Powered by Deep Web Technologies
Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



The Antrim Shale: Structural and stratigraphic influences on gas production  

Science Conference Proceedings (OSTI)

The Antrim Shale of the Michigan basin is one of the most actively drilled gas plays in the United States. Core analysis, geologic mapping, and core to log correlations of a 9 mi{sup 2} study area in the middle of the present play have defined geologic influences on the location and productivity of Antrim reservoirs. Application of these factors in the design of exploration and development strategies could improve gas recovery from the Antrim Shale. The lower section of the Antrim Shale, containing the present producing horizons, is composed of four lithologies that subdivide the Antrim into facies and parasequences based upon their mineralogy and textural characteristics. The black shales of the producing horizons are characterized by high but variable quartz contents and an extremely fine-grained matrix of muscovite and clays. The black shales are surrounded by two types of gray shale, differentiated by amount and form of carbonates, and a green shale. The type of shale bounding the productive, organic-rich black shales may affect stimulation strategies and their effectiveness. These black shales average 10% but can be as high as 20% TOC by weight. The organic contents impart a distinctive signature to gamma ray logs that enabled isopach, lithofacies, and structural mapping of the Antrim. Correlated with available production data, the maps reveal distinct trends suggesting that well performance is influenced by both structural and stratigraphic controls.

Manger, K.C.; Oliver, S.J.P. (ICF Resources Incorporated, Fairfax, VA (United States)); Scheper, R.J. (Gas Research Inst., Chicago, IL (United States))



Antrim County, Michigan ASHRAE 169-2006 Climate Zone | Open Energy...  

Open Energy Info (EERE)

Antrim County, Michigan ASHRAE 169-2006 Climate Zone Jump to: navigation, search County Climate Zone Place Antrim County, Michigan ASHRAE Standard ASHRAE 169-2006 Climate Zone...


Pyrochromatographic study of Michigan antrim shale  

DOE Green Energy (OSTI)

Pyrochromatographic analyses were performed on samples of Antrim shale from 35 wells and nine outcrops in the Michigan Basin. Hydrocarbon components from C/sub 5/ to C/sub 30/ were measured. The majority of the analyses indicate the Antrim to be potentially gas productive. The total hydrocarbon count for each well was divided by the number of samples analyzed to obtain the average hydrocarbon count per sample. Hydrocarbon counts per sample generally increase with depth and toward the center of the Michigan Basin. A bar graph for each well, showing the total hydrocarbon count for each sample, by depth, was plotted and compared with the gamma ray log. A correlation coefficient of 0.696 between increased hydrocarbon counts and increased radioactivity was calcuated based on data from five wells.

Snyder, R.H.; Maness, M.



Evaluating the antrim shale formation using a Geographic Information System  

Science Conference Proceedings (OSTI)

The Antrim Shale formation is currently the most active exploration play in the Michigan basin. With more than 3500 producing wells, the Antrim Shale has significantly increased Michigan's natural gas reserves. The Antrim Shale now accounts for over 50% of Michigan's daily natural gas production. C-Map is a vector-based Geographic Information System developed at Michigan State University. It is used throughout Michigan, primarily by state and local government agencies, to assist in programs that range from resource management to civic planning. Although not originally designed for oil and gas exploration, many of the features found in C-Map are ideally suited to this task. Exploration functions performed on C-Map include the creation of base maps, data posting, and thematic mapping. Interfaces written into C-MAP also allow for computer gridding, contouring, and 3-D modeling using commercial software designed for this purpose. C-MAP can also be used in conjunction with Michigan's Resource Inventory System, the digital land-use database developed by the Michigan Department of Natural Resources. The unconventional nature of the Antrim Shale reservoir, along with the large volume of wells drilled and data collected have combined to make the Antrim Shale a very difficult play to evaluate. C-Map, with its analytical tools, low cost, and compatibility with an existing digital land-use database for Michigan is an ideal exploration tool for companies and individuals attempting to enhance their understanding of this challenging play.

Carlton, R.B. (Nomeco Oil Gas Co., Jackson, MI (United States))



Hydrogeochemistry of the Antrim Shale (Devonian) in the Michigan Basin  

SciTech Connect

The Antrim shale has been the focus of active exploration and production in the Michigan Basin since 1987. The producing trend is presently located along the northern rim of the basin, but new ventures are expanding into the southern part of the basin and a predictive model for gas generation and production is greatly needed. The authors have undertaken a geochemical investigation of the waters co-produced with gases in the Antrim shale. There is unusual regional variability in the water chemistry. For example, salinity ranges from near potable water to nearly 10 times the salinity of ocean water within a distance of 80 km. Understanding the origin of solutes, waters and natural gas being produced from the Antrim Shale will aid in developing a model for natural gas generation and migration within the basin. The chemical and isotopic compositions of Antrim waters suggest that there are two sources of water and salinity within the reservoir: (1) saline, high-bromide basinal brine moving updip into the producing areas, and (2) ancient, dilute glacial melt water. Either of these waters can gain additional NaCl from dissolving Br-poor halite located within the updip pinch-out of the Detroit River Salt. When plotted geographically, variations in these components exhibit distinct regional patterns and may ultimately highlight major water and gas migration avenues. In addition to variable water salinity, the authors' preliminary results suggest that complexities in natural gas chemistry are reflected in the composition of coexisting waters.

Martini, A.M.; Walter, L.M.; Richards, J.A.; Budai, J.M. (Univ. of Michigan, Ann Arbor, MI (United States). Dept. of Geological Sciences)



The Antrim shale, fractured gas reservoirs with immense potential  

Science Conference Proceedings (OSTI)

Antrim shale gas production has grown from 0.4 Bcf of gas in 1987 to 127 Bcf in 1994, causing record gas production in Michigan. Recent industry activity suggests the play will continue to expand. The GRI Hydrocarbon Model's Antrim resource base description was developed in 1991 based on industry activity through 1990. The 1991 description estimated 32 Tcf of recoverable resource, and was limited to northern Michigan which represents only part of the Antrim's total potential. This description indicated production could increase manyfold, even with low prices. However, its well recovery rate is less than current industry results and projected near term production lags actual production by 1 to 2 years. GRI is updating its description to better reflect current industry results and incorporate all prospective areas. The description in northern Michigan is updated using production and well data through 1994 and results from GRI's research program. The description is then expanded to the entire basin. Results indicate the northern resource is somewhat larger than the previous estimate and the wells perform better. Extrapolation to the entire basin using a geologic analog model approximately doubles the 1991 estimate. The model considers depositional, structural, and tectonic influences; fracturing; organic content; thermal history; and hydrocarbon generation, migration and storage. Pleistocene glaciation and biogenic gas are also included for areas near the Antrim subcrop.

Manger, K.C. (DynCorp., Alexandria, VA (United States)); Woods, T.J. (Gas Research Institute., Washington, DC (United States)) Curtis, J.B. (Colorado School of Mines, Golden, CO (United States))



A prediction investigated: Antrim gas fields in central and southern Michigan  

SciTech Connect

An exploration rationale based on observations in the Appalachian basin has been applied to Michigan. The rationale assumes that not all shale gas is indigenous and that gas production is related to both a greater gas content and a greater fracture density than regional average. Areas [open quotes]charged with gas[close quotes] can be expected where methane has migrated from downdip Antrim or from older sources into stratigraphic traps created by shale facies change. Increased fracturing requires geologically [open quotes]new[close quotes] crustal movement. Small areas of predicted shale gas potential were identified using (1) mapped facies changes, (2) bitumen concentrations, (3) Traverse Lime structure, and (4) glacial hinge lines. Three areas, about 6 by 15 mi, in south central Michigan showed an organic matter (bitumen) equal to or greater than in Otsego County. Each area was crossed by a shale to shale facies change with less permeable shale positioned updip of expected gas movement. All three areas lie along projections of glacial hinge lines, where geologically [open quotes]new[close quotes] flexing ([approximately]13,000 YBP) is postulated to have created [open quotes]fresh[close quotes], localized breakage. The areas were superimposed on an oil and gas map and well records in and around the areas were searched for evidence of gas, water, or lost circulation. Antrim [open quotes]gas[close quotes] occurred in two areas; specifically, seven wells in or near the southern, shallowest area and in four wells in or bordering another. Although the evidence is inconclusive, the gas reported where gas was predicted is presented as support for the exploration methodology advanced.

Matthews, R.D. (R.D. Matthews, Incs., Chicago, IL (United States)); Jones, M.W. (Michigan Petroleum Geologists, Inc., Litchfield, MI (United States))



Antrim, New Hampshire: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Antrim, New Hampshire: Energy Resources Antrim, New Hampshire: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 43.0309142°, -71.9389689° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.0309142,"lon":-71.9389689,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fracture analysis of the upper devonian antrim shale, Michigan basin  

Science Conference Proceedings (OSTI)

The Antrim Shale is a fractured, unconventional gas reservoir in the northern Michigan basin. Controls on gas production are poorly constrained but must depend on the fracture framework. Analyses of fracture geometry (orientation, spacing, and aperture width) were undertaken to better evaluate reservoir permeability and, hence, pathways for fluid migration. Measurements from nearly 600 fractures were made from outcrop, core, and Formation MicroScanner logs covering three members of the Antrim Shale (Norwood, Paxton, Lachine) and the Ellsworth Shale. Fracture analyses indicate pronounced reservoir anisotropy among the members. Together related with lithologic variations, this leads to unique reservoir characteristics within each member. There are two dominant fracture sets, northeast-southwest and northwest-southeast. Fracture density varies among stratigraphic intervals but always is lowest in the northwest-southeast fracture set and is greatest in the northeast-southwest fracture set. While aperture width decreases markedly with depth, subsurface variation in mean aperture width is significant. Based on fracture density and mean aperture width, the Norwood member has the largest intrinsic permeability and the Ellsworth Shale the lowest intrinsic permeability. The highest intrinsic fracture permeability in all intervals is associated with the northeast-southwest fracture set. The Norwood and Lachine members thus exhibit the best reservoir character. This information is useful in developing exploration strategies and completion practices in the Antrim Shale gas play.

Richards, J.A.; Budai, J.M.; Walter, L.M.; Abriola, L.M. (Univ. of Michigan, Ann Arbor, MI (United States))



Hydrogeochemistry of the antrim shale northern michigan basin. Annual report, September 1, 1993-May 1, 1995  

Science Conference Proceedings (OSTI)

This study was intended to document gradients in fluid chemistry over the producing trend of the Antrim Shale in the northern Michigan Basin, relate these geochemical gradients to fracture networks or structures within the reservoir, and establish their signifcance relative to the hydrology of the Antrim and gas production potential of the unit.

Walter, L.M.; Budai, J.M.; Abriola, L.M.; Stearns, C.H.; Martini, A.M.



Sugar Land, TX -  

NLE Websites -- All DOE Office Websites (Extended Search)

Petroleum Engineering Alumnus Recognized by Secretary of Energy for Work at National Lab Sugar Land, TX - The National Energy Technology Laboratory is proud to announce that...


Geological controls on natural gas production in the Antrim Shale of the Michigan basin  

Science Conference Proceedings (OSTI)

The Antrim Shale (Devonian-Mississippian) is a prolific natural gas reservoir with distinctive source rock and reservoir characteristics. The Antrim is composed of two distinctive lithofacies: a black shale lithofacies having total organic carbon (TOC) values as high as 12% and a gray-green shale lithofacies having TOC values generally below 0.5 %. The black shale facies is the primary source bed and reservoir for natural gas. Based on Rock-Eval data the kerogen in the Antrim Shale is only marginally mature with respect to generation of liquid hydrocarbons. This in the range of 435{degree}C, vitrinite reflectance values are 0.41, and thermal alteration index (TAI) is 2. These data indicate a maximum burial temperature of approximately 60{degree}C in Otsego County, Michigan, the main play area. Although the thermal maturation level in this area is very low, the gas produced from the Antrim is internally sourced and thermogenic; this interpretation is based on the presence of trace amounts of high-gravity oil and a thermogenic isotopic signature of produced gas samples. The black shale facies in the Antrim contains significant authigenic silica and is more susceptible to fracturing compared to the carbonate-cemented gray-green shales facies. Extremely low gas permeability values (0.1 md) indicates that fractures serve as conduits for delivery of gas to the borehole. Most of the gas must be stored in the shale matrix porosity because total gas volume produced far exceeds fracture reservoir volume.

Dellapenna, T.M. (Western Michigan Univ., Kalamazoo (USA))



Sugar Land, TX -  

NLE Websites -- All DOE Office Websites (Extended Search)

Alumnus Recognized by Secretary of Energy for Work at National Lab Sugar Land, TX - The National Energy Technology Laboratory is proud to announce that U.S. Air Force Academy...


Geochemical constraints on microbial methanogenesis in an unconventional gas reservoir: Devonian Antrim shale, Michigan  

Science Conference Proceedings (OSTI)

The Upper Devonian Antrim Shale is a self-sourced, highly fractured gas reservoir. It subcrops around the margin of the Michigan Basin below Pleistocene glacial drift, which has served as a source of meteoric recharge to the unit. The Antrim Shale is organic-rich (>10% total organic carbon), hydrogen-rich (Type I kerogen) and thermally immature (R[sub o] = 0.4 to 0.6). Reserve estimates range from 4-8 Tcf, based on assumptions of a thermogenic gas play. Chemical and isotopic properties measured in the formation waters show significant regional variations and probably delineate zones of increased fluid flow controlled by the fracture network. [sup 14]C determinations on dissolved inorganic carbon indicate that freshwater recharge occurred during the period between the last glacial advance and the present. The isotopic composition of Antrim methane ([delta][sup 13]C = -49 to -59[per thousand]) has been used to suggest that the gas is of early thermogenic origin. However, the highly positive carbon of co-produced CO[sub 2] gas ([delta][sup 13]C [approximately] +22[per thousand]) and DIC in associated Antrim brines ([delta][sup 13]C = +19 to +31[per thousand]) are consistent with bacterially mediated fractionation. The correlation of deuterium in methane ([delta]D = -200 to -260[per thousand]) with that of the co-produced waters (SD = -20 to -90176) suggests that the major source of this microbial gas is via the CO[sub 2] reduction pathway within the reservoir. Chemical and isotopic results also demonstrate a significant (up to 25%) component of thermogenic gas as the production interval depth increases. The connection between the timing of groundwater recharge, hydrogeochemistry and gas production within the Antrim Shale, Michigan Basin, is likely not unique and may find application to similar resources elsewhere.

Martini, A.M.; Budal, J.M.; Walter, L.M. (Univ. of Michigan, Ann Arbor, MI (United States)) (and others)



Chattanooga Eagle Ford Western Gulf TX-LA-MS Salt Basin Uinta Basin  

U.S. Energy Information Administration (EIA) Indexed Site

Western Western Gulf TX-LA-MS Salt Basin Uinta Basin Devonian (Ohio) Marcellus Utica Bakken*** Avalon- Bone Spring San Joaquin Basin Monterey Santa Maria, Ventura, Los Angeles Basins Monterey- Temblor Pearsall Tuscaloosa Big Horn Basin Denver Basin Powder River Basin Park Basin Niobrara* Mowry Niobrara* Heath** Manning Canyon Appalachian Basin Antrim Barnett Bend New Albany Woodford Barnett- Woodford Lewis Hilliard- Baxter- Mancos Excello- Mulky Fayetteville Floyd- Neal Gammon Cody Haynesville- Bossier Hermosa Mancos Pierre Conasauga Michigan Basin Ft. Worth Basin Palo Duro Basin Permian Basin Illinois Basin Anadarko Basin Greater Green River Basin Cherokee Platform San Juan Basin Williston Basin Black Warrior Basin A r d m o r e B a s i n Paradox Basin Raton Basin Montana Thrust Belt Marfa Basin Valley & Ridge Province Arkoma Basin Forest


Category:Amarillo, TX | Open Energy Information  

Open Energy Info (EERE)

Amarillo, TX Amarillo, TX Jump to: navigation, search Go Back to PV Economics By Location Media in category "Amarillo, TX" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Amarillo TX CPS Energy.png SVFullServiceRestauran... 62 KB SVHospital Amarillo TX CPS Energy.png SVHospital Amarillo TX... 66 KB SVLargeHotel Amarillo TX CPS Energy.png SVLargeHotel Amarillo ... 61 KB SVLargeOffice Amarillo TX CPS Energy.png SVLargeOffice Amarillo... 59 KB SVMediumOffice Amarillo TX CPS Energy.png SVMediumOffice Amarill... 62 KB SVMidriseApartment Amarillo TX CPS Energy.png SVMidriseApartment Ama... 61 KB SVOutPatient Amarillo TX CPS Energy.png SVOutPatient Amarillo ... 60 KB SVPrimarySchool Amarillo TX CPS Energy.png SVPrimarySchool Amaril... 61 KB SVQuickServiceRestaurant Amarillo TX CPS Energy.png


Category:Houston, TX | Open Energy Information  

Open Energy Info (EERE)

TX TX Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houston, TX" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houston TX Entergy Texas Inc..png SVFullServiceRestauran... 73 KB SVHospital Houston TX Entergy Texas Inc..png SVHospital Houston TX ... 74 KB SVLargeHotel Houston TX Entergy Texas Inc..png SVLargeHotel Houston T... 74 KB SVLargeOffice Houston TX Entergy Texas Inc..png SVLargeOffice Houston ... 74 KB SVMediumOffice Houston TX Entergy Texas Inc..png SVMediumOffice Houston... 78 KB SVMidriseApartment Houston TX Entergy Texas Inc..png SVMidriseApartment Hou... 77 KB SVOutPatient Houston TX Entergy Texas Inc..png SVOutPatient Houston T... 75 KB SVPrimarySchool Houston TX Entergy Texas Inc..png


US WSC TX Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

WSC TX WSC TX Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US WSC TX Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US WSC TX Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US WSC TX Expenditures dollars ELECTRICITY ONLY average per household * Texas households consume an average of 77 million Btu per year, about 14% less than the U.S. average. * Average electricity consumption per Texas home is 26% higher than the national average, but similar to the amount used in neighboring states. * The average annual electricity cost per Texas household is $1,801, among the highest in the nation, although similar to other warm weather states like Florida. * Texas homes are typically newer, yet smaller in size, than homes in other parts of


US WSC TX Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

WSC TX WSC TX Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US WSC TX Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US WSC TX Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US WSC TX Expenditures dollars ELECTRICITY ONLY average per household * Texas households consume an average of 77 million Btu per year, about 14% less than the U.S. average. * Average electricity consumption per Texas home is 26% higher than the national average, but similar to the amount used in neighboring states. * The average annual electricity cost per Texas household is $1,801, among the highest in the nation, although similar to other warm weather states like Florida. * Texas homes are typically newer, yet smaller in size, than homes in other parts of

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Office of Legacy Management (LM)

*. *. ( ARGONNE RATIONAL 1-Ci3ORATORY . 1 D&TX 7. my 19, 1349 70 t. Z. ROse at L, Em &=i*p~~4 DVur;uM hLl%L ?bvs -Lcs . FReti c. c. Fqpr an2 2. E. sulu+rr fis2 S*crep t & fbQ s-e: of the ?atagel DrFAm%un !! 1 0 * the >rt &Fz=z d t& &men of ScieJce & >&7*-z 4-q 2s'; %rZion 0C the ZLLS~~~ of Science a2 31~52-37 fo2 T&imcyyg c.=A+=< he-< - ,,a uas c:cgetes ALL 12, 1SL9. Z 0 sor;~~,-~-lioi! c.jme s 'm&-go& ~WC& c ",& d*cg&A c&.6 be ciS',&Ctti 03 2.q ZLS CC the 5iiUdi; 0~ eqt&-p*t ~-3 niq b the &-CT iq95, - < less Se&,-0~22 3 wels off tze b.ckm5n' ,e ueze t& 233 &,/zip fe pe*-se a?& coL&cs El5 less t&3 c. 5z/z fo- pcxabi beta-g+iis couxezs.


60-day waste compatibility safety issue and final results for 244-TX DCRT, grab samples TX-95-1, TX-95-2, and TX-95-3  

Science Conference Proceedings (OSTI)

Three grab samples (TX-95-1, TX-95-2, and TX-95-3) were taken from tank 241- TX-244 riser 8 on November 7, 1995 and received by the 222-S Laboratory on that same day. Samples TX-95-1 and TX-95-2 were designated as supernate liquids, and sample TX-95-3 was designated as a supernate/sludge. These samples were analyzed to support the waste compatibility safety program. Accuracy and precision criteria were met for all analyses. No notifications were required based on sample results. This document provides the analysis to support the waste compatibility safety program.

Esch, R.A.




NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


Freeport, TX Natural Gas LNG Imports (Price) From Nigeria (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Freeport, TX Natural Gas LNG Imports (Price) From Nigeria (Dollars per Thousand Cubic Feet) Freeport, TX Natural Gas LNG Imports (Price) From Nigeria (Dollars per Thousand Cubic...


Penitas, TX Natural Gas Pipeline Imports From Mexico (Million...  

Annual Energy Outlook 2012 (EIA)

View History: Annual Download Data (XLS File) Penitas, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) Penitas, TX Natural Gas Pipeline Imports From Mexico...


Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Annual Download Data (XLS File) Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) Hidalgo, TX Natural Gas Pipeline Imports From Mexico...


Alamo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Alamo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Alamo, TX Natural Gas Pipeline Exports to Mexico...


Penitas, TX Natural Gas Pipeline Exports to Mexico (Dollars per...  

U.S. Energy Information Administration (EIA) Indexed Site

View History: Monthly Annual Download Data (XLS File) Penitas, TX Natural Gas Pipeline Exports to Mexico (Dollars per Thousand Cubic Feet) Penitas, TX Natural Gas Pipeline Exports...


Penitas, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Penitas, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Penitas, TX Natural Gas Pipeline Exports to Mexico...


Clint, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Annual Energy Outlook 2012 (EIA)

View History: Monthly Annual Download Data (XLS File) Clint, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Clint, TX Natural Gas Pipeline Exports to Mexico...


Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Hidalgo, TX Natural Gas Pipeline Exports to Mexico...


Alamo, TX Natural Gas Pipeline Imports From Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Annual Download Data (XLS File) Alamo, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) Alamo, TX Natural Gas Pipeline Imports From Mexico (Million...


Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Dollars per...  

U.S. Energy Information Administration (EIA) Indexed Site

View History: Monthly Annual Download Data (XLS File) Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Dollars per Thousand Cubic Feet) Hidalgo, TX Natural Gas Pipeline Exports...


Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price...  

Gasoline and Diesel Fuel Update (EIA)

Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price) (Dollars per Thousand Cubic Feet) Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price) (Dollars per...


AOCS Official Method Tx 1a-66  

Science Conference Proceedings (OSTI)

Hydroxyl Value of Epoxidized Oils AOCS Official Method Tx 1a-66 Methods Downloads Methods Downloads DEFINITION The hydroxyl value is defined as the mg of potassium hydroxide equivalent to the hydroxyl content of 1


TX-100 manufacturing final project report.  

