathode design addresses this tradeoff of robustness and QE. In such a dispenser, a cesium-based surface layer is deposited on a porous substrate. The surface layer can be replenished from a subsurface cesium reservoir under gentle heating, allowing cesium to diffuse controllably to the surface and providing demonstrably more robust photocathodes. In support of the premise that recesiation is able to restore contaminated photocathodes, we here report controlled contamination of cesium-based surface layers with subsequent recesiation and the resulting effect on QE. Contaminant gases investigated include examples known from the vacuum environment of typical electron guns.

  11. The imaginary quadratic fields of class number two

    E-Print Network [OSTI]

    Merritt, Michael Henry

    1962-01-01T23:59:59.000Z

    ~ leg x 10 e MWs. 'e?ver? Rehmer L9) 6 had a?ed Still a?S?ther Criteri?n t'? ~ thia b?umd C?read m ~ 5 X 1, 0 e 9 The starting P?int for this Chesis is the c?ncePC ?f class numbers and we develop t'hat part of the nun-analytic theory pertaining..., then there exist principal ideals ( 6 ), ((3)? (Y ), and (5) such that (m)A (P)3 and (Y )B ~ (E)C ~ Thus (0 Y )A? (/d&)B (P &)C? By definition 2, 1, A ~ C, It follows from theorems 2 I, 2 2, and 2, 3 that the relation m is an equivalence relation, and hence we...

  12. A Grid of NLTE Line-Blanketed Model Atmospheres of Early B-type Stars

    E-Print Network [OSTI]

    Thierry Lanz; Ivan Hubeny

    2006-11-29T23:59:59.000Z

    We have constructed a comprehensive grid of 1540 metal line-blanketed, NLTE, plane-parallel, hydrostatic model atmospheres for the basic parameters appropriate to early B-type stars. The BSTAR2006 grid considers 16 values of effective temperatures, 15,000 K grid complements our earlier OSTAR2002 grid of O-type stars (Lanz & Hubeny, 2003, ApJS, 146, 417). The paper contains a description of the BSTAR2006 grid and some illustrative examples and comparisons. NLTE ionization fractions, bolometric corrections, radiative accelerations, and effective gravities are obtained over the parameter range covered by the grid. By extrapolating radiative accelerations, we have determined an improved estimate of the Eddington limit in absence of rotation between 55,000 and 15,000 K. The complete BSTAR2006 grid is available at the TLUSTY website (http://nova.astro.umd.edu).

  13. Construction of the noncommutative complex ball

    SciTech Connect (OSTI)

    Wang, Zhituo, E-mail: zhituo@mat.uniroma3.it [Dipartimento di Matematica, Universitŕ di Roma Tre Largo S. L. Murialdo 1, 00146 Roma (Italy)

    2014-09-15T23:59:59.000Z

    We describe the construction of the noncommutative complex ball whose commutative analog is the Hermitian symmetric space D = SU(m, 1)/U(m), with the method of coherent state quantization. In the commutative limit, we obtain the standard manifold. We also consider a quantum field theory model on the noncommutative manifold.

  14. The University of Maine does not discriminate on the grounds of race, color, religion, sex, sexual orientation, including transgender status and gender expression, national origin, citizenship status, age, disability, genetic information or veteran's stat

    E-Print Network [OSTI]

    Thomas, Andrew

    and Culture Sarah Molasses,A.D. 1835 T #12;3 U N I V E R S I T Y O F M A I N E M U S E U M S 4N E W S F O R

  15. Spring 2002 ASME/API Gas Lift Workshop, February 5-6, 2002, Houston, Texas.

    E-Print Network [OSTI]

    Gudmundsson, Jon Steinar

    the fluid density, u (m/s) the fluid flowing velocity and a (m/s) the speed of sound in the fluid. The speed of sound in the fluid is equivalent to the propagation speed of the pressure pulse generated. A typical effective. The use of pressure pulse technology for production testing, giving production rate of gas-liquid

  16. Geophys. J. Int. (2011) 185, 157166 doi: 10.1111/j.1365-246X.2011.04929.x GJIGeomagnetism,rockmagnetismandpalaeomagnetism

    E-Print Network [OSTI]

    2011-01-01T23:59:59.000Z

    an immense amount of computing power. These two factors pose a significant challenge to solving large- scale December 15; in original form 2010 July 21 S U M M A R Y Many geophysical inverse problems involve large quadtree or octree model discretization and wavelet transforms on reordered parameter sets. The adaptive

  17. DESIGN-PHASE COMMISSIONING This procedure defines the process for performing design-phase commissioning (Cx) on new

    E-Print Network [OSTI]

    Kamat, Vineet R.

    -phase commissioning (Cx) on new building, building addition and building renovation projects. When performed-phase Cx is a process by which a building Commissioning Authority (CxA) assists the U-M Design Manager Manager, but the CxA shall provide the Design Manager with recommendations on the MEP design to assure

  18. Geophys. J. Int. (2010) 182, 843864 doi: 10.1111/j.1365-246X.2010.04674.x GJIMineralphysics,rheology,heatflowandvolcanology

    E-Print Network [OSTI]

    by gas content as well as gas compressibility, both of which vary according to different processes collapses the gas volume near the base of the erupting column for slow eruptions. Once compaction ceases S U M M A R Y Volcanic eruptions involve high-speed turbulent flows of gas and magma mixtures in which

  19. Geophys. J. Int. (2011) doi: 10.1111/j.1365-246X.2011.05105.x GJIGeomagnetism,rockmagnetismandpalaeomagnetism

    E-Print Network [OSTI]

    Constable, Steve

    ,rockmagnetismandpalaeomagnetism A marine electromagnetic survey to detect gas hydrate at Hydrate Ridge, Oregon K. A. Weitemeyer,1 S; in original form 2010 April 8 S U M M A R Y Gas hydrates are a potential energy resource and hazard of controlled source electromagnetic (CSEM) and magnetotelluric (MT) methods to map gas hydrate and free gas

  20. Analysis and dynamic modeling of a moraine failure and glacier lake outburst flood at Ventisquero Negro, Patagonian Andes (Argentina)

    E-Print Network [OSTI]

    Stoffel, Markus

    Outburst hydrograph s u m m a r y Although moraine dams are inherently prone to failure because and the application of a dynamic dam break model. Results indicate that the moraine failure was caused most probably erosion and finally to dam failure. The lake volume of ca. 10 Â 106 m3 was released in ca. 3 h, producing

  1. Cadmium Biosorption Rate in Protonated Sargassum Biomass

    E-Print Network [OSTI]

    Volesky, Bohumil

    Cadmium Biosorption Rate in Protonated Sargassum Biomass J I N B A I Y A N G A N D B O H U M I L V Sargassum fluitans biomass was accompanied by the release of hydrogen protons from the biomass. The uptake the overall biosorption rate of cadmium ions in flat seaweed biomass particles. The overall biosorption

  2. BERKSHIRE ENCYCLOPEDIA OF SUSTAINABILITY

    E-Print Network [OSTI]

    Kammen, Daniel M.

    BERKSHIRE ENCYCLOPEDIA OF SUSTAINABILITY V O L U M E S 1-10 A ground-breaking interdisciplinary@berkshirepublishing.com | Tel +1 413 528 0206 19 April, 2012 In the 10-volume Berkshire Encyclopedia of Sustainability, experts, regional sustainability issues, and resource and ecosystem management. The ten volumes are available

  3. C

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Ostrander Castle Rock Baxter Road Substation Site Casey Road Substation Site Monahan Creek Substation Site S i l v e r L a k e Co w l i t z T o u t l e C o l u m b i a R i v e r...

  4. C

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Glade Brush Prairie Vancouver Portland Minnehaha Salmon Creek Camas Battle Ground Oak Park Washougal Sundial Substation Site u v e r a k e L a c a m a s L a k e Sal mo n C o l u m...

  5. IOP PUBLISHING and INTERNATIONAL ATOMIC ENERGY AGENCY NUCLEAR FUSION Nucl. Fusion 49 (2009) 104010 (12pp) doi:10.1088/0029-5515/49/10/104010

    E-Print Network [OSTI]

    École Normale Supérieure

    2009-01-01T23:59:59.000Z

    IOP PUBLISHING and INTERNATIONAL ATOMIC ENERGY AGENCY NUCLEAR FUSION Nucl. Fusion 49 (2009) 104010. Zwingmann CEA, IRFM, F-13108 St Paul-lez-Durance, France 1 Associazione EURATOM-ENEA sulla Fusione, C;Nucl. Fusion 49 (2009) 104010 G. Giruzzi et al 9 LJAD, U.M.R. C.N.R.S. No 6621, Universit´e de Nice

  6. Current Experiments in Elementary Particle Physics (August 1994)

    E-Print Network [OSTI]

    Galic, H.

    2010-01-01T23:59:59.000Z

    R A D A M A N T E , F . (Trieste U) C E R N - P S - 1 9 9 BIndiana U ) B N L - 8 5 2 G R I O N , N . (Trieste U & IN F N , Trieste) T R I U M F - 5 5 6 E G G E R , J . P . (

  7. CGSR Executive Committee Meeting, Sep. 23/2010 Appendix B Department ofElectricaland Computer Engineering

    E-Print Network [OSTI]

    Saskatchewan, University of

    and Bio-resource Engineering 15 Chemical Engineering 12 Mechanical Engineering 15 Civil and Geological Engineering M E M O R A N D U M To: Gregory Marion, Chair of College of Graduate Studies and Research Graduate Programs Committee From: Ha Nguyen, Graduate Chair, Department of Electrical and Computer Engineering Date

  8. Regional regression models of watershed suspended-sediment discharge for the eastern United States

    E-Print Network [OSTI]

    Vogel, Richard M.

    : Sediment transport Regression Water quality Ungaged GAGES SPARROW s u m m a r y Estimates of mean annual Streamflow (GAGES) database. The resulting regional regression models summarized for major US water resources contaminants including pesticides, met- als, and polycyclic aromatic hydrocarbons (PAHs) readily sorb

  9. Suckermouth catfishes (aka "plecos") are very popular in the aquarium trade due to their hardiness and longevity. As a result, this group of species has joined the ranks of the many

    E-Print Network [OSTI]

    Jawitz, James W.

    : Suckermouth Catfish 1 Science: Acoustic Invasion 2 More Science: Chytrid Vector 2 Reevaluating `Away -Field: Vermiculated sailfin catfish #12;V o l u m e 5 , I s s u e 2 ­ P g . 2 Science: Acoustic Invasion In natural in comparison to urban noise pollution. Human-related noise pollution arises from a variety of sources

  10. Geophys. J. Int. (2012) doi: 10.1111/j.1365-246X.2012.05414.x GJISeismology

    E-Print Network [OSTI]

    Bodin, Thomas

    2012-01-01T23:59:59.000Z

    September 26 S U M M A R Y A meaningful interpretation of seismic measurements requires a rigorous modelling to aid interpretation, seismic data allow us to examine the scale and nature of heterogeneities of seismologists for interpretation of seismic data for more than 30 yr, and has resulted in numerous models

  11. Geophys. J. Int. (2012) 189, 15361556 doi: 10.1111/j.1365-246X.2012.05414.x GJISeismology

    E-Print Network [OSTI]

    Sambridge, Malcolm

    2012-01-01T23:59:59.000Z

    ; in original form 2011 September 26 S U M M A R Y A meaningful interpretation of seismic measurements requires modelling to aid interpretation, seismic data allow us to examine the scale and nature of heterogeneities of seismologists for interpretation of seismic data for more than 30 yr, and has resulted in numerous models

  12. Positioning the performance of public service. When management tools are in conflict : the case of urban water management

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    the conflict between new and existing performance management tools in a large urban public service3 . We usePositioning the performance of public service. When management tools are in conflict : the case of urban water management Marie Tsanga Tabi, U.M.R Cemagref-ENGEES "Management of Public Services", 1 quai

  13. First-in-Human Phase I Study of Pictilisib (GDC-0941), a Potent Pan–Class I Phosphatidylinositol-3-Kinase (PI3K) Inhibitor, in Patients with Advanced Solid Tumors

    E-Print Network [OSTI]

    Sarker, Debashis; Ang, Joo Ern; Baird, Richard; Kristeleit, Rebecca; Shah, Krunal; Moreno, Victor; Clarke, Paul A.; Raynaud, Florence I.; Levy, Gallia; Ware, Joseph A.; Mazina, Kathryn; Lin, Ray; Wu, Jenny; Fredrickson, Jill; Spoerke, Jill M.; Lackner, Mark R.; Yan, Yibing; Friedman, Lori S.; Kaye, Stan B.; Derynck, Mika K.; Workman, Paul; de Bono, Johann S.

    2014-11-04T23:59:59.000Z

    pharmacokinetic- pharmacodynamic modeling based on MDA-MB-361, a human breast cancer xenograft with HER2 amplification and PIK3CA 1633G>A mutation, predicted the minimal target plasma AUC to be 6uM*hr (3000 ng*hr/ml) in order to achieve ?90% tumor growth...

  14. I N S T I T U T F U R I N F O R M A T I K Automotive Architecture Framework

    E-Print Network [OSTI]

    Broy, Manfred

    architecture development for the automotive industry. It outlines best practices and methods and introduces in the Automotive industry) demand a structured, repeatable method for · sufficiently describing and evaluatingT U M I N S T I T U T F ¨U R I N F O R M A T I K Automotive Architecture Framework: Towards

  15. PALEOZOIC TRACE FOSSILS FROM THE KUFRA BASIN, LIBYA

    E-Print Network [OSTI]

    Benton, Michael

    PALEOZOIC TRACE FOSSILS FROM THE KUFRA BASIN, LIBYA BRIAN R. TURNER AND MICHAEL J. BENTONPaleozoicsuccessionin the southeastern part ofthe Kufra Basin, Libya, comprises a sequence of sedimentary facies up to 250 m thick THEK u m BASINin southeast Libya (Figure 1)occupiesan area of about 400,000km2and is filled

  16. Using X-ray computed tomography in pore structure characterization for a Berea sandstone: Resolution effect

    E-Print Network [OSTI]

    Hu, Qinhong "Max"

    Using X-ray computed tomography in pore structure characterization for a Berea sandstone Keywords: XCT Pore structure characterization Resolution effect MIP s u m m a r y X-ray computed tomography electron microscopy (Ioannidis et al., 1996), X-ray computed tomography (XCT) with either conventional

  17. michigan architecture 20082009

    E-Print Network [OSTI]

    Kamat, Vineet R.

    2008­2009 michigan architecture Programs + Courses #12;#12;2008­2009 ARCHITECTURE PROGRAMS + COURSE This bulletin provides an overview of policies, procedures, degree options, and courses for the U-M architecture of Architecture + Urban Planning 2150 Art + Architecture Building 2000 Bonisteel Boulevard Ann Arbor, MI 48109

  18. EMPLOYEE FUEL ACCESS APPLICATION Use this application to request access for employees to use the campus service stations in conjunction with a fuel

    E-Print Network [OSTI]

    Kirschner, Denise

    EMPLOYEE FUEL ACCESS APPLICATION Use this application to request access for employees to use the campus service stations in conjunction with a fuel access device. In order to obtain fuel from for access. Employee access is not required for the U-M fleet vehicle equipped with an automated fuel device

  19. OCTOBER 2010 SPECIAL INSTRUCTIONS TO DESIGNERS SID-S SUSTAINABLE PRODUCTS PORTFOLIO

    E-Print Network [OSTI]

    Kamat, Vineet R.

    by the Sustainability Team at the University of Michigan (U-M) Department of Architecture, Engineering & ConstructionSID-S OCTOBER 2010 SPECIAL INSTRUCTIONS TO DESIGNERS SID-S SUSTAINABLE PRODUCTS PORTFOLIO Page 1 of 2 SUSTAINABLE PRODUCTS PORTFOLIO General The Sustainable Products Portfolio (SPP) is maintained

  20. Program of Work Master of Science in Healthcare Administration

    E-Print Network [OSTI]

    Huang, Haiying

    be completed in 24 months! C U R R I C U L U M General Business Courses 1. BSTAT 5315 (Statistical MethodsProgram of Work Master of Science in Healthcare Administration 39-Hour M.S. DEGREE PROGRAM Can

  1. Geophys. J. Int. (1997) 129,439-449 Shear-wave anisotropy and the stress field from borehole recordings

    E-Print Network [OSTI]

    Edinburgh, University of

    Geophys. J. Int. (1997) 129,439-449 Shear-wave anisotropy and the stress field from borehole of Earth Sciences, University of Southern California, Los Angeles, CA 90089-0740, USA Accepted 1997 January 16. Received 1997 January 14; in original form 1995 August 30. S U M M A R Y 53 local earthquakes

  2. UBC Social Ecological Economic Development Studies (SEEDS) Student Report Joshua Power

    E-Print Network [OSTI]

    ­ the UBC LCA Project ­ which aims to support the development of the field of life cycle assessment (LCA Summary This study, a life cycle assessment (LCA) of the Earth Sciences Building (ESB) serves t y o f B r i t i s h C o l u m b i a Life Cycle Assessment: Earth Sciences Building #12;ii Executive

  3. The evaluation of a valveless disposable respirator for use as respiratory protection against exposure to Halothane (2-Bromo-2-Chloro-1,1,1-Trifluoroethane)

    E-Print Network [OSTI]

    Gaudet, Glenn Lawrence

    1980-01-01T23:59:59.000Z

    12. 04 12. 77 * MIRAN Absorbance of Challenge Atmosphere at 20. 25 Meter Pathlength/IZ. 3 ** Concentration of Challenge Atmosphere = 137 ppm *** Area under porn-time curve since last exposure time increment. uM wavelength = 0. 95 A Summary...

  4. TSC Modelling of Current Ramp Scenarios with ITB-Generated Bootstrap Currents in JT-60U Reversed Shear Discharges

    E-Print Network [OSTI]

    A Modelling of Internal & Edge Transport Barriers (ITB & ETB) relevant to bootstrap currents has been with the ITB & ETB-generated bootstrap currents. A fast and strong ITB build-up near plasma core may cause process of Current Hole formation. - 2 - #12;qmin ITB & ETB Modelling on TSC Numerical Model JT-60U m

  5. STUDENT ORGANIZATION VEHICLE RENTAL FORM Use this form in conjunction with a vehicle reservation form to request a rental vehicle from University of Michigan

    E-Print Network [OSTI]

    Kirschner, Denise

    STUDENT ORGANIZATION VEHICLE RENTAL FORM Use this form in conjunction with a vehicle reservation form to request a rental vehicle from University of Michigan (U-M) Parking and Transportation Services Services to confirm vehicle availability before submitting a request. Form Instructions: Complete each

  6. MOTOR VEHICLE RECORD AUTHORIZATION This form authorizes Parking and Transportation (PTS) Fleet Services to conduct a motor vehicle record check to

    E-Print Network [OSTI]

    Kirschner, Denise

    MOTOR VEHICLE RECORD AUTHORIZATION This form authorizes Parking and Transportation (PTS) ­ Fleet Services to conduct a motor vehicle record check to verify eligibility to operate University of Michigan (U-M) vehicles. Form Instructions: · Complete each section of the form · Print and fax

  7. A graphical method to study suspended sediment dynamics during flood events in the Wadi Sebdou, NW Algeria (19732004)

    E-Print Network [OSTI]

    A graphical method to study suspended sediment dynamics during flood events in the Wadi Sebdou, NW sediment concentration Semiarid watershed Flood Wadi Algeria s u m m a r y Small sub-basins are numerous period (1973­2004) was analyzed at the outlet of the Wadi Sebdou basin (256 km2 ) in northwest Algeria

  8. Changes in sources and storage in a karst aquifer during a transition from drought to wet conditions

    E-Print Network [OSTI]

    Banner, Jay L.

    , and used inverse geochemical modeling (PHREEQC) to con- strain controls on groundwater compositions during more storage. Ă? 2012 Elsevier B.V. All rights reserved. 1. Introduction Karst groundwater systems Keywords: Karst Drought Telogenetic Edwards aquifer Groundwater Texas s u m m a r y Understanding

  9. On the Cosmic Evolution of Fe/Mg in QSO Absorption Line Systems

    E-Print Network [OSTI]

    Dey, Arjun; Rubin, Kate H R; Zhu, Guangtun Ben; Suresh, Joshua

    2015-01-01T23:59:59.000Z

    We investigate the variation of the ratio of the equivalent widths of the FeII$\\lambda$2600 line to the MgII$\\lambda\\lambda$2796,2803 doublet as a function of redshift in a large sample of absorption lines drawn from the JHU-SDSS Absorption Line Catalog. We find that despite large scatter, the observed ratio shows a trend where the equivalent width ratio $\\mathcal{R}\\equiv W_{\\rm FeII}/W_{\\rm MgII}$ decreases monotonically with increasing redshift $z$ over the range $0.55 \\le z \\le 1.90$. Selecting the subset of absorbers where the signal-to-noise ratio of the MgII equivalent width $W_{\\rm MgII}\\ge$3 and modeling the equivalent width ratio distribution as a gaussian, we find that the mean of the gaussian distribution varies as $\\mathcal{R}\\propto (-0.045\\pm0.005)z$. We discuss various possible reasons for the trend. A monotonic trend in the Fe/Mg abundance ratio is predicted by a simple model where the abundances of Mg and Fe in the absorbing clouds are assumed to be the result of supernova ejecta and where t...

  10. Final Scientific/Technical Report

    SciTech Connect (OSTI)

    Chang, Yale [JHU/APL; Thomas, Michael E. [JHU/APL; Siegrist, Karen M. [JHU/APL; Lennon, Andrew M. [JHU/APL; Hunter, Lawrence W. [JHU/APL; Oguz, Hasan O. [JHU/APL

    2014-07-01T23:59:59.000Z

    JHU/APL conducted solid propellant fire characterization tests in warm, humid, ambient conditions near sea level. Yttria and ceria surrogate materials were placed in the fires. The substrates simulating ground surfaces were concrete from a Kennedy Space Center launch pad, and steel covered with a protective ablative material representing a launch platform. In-situ instrumentation consisted of witness materials, thermocouples, air handlers, filters, and cascade impactors; remote instrumentation consisted of optical cameras and spectrometers. Test and analysis team members included the Naval Air Warfare Center Aircraft Division, Sandia National Laboratories (SNL), Alliant Techsystems, and the Johns Hopkins University. Test data were analyzed, reported, and delivered, including plume rise and transport captured on video. Derivation of the alumina particle size distributions formed the basis for condensing vapor and agglomeration estimates. Assessment of alumina mass in the plume, along with the surrogate fraction from filter forensics, provided an estimate of airborne surrogate mass. Technical interchange meetings were held with SNL and the Jet Propulsion Laboratory. Specifications for the fire environment were developed and delivered. A thermochemistry model that simultaneously provides the maximum temperature and heat flux was developed and delivered. An SPIE paper on 3D pyrometry of the fire was written and presented.

  11. Artificial Neural Network for search for metal poor galaxies

    E-Print Network [OSTI]

    Shi, F; Kong, X; Chen, Y

    2013-01-01T23:59:59.000Z

    In order to find a fast and reliable method for selecting metal poor galaxies (MPGs), especially in large surveys and huge database, an Artificial Neural Network (ANN) method is applied to a sample of star-forming galaxies from the Sloan Digital Sky Survey (SDSS) data release 9 (DR9) provided by the Max Planck Institute and the Johns Hopkins University (MPA/JHU). A two-step approach is adopted:(i) The ANN network must be trained with a subset of objects that are known to be either MPGs or MRGs(Metal Rich galaxies), treating the strong emission line flux measurements as input feature vectors in an n-dimensional space, where n is the number of strong emission line flux ratios. (ii) After the network is trained on a sample of star-forming galaxies, remaining galaxies are classified in the automatic test analysis as either MPGs or MRGs. We consider several random divisions of the data into training and testing sets: for instance, for our sample, a total of 70 percent of the data are involved in training the algor...

  12. Adsorption and elution in hollow-fiber-packed bed for recovery of uranium from seawater

    SciTech Connect (OSTI)

    Takeda, T.; Saito, K.; Ueza, K.; Furusaki, S. (Dept. of Chemical Engineering, Faculty of Engineering, Univ. of Tokyo, Hongo, Tokyo 113 (JP)); Sugo, T.; Okamoto, J. (Japan Atomic Energy Research Inst., Takasaki Radiation Chemistry Research Establishment, Takasaki, Gunma 370-12 (JP))

    1991-01-01T23:59:59.000Z

    This paper reports on a 0.9-m-high fixed bed charged with hollow fibers containing amidoxime groups placed on the coast of the Pacific Ocean for the recovery of uranium from seawater. Continuous flow of seawater at a superficial velocity of 4 cm/s provided an averaged uranium content of 0.97 g of U/kg in the amidoxime hollow fiber along the bed after 30 days contact. An elution curve having a 230 g of U/m{sup 3} peak concentration and a 45 g of U/m{sup 3} integrated concentration of uranium was obtained at a superficial velocity of 1 N HCl of 0.0125 cm/s. The required cross-sectional area of the amidoxime hollow fiber-packed bed to produce 10 kg of U per annum was calculated as 9.4 m{sup 2} with a 0.9-m bed height.

  13. available on-line at www.uoregon.edu/~wright FOURTH ANNUAL CHRISTMAS CRYPTOGRAMS

    E-Print Network [OSTI]

    Wright, Charles R.B.

    @uoregon.edu. 1 . C O C K U P C I C P V H L , P T F L U X N T L D U E X H S , M D H A U M M A H A T L S W H E R E S S T O P O D H L H D H A C K , M D H A U M M A H A T L S W H E R E C E A H H Y T P M D H D C K . -- P H T P C M C A F C L T A 2 . W E H A D Y O U T H S I R W Y B A U O T H V I T V R H U L D C W P D T D E H

  14. AN INVESTIGATION OF SEDIMENT TRANSPORT BEHIND THE TEXAS CITY DIKE

    E-Print Network [OSTI]

    Taylor, April

    2007-09-17T23:59:59.000Z

    .1 1 10 100 1000 Particle Size (µm) 0 2 4 6 8 10 12 14 16 18 20 22 24 Vo l u m e ( % ) Averaged Result-1A-77-80, Tuesday, September 12, 2006 1:39:12 PM Averaged Result-1A-80-86, Tuesday, September 12, 2006 1:47:08 PM... 16 18 20 22 24 Vo l u m e ( % ) Averaged Result-1A-141-150, Tuesday, September 12, 2006 2:34:19 PM Averaged Result-1A-151-160, Tuesday, September 12, 2006 2:40:45 PM Averaged Result-1A-161-170, Tuesday, September 12, 2006 2:47:37 PM Averaged...

  15. Microsoft Word - winter.doc

    U.S. Energy Information Administration (EIA) Indexed Site

    0, 1998 http:www.eia.doe.gov A v e r a g e T e m p e r a tu r e fo r F o u r M a jo r G a s C o n s u m in g M e tr o A r e a s 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 1 0 1 9 8 1 0...

  16. Microsoft Word - winter.doc

    Gasoline and Diesel Fuel Update (EIA)

    7, 1998 http:www.eia.doe.gov A v e r a g e T e m p e r a t u r e fo r F o u r M a jo r G a s C o n s u m in g M e t r o A r e a s 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 1 0 1 9 8 1...

  17. Microsoft Word - winter.doc

    U.S. Energy Information Administration (EIA) Indexed Site

    9, 1998 http:www.eia.doe.gov A v e r a g e T e m p e r a t u r e f o r F o u r M a jo r G a s C o n s u m in g M e t r o A r e a s 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 1 0 1 9 8 1...

  18. --No Title--

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    < h 2 c l a s s " t e x t - c e n t e r " a l i g n " c e n t e r " > P r e s e n t a t i o n s o f t h e I n t e r n a t i o n a l S y m p o s i u m < h 2 > < h 1 c l a s...

  19. Modeling Uranium-Proton Ion Exchange in Biosorption

    E-Print Network [OSTI]

    Volesky, Bohumil

    seaweed biomass was used to remove the heavy metal uranium from the aqueous solution. Uranium biosorptionModeling Uranium-Proton Ion Exchange in Biosorption J I N B A I Y A N G A N D B O H U M I L V O L E, Quebec, Canada H3A 2B2 Biosorption of uranium metal ions by a nonliving protonated Sargassum fluitans

  20. Questions

    E-Print Network [OSTI]

    CamScanner

    2014-06-17T23:59:59.000Z

    N o t e t h a t t h e sam e p h e n o m e n o n o c c u r s w h e n t h e rea l n u m b er s are re ga r de d a s a su bfie ld o f t h e c o m p l e x fi e ld ,. a n d it a l so o ccu ...

  1. Differential Effects of Insulin Resistance on Leucine and Glucose Kinetics in Obesity

    E-Print Network [OSTI]

    Wurtman, Richard

    of primed, constant infusions of D-[6,6-ZHz]glucose and L-[1-13C]leucine. Each subject participated in two insulin clamp studies on separate days, at infusion rates of 10 and 40 mU (m2 . minI"'. producing plasma)-', respectively), and its decline in response to insulin infusion was also comparable (8% and 10% during the 10-m

  2. UNITED STATES GEOLOGICAL SURVEY DEPARTMENT OF THE INTERIOR

    Office of Scientific and Technical Information (OSTI)

    a d i n g upwards i n t o t h e T e r t i a r y beds of t h e " C o n t i n e n t a l Terminal." The p e t r o l e u m p r o s p e c t s of t h e s e r o c k s , i n t h e p a s t...

  3. If a government or NGO (a nongovernmental, nonprofit organization) of a developing country decides that infor-

    E-Print Network [OSTI]

    Blake, Edwin

    Upon U N D E R D E V E L O P M E N T Edwin Blake University of Cape Town edwin@cs.uct.ac.za Editor: Gary Marsden u University of Cape Town u gaz@acm.org F u O u R u U u M ©Dan Blake is a professor in the department of computer science at the University of Cape Town, South Africa

  4. GM Project G.6 R -1 October 2000 Administration on Aging. 1997.Demographic Changes. U.S. Department of Health and

    E-Print Network [OSTI]

    ://www.aoa.gov/factsheets/Transportation.html. American Health Care Association. 1997. The Nursing Home Facility Sourcebook: Facts and Trends ­1997. p. 7. American Health Care Association. 1998. "The Looming Crisis." http://www.ahca.org/secure/nfres.htm and http.S. Department of Health and H u m a n S e r v i c e s . W a s h i n g t o n , D . C . http

  5. COURBES LISSES, CYCLE MAXIMAL ET POINTS INFINIMENT VOISINS DES SINGULARITES DE SURFACES

    E-Print Network [OSTI]

    Gonzalez-Sprinberg, Gerard

    S ; on appelle cycle maximal le cycle ZX = miEi d´efini par la partie divisorielle de mOX, o`u m est l seulement si le cycle maximal ZX = miEi de mOX poss`ede une composante r´eduite, i.e. il existe i tel que mi = 1. S'il en est ainsi, mOX est localement principal au voisinage du point exceptionnel P de la

  6. SFIBulletin How Complex Societies Evolve

    E-Print Network [OSTI]

    of bees in May Is worth a load of hay; A swarm of bees in June Is worth a silver spoon; A swarm of bees #12;2 S A N T A F E I N S T I T U T E B U L L E T I N · S U M M E R 2 0 0 1 profile SIR ROBERT MAYby

  7. IEEE TRANSACTIONS ON INFORMATION THEORY, VOL. IT-1i', NO. 6, NOVEMBER 1971 677 Study of an Integral Equation

    E-Print Network [OSTI]

    Moore, John Barratt

    system i = F(t)x + g(t)u y = If'(t)x+ jl(t)u+ M)% (2) where U(o)and V(")are independent zero-mean white to be the output covariance of a linear finite-dimensional system excited by white noise. Solutions. In most of the work to follow, we shall not assume that the equations of a linear system generating R(., o

  8. Greetings from the Warner College of Natural Re-

    E-Print Network [OSTI]

    of the National A message from Dean Joseph O'Leary September 2008 Every newsletter we will spot- light, through R T I U M F O R W A R F A R E E C O L O G Y O R G A N I Z A T I O N A L M E E T I N G Dean O'Leary

  9. Calix 2007:9th International Conference on Calixarene Chemistry

    SciTech Connect (OSTI)

    Jeffery Davis

    2011-09-09T23:59:59.000Z

    The DOE funds helped support an International Conference, Calix 2007, whose focus was on Supramolecular Chemistry. The conference was held at the University of Maryland from August 6-9, 2007 (Figure 1). The conference website is at www.chem.umd.edu/Conferences/Calix2007. This biannual conference had previously been held in the Czech Republic (2005), Canada (2003), Netherlands (2001), Australia (1999), Italy (1997), USA (Fort Worth, 1995) Japan (1993) and Germany (1991). Calixarenes are cup-shaped compounds that are a major part of Supramolecular Chemistry, for which Cram, Lehn and Pederson were awarded a Nobel Prize 20 years ago. Calixarene chemistry has expanded greatly in the last 2 decades, as these compounds are used in synthetic and mechanistic chemistry, separations science, materials science, nanoscience and biological chemistry. The organizing committee was quite happy that Calix 2007 encompassed the broad scope and interdisciplinary nature of the field. Our goal was to bring together leading scientists interested in calixarenes, molecular recognition, nanoscience and supramolecular chemistry. We believe that new research directions and collaborations resulted from an exchange of ideas between conferees. This grant from the DOE was crucial toward achieving that goal, as the funds helped cover some of the registration and accommodations costs for the speakers.