DOE Green Energy (OSTI)

This report details the work completed under the TX-100 blade manufacturing portion of the Carbon-Hybrid Blade Developments: Standard and Twist-Coupled Prototype project. The TX-100 blade is a 9 meter prototype blade designed with bend-twist coupling to augment the mitigation of peak loads during normal turbine operation. This structural coupling was achieved by locating off axis carbon fiber in the outboard portion of the blade skins. The report will present the tooling selection, blade production, blade instrumentation, blade shipping and adapter plate design and fabrication. The baseline blade used for this project was the ERS-100 (Revision D) wind turbine blade. The molds used for the production of the TX-100 were originally built for the production of the CX-100 blade. The same high pressure and low pressure skin molds were used to manufacture the TX-100 skins. In order to compensate for the difference in skin thickness between the CX-100 and the TX-100, however, a new TX-100 shear web plug and mold were required. Both the blade assembly fixture and the root stud insertion fixture used for the CX-100 blades could be utilized for the TX-100 blades. A production run of seven TX-100 prototype blades was undertaken at TPI Composites during the month of October, 2004. Of those seven blades, four were instrumented with strain gauges before final assembly. After production at the TPI Composites facility in Rhode Island, the blades were shipped to various test sites: two blades to the National Wind Technology Center at the National Renewable Energy Laboratory in Boulder, Colorado, two blades to Sandia National Laboratory in Albuquerque, New Mexico and three blades to the United States Department of Agriculture turbine field test facility in Bushland, Texas. An adapter plate was designed to allow the TX-100 blades to be installed on existing Micon 65/13M turbines at the USDA site. The conclusion of this program is the kick-off of the TX-100 blade testing at the three testing facilities.

Ashwill, Thomas D.; Berry, Derek S. (TPI Composites, Inc., Warren, RI)



Category:El Paso, TX | Open Energy Information  

Open Energy Info (EERE)

El Paso, TX El Paso, TX Jump to: navigation, search Go Back to PV Economics By Location Media in category "El Paso, TX" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant El Paso TX CPS Energy.png SVFullServiceRestauran... 60 KB SVHospital El Paso TX CPS Energy.png SVHospital El Paso TX ... 65 KB SVLargeHotel El Paso TX CPS Energy.png SVLargeHotel El Paso T... 60 KB SVLargeOffice El Paso TX CPS Energy.png SVLargeOffice El Paso ... 59 KB SVMediumOffice El Paso TX CPS Energy.png SVMediumOffice El Paso... 62 KB SVMidriseApartment El Paso TX CPS Energy.png SVMidriseApartment El ... 60 KB SVOutPatient El Paso TX CPS Energy.png SVOutPatient El Paso T... 60 KB SVPrimarySchool El Paso TX CPS Energy.png SVPrimarySchool El Pas... 61 KB SVQuickServiceRestaurant El Paso TX CPS Energy.png


Response Robot Evaluation Exercise Disaster City, TX DAY 1 ...  

Science Conference Proceedings (OSTI)

Page 1. Response Robot Evaluation Exercise Disaster City, TX and Meeting of the ASTM International Committee on Homeland ...



DOE - Office of Legacy Management -- Sutton Steele and Steele Co - TX 09  

Office of Legacy Management (LM)

Sutton Steele and Steele Co - TX 09 Sutton Steele and Steele Co - TX 09 FUSRAP Considered Sites Site: SUTTON, STEELE & STEELE CO. (TX.09) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Sutton, Steele & Steele, Inc. TX.09-1 Location: Dallas , Texas TX.09-1 Evaluation Year: 1993 TX.09-2 Site Operations: Conducted operations to separate Uranium shot by means of air float tables and conducted research to air classify C-Liner and C-Special materials. TX.09-1 TX.09-3 TX.09-4 TX.09-5 Site Disposition: Eliminated - Potential for contamination considered remote TX.09-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium TX.09-4 TX.09-5 Radiological Survey(s): Health and Safety Monitoring TX.09-4 TX.09-5 Site Status: Eliminated from consideration under FUSRAP


CleanTX Foundation | Open Energy Information  

Open Energy Info (EERE)

CleanTX Foundation CleanTX Foundation Address 3925 W Braker Lane Place Austin, Texas Zip 78759 Region Texas Area Notes Promotes entrepreneurship in the field of clean technology, by providing educational forums, content, awareness and networking opportunities Website http://cleantx.org/ Coordinates 30.396989°, -97.735768° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.396989,"lon":-97.735768,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EIA Drilling Productivity Report  

U.S. Energy Information Administration (EIA) Indexed Site

Drilling Productivity Report Drilling Productivity Report For Center on Global Energy Policy, Columbia University October 29, 2013 | New York, NY By Adam Sieminski, Administrator The U.S. has experienced a rapid increase in natural gas and oil production from shale and other tight resources Adam Sieminski, EIA Drilling Productivity Report October 29, 2013 2 0 5 10 15 20 25 30 35 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) 0.0 0.4 0.8 1.2 1.6 2.0 2.4 2.8 2000 2002 2004 2006 2008 2010 2012 Eagle Ford (TX) Bakken (MT & ND) Granite Wash (OK & TX) Bonespring (TX Permian) Wolfcamp (TX Permian) Spraberry (TX Permian) Niobrara-Codell (CO) Woodford (OK)


Price Liquefied Freeport, TX Natural Gas Exports Price to United...  

Gasoline and Diesel Fuel Update (EIA)

United Kingdom (Dollars per Thousand Cubic Feet) Price Liquefied Freeport, TX Natural Gas Exports Price to United Kingdom (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1...


,"Hidalgo, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Hidalgo, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Penitas, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Penitas, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2002 ,"Release Date:","172014" ,"Next...


,"Alamo, TX Natural Gas Pipeline Imports From Mexico (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Alamo, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Eagle Pass, TX Natural Gas Pipeline Exports to Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Eagle Pass, TX Natural Gas Pipeline Exports to Mexico (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"El Paso, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","El Paso, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2002 ,"Release Date:","12122013"...



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


EDF Industrial Power Services (TX), LLC | Open Energy Information  

Open Energy Info (EERE)

Power Services (TX), LLC Power Services (TX), LLC Jump to: navigation, search Name EDF Industrial Power Services (TX), LLC Place Texas Utility Id 56315 Utility Location Yes Ownership R NERC ERCOT Yes ISO Ercot Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Industrial: $0.0394/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=EDF_Industrial_Power_Services_(TX),_LLC&oldid=410609" Categories: EIA Utility Companies and Aliases


Golden Pass, TX Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

from Qatar (Million Cubic Feet) Golden Pass, TX Natural Gas Liquefied Natural Gas Imports from Qatar (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...


Freeport, TX Exports to India Liquefied Natural Gas (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Exports to India Liquefied Natural Gas (Million Cubic Feet) Freeport, TX Exports to India Liquefied Natural Gas (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct...


Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Dollars...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Freeport, TX Natural Gas Liquefied Natural Gas Imports from Trinidad...  

Gasoline and Diesel Fuel Update (EIA)

Trinidad and Tobago (Million Cubic Feet) Freeport, TX Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug...


Penitas, TX Natural Gas Pipeline Imports From Mexico (Dollars...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) Penitas, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Alamo, TX Natural Gas Pipeline Imports From Mexico (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) Alamo, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...


Freeport, TX Liquefied Natural Gas Imports from Yemen (Million...  

Annual Energy Outlook 2012 (EIA)

from Yemen (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Imports from Yemen (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 2,869 3,108...


Freeport, TX Liquefied Natural Gas Imports From Peru (Million...  

Annual Energy Outlook 2012 (EIA)

From Peru (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Imports From Peru (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,175 3,338 3,262...


Freeport, TX Natural Gas Liquefied Natural Gas Imports from Egypt...  

Gasoline and Diesel Fuel Update (EIA)

Egypt (Million Cubic Feet) Freeport, TX Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 2,969 -...


Price Liquefied Freeport, TX Natural Gas Exports Price to Japan...  

Gasoline and Diesel Fuel Update (EIA)

Japan (Dollars per Thousand Cubic Feet) Price Liquefied Freeport, TX Natural Gas Exports Price to Japan (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...


Freeport, TX Liquefied Natural Gas Exports to Brazil (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

to Brazil (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Exports to Brazil (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 2,581 2012 2,601...

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Freeport, TX Liquefied Natural Gas Exports to South Korea (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

South Korea (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Exports to South Korea (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,157...


Freeport, TX Natural Gas Liquefied Natural Gas Imports (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Liquefied Natural Gas Imports (Million Cubic Feet) Freeport, TX Natural Gas Liquefied Natural Gas Imports (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...


DOE - Office of Legacy Management -- Pantex Sewage Reservoir - TX 03  

Office of Legacy Management (LM)

Pantex Sewage Reservoir - TX 03 Pantex Sewage Reservoir - TX 03 FUSRAP Considered Sites Site: Pantex Sewage Reservoir (TX.03 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


Price of Freeport, TX Natural Gas LNG Imports (Dollars per Thousand...  

U.S. Energy Information Administration (EIA) Indexed Site

Freeport, TX Natural Gas LNG Imports (Dollars per Thousand Cubic Feet) Price of Freeport, TX Natural Gas LNG Imports (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2...


McAllen, TX Natural Gas Pipeline Imports From Mexico (Million...  

Annual Energy Outlook 2012 (EIA)

View History: Annual Download Data (XLS File) McAllen, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) McAllen, TX Natural Gas Pipeline Imports From Mexico...


McAllen, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) McAllen, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) McAllen, TX Natural Gas Pipeline Exports to Mexico...


TEXAS TECH UNIVERSITY Lubbock, TX 79409-1108  

E-Print Network (OSTI)

TEXAS TECH UNIVERSITY Box 41108 Lubbock, TX 79409-1108 Name (as shown on your income tax return by the appropriate ownership type that applies to you or your business. I L *Texas Limited Partnership: SSN & Social Security Number (SSN) T *Texas Corporation Owners Name

Westfall, Peter H.


Double-contained receiver tank 244-TX, grab samples, 244TX-97-3 analytical results for the final report  

Science Conference Proceedings (OSTI)

This document is the final report for the double-contained receiver tank (DCRT) 244-TX grab samples. Three grabs samples were collected from riser 8 on May 29, 1997. Analyses were performed in accordance with the Compatibility Grab Sampling and Analysis Plan (TSAP) and the Data Quality Objectives for Tank Farms Waste Compatibility Program (DQO). The analytical results are presented in a table.

Esch, R.A.



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


GRR/Section 8-TX-c - Distributed Generation Interconnection | Open Energy  

Open Energy Info (EERE)

GRR/Section 8-TX-c - Distributed Generation Interconnection GRR/Section 8-TX-c - Distributed Generation Interconnection < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 8-TX-c - Distributed Generation Interconnection 8-TX-c - Distributed Generation Interconnection.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUCT Substantive Rule 25.211 PUCT Substantive Rule 25.212 Triggers None specified Click "Edit With Form" above to add content 8-TX-c - Distributed Generation Interconnection.pdf 8-TX-c - Distributed Generation Interconnection.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process for distributed generation (DG)


GRR/Section 8-TX-b - ERCOT Interconnection | Open Energy Information  

Open Energy Info (EERE)

8-TX-b - ERCOT Interconnection 8-TX-b - ERCOT Interconnection < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 8-TX-b - ERCOT Interconnection 8-TX-b - ERCOT Interconnection Process.pdf Click to View Fullscreen Regulations & Policies PUCT Substantive Rule 25.198 Triggers None specified Click "Edit With Form" above to add content 8-TX-b - ERCOT Interconnection Process.pdf 8-TX-b - ERCOT Interconnection Process.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the procedures for interconnection with Electricity Reliability Council of Texas (ERCOT) in Texas. According to PUCT Substantive Rule 25.198, the responsibility for


GRR/Section 3-TX-g - Lease of Relinquishment Act Lands | Open Energy  

Open Energy Info (EERE)

3-TX-g - Lease of Relinquishment Act Lands 3-TX-g - Lease of Relinquishment Act Lands < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-g - Lease of Relinquishment Act Lands 03-TX-g - Lease of Relinquishment Act Lands.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-g - Lease of Relinquishment Act Lands.pdf 03-TX-g - Lease of Relinquishment Act Lands.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of obtaining a geothermal lease on Relinquishment Act Lands in Texas. The Texas General Land Office (GLO) of Texas handles the leasing process on Relinquishment Act Lands through Title


Staubli TX-90XL robot qualification at the LLIHE.  

SciTech Connect

The Light Initiated High Explosive (LIHE) Facility uses a robotic arm to spray explosive material onto test items for impulse tests. In 2007, the decision was made to replace the existing PUMA 760 robot with the Staubli TX-90XL. A qualification plan was developed and implemented to verify the safe operating conditions and failure modes of the new system. The robot satisfied the safety requirements established in the qualification plan. A performance issue described in this report remains unresolved at the time of this publication. The final readiness review concluded the qualification of this robot at the LIHE facility.

Covert, Timothy Todd



,"McAllen, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","McAllen, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Modal testing of the TX-100 wind turbine blade.  

DOE Green Energy (OSTI)

This test report covers the SNL modal test results for two nominally identical TX-100 wind turbine blades. The TX-100 blade design is unique in that it features a passive braking, force-shedding mechanism where bending and torsion are coupled to produce desirable aerodynamic characteristics. A specific aim of this test is to characterize the coupling between bending and torsional dynamics. The results of the modal tests and the subsequent analysis characterize the natural frequencies, damping, and mode shapes of the individual blades. The results of this report are expected to be used for model validation--the frequencies and mode shapes from the experimental analysis can be compared with those of a finite-element analysis. Damping values are included in the results of these tests to potentially improve the fidelity of numerical simulations, although numerical finite element models typically have no means of predicting structural damping characteristics. Thereafter, an additional objective of the test is achieved in evaluating the test to test and unit variation in the modal parameters of the two blades.

Reese, Sarah; Griffith, Daniel Todd; Casias, Miguel; Simmermacher, Todd William; Smith, Gregory A.



GRR/Section 13-TX-a - State Land Use Assessment | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 13-TX-a - State Land Use Assessment GRR/Section 13-TX-a - State Land Use Assessment < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 13-TX-a - State Land Use Assessment 13-TX-a - State Land Use Assessment.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Regulations & Policies Open Beaches Act Dune Protection Act Beach Dune Rules Triggers None specified Click "Edit With Form" above to add content 13-TX-a - State Land Use Assessment.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Texas General Land Office (GLO) is in charge of making sure construction on the Texas coast that affects the beach and dunes is


GRR/Section 3-TX-e - Lease of Texas Parks & Wildlife Department Land | Open  

Open Energy Info (EERE)

TX-e - Lease of Texas Parks & Wildlife Department Land TX-e - Lease of Texas Parks & Wildlife Department Land < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-e - Lease of Texas Parks & Wildlife Department Land 03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of leasing Texas Parks & Wildlife Department (TPWD) land in Texas. The Texas General Land Office manages

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GRR/Section 3-TX-d - Lease of Permanent School Fund Land | Open Energy  

Open Energy Info (EERE)

3-TX-d - Lease of Permanent School Fund Land 3-TX-d - Lease of Permanent School Fund Land < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-d - Lease of Permanent School Fund Land 03-TX-d - Lease of Public School Fund Land (1).pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-d - Lease of Public School Fund Land (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of leasing Public School Fund (PSF) lands in Texas. The Texas General Land Office (GLO) oversees the leasing process for PSF lands through Title 31 of the Texas Administrative Code


GRR/Section 19-TX-e - Temporary Surface Water Permit | Open Energy  

Open Energy Info (EERE)

-TX-e - Temporary Surface Water Permit -TX-e - Temporary Surface Water Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-e - Temporary Surface Water Permit 19-TX-e Temporary Surface Water Permit.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11.138 Triggers None specified Click "Edit With Form" above to add content 19-TX-e Temporary Surface Water Permit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Texas, the Texas Commission on Environmental Quality (TCEQ), or in certain instances regional TCEQ offices or local Watermasters, issue


GRR/Section 3-TX-f - Lease of Land Trade Lands | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 3-TX-f - Lease of Land Trade Lands GRR/Section 3-TX-f - Lease of Land Trade Lands < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-f - Lease of Land Trade Lands 03-TX-f - Lease of Land Trade Lands.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-f - Lease of Land Trade Lands.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of leasing Land Trade Lands in Texas. The Texas General Land Office (GLO) administers leases on Land Trade Lands through Title 31 of the Texas Administrative Code Section 155.42.


CX-100 and TX-100 blade field tests.  

SciTech Connect

In support of the DOE Low Wind Speed Turbine (LWST) program two of the three Micon 65/13M wind turbines at the USDA Agricultural Research Service (ARS) center in Bushland, Texas will be used to test two sets of experimental blades, the CX-100 and TX-100. The blade aerodynamic and structural characterization, meteorological inflow and wind turbine structural response will be monitored with an array of 75 instruments: 33 to characterize the blades, 15 to characterize the inflow, and 27 to characterize the time-varying state of the turbine. For both tests, data will be sampled at a rate of 30 Hz using the ATLAS II (Accurate GPS Time-Linked Data Acquisition System) data acquisition system. The system features a time-synchronized continuous data stream and telemetered data from the turbine rotor. This paper documents the instruments and infrastructure that have been developed to monitor these blades, turbines and inflow.

Holman, Adam (USDA-Agriculture Research Service, Bushland, TX); Jones, Perry L.; Zayas, Jose R.



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


ORNL measurements at Hanford Waste Tank TX-118  

Science Conference Proceedings (OSTI)

A program of measurements and calculations to develop a method of measuring the fissionable material content of the large waste storage tanks at the Hanford, Washington, site is described in this report. These tanks contain radioactive waste from the processing of irradiated fuel elements from the plutonium-producing nuclear reactors at the Hanford site. Time correlation and noise analysis techniques, similar to those developed for and used in the Nuclear Weapons Identification System at the Y-12 Plant in Oak Ridge, Tennessee, will be used at the Hanford site. Both ``passive`` techniques to detect the neutrons emitted spontaneously from the waste in the tank and ``active`` techniques using AmBe and {sup 252}Cf neutron sources to induce fissions will be used. This work is divided into three major tasks: (1) development of high-sensitivity neutron detectors that can selectively count only neutrons in the high {gamma} radiation fields in the tanks, (2) Monte Carlo neutron transport calculations using both the KENO and MCNP codes to plan and analyze the measurements, and (3) the measurement of time-correlated neutrons by time and frequency analysis to distinguish spontaneous fission from sources inside the tanks. This report describes the development of the detector and its testing in radiation fields at the Radiation Calibration Facility at Oak Ridge National Laboratory and in tank TX-118 at the 200 W area at Westinghouse Hanford Company.

Koehler, P.E.; Mihalczo, J.T.



GRR/Section 11-TX-a - State Cultural Considerations Overview | Open Energy  

Open Energy Info (EERE)

GRR/Section 11-TX-a - State Cultural Considerations Overview GRR/Section 11-TX-a - State Cultural Considerations Overview < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-TX-a - State Cultural Considerations Overview 11TXAStateCulturalConsiderationsOverview.pdf Click to View Fullscreen Contact Agencies Texas Historical Commission Regulations & Policies NRC Ch. 191: Antiquities Code CCP Ch. 49: Inquests Upon Dead Bodies Triggers None specified Click "Edit With Form" above to add content 11TXAStateCulturalConsiderationsOverview.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative 11-TX-a.1 - Have Potential Human Remains Been Discovered?


GRR/Section 3-TX-c - Highway Right of Way Lease | Open Energy Information  

Open Energy Info (EERE)

3-TX-c - Highway Right of Way Lease 3-TX-c - Highway Right of Way Lease < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-c - Highway Right of Way Lease 03TXCEncroachmentIssues.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Texas Department of Transportation Regulations & Policies 43 TAC 21.600 43 TAC 21.603 43 TAC 21.606 Triggers None specified Click "Edit With Form" above to add content 03TXCEncroachmentIssues.pdf 03TXCEncroachmentIssues.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the procedure for obtaining a state highway asset lease in Texas. The Texas Department of Transportation (TxDOT) may lease any highway asset.


McAllen, TX Natural Gas Pipeline Imports From Mexico (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Dollars per Thousand Cubic Feet) McAllen, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


GRR/Section 19-TX-b - New Water Right Process For Surface Water...  

Open Energy Info (EERE)

TX-b - New Water Right Process For Surface Water and Ground Water < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of...



NLE Websites -- All DOE Office Websites (Extended Search)

2005 Hurricanes on the Natural Gas Industry in the Gulf of Mexico Region Mexico FL GA SC AL MS LA TX AR TN TN Katrina - Cumulative wind > 39 mph Katrina - Cumulative wind > 73 mph...


GRR/Section 11-TX-c - Cultural Resource Discovery Process | Open Energy  

Open Energy Info (EERE)

-TX-c - Cultural Resource Discovery Process -TX-c - Cultural Resource Discovery Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-TX-c - Cultural Resource Discovery Process 11TXCCulturalResourceDiscoveryProcess.pdf Click to View Fullscreen Contact Agencies Texas Historical Commission Regulations & Policies Sec. 191: Antiquities Code Triggers None specified Click "Edit With Form" above to add content 11TXCCulturalResourceDiscoveryProcess.pdf 11TXCCulturalResourceDiscoveryProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative 11-TX-c.1 - Is the Project Located on State or Local Public Land? Before breaking ground at a project location on state or local public land,


EIS-0412: Federal Loan Guarantee to Support Construction of the TX Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12: Federal Loan Guarantee to Support Construction of the TX 12: Federal Loan Guarantee to Support Construction of the TX Energy LLC, Industrial Gasification Facility near Beaumont, Texas EIS-0412: Federal Loan Guarantee to Support Construction of the TX Energy LLC, Industrial Gasification Facility near Beaumont, Texas Overview The Department of Energy is assessing the potential environmental impacts for its proposed action of issuing a Federal loan guarantee to TX Energy, LLC (TXE). TXE submitted an application to DOE under the Federal loan guarantee program pursuant to the Energy Policy Act of 2005 (EPAct 2005) to support construction of the TXE industrial Gasification Facility near Beaumont, Texas. TXE is a subsidiary of Eastman Chemical Company (Eastman) and proposes to develop the Facility on a 417-acre parcel of land. The Facility would


Status and outlook for shale gas and tight oil development in the U.S.  

Gasoline and Diesel Fuel Update (EIA)

Joint Forum on US Shale Gas & Pacific Gas Markets Joint Forum on US Shale Gas & Pacific Gas Markets May 14, 2013 | New York, NY By Adam Sieminski, Administrator U.S. Shale Gas 2 Adam Sieminski , May 14, 2013 Domestic production of shale gas has grown dramatically over the past few years Adam Sieminski , May 14, 2013 3 0 5 10 15 20 25 30 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) shale gas production (dry) billion cubic feet per day Sources: LCI Energy Insight gross withdrawal estimates as of March 2013 and converted to dry production estimates with EIA-calculated average gross-to-dry shrinkage factors by state and/or shale play. Shale gas leads growth in total gas production through 2040 to



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


RCRA Assessment Plan for Single-Shell Tank Waste Management Area TX-TY  

SciTech Connect

WMA TX-TY contains underground, single-shell tanks that were used to store liquid waste that contained chemicals and radionuclides. Most of the liquid has been removed, and the remaining waste is regulated under the RCRA as modified in 40 CFR Part 265, Subpart F and Washington States Hazardous Waste Management Act . WMA TX-TY was placed in assessment monitoring in 1993 because of elevated specific conductance. A groundwater quality assessment plan was written in 1993 describing the monitoring activities to be used in deciding whether WMA TX-TY had affected groundwater. That plan was updated in 2001 for continued RCRA groundwater quality assessment as required by 40 CFR 265.93 (d)(7). This document further updates the assessment plan for WMA TX-TY by including (1) information obtained from ten new wells installed at the WMA after 1999 and (2) information from routine quarterly groundwater monitoring during the last five years. Also, this plan describes activities for continuing the groundwater assessment at WMA TX TY.