  10. Microbial dissolved organic phosphorus utilization in the Hudson River Estuary

    SciTech Connect (OSTI)

    Ammerman, J.W. (Texas A M Univ., College Station (United States)); Angel, D.L. (City College of New York, NY (United States))

    1990-01-09T23:59:59.000Z

    The Hudson River Estuary has large inputs of phosphorus and other nutrients from sewage discharge. Concentrations of soluble reactive phosphorus (SRP) reach at least 4 uM during the summer low-flow period. Biological utilization of phosphorus and other nutrients is usually minimal because of the high turbidity and short residence time of the water. Therefore SRP is normally a conservative tracer of salinity, with maximum concentrations found off Manhattan and decreasing to the north. Despite this abundance of SRP, some components of the dissolved organic phosphorus (DOP) appear to be rapidly cycled by microbes. The objective of this study was to measure this DIP cycling during both the high- and low-flow periods. We measured the concentrations of SRP and DOP, the SRP turnover rate, algal and bacterial biomass, and the substrate turnover rates of two microbial cell-surface phosphatases, alkaline phosphatase (AP) and 5[prime] - nucleotidase (5PN). SRP concentrations ranged from about 0.5-4 uM, DOP was usually less than 1 uM. SRP and AP turnover were slow (generally < 5%/h), but 5PN substrate turnover was high with a median rate of 100%/h. Furthermore, over 30% of the phosphate hydrolyzed by 5PN was immediately taken up. If the nucleotide-P concentration is conservatively assumed to be 5 nM, than the rate of phosphate utilization from DOP is nearly equal to that from SRP. That is paradoxical considering the large SRP concentration, but suggests that much of this SRP may be biologically unavailable due to complexation with iron or other processes.

  11. Heat transfer at the mold-metal interface in permanent mold casting of aluminum alloys project. Annual project status report for the period October 1, 1997 to September 30, 1998

    SciTech Connect (OSTI)

    Pehlke, R.D.; Hao, S.W.

    1998-09-30T23:59:59.000Z

    In the first year of this three-year project, substantial progress has been achieved. This project on heat transfer coefficients in metal permanent mold casting is being conducted in three areas. They are the theoretical study at the University of Michigan, the experimental investigations of squeeze casting and semi-solid casting at CMI-Tech Center, and the experimental investigation of low pressure permanent mold casting at Amcast Automotive. U-M did an initial geometry which was defined for ProCAST to solve, and then a geometry half the size was defined and solved using the same boundary conditions. A conceptual mold geometry was examined and is represented as an axisymmetric element.Furthermore, the influences of the localized heat transfer coefficients on the casting process were carefully studied. The HTC Evaluator has been proposed and initially developed by the U-M team. The Reference and the Database Modules of the HTC Evaluator have been developed, and extensively tested. A series of technical barriers have been cited and potential solutions have been surveyed. At the CMI-Tech Center, the Kistler direct cavity pressure measurement system has been purchased and tested. The calibrations has been evaluated. The probe is capable of sensing a light finger pressure. The experimental mold has been designed and modified. The experimental mold has been designed and modified. The first experiment is scheduled for October 14, 1998. The geometry of the experimental hockey-puck casting has been given to the U-M team for numerical analysis.

  12. Evaluation of fuel rod characterization for transient fuel modeling 

    E-Print Network [OSTI]

    Bechler, Eric Wayne

    1989-01-01T23:59:59.000Z

    P+ (g1+ g2) + brad (4) 17 where hgap is the gap conductance ks is the conductivity of the gas mixture tsap is the gap width gt+g2 are the temperature jump distances at the clad inner and fuel outer surfaces The temperature jump distances... the temperature of the fuel increases dramatically. & The model defines the total cumulative release during time t to be t 2 ) ( ) d ~ 1- exp[-m rt (r (t) - r(u))] m=1 m tt 0 (6) where rt r(t) = J D'(u) du 0 R is the total fission gas release during time...

  13. Volume 66, Numbers 3&4 (Complete)

    E-Print Network [OSTI]

    Dickson, Donald

    2008-01-01T23:59:59.000Z

    Tyacke. Woodbridge, Suffolk: Boydell Press, 2006. xiv + 254 pp. + 1 illus. $85.00. Review by P. G. st a n w o o d , un i v e r s i t y o f Br i t i s h co l u m B i a . Nicholas Tyacke is well known to literary and church historians? and to all... EVENTEENTH- ENTURY EWS FALL - WINTER 2008 Vol. 66 Nos. 3&4 Including THE NEO-LATIN NEWS Vol. 56, Nos. 3&4 Se v e n t e e n t h -Ce n t u r y ne w S VOLUME 66, Nos. 3&4 FALL...

  14. Development of a genetic linkage map of comparative anchor loci for bovine chromosome 5

    E-Print Network [OSTI]

    Brodigan Thomas Matthew

    1998-01-01T23:59:59.000Z

    , particular those scientists that added a little more, Caird Rexroad, Dennis Weaver, Srinivas Kata, Pete Skirpstunis and Erik Upeslacis. Also thanks to my old Triangle brothers and friends, especially Scott Cullen, who gave me another connection back...-ATP was replaced by alpha- 32p-CTP. PCR radioincorporation reactions included the following: 1. 5 ul of DNA, 6. 5 ul of HsO, 1. 0 ul of both 0. 5mM dNTP and 10x PCR buffer, 0. 4 ul of both forward and reverse 10uM primers, and 0. 1 ul of both Taq polymerase...

  15. In vitro regulation of porcine Leydig cell steroidogenesis by insulin-like growth factor I (IGF-I) and the phorbol ester 12-myristate-13- acetate (PMA)

    E-Print Network [OSTI]

    French, Joseph Thomas

    1988-01-01T23:59:59.000Z

    LH-stimulated T, Pe and E production. Forskolin (100 uM) stimulated (P c . 05) T and Pe production and this effect was augmented by IGF-I (25 ng/ml). Co-treatment with IGF-I (25 ng/ml) also enhanced dibutyryl cyclic AMP f(Bu)2cAMP]-stimulated T and Pe... Chair of Advisory Committee: Dr. Thomas H. Welsh, Jr. The effects of IGF-I and PMA on gonadotropin-stimulated Leydig cell production of pregnenolone (Pe), testosterone (T) and estradiol (E) were examined using primary cultures of neonatal porcine...

  16. A review of "Religious Politics in Post-Reformation England: Essays in Honour of Nicholas Tyacke" edited by K. Fincham and P. Lake

    E-Print Network [OSTI]

    Stanwood, Paul

    2008-01-01T23:59:59.000Z

    . Kenneth Fincham and Peter Lake, eds. Religious Politics in Post- Reformation England: Essays in Honour of Nicholas Tyacke. Woodbridge, Suffolk: Boydell Press, 2006. xiv + 254 pp. + 1 illus. $85.00. Review by P. G. st a n w o o d , Un i v e r s i t y o... f Br i t i s h Co l U m B i a . Nicholas Tyacke is well known to literary and church historians? and to all students of early modern England?for his highly influential Anti-Calvinists: The Rise of English Arminianism c.1590-1640 (Oxford...

  17. The Effect of Energy Prices on Operation and Investment in OECD Countries: Evidence from the Vintage Capital Model

    E-Print Network [OSTI]

    Steinbuks, J; Meshreky, A; Neuhoff, Karsten

    www.electricitypolicy.org.uk E P R G W O R K IN G P A P E R N O N -T E C H N IC A L S U M M A R Y The Effect of Energy Prices on Operation and Investment in OECD Countries: Evidence from the Vintage Capital Model EPRG Working Paper... 0922 Cambridge Working Paper in Economics 0933 Jevgenijs Steinbuks, Andreia Meshreky, and Karsten Neuhoff Empirical analysis of the effect of energy prices on energy use has been so far limited by the ability of econometric models to reflect...

  18. Turbercidin metabolism in Neurospora crassa

    E-Print Network [OSTI]

    Lyda, Timothy Stuart

    1982-01-01T23:59:59.000Z

    of 14C incorporated into the acid-soluble nucleotide pools of germinated pvr-l, tub conidia incubated with 10 nM [8- 4C] adenosine, 2 pCi/uMol for 20 min 22 g d l g N d~p md' ppl mented with tubercidin (to 100 uM) Anion-exchange elution profile... f ~N d' ppl d with tubercidin (to 100 nial) . Top row (left to right) Ryr-l, tubR ungerminated conidia, conidia germinated 60 min, conidia germinated 4 h. Bottom row (left to right) wild type ungerminated conidia, conidia germinated 60 min...

  19. Effect of environmental exposure on the stiffness and energy loss properties of nitrile elastomers

    E-Print Network [OSTI]

    Colmenero, Michael Adam

    1994-01-01T23:59:59.000Z

    . Power Sections The design and utilization of power sections has been extensively d o c u m e n t e d . 2 ' 3 ' 4 ' 5 ' 6 , 7 The downhole power sections consist of a metal tube lined with an elastomer compound, stator, and a metal rotor. Figure 2... furnace CO .E o ~^ V) CD > CO CO 0) Q_ o o u _D _Q C O _Q L_ O (J o CO CD Q_ CO c 0) c E CD U L_ 0 c cr 1 in Table VI Compression Modulus for Three Types of Carbon Black Compound Compression modulus (MPa) M - 3 a 7.1 M...

  20. Deformation Expression for Elements of Algebras (VI) --Vacuum representation of Heisenberg algebra--

    E-Print Network [OSTI]

    Hideki Omori; Yoshiaki Maeda; Naoya Miyazaki; Akira Yoshioka

    2012-04-25T23:59:59.000Z

    The Weyl algebra (W_{2m}[h]; *) is the algebra generated by u=(u_1,...,u_m,v_1,.....,v_m) over C with the fundamental commutation relation [u_i,v_j]=-ih\\delta_{ij}, where h is a positive constant. The Heisenberg algebra (\\Cal H_{2m}[nu];*) is the algebra given by regarding the scalar parameter h in the Weyl algebra W_{2m}[h] to be a generator nu which commutes with all others.

  1. Carbon Markets and Technological Innovation

    E-Print Network [OSTI]

    Weber, T A; Neuhoff, Karsten

    www.eprg.group.cam.ac.uk E P R G W O R K IN G P A P E R N O N -T E C H N IC A L S U M M A R Y Carbon Markets and Technological Innovation EPRG Working Paper 0917 Cambridge Working Paper in Economics 0932 Thomas A. Weber... and Karsten Neuhoff This paper examines how considering firm-level innovation in carbon-abatement technologies influences the optimal design choice for carbon pricing. It builds on Weitzman’s model (1974) that shows in what instances cap and trade...

  2. Does Electricity (and Heat) Network Regulation have anything to learn from Fixed Line Telecoms?

    E-Print Network [OSTI]

    Pollitt, Michael G.

     to electricity, between 2003 and 2008 the percentage of households in Christchurch,  New Zealand, heating via heat pumps has increased from 8% to 35%, with the figure projected to 70% by  2015?18 (Orion, 2008, p.6).  4 The UK history of telecoms reform... www.electricitypolicy.org.uk E P R G W O R K IN G P A P E R N O N -T E C H N IC A L S U M M A R Y Does Electricity (and Heat) Network Regulation have anything to learn from Fixed Line Telecoms Regulation? EPRG Working Paper 0914...

  3. Polymeric Microparticles as a Generic Platform for Vaccine Delivery

    E-Print Network [OSTI]

    Merkle, Hans P.

    2006-10-26T23:59:59.000Z

    by pseudopods, Pp by sinking into cells Pp Pp Pp L Thiele et al. JCR 76:149-68 (2001) 3 Fusion of lysosomes with phagocytosed PLGA microspheres in macrophages 4 h 24 h Lysosomes: FITC-dextran PLGA microspheres: rhodamine 48 h 10 ?m E Walter et al. 2000 Antigen... alone Y Waeckerle-Men et al. Vaccine 24:1847-1857 (2006) Encapsulation of tetanus toxoid (TT) in PLGA microspheres to prolong antigen presentation to CD4+ T cells by human MoDC 0 100 200 300 IF N - ? ( pg/ ml ) S o l . F l u M 5 0 ? g / m l MS...

  4. Dynamics of the UK Natural Gas Industry: System Dynamics Modelling and Long-Term Energy Policy Analysis

    E-Print Network [OSTI]

    Chi, K C; Reiner, David; Nuttall, William J

    www.eprg.group.cam.ac.uk E P R G W O R K IN G P A P E R N O N -T E C H N IC A L S U M M A R Y DYNAMICS OF THE UK NATURAL GAS INDUSTRY: SYSTEM DYNAMICS MODELLING AND LONG-TERM ENERGY POLICY ANALYSIS EPRG Working Paper 0913... Cambridge Working Paper in Economics 0922 Kong Chyong Chi , David M. Reiner and William J. Nuttall The UK offshore natural gas and oil industry has a long and successful history and has been said to represent the pride of UK...

  5. Subjects: Trematoda And Trematode Diseases, Part 4: Supergenera and Genera E-G

    E-Print Network [OSTI]

    Doss, Mildred A.; Roach, Katharine F.; Breen, Virginia L.

    1965-01-01T23:59:59.000Z

    .--Yamaguti, S. , 1958a, 642-643 (in- cludes M i ? ? ? p ? ? ? p h i u m, Patagifer, Episthmium, Echinochasmus, Stephano- prora, Monilifer). ?Yamashita, J. , 1938f, 875,876,877. (ECHINOCHASMUS) Bashkirova, E. L, 1941b, 256, 258(subg. of Echinochasmus.... cochensi Skrjabin, ?. I. ; & Bashkirova, E . ?. , 1956a, 602(for cohensi Rao, 1951). cohensi Krishna Rao.M.S., 1951b, 215-216, figs. l-3(Larus argentatus; i ? t e s t i ? e; Canada). --Leonov, V. ?. , 1956a, 74. colymbi Oshmarin, P. G. , 1950b, 166...

  6. Lithospermic acid B protects beta-cells from cytokine-induced apoptosis by alleviating apoptotic pathways and activating anti-apoptotic pathways of Nrf2-HO-1 and Sirt1

    SciTech Connect (OSTI)

    Lee, Byung-Wan; Chun, Sung Wan; Kim, Soo Hyun; Lee, Yongho; Kang, Eun Seok; Cha, Bong-Soo; Lee, Hyun Chul, E-mail: endohclee@yuhs.ac

    2011-04-01T23:59:59.000Z

    Lithospermic acid B (LAB) has been reported to protect OLETF rats, an established type 2 diabetic animal model, from the development of diabetes-related vascular complications. We investigated whether magnesium lithospermate B (LAB) has a protective role under cytokine-induced apoptosis in INS-1 cells in vitro and whether it slows the development of diabetes in OLETF rats in vivo. Pretreatment with 50 {mu}M LAB significantly reduced the 1000 U/mL INF-{gamma} and 100 U/mL IL-1{beta}-induced INS-1 cell death. LAB significantly alleviated cytokine-induced phosphorylations of p38 and JNK in accordance with a decrease in cleaved caspase-3 activity in beta-cells. LAB also protected against the cytokine-induced caspase-3 apoptotic pathway via significant activation of Nrf2-HO (heme-oxigenase)-1 and Sirt1 expression. OLETF rats treated with 40 mg/kg/day LAB showed a significant improvement in glucose tolerance compared to untreated OLETF control rats in vivo. Our results suggest that the cytoprotective effects of LAB on pancreatic {beta}-cells are related with both alleviating apoptotic pathways and activating anti-apoptotic pathways of Nrf2-HO-1 and Sirt1.

  7. Characterizing guayule rubber transferase activity

    SciTech Connect (OSTI)

    Cornish, K.; Backhaus, R.A. (Arizona State Univ., Tempe (USA))

    1989-04-01T23:59:59.000Z

    Rubber transferase (RuT) activity, measured as incorporation of {sup 14}C(isopentenyl pyrophosphate) (IPP) into rubber, was assayed in suspensions of rubber particles purified from bark tissue of Parthenium argentatum, Gray. Rubber particle suspensions (RSP) have high RuT activity which is not diminished by repeated washing of the particles, demonstrating the firm association of the enzyme system with the particles. RuT activity varied with line: 11591 yielded more rubber particles with a greater activity per particle, than did other lines tested. Variation in activity also varied with bark age and season. Activity rapidly declined at temperatures above 16{degree}C in line 593, but was more stable in RSP isolated form line 11591. IPP-incorporation depends upon the concentration of two substrates, IPP and the starter molecule farnesyl pyrophosphate (FPP). In lines 593 and 11591, 20 uM FPP saturated the enzyme present in 6 {times} 10{sup 10} particles {times} cm{sup {minus}3}, whereas about 1 mM IPP was required for saturation. Under saturating FPP, the apparent K{sub m} of RuT was about 250 uM.

  8. Internship experience at Texas Instruments: the internship report 

    E-Print Network [OSTI]

    Glover, Kerry Cloyce, 1954-

    2013-03-13T23:59:59.000Z

    T E X A S I N S T R U M E N T S T h e I n t e r n s h i p R e p o r t by K E R R Y C L O Y C E G L O V E R S u b m i t t e d to the C o l l e g e of E n g i n e e r i n g of T e x a s A & M U n i v e r s i t y i n p a r t i a l f... u l f i l l m e n t for the d e g r e e of D O C T O R OF E N G I N E E R I N G M a y 1982 M a j o r S u b j e c t : E l e c t r i c a l E n g i n e e r i n g T E X A S I N S T R U M E N T S The, I n t e r n s h i p R e p o r t by K E...

  9. Studies in petroleum geology; reprints, 1935-1955 

    E-Print Network [OSTI]

    Halbouty, Michel Thomas

    1956-01-01T23:59:59.000Z

    "I ^S0> Hi ^ #1 F A C T O R S A F F E C T I N G Q U A N T I T Y O F OIL A C C U M U L A T I O N A R O U N D SOME T E X A S G U L F C O A S T P I E R C E M E N T - T Y P E S A L T DOMES B Y M I C H E L T . H A L B O U T Y A N D G E O R G E C. H... A R D I N , JR . Reprinted for private circulation from T H E B U L L E T I N OF T H E A M E R I C A N A S S O C I A T I O N OF P E T R O L E U M GEOLOGISTS Vo l . 39, No . 5, M a y , 1955 LIBRARY A & M COLLEGE OF TEXAS B U L L E T I N O F T H...

  10. Population genetic structure of Conophthorus ponderosae Hopkins (Coleoptera: Scolytidae) inferred from mitochondrial DNA haplotypes

    E-Print Network [OSTI]

    Menard, Katrina Louise

    2006-10-30T23:59:59.000Z

    1 AP PENDIX A Ha p l e t t e r L oc al i t y E S C S p e c i e s 20 0- 30 0k m > 90 0k m H o s t S u bs pe c i e s S ubge ne r a S e c t i o n AD U t ah : D a gg et C o . A s h l e y N F 1 H C . po nd er o s a e JV P . po nd er o s a s c o p u... l o r u m P i n us P o n d e r os ae AD U t ah : D a gg et C o . A s h l e y N F 1 H C . po nd er o s a e JV P . po nd er o s a s c o p u l o r u m P i n us P o n d e r os ae AD U t ah : D a gg et C o . A s h l e y N F 1 H C . po nd er o s a...

  11. Internship experience at Texas Instruments: the internship report

    E-Print Network [OSTI]

    Glover, Kerry Cloyce, 1954-

    2013-03-13T23:59:59.000Z

    T E X A S I N S T R U M E N T S T h e I n t e r n s h i p R e p o r t by K E R R Y C L O Y C E G L O V E R S u b m i t t e d to the C o l l e g e of E n g i n e e r i n g of T e x a s A & M U n i v e r s i t y i n p a r t i a l f... R e p . ) M A Y 1982 A B S T R A C T I n t e r n s h i p E x p e r i e n c e w i t h T e x a s I n s t r u m e n t s K e r r y C l o y c e G l o v e r , B.S., T e x a s A & M U n i v e r s i t y M . S . , T e x a s A & M U n i v e...

  12. RADIOISOTOPE IDENTIFICATION OF SHIELDED AND MASKED SNM RDD MATERIALS

    SciTech Connect (OSTI)

    Salaymeh, S.; Jeffcoat, R.

    2010-06-17T23:59:59.000Z

    Sonar and speech techniques have been investigated to improve functionality and enable handheld and other man-portable, mobile, and portal systems to positively detect and identify illicit nuclear materials, with minimal data and with minimal false positives and false negatives. RadSonar isotope detection and identification is an algorithm development project funded by NA-22 and employing the resources of Savannah River National Laboratory and three University Laboratories (JHU-APL, UT-ARL, and UW-APL). Algorithms have been developed that improve the probability of detection and decrease the number of false positives and negatives. Two algorithms have been developed and tested. The first algorithm uses support vector machine (SVM) classifiers to determine the most prevalent nuclide(s) in a spectrum. It then uses a constrained weighted least squares fit to estimate and remove the contribution of these nuclide(s) to the spectrum, iterating classification and fitting until there is nothing of significance left. If any Special Nuclear Materials (SNMs) were detected in this process, a second tier of more stringent classifiers are used to make the final SNM alert decision. The second algorithm is looking at identifying existing feature sets that would be relevant in the radioisotope identification context. The underlying philosophy here is to identify parallels between the physics and/or the structures present in the data for the two applications (speech analysis and gamma spectroscopy). The expectation is that similar approaches may work in both cases. The mel-frequency cepstral representation of spectra is widely used in speech, particularly for two reasons: approximation of the response of the human ear, and simplicity of channel effect separation (in this context, a 'channel' is a method of signal transport that affects the signal, examples being vocal tract shape, room echoes, and microphone response). Measured and simulated gamma-ray spectra from a hand-held Radioisotope Identification Device were used to evaluate the algorithms. This paper will present and discuss results of the Test and Evaluation performed on two algorithms produced from the project.

  13. PROBING THE LOW-REDSHIFT STAR FORMATION RATE AS A FUNCTION OF METALLICITY THROUGH THE LOCAL ENVIRONMENTS OF TYPE II SUPERNOVAE

    SciTech Connect (OSTI)

    Stoll, R.; Stanek, K. Z.; Pogge, R. W. [Department of Astronomy, Ohio State University, 140 West 18th Avenue, Columbus, OH 43210-1173 (United States); Prieto, J. L. [Department of Astrophysical Sciences, Princeton University, 4 Ivy Lane, Peyton Hall, Princeton, NJ 08544 (United States)

    2013-08-10T23:59:59.000Z

    Type II supernovae (SNe) can be used as a star formation tracer to probe the metallicity distribution of global low-redshift star formation. We present oxygen and iron abundance distributions of Type II SN progenitor regions that avoid many previous sources of bias. Because iron abundance, rather than oxygen abundance, is of key importance for the late stage evolution of the massive stars that are the progenitors of core-collapse supernovae, and because iron enrichment lags oxygen enrichment, we find a general conversion from oxygen abundance to iron abundance. The distributions we present here are the best yet observational standard of comparison for evaluating how different classes of supernovae depend on progenitor metallicity. We spectroscopically measure the gas-phase oxygen abundance near a representative subsample of the hosts of Type II SNe from the first-year Palomar Transient Factory (PTF) SN search, using a combination of Sloan Digital Sky Survey (SDSS) spectra near the SN location (9 hosts) and new longslit spectroscopy (25 hosts). The median metallicity of these 34 hosts at or near the SN location is 12+log(O/H) = 8.65, with a median error of 0.09. The median host galaxy stellar mass from fits to SDSS photometry is 10{sup 9.9} M{sub Sun }. They do not show a systematic offset in metallicity or mass from a redshift-matched sample of the MPA/JHU value-added catalog. In contrast to previous SN host metallicity studies, this sample is drawn from a single survey. It is also drawn from an areal rather than a targeted survey, so SNe in the lowest-mass galaxies are not systematically excluded. Indeed, the PTF SN search has a slight bias toward following up transients in low mass galaxies. The progenitor region metallicity distribution we find is statistically indistinguishable from the metallicity distribution of Type II SN hosts found by targeted surveys and by samples from multiple surveys with different selection functions. Using the relationship between iron and oxygen abundances found for Milky Way disk, bulge, and halo stars, we translate our distribution of Type II SN environments as a function of oxygen abundance into an estimate of the iron abundance, since iron varies more steeply than oxygen. We find that though this sample spans only 0.65 dex in oxygen abundance, the gap between the iron and oxygen abundance is 50% wider at the low-metallicity end of our sample than at the high-metallicity end.

  14. Final Progress Report submitted via the DOE Energy Link (E-Link) in June 2009 [Collaborative Research: Decadal-to-Centennial Climate & Climate Change Studies with Enhanced Variable and Uniform Resolution GCMs Using Advanced Numerical Techniques

    SciTech Connect (OSTI)

    Fox-Rabinovitz, M; Cote, J

    2009-10-09T23:59:59.000Z

    The joint U.S-Canadian project has been devoted to: (a) decadal climate studies using developed state-of-the-art GCMs (General Circulation Models) with enhanced variable and uniform resolution; (b) development and implementation of advanced numerical techniques; (c) research in parallel computing and associated numerical methods; (d) atmospheric chemistry experiments related to climate issues; (e) validation of regional climate modeling strategies for nested- and stretched-grid models. The variable-resolution stretched-grid (SG) GCMs produce accurate and cost-efficient regional climate simulations with mesoscale resolution. The advantage of the stretched grid approach is that it allows us to preserve the high quality of both global and regional circulations while providing consistent interactions between global and regional scales and phenomena. The major accomplishment for the project has been the successful international SGMIP-1 and SGMIP-2 (Stretched-Grid Model Intercomparison Project, phase-1 and phase-2) based on this research developments and activities. The SGMIP provides unique high-resolution regional and global multi-model ensembles beneficial for regional climate modeling and broader modeling community. The U.S SGMIP simulations have been produced using SciDAC ORNL supercomputers. The results of the successful SGMIP multi-model ensemble simulations of the U.S. climate are available at the SGMIP web site (http://essic.umd.edu/~foxrab/sgmip.html) and through the link to the WMO/WCRP/WGNE web site: http://collaboration.cmc.ec.gc.ca/science/wgne. Collaborations with other international participants M. Deque (Meteo-France) and J. McGregor (CSIRO, Australia) and their centers and groups have been beneficial for the strong joint effort, especially for the SGMIP activities. The WMO/WCRP/WGNE endorsed the SGMIP activities in 2004-2008. This project reflects a trend in the modeling and broader communities to move towards regional and sub-regional assessments and applications important for the U.S. and Canadian public, business and policy decision makers, as well as for international collaborations on regional, and especially climate related issues.

  15. Effects of variations in rate of temperature rise, curing temperature and size of specimen on selected physical properties of concrete made with type I cement and steam cured at atmospheric pressure

    E-Print Network [OSTI]

    Olivieri-Cintron, Elmer

    1958-01-01T23:59:59.000Z

    Rate of Temperature Rise o Moist Cured a 40 oP/hr 60 F/hr ~ 80 oF/hr 0 oP/hr 1000 0 0 FIG. 2 8 12 16 20 24 TIME ? &ags COMPRESSIVE STRENGTH OP PRISMS CURED kT 185oP 28 800 600 W 500 Its 0 400 o Pl '500 Rate of Temperature Rise... 200 0 12 16 TIME - days 20 24 PIG. 4 FLEXURAL STRENGTH OP PRISMS CURED ET 185oP Q EO O I M u M O A o M O EO Rate of Temperature Rise Roist Cured 40 P/bl' 60 oP ~ 80 oP a 120 oF 2 0 Pig. 5 24 12 8 IS TIME - days SONIC RODULUS...

  16. A supermatrix model for N=6 super Chern-Simons-matter theory

    E-Print Network [OSTI]

    Drukker, Nadav

    2009-01-01T23:59:59.000Z

    We construct the Wilson loop operator of N=6 super Chern-Simons-matter which is invariant under half of the supercharges of the theory and is dual to the simplest macroscopic open string in AdS_4 x CP^3. The Wilson loop couples, in addition to the gauge and scalar fields of the theory, also to the fermions in the bi-fundamental representation of the U(N) x U(M) gauge group. These ingredients are naturally combined into a superconnection whose holonomy gives the Wilson loop, which can be defined for any representation of the supergroup U(N|M). Explicit expressions for loops supported along an infinite straight line and along a circle are presented. Using the localization calculation of Kapustin et al. we show that the circular loop is computed by a supermatrix model and discuss the connection to pure Chern-Simons theory with supergroup U(N|M).

  17. A supermatrix model for N=6 super Chern-Simons-matter theory

    E-Print Network [OSTI]

    Nadav Drukker; Diego Trancanelli

    2009-12-16T23:59:59.000Z

    We construct the Wilson loop operator of N=6 super Chern-Simons-matter which is invariant under half of the supercharges of the theory and is dual to the simplest macroscopic open string in AdS_4 x CP^3. The Wilson loop couples, in addition to the gauge and scalar fields of the theory, also to the fermions in the bi-fundamental representation of the U(N) x U(M) gauge group. These ingredients are naturally combined into a superconnection whose holonomy gives the Wilson loop, which can be defined for any representation of the supergroup U(N|M). Explicit expressions for loops supported along an infinite straight line and along a circle are presented. Using the localization calculation of Kapustin et al. we show that the circular loop is computed by a supermatrix model and discuss the connection to pure Chern-Simons theory with supergroup U(N|M).

  18. Simulations of Design Modifications in Military Health Facilities

    E-Print Network [OSTI]

    Kiss, Christopher William

    2012-07-16T23:59:59.000Z

    the military population. Civilian medical 0 1 2 3 4 5 6 7 8 9 10 50+ 40-49 30-39 20-29 1-19 N u m b e r o f Faci litie s Age (years) 6 leadership, such as former Assistant Secretaries of Defense for Health Affairs, Dr. W... --------------------------------------------------------------------------------------------------------------------------------- ENGLISH MULTIPLIED BY GIVES METRIC MULTIPLIED BY GIVES ENGLISH 1 1.000000 1.000000 2 1.000000 1.000000 3 BTU 0.293000 WH 3.412969 BTU 4 BTU/HR 0.293000 WATT 3.412969 BTU/HR 5 BTU/LB-F 4183.830078 J/KG-K 0.000239 BTU/LB-F 6 BTU/HR-SQFT-F 5.678260 W/M2-K 0...

  19. Aquaculture of Uranium in Seawater by a Fabric-Adsorbent Submerged System

    SciTech Connect (OSTI)

    Seko, Noriaki [Japan Atomic Energy Research Institute (Japan); Katakai, Akio [Japan Atomic Energy Research Institute (Japan); Hasegawa, Shin [Japan Atomic Energy Research Institute (Japan); Tamada, Masao [Japan Atomic Energy Research Institute (Japan); Kasai, Noboru [Japan Atomic Energy Research Institute (Japan); Takeda, Hayato [Japan Atomic Energy Research Institute (Japan); Sugo, Takanobu [Japan Atomic Energy Research Institute (Japan); Saito, Kyoichi [Chiba University (Japan)

    2003-11-15T23:59:59.000Z

    The total amount of uranium dissolved in seawater at a uniform concentration of 3 mg U/m{sup 3} in the world's oceans is 4.5 billion tons. An adsorption method using polymeric adsorbents capable of specifically recovering uranium from seawater is reported to be economically feasible. A uranium-specific nonwoven fabric was used as the adsorbent packed in an adsorption cage 16 m{sup 2} in cross-sectional area and 16 cm in height. We submerged three adsorption cages in the Pacific Ocean at a depth of 20 m at 7 km offshore of Japan. The three adsorption cages consisted of stacks of 52 000 sheets of the uranium-specific non-woven fabric with a total mass of 350 kg. The total amount of uranium recovered by the nonwoven fabric was >1 kg in terms of yellow cake during a total submersion time of 240 days in the ocean.