Horton, Duane G.



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


GRR/Section 18-TX-a - Underground Storage Tank Process | Open Energy  

Open Energy Info (EERE)

TX-a - Underground Storage Tank Process TX-a - Underground Storage Tank Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-TX-a - Underground Storage Tank Process 18TXAUndergroundStorageTanks (1).pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies 30 Texas Administrative Code 334 - Underground and Aboveground Storage Tanks 30 Texas Administrative Code 37 - Financial Assurance for Petroleum Underground Storage Tanks Triggers None specified Click "Edit With Form" above to add content 18TXAUndergroundStorageTanks (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GRR/Section 3-TX-a - State Geothermal Lease | Open Energy Information  

Open Energy Info (EERE)

3-TX-a - State Geothermal Lease 3-TX-a - State Geothermal Lease < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-a - State Geothermal Lease 03TXAStateGeothermalLease.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Regulations & Policies Texas Natural Resources Code 31 TAC 9.22 31 TAC 13.33 31 TAC 13.62 31 TAC 155.42 Triggers None specified Click "Edit With Form" above to add content 03TXAStateGeothermalLease.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of obtaining a state geothermal lease from the state of Texas. The Texas General Land Office manages


GRR/Section 19-TX-a - Water Access and Water Issues Overview | Open Energy  

Open Energy Info (EERE)

9-TX-a - Water Access and Water Issues Overview 9-TX-a - Water Access and Water Issues Overview < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-a - Water Access and Water Issues Overview 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11 Triggers None specified Click "Edit With Form" above to add content 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf Flowchart Narrative In the late 1960's Texas transitioned its water law system, switching


GRR/Section 19-TX-b - New Water Right Process For Surface Water and Ground  

Open Energy Info (EERE)

TX-b - New Water Right Process For Surface Water and Ground TX-b - New Water Right Process For Surface Water and Ground Water < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-b - New Water Right Process For Surface Water and Ground Water 19TXBNewWaterRightProcessForSurfaceWaterAndGroundWater.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Texas Water Development Board Regulations & Policies Tex. Water Code § 11 Triggers None specified Click "Edit With Form" above to add content 19TXBNewWaterRightProcessForSurfaceWaterAndGroundWater.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 11-TX-b - Human Remains Process | Open Energy Information  

Open Energy Info (EERE)

1-TX-b - Human Remains Process 1-TX-b - Human Remains Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-TX-b - Human Remains Process 11TXBHumanRemainsProcess.pdf Click to View Fullscreen Regulations & Policies CCP Art. 49 Triggers None specified Click "Edit With Form" above to add content 11TXBHumanRemainsProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the procedure a developer must follow when human remains are discovered on or near the project site. Local law enforcement must conduct an investigation into the death of the person, and is the


GRR/Section 14-TX-c - Underground Injection Control Permit | Open Energy  

Open Energy Info (EERE)

TX-c - Underground Injection Control Permit TX-c - Underground Injection Control Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-c - Underground Injection Control Permit Pages from 14TXCUndergroundInjectionControlPermit (4).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 27 16 TAC 3.9 46 TAC 3.46 16 TAC 3.30 - MOU between the RRC and the TCEQ Triggers None specified Click "Edit With Form" above to add content Pages from 14TXCUndergroundInjectionControlPermit (4).pdf Pages from 14TXCUndergroundInjectionControlPermit (4).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 7-TX-b - REC Generator | Open Energy Information  

Open Energy Info (EERE)

TX-b - REC Generator TX-b - REC Generator < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-TX-b - REC Generator 07TXBRECGeneratorCertification.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies Goal for Renewable Energy, PUCT Substantive Rule 25.173 Triggers None specified Click "Edit With Form" above to add content 07TXBRECGeneratorCertification.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the application and approval process for participating in the Renewable Energy Credit program in Texas.


GRR/Section 19-TX-c - Surface Water Permit | Open Energy Information  

Open Energy Info (EERE)

19-TX-c - Surface Water Permit 19-TX-c - Surface Water Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-c - Surface Water Permit 19TXCSurfaceWaterPermit.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11 30 TAC 295 30 TAC 297 Triggers None specified Click "Edit With Form" above to add content 19TXCSurfaceWaterPermit.pdf 19TXCSurfaceWaterPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Texas, the Texas Commission on Environmental Quality (TCEQ) issues surface water permits. Under, Tex. Water Code § 11, surface water permits


GRR/Section 5-TX-a - Drilling and Well Development | Open Energy  

Open Energy Info (EERE)

GRR/Section 5-TX-a - Drilling and Well Development GRR/Section 5-TX-a - Drilling and Well Development < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 5-TX-a - Drilling and Well Development 05TXADrillingAndWellDevelopment.pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas Texas Water Development Board Regulations & Policies 16 TAC 3.5: Application To Drill, Deepen, Reenter, or Plug Back 16 TAC 3.78: Fees and Financial Security Requirements 16 TAC 3.37: Statewide Spacing Rule 16 TAC 3.38: Well Densities 16 TAC 3.39: Proration and Drilling Units: Contiguity of Acreage and Exception 16 TAC 3.33: Geothermal Resource Production Test Forms Required Triggers None specified Click "Edit With Form" above to add content


GRR/Section 14-TX-b - Texas NPDES Permitting Process | Open Energy  

Open Energy Info (EERE)

14-TX-b - Texas NPDES Permitting Process 14-TX-b - Texas NPDES Permitting Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-b - Texas NPDES Permitting Process 14TXBTexasNPDESPermittingProcess (4).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas United States Environmental Protection Agency Regulations & Policies Tex. Water Code § 26.131(b) 16 TAC 3.8 Memorandum of Understanding between the RRC and the TCEQ 16 TAC 3.30 Triggers None specified Click "Edit With Form" above to add content 14TXBTexasNPDESPermittingProcess (4).pdf 14TXBTexasNPDESPermittingProcess (4).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative


,"Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)" Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","nga_epg0_irp_ygrt-nmx_mmcfa.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/nga_epg0_irp_ygrt-nmx_mmcfa.htm" ,"Source:","Energy Information Administration"


GRR/Section 8-TX-a - Transmission Siting | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 8-TX-a - Transmission Siting GRR/Section 8-TX-a - Transmission Siting < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 8-TX-a - Transmission Siting 08TXATransmissionSiting.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUCT Substantive 25.83: Transmission Construction Reports PUCT Substantive Rule 25.101: Certification Criteria Triggers None specified Click "Edit With Form" above to add content 08TXATransmissionSiting.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Transmission siting is handled by the Public Utility Commission of Texas


GRR/Section 6-TX-a - Extra-Legal Vehicle Permitting Process | Open Energy  

Open Energy Info (EERE)

6-TX-a - Extra-Legal Vehicle Permitting Process 6-TX-a - Extra-Legal Vehicle Permitting Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-TX-a - Extra-Legal Vehicle Permitting Process 06TXAExtraLegalVehiclePermittingProcess.pdf Click to View Fullscreen Contact Agencies Texas Department of Motor Vehicles Texas Department of Transportation Regulations & Policies Tex. Transportation Code § 621 Tex. Transportation Code § 622 Tex. Transportation Code § 623 43 TAC 219 Triggers None specified Click "Edit With Form" above to add content 06TXAExtraLegalVehiclePermittingProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 19-TX-d - Transfer of Surface Water Right | Open Energy  

Open Energy Info (EERE)

19-TX-d - Transfer of Surface Water Right 19-TX-d - Transfer of Surface Water Right < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-d - Transfer of Surface Water Right 19TXDTransferOfWaterRight.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11 30 TAC 297.81 30 TAC 297.82 30 TAC 297.83 Triggers None specified Click "Edit With Form" above to add content 19TXDTransferOfWaterRight.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Texas water law allows surface water rights to be transferred from one party to another. (Tex. Water Code § 11)


Hanford Tank Farms Vadose Zone, Addendum to the TX Tank Farm Report  

Science Conference Proceedings (OSTI)

This addendum to the TX Tank Farm Report (GJO-97-13-TAR, GJO-HAN-11) published in September 1997 incorporates the results of high-rate and repeat logging activities along with shape factor analysis of the logging data. A high-rate logging system was developed and deployed in the TX Tank Farm to measure cesium-137 concentration levels in high gamma flux zones where the spectral gamma logging system was unable to collect usable data because of high dead times and detector saturation. This report presents additional data and revised visualizations of subsurface contaminant distribution in the TX Tank Farm at the DOE Hanford Site in the state of Washington.

Spatz, R.



GRR/Section 12-TX-a - Flora and Fauna Considerations | Open Energy  

Open Energy Info (EERE)

TX-a - Flora and Fauna Considerations TX-a - Flora and Fauna Considerations < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 12-TX-a - Flora and Fauna Considerations 12TXAFloraAndFaunaConsiderations.pdf Click to View Fullscreen Contact Agencies Texas Parks and Wildlife Department Regulations & Policies Texas Parks and Wildlife Code § 68 31 TAC 65.175 31 TAC 65.176 31 TAC 65.173 Triggers None specified Click "Edit With Form" above to add content 12TXAFloraAndFaunaConsiderations.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Texas, no person may capture, trap, take, or kill, or attempt to


GRR/Section 14-TX-a - Nonpoint Source Pollution | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 14-TX-a - Nonpoint Source Pollution GRR/Section 14-TX-a - Nonpoint Source Pollution < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-a - Nonpoint Source Pollution 14TXANonpointSourcePollution.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Clean Water Act CWA §319(b) Triggers None specified Click "Edit With Form" above to add content 14TXANonpointSourcePollution.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Texas Nonpoint Source Management Program (Management Program) is required under the Clean Water Act(CWA), specifically CWA §319(b). The


GRR/Section 6-TX-b - Construction Storm Water Permitting Process | Open  

Open Energy Info (EERE)

6-TX-b - Construction Storm Water Permitting Process 6-TX-b - Construction Storm Water Permitting Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-TX-b - Construction Storm Water Permitting Process 06TXBConstructionStormWaterPermit.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality EPA Regulations & Policies TPDES Construction General Permit (TXR150000) 30 Texas Administrative Code 205 General Permits for Waste Discharges Texas Water Code 26.040 General Permits Clean Water Act Triggers None specified Click "Edit With Form" above to add content 06TXBConstructionStormWaterPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 4-TX-a - State Exploration Process | Open Energy Information  

Open Energy Info (EERE)

4-TX-a - State Exploration Process 4-TX-a - State Exploration Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-TX-a - State Exploration Process 04TXAStateExplorationProcess.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Railroad Commission of Texas Texas Parks and Wildlife Department Regulations & Policies 16 TAC 3.5: Application to Drill, Deepen, Reenter, or Plug Back 16 TAC 3.7: Strata to Be Sealed Off 16 TAC 3.79: Definitions 16 TAC 3.100: Seismic Holes and Core Holes 31 TAC 10.2: Prospect Permits on State Lands 31 TAC 155.40: Definitions 31 TAC 155.42: Mining Leases on Properties Subject to Prospect 31 TAC 9.11: Geophysical and Geochemical Exploration Permits Triggers None specified


GRR/Section 14-TX-d - Section 401 Water Quality Certification | Open Energy  

Open Energy Info (EERE)

4-TX-d - Section 401 Water Quality Certification 4-TX-d - Section 401 Water Quality Certification < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-d - Section 401 Water Quality Certification 14TXDSection401WaterQualityCertification (2).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas Regulations & Policies 16 TAC 3.93 - RRC Water Quality Certification 16 TAC 3.30 - MOU between the RRC and the TCEQ Triggers None specified Click "Edit With Form" above to add content 14TXDSection401WaterQualityCertification (2).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Section 401 of the Clean Water Act (CWA) requires a Water Quality


GRR/Section 3-TX-b - Land Access | Open Energy Information  

Open Energy Info (EERE)

3-TX-b - Land Access 3-TX-b - Land Access < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-b - Land Access 03TXBLandAccess.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Railroad Commission of Texas Regulations & Policies Tex. Nat. Rec. Code Sec. 51.291(a) Tex. Nat. Rec. Code Sec. 33.111 Triggers None specified Click "Edit With Form" above to add content 03TXBLandAccess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of gaining access to certain types of land in Texas apart from the geothermal resource lease process.

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GRR/Section 14-TX-e - Ground Water Discharge Permit | Open Energy  

Open Energy Info (EERE)

GRR/Section 14-TX-e - Ground Water Discharge Permit GRR/Section 14-TX-e - Ground Water Discharge Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-e - Ground Water Discharge Permit 14TXEGroundWaterDischargePermit (1).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas United States Environmental Protection Agency Regulations & Policies 16 TAC 3.8 (Rule 8) Triggers None specified Click "Edit With Form" above to add content 14TXEGroundWaterDischargePermit (1).pdf 14TXEGroundWaterDischargePermit (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Pits are used in drilling operations to contain drilling related fluids and


GRR/Section 7-TX-a - Energy Facility Registration | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 7-TX-a - Energy Facility Registration GRR/Section 7-TX-a - Energy Facility Registration < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-TX-a - Energy Facility Registration 07TXAEnergyFacilitySiting.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUC Substantive Rule 25.109: Registration of Power Generation Companies and Self-Generators Triggers None specified Click "Edit With Form" above to add content 07TXAEnergyFacilitySiting.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the necessary process for registering as an


GRR/Section 7-TX-c - Certificate of Convenience and Necessity | Open Energy  

Open Energy Info (EERE)

GRR/Section 7-TX-c - Certificate of Convenience and Necessity GRR/Section 7-TX-c - Certificate of Convenience and Necessity < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-TX-c - Certificate of Convenience and Necessity 07TXCCertificateOfConvenienceAndNecessity.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUCT Substantive Rule 22 PUCT Substantive Rule 25.5 PUCT Substantive Rule 25.83 PUCT Substantive Rule 25.101 Public Utility Regulatory Act Triggers None specified Click "Edit With Form" above to add content 07TXCCertificateOfConvenienceAndNecessity.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Texas AgriLife Research and Extension Center 17360 Coit Road, Dallas, TX 75252  

E-Print Network (OSTI)

Texas AgriLife Research and Extension Center 17360 Coit Road, Dallas, TX 75252 Fall Integrated Pest Management Seminar Melody Lee Texas Department of Agriculture -- Dallas Dr. Dotty Woodson Texas AgriLife Extension Service--Dallas Dr. Young-Ki Jo Texas AgriLife Extension Service -- College Station Dr. James Mc

Wilkins, Neal


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



File:15-TX-a- Fact Sheet - Tips for a Speedy Administrative Review.pdf |  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search File Edit History Facebook icon Twitter icon » File:15-TX-a- Fact Sheet - Tips for a Speedy Administrative Review.pdf Jump to: navigation, search File File history File usage Metadata File:15-TX-a- Fact Sheet - Tips for a Speedy Administrative Review.pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 16 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 14:17, 12 June 2013 Thumbnail for version as of 14:17, 12 June 2013 1,275 × 1,650 (16 KB) Apalazzo (Talk | contribs)


File:03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf |  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search File Edit History Facebook icon Twitter icon » File:03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 46 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 12:50, 26 July 2013 Thumbnail for version as of 12:50, 26 July 2013 1,275 × 1,650 (46 KB) Apalazzo (Talk | contribs)


File:USDA-CE-Production-GIFmaps-TX.pdf | Open Energy Information  

Open Energy Info (EERE)

TX.pdf TX.pdf Jump to: navigation, search File File history File usage Texas Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 442 KB, MIME type: application/pdf) Description Texas Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Texas External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:21, 27 December 2010 Thumbnail for version as of 16:21, 27 December 2010 1,650 × 1,275 (442 KB) MapBot (Talk | contribs) Automated bot upload


GRR/Section 15-TX-a - Air Permit - Permit to Construct | Open Energy  

Open Energy Info (EERE)

GRR/Section 15-TX-a - Air Permit - Permit to Construct GRR/Section 15-TX-a - Air Permit - Permit to Construct < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 15-TX-a - Air Permit - Permit to Construct 15TXAAirPermitPermitToConstruct (1).pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Title 30 of the Texas Administrative Code 30 TAC 116.114 30 TAC 39.418 30 TAC 39.604 30 TAC 39.605 30 TAC 39.409 30 TAC 116.136 30 TAC 55.254 30 TAC 116.136 30 TAC 116.137 Triggers None specified Click "Edit With Form" above to add content 15TXAAirPermitPermitToConstruct (1).pdf 15TXAAirPermitPermitToConstruct (1).pdf 15TXAAirPermitPermitToConstruct (1).pdf Error creating thumbnail: Page number not in range.


File:03-TX-g - Lease of Relinquishment Act Lands.pdf | Open Energy  

Open Energy Info (EERE)

-TX-g - Lease of Relinquishment Act Lands.pdf -TX-g - Lease of Relinquishment Act Lands.pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-g - Lease of Relinquishment Act Lands.pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Go to page 1 2 Go! next page → next page → Full resolution ‎(1,275 × 1,650 pixels, file size: 82 KB, MIME type: application/pdf, 2 pages) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 11:49, 29 July 2013 Thumbnail for version as of 11:49, 29 July 2013 1,275 × 1,650, 2 pages (82 KB) Apalazzo (Talk | contribs) 14:43, 26 July 2013 Thumbnail for version as of 14:43, 26 July 2013 1,275 × 1,650, 2 pages (82 KB) Apalazzo (Talk | contribs)


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rick Dunst Rick Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 MS 922-273C Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Felicia Manciu Principal Investigator University of Texas at El Paso 500 West University Avenue El Paso, TX 79968-8900 915-747-5715 fsmanciu@utep.edu PROJECT DURATION Start Date 01/15/2009 End Date 12/15/2013 COST Total Project Value $249,546 DOE/Non-DOE Share $249,546 / $0


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Tank 241-TX-118, core 236 analytical results for the final report  

SciTech Connect

This document is the analytical laboratory report for tank 241-TX-118 push mode core segments collected between April 1, 1998 and April 13, 1998. The segments were subsampled and analyzed in accordance with the Tank 241-TX-118 Push Mode Core sampling and Analysis Plan (TSAP) (Benar, 1997), the Safety Screening Data Quality Objective (DQO) (Dukelow, et al., 1995), the Data Quality Objective to Support Resolution of the Organic Complexant Safety Issue (Organic DQO) (Turner, et al, 1995) and the Historical Model Evaluation Data Requirements (Historical DQO) (Sipson, et al., 1995). The analytical results are included in the data summary table (Table 1). None of the samples submitted for Differential Scanning Calorimetry (DSC) and Total Organic Carbon (TOC) exceeded notification limits as stated in the TSAP (Benar, 1997). One sample exceeded the Total Alpha Activity (AT) analysis notification limit of 38.4{micro}Ci/g (based on a bulk density of 1.6), core 236 segment 1 lower half solids (S98T001524). Appropriate notifications were made. Plutonium 239/240 analysis was requested as a secondary analysis. The statistical results of the 95% confidence interval on the mean calculations are provided by the Tank Waste Remediation Systems Technical Basis Group in accordance with the Memorandum of Understanding (Schreiber, 1997) and are not considered in this report.




File:03-TX-f - Lease of Land Trade Lands.pdf | Open Energy Information  

Open Energy Info (EERE)

f - Lease of Land Trade Lands.pdf f - Lease of Land Trade Lands.pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-f - Lease of Land Trade Lands.pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 42 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 13:54, 26 July 2013 Thumbnail for version as of 13:54, 26 July 2013 1,275 × 1,650 (42 KB) Apalazzo (Talk | contribs) You cannot overwrite this file. Edit this file using an external application (See the setup instructions for more information) File usage The following page links to this file: GRR/Section 3-TX-f - Lease of Land Trade Lands


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


RCRA Assessment Plan for Single-Shell Tank Waste Management Area TX-TY at the Hanford Site  

SciTech Connect

A groundwater quality assessment plan was prepared to investigate the rate and extent of aquifer contamination beneath Waste Management Area TX-TY on the Hanford Site in Washington State. This plan is an update of a draft plan issued in February 1999, which guided work performed in fiscal year 2000.

Hodges, Floyd N.; Chou, Charissa J.



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



Application of CC at a Corporate Headquarters Facility in Dallas, TX  

E-Print Network (OSTI)

A corporate headquarters complex located in Dallas, TX consists of four buildings served by a central utility plant. The Continuous Commissioning (CC) process was applied to one building with approximately 688,000 square feet of primarily of data floor space. This building was identified as a candidate for the CC process because it consumed 58% of the 132 million kWh of electricity used by the complex in 2010 and had recently received several HVAC upgrades. CC is an ongoing process for existing buildings and central plant facilities to resolve operating problems, improve comfort, optimize energy use, and identify retrofits based on current building usage rather than original design intent [1]. The data floor optimization process consisted of three components: traditional commissioning activities, CC measure implementation, and low cost retrofits. Various M&V strategies were also utilized to quantify the resulting energy savings in a building whose energy use is dominated by data equipment load. Using six months of pre- and post- implementation HVAC equipment electrical service meter trend data, a savings of 948,700 kWh was achieved. When these savings are extrapolated to twelve months, this project is expected to reduce the 2010 HVAC electricity usage by 25% ($133,000). Once the central plant savings are included, the overall savings of this project is approximately $146,000/year.

Meline, K.; Kimla, J.



Lessons Learned from Continuous Commissioning of the Robert E. Johnson State Office Building, Austin, TX  

E-Print Network (OSTI)

The Robert E. Johnson State Office building is a 5-story, 303,389 square foot office building built in 2000 located in downtown Austin, TX. The original building design included a number of energy conservation measures that were incorporated into the final construction. During the investigation of the building, four energy conservation measures were identified, three of which deal with conventional HVAC systems. The fourth is related to the currently unutilized daylighting system which was one of the energy conservation measures of the original building design. Utilizing this system would lead to approximately 18.5% annual lighting energy savings or 5.6% annual whole building energy savings based on a DOE-2 simulation analysis. Three main lessons were learned from the experience with the Robert E. Johnson building: The traditional design-construction-operation team must include the energy conservation analysis team The entire building process should be reorganized to assure that complete information is provided and passed on from the energy conservation analysis team High performance buildings should be continuously monitored and analyzed

Bynum, J.; Claridge, D. E.



File:03-TX-d - Lease of Public School Fund Land (1).pdf | Open Energy  

Open Energy Info (EERE)

Land (1).pdf Land (1).pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-d - Lease of Public School Fund Land (1).pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 41 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 11:26, 29 July 2013 Thumbnail for version as of 11:26, 29 July 2013 1,275 × 1,650 (41 KB) Apalazzo (Talk | contribs) 13:47, 26 July 2013 Thumbnail for version as of 13:47, 26 July 2013 1,275 × 1,650 (41 KB) Apalazzo (Talk | contribs) You cannot overwrite this file. Edit this file using an external application (See the setup instructions for more information)


TxDOT Goes Beyond Compliance by Purchasing 100% AFVs. EPAct Fleet Information and Regulations, State& Alternative Fuel Provider Program Success Story  

DOE Green Energy (OSTI)

Fact sheet features the challenges the Texas Department of Transportation (TxDOT) faced and overcame in complying to a Texas legislation that calls for the acquisition of only alternative fuel vehicles.

Not Available



CALDERN, HCTOR. Narratives of Greater Mxico: Essays on Chicano Literary History, Genre, and Borders. Austin, TX: U of Texas P, 2004. 284 pp.  

E-Print Network (OSTI)

Borders. Austin, TX: U of Texas P, 2004. 284 pp. "There areEl New Paso and Ro Grande, Texas; Mxico; San Francisco andthe and cultural migrant Texas-Mexican farmworker community

Prez, Marisol



To be presented at the 2007 ASHRAE Winter Meeting, January 27-31, 2007, Dallas, TX. Measured energy performance a US-China demonstration  

E-Print Network (OSTI)

LBNL-60978 To be presented at the 2007 ASHRAE Winter Meeting, January 27-31, 2007, Dallas, TX efficient than ASHRAE 90.1- 1999. The utility data from the first year's operation match well the analysis


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Optimal Deployment Plan of Emission Reduction Technologies for TxDOT's Construction Equipment  

E-Print Network (OSTI)

The purpose of this study was to develop and test an optimization model that will provide a deployment plan of emission reduction technologies to reduce emissions from non-road equipment. The focus of the study was on the counties of Texas that have nonattainment (NA) and near-nonattainment (NNA) status. The objective of this research was to develop methodologies that will help to deploy emission reduction technologies for non-road equipment of TxDOT to reduce emissions in a cost effective and optimal manner. Three technologies were considered for deployment in this research, (1) hydrogen enrichment (HE), (2) selective catalytic reduction (SCR) and (3) fuel additive (FA). Combinations of technologies were also considered in the study, i.e. HE with FA, and SCR with FA. Two approaches were investigated in this research. The first approach was "Method 1" in which all the technologies, i.e. FA, HE and SCR were deployed in the NA counties at the first stage. In the second stage the same technologies were deployed in the NNA counties with the remaining budget, if any. The second approach was called "Method 2" in which all the technologies, i.e. FA, HE and SCR were deployed in the NA counties along with deploying only FA in the NNA counties at the first stage. Then with the remaining budget, SCR and HE were deployed in the NNA counties in the second stage. In each of these methods, 2 options were considered, i.e. maximizing NOx reduction with and without fuel economy consideration in the objective function. Thus, the four options investigated each having different mixes of emission reduction technologies include Case 1A: Method 1 with fuel economy consideration; Case 1B: Method 1 without fuel economy consideration; Case 2A: Method 2 with fuel economy consideration; and Case 2B: Method 2 without fuel economy consideration and were programmed with Visual C++ and ILOG CPLEX. These four options were tested for budget amounts ranging from $500 to $1,183,000 and the results obtained show that for a given budget one option representing a mix of technologies often performed better than others. This is conceivable because for a given budget the optimization model selects an affordable option considering the cost of technologies involved while at the same time maximum emission reduction, with and without fuel economy consideration, is achieved. Thus the alternative options described in this study will assist the decision makers to decide about the deployment preference of technologies. For a given budget, the decision maker can obtain the results for total NOx reduction, combined diesel economy and total combined benefit using the four models mentioned above. Based on their requirements and priorities, they can select the desired model and subsequently obtain the required deployment plan for deploying the emission reduction technologies in the NA and NNA counties.

Bari, Muhammad Ehsanul



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



2004 Initial Assessments for the T and TX TY Tank Farm Field Investigation Report (FIR): Numerical Simulations  

SciTech Connect

In support of CH2M HILL Hanford Group, Inc.s (CHG) preparation of a Field Investigative Report (FIR) for the Hanford Site Single-Shell Tank Waste Management Area (WMA) T and TX-TY, a suite of numerical simulations of flow and solute transport was executed using the STOMP code to predict the performance of surface barriers for reducing long-term risks from potential groundwater contamination at the T and TX-TY WMA. The scope and parametric data for these simulations were defined by a modeling data package provided by CHG. This report documents the simulation involving 2-D cross sections through the T Tank and the TX-TY Tank Farm. Eight cases were carried out for the cross sections to simulate the effects of interim barrier, water line leak, inventory distribution, and surface recharge on water flow and the transport of long-lived radionuclides (i.e., technecium-99 and uranium) and chemicals (i.e., nitrate and chromium For simulations with barriers, it is assumed that an interim barrier is in place by the year 2010. It was also assumed that, for all simulations, as part of tank farm closure, a closure barrier was in place by the year 2040. The modeling considers the estimated inventories of contaminants within the vadose zone and calculates the associated risk. It assumes that no tanks will leak in the future. Initial conditions for contaminant concentration are provided as part of inventory estimates for uranium, technetium-99, nitrate, and chromium. For moisture flow modeling, Neumann boundary conditions are prescribed at the surface with the flux equal to the recharge rate estimate. For transport modeling, a zero flux boundary is prescribed at the surface for uranium, technetium-99, nitrate, and chromium. The western and eastern boundaries are assigned no-flux boundaries for both flow and transport. The water table boundary is prescribed by water table elevations and the unconfined aquifer hydraulic gradient. No-flux boundaries are used for the lower boundary. Numerical results were obtained for compliance at the WMA boundary, 200 Areas boundary, exclusion boundary beyond the 200 Areas, and the Columbia River (DOE-RL 2000). Streamtube/analytical models were used to route computed contaminant concentrations at the water table to the downstream compliance points. When the interim barrier was applied at 2010, the soil was desaturated gradually. The difference in saturation of the soil with and without the interim barrier was the largest at 2040, the time the closure barrier was applied. After this, the difference in saturation in the two cases became smaller with time. Generally, the solutes broke though faster if there was a water line leak. A relative small five-day leak (Case 4) had little effect on the peak concentration, while a large 20-yr leak (Case 3) increased the peak concentration significantly and reduced the solute travel in the vadose zone. The distribution of the inventory, either uniform or nonuniform, has little effect on peak arrival time; the peak concentrations of the conservative solutes varied by -6.9 to 0.2% for the T tank farm and by 11 to 49.4% for the TX tank farm. The reduction of the meteoric recharge before the barrier was applied led to less soil saturation, as expected, and thus longer solute travel time in the vadose zone and smaller peak fence line concentration. The effect on soil saturation lasted for about another 50 years after the barrier was applied at 2050. However, the reduced recharge rate affected the breakthough curve till the end of the simulation. The fence line concentrations at the year 3000 were always higher for cases with reduced natural recharge than for those of the base case, which indicates that the fundamental impact of the reduced natural recharge is a smoothing of the breakthrough concentrations at the compliance points.

Zhang, Z. F.; Freedman, Vicky L.; Waichler, Scott R.



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Antrim County, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

9730441°, -85.1769095° 9730441°, -85.1769095° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.9730441,"lon":-85.1769095,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



U.S. Energy Information Administration (EIA) Indexed Site

THURSDAY, APRIL 2, 2009 The meeting convened at 9:00 a.m. in Room 8E-089 of the James Forrestal Building, 1000 Independence Avenue, SW, Washington, D.C., Ed Blair, Chair, presiding. COMMITTEE MEMBERS PRESENT: EDWARD BLAIR, Chair STEVE BROWN MICHAEL COHEN BARBARA FORSYTH WALTER HILL VINCENT IANNACCHIONE NANCY KIRKENDALL EDWARD KOKKELENBERG ISRAEL MELENDEZ MICHAEL TOMAN JOHN WEYANT (202) 234-4433 Neal R. Gross & Co., Inc. Page 2 EIA STAFF PRESENT: STEPHANIE BROWN, Designated Federal Official, Director, Statistics and Methods Group (SMG) JAMES BERRY CAROL JOYCE BLUMBERG TINA BOWERS JAKE BOURNAZIAN, SMG EUGENE BURNS MICHAEL COLE, Office of Integrated Analysis and Forecasting (OIAF) JOHN CONTI BRENDA COX, SRA RAMESH DANDEKAR, SMG

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



U.S. Energy Information Administration (EIA) Indexed Site

FRIDAY APRIL 3, 2009 The meeting convened at 9:00 a.m. in Room 8E-089 of the James Forrestal Building, 1000 Independence Avenue, S.W., Washington, D.C., Edward Blair, Chair, presiding. COMMITTEE MEMBERS PRESENT: EDWARD BLAIR, Chair STEVE BROWN BARBARA FORSYTH WALTER HILL VINCENT IANNACCHIONE NANCY KIRKENDALL EDWARD KOKKELENBERG ISRAEL MELENDEZ MICHAEL TOMAN JOHN WEYANT (202) 234-4433 Neal R. Gross & Co., Inc. Page 2 EIA STAFF PRESENT: STEPHANIE BROWN, Designated Federal Official, Director, Statistics and Methods Group (SMG) JAMES BERRY CAROL JOYCE BLUMBERG TINA BOWERS JAKE BOURNAZIAN, SMG EUGENE BURNS MICHAEL COLE, Office of Integrated Analysis and Forecasting (OIAF) JOHN CONTI BRENDA COX, SRA RAMESH DANDEKAR, SMG JOHN PAUL DELEY, OIT


Alkali/TX sub 2 catalysts for CO/H sub 2 conversion to C sub 1 -C sub 4 alcohols  

DOE Green Energy (OSTI)

The objective of this research is to investigate and develop novel catalysts for the conversion of coal-derived synthesis gas into C{sub 1}--C{sub 4} alcohols by a highly selective process. Therefore, the variations of catalyst activity and selectivity for the synthesis of alcohols from H{sub 2}/CO {le}1 synthesis gas for a series of A/TX{sub 2} compounds, where A is a surface alkali dopant, T is a transition metal, and X is a S, Se, or Te, will be determined. The alkali component A, which is essential for C-O and C-C bond forming reactions leading to alcohols, will be highly dispersed on the TX{sub 2} surfaces by using chemical vapor deposition (CVD) and chemical complexation/anchoring (CCA) methods. Catalysts that have been prepared during this quarter include RuS{sub 2}, NbS{sub 2}, K/MoS{sub 2}, and K/Crown either/MoS{sub 2}. Catalysts tested include KOH/MoS{sub 2} and K/Crown ether/MoS{sub 2}. 9 refs., 10 figs., 2 tabs.

Klier, K.; Herman, R.G.; Brimer, A.; Richards, M.; Kieke, M.; Bastian, R.D.



Characterization of Vadose Zone Sediments Below the TX Tank Farm: Boreholes C3830, C3831, C3832 and RCRA Borehole 299-W10-27  

Science Conference Proceedings (OSTI)

This report was revised in September 2008 to remove acid-extractable sodium data from Tables 4.8, 4.28,4.43, and 4.59. The sodium data was removed due to potential contamination introduced during the acid extraction process. The rest of the text remains unchanged from the original report issued in April 2004. The overall goal of the Tank Farm Vadose Zone Project, led by CH2M HILL Hanford Group, Inc., is to define risks from past and future single-shell tank farm activities at Hanford. To meet this goal, CH2M HILL Hanford Group, Inc. tasked scientists from Pacific Northwest National Laboratory to perform detailed analyses on vadose zone sediments from within Waste Management Area (WMA) T-TX-TY. This report is the first of two reports written to present the results of these analyses. Specifically, this report contains all the geologic, geochemical, and selected physical characterization data collected on vadose zone sediment recovered from boreholes C3830, C3831, and C3832 in the TX Tank Farm, and from borehole 299-W-10-27 installed northeast of the TY Tank Farm.

Serne, R. Jeffrey; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; Legore, Virginia L.; Orr, Robert D.; Kutnyakov, Igor V.; Baum, Steven R.; Geiszler, Keith N.; Valenta, Michelle M.; Vickerman, Tanya S.



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Characterization of Vadose Zone Sediments Below the TX Tank Farm: Probe Holes C3830, C3831, C3832 and 299-W10-27  

Science Conference Proceedings (OSTI)

Pacific Northwest National Laboratory performed detailed analyses on vadose zone sediments from within Waste Management Area T-TX-TY. This report contains all the geologic, geochemical, and selected physical characterization data collected on vadose zone sediment recovered from three probe holes (C3830, C3831, and C3832) in the TX Tank Farm, and from borehole 299-W-10-27. Sediments from borehole 299-W-10-27 are considered to be uncontaminated sediments that can be compared with contaminated sediments. This report also presents our interpretation of the sediment lithologies, the vertical extent of contamination, the migration potential of the contaminants, and the likely source of the contamination in the vadose zone and groundwater below the TX Tank Farm. Sediment from the probe holes was analyzed for: moisture, radionuclide and carbon contents;, one-to-one water extracts (soil pH, electrical conductivity, cation, trace metal, and anion data), and 8 M nitric acid extracts. Overall, our analyses showed that common ion exchange is a key mechanism that influences the distribution of contaminants within that portion of the vadose zone affected by tank liquor. We did not observe significant indications of caustic alteration of the sediment mineralogy or porosity, or significant zones of slightly elevated pH values in the probe holes. The sediments do show that sodium-, nitrate-, and sulfate-dominated fluids are present. The fluids are more dilute than tank fluids observed below tanks at the SX and BX Tank Farms. Three primary stratigraphic units were encountered in each probe hole: (1) backfill material, (2) the Hanford formation, and (3) the Cold Creek unit. Each of the probe holes contain thin fine-grained layers in the Hanford H2 stratigraphic unit that may impact the flow of leaked fluids and effect irregular and horizontal flow. The probe holes could not penetrate below the enriched calcium carbonate strata of the Cold Creek lower subunit; therefore, we did not identify the maximum vertical penetration of the tank related plumes. However, the more elevated portions of the electrical conductivity (EC) profile at probe hole C3830 currently resides at the bottom of a fine-grained thin lens in the Hanford H2 unit at 87 ft bgs. At C3831, we lack good sample coverage to ascertain whether the salt plume has significantly descended into the Cold Creek Unit. There is strong indication at probe hole C3832 that the saline plume has descended into the Cold Creek Unit. The profiles do collectively suggest that the deepest penetration of tank related fluids is found in probe hole C3832. The water potential data from 299-W10-27?s H2 unit, the unit where most of the contaminants reside in the TX probe holes, are consistent with a draining profile. Despite the evidence that elevated EC values may be present in all three probe holes to their depth of refusal, the concentrations of long-term risk drivers are not large. The inventories of potential contaminants of concern, nitrate, technetium-99, uranium, and chromium, are provided. In addition, in situ desorption Kd values for these contaminants are provided. For conservative modeling purposes, we recommend using Kd values of 0 mL/g for nitrate and technetium-99, a value of 1 mL/g for uranium, and 10 mL/g for chromium to represent the entire vadose zone profile from the bottoms of the tanks to the water table. These conservative Kd values along with the provided inventories in the vadose zone sediments obtained from the three probe holes can be used in long-term risk projections that rely on estimates of water recharge and vadose zone and aquifer transport calculations.

Serne, R JEFFREY.; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; LeGore, Virginia L.; Orr, Robert D.; Kutnyakov, Igor V.; Baum, Steven R.; Geiszler, Keith N.; Valenta, Michelle M.; Vickerman, Tanya S.



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

+ + + + + STUDYING THE COMMUNICATIONS REQUIREMENTS OF ELECTRIC UTILITIES TO INFORM FEDERAL SMART GRID POLICIES + + + + + PUBLIC MEETING + + + + + THURSDAY, JUNE 17, 2010 + + + + + The Public Meeting was held in Room 8E069 at the Department of Energy, Forrestal Building, 1000 Independence Avenue, S.W., Washington, D.C., at 10:00 a.m., Scott Blake Harris, Chair, presiding. PRESENT: BECKY BLALOCK SHERMAN J. ELLIOTT LYNNE ELLYN SCOTT BLAKE HARRIS JIM INGRAHAM JIM L. JONES MICHAEL LANMAN KYLE McSLARROW ROY PERRY 202-234-4433 Neal R. Gross & Co., Inc. Page 2



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WEDNESDAY WEDNESDAY OCTOBER 19, 2011 + + + + + The Electricity Advisory Committee met in the Conference Center of the National Rural Electric Cooperative Association Headquarters, 4301 Wilson Boulevard, Arlington, Virginia, at 2:00 p.m., Richard Cowart, Chair, presiding. MEMBERS PRESENT RICHARD COWART, Regulatory Assistance Project, Chair THE HONORABLE ROBERT CURRY, New York State Public Service Commission JOSE DELGADO, American Transmission Company (Ret.) ROGER DUNCAN, Austin Energy (Ret.) ROBERT GRAMLICH, American Wind Energy Association MICHAEL HEYECK, American Electric Power JOSEPH KELLIHER, NextEra Energy, Inc. EDWARD KRAPELS, Anbaric Holdings RALPH MASIELLO, KEMA RICH MEYER, National Rural Electric


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester


Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

THURSDAY THURSDAY OCTOBER 20, 2011 + + + + + The Electricity Advisory Committee met, in the Conference Center of the National Rural Electric Cooperative Association Headquarters, 4301 Wilson Boulevard, Arlington, Virginia, at 8:00 a.m., Richard Cowart, Chair, presiding. MEMBERS PRESENT RICHARD COWART, Regulatory Assistance Project, Chair RICK BOWEN, Alcoa RALPH CAVANAGH, Natural Resources Defense Council THE HONORABLE ROBERT CURRY, New York State Public Service Commission JOSE DELGADO, American Transmission Company (Ret.) ROGER DUNCAN, Austin Energy (Ret.) ROBERT GRAMLICH, American Wind Energy Association MICHAEL HEYECK, American Electric Power JOSEPH KELLIHER, NextEra Energy, Inc. EDWARD KRAPELS, Anbaric Holdings


Micro-Grids for Colonias (TX)  

Science Conference Proceedings (OSTI)

This report describes the results of the final implementation and testing of a hybrid micro-grid system designed for off-grid applications in underserved Colonias along the Texas/Mexico border. The project is a federally funded follow-on to a project funded by the Texas State Energy Conservation Office in 2007 that developed and demonstrated initial prototype hybrid generation systems consisting of a proprietary energy storage technology, high efficiency charging and inverting systems, photovoltaic cells, a wind turbine, and bio-diesel generators. This combination of technologies provided continuous power to dwellings that are not grid connected, with a significant savings in fuel by allowing power generation at highly efficient operating conditions. The objective of this project was to complete development of the prototype systems and to finalize and engineering design; to install and operate the systems in the intended environment, and to evaluate the technical and economic effectiveness of the systems. The objectives of this project were met. This report documents the final design that was achieved and includes the engineering design documents for the system. The system operated as designed, with the system availability limited by maintenance requirements of the diesel gensets. Overall, the system achieved a 96% availability over the operation of the three deployed systems. Capital costs of the systems were dependent upon both the size of the generation system and the scope of the distribution grid, but, in this instance, the systems averaged $0.72/kWh delivered. This cost would decrease significantly as utilization of the system increased. The system with the highest utilization achieved a capitol cost amortized value of $0.34/kWh produced. The average amortized fuel and maintenance cost was $0.48/kWh which was dependent upon the amount of maintenance required by the diesel generator. Economically, the system is difficult to justify as an alternative to grid power. However, the operational costs are reasonable if grid power is unavailable, e.g. in a remote area or in a disaster recovery situation. In fact, avoided fuel costs for the smaller of the systems in use during this project would have a payback of the capital costs of that system in 2.3 years, far short of the effective system life.

Dean Schneider; Michael Martin; Renee Berry; Charles Moyer



Freeport, TX LNG Imports from All Countries  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


TX, RRC District 6 Proved Nonproducing Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Includes only those ...


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Shale-Derived Dissolved Organic Matter as a Substrate for Subsurface Methanogenic Communities in the Antrim Shale, Michigan Basin, USA.  

E-Print Network (OSTI)

??The microbial origin of methane produced from sedimentary basins is a subject of great interest, with implications for the global cycling of carbon as well (more)

Huang, Roger



Category:SecondarySchool | Open Energy Information  

Open Energy Info (EERE)

IA MidAmerican Energy Co (Iowa).png SVSecondarySchool Des ... 68 KB SVSecondarySchool Detroit MI Detroit Edison Co.png SVSecondarySchool Detr... 66 KB SVSecondarySchool El Paso TX...



NLE Websites -- All DOE Office Websites (Extended Search)

A . ID 'ODE Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 PAGE 1 OF 2 PAGES MI83 I April 1,2009 6. ISSUED BY CODE U.S. Department of Energy...



NLE Websites -- All DOE Office Websites (Extended Search)



Vehicle Technologies Office: Fact #672: April 25, 2011 Freight...  

NLE Websites -- All DOE Office Websites (Extended Search)

82.4 167.9 Long Beach, CA Water 4 32.8 119.2 152 Houston, TX Water 5 68.5 78.2 146.7 Detroit, MI Land 6 66.5 53.7 120.2 Laredo, TX Land 7 53.9 61.8 115.8 Chicago, IL Air 8 35.9...



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Oil and Gas Field Code Index  

U.S. Energy Information Administration (EIA)

000478 TX Cat 000479 TX Cattail Hollow 000480 TX Catto 000481 TX Cavallo West 000482 TX Cayman 000483 TX Cecile South 000484 TX Celery 000485 OK Centerpoint SW


Markowski Briefing, June 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

III Development III Development Phase Injection Test RCSP Annual Meeting Pittsburgh, PA October 5, 2010 David Ball 2 Michigan Basin MRCSP Geologic Test Sites Aligned with major geologic provinces Geo Test Sites Phase II Phase III 3 Sparr Road Our proposed Phase III site is near our Phase II Michigan Basin site Otsego County, MI Chester 10 Gas Processing Plant and Compressor Station. Phase III Test Site. Charlton 30/31 Phase II Test Site 4 Phase III Site Synopsis * Location: - Chester Township, Otsego County MI * Injection Target: - Primary target is St. Peter Sandstone - Additional and/or backup target is Bass Island/Bois Blanc * Injection Goal: - 1 million metric tons of CO 2 - Approximately four years of injection * Source of CO 2 : - Processing of natural gas from Antrim Shale * Key Local Participants:


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding


TX, RRC District 4 Onshore Nonassociated Natural Gas Proved Reserves...  

Gasoline and Diesel Fuel Update (EIA)

Increases 860 980 1,064 798 1,129 2,390 1979-2011 Revision Decreases 1,900 854 1,684 1,456 882 1,133 1979-2011 Sales 1,198 1,895 191 273 219 964 2000-2011 Acquisitions 1,235...


TX, RRC District 1 Nonassociated Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

,048 1,029 987 1,456 2,332 5,227 1979-2011 Adjustments 83 -6 113 5 -95 -42 1979-2011 Revision Increases 32 51 37 110 430 2,184 1979-2011 Revision Decreases 186 109 143 110 331 116...