  20. Characterization of Sclerotinia minor populations in Texas

    E-Print Network [OSTI]

    Henry, Merribeth Annette

    2009-06-02T23:59:59.000Z

    F: [HEX] GCTCCTGTATACCATGTCTTG R: GGACTTTCGGACATGATGAT 117-4 AF77924 (TAC) 6 C(TAC)3 F: [HEX] TCAAGTACAGCATTTGC R: TTCCAGTCATTACCTACTAC 6-2 AF377901 (TTTTTC) 2 (TTTTTG)2 (TTTTTC) F: GGGGGAAAGGGATAAAGAAAAG R: CAGACAGGATTATAAGCTTGGTCAC... 20 18 16 14 12 10 8 6 4 2 0 N u m b e r o f I s o l a t e s (c) (d) 6 0 . 0 1 - 6 5 5 5 . 0 1 - 6 0 5 0 . 0 1 - 5 5 5 . 0 1 - 1 0 . 4 5 . 0 1 - 5 0 4 0 . 0 1 - 4 5 3 5 . 0 1 - 4 0 3 0 . 0 1 - 3 5 2 5 . 0 1 - 3 0 2 0 . 0 1 - 2 5 1 5 . 0...

  1. Paraffin deposition in offshore oil production

    E-Print Network [OSTI]

    Elphingstone, Gerald Mason

    1995-01-01T23:59:59.000Z

    *, the dimensionless time-averaged temperature in the pipe wal l , is de fined as rr,w np V* = ^ ? ? (111.30) Jo ? -Lb The j u m p energy balance is applied at r* = 1/Rg to find the remaining bound ary condition: a t r * = -sr kS^nr = kW~^r (IIL31) B*8 dr* dr... Appendix A.2 . ) : dT" d * 2 * ? ? _ H* z dz* L 1 d NPrRxr*~d? 1 + Npr ^ ^ ^ (111.18) wi th in i t i a l and boundary conditions at z* = 0 at r* = 0 at r* = 1 at r * = 1 T* = 1 dr dr* ? m dB*8 _ NL ~dF ~~Nr Ste ks dT k dr" dT dr* (111...

  2. The Power of Space: The Acropolis, the Theatre of Dionysos, and Tragedy in the 5th Century BCE

    E-Print Network [OSTI]

    Bondari, Katrina

    2011-05-19T23:59:59.000Z

    :NRFNAhWHCRLWPD:PWNEFAPRF: WyPFOWLADBNABD:LW BDRFoWPFARuBRAOIW5BAWAC:WyELAW D:NEoFRnP5G:WAEWAC:WBFADPRF: W:O:WAE POWRLWAC:WHC:PAD:WEpWdREFOLELWACPAWD:LALWEFWAC: LEBACWLGEY:WEpWAC:WSNDEYEGRLWriGPA:Wbgh HCRLWLADBNABD:WPF WRALWGENPAREFWEFWAC:WLGEY:WEpWAC:WSNDEYEGRLWYRuB: Wy...:WLPAWEFWAC:WLGEY:WEpWAC:WslPervW FBNG:BLatCRG:WpBFNAREFRFoWPLWYPDAWEpWPWD:GRoREBLWYD:NRFNAhWlPURFoWsBLAWD:P WqPDURFW .PDGLEFvLWnPpEuralmanuimlidpIEu.a LuayudelteEralma Luptiua?iELetuEt?u?mWpEBF WAC: AC:PAD:vLWGENPAREFWRFWAC:WEU:DGPYW5:At::FWAC:WSNDEYEGRLWPF WAC:WdREFOLELWYD:NRFNAW b...

  3. Reducible Poly(amido ethylenimine)s for Nucleic Acid Delivery

    E-Print Network [OSTI]

    Christensen, Lane

    2006-10-26T23:59:59.000Z

    is reduced 1 2 4 8 16 32 64 -50 -25 0 25 50 EDA/CBA DETA/CBA TETA/CBA n = 5 ? SEM w/DTT w/w Z e t a P o t e n t i a l ( m V ) Bioconjugate Chemistry (2006) 17; 1233-1240. 1 2 3 4 5 6 7 8 9 10 11 12 13 14... in fluorescence #1; Due to reducible disulfide bonds? 12 0 50 250 500 1.0?10 07 1.0?10 08 1.0?10 09 1.0?10 10 SS-PAED bPEI mM BSO R L U / m g P r o t e i n Effect on the Presence of GSH Inhibitor DL -Buthionine Sulfoxamine (BSO) ? BSO decreases intracellular GSH...

  4. Auslegung: a journal of philosophy, Volume 19, Number 2 (Summer 1993): Front Matter

    E-Print Network [OSTI]

    . The Journal is intended as a f o r u m for the e x p r e s s i o n of any and all scholar ly philosophical p e r s p e c t i v e s . The editors are primarily interested in publishing the w o r k of n e w P h . D ' s a n d a d v a n c e d s t u d e n t s p... u r s u i n g a P h . D . d e g r e e in Phi losophy . H o w e v e r , all technically c o m p e t e n t p h i l o s o p h i c a l w o r k will be considered. Auslegung opposes all forms of discrimi­ nation on the basis of: race, gender , creed...

  5. A study of geometrical and gravitational effects for miscible displacement phenomena

    E-Print Network [OSTI]

    Fraser, John Wall

    1971-01-01T23:59:59.000Z

    Ul X I( Ih IU I CC 2 V IU lh Dl' UI 4 W Cl I( Ul 0, r 1 x x IA IA m IA OO IA UI Ci WI?I U, r( eC K K lh CL' K UI 0 0 CIU, U M N Cl 0 IA ~ sl II W CC IA Cl M IA CD Ih O 2 1 M 0 I- UJ ?C K ae CC. K Cl % 0, O 0 ~ C... ooaaaaao ax l ~ ~ II II a O a II Il II II U J J IA e ?a ??a ? l J I a??e ?e W e aerw??VIA CL CL ~ ??e X ) & Z ~ OO~? ~%?C?C~ IU CL' Q Z V CI Z O I O I QORVRRXQRZC" O Cl CU CL' K CC CL' CU LI CC Z Q a II O ?e Kl CC Cl Q U, Cl K II K & X II K...

  6. i k i u p 2 e s F y d e l l 2 v k e

    E-Print Network [OSTI]

    2 i k i u p 2 e s F y d e l l 2 v k e h v i s 2 v k e v k e 2 f i l l y 2 g h i n o o k r i n e v i l l e 2 e s F u l i n 2 v k e i s t 2 v k e u m m i t 2 v k e i l k 2 v k e i m t u s t u s D 2 v k e v v 2 v k e u t t l e 2 v k e r y s t k 2 e s F g r e s e n t 2 v k

  7. U N I V E R S I T Y O F R O C H E S T E R , O N E U N I V E R S I T Y --O N E P L A N 2 0 0 8 C A M P U S M A S T E R P L A N

    E-Print Network [OSTI]

    Portman, Douglas

    U N I V E R S I T Y O F R O C H E S T E R , O N E U N I V E R S I T Y -- O N E P L A N 2 0 0 8 C A M P U S M A S T E R P L A N E x e c u t i v e S u m m a r y #12;U N I V E R S I T Y O F R O C H E S T E R , O N E U N I V E R S I T Y -- O N E P L A N Copyright © 2008 AYERS | SAINT | GROSS All Rights

  8. Sta te a n d E v e n ts fo r W e b Se r v ic e s: A C o m p a r iso n o f F iv e W S-R e so u r c e F r a m e w o r k a n d W S-N o tific a tio n

    E-Print Network [OSTI]

    Humphrey, Marty

    Sta te a n d E v e n ts fo r W e b Se r v ic e s: A C o m p a r iso n o f F iv e W S-R e so u r c e F r a m e w o r k a n d W S-N o tific a tio n Im p le m e n ta tio n s M a rty H u m p h re y , G le n n W a sso n D e p a rtm e n t o f C o m p u te r S c ie n c e , U n iv e rsity o f V irg in ia , C

  9. Oceanography Vol.22, No.264 By E r i c P. c h a s s i g N E t, h a r l E y E . h u r l B u rt, E . J o s E Ph M E t zg E r ,

    E-Print Network [OSTI]

    Oceanography Vol.22, No.264 By E r i c P. c h a s s i g N E t, h a r l E y E . h u r l B u rt, E . J o s E Ph M E t zg E r , o l E M a rt i N s M E d sta d, J a M E s a . c u M M i N g s , g E o r g E r . h a l l i w E l l , r a i N E r B l E c k , r E My B a r a i l l E , a l a N J . wa l lc r a f

  10. Reducing Energy Use with 50% ROI through Continuous Commissioning®

    E-Print Network [OSTI]

    Claridge, D.

    2012-01-01T23:59:59.000Z

    8 S ep -0 8 No v- 08 Jan -0 9 M ar -0 9 M ay -0 9 Ju l-0 9 S ep -0 9 C um ul at iv e S av in gs ChW Elect Gas CC? Results ? Austin City Hall Post-CC? $ 112K 17% Energy Savings ROI > 50% Implementation...,000,000 $3,000,000 $4,000,000 $5,000,000 $6,000,000 $7,000,000 Sep-07 Jan-08 May-08 Sep-08 Jan-09 May-09 Sep-09 Jan-10 May-10 Sep-10 Jan-11 May-11 Sep-11 Jan-12 May-12 C u m u la ti ve S av in g s ( $) Electricity Chilled Water Hot...

  11. A technique for obtaining a numerical solution of a system of ordinary differential equations

    E-Print Network [OSTI]

    McAnally, Jon Philip

    1966-01-01T23:59:59.000Z

    ) gives 5 6 R (x + nh)dn = ? [513f (E ) ? 38f (E )] (2 ~ 7) h (5) ? (5) 1440 0 se 0 & xl Jog 'naggy?m aq ueo eynuuog aoua?ayppp agZu?g p?em?oj s, uopmag 'Ul . . . z ( = 5 [ ??]3 '~ [ ?? pue Z't=?' [( &) s ~ ~ ( &) ?( &) s] = (3)8 (9) (9) (9) pue... ( q 0 ] 3 q $T 9eqa unoqs seq ( [ I ] ) I Jg xua'H SSZOOZd HO1OBHHOO ZH1 d0 ZDNBOHHhNOO III 'd 3 1 d V H 0 [( ~X x)dS6 + ( L' x)d0S - ( A' x)d009 + x)dOSC - ( X' x)dSZ&] ? + X ~ gsqq suaam sy~ ~C . T+? T+u (' mTT 1eqa szoTTod sd ' + g ? + d aq...

  12. New Catalytic DNA Biosensors for Radionuclides and Metal ions

    SciTech Connect (OSTI)

    Lu, Yi

    2005-06-01T23:59:59.000Z

    In vitro selection for DNAzymes that are catalytically active with UO22+ ions as the metal cofactor has been completed. The 10th generation pool of DNA was cloned and sequenced. A total of 84 clones were sequenced and placed into families based on sequence alignments. Selected members of each family were 5-labeled with 32P and amplified using PCR. Activity assays were conducted using the isotopically labeled DNAzymes in order to determine which sequences were the most active. The secondary structures of the two most active sequences, called Clone 13 and Clone 39, were determined using the computer program Mfold. A cleavage rate of approximately 1 min-1 in the presence of 10 uM UO22+ was observed for both clones. Clone 39 was determined to be the best candidate for truncation to create a trans-cleaving DNAzyme, based on its secondary structure. An enzyme strand, called 39E, and a substrate strand, called 39DS, were designed by truncating the cis-cleaving DNAzyme. An alternative enzyme strand, called 39Ec, was also assayed with the 39DS substrate. This strand was designed so that the two binding arms were perfectly complimentary, unlike 39E, which formed three mismatched base pairs with 39DS. Both 39E and 39Ec were found to be active, with a rate of approximately 1 min-1 in the presence of 10 uM UO22+. A preliminary UO22+ binding curve was obtained for the 39Ec/39DS trans-cleaving system. The enzyme is active with UO22+ concentrations as low as 1 nM. Based on the preliminary binding curve data, the apparent UO22+ binding constant is approximately 330 nM, and kmax is approximately 1 min-1.

  13. A disease of swine caused by a chromobacterium species

    E-Print Network [OSTI]

    Sippel, William Lawrence

    1955-01-01T23:59:59.000Z

    ?Pa(y.?h.b.PO< TABLE OF CONTENTS x? pPOTa?mrOpaP O9, 1gs,'s, w'us,1 VS r9Q6M6V'w4, Q?uM ?g6?'w,uM 9's 864 V,,8 1,swQgV,1 JQ,?g6us?S g8 sAg8,? p4 A's w68sg1,Q,1 65 su55gwg'84 gM? J6Q4'8w, 56Q ' 1gss,Q4'4g68 JQ6V?,M 56Q 49, 56??6Ag8C Q,'s68s7 ?'? p4 'JJ,'Qs 's '8...'8gsM JQ61uwg8C V?u,IV?'w? JgCM,84 A's gs6?'4,1 5Q6M 49, sJ?,,8? P6 '8gM'? g86wu?'4g68 6Q Vg6w9,Mgw'? s4u1g,s 'Q, Q,? w6Q1,1 56Q 49gs V'w4,QguM Vu4 g4s V,9'?g6Q '81 'JJ,'Q'8w, g8 49, s46w? wu?4uQ, w6??,w4g68 ?,81 suJJ6Q4 46 49, suJJ6sg4g68 49...

  14. Ocean thermal plantships for production of ammonia as the hydrogen carrier.

    SciTech Connect (OSTI)

    Panchal, C.B.; Pandolfini, P. P.; Kumm, W. H.; Energy Systems; Johns Hopkins Univ.; Arctic Energies, Ltd.

    2009-12-02T23:59:59.000Z

    Conventional petroleum, natural gas, and coal are the primary sources of energy that have underpinned modern civilization. Their continued availability in the projected quantities required and the impacts of emission of greenhouse gases (GHGs) on the environment are issues at the forefront of world concerns. New primary sources of energy are being sought that would significantly reduce the emissions of GHGs. One such primary source that can help supply energy, water, and fertilizer without GHG emissions is available in the heretofore unexploited thermal gradients of the tropical oceans. The world's oceans are the largest natural collector and reservoir of solar energy. The potential of ocean energy is limitless for producing base-load electric power or ammonia as the hydrogen carrier and fresh water from seawater. However, until now, ocean energy has been virtually untapped. The general perception is that ocean thermal energy is limited to tropical countries. Therefore, the full potential of at-sea production of (1) ammonia as a hydrogen carrier and (2) desalinated water has not been adequately evaluated. Using ocean thermal plantships for the at-sea co-production of ammonia as a hydrogen carrier and desalinated water offer potential energy, environmental, and economic benefits that support the development of the technology. The introduction of a new widespread solution to our projected energy supply requires lead times of a decade or more. Although continuation of the ocean thermal program from the 1970s would likely have put us in a mitigating position in the early 2000s, we still have a window of opportunity to dedicate some of our conventional energy sources to the development of this renewable energy by the time new sources would be critically needed. The primary objective of this project is to evaluate the technical and economic viability of ocean thermal plantships for the production of ammonia as the hydrogen carrier. This objective is achieved by completing project tasks that consist of updating the John Hopkins University/Applied Physics Laboratory (JHU/APL) pilot plantship design and extrapolating it to commercial plantships, evaluating a new energy-efficient ammonia synthesis process, evaluating the co-production of desalinated water on plantships, and developing a conceptual design of a satellite plantships system for commercial-scale ammonia production. In addition, an industrial workshop was organized to present the results and develop future goals for commercialization of ocean thermal plantships by 2015. The following goals, arranged in chronological order, were examined at the workshop: (1) Global displacement of petroleum-fuel-based (diesel, fuel oil, naphtha) power generation for freeing up these fuels for transportation, chemical feedstock, and other high-valued uses; (2) At-sea production of desalinated water for regions of critical water shortages; (3) Displacement of carbon-based feed stocks and energy for production of ammonia fertilizers; (4) Development of hydrogen supply to allow economic processing of heavy crude oils and upgrading oil sands; (5) Development of ammonia-fueled distributed energy to displace natural-gas fueled power generation to free up natural gas for higher-value uses and the mitigation of issues associated with imported liquefied natural gas (LNG); and (6) Use of ammonia as a hydrogen carrier for transportation.