TX, RRC District 3 Onshore Nonassociated Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

1979-2011 Adjustments 28 16 74 -105 56 -29 1979-2011 Revision Increases 401 445 324 456 419 355 1979-2011 Revision Decreases 454 444 491 338 288 225 1979-2011 Sales 412 565 70...


El Paso, TX Natural Gas Pipeline Exports to Mexico (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 958: 860: 509: 487: 503: 482: 449: 452: 456: 531: 670: 1,024: 2012: 710: 783: 648: 505: 407: 432: 469: 490 ...


TX, RRC District 8 Associated-Dissolved Natural Gas Proved ...  

U.S. Energy Information Administration (EIA)

Area: Period: Annual : Download Series History: Definitions, Sources ... 51: 102: 285: 153: 2000-2011: Acquisitions: 148: 169: 189: 119: 805: 485: 2000-2011 ...


,"TX, RRC District 1 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 3 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 4 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 8 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 2 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 5 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 9 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, State Offshore Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 10 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 6 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


Freeport, TX LNG Imports (Price) from Yemen (Dollars per Thousand...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- -- 2010's -- 10.30...

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Houston-Galveston, TX Alternative Fuel Vehicle (AFV) Incentives...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Savings For Alternative Fuel Vehicles Program Information Funding Source Greater Houston Clean Cities Coalition Texas Program Type Vehicle Purchase & Infrastructure Development...


El Paso, TX Natural Gas Imports by Pipeline from Mexico  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 1998 1999 2000 2001 2002 View...


Alamo, TX Natural Gas Imports by Pipeline from Mexico  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2006 2007 2008 2009 2010 2011 View...


Hidalgo, TX Natural Gas Imports by Pipeline from Mexico  

Annual Energy Outlook 2012 (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2006 2007 2008 2009 2010 2011 View...


Penitas, TX Natural Gas Imports by Pipeline from Mexico  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 1996 1998 1999 2000 2001 2002 View...


Freeport, TX Natural Gas LNG Imports (Price) From Peru (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- -- 2010's 7.44 7.38...


Freeport, TX Liquefied Natural Gas Imports From Peru (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 0 0 0 2010's 6,463 9,775...


TX, RRC District 1 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

2 435 1,564 5,123 2007-2011 Adjustments 5 8 0 2009-2011 Revision Increases 1 322 2,141 2009-2011 Revision Decreases 0 251 48 2009-2011 Sales 0 409 1,132 2009-2011 Acquisitions 0...


TX, RRC District 9 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

7,134 8,700 10,756 12,573 10,276 2007-2011 Adjustments 179 533 42 2009-2011 Revision Increases 580 1,044 3,005 2009-2011 Revision Decreases 469 191 5,864 2009-2011 Sales 53 83...


TX, RRC District 5 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

8,099 11,408 13,691 16,032 19,747 2007-2011 Adjustments 657 105 233 2009-2011 Revision Increases 928 643 3,094 2009-2011 Revision Decreases 587 405 1,405 2009-2011 Sales 5 0 5,772...


TX, RRC District 10 Shale Gas Proved Reserves, Reserves Changes...  

Annual Energy Outlook 2012 (EIA)

0 0 0 0 0 2007-2011 Adjustments 0 0 -1 2009-2011 Revision Increases 0 0 0 2009-2011 Revision Decreases 0 0 0 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 0 2009-2011 Extensions...


TX, RRC District 3 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

0 0 1 2007-2011 Adjustments 0 0 1 2009-2011 Revision Increases 0 0 0 2009-2011 Revision Decreases 0 0 0 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 0 2009-2011 Extensions 0 0...


TX, RRC District 2 Onshore Shale Gas Proved Reserves, Reserves...  

Gasoline and Diesel Fuel Update (EIA)

2010 2011 View History Proved Reserves as of Dec. 31 395 1,692 2010-2011 Adjustments 6 237 2010-2011 Revision Increases 6 388 2010-2011 Revision Decreases 5 402 2010-2011 Sales 0...


TX, State Offshore Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

0 0 0 0 2007-2010 Adjustments 0 0 2009-2010 Revision Increases 0 0 2009-2010 Revision Decreases 0...


TX, State Offshore Shale Gas Proved Reserves, Reserves Changes...  

Annual Energy Outlook 2012 (EIA)

2007 2008 2009 2010 View History Proved Reserves as of Dec. 31 0 0 0 0 2007-2010 Adjustments 0 0 2009-2010 Revision Increases 0 0 2009-2010 Revision Decreases 0 0 2009-2010 Sales...


TX, RRC District 10 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

-1 2009-2011 Revision Increases 0 0 0 2009-2011 Revision Decreases 0 0 0 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 0 2009-2011 Extensions 0 0 1...


TX, RRC District 4 Onshore Shale Gas Proved Reserves, Reserves...  

Annual Energy Outlook 2012 (EIA)

78 565 2,611 2007-2011 Adjustments 53 0 185 2009-2011 Revision Increases 0 66 792 2009-2011 Revision Decreases 0 12 295 2009-2011 Sales 0 0 75 2009-2011 Acquisitions 0 0 75...


TX, RRC District 8 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

5 48 24 90 61 2007-2011 Adjustments -1 53 -79 2009-2011 Revision Increases 2 20 45 2009-2011 Revision Decreases 22 0 12 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 20...


TX, RRC District 6 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

0 173 1,161 4,381 6,584 2007-2011 Adjustments 40 1,968 26 2009-2011 Revision Increases 422 1,206 2,322 2009-2011 Revision Decreases 8 1,319 1,860 2009-2011 Sales 0 88 879 2009-2011...


TX, RRC District 3 Onshore Crude Oil Proved Reserves, Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TX, RRC District 1 Crude Oil Proved Reserves, Reserves Changes ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


Dallas-Fort Worth, TX Clean Taxi Replacement Incentive  

Energy.gov (U.S. Department of Energy (DOE))

The North Central Texas Council of Governments has partnered with the U.S. Environmental Protection Agency and the City of Dallas to develop the North Texas Green & Go Clean Taxi Partnership as...


Freeport, TX LNG Imports from Trinidad/Tobago  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Galvan Ranch, TX Natural Gas Imports by Pipeline from Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Eagle Pass, TX Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


McAllen, TX Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


TX, RRC District 4 Onshore Lease Condensate Proved Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Federal Offshore ...


TX, RRC District 10 Coalbed Methane Proved Reserves, Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 8A Natural Gas Liquids Proved Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 1 Dry Natural Gas Proved Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 2 Onshore Proved Nonproducing Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Includes only those ...


TX, RRC District 6 Crude Oil Proved Reserves, Reserves Changes ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


TX, RRC District 9 Crude Oil Proved Reserves, Reserves Changes ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


TX, RRC District 7B Lease Condensate Proved Reserves, Reserve ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Federal Offshore ...


TX, RRC District 3 Onshore Natural Gas Liquids Proved Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


Freeport, TX Liquefied Natural Gas Exports Price to Brazil (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- -- 2010's -- 12.74 11.19...



Energy.gov (U.S. Department of Energy (DOE))

The Department of Energy (DOE) and Department of Homeland Security (DHS), in coordination with the Federal Bureau of Investigation, the Federal Energy Regulatory Commission's Office of Energy Infrastructure Security, the Electricity Sector Information Sharing and Analysis Center (ES-ISAC), North American Electricity Reliability Corporation (NERC), and industry experts, will conduct a series of briefings across the country with electricity sector owners and operators, and local law enforcement on the physical security of electricity substations.


DOE - Office of Legacy Management -- Falls City Mill Site - TX...  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials Handled: Radiological Survey(s): Site Status: Also see Falls City, Texas, Disposal Site Documents Related to Falls City Mill Site Data Validation Package for...


TX, RRC District 8A Crude Oil Proved Reserves, Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


TX, RRC District 3 Onshore Lease Condensate Proved Reserves,...  

U.S. Energy Information Administration (EIA) Indexed Site

75 128 65 74 75 76 1979-2011 Adjustments 3 -2 3 2009-2011 Revision Increases 20 19 18 2009-2011 Revision Decreases 10 16 9 2009-2011 Sales 1 4 11 2009-2011 Acquisitions 1 12 10...

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Galvan Ranch, TX Natural Gas Imports by Pipeline from Mexico  

U.S. Energy Information Administration (EIA)

Pipeline Volumes: 19: 18: 20: 20: 14: 28: 2011-2013: Pipeline Prices: 2.42: 2.34: 2.53: 2.53: 3.21: 3.21: 2011-2013-= No Data Reported; --= Not Applicable; NA = Not ...


El Paso, TX Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reactive Transport Models with Reactive Transport Models with Geomechanics to Mitigate Risks of CO2 Utilization and Storage Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

a Prototype Commercial a Prototype Commercial Gasifier Sensor Background Integrated gasification combined cycle (IGCC) technology has the potential to improve the efficiency and environmental performance of fossil fuel based electric power production. During the IGCC process, coal and/or biomass is gasified at high temperature and pressure to form synthesis gas (syngas), a mixture of hydrogen, carbon monoxide, carbon dioxide, and small amounts of contaminants such as hydrogen sulfide. The syngas can be used to produce power, chemicals, and/or fuels. The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) Gasification Technologies Program is focused on enhancing the performance of gasification systems, thus enabling U.S. industry to improve the competitiveness of


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Phase III Xlerator Program: Rapid Phase III Xlerator Program: Rapid Commercialization of Advanced Turbine Blades for IGCC Power Plants-Mikro Systems Background Mikro Systems, Inc. is developing their proprietary TOMO SM manufacturing technology to produce turbine blades with significantly improved internal cooling geometries that are beyond current manufacturing state-of-the-art, thus enabling higher operating temperatures. Funding from the American Recovery and Reinvestment Act (ARRA) under the Small Business Innovation Research (SBIR) Phase III Xlerator Program will be directed towards accelerating commercial adoption of TOMO SM technology by leading turbine manufacturers through the demonstration of superior manufacturability, cost, and performance. Ultimately, this technology will lead to improved efficiency


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Non-Thermal Plasma for Fossil Energy Non-Thermal Plasma for Fossil Energy Related Applications Background The U.S. Department of Energy is investigating various non-thermal plasma tech- nologies for their catalytic properties related to fossil energy conversion and carbon dioxide decomposition. Non-thermal plasma is an ionized gas comprised of a mixture of charged particles (electrons, ions), active chemical radicals (O 3 , O, OH), and highly excited species that are known to accelerate reforming reactions in


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PROJEC PROJEC T FAC TS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Gordon Bierwagen Principal Investigator North Dakota State University P.O. Box 6050 Department 2760 Fargo, ND 58108-6050 701-231-8294 gordon.bierwagen@ndsu.edu PARTNERS None PROJECT DURATION Start Date 12/01/2009 End Date 11/30/2011 COST Total Project Value $298,949 DOE/Non-DOE Share $298,949 / $0 PROJECT NUMBER DE-FE0002054 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Training Toward Advanced 3-D Seismic Training Toward Advanced 3-D Seismic Methods for CO 2 Monitoring, Verification, and Accounting Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effective- ness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO 2 ) to reduce greenhouse gas (GHG) emissions without adversely af fecting energy use or hindering economic grow th. Geologic carbon storage involves the injection of CO 2 into underground formations that have the ability to securely contain the CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Cathode Surface Chemistry and Cathode Surface Chemistry and Optimization Studies-Carnegie Mellon University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Carnegie Mellon University's (CMU) project was selected to acquire the fundamental knowledge and understanding that will facilitate research and development to enhance


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Jose Castillo Principal Investigator San Diego State University 5500 Campanile Drive San Diego, CA 92122 619-594-7205 castillo@myth.sdsu.edu PARTNERS Sienna Geodynamics and Consulting, Inc. PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,993 DOE/Non-DOE Share $299,993 / $0 PROJECT NUMBER DE-FE0002069 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

a Coal-Biomass to Liquids a Coal-Biomass to Liquids Plant in Southern West Virginia Background Concerns regarding global supplies of oil, energy security, and climate change have generated renewed interest in alternative energy sources. The production of liquid fuels from coal provides an option for reducing petroleum use in the U.S. transportation sector and enhancing national and economic security by decreasing the nation's reliance on foreign oil. Two basic methods can be employed to produce liquid fuels


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Creep-Fatigue-Environment Creep-Fatigue-Environment Interactions in Steam Turbine Rotor Materials for Advanced Ultrasupercritical Coal Power Plants Background The U.S. Department of Energy (DOE) promotes the advancement of computational capabilities to develop materials for advanced fossil energy power systems. The DOE's National Energy Technology Laboratory (NETL) Advanced Research (AR) Program is working to enable the next generation of Fossil Energy (FE) power systems. One goal of the AR Materials Program is to conduct research leading to a scientific understanding of high-performance materials capable of service in the hostile environments associated with advanced ultrasupercritical (A-USC) coal-fired power plants. A-USC plants will increase coal-fired power plant efficiency by allowing operation


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL's Fluid Chemistry Analysis NETL's Fluid Chemistry Analysis Capacity Background Establishing the geochemistry of surface and ground waters requires an arsenal of techniques devoted to determining the constituents these waters contain and the environment in which they exist. Many standard techniques have been developed over the years, and new ones continue to be explored as more complex matrices and harsher environments are encountered. Deep geologic storage of carbon dioxide and the development of unconventional oil and gas resourses are two areas of current concern where the study of geochemical processes is challenging due to the complex nature of the natural samples, and where routine analytical techniques are being pushed to their limits. The facilities at NETL include both conventional and cutting-edge instrumentation


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

29,759 29,759 PROJECT NUMBER FWP-2012.03.03 Task 3 Conversion and Fouling Background Coal and biomass gasification is an approach to cleaner power generation and other uses of these resources. Currently, the service life of gasifiers does not meet the performance needs of users. Gasifiers fail to achieve on-line availability of 85-95 percent in utility applications and 95 percent in applications such as chemical production. The inability to meet these goals has created a potential roadblock to widespread acceptance and commercialization of advanced gasification technologies. Gasifier output is a hot gas mixture consisting primarily of hydrogen and carbon monoxide (CO), known as synthesis gas (syngas). The syngas cooler is one of the key components identified as negatively impacting gasifier availability. Ash originating from impurities


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Compact Eye-safe Scanning Differential Compact Eye-safe Scanning Differential Absorption LIDAR (DIAL) for Spatial Mapping of Carbon Dioxide for MVA at Geologic Carbon Sequestration Sites Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Energy California Project Hydrogen Energy California Project Background A need exists to further develop carbon management technologies that capture and store or beneficially reuse carbon dioxide (CO 2 ) that would otherwise be emitted into the atmosphere from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. Under the Clean Coal Power Initiative (CCPI) Round 3 program, the U.S. Department of Energy (DOE) is providing financial assistance, including funding under the American Recovery and Reinvestment Act (ARRA) of 2009, to industry to demonstrate the commercial viability of technologies that will capture CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Simulation of CO Simulation of CO 2 Leakage and Caprock Remediation Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the environment, and can provide the basis for establishing carbon credit trading markets


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Pressure Membrane Contactors for Pressure Membrane Contactors for CO 2 Capture Background The mission of the U.S. Department of Energy/National Energy Technology Laboratory (DOE/NETL) Carbon Capture Research & Development (R&D) Program is to develop innovative environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. The Carbon Capture R&D Program portfolio of carbon dioxide (CO 2 ) emissions control technologies and CO 2 compression is focused on advancing technological options for new and existing coal- fired power plants in the event of carbon constraints. Post-combustion separation and capture of CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACTS Joseph Stoffa Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-0285 joseph.stoffa@netl.doe.gov Xingbo Liu Principal Investigator Dept. MechanaWest Virginia University P.O. Box 6106 Morgantown, WV 26506-6106 304-293-3339 xingbo.liu@mail.wvu.edu Shailesh D. Vora Technology Manager, Fuel Cells National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7515 shailesh.vora@netl.doe.gov PARTNERS None PROJECT DURATION Start Date End Date 08/31/2012 09/30/2015 COST Total Project Value $634,839 DOE/Non-DOE Share $499,953 / $134,886 AWARD NUMBER FE0009675 Fundamental Understanding of Oxygen Reduction and Reaction Behavior and Developing High Performance and Stable


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Shizhong Yang Shizhong Yang Principal Investigator Department of computer science/LoNI southern University and a&M college Baton rouge, Louisiana 70813 225-771-2060 shizhong_yang@subr.edu PROJECT DURATION Start Date End Date 06/01/2012 05/31/2015 COST Total Project Value $200,000 DOE/Non-DOE Share $200,000 / $0 Novel Nano-Size Oxide Dispersion Strengthened Steels Development through Computational and Experimental Study Background Ferritic oxide dispersion strengthened (oDs) steel alloys show promise for use at higher temperatures than conventional alloys due to their high-temperature oxidation resistance and dislocation creep properties. the development of oDs alloys with nanoscale powders of transition metal oxides (yttrium and chromium) dispersed in


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Clean Coal Power Initiative (CCPI 3) Clean Coal Power Initiative (CCPI 3) NRG Energy: W.A. Parish Post-Combustion CO2 Capture and Sequestration Project Background Additional development and demonstration is needed to improve the cost and efficiency of carbon management technologies that capture and store carbon dioxide (CO 2 ) that would otherwise be emitted from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. The U.S. Department of Energy (DOE) is providing financial assistance through the Clean Coal Power Initiative (CCPI) Round 3, which includes funding from the American Recovery and Reinvestment Act (ARRA), to demonstrate the commercial viability


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Radiocarbon as a Reactive Tracer for Radiocarbon as a Reactive Tracer for Tracking Permanent CO2 Storage in Basaltic Rocks Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Degradation of TBC Systems in Degradation of TBC Systems in Environments Relevant to Advanced Gas Turbines for IGCC Systems- University of Pittsburgh Background The conditions inside integrated gasification combined cycle (IGCC) systems, such as high steam levels from hydrogen firing, high carbon dioxide steam mixtures in oxy- fired systems, and different types of contaminants, introduce complexities associated with thermal barrier coating (TBC) durability that are currently unresolved. In this work the University of Pittsburgh will team with Praxair Surface Technologies (PST) to deter- mine the degradation mechanisms of current state-of-the-art TBCs in environments consisting of deposits and gas mixtures that are representative of gas turbines using coal-derived synthesis gas (syngas).


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Cost Alloys for High-Temperature Low-Cost Alloys for High-Temperature SOFC Systems Components - QuesTek Innovations Background One of the key opportunities for cost reduction in a solid oxide fuel cell (SOFC) system is the set of balance of plant (BOP) components supporting the fuel cell itself, including the heat exchanger and air/fuel piping. These represent about half of the overall cost of the system. A major enabling technological breakthrough is to replace incumbent nickel-based superalloys in high-temperature BOP components with low-cost ferritic stainless steel. However, the ferritic alloys are unsuitable for SOFC application without additional coatings due to the inherent volatile nature of the alloy's chromium oxide (Cr2O3) element, which tends to poison the fuel cell's cathode


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Southwestern United States Carbon Southwestern United States Carbon Sequestration Training Center Background Carbon capture, utilization, and storage (CCUS) technologies offer great potential for mitigating carbon dioxide (CO2) emissions emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will require a drastically expanded workforce trained in CCUS related disciplines, including geologists, engineers, scientists, and technicians. Training to enhance the existing CCUS workforce and to develop new professionals can be accomplished through focused educational initiatives in the CCUS technology area. Key educational topics include simulation and risk assessment; monitoring, verification,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Beneficial Use of CO2 in Precast Beneficial Use of CO2 in Precast Concrete Products Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Barrier Coatings for Thermal Barrier Coatings for Operation in High Hydrogen Content Fueled Gas Turbines-Stony Brook University Background Traditional thermal barrier coatings (TBCs) based on yttria-stabilized zirconia (YSZ) will likely not be suitable in gas turbines used in integrated gasification combined cycle (IGCC) power plants. This is due to higher operating temperatures that will not only affect phase stability and sintering but will accelerate corrosive degradation phenomena. Coatings provide a framework to combat degradation issues and provide performance improvements needed for higher temperature environments. The Center for Thermal Spray Research (CTSR) at Stony Brook University, in partnership with its industrial Consortium for Thermal Spray Technology, is investigating science and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Cooling for IGCC Turbine Cooling for IGCC Turbine Blades-Mikro Systems Background Turbine blade and vane survivability at higher operating temperatures is the key to improving turbine engine performance for integrated gasification combined cycle (IGCC) power plants. Innovative cooling approaches are a critical enabling technology to meet this need. Mikro Systems, Inc. is applying their patented Tomo-Lithographic Molding (TOMO) manufacturing technology to produce turbine blades with significantly improved internal cooling geometries that go beyond the current manufacturing state-of-the-art to enable higher operating temperatures. This project addresses two important aspects. First is the need to increase the quality and reliability of the core manufacturing process capability to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combustion Dynamics in Multi-Nozzle Combustion Dynamics in Multi-Nozzle Combustors Operating on High- Hydrogen Fuels-Pennsylvania State University Background Combustion dynamics is a major technical challenge to the development of efficient, low emission gas turbines. Current information is limited to single-nozzle combustors operating on natural gas and neglects combustors with configurations expected to meet operability requirements using a range of gaseous fuels such as coal derived synthesis gas (syngas). In this project, Pennsylvania State University (Penn State) in collaboration with Georgia Institute of Technology (Georgia Tech) will use multiple-nozzle research facilities to recreate flow conditions in an actual gas turbine to study complicated interactions between flames that can aggravate the combustion dynamics in syngas-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Summit Texas Clean Energy, LLC: Texas Summit Texas Clean Energy, LLC: Texas Clean Energy Project: Pre-Combustion CO 2 Capture and Sequestration Background A need exists to further develop carbon management technologies that capture and store, or beneficially reuse, carbon dioxide (CO 2 ) that would otherwise be emitted into the atmosphere from coal-based electric power generating facilities. Carbon capture and storage (CCS) technologies offer the potential to significantly reduce CO 2 emissions and mitigate the anthropogenic contribution to global climate change, while substantially reducing or minimizing the economic impacts of the solution. Under Round 3 of the Clean Coal Power Initiative (CCPI), the U.S. Department of Energy (DOE) is providing up to $450 million in co-funded financial assistance to industry,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Solar-Based Catalytic Efficiency Solar-Based Catalytic Structure for CO2 Reforming Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE-WRI Cooperative Research and DOE-WRI Cooperative Research and Development Program for Fossil Energy- Related Resources Background Our nation's demand for cleaner and more efficient fossil energy production will increase during the coming decades, necessitating the development of new energy technologies to achieve energy independence in an environmentally responsible manner. The University of Wyoming (UW) Research Corporation's Western Research Institute (WRI) has been supporting the U.S. Department of Energy (DOE) Office of Fossil Energy (FE) and its mission of developing fossil energy and related environmental technologies for over two decades. Federal funding for these research efforts has usually been provided through congressionally mandated cooperative agreements, with cost share


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Unconventional Resources Unconventional Resources Background Natural gas and crude oil provide two-thirds of our Nation's primary energy supply and will continue to do so for at least the next several decades, as the Nation transitions to a more sustainable energy future. The natural gas resource estimated to exist within the United States has expanded significantly, but because this resource is increasingly harder to locate and produce, new technologies are required to extract it. Under the Energy Policy Act of 2005, the National Energy Technology Laboratory is charged with developing a complementary research program supportive of improving safety and minimizing the environmental impacts of activities related to unconventional natural gas and other petroleum resource exploration and production technology


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Romanosky Romanosky Crosscutting Research Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-4721 robert.romanosky@netl.doe.gov Richard Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Shizhong Yang Principal Investigator Southern University


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Staged, High-Pressure Oxy-Combustion Staged, High-Pressure Oxy-Combustion Technology: Development and Scale-up Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available CO2 capture and storage significantly reduces efficiency of the power cycle. The aim of the ACS program is to develop advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while maintaining near zero emissions of other flue gas pollutants.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cells Operating on Solid Oxide Fuel Cells Operating on Alternative and Renewable Fuels- Pennsylvania State University Background In this congressionally directed project, the Earth and Mineral Science (EMS) Energy Institute at Pennsylvania State University (PSU) focuses on the development of fuel processors, reforming catalysts, and chemical sorbents to support the production of electricity from anaerobic digester gas (ADG) and ultra-low sulfur diesel (ULSD) via solid-oxide fuel cells (SOFCs). PSU will use the fuel processors, reforming catalysts, and chemical sorbents developed under this work to transform and clean ADG and ULSD into a syngas stream suitable as a feedstock for SOFCs. This project is managed by the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL), whose mission is to advance energy options to fuel


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cell Cathode Enhancement Solid Oxide Fuel Cell Cathode Enhancement Through a Vacuum-assisted Infiltration- Materials and Systems Research, Inc. Background Solid oxide fuel cell (SOFC) technology promises to provide an efficient method to generate electricity from coal-derived synthesis gas (syngas), biofuels, and natural gas. The typical SOFC composite cathode (current source) possesses excellent performance characteristics but is subject to chemical stability issues at elevated temperatures both during manufacturing and power generation. Costs attributed to the cathode and its long-term stability issues are a current limitation of SOFC technologies. These must be addressed before commercial SOFC power generation can be realized. Materials and Systems Research, Inc. (MSRI) will develop a vacuum-assisted infiltration


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Study of the Durability of Doped Study of the Durability of Doped Lanthanum Manganite and Cobaltite Based Cathode Materials under "Real World" Air Exposure Atmospheres- University of Connecticut Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Briggs White Briggs White Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-5437 briggs.white@netl.doe.gov Jeff Stevenson Principal Investigator Pacific Northwest National Laboratory P.O. Box 999, MS K2-44 Richland, WA 99352 509-372-4697 jeff.stevenson@pnl.com PARTNERS Oak Ridge National Laboratory University of Connecticut PROJECT DURATION Start Date End Date 10/01/1999 09/30/2013 (annual continuations) COST Total Project Value $52,889,667 DOE/Non-DOE Share $52,889,667 / $0 AWARD NUMBER FWP40552 PR OJ E C T FAC T S Fuel Cells Low Cost Modular SOFC Development- Pacific Northwest National Laboratory Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) has a mission to advance energy options to fuel our economy, strengthen our security,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Karen Kluger Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6667 karen.kluger@netl.doe.gov Gary Mavko Principal Investigator Stanford University 397 Panama Mall Stanford, CA 94305-2215 650-723-9438 Fax: 650-723-1188 mavko@stanford.edu PROJECT DURATION Start Date 12/01/2009 End Date 06/30/2013 COST Total Project Value $385,276 DOE/Non-DOE Share $295,777/ $89,499 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Rock Physics of Geologic Carbon Sequestration/Storage


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Comprehensive Comprehensive Monitoring Techniques to Verify the Integrity of Geological Storage Reservoirs Containing Carbon Dioxide Background Research aimed at monitoring the long-term storage stability and integrity of carbon dioxide (CO2) stored in geologic formations is one of the most pressing areas of need if geological storage is to become a significant factor in meeting the United States' stated objectives to reduce greenhouse gas emissions. The most promising geologic formations under consideration for CO2 storage are active and depleted oil and gas formations, brine formations, and deep, unmineable coal seams. Unfortunately, the long-term CO2 storage capabilities of these formations are not yet well understood. Primary Project Goal The goal of this effort is to develop


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

SO SO 2 -Resistent Immobilized Amine Sorbents for CO 2 Capture Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies for Monitoring Technologies for Monitoring CO 2 Saturation and Pore Pressure in Geologic Formations: Linking the Chemical and Physical Effects to Elastic and Transport Properties Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Monitoring and Numerical Modeling of Monitoring and Numerical Modeling of Shallow CO 2 Injection, Greene County, Missouri Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO 2 ). Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Tagging Carbon Dioxide to Enable Tagging Carbon Dioxide to Enable Quantitative Inventories of Geological Carbon Storage Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Nanoporous, Metal Carbide, Surface Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations Background Both coal and biomass are readily available in the U.S. and can be thermally processed to produce hydrogen and/or power. The produced hydrogen can be sent directly to a fuel cell or hydrogen turbines for efficient and environmentally clean power generation. More efficient hydrogen production processes need to be developed before coal and biomass can become economically viable sources of hydrogen. To meet this need, the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is partnering with the Colorado School of Mines and Pall Corporation to develop nanoporous metal carbide surface diffusion membranes for use in high temperature


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigation on Flame Characteristics Investigation on Flame Characteristics and Burner Operability Issues of Oxy-Fuel Combustion Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently underrepresented in the United States. Education and training activities


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Object Optimization Approaches Object Optimization Approaches for the Design of Carbon Geological Sequestration Systems Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO 2 ). Carbon capture and storage (CCS) technologies offer great potential for reducing CO 2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Sensors and Control Sensors and Control CONTACTS Ben Chorpening Sensors & Controls Technical Team Coordinator 304-285-4673 benjamin.chorpening@netl.doe.gov Steven Woodruff Principal Investigator 304-285-4175 steven.woodruff@netl.doe.gov Michael Buric Co-Principal Investigator 304-285-2052 michael.buric@netl.doe.gov Raman Gas Composition Sensor System for Natural Gas and Syngas Applications Goal The goal of this project is to develop and test a Raman laser spectroscopy system for responsive gas composition monitoring, and to transfer the technology to industry for commercial implementation. The instrument provides state-of-the-art improvement of reduced size and increased sensitivity and sample rate to facilitate the process control


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Joining of Advanced Joining of Advanced High-Temperature Materials Background To remain economically competitive, the coal-fired power generation industry needs to increase system efficiency, improve component and system reliability, and meet ever tightening environmental standards. In particular, cost-effective improvements in thermal efficiency are particularly attractive because they offer two potential benefits: (1) lower variable operating cost via increased fuel utilization (fuel costs represent over 70 percent of the variable operating cost of a fossil fuel-fired power plant) and (2) an economical means of reducing carbon dioxide (CO2) and other emissions. To achieve meaningful gains, steam pressure and temperature must be increased to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Basin-Scale Leakage Risks from Geologic Basin-Scale Leakage Risks from Geologic Carbon Sequestration: Impact on Carbon Capture and Storage Energy Market Competitiveness Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R R &D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


El Paso, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 958 860 509 487 503 482 449 452 456 531 670 1,024 2012 710 783 648 505 407 432 469 490 383 409 493 510 2013 571 446 632 481...


TX, RRC District 1 Natural Gas Reserves Summary as of Dec. 31  

Gasoline and Diesel Fuel Update (EIA)

6,127 1979-2011 Natural Gas Nonassociated, Wet After Lease Separation 1,048 1,029 987 1,456 2,332 5,227 1979-2011 Natural Gas Associated-Dissolved, Wet After Lease Separation 61...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

on Local and Regional Air on Local and Regional Air Quality Impacts of Oil and Natural Gas Development Goal The NETL research effort in improving the assessment of impacts to air quality from oil and gas exploration and production activities has the following goals: (1) using NETL's mobile air monitoring laboratory, conduct targeted on-site measurements of emissions from oil and gas production activities that may impact the environment and (2) use collected data in atmospheric chemistry and transport models to further understanding of local and regional air quality impacts. Background The development of shale gas and shale oil resources requires horizontal drilling and multi-stage hydraulic fracturing, two processes that have been known for many years but have only recently become common practice. In addition, fugitive atmospheric


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Evaluation of the Carbon Sequestration Evaluation of the Carbon Sequestration Potential of the Cambro Ordovician Strata of the Illinois and Michigan Basins Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strand- plain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef.


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Air Products and Chemicals, Inc.: Air Products and Chemicals, Inc.: Demonstration of CO2 Capture and Sequestration of Steam Methane Reforming Process Gas Used for Large-Scale Hydrogen Production Background Carbon dioxide (CO2) emissions from industrial processes, among other sources, are linked to global climate change. Advancing development of technologies that capture and store or beneficially reuse CO2 that would otherwise reside in the atmosphere for extended periods is of great importance. Advanced carbon capture, utilization and storage (CCUS) technologies offer significant potential for reducing CO2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. Under the Industrial Carbon Capture and Storage (ICCS) program, the U.S. Department


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Filtration to Improve Single Filtration to Improve Single Crystal Casting Yield-Mikro Systems Background Single crystal (SX) nickel superalloys are a primary material choice for gas turbine hot gas path component castings because of their high resistance to deformation at elevated temperatures. However, the casting yields of these components need to be improved in order to reduce costs and encourage more widespread use within the gas turbine industry. Low yields have been associated with a number of process-related defects common to the conventional casting of SX components. One innovative improvement, advanced casting filter designs, has been identified as a potential path toward increasing the yield rates of SX castings for high-temperature gas turbine applications. Mikro Systems, Inc. (Mikro) proposes to increase SX casting yields by developing


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Siemens Energy Siemens Energy Background Siemens Energy, along with numerous partners, has an ongoing U.S. Department of Energy (DOE) program to develop hydrogen turbines for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). Siemens Energy is expanding this program for industrial applications such as cement, chemical, steel, and aluminum plants, refineries, manufacturing facilities, etc., under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines for industrial CCS. ARRA industrial technology acceleration,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Design of Advanced Engineering Design of Advanced Hydrogen-Carbon Dioxide Palladium and Palladium/Alloy Composite Membrane Separations and Process Intensification Background Technologies for pre-combustion carbon dioxide (CO2) capture and economical hydrogen (H2) production will contribute to the development of a stable and sustainable U.S. energy sector. The integrated gasification combined cycle (IGCC) system can produce synthesis gas (syngas) that can be used to produce electricity, hydrogen, fuels, and/or chemicals from coal and coal/biomass-mixtures in an environmentally responsible manner. The water-gas shift (WGS) reaction is a key part of this process for production of H2. The application of H2 separation technology can facilitate the production of high-purity H2 from gasification-based systems, as well as allow for process


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhancement of SOFC Cathode Electro- Enhancement of SOFC Cathode Electro- chemical Performance Using Multi-Phase Interfaces- University of Wisconsin Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Materials Design of Computational Materials Design of Castable SX Ni-based Superalloys for IGT Blade Components-QuesTek Innovations Background Higher inlet gas temperatures in industrial gas turbines (IGTs) enable improved thermal efficiencies, but creep-the tendency of materials to deform gradually under stress-becomes more pronounced with increasing temperature. In order to raise inlet temperatures of IGTs, turbine blade materials are required to have superior creep rupture resistance. Nickel (Ni)-based single crystal (SX) blades have higher creep strength in comparison with directionally solidified blades and are widely used in aerospace engines. However, their use in IGTs, which require larger-size castings (two to three times the size needed in aerospace applications), is limited

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maira Reidpath Maira Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Steven S.C. Chuang Principal Investigator The University of Akron Department of Chemical and Biomolecular Engineering 230 E. Buchtel Commons Akron, OH 44325 330-972-6993 schuang@uakron.edu PARTNERS None PROJECT DURATION Start Date End Date 09/01/2009 08/31/2013 COST Total Project Value $1,713,961 DOE/Non-DOE Share $1,370,977/$342,984 AWARD NUMBER Techno-Economic Analysis of Scalable Coal-Based Fuel Cells-University of Akron Background In this congressionally directed project, the University of Akron (UA) will develop a scalable coal fuel cell manufacturing process to a megawatt scale. UA has demonstrated the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combined Pressure, Temperature Combined Pressure, Temperature Contrast, and Surface-Enhanced Separation of Carbon Dioxide (CO 2 ) for Post-Combustion Carbon Capture Background The mission of the U.S. Department of Energy/National Energy Technology Laboratory (DOE/NETL) Carbon Capture Research & Development (R&D) Program is to develop innovative environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. The Carbon Capture R&D Program portfolio of carbon dioxide (CO 2 ) emissions control tech- nologies and CO 2 compression is focused on advancing technological options for new and existing coal-fired


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Conductivity, High Thermal Conductivity, High Durability Thermal Barrier Coatings for IGCC Environments-University of Connecticut Background Improved turbine materials are needed to withstand higher component surface temperatures and water vapor content for successful development and deployment of integrated gasification combined cycle (IGCC) power plants. Thermal barrier coatings (TBCs) in particular are required to have higher surface temperature capability, lower thermal conductivity, and resistance to attack at high temperature by contaminants such as calcium-magnesium-alumina-silicate (CMAS) and water vapor. There is also a concurrent need to address cost and availability issues associated with rare earth elements used in all low thermal conductivity TBCs.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reducing Uncertainties in Model Reducing Uncertainties in Model Predictions via History Matching of CO2 Migration and Reactive Transport Modeling of CO2 Fate at the Sleipner Project, Norwegian North Sea Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is todevelop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Molecular Separations Using Micro- Molecular Separations Using Micro- Defect Free Ultra-Thin Films Background Current methods for separating carbon dioxide (CO 2 ) from methane (CH 4 ) in fuel gas streams are energy and cost-intensive. Molecular sieve membrane development for carbon capture has been pursued for several decades because of the potential these membranes have for high selectivity while using less energy than cryogenic separation methods and greater flux (permselectivity) than is possible from polymeric membranes. However, the adoption of molecular sieve membrane technology has been hindered by high production costs and the micro-defect fissures that always accompany this type of membrane when fabricated using conventional techniques. The Department of Energy's (DOE) National Energy Technology Laboratory (NETL), has


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Characterization of the South Characterization of the South Georgia Rift Basin for Source Proximal CO 2 Storage Background Carbon capture, utilization and storage (CCUS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Joshua Hull Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-0906 joshua.hull@netl.doe.gov Erik Westman Principal Investigator Virginia Polytechnic Institute and State University 100 Holden Hall Blacksburg, VA 24061 540-0231-7510 Fax: 540-231-4070 ewestman@vt.edu PROJECT DURATION Start Date End Date 12/01/2009 12/31/2012 COST Total Project Value $257,818 DOE/Non-DOE Share $248,441 / $9,377 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. P R OJ E C T FAC T


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory Scale Liquids Production Laboratory Scale Liquids Production and Assessment: Coal and Biomass to Drop-In Fuels Background A major problem with the production of liquid fuels from coal is that the production process and subsequent combustion of the fuel generate excessive greenhouse gases over the entire production and usage lifecycle. Adding lignocellulosic biomass (as a raw feed material) along with coal has the potential to reduce lifecycle greenhouse gas emissions to below those of petroleum products. Altex Technologies Corporation (Altex) has developed an innovative thermo-chemical process capable of converting coal and biomass to transportation fuel ready for blending. The Department of Energy (DOE) National Energy Technology Laboratory (NETL) has partnered with Altex to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Capture and Storage Training Carbon Capture and Storage Training Background Carbon capture, utilization, and storage (CCUS) technologies offer great potential for mitigating carbon dioxide (CO2) emissions emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will require a drastically expanded workforce trained in CCUS related disciplines, including geologists, engineers, scientists, and technicians. Training to enhance the existing CCUS workforce and to develop new professionals can be accomplished through focused educational initiatives in the CCUS technology area. Key educational topics include simulation and risk assessment; monitoring, verification, and accounting (MVA); geology-related


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Program Technology Program Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Dawn Deel Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4133 dawn.deel@netl.doe.gov Sherry Mediati Business Contact California Energy Commission 1516 9th Street, MS 1 Sacramento, CA 95814 916-654-4204 smediati@energy.state.ca.us Mike Gravely Principal Investigator California Energy Commission 1516 Ninth Street, MS 43 Sacramento, CA 95814 916-327-1370 mgravely@energy.state.ca.us Elizabeth Burton Technical Director Lawrence Berkeley National Laboratory 1 Cyclotron Road, MS 90-1116 Berkeley, CA 94720 925-899-6397 eburton@lbl.gov West Coast Regional Carbon


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Andrea Dunn Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Marte Gutierrez Principal Investigator Colorado School of Mines 1600 Illinois Street Golden, CO 80401 303-273-3468 Fax: 303-273-3602 mgutierr@mines.edu PROJECT DURATION Start Date 12/01/2009 End Date 5/31/2013 COST Total Project Value $297,505 DOE/Non-DOE Share $297,505 / $0 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Training and Research on Probabilistic Hydro-Thermo-Mechanical Modeling of Carbon Dioxide Geological Sequestration in Fractured Porous Rocks Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Efficiency Molten Bed Oxy- Coal Combustion with Low Flue Gas Recirculation Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO 2 ) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO 2 capture. Additionally, the program looks to accomplish this while maintaining near


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasification Characteristics of Gasification Characteristics of Coal/Biomass Mixed Fuels Background Domestically abundant coal is a primary energy source and when mixed with optimum levels of biomass during the production of liquid fuels may have lower carbon footprints compared to petroleum fuel baselines. Coal and biomass mixtures are converted via gasification into synthesis gas (syngas), a mixture of predominantly carbon monoxide and hydrogen, which can be subsequently converted to liquid fuels by Fischer-Tropsch chemistry. The Department of Energy (DOE) is supporting research focused on using coal and biomass to produce clean and affordable power, fuels and chemicals. The DOE's National Energy Technology Laboratory (NETL) is partnering with Leland Stanford Junior


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbonaceous Chemistry for Carbonaceous Chemistry for Computational Modeling (C3M) Description C3M is chemistry management software focused on computational modeling of reacting systems. The primary function of C3M is to provide direct links between r e l i a b l e s o u r c e s o f k i n e t i c information (kinetic modeling soft- ware, databases, and literature) and commonly used CFD software su ch as M FIX , FLUEN T, an d BARRACUDA with minimal effort from the user. C3M also acts as a virtual kinetic laboratory to allow a CFD practitioner or researcher to evaluate complex, large sets of kinetic expressions for reliability and suitability and can interact with spreadsheet and process models. Once the chemical model is built within C3M, the software also allows the user to directly export


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Phase III Xlerator Program: Electro-deposited Phase III Xlerator Program: Electro-deposited Mn-Co Alloy Coating for Solid Oxide Fuel Cell Interconnects-Faraday Technology Background Based on preliminary cost analysis estimates, Faraday Technology has shown that its FARADAYIC TM electrodeposition process for coating interconnects is cost competitive. Funding from the American Recovery and Reinvestment Act (ARRA) under the Small Business Innovation Research (SBIR) Phase III Xlerator Program will be directed toward developing, optimizing, and validating the FARADAYIC process as an effective and economical manufacturing method for coating interconnect materials with a manganese-cobalt (Mn-Co) alloy for use in solid oxide fuel cell (SOFC) stacks. This project is managed by the U.S. Department of Energy (DOE) National Energy


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Technology to Mitigate Syngas Technology to Mitigate Syngas Cooler Fouling Background Coal gasification, in conjunction with integrated gasification combined cycle (IGCC) power production, is under development to increase efficiency and reduce greenhouse gas emissions associated with coal-based power production. However, coal gasification plants have not achieved their full potential for superior performance and economics due to challenges with reliability and availability. In particular, performance of the syngas cooler located downstream of the gasifier has been an issue. The syngas cooler is a fire tube heat exchanger located between the gasifier and the gas turbine. The purpose of the syngas cooler is to cool the raw syngas from the gasifier and recover heat. Although


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Processing and Evaluation of Next Processing and Evaluation of Next Generation Oxygen Carrier Materials for Chemical Looping Combustion Background The Department of Energy (DOE) supports research towards the development of efficient and inexpensive CO 2 capture technologies for fossil fuel based power generation. The Department of Energy Crosscutting Research Program (CCR) serves as a bridge between basic and applied research. Projects supported by the Crosscutting Research Program conduct a range of pre-competitive research focused on opening new avenues to gains in power plant efficiency, reliability, and environmental quality by research in materials and processes, coal utilization science, sensors and controls, and computational energy science. Within the CCR, the University Coal Research (UCR) Program sponsors


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Studies to Enable Robust, Studies to Enable Robust, Reliable, Low Emission Gas Turbine Combustion of High Hydrogen Content Fuels-University of Michigan Background The University of Michigan will perform experimental and computational studies which can provide an improved and robust understanding of the reaction kinetics and other fundamental characteristics of combustion of high hydrogen content (HHC) fuels that are vital to advancing HHC turbine design and to making coal gasification power plants environmentally sustainable and cost- competitive. The scope of work includes Rapid Compression Facility (RCF) studies of HHC ignition delay times and hydroxyl radical (OH) time-histories, flame speeds, and flammability limits. A range of temperatures, pressures, and test gas mixture compositions will


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maria Reidpath Maria Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Bogdan Gurau Principal Investigator NuVant Systems, Inc. 130 N West Street Crown Point, IN 46307 219-644-3232 b.gurau@nuvant.com PARTNERS None PROJECT DURATION Start Date End Date 08/01/2009 05/31/2013 COST Total Project Value $1,142,481 DOE/Non-DOE Share $913,985 / $228,496 AWARD NUMBER Improved Flow-field Structures for Direct Methanol Fuel Cells-NuVant Systems, Inc. Background In this congressionally directed project, NuVant Systems, Inc. (NuVant) will improve the performance of direct methanol fuel cells (DMFCs) by designing anode flow-fields specifically for the delivery of liquid methanol. The goal is to deliver concentrated


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Environmental Considerations and Environmental Considerations and Cooling Strategies for Vane Leading Edges in a Syngas Environment- University of North Dakota Background Cooling airfoil leading edges of modern first stage gas turbine vanes presents a con- siderable challenge due to the aggressive heat transfer environment and efficiency penalties related to turbine hot gas path cooling. This environment is made more complex when natural gas is replaced by high hydrogen fuels (HHF) such as synthesis gas (syngas) derived from coal gasification with higher expected levels of impurities. In this project the University of North Dakota (UND) and The Ohio State University (OSU) will explore technology opportunities to improve the reliability of HHF gas turbines by analyzing the effects

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Alternative Low-Cost Process for Alternative Low-Cost Process for Deposition of MCrAlY Bond Coats for Advanced Syngas/Hydrogen Turbine Applications-Tennessee Technological University Background One of the material needs for the advancement of integrated gasification combined cycle (IGCC) power plants is the development of low-cost effective manufacturing processes for application of coating architectures with enhanced performance and durability in coal derived synthesis gas (syngas)/hydrogen environments. Thermal spray technologies such as air plasma spray (APS) and high-velocity oxy-fuel (HVOF) are currently used to fabricate thermal barrier coating (TBC) systems for large land- based turbine components. In this research Tennessee Technological University (TTU) will develop metal chromium-aluminum-yttrium (MCrAlY; where M = nickel [Ni], cobalt