  15. Deformation Behavior of Sub-micron and Micron Sized Alumina Particles in Compression.

    SciTech Connect (OSTI)

    Sarobol, Pylin; Chandross, Michael E.; Carroll, Jay; Mook, William; Boyce, Brad; Kotula, Paul G.; McKenzie, Bonnie B.; Bufford, Daniel Charles; Hall, Aaron Christopher.

    2014-09-01T23:59:59.000Z

    The ability to integrate ceramics with other materials has been limited due to high temperature (>800degC) ceramic processing. Recently, researchers demonstrated a novel process , aerosol deposition (AD), to fabricate ceramic films at room temperature (RT). In this process, sub - micro n sized ceramic particles are accelerated by pressurized gas, impacted on the substrate, plastically deformed, and form a dense film under vacuum. This AD process eliminates high temperature processing thereby enabling new coatings and device integration, in which ceramics can be deposited on metals, plastics, and glass. However, k nowledge in fundamental mechanisms for ceramic particle s to deform and form a dense ceramic film is still needed and is essential in advancing this novel RT technology. In this wo rk, a combination of experimentation and atomistic simulation was used to determine the deformation behavior of sub - micron sized ceramic particle s ; this is the first fundamental step needed to explain coating formation in the AD process . High purity, singl e crystal, alpha alumina particles with nominal size s of 0.3 um and 3.0 um were examined. Particle characterization, using transmission electron microscopy (TEM ), showed that the 0.3 u m particles were relatively defect - free single crystals whereas 3.0 u m p articles were highly defective single crystals or particles contained low angle grain boundaries. Sub - micron sized Al 2 O 3 particles exhibited ductile failure in compression. In situ compression experiments showed 0.3um particles deformed plastically, fractured, and became polycrystalline. Moreover, dislocation activit y was observed within the se particles during compression . These sub - micron sized Al 2 O 3 particles exhibited large accum ulated strain (2 - 3 times those of micron - sized particles) before first fracture. I n agreement with the findings from experimentation , a tomistic simulation s of nano - Al 2 O 3 particles showed dislocation slip and significant plastic deformation during compressi on . On the other hand, the micron sized Al 2 O 3 particles exhibited brittle f racture in compression. In situ compression experiments showed 3um Al 2 O 3 particles fractured into pieces without observable plastic deformation in compression. Particle deformation behaviors will be used to inform Al 2 O 3 coating deposition parameters and particle - particle bonding in the consolidated Al 2 O 3 coatings.

  16. Evidence for Multiple Modes of Uranium Immobilization by an Anaerobic Bacterium

    SciTech Connect (OSTI)

    Allison E. Ray; John R. Bargar; Alice C. Dohnalkova; Vaidee Sivaswamy; Yoshiko Fujita; Timothy S. Magnuson

    2011-05-01T23:59:59.000Z

    ABSTRACT Microbial reduction of hexavalent uranium has been studied widely for its potential role in bioremediation and removal of soluble U(VI) from contaminated groundwater. More recently, some microorganisms have been examined for their role in immobilization of U(VI) via precipitation of uranyl phosphate minerals mediated by microbial phosphate release, alleviating the requirement for long-term redox control. Here, we investigated the mechanism of U(VI) removal mediated by an environmental isolate, strain UFO1, that is indigenous to the Field Research Center (FRC) in Oak Ridge, TN and has been detected in U(VI)-contaminated sediments. U(VI) removal was examined in the presence and absence of the electron-shuttling moiety, anthraquinone-2,6-disulfonate (AQDS). Cell suspensions were capable of the near complete removal of 100 uM U(VI) from solution within 48 hours; U(VI) removal was not dependent on the presence of an exogenous electron donor or AQDS, although AQDS increased the rate of U(VI) removal. Profiles of ortho-phosphate concentration over time suggested phosphate liberation from cells. However, X-ray Absorption Near Edge Structure (XANES) spectroscopic measurements indicated that U(IV) was the predominant oxidation state of uranium in cell suspensions in both the absence and presence of 100 uM AQDS. Extended X-ray Absorption Fine Structure spectroscopy (EXAFS) measurements indicated that 20% of the cell-associated precipitates in a U(VI)-treated suspension that lacked AQDS had spectral characteristics consistent with a uranyl phosphate solid phase. EXAFS fits further show that that U(IV) is present dominantly as a monomeric sorbed complex. TEM-EDS confirmed the presence of uranyl phosphate with a U:P ratio consistent with autunite (1:1). These results suggest that strain UFO1 has the ability to mediate U(VI) removal from solution via both reductive and phosphate precipitation mechanisms, and may potentially be useful for the remediation of U-contaminated sediments at the FRC.

  17. FINAL REPORT

    SciTech Connect (OSTI)

    PETER, GARY F. [UNIVERSITY OF FLORIDA] [UNIVERSITY OF FLORIDA

    2014-07-16T23:59:59.000Z

    Excellent progress was made in standardizing three complementary methods: Magnetic resonance imaging, x-ray micro CT, and MALDI imaging linear ion trap mass spectroscopy to image biomass and chemical, anatomical and functional changes that occur during pretreatment and hydrolysis. Magnetic resonance microscopy provides excellent images with as low as 5 uM resolution with hydrated biomass samples. We visualized dramatic changes in signal associated with the hydrolysis of the carbohydrates by strong acids. Quantitative diffusion approaches were used to probe more subtle structural changes in biomass. Diffusion tensor calculations reflect diffusion anisotropy and fractional anisotropy maps clearly show the longer range diffusion within the vessels compared to within the fiber cells. The diffusion is increased along the cell walls of the vessels. Suggesting that further research with NMR imaging should be pursued. X-ray CT provides excellent images at as low as 3.5 uM resolution from dried biomass. Small increases in surface area, and decreases in local density have been quantified in with wood after mild pretreatments; these changes are expected to be underestimates of the hydrated wood, due to the ~12% shrinkage that occurs upon drying untreated wood. MALDI-MS spectra show high ion intensities at most mass to charge ratios in untreated and pretreated woody material. MALDI-MSn is required to improve specificity and reduce background for imaging. MALDI-TOF is not specific enough for carbohydrate identification. Using MALDI-LIT/MSn we can readily identify oligomeric glucans and xylans and their fragmentation patterns as well as those of the glucuronic acid side chains of birch 4-O-methyl glucuronxylan. Imaging of glucan and xylan oligomers show that many contain isobaric ions with different distributions, indicating again that MSn is needed for accurate imaging of lignocellulosic materials. We are now starting to integrate the three imaging methods by using the same set of biomass samples imaged with all three methods, and using common analytical software to quantify parameters from the three dimensional images. In addition to the proposed experiments, we conducted imaging studies with a novel TOF-SIMS instrument available through collaborations with the AMOLF goup led by Ron Heeren at the FOM Institute in Amersterdam, Netherlands. ToF-SIMS was used to image intact cross sections of Populus stems with high spatial resolution, chemically selectivity. ToF-SIMS images were correlated with fluorescence microscopy which allowed for more positive ion identification.

  18. Prognostic Significance of Carbohydrate Antigen 19-9 in Unresectable Locally Advanced Pancreatic Cancer Treated With Dose-Escalated Intensity Modulated Radiation Therapy and Concurrent Full-Dose Gemcitabine: Analysis of a Prospective Phase 1/2 Dose Escalation Study

    SciTech Connect (OSTI)

    Vainshtein, Jeffrey M., E-mail: jvainsh@med.umich.edu [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Schipper, Matthew [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States)] [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Zalupski, Mark M. [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States)] [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States); Lawrence, Theodore S. [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States)] [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Abrams, Ross [Department of Radiation Oncology, Rush Medical Center, Chicago, Illinois (United States)] [Department of Radiation Oncology, Rush Medical Center, Chicago, Illinois (United States); Francis, Isaac R. [Department of Radiology, University of Michigan, Ann Arbor, Michigan (United States)] [Department of Radiology, University of Michigan, Ann Arbor, Michigan (United States); Khan, Gazala [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States)] [Division of Hematology Oncology, Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan (United States); Leslie, William [Division of Hematology Oncology, Department of Internal Medicine, Rush Medical Center, Chicago, Illinois (United States)] [Division of Hematology Oncology, Department of Internal Medicine, Rush Medical Center, Chicago, Illinois (United States); Ben-Josef, Edgar [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States)] [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States)

    2013-05-01T23:59:59.000Z

    Purpose: Although established in the postresection setting, the prognostic value of carbohydrate antigen 19-9 (CA19-9) in unresectable locally advanced pancreatic cancer (LAPC) is less clear. We examined the prognostic utility of CA19-9 in patients with unresectable LAPC treated on a prospective trial of intensity modulated radiation therapy (IMRT) dose escalation with concurrent gemcitabine. Methods and Materials: Forty-six patients with unresectable LAPC were treated at the University of Michigan on a phase 1/2 trial of IMRT dose escalation with concurrent gemcitabine. CA19-9 was obtained at baseline and during routine follow-up. Cox models were used to assess the effect of baseline factors on freedom from local progression (FFLP), distant progression (FFDP), progression-free survival (PFS), and overall survival (OS). Stepwise forward regression was used to build multivariate predictive models for each endpoint. Results: Thirty-eight patients were eligible for the present analysis. On univariate analysis, baseline CA19-9 and age predicted OS, CA19-9 at baseline and 3 months predicted PFS, gross tumor volume (GTV) and black race predicted FFLP, and CA19-9 at 3 months predicted FFDP. On stepwise multivariate regression modeling, baseline CA19-9, age, and female sex predicted OS; baseline CA19-9 and female sex predicted both PFS and FFDP; and GTV predicted FFLP. Patients with baseline CA19-9 ?90 U/mL had improved OS (median 23.0 vs 11.1 months, HR 2.88, P<.01) and PFS (14.4 vs 7.0 months, HR 3.61, P=.001). CA19-9 progression over 90 U/mL was prognostic for both OS (HR 3.65, P=.001) and PFS (HR 3.04, P=.001), and it was a stronger predictor of death than either local progression (HR 1.46, P=.42) or distant progression (HR 3.31, P=.004). Conclusions: In patients with unresectable LAPC undergoing definitive chemoradiation therapy, baseline CA19-9 was independently prognostic even after established prognostic factors were controlled for, whereas CA19-9 progression strongly predicted disease progression and death. Future trials should stratify by baseline CA19-9 and incorporate CA19-9 progression as a criterion for progressive disease.

  19. National Geo-Database for Biofuel Simulations and Regional Analysis of Biorefinery Siting Based on Cellulosic Feedstock Grown on Marginal Lands

    SciTech Connect (OSTI)

    Izaurralde, Roberto C.; Zhang, Xuesong; Sahajpal, Ritvik; Manowitz, David H.

    2012-04-01T23:59:59.000Z

    The goal of this project undertaken by GLBRC (Great Lakes Bioenergy Research Center) Area 4 (Sustainability) modelers is to develop a national capability to model feedstock supply, ethanol production, and biogeochemical impacts of cellulosic biofuels. The results of this project contribute to sustainability goals of the GLBRC; i.e. to contribute to developing a sustainable bioenergy economy: one that is profitable to farmers and refiners, acceptable to society, and environmentally sound. A sustainable bioenergy economy will also contribute, in a fundamental way, to meeting national objectives on energy security and climate mitigation. The specific objectives of this study are to: (1) develop a spatially explicit national geodatabase for conducting biofuel simulation studies and (4) locate possible sites for the establishment of cellulosic ethanol biorefineries. To address the first objective, we developed SENGBEM (Spatially Explicit National Geodatabase for Biofuel and Environmental Modeling), a 60-m resolution geodatabase of the conterminous USA containing data on: (1) climate, (2) soils, (3) topography, (4) hydrography, (5) land cover/ land use (LCLU), and (6) ancillary data (e.g., road networks, federal and state lands, national and state parks, etc.). A unique feature of SENGBEM is its 2008-2010 crop rotation data, a crucially important component for simulating productivity and biogeochemical cycles as well as land-use changes associated with biofuel cropping. ARRA support for this project and to the PNNL Joint Global Change Research Institute enabled us to create an advanced computing infrastructure to execute millions of simulations, conduct post-processing calculations, store input and output data, and visualize results. These computing resources included two components installed at the Research Data Center of the University of Maryland. The first resource was 'deltac': an 8-core Linux server, dedicated to county-level and state-level simulations and PostgreSQL database hosting. The second resource was the DOE-JGCRI 'Evergreen' cluster, capable of executing millions of simulations in relatively short periods. ARRA funding also supported a PhD student from UMD who worked on creating the geodatabases and executing some of the simulations in this study. Using a physically based classification of marginal lands, we simulated production of cellulosic feedstocks from perennial mixtures grown on these lands in the US Midwest. Marginal lands in the western states of the US Midwest appear to have significant potential to supply feedstocks to a cellulosic biofuel industry. Similar results were obtained with simulations of N-fertilized perennial mixtures. A detailed spatial analysis allowed for the identification of possible locations for the establishment of 34 cellulosic ethanol biorefineries with an annual production capacity of 5.6 billion gallons. In summary, we have reported on the development of a spatially explicit national geodatabase to conduct biofuel simulation studies and provided simulation results on the potential of perennial cropping systems to serve as feedstocks for the production of cellulosic ethanol. To accomplish this, we have employed sophisticated spatial analysis methods in combination with the process-based biogeochemical model EPIC. The results of this study will be submitted to the USDOE Bioenergy Knowledge Discovery Framework as a way to contribute to the development of a sustainable bioenergy industry. This work provided the opportunity to test the hypothesis that marginal lands can serve as sources of cellulosic feedstocks and thus contribute to avoid potential conflicts between bioenergy and food production systems. This work, we believe, opens the door for further analysis on the characteristics of cellulosic feedstocks as major contributors to the development of a sustainable bioenergy economy.

  20. Signal of Theta^+ in quenched lattice QCD with exact chiral symmetry

    E-Print Network [OSTI]

    Chiu, T W; Chiu, Ting-Wai; Hsieh, Tung-Han

    2005-01-01T23:59:59.000Z

    We investigate the mass spectrum of the pentaquark baryon ($ udud \\bar s $) in quenched lattice QCD with exact chiral symmetry. Using 3 different interpolating operators, we measure their $ 3 \\times 3 $ correlation matrix and obtain the eigenvalues $ A^{\\pm} (t) $ with $ \\pm $ parity, for 100 gauge configurations generated with Wilson gauge action at $ \\beta = 6.1 $ on the $ 20^3 \\times 40 $ lattice. For the lowest-lying $ J^P = 1/2^- $ state, its effective mass is almost identical to that of the KN s-wave, while for the lowest-lying $ J^P = 1/2^+ $ state, its effective mass is smaller than that of the KN p-wave, especially for the regime $ m_u < m_s $. By chiral extrapolation (linear in $m_\\pi^2$) to $ m_\\pi = 135 $ MeV, we obatin the masses of the lowest-lying states: $ m(1/2^-) = 1424(57) $ MeV and $ m(1/2^+) = 1562(121) $ MeV, in agreement with the masses of $ m_K + m_N \\simeq 1430 $ MeV and $ \\Theta^+(1540) $ respectively.

  1. Squirrel: A Community-Directed Approach to Investing

    E-Print Network [OSTI]

    Smith, Brian

    2011-12-31T23:59:59.000Z

    Is the Right Strategy. Design Management Review, 18(4), 73-80,101. 8 7. Appendix Sq u i r r e l : ) A ) C o m m u n i t y 1 D i r e c t e d ) A p p r o a c h ) t o ) I n v e s t i n g D e c e m b e r ) 5 , ) ) 2 0 1 1 © ) B r i a n ) M . ) S m i t h D e s i g... i c t , ' c o l d , ' f a c e l e s s ' m e g a c o r p , ' s e c r e 1 v e , ' “ g o o d ' o l ’ ' b o y s , ” ' “ p e o p l e ' a r e ' j u s t ' n u m b e r s , ” ' p e o p l e ' a r e ' p a s s i v e e m p o w e r i n g , ' o p 1 m i s 1 c , ' h...