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid-Fueled Pressurized Chemical Solid-Fueled Pressurized Chemical Looping with Flue-Gas Turbine Combined Cycle for Improved Plant Efficiency and CO2 Capture Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hafnia-Based Nanostructured Hafnia-Based Nanostructured Thermal Barrier Coatings for Advanced Hydrogen Turbine Technology- University of Texas at El Paso Background Thermal barrier coatings (TBCs) are protective layers of low thermal conductivity ceramic refractory material that protect gas turbine components from high temperature exposure. TBCs improve efficiency by allowing gas turbine components to operate at higher temperatures and are critical to future advanced coal-based power generation systems. Next generation gas turbine engines must tolerate fuel compositions ranging from natural gas to a broad range of coal-derived synthesis gasses (syngas) with high hydrogen content. This will require TBCs to withstand surface temperatures much higher than those currently experienced by standard materials. In this project the University of Texas at El Paso (UTEP)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Direct Utilization of Coal Syngas in High Direct Utilization of Coal Syngas in High Temperature Fuel Cells-West Virginia University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. West Virginia University's (WVU) project will establish the tolerance limits of contaminant


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

and Geotechnical Site and Geotechnical Site Investigations for the Design of a CO2 Rich Flue Gas Direct Injection and Storage Facility in an Underground Mine in the Keweenaw Basalts Background Fundamental and applied research on carbon capture, utilization and storage (CCUS) technologies is necessary in preparation for future commercial deployment. These technologies offer great potential for mitigating carbon dioxide (CO2) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCUS technical and non-technical disciplines that are currently under-represented in the United States. Education and training


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

National Risk Assessment Partnership National Risk Assessment Partnership The Need for Quantitative Risk Assessment for Carbon Utilization and Storage Carbon utilization and storage-the injection of carbon dioxide (CO2) into permanent underground and terrestrial storage sites-is an important part of our nation's strategy for managing CO2 emissions. Several pilot- to intermediate-scale carbon storage projects have been performed in the U.S. and across the world. However, some hurdles still exist before carbon storage becomes a reality in the U.S. at a large scale. From a technical point of view, carbon storage risk analysis is complicated by the fact that all geologic storage sites are not created equally. Every potential site comes with an individual set of characteristics, including type of storage formation, mineral make-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

FACTS FACTS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Joseph Labuz Principal Investigator University of Minnesota 500 Pillsbury Drive SE Room 122 CivE 0851 Minneapolis, MN 55455 612-625-9060 jlabuz@umn.edu PARTNERS None PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,568 DOE/Non-DOE Share $299,568 / $0 PROJECT NUMBER DE-FE0002020 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Model Development-LG Fuel Model Development-LG Fuel Cell Systems Background In this congressionally directed project, LG Fuel Cell Systems Inc. (LGFCS), formerly known as Rolls-Royce Fuel Cell Systems (US) Inc., is developing a solid oxide fuel cell (SOFC) multi-physics code (MPC) for performance calculations of their fuel cell structure to support product design and development. The MPC is based in the computational fluid dynamics software package STAR-CCM+ (from CD-adapco) which has been enhanced with new models that allow for coupled simulations of fluid flow, porous flow, heat transfer, chemical, electrochemical and current flow processes in SOFCs. Simulations of single cell, five-cell, substrate and bundle models have been successfully validated against experimental data obtained by LGFCS. The MPC is being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

of the Highest- of the Highest- Priority Geologic Formations for CO 2 Storage in Wyoming Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strand- plain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Assessment of Factors Influencing Assessment of Factors Influencing Effective CO2 Storage Capacity and Injectivity in Eastern Gas Shales Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reflection Reflection Seismic Monitoring and Reservoir Modeling for Geologic CO2 Sequestration Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Dry Sorbent Technology Dry Sorbent Technology for Pre-Combustion CO 2 Capture Background An important component of the Department of Energy (DOE) Carbon Capture Program is the development of carbon capture technologies for power systems. Capturing carbon dioxide (CO 2 ) from mixed-gas streams is a first and critical step in carbon sequestration. To be technically and economically viable, a successful separation method must be applicable to industrially relevant gas streams at realistic temperatures and practical CO 2 loading volumes. Current technologies that are effective at separating CO 2 from typical CO 2 -containing gas mixtures, such as coal-derived shifted synthesis gas (syngas), are both capital and energy intensive. Research and development is being conducted to identify technologies that will provide improved economics and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gas Turbine Thermal Gas Turbine Thermal Performance-Ames Laboratory Background Developing turbine technologies to operate on coal-derived synthesis gas (syngas), hydrogen fuels, and oxy-fuels is critical to the development of advanced power gener-ation technologies such as integrated gasification combined cycle and the deployment of near-zero-emission type power plants with capture and separation of carbon dioxide (CO 2 ). Turbine efficiency and service life are strongly affected by the turbine expansion process, where the working fluid's high thermal energy gas is converted into mechanical energy to drive the compressor and the electric generator. The most effective way to increase the efficiency of the expansion process is to raise the temperature of the turbine's


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Turbines Hydrogen Turbines CONTACTS Richard A. Dennis Technology Manager, Turbines National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4515 richard.dennis@netl.doe.gov Travis Shultz Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507-0880 304-285-1370 travis.shultz@netl.doe.gov Jacob A. Mills Principal Investigator Florida Turbine Technologies, Inc 1701 Military Trail Suite 110 Jupiter, FL 33458-7887 561-427-6349 jmills@fttinc.com PARTNERS None PROJECT DURATION Start Date End Date 06/28/2012 08/13/2015 COST Total Project Value $1,149,847 DOE/Non-DOE Share $1,149,847 / $0 AWARD NUMBER SC0008218 Air-Riding Seal Technology for Advanced Gas Turbine Engines-Florida Turbine


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rodosta Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Darin Damiani Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4398 darin.damiani@netl.doe.gov Vivak Malhotra Principal Investigator Southern Illinois University Neckers 483A Mailcode: 4401 Carbondale, IL 62901 618-453-2643 Fax: 618-453-1056 vmalhotra@physics.siu.edu PARTNERS None Risk Assessment and Monitoring of Stored CO2 in Organic Rock under Non-Equilibrium Conditions Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Statistical Analysis of CO2 Exposed Wells Statistical Analysis of CO2 Exposed Wells to Predict Long Term Leakage through the Development of an Integrated Neural-Genetic Algorithm Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological Sequestration Geological Sequestration Consortium-Development Phase Illinois Basin - Decatur Project Site Background The U.S. Department of Energy Regional Carbon Sequestration Partnership (RCSP) Initiative consists of seven partnerships. The purpose of these partnerships is to determine the best regional approaches for permanently storing carbon dioxide (CO2) in geologic formations. Each RCSP includes stakeholders comprised of state and local agencies, private companies, electric utilities, universities, and nonprofit organizations. These partnerships are the core of a nationwide network helping to establish the most suitable technologies, regulations, and infrastructure needs for carbon storage. The partnerships include more than 400 distinct organizations, spanning 43 states


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACT CONTACT Cathy Summers Director, Process Development Division National Energy Technology Laboratory 1450 Queen Ave., SW Albany, OR 97321-2198 541-967-5844 cathy.summers@netl.doe.gov An Integrated Approach To Materials Development Traditional trial-and-error method in materials development is time consuming and costly. In order to speed up materials discovery for a variety of energy applications, an integrated approach for multi-scale materials simulations and materials design has


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Scale Simulations of the Large Scale Simulations of the Mechanical Properties of Layered Transition Metal Ternary Compounds for FE Power Systems Background The U.S. Department of Energy (DOE) promotes the advancement of computational capabilities to develop materials for advanced fossil energy power systems. The DOE's National Energy Technology Laboratory (NETL) Advanced Research (AR) Program is working to enable the next generation of Fossil Energy (FE) power systems. The goal of


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigations and Investigations and Rational Design of Durable High- Performance SOFC Cathodes- Georgia Institute of Technology Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration of solid SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Cathode durability is critical to long-term SOFC performance for commercial deployment.

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxygen Carriers for Coal-Fueled Oxygen Carriers for Coal-Fueled Chemical Looping Combustion Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Novel Supercritical Carbon Dioxide Novel Supercritical Carbon Dioxide Power Cycle Utilizing Pressurized Oxy-combustion in Conjunction with Cryogenic Compression Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while maintaining near


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PO Box 880 PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea McNemar Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-2024 andrea.mcnemar@netl.doe.gov Charles D. Gorecki Technical Contact Senior Research Manager Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5355 cgorecki@undeerc.org Edward N. Steadman Deputy Associate Director for Research Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5279 esteadman@undeerc.org John A. Harju Associate Director for Research Energy & Environmental Research Center University of North Dakota


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological & Environmental Sciences Geological & Environmental Sciences Subsurface Experimental Laboratories Autoclave and Core Flow Test Facilities Description Researchers at NETL study subsurface systems in order to better characterize and understand gas-fluid-rock and material interactions that impact environmental and resource issues related to oil, gas, and CO2 storage development. However, studying the wide variety of subsurface environments related to hydrocarbon and CO2 systems requires costly and technically challenging tools and techniques. As a result, NETL's Experimental Laboratory encompasses multi-functional, state-of-the-art facilities that perform a wide spectrum of geological studies providing an experimental basis for modeling of various subsurface phenomena and processes. This includes, but is not


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Improving Durability of Turbine Components through Trenched Film Cooling and Contoured Endwalls-University of Texas at Austin Background Gas turbine operation utilizing coal-derived high hydrogen fuels (synthesis gas, or syngas) requires new cooling configurations for turbine components. The use of syngas is likely to lead to degraded cooling performance resulting from rougher surfaces and partial blockage of film cooling holes. In this project the University of Texas at Austin (UT) in cooperation with The Pennsylvania State University (Penn State) will investigate the development of new film cooling and endwall cooling designs for maximum performance when subjected to high levels of contaminant depositions. This project was competitively selected under the University Turbine Systems Research


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Single-Crystal Sapphire Optical Fiber Single-Crystal Sapphire Optical Fiber Sensor Instrumentation for Coal Gasifiers Background Accurate temperature measurement inside a coal gasifier is essential for safe, efficient, and cost-effective operation. However, current sensors are prone to inaccurate readings and premature failure due to harsh operating conditions including high temperatures (1,200-1,600 degrees Celsius [°C]), high pressures (up to 1000 pounds per square inch gauge [psig]), chemical corrosiveness, and high flow rates, all of which lead to corrosion, erosion, embrittlement, and cracking of gasifier components as well as sensor failure. Temperature measurement is a critical gasifier control parameter because temperature is a critical factor influencing the gasification and it leads to impacts in efficiency and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Unraveling the Role of Transport, Unraveling the Role of Transport, Electrocatalysis, and Surface Science in the SOFC Cathode Oxygen Reduction Reaction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The electrochemical performance of SOFCs can be substantially influenced by


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Swirl Injectors for Hydrogen Gas Low-Swirl Injectors for Hydrogen Gas Turbines in Near-Zero Emissions Coal Power Plants-Lawrence Berkeley National Laboratory Background The U.S. Department of Energy Hy(DOE) Lawrence Berkeley National Laboratory (LBNL) is leading a project in partnership with gas turbine manufacturers and universities to develop a robust ultra-low emission combustor for gas turbines that burn high hydrogen content (HHC) fuels derived from gasification of coal. A high efficiency and ultra-low emissions HHC fueled gas turbine is a key component of a near-zero emis- sions integrated gasification combined cycle (IGCC) clean coal power plant. This project is managed by the DOE National Energy Technology Laboratory (NETL). NETL is researching advanced turbine technology with the goal of producing reliable,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of a Coal-Based Demonstration of a Coal-Based Transport Gasifier Background Coal is an abundant and indigenous energy resource and currently supplies almost 38 percent of the United States' electric power. Demand for electricity, vital to the nation's economy and global competitiveness, is projected to increase by almost 28 percent by 2040. The continued use of coal is essential for providing an energy supply that supports sustainable economic growth. Unfortunately, nearly half of the nation's electric power generating infrastructure is more than 30 years old and in need of substantial refurbishment or replacement. Additional capacity must also be put in service to keep pace with the nation's ever-growing demand for electricity. It is in the public interest


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Foamed Wellbore Cement Foamed Wellbore Cement Stability under Deep Water Conditions Background Foamed cement is a gas-liquid dispersion that is produced when an inert gas, typically nitrogen, is injected into a conventional cement slurry to form microscopic bubbles. Foamed cements are ultralow-density systems typically employed in formations that are unable to support annular hydrostatic pressure exerted by conventional cement slurries. More recently, the use of foamed cement has expanded into regions with high-stress environments, for example, isolating problem formations typical in the Gulf of Mexico. In addition to its light-weight application, foamed cement has a unique resistance to temperature and pressure-induced stresses. Foamed cement exhibits superior fluid


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scale Computational Design and Scale Computational Design and Synthesis of Protective Smart Coatings for Refractory Metal Alloys Background The goal of the University Coal Research (UCR) Program within the Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to further the understanding of coal utilization. Since the program's inception in 1979, its primary objectives have been to (1) improve understanding of the chemical and physical processes involved in the conversion and utilization of coal so it can be used in an environmentally acceptable manner, (2) maintain and upgrade the coal research capabilities of and facilities at U.S. colleges and universities, and (3) support the education of students in the area of coal science. The National Energy Technology Laboratory's Office of Coal and Power Systems supports


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Conversion of CO2 in Commercial Conversion of CO2 in Commercial Materials using Carbon Feedstocks Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Experimental and Chemical Kinetics Experimental and Chemical Kinetics Study of the Combustion of Syngas and High Hydrogen Content Fuels- Pennsylvania State University Background Pennsylvania State University is teaming with Princeton University to enhance scientific understanding of the underlying factors affecting combustion for turbines in integrated gasification combined cycle (IGCC) plants operating on synthesis gas (syngas). The team is using this knowledge to develop detailed, validated combustion kinetics models that are useful to support the design and future research and development needed to transition to fuel flexible operations, including high hydrogen content (HHC) fuels derived from coal syngas, the product of gasification of coal. This project also funda- mentally seeks to resolve previously reported discrepancies between published ex-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Coating Issues in Coal-Derived Synthesis Coating Issues in Coal-Derived Synthesis Gas/Hydrogen-Fired Turbines-Oak Ridge National Laboratory Background The Department of Energy (DOE) Oak Ridge National Laboratory (ORNL) is leading research on the reliable operation of gas turbines when fired with synthesis gas (syngas) and hydrogen-enriched fuel gases with respect to firing temperature and fuel impurity levels (water vapor, sulfur, and condensable species). Because syngas is derived from coal, it contains more carbon and more impurities than natural gas. In order to achieve the desired efficiency, syngas-fired systems need to operate at very high temperatures but under combustion conditions necessary to reduce nitrogen oxide (NO X ) emissions. ORNL's current project is focused on understanding the performance of high-


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Diode Laser Cladding of High Diode Laser Cladding of High Temperature Alloys Used in USC Coal- Fired Boilers Background The Advanced Research (AR) Materials Program addresses materials requirements for all fossil energy systems, including materials for advanced power generation and coal fuels technologies. Examples of these technologies include coal gasification, heat engines such as turbines, combustion systems, fuel cells, hydrogen production, and carbon capture


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Electrochemical Processes Electrochemical Processes for CO2 Capture and Conversion to Commodity Chemicals Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Preparation and Testing of Corrosion- Preparation and Testing of Corrosion- and Spallation-Resistant Coatings- University of North Dakota Background The life of turbine components is a significant issue in gas fired turbine power systems. In this project the University of North Dakota (UND) will advance the maturity of a process capable of bonding oxide-dispersion strengthened alloy coatings onto nickel-based superalloy turbine parts. This will substantially improve the lifetimes and maximum use temperatures of parts with and without thermal barrier coatings (TBCs). This project is laboratory research and development and will be performed by UND at their Energy & Environmental Research Center (EERC) facility and the Department of Mechanical Engineering. Some thermal cycle testing will occur at Siemens Energy


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Integrated Assessment Model for Predicting Integrated Assessment Model for Predicting Potential Risks to Groundwater and Surface Water Associated with Shale Gas Development Background The EPAct Subtitle J, Section 999A-999H established a research and development (R&D) program for ultra-deepwater and unconventional natural gas and other petroleum resources. This legislation identified three program elements to be administered by a consortium under contract to the U.S. Department of Energy. Complementary research performed by the National Energy Technology Laboratory's (NETL) Office of Research and Development (ORD) is a fourth program element of this cost-shared program. NETL was also tasked with managing the consortium: Research Partnership to Secure Energy for America (RPSEA). Historically, the Complementary R&D Program being carried out by NETL's ORD has focused


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of Enabling Spar-Shell Demonstration of Enabling Spar-Shell Cooling Technology in Gas Turbines - Florida Turbine Technologies Background The Florida Turbine Technologies (FTT) spar-shell gas turbine airfoil concept has an internal structural support (the spar) and an external covering (the shell). This concept allows the thermal-mechanical and aerodynamic requirements of the airfoil design to be considered separately, thereby enabling the overall design to be optimized for the harsh environment these parts are exposed to during operation. Such optimization is one of the major advantages of the spar-shell approach that is not possible with today's conventional monolithic turbine components. The proposed design integrates a novel cooling approach based on Advanced Recircu-


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Alamos National Laboratory - Los Alamos National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization and Pre-Combustion Capture Goals Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop technologies to capture, separate, and store carbon dioxide (CO 2 ) to aid in reducing greenhouse gas (GHG) emissions without adversely influencing energy use or hindering economic growth. Carbon capture and sequestration (CCS) - the capture of CO 2 from large point sources and subsequent injection into deep geologic formations for permanent storage - is one option that is receiving considerable attention. NETL is devoted to improving geologic carbon sequestration technology by funding research projects aimed at removing barriers to commercial-scale

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cell Cathodes: Solid Oxide Fuel Cell Cathodes: Unraveling the Relationship among Structure, Surface Chemistry, and Oxygen Reduction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The Boston University (BU) project was competitively selected to acquire the fundamental


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials for Robust Repair Materials for Robust Repair of Leaky Wellbores in CO2 Storage Formations Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-fired Pressurized Fluidized Bed Oxy-fired Pressurized Fluidized Bed Combustor Development and Scale-up for New and Retrofit Coal-fired Power Plants Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy-combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Quantification Quantification of Wellbore Leakage Risk Using Non-Destructive Borehole Logging Techniques Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Storage Research Storage Research Carbon capture and storage (CCS) is a key component of the U.S. carbon management portfolio. Numerous studies have shown that CCS can account for up to 55 percent of the emissions reductions needed to stabilize and ultimately reduce atmospheric concentrations of CO 2 . NETL's Carbon Storage Program is readying CCS technologies for widespread commercial deployment by 2020. The program's goals are:


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Sequestration Sequestration Training and Research Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO2). Carbon capture and storage (CCS) technologies offer great potential for reducing CO2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess the skills required for implementing and deploying CCS technologies.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gulf of Mexico Miocene CO Gulf of Mexico Miocene CO 2 Site Characterization Mega Transect Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional storage types are porous permeable clastic or carbonate rocks that have


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE Leads Collaborative Effort DOE Leads Collaborative Effort to Quantify Environmental Changes that Coincide with Shale Gas Development Background DOE's National Energy Technology Laboratory (NETL) is leading a joint industry/ government research project to document environmental changes that occur during the lifecycle of shale gas development. The research plan calls for one year of environmental monitoring before development takes place to establish baseline conditions and account for seasonal variations. Monitoring then will continue through the different stages of unconventional shale gas development including: road and pad construction, drilling, and hydraulic fracturing, and for at least one year of subsequent production operations. The study will take place at a Range Resources-Appalachia


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

General Electric General Electric Background GE Power & Water, along with GE Global Research Center, has an ongoing U.S. Depart- ment of Energy (DOE) program to develop gas turbine technology for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). GE is broadening this development effort, along with expanding applicability to industrial applications such as refineries and steel mills under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines with industrial CCS. ARRA industrial technology acceleration,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Livermore National Laboratory Livermore National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop carbon capture and storage (CCS) technologies to capture, separate, and store carbon dioxide (CO 2 ) in order to reduce green-house gas emissions without adversely influencing energy use or hindering economic growth. Carbon sequestration technologies capture and store CO 2 by injecting and permanently storing it in underground geologic formations. NETL is working to advance geologic carbon sequestration technology by funding research projects that aim to accelerate deployment and remove barriers to commercial-scale carbon sequestration. Lawrence Livermore National Laboratory


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

r r oj e c t Fac t s Advanced Research Micro-Structured Sapphire Fiber Sensors for Simultaneous Measurements of High Temperature and Dynamic Gas Pressure in Harsh Environments Background Securing a sustainable energy economy by developing affordable and clean energy from coal and other fossil fuels is central to the mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL). To further this mission, NETL funds research and development of novel sensors that can function under the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-Fuel Turbo Machinery Oxy-Fuel Turbo Machinery Development for Energy Intensive Industrial Applications-Clean Energy Systems Background Clean Energy Systems (CES), with support from Siemens Energy and Florida Turbine Technologies (FTT), has an ongoing U.S. Department of Energy (DOE) program to develop an oxy-fuel combustor for highly efficient near zero emission power plants. CES is expanding this development for an industrial-scale, oxy-fuel reheat combustor- equipped intermediate-pressure oxy-fuel turbine (IP-OFT) under the American Recovery and Reinvestment Act (ARRA). Through the design, analysis, and testing of a modified Siemens SGT-900 gas turbine, the team will demonstrate a simple-cycle oxy-fuel system. ARRA funding is accelerating advancement in OFT technology for


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Passive Wireless Acoustic Wave Sensors Passive Wireless Acoustic Wave Sensors for Monitoring CO 2 Emissions for Geological Sequestration Sites Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO 2 ) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO 2 into underground formations that have the ability to securely contain the CO


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Criteria for Flame- Criteria for Flame- holding Tendencies within Premixer Passages for High Hydrogen Content Fuels-University of California, Irvine Background The gas turbine community must develop low emissions systems while increasing overall efficiency for a widening source of fuels. In this work, the University of California, Irvine (UCI) will acquire the fundamental knowledge and understanding to facilitate the development of robust, reliable, and low emissions combustion systems with expanded high hydrogen content (HHC) fuel flexibility. Specifically, understanding flashback and the subsequent flameholding tendencies associated with geometric features found within combustor fuel/air premixers will enable the development of design guides to estimate flame holding tendencies for lean, premixed emission combustion systems


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combining Space Geodesy, Seismology, Combining Space Geodesy, Seismology, and Geochemistry for MVA of CO2 in Sequestration Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO2) leakage at CO2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO2, with a high level of confidence that the CO2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhanced Analytical Simulation Tool for Enhanced Analytical Simulation Tool for CO2 Storage Capacity Estimation and Uncertainty Quantification Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


,"TX, RRC District 7C Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 7B Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


Salinization of Irrigated Urban Soils: A Case Study of El Paso, TX  

E-Print Network (OSTI)

This study was conducted to assess soil salinity levels in large landscape areas, such as golf courses, parks, and school grounds which were developed on various soil types in El Paso, Texas. The survey encompassed the East, the Central, the Northwest, and the Upper and Lower Valleys, covering 16 fairways at seven golf courses, 37 city parks, 30 school grounds, and 13 apartment landscapes on the Westside. The highest soil salinity (6 to 11 dS m-1) was found in the clayey soils of the Upper and Lower valleys, even when water of low salinity (650 to 750 ppm) had been used for irrigation. Spadoratic soil salinization was also observed in loamy soils of the South Central irrigated with city potable water, and topdressed soils of the Northwest after conversion to reclaimed water. Soil salinization was not observed in deep sand along I-10, and seldom in sandy calcic soils in the East and North Central, even though these soils contain a layer of caliche. Soil types play a role on soil salinization as much as does water quality.

Miyamoto, S.


Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Impact of Tropical Cyclones on the Geomorphic Evolution of Bolivar Peninsula, TX  

E-Print Network (OSTI)

Annually, tropical cyclones do tremendous damage and are agents of long-term coastal change. To test this idea of different tropical cyclones delivering consistent coastal change, a landform with such evolution is needed. One such landform is a spit. What contributions do tropical cyclones give toward the evolution of a spit, and do tropical cyclones give the same kinds of impacts? To determine if tropical cyclones have similar impacts, shoreline and volumetric change from four storms impacting Bolivar Peninsula are considered. Being a southwest-trended spit at a length of 33.5 kilometers, storm impacts are measured in the form of one dimensional shoreline and two dimensional volumetric change. These impacts are abstracted into shoreline change and volumetric change patterns. These patterns are identified and compared for differences between each storm and similarity among all storms. Results indicate that shoreline accretionary zones vary alongshore. Results from Hurricane Ike indicate an accretionary zone ten kilometers from the distal end. Shoreline change patterns for Hurricane Rita show an unstable accretionary zone at four kilometers from the distal end. Results for Tropical Storm Fay indicate an unstable accretionary zone that begins at the distal end and continues to the middle of the spit. In terms of similarity for shoreline change, all patterns from storms demonstrated erosion near Rollover Fish Pass. One dimensional volumetric change patterns were entirely erosive for Hurricanes Rita and Ike, and Tropical Storm Fay had by small zones of accretion near the distal portion of the spit. Tropical Storm Josephine demonstrated an accretion zone between the middle and distal portion of the spit. Results from two dimensional volumetric change patterns suggest a threshold for inland penetration. Tropical Storm Fay showed a ten to twenty meter wide pattern of erosion around five kilometers from the distal end and near the proximal end of the spit, and Hurricane Rita demonstrated a twenty meter wide pattern of erosion near the distal end. Hurricane Ike had erosive penetration of up to 200 meters around fifteen kilometers from the distal end. Results suggest that certain storms reinforce the standard spit growth model, and others work against it.

Hales, Billy



Farmers and ranchers in Calhoun County, TX: their land ethic and their interest in nature tourism  

E-Print Network (OSTI)

This paper is based on research that investigates (1) the land relationships of farmers and ranchers in Calhoun County, Texas, and (2) their opinions about, and interest in, nature tourism and/or starting a nature tourism enterprise. The methodology of this study consists of in-depth, semi-structured, open-ended interviews following an interpretive research approach (drawing from hermeneutic phenomenology), in order to get at the experiences of the farmers/ranchers and the meanings related to these experiences. The results of this descriptive and interpretive research indicate that the relationship of these agricultural producers with the land are far more complex than expressed in the environmental literature, and extends beyond the simplistic categories of anthropocentric (human centered) and non-anthropocentric (wilderness has value independent of humans) attitudes toward nature and the natural environment. Included in the framework of the producer's agricultural land ethic, which is built from the land relationship, are concepts such as the producers? sincere desire to take care of the land, their respect for the land, and specific views on their practices with the land. The agricultural land ethic provides insight into what guides the farmer in their daily operation of the farm and/or ranch as well as what influences them in their consideration of nature tourism. Finally, implications and recommendations are presented for the conservation and preservation of rural agricultural practices and ecological spaces through a revisited land ethic, and for the potential and pitfalls of diversifying into nature tourism in order to offset declining farm/ranching incomes.

Williams, Kimberly Lyn



McAllen, TX Natural Gas Imports by Pipeline from Mexico  

Annual Energy Outlook 2012 (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2006 2007 2008 2009 2010 2011 View...


TX, RRC Distict 7C Shale Gas Proved Reserves, Reserves Changes...  

Annual Energy Outlook 2012 (EIA)

2010 2011 View History Proved Reserves as of Dec. 31 13 27 2010-2011 Adjustments 0 -1 2010-2011 Revision Increases 0 13 2010-2011 Revision Decreases 0 19 2010-2011 Sales 0 0...


TX, RRC District 7B Shale Gas Proved Reserves, Reserves Changes...  

Annual Energy Outlook 2012 (EIA)

2,018 2,336 2,022 2,435 3,466 2007-2011 Adjustments 56 267 -193 2009-2011 Revision Increases 119 273 385 2009-2011 Revision Decreases 181 242 358 2009-2011 Sales 496 0 748...


TX, RRC District 7C Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

2010 2011 View History Proved Reserves as of Dec. 31 13 27 2010-2011 Adjustments 0 -1 2010-2011 Revision Increases 0 13 2010-2011 Revision Decreases 0 19 2010-2011 Sales 0 0...


820 Gessner Rd. -Ste. 920 Houston, TX 77024 www.energytribune.com  

E-Print Network (OSTI)

, so let us concen- trate on Indonesia and the oil palm. The oil palm (Elaeis) is the most productive oil crop in the world, with an average annual yield of 3 to 4 tons of crude palm oil per hectare production, moving into Brazilian sugarcane for ethanol and In- donesian palm oil for biodiesel. Woertz

Patzek, Tadeusz W.


Price of Freeport, TX Natural Gas LNG Imports from Egypt (Nominal...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- 4.24 2010's --...


Price of Freeport, TX Natural Gas LNG Imports from Trinidad and...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- 13.83 4.77 2010's -- 10.60...


TX, RRC District 6 Associated-Dissolved Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

276 247 412 451 458 471 1979-2011 Adjustments 6 8 4 16 13 38 1979-2011 Revision Increases 65 45 141 85 23 34 1979-2011 Revision Decreases 113 34 26 34 37 25 1979-2011 Sales 1 8 12...


TX, RRC District 10 Associated-Dissolved Natural Gas Proved Reserves...  

Annual Energy Outlook 2012 (EIA)

316 436 482 610 569 898 1979-2011 Adjustments 17 -22 -75 20 -20 -24 1979-2011 Revision Increases 84 80 134 89 97 293 1979-2011 Revision Decreases 50 46 81 49 193 41 1979-2011 Sales...


TX, RRC District 3 Onshore Associated-Dissolved Natural Gas Proved...  

Annual Energy Outlook 2012 (EIA)

489 474 479 476 466 399 1979-2011 Adjustments -10 24 28 -14 34 1 1979-2011 Revision Increases 41 58 76 69 98 58 1979-2011 Revision Decreases 52 110 83 57 54 52 1979-2011 Sales 25...


TX, RRC District 9 Associated-Dissolved Natural Gas Proved Reserves...  

Gasoline and Diesel Fuel Update (EIA)

05 139 158 422 585 957 1979-2011 Adjustments -6 46 19 -76 11 -48 1979-2011 Revision Increases 11 18 8 16 199 61 1979-2011 Revision Decreases 11 10 19 18 10 8 1979-2011 Sales 2 0 0...


TX, RRC District 1 Associated-Dissolved Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

61 72 60 67 267 900 1979-2011 Adjustments 4 5 -5 -2 -15 -15 1979-2011 Revision Increases 6 23 7 4 29 119 1979-2011 Revision Decreases 4 8 11 3 16 64 1979-2011 Sales 0 4 0 0 0 10...


TX, RRC District 8 Natural Gas Proved Reserves, Wet After Lease ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 5 Associated-Dissolved Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

57 50 40 21 8 40 1979-2011 Adjustments 0 3 2 43 -12 7 1979-2011 Revision Increases 12 2 2 7 2 31 1979-2011 Revision Decreases 1 6 3 65 2 2 1979-2011 Sales 0 0 7 0 0 4 2000-2011...


TX, RRC District 8A Associated-Dissolved Natural Gas Proved Reserves...  

Gasoline and Diesel Fuel Update (EIA)

,302 1,443 1,194 1,246 1,170 1,258 1979-2011 Adjustments -2 0 35 76 -67 -12 1979-2011 Revision Increases 117 261 69 168 141 202 1979-2011 Revision Decreases 106 75 257 96 59 33...


TX, RRC District 7B Associated-Dissolved Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

74 62 68 102 121 133 1979-2011 Adjustments -1 5 4 -3 39 -27 1979-2011 Revision Increases 10 15 2 16 9 39 1979-2011 Revision Decreases 4 8 7 4 14 12 1979-2011 Sales 1 14 0 0 0 0...


TX, RRC District 8 Natural Gas Reserves Summary as of Dec. 31  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 2 Onshore Associated-Dissolved Natural Gas Proved...  

Annual Energy Outlook 2012 (EIA)

8 137 72 72 134 924 1979-2011 Adjustments -2 -1 -28 15 -13 57 1979-2011 Revision Increases 8 49 26 8 35 61 1979-2011 Revision Decreases 7 11 53 30 15 21 1979-2011 Sales 14 12 0 0 0...

Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TX, RRC Distict 7C Associated-Dissolved Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

196 1,314 1,382 1,706 1,930 2,379 1979-2011 Adjustments 7 0 21 13 41 -11 1979-2011 Revision Increases 80 125 59 224 228 388 1979-2011 Revision Decreases 55 42 152 59 92 264...


TX, RRC District 4 Onshore Associated-Dissolved Natural Gas Proved...  

U.S. Energy Information Administration (EIA) Indexed Site

110 117 127 96 91 61 1979-2011 Adjustments 2 6 4 5 -1 11 1979-2011 Revision Increases 21 38 36 14 14 25 1979-2011 Revision Decreases 39 24 24 32 13 23 1979-2011 Sales 9 1 2 0 1 34...


TX, RRC District 2 Onshore Crude Oil plus Lease Condensate Proved ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


Case history: Underbalance drilling the midway and Navarro formations successfully in Hallettsville, TX  

Science Conference Proceedings (OSTI)

Underbalanced drilling proves to be a sound and economical procedure with an average of $500 M being saved per well. An average reduction of 19 days to total depth has also been experienced with this method of drilling. The major advantages of drilling underbalanced are lower cost, reduced drilling days, and reduced trouble time (i.e., differential sticking and hole drag due to thick mud cake across shallow depleted Wilcox sands).

Louison, R.F.; Andrews, J.P.; Reese, R.T.



ASTM Meeting Agenda for San Antonio, TX (v2010.3)  

Science Conference Proceedings (OSTI)

... Then on Wednesday morning we will meet at the hotel for the Main ... TOPIC: ENERGY (Karl Reichard) Discuss and demonstrate the first 20 laps with ...




E-Print Network (OSTI)

. Habib. The pemex autonomous demining robot: Perception and navigation strategies. In Proc. of IEEE

Botte, Gerardine G.


International Truck & Bus Meeting & Exhibition, Fort Worth, TX, November 2003. 2003-01-3369  

E-Print Network (OSTI)

System Development for an Advanced-Technology Medium-Duty Hybrid Electric Truck Chan-Chiao Lin, Huei Peng for a hybrid electric vehicle (HEV). The hybrid electric truck that employs this control system features a "Direct Hybrid" powertrain system [1], which integrates an advanced diesel engine, an electric traction

Peng, Huei


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Surface-Modified Electrodes: Enhancing Surface-Modified Electrodes: Enhancing Performance Guided by In-Situ Spectroscopy and Microscopy- Stanford University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by mass and


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Eddy Simulation Modeling of Large Eddy Simulation Modeling of Flashback and Flame Stabilization in Hydrogen-Rich Gas Turbines using a Hierarchical Validation Approach- University of Texas at Austin Background The focus of this project is the development of advanced large eddy simulation (LES)-based combustion modeling tools that can be used to design low emissions combustors burning high hydrogen content fuels. The University of Texas at Austin (UT) will develop models for two key topics: (1) flame stabilization, lift- off, and blowout when fuel-containing jets are introduced into a crossflow at high pressure, and (2) flashback dynamics of lean premixed flames with detailed description of flame propagation in turbulent core and near-wall flows. The jet- in-crossflow (JICF) configuration is widely used for rapid mixing of reactants


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficient Efficient Regeneration of Physical and Chemical Solvents for CO 2 Capture Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial Scale CO2 Injection and Commercial Scale CO2 Injection and Optimization of Storage Capacity in the Southeastern United States Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Turbine Thermal Management-NETL-RUA Turbine Thermal Management-NETL-RUA Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is researching advanced turbine technology with the goal of producing reliable, affordable, and environmentally friendly electric power in response to the nation's increasing energy challenges. With the Hydrogen Turbine Program, NETL is leading the research, development, and demonstration of technologies to achieve power production from high-hydrogen-content fuels derived from coal that is clean, efficient, and cost-effective, and minimizes carbon dioxide (CO 2 ) emissions, and will help maintain the nation's leadership in the export of gas turbine equipment. The NETL Regional University Alliance (RUA) is an applied research collaboration that


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scoping Studies to Evaluate the Benefits Scoping Studies to Evaluate the Benefits of an Advanced Dry Feed System on the Use of Low Rank Coal in Integrated Gasification Combined Cycle Background Gasification of coal or other solid feedstocks (biomass, petroleum coke, etc.) produces synthesis gas (syngas), which can be cleaned and used to produce electricity and a variety of commercial products that support the U.S. economy, decrease U.S. dependence on oil imports, and meet current and future environmental emission standards. The major challenge is cost, which needs to be reduced to make integrated gasification combined cycle (IGCC) technology competitive. An IGCC plant combines a combustion turbine operating on a gasified fuel stream--syngas--with a steam turbine to capture what would otherwise be waste heat. Currently, the estimated cost of power from IGCC is higher than


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reliability and Durability of Materials Reliability and Durability of Materials and Components for SOFCs - Oak Ridge National Laboratory Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) has a mission to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Oak Ridge National Laboratory's (ORNL) project was selected to acquire the fundamental


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

SOFC Protection Coatings Based on a SOFC Protection Coatings Based on a Cost-Effective Aluminization Process- NexTech Materials Background To make solid oxide fuel cell (SOFC) systems easier to manufacture and reduce costs, less expensive stainless steels have been substituted into the stack design as alternatives to ceramic interconnects. Stainless has also been substituted for high-cost, nickel-based superalloys in balance of plant (BOP) components. For successful implementation of these steels, protective coatings are necessary to protect the air-facing metal surfaces from high-temperature corrosion/oxidation and chromium (Cr) volatilization. NexTech Materials Ltd. (NexTech) will develop an aluminide diffusion coating as a low- cost alternative to conventional aluminization processes and evaluate the ability of the


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Patricia Rawls Patricia Rawls Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-5882 patricia.rawls@netl.doe.gov Sankaran Sundaresan Principal Investigator Princeton University Department of Chemical Engineering Princeton, NJ 08544 609-258-4583 sundar@princeton.edu PROJECT DURATION Start Date 10/01/2011 End Date 09/30/2014 COST Total Project Value $420,366 DOE/Non-DOE Share $300,000 / $120,366 Implementation and Refinement


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Methanol Economy Methanol Economy Background Fossil fuels such as coal, oil, and natural gas are composed of hydrocarbons with varying ratios of carbon and hydrogen. Consumption of hydrocarbons derived from fossil fuels is integral to modern day life in the U.S. Hydrocarbons are used as fuels and raw materials in the transportation sector and in many industrial production processes including chemicals, petrochemicals, plastics, pharmaceuticals, agrochemicals, and rubber.



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................



Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)


Note: This page contains sample records for the topic "tx antrim mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Does Future Home Networking Look Blue?  

Science Conference Proceedings (OSTI)

... Anything that runs on electricity Obvious ... Data Rate 433.9 kbit/s max ... (1 Master & 1-* Slaves) MASTER TX RX TX RX TX RX TX RX TX RX ...



fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

253845 TX Fran-Glass 253876 TX Frances 253907 MS Frances Creek 253919 TX Frances Hill 253938 IN Francesville ... 260402 TX Fulton Beach NE 260433 TX Fulton Beach North



E-Print Network (OSTI)

62 (from an inert gas run using Utah shale) produce a highfrom an inert gas run using Antrim shale) produced a highhot combustion gases may release spent shale fines which are



Predicting the occurrence of open natural fractures in shale reservoirs  

SciTech Connect

Prolific oil and gas production has been established from naturally fractured shale reservoirs. For example, in the last few years over 4 Tcf of gas reserves have been established within the self-sourcing Antrim Shale of the Michigan Basin. Historically, locating subsurface fracture systems essential for commercial production has proven elusive and costly. An integrated exploration approach utilizing available geologic, geophysical, and remote sensing data has successfully located naturally fractured zones within the Antrim Shale. It is believed that fracturing of the Antrim shale was a result of basement involved tectonic processes. Characteristic integrated stacked signatures of known fracture systems within the Antrim were built using gravity and magnetic data, structure maps, fracture identification logs, and Landsat imagery. Wireline fracture logs pinpointed the locations and geometries of subsurface fracture systems. Landsat imagery was interpreted to reveal surficial manifestations of subsurface structures.

Decker, A.D.; Klawitter, A.L. (Advanced Resources International, Denver, CO (United States))



Intermediate photovoltaic system application experiment operational performance report. Volume 7, for Newman Power Station, El Paso, TX  

DOE Green Energy (OSTI)

Performance data are given for the month of December, 1981 for a photovoltaic power supply at a Texas power station. Data include: monthly and daily electric energy produced; monthly and daily solar energy received; monthly and daily array efficiency; plots of energy produced as a function of power level, voltage, cell temperature, and hour of the day; monthly and daily electrical energy supplied by the photovoltaic system to the load; daily system availability; monthly and hourly insolation; monthly and hourly ambient temperature; monthly and hourly wind speed; wind direction distribution; heating and cooling degree days; number of freeze/thaw cycles; hourly cell temperature; and a plot of daily data acquisition mode and recording interval. Also included are brief summaries of three site events. (LEW)

Not Available



Superfund Record of Decision (EPA Region 6): Texarkana Wood Preserving Company, Operable Unit 2, Texarkana, TX, September 1993  

SciTech Connect

This decision document presents the selected remedial action for Operable Unit Two for the Texarkana Wood Preserving Company (TWPC) Superfund Site (Site) in Texarkana, Texas. This operable unit is the second of two operable units planned for the Site. Operable Unit Two involves remediation of the deeper ground water contaminated above the action levels in a limited area of the Silty Sand Zone around Monitoring Well-16.

Not Available



Solar Resources Measurements in Houston, TX -- Equipment Only: Cooperative Research and Development Final Report, CRADA Number CRD-06-204  

SciTech Connect

Loaning Texas Southern University equipment in order to perform site-specific, long-term, continuous, and high-resolution measurements of solar irradiance is important for developing renewable resource data. These data are used for several research and development activities consistent with the NREL mission: (1) establish a national 30-year climatological database of measured solar irradiances; (2) provide high quality ground-truth data for satellite remote sensing validation; (3) support development of radiative transfer models for estimating solar irradiance from available meteorological observations; (4) provide solar resource information needed for technology deployment and operations. Data acquired under this agreement will be available to the public through NREL's Measurement & Instrumentation Data Center - MIDC (http://www.nrel.gov/midc) Or the Renewable Resource Data Center - RReDC (http://rredc.nrel.gov). The MIDC offers a variety of standard data display, access, and analysis tools designed to address the needs of a wide user audience (e.g., industry, academia, and government interests).

Stoffel, T.



Anomalous zones in Gulf Coast Salt domes with special reference to Big Hill, TX, and Weeks Island, LA  

Science Conference Proceedings (OSTI)

Anomalous features in Gulf Coast Salt domes exhibit deviations from normally pure salt and vary widely in form from one dome to the next, ranging considerably in length and width. They have affected both conventional and solution mining in several ways. Gas outbursts, insolubles, and potash (especially carnallite) have led to the breakage of tubing in a number of caverns, and caused irregular shapes of many caverns through preferential leaching. Such anomalous features essentially have limited the lateral extent of conventional mining at several salt mines, and led to accidents and even the closing of several other mines. Such anomalous features, are often aligned in anomalous zones, and appear to be related to diapiric processes of salt dome development. Evidence indicates that anomalous zones are found between salt spines, where the differential salt intrusion accumulates other materials: Anhydrite bands which are relatively strong, and other, weaker impurities. Shear zones and fault displacement detected at Big Hill and Weeks Island domes have not yet had any known adverse impacts on SPR oil storage, but new caverns at these sites conceivably may encounter some potentially adverse conditions. Seismic reflection profiles at Big Hill dome have shown numerous fractures and faults in the caprock, and verified the earlier recognition of a major shear zone transecting the entire salt stock and forming a graben in the overlying caprock. Casing that is placed in such zones can be at risk. Knowledge of these zones should create awareness of possible effects rather than preclude the future emplacement of caverns. To the extent possible, major anomalous zones and salt stock boundaries should be avoided. Shear zones along overhangs may be particularly hazardous, and otherwise unknown valleys in the top of salt may occur along shear zones. These zones often can be mapped geophysically, especially with high-resolution seismic techniques.

Neal, J.T. [Sandia National Labs., Albuquerque, NM (United States); Magorian, T.R. [Magorian (Thomas R.), Amherst, NY (United States); Thoms, R.L. [AGM, Inc., College Station, TX (United States); Autin, W.J.; McCulloh, R.P. [Louisiana Geological Survey, Baton Rouge, LA (United States); Denzler, S.; Byrne, K.O. [Acres International Corp., Amherst, NY (United States)



Design of 9-meter carbon-fiberglass prototype blades : CX-100 and TX-100 : final project report.  

DOE Green Energy (OSTI)

TPI Composites, Inc. (TPI), Global Energy Concepts, LLC (GEC), and MDZ Consulting (MDZ) have collaborated on a project to design, manufacture, and test prototype carbon-fiberglass hybrid wind turbine blades of 9-m length. The project, funded by Sandia National Laboratories, involves prototype blades in both conventional (unidirectional spar fibers running along the blade span) and ''adaptive'' (carbon fibers in off-axis orientation to achieve bend-twist-coupling) configurations. After manufacture, laboratory testing is being conducted to determine the static and fatigue strength of the prototypes, in conjunction with field testing to evaluate the performance under operational conditions.

Berry, Derek (TPI Composites, Inc., Warren, RI)



Design of 9-meter carbon-fiberglass prototype blades : CX-100 and TX-100 : final project report.  

SciTech Connect

TPI Composites, Inc. (TPI), Global Energy Concepts, LLC (GEC), and MDZ Consulting (MDZ) have collaborated on a project to design, manufacture, and test prototype carbon-fiberglass hybrid wind turbine blades of 9-m length. The project, funded by Sandia National Laboratories, involves prototype blades in both conventional (unidirectional spar fibers running along the blade span) and ''adaptive'' (carbon fibers in off-axis orientation to achieve bend-twist-coupling) configurations. After manufacture, laboratory testing is being conducted to determine the static and fatigue strength of the prototypes, in conjunction with field testing to evaluate the performance under operational conditions.

Berry, Derek (TPI Composites, Inc., Warren, RI)



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.