  2. Student Competition: Demographic trends around Martin Luther King Jr. Streets in United States Cities

    E-Print Network [OSTI]

    Butler, RaeLynn

    2007-11-14T23:59:59.000Z

    t e d S t a t e s , P o r t l a n d , O r e g o n - M L K S TR E E TS R O A D S S o u r c e: U.S . Cen su s B u r ea u 20 00 M a p d e si g n e d b y R a e L yn n Bu t l e r C e ns us E t hni c i t y 2 0 0 0 P e r C a p i t a I n c o m e... su s Bu re a u M a p d e si g n e d b y R a e L yn n Bu t l e r 0 0. 75 1. 50. 37 5 M i les ROADS M L K S T RE E T S ID OR WA CA MT NV UT P o r t l a n d , O R D e m o g r a p h i c s 20151050 P e r C a p i t a I n c o m e 2 8 , 0 0 0...

  3. Council on East Asian Libraries Statistics 1999-2000 For North American Institutions

    E-Print Network [OSTI]

    Doll, Vickie; Simpson, Fung-yin Kuo

    2001-02-01T23:59:59.000Z

    kloa area keea o nla cata j ogel oger zo ad head I 1 am er w eer w eel utorontoca o o s ces o o o & L ogran ograp ab ub L east how n o w hob co nt ank haitas eaitas m ese n ese m em e es es L serv L m te ate ale phol pher ographer arary brary v ch m ib... dur m ul zo n N O N n o m 0 yoa yok n c cco n ce co o cac o an cQ u m es 0 thdraw n 1 m o r K O R m o m 0 0 0 U A U A 0 0 8 0 0 0 0 0 U A Q m ot m ol c 3 0O do sept kept Q W 1 am z JPN 0 0 0 U A U A 0 0 t 2 21 0 1 i- o 0 t U A t 0 111 1 w eer am er w...

  4. The generalized cusp in ABJ(M) N = 6 Super Chern-Simons theories

    E-Print Network [OSTI]

    Griguolo, Luca; Martelloni, Gabriele; Seminara, Domenico

    2012-01-01T23:59:59.000Z

    We construct a generalized cusped Wilson loop operator in N = 6 super Chern-Simons-matter theories which is locally invariant under half of the supercharges. It depends on two parameters and interpolates smoothly between the 1/2 BPS line or circle and a pair of antiparallel lines, representing a natural generalization of the quark-antiquark potential in ABJ(M) theories. For particular choices of the parameters we obtain 1/6 BPS configurations that, mapped on S^2 by a conformal transformation, realize a three-dimensional analogue of the wedge DGRT Wilson loop of N = 4. The cusp couples, in addition to the gauge and scalar fields of the theory, also to the fermions in the bifundamental representation of the U(N)xU(M) gauge group and its expectation value is expressed as the holonomy of a suitable superconnection. We discuss the definition of these observables in terms of traces and the role of the boundary conditions of fermions along the loop. We perform a complete two-loop analysis, obtaining an explicit resu...

  5. The generalized cusp in ABJ(M) N = 6 Super Chern-Simons theories

    E-Print Network [OSTI]

    Luca Griguolo; Daniele Marmiroli; Gabriele Martelloni; Domenico Seminara

    2013-06-20T23:59:59.000Z

    We construct a generalized cusped Wilson loop operator in N = 6 super Chern-Simons-matter theories which is locally invariant under half of the supercharges. It depends on two parameters and interpolates smoothly between the 1/2 BPS line or circle and a pair of antiparallel lines, representing a natural generalization of the quark-antiquark potential in ABJ(M) theories. For particular choices of the parameters we obtain 1/6 BPS configurations that, mapped on S^2 by a conformal transformation, realize a three-dimensional analogue of the wedge DGRT Wilson loop of N = 4. The cusp couples, in addition to the gauge and scalar fields of the theory, also to the fermions in the bifundamental representation of the U(N)xU(M) gauge group and its expectation value is expressed as the holonomy of a suitable superconnection. We discuss the definition of these observables in terms of traces and the role of the boundary conditions of fermions along the loop. We perform a complete two-loop analysis, obtaining an explicit result for the generalized cusp at the second non-trivial order, from which we read off the interaction potential between heavy 1/2 BPS particles in the ABJ(M) model. Our results open the possibility to explore in the three-dimensional case the connection between localization properties and integrability, recently advocated in D = 4.

  6. Specifications of Futures and Options Contracts

    E-Print Network [OSTI]

    Welch, Mark; Robinson, John; Anderson, David P.

    2009-06-01T23:59:59.000Z

    mechanisms and changes in futures contract specifications. Mark Welch, John Robinson and David P. Anderson* 2 ( c o n t i n u e d o n n e x t p a ge ) T a bl e 1 . C o n t r a c t s p e c i fi c a t i o n s f or a g r i c u l t u r a l c ro p a n d l iv e... s t o ck f u t u r e s . C om m o di t y & s i z e o f c o n t r a c t T i c k e r s y m b o l T r a d i n g h o u r s ( c e n t r a l t i m e ) M o nt h s t ra d e d P r i c e quo t e s M i n i m u m p r i c e fluc t u a t i on D a i l y l i m i...

  7. Up- and down-quark masses from finite-energy QCD sum rules to five loops

    SciTech Connect (OSTI)

    Dominguez, C. A.; Nasrallah, N. F.; Roentsch, R. H.; Schilcher, K. [Centre for Theoretical Physics and Astrophysics, University of Cape Town, Rondebosch 7700 (South Africa) and Department of Physics, Stellenbosch University, Stellenbosch 7600 (South Africa); Faculty of Science, Lebanese University, Tripoli (Lebanon); Centre for Theoretical Physics and Astrophysics, University of Cape Town, Rondebosch 7700 (South Africa); Institut fuer Physik, Johannes Gutenberg-Universitaet, Staudingerweg 7, D-55099 Mainz (Germany)

    2009-01-01T23:59:59.000Z

    The up- and down-quark masses are determined from an optimized QCD finite-energy sum rule involving the correlator of axial-vector divergences, to five-loop order in perturbative QCD, and including leading nonperturbative QCD and higher order quark-mass corrections. This finite-energy sum rule is designed to reduce considerably the systematic uncertainties arising from the (unmeasured) hadronic resonance sector, which in this framework contributes less than 3-4% to the quark mass. This is achieved by introducing an integration kernel in the form of a second degree polynomial, restricted to vanish at the peak of the two lowest lying resonances. The driving hadronic contribution is then the pion pole, with parameters well known from experiment. The determination is done in the framework of contour improved perturbation theory, which exhibits a very good convergence, leading to a remarkably stable result in the unusually wide window s{sub 0}=1.0-4.0 GeV{sup 2}, where s{sub 0} is the radius of the integration contour in the complex energy (squared) plane. The results are m{sub u}(Q=2 GeV)=2.9{+-}0.2 MeV, m{sub d}(Q=2 GeV)=5.3{+-}0.4 MeV, and (m{sub u}+m{sub d})/2=4.1{+-}0.2 MeV (at a scale Q=2 GeV)

  8. Hollow cylinder dynamic pressurization and radial flow through permeability tests for cementitous materials

    E-Print Network [OSTI]

    Jones, Christopher Andrew

    2009-05-15T23:59:59.000Z

    depending on the age and relative strength of the specimen. Since the specimen was sealed at both ends, the fluid would flow T es ti n g Fl u i d ( W a ter etc .) Hy d r a u l i c o i l L V D T c o i l E l ec tr i c - h y d r a u l i c p u m p Ho l... is representative of a typical driveway or sidewalk mix. C e m e n t T y p e I / I I 334 k g / m 3 564 l b s / y d 3 W a t e r 200 k g / m 3 338 l b s / y d 3 C oa r s e A g g r e g a t e ( 9 . 5 m m m a x ) 1232 k g / m 3 2079 l b s / y d 3 F i n e A g g r...

  9. The vertical distribution of meiofauna in sandy sediment: the influence of macrofauna-induced changes in sediment oxygen and sulfide gradients

    E-Print Network [OSTI]

    Meyers, Mark Bennett

    1985-01-01T23:59:59.000Z

    . And to the many f r iends and men to rs w h o have lent their suppo r t for th is thes is and my educa t i on . vii T A B L E OF C O N T E N T S Page A B S T R A C T iii D E D I C A T I O N v A C K N O W L E D G E M E N T S vi T A B L E O F C O N T E N.... Repo r ted as n u m b e r s per 10 g sed imen t , * = less than 1 per 10 g 26 ix L IST OF F I G U R E S F IGURE Page 1 T ips of the m ic roe lec t rodes used in the exper imen ts 11 2 Cal ibrat ion of the sul f ide m ic roe lec t rode over the typ...

  10. Council on East Asian Libraries Statistics 2006-2007 For North American Institutions

    E-Print Network [OSTI]

    Doll, Vickie; Hsu, Calvin; Simpson, Fung-yin Kuo

    2008-02-01T23:59:59.000Z

    ://www.arl.org/bm~doc/07ssurvey_final.pdf> Holdings of East Asian Materials of North American Institutions as of June 30, T o t a l Vol u m e s in Lib r a r y I n s t i t u t io n s JP N K OR N- CJ K TOTA LCHN JPN K OR N-CJ K TOTALCHN J PN KOR N-CJK TO TA LCHN JPN K OR N... 12865 210 0 1 7 5 5 0 16 , 720 B ri g h a m Youn g 5 0 042 15088 8 19 9 0 73 , 329 2089 3 33 453 0 2,875 0 0 0 0 0 208 9 3 3 3 453 0 2,875 52131 1 5421 8652 0 76,204 Britis h Columb i a 295242 148352 24913 761 6 3 544,07 0 4811 4797 455 0 1 0 , 0 6 3 0 0...

  11. Diffusive Release of Uranium from Contaminated Sediments into Capillary Fringe Pore Water

    SciTech Connect (OSTI)

    Rod, Kenton A.; Wellman, Dawn M.; Flury, Markus; Pierce, Eric M.; Harsh, James B.

    2012-09-13T23:59:59.000Z

    We investigated the dynamics of U release between pore water fractions, during river stage changes from two contaminated capillary fringe sediments. Samples were from 7.0 m and 7.6 m below ground surface (bgs) in the Hanford 300 area. Sediments were packed into columns and saturated with Hanford groundwater for three to 84 days. After specified times, > 48 µm radius (calculated) sediment pores were drained, followed by draining pores to 15 µm radius. U release in the first two weeks was similar between sediments and pore sizes with a range of 4.4 to 5.6 µM U in the 14 day sample. The 7.0 m bgs sediment U declined in the larger pores to 0.22 µM at day 84, whereas the small pores released U to 6.7 µM at day 84. The 7.6 m bgs sediment released 1.4 µM on day 84, in the large pores, but continuously released U from the smaller pores (13.2 uM on day 84). The continuous release of U has resulted in a diffusion gradient from the smaller to larger pores. The observed differences in U pore-water concentrations between the two sediment samples were attributed to co-precipitation of U with carbonates. A mineral phase in the sediments was also identified as an U-carbonate species, similar to rutherfordine [UO2(CO3)].

  12. Inverse sensitivity analysis of SISO and MIMO systems using Maletinsky's spline-type modulation function method

    E-Print Network [OSTI]

    Smith, Cherri Imelda

    1987-01-01T23:59:59.000Z

    Method section. Rewritting equation (3-17) to include all k modulations yields x=[ Z, U ] (b) (3-1 8) where 17 M(x, ttt)?. , M(x, 6)k 2 M(x, 8)k, M(x, v)x, . . . M(x v) M(x, @)k 2 M(x, e)k 2 . . M(x "", @)k 2 Recall from equation (3-7) M (x ', g)z... ? (-1)' M(x, e ' )x Thus, U, X and Z may be written as M(u, e )k i -M(u, v )x i . . . (-1) uM(u, v ') M(u, a' ')?2 -M(u, 8 ')k e . . . (-1) "M(u, e' ") (3- I 9a) M(x, @)k M(x, e)k e (3-1 9b) 18 -M(x, g )k t M(x, e )k t . . . ( 1) M(x, ttf x ) -M(x...

  13. Preliminary LEU fuel cycle analyses for the Belgian BR2 reactor

    SciTech Connect (OSTI)

    Deen, J.R.; Snelgrove, J.L.

    1986-01-01T23:59:59.000Z

    Fuel cycle calculations have been performed with reference HEU fuel and LEU fuel using Cd wires or boron as burnable absorbers. The /sup 235/U content in the LEU element has increased 20% to 480g compared to the reference HEU element. The number of fuel plates has remained unchanged while the fuel meat thickness has increased to 0.76 mm from 0.51 mm. The LEU meat density is 5.1 Mg U/m/sup 3/. The reference fuel cycle was a 31 element core operating at 56 MW with a 19.8 day cycle length and eight fresh elements loaded per cycle. Comparable fuel cycle characteristics can be achieved using the proposed LEU fuel element with either Cd wires or boron burnable absorbers. The neutron flux for E/sub n/ > 1 eV changes very little (<5%) in LEU relative to HEU cores. Thermal flux reductions are 5 to 10% in non-fueled positions, and 20 to 30% in fuel elements.

  14. Specifications of Futures and Options Contracts 

    E-Print Network [OSTI]

    Welch, Mark; Robinson, John; Anderson, David P.

    2009-06-01T23:59:59.000Z

    mechanisms and changes in futures contract specifications. Mark Welch, John Robinson and David P. Anderson* 2 ( c o n t i n u e d o n n e x t p a ge ) T a bl e 1 . C o n t r a c t s p e c i fi c a t i o n s f or a g r i c u l t u r a l c ro p a n d l iv e... s t o ck f u t u r e s . C om m o di t y & s i z e o f c o n t r a c t T i c k e r s y m b o l T r a d i n g h o u r s ( c e n t r a l t i m e ) M o nt h s t ra d e d P r i c e quo t e s M i n i m u m p r i c e fluc t u a t i on D a i l y l i m i...

  15. Genetic diversity and combining ability among sorghum conversion lines 

    E-Print Network [OSTI]

    Mateo Moncada, Rafael Arturo

    2007-04-25T23:59:59.000Z

    i ? GEN E T I C? DI V E RSI T Y? AND?COM B I NI NG? AB I L I T Y? AM ONG? SORGH U M? CONVE RSI ON? L I N E S ? A ? D i s s ert a t i o n? by? R AFA E L ? A R T UR O? M A T E O? M ONC A D A? Submi t t ed? to? t h e?O f f i c e?o f ? Graduat e?S t udi... es ? o f ? T ex as ? A& M ? U ni vers i t y? i n ? p art i a l ? f u lf il lm e n t ? o f ? t h e?r equi r e m e n t s ? f o r ? t h e?degr ee ? o f ? DOC T OR ? OF ? PHI L OSOPHY? De ce m ber? 2006? M a j o r ? Subj ec t :? Pl a n t ? B r ee d i n g...

  16. Review and Recommendations of Existing Methods and Tools for Building Energy Analysis: Subtask 2.4 for the Southern Energy Efficiency Center 

    E-Print Network [OSTI]

    Kim, Hyojin; Verdict, Malcolm; Haberl, Jeff S.

    2009-01-01T23:59:59.000Z

    Categories. N i n e C a t e g o ri e s R e c o m m e n d e d U s e N o . o f R e c o m m e n d e d T o o l s A . U t i l i t y Bi l l M o n i t o ri n g / A n a l y s i s T o o l s T o a n a l y z e t h e b i l l i n g o r i n t e rv a l e n e... rg y d a t a 5 , 1 1 , 1 3 , 1 6 , 1 7 , 2 6 , 3 0 , 4 0 , 4 8 , 4 9 , 5 0 , 5 1 , 5 6 . B. Sm a rt M e t e ri n g T o o l s T o t ra c k t h e re a l -t i m e e n e rg y c o n s u m p t i o n d a i l y o r h o u rl y , e i...

  17. High Energy Theory Workshops and Visitors at the Michigan Center for Theoretical Physics FY14

    SciTech Connect (OSTI)

    Pierce, Aaron T. [University of Michigan

    2014-04-01T23:59:59.000Z

    The workshop was held from September 23-25, 2013 on the University of Michigan campus. Local organizers were Dragan Huterer, Katherine Freese, and Heidi Wu (University of Michigan). Marilena Lo Verde (University of Chicago) also served as an external organizer. This workshop sought to gather experimentalists and theorists to discuss and define directions in cosmology research after the 1st year release of Planck data. The workshop included 35 invited (non-U-M) cosmologists, most of them relatively junior. The workshop was notable for spirited discussion of various theoretical ideas and experimental developments, and particularly on how one could test theory with ongoing and future experiments. In our follow-up poll, 95% of participants reported that interactions with other participants at the workshop may lead to further collaboration. Most participants (again about 95%) reported that they are very satisfied with the quality of the program, information they received, and the logistical support. Slides are available on line at: http://www.umich.edu/~mctp/SciPrgPgs/events/2013/CAP13/program.html. The YHET visitor program invited weekly young visitors to the University of Michigan campus to present their work. This year 23 participants came under the program. Slides are available on line for talks when applicable: http://mctp.physics.lsa.umich.edu/brown-bag-seminar-history/winter 2014 and http://mctp.physics.lsa.umich.edu/brown-bag-seminar-history/fall-2013.

  18. TREKisM Issue 54

    E-Print Network [OSTI]

    1987-01-01T23:59:59.000Z

    I N U M M 0 C S L N J K IRK A R o L A VON MEN E Y R ARB I L I H RAE I X V L R E MHO C T POI L E L E C I N A J GSA RNA 0 U 0 P S A E S L U P MIL I S L RNA I L 0 H T P T K MUD 0 A N S W T R N I A T PAC A M M H H L R S A E 0 GAR T H DOE S BRA I N A UNA... Y U TTl C M H R L V ERR P ORE YON S K V K R N T P H H B 0 K COP S SOL I E R F Y D L X A L CAD E T U T B T H U CAR U H U 0 C N lOB 0 lOR 0 NAN FDA L TAU lOB I L NIH 0 S ADD R F G G N M RAE P E Y N T M N Y K S U LAP R I N 0 U A T L 0 0 S U L M H X F...

  19. Wave variability and wave spectra for wind generated gravity waves

    E-Print Network [OSTI]

    Bretschneider, Charles L.

    1959-01-01T23:59:59.000Z

    \\?\\jP\\-P7 cJ)srwJ cJ7 usr)c7(L s{ U)s{7((s) /? 6? /sJy(sy \\yi a)9 h? h9 Urcq s{ cJ7 Cyj?7)(jcL s{ n\\Pj{s)yj\\e m7)?7P7L] a)9 n9 U? m7((7 s{ $J7 n\\Pj{s)yj\\ ns_d\\yLe '7f v)P7\\y(] cJ7 m7\\uJ 0)s(jsy ms\\)ie \\yi scJ7) s{{ju7( s{ cJ7 C9 2? ^)_L ns)d( s{ 0...Jc \\yi f\\?7 d7)jsi (lr\\)7i j( (rww7(c7i9 ?c j( {sryi cJ\\c cJ7 _\\)wjy\\P d)s-\\-jPjcL ij(c)j-rcjsy s{ f\\?7 J7jwJc( {sPPsf( h\\LP7jwJW( ij(c)j-rcjsy uPs(7PL9 $Jj( usyuPr(jsy j( -\\(7i rdsy ob )7us)i( s{ \\-src 100 f\\?7( 7\\uJ dPr( (7?7)\\P 7Sc)\\ Psyw )7us)i( c...

  20. Heavy dense QCD and nuclear matter from an effective lattice theory

    E-Print Network [OSTI]

    Jens Langelage; Mathias Neuman; Owe Philipsen

    2014-03-17T23:59:59.000Z

    A three-dimensional effective lattice theory of Polyakov loops is derived from QCD by expansions in the fundamental character of the gauge action, u, and the hopping parameter, \\kappa, whose action is correct to \\kappa^n u^m with n+m=4. At finite baryon density, the effective theory has a sign problem which meets all criteria to be simulated by complex Langevin as well as by Monte Carlo on small volumes. The theory is valid for the thermodynamics of heavy quarks, where its predictions agree with simulations of full QCD at zero and imaginary chemical potential. In its region of convergence, it is moreover amenable to perturbative calculations in the small effective couplings. In this work we study the challenging cold and dense regime. We find unambiguous evidence for the nuclear liquid gas transition once the baryon chemical potential approaches the baryon mass, and calculate the nuclear equation of state. In particular, we find a negative binding energy per nucleon causing the condensation, whose absolute value decreases exponentially as mesons get heavier. For decreasing meson mass, we observe a first order liquid gas transition with an endpoint at some finite temperature, as well as gap between the onset of isospin and baryon condensation.

  1. Testing Minimal Universal Extra Dimensions Using Higgs Boson Searches at the LHC

    E-Print Network [OSTI]

    Genevieve Belanger; Alexander Belyaev; Matthew Brown; Mitsuru Kakizaki; Alexander Pukhov

    2012-12-13T23:59:59.000Z

    Large Hadron Collider (LHC) searches for the SM Higgs boson provide a powerful limit on models involving Universal Extra Dimensions (UED) where the Higgs production is enhanced. We have evaluated all one-loop diagrams for Higgs production from gluon fusion and decay to two photons within "minimal" UED (mUED), independently confirming previous results, and we have evaluated enhancement factors for Higgs boson production and decay over the mUED parameter space. Using these we have derived limits on the parameter space, combining data from both ATLAS and CMS collaborations for the most recent 7 TeV and 8 TeV LHC data. We have performed a rigorous statistical combination of several Higgs boson search channels which is important because mUED signatures from the Higgs boson are not universally enhanced. We have found that 1/R 1000 GeV) around m_h = 118 GeV are left. The latter is likely to be excluded as more data becomes available whereas the region around 125 GeV is where the recently discovered Higgs-like particle was observed and therefore where the exclusion limit is weaker. It is worth stressing that mUED predicts an enhancement for all channels for Higgs production by gluon fusion and decay while the vector boson fusion process WW/ZZ -> h -> AA is generically suppressed and WW/ZZ -> h -> WW*/ZZ* is standard. Therefore, as more 8 TeV LHC data becomes available, the information on individual Higgs boson production and decay processes provided by the CMS and ATLAS experiments can be effectively used to favour mUED or exclude it further.

  2. Fermion masses and mixings from dihedral flavor symmetries with preserved subgroups

    SciTech Connect (OSTI)

    Blum, A.; Hagedorn, C.; Lindner, M. [Max-Planck-Institut fuer Kernphysik, Postfach 10 39 80, 69029 Heidelberg (Germany)

    2008-04-01T23:59:59.000Z

    We perform a systematic study of dihedral groups used as flavor symmetry. The key feature here is the fact that we do not allow the dihedral groups to be broken in an arbitrary way, but in all cases some (nontrivial) subgroup has to be preserved. In this way we arrive at only five possible (Dirac) mass matrix structures which can arise, if we require that the matrix has to have a nonvanishing determinant and that at least two of the three generations of left-handed (conjugate) fermions are placed into an irreducible two-dimensional representation of the flavor group. We show that there is no difference between the mass matrix structures for single- and double-valued dihedral groups. Furthermore, we comment on possible forms of Majorana mass matrices. As a first application we find a way to express the Cabibbo angle, i.e. the Cabibbo-Kobayashi-Maskawa matrix element |V{sub us}|, in terms of group theory quantities only, the group index n, the representation index j and the index m{sub u,d} of the different preserved subgroups in the up and down quark sector: |V{sub us}|=|cos(({pi}(m{sub u}-m{sub d})j/n))| which is |cos((3{pi}/7))|{approx_equal}0.2225 for n=7, j=1, m{sub u}=3 and m{sub d}=0. We prove that two successful models which lead to maximal atmospheric mixing and vanishing {theta}{sub 13} in the lepton sector are based on the fact that the flavor symmetry is broken in the charged lepton, Dirac neutrino and Majorana neutrino sector down to different preserved subgroups whose mismatch results in the prediction of these mixing angles. This also demonstrates the power of preserved subgroups in connection with the prediction of mixing angles in the quark as well as in the lepton sector.

  3. Gluon condensates and c, b quark masses from quarkonia ratios of moments

    E-Print Network [OSTI]

    Stephan Narison

    2011-10-13T23:59:59.000Z

    We extract (for the first time) the ratio of the gluon condensate / expressed in terms of the liquid instanton radius rho_c from charmonium moments sum rules by examining the effects of in the determinations of both rho_c and the running MS mass m_c(m_c). Using a global analysis of selected ratios of moments at different Q^2=0, 4m_c^2 and 8m_c^2 and taking from 0.06 GeV^4, where the estimate of rho_c is almost independent of , we deduce: rho_c=0.98(21) GeV^{-1} which corresponds to = (31+- 13) GeV^2 . The value of m_c(m_c) is less affected (within the errors) by the variation of , where a common solution from different moments are reached for greater than 0.02 GeV^4. Using the values of =0.06(2) GeV^4 from some other channels and the previous value of , we deduce: m_c(m_c)=1260(18) MeV and m_b(m_b)=4173(10) MeV, where an estimate of the 4-loops contribution has been included. Our analysis indicates that the errors in the determinations of the charm quark mass without taking into account the ones of the gluon condensates have been underestimated. To that accuracy, one can deduce the running light and heavy quark masses and their ratios evaluated at M_Z, where it is remarkable to notice the approximate equalities: m_s/m_u= m_b/m_s= m_t/m_b= 51(4), which might reveal some eventual underlying novel symmetry of the quark mass matrix in some Grand Unified Theories.

  4. Selective Recovery of Enriched Uranium from Inorganic Wastes

    SciTech Connect (OSTI)

    Kimura, R. T.

    2003-02-26T23:59:59.000Z

    Uranium as U(IV) and U(VI) can be selectively recovered from liquids and sludge containing metal precipitates, inorganic salts, sand and silt fines, debris, other contaminants, and slimes, which are very difficult to de-water. Chemical processes such as fuel manufacturing and uranium mining generate enriched and natural uranium-bearing wastes. This patented Framatome ANP (FANP) uranium recovery process reduces uranium losses, significantly offsets waste disposal costs, produces a solid waste that meets mixed-waste disposal requirements, and does not generate metal-contaminated liquids. At the head end of the process is a floating dredge that retrieves liquids, sludge, and slimes in the form of a slurry directly from the floor of a lined surface impoundment (lagoon). The slurry is transferred to and mixed in a feed tank with a turbine mixer and re-circulated to further break down the particles and enhance dissolution of uranium. This process uses direct steam injection and sodium hypochlorite addition to oxidize and dissolves any U(IV). Cellulose is added as a non-reactive filter aid to help filter slimes by giving body to the slurry. The slurry is pumped into a large recessed-chamber filter press then de-watered by a pressure cycle-controlled double-diaphragm pump. U(VI) captured in the filtrate from this process is then precipitated by conversion to U(IV) in another Framatome ANP-patented process which uses a strong reducing agent to crystallize and settle the U(IV) product. The product is then dewatered in a small filter press. To-date, over 3,000 Kgs of U at 3% U-235 enrichment were recovered from a 8100 m2 hypalon-lined surface impoundment which contained about 10,220 m3 of liquids and about 757 m3 of sludge. A total of 2,175 drums (0.208 m3 or 55 gallon each) of solid mixed-wastes have been packaged, shipped, and disposed. In addition, 9463 m3 of low-U liquids at <0.001 KgU/m3 were also further processed and disposed.

  5. Measuring microfocal spots using digital radiography

    SciTech Connect (OSTI)

    Fry, David A [Los Alamos National Laboratory; Ewert, Uwe [BAM

    2009-01-01T23:59:59.000Z

    Measurement of microfocus spot size can be important for several reasons: (1) Quality assurance during manufacture of microfocus tubes; (2) Tracking performance and stability of microfocus tubes; (3) Determining magnification is especially important for digital radiography where the native spatial resolution of the digital system is not adequate for the application; and (4) Knowledge of unsharpness from the focal spot alone. The European Standard EN 12543-5 is based on a simple geometrical method of calculating focal spot size from unsharpness of high magnification film radiographs. The following equations are used for the focal spot size measurement: By similar triangles the following equations are presupposed: f/a = U/b and M = (a+b)/a. These equations can be combined to yield the well known expression: U = f(M - 1). Solving for f, f = U/(M-1). Therefore, the focal spot size, f, can be calculated by measuring the radiographic unsharpness and magnification of a known object. This is the basis for these tests. The European standard actually uses one-half of the unsharpness (which are then added together) from both sides of the object to avoid additional unsharpness contributions due to edge transmission unsharpness of the round test object (the outside of the object is measured). So the equation becomes f = (1/2 U{sub 1} + 1/2 U{sub 2})/(M-1). In practice 1/2 U is measured from the 50% to the 90% signal points on the transition profile from ''black'' to ''white,'' (positive image) or attenuated to unattenuated portion of the image. The 50% to 90% points are chosen as a best fit to an assumed Gaussian radiation distribution from the focal spot and to avoid edge transmission effects. 1/2 U{sub 1} + 1/2 U{sub 2} corresponds about to the full width at half height of a Gaussian focal spot. A highly absorbing material (Tungsten, Tungsten Alloy, or Platinum) is used for the object. Either wires or a sphere are used as the object to eliminate alignment issues. One possibility is to use the wires in the ASTM E2002 unsharpness gage and take two orthogonal images. The signal levels in the image need to be linear with radiation exposure and so may need conversion if a nonlinear detector is used to acquire the image.

  6. Enhanced vector borne disease surveillance of California Culex mosquito populations reveals spatial and species-specific barriers of infection.

    SciTech Connect (OSTI)

    VanderNoot, Victoria A.; Curtis, Deanna Joy; Koh, Chung-Yan; Brodsky, Benjamin H [Sandia National Laboratories, Albuquerque, NM; Lane, Todd

    2014-08-01T23:59:59.000Z

    Monitor i ng in f ectio n s in v ect o rs su c h as m osquit o es, s a nd fl i es, tsetse fl i es, a nd ticks to i denti f y hu m a n path o gens m a y s e r v e as a n ear l y w arn i ng det e ction system t o dir e ct loc a l g o v er n ment dise a se pr e v en t i v e m easu r e s . One major hurdle i n de t ection is the abi l i t y to scre e n l arge n u mbers of v e c t ors for h uman patho g ens w i thout t h e u s e of ge n o t y pe - s p ecific m o lecu l ar tec h nique s . N e x t genera t ion s equ e nc i ng (NG S ) pr o v i des a n unbi a sed p latfo r m capab l e of identi f y i ng k n o w n a n d unk n o w n p ath o ge n s circula t ing w i thin a v e ctor p opul a tion, but utili z ing t h is te c h nolo g y i s tim e - con s u ming a n d cos t l y for v ecto r -b o rne disease su r v e illan c e pr o gra m s. T o addr e s s this w e d e v e lop e d cos t -eff e ct i v e Ilumina(r) R NA- S eq l i bra r y p r epara t ion m e thodol o gies i n con j u n ction w i t h an automa t ed c ompu t at i onal a n a l y sis pipel i n e to ch a racter i ze t h e microbial popula t ions c ircula t i n g in Cu l e x m o squit o e s (Cul e x qui n quef a s c iatu s , C ul e x quinq u efasc i atus / pip i ens co m pl e x h y bri d s, and C u l e x ta r salis ) t hroug h out Californ i a. W e assembled 2 0 n o vel a n d w e l l -do c ume n ted a r b o v i ruses repres e nting mem b e rs of B u n y a v ir i da e , F l a v i virid a e, If a virida e , Meson i v i rida e , Nid o v iri d ae, O rtho m y x o virid a e, Pa r v o v iri d ae, Re o virid a e, R h a b d o v i rid a e, T y m o v iri d ae, a s w ell as s e v e r al u n assi g n e d v irus e s . In addit i o n, w e m app e d mRNA s pecies to d i vergent s peci e s of t r y panos o ma a nd pl a s modium eu k a r yotic parasit e s and cha r a c terized t he p r oka r yot i c microb i al c o mposit i on to i d enti f y bacteri a l tran s c r ipts der i v ed from wolba c hia, clo s tridi u m, m y c oplas m a, fusoba c terium and c am p y l o bacter bac t er i al spec i e s . W e utilized the s e mic r obial transcri p tomes pre s e nt in g e ogra p hical l y defined Cul e x po p ul a tions to defi n e spatial and m osqui t o specie s -spec i fic ba r r iers of i n fecti o n. T he v i r ome and microbi o me c o mpos i tion id e ntified in e ach mosqui t o p o ol pr o v i ded suf f icient resolut i on to dete r m i ne both the mosq u ito species and the g e o graphic regi o n in Californ i a w h e re t h e mosqui t o po o l orig i n ated. T his d a ta pr o v i des ins i ght in t o the compl e x i t y of microb i al spec i es cir c ulati n g in med i cal l y i mport a nt Culex mosqui t oes a nd t h eir potent i al im p act o n t he tran s missi o n of v ector-b o rne human / veter i na r y p a t hogens in C a liforn i a.