Powered by Deep Web Technologies
Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


An accelerated zone 2 trip algorithm for non-pilot distance relays  

Science Conference Proceedings (OSTI)

This paper presents an algorithm able to accelerate the zone 2 trip of non-pilot distance relays by detecting remote breaker operation following a zone 2 fault. It is based on monitoring changes in proposed composite signals. The performance of the proposed ... Keywords: accelerated trip (AT), real time digital simulator (RTDS), sequential accelerated trip (SAT), total fault clearing time (TFCT)

German Rosas Ortiz; Tarlochan S. Sidhu



Data Processing Procedures and Methodology for Estimating Trip Distances for the 1995 American Travel Survey (ATS)  

SciTech Connect

The 1995 American Travel Survey (ATS) collected information from approximately 80,000 U.S. households about their long distance travel (one-way trips of 100 miles or more) during the year of 1995. It is the most comprehensive survey of where, why, and how U.S. residents travel since 1977. ATS is a joint effort by the U.S. Department of Transportation (DOT) Bureau of Transportation Statistics (BTS) and the U.S. Department of Commerce Bureau of Census (Census); BTS provided the funding and supervision of the project, and Census selected the samples, conducted interviews, and processed the data. This report documents the technical support for the ATS provided by the Center for Transportation Analysis (CTA) in Oak Ridge National Laboratory (ORNL), which included the estimation of trip distances as well as data quality editing and checking of variables required for the distance calculations.

Hwang, H.-L.; Rollow, J.



My Trip Calculator  

NLE Websites -- All DOE Office Websites (Extended Search)

Savings Calculator Trip Calculator Benefits Why is fuel economy important? Climate Change Oil Dependence Costs Sustainability Save Money Vehicles produce about half of the...


Textile - Compressor Trip Investigation  

Science Conference Proceedings (OSTI)

This power quality (PQ) case study presents the investigation of an 800 HP, 4160 volt compressor that has been tripping off at a textile manufacturing facility.



Outdoor science field trips.  

E-Print Network (OSTI)

??The purpose of this study was to assess the cognitive and affective values of an outdoor science field trip. Participants were 28 fifth grade students,ů (more)

Loyd, Kerrie Anne Therese



Turbine Overspeed Trip Modernization  

Science Conference Proceedings (OSTI)

This report provides guidance for power plant engineers contemplating modernization of their main turbine overspeed trip systems. When a large power plant turbine suddenly loses its output shaft loading due to a generator or power grid problem, the steam flow driving the turbine must be cut off very quickly to prevent an overspeed event. The overspeed trip system protects personnel and plant systems by preventing missiles that can result when turbines disintegrate at higher than normal rotational speeds....



School Trips in Autumn  

NLE Websites -- All DOE Office Websites (Extended Search)

in Autumn in Autumn Nature Bulletin No. 465-A October 7, 1972 Forest Preserve District of Cook County George W. Dunne, President Roland F. Eisenbeis, Supt. of Conservation SCHOOL TRIPS IN AUTUMN Autumn is an ideal season for classrooms out-of-doors, when teachers and their pupils enjoy and learn from trips to convenient natural areas such as our forest preserves. The days are usually sunny, the air is cool and invigorating, the fields and woodlands are clothed with tapestries of rich colors, the birds are flocking southward, and it is harvest time in all the land. Field trips, now or at any time in the school year, make real and vivid those subjects studied in the classroom and its textbooks. On field trips, teachers and youngsters explore and discover together. They employ all five senses: they see, hear, smell, taste and feel. Such learning, by the most natural and enjoyable process, is rapid and sticks with them. Inevitably, a field trip will yield a fund of unforgettable experiences and a wealth of specimens for the classroom or pupils' own collections.


Gov. Granholm, Administration Officials to Preview the President's Trip to  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Gov. Granholm, Administration Officials to Preview the President's Gov. Granholm, Administration Officials to Preview the President's Trip to Holland, Michigan Gov. Granholm, Administration Officials to Preview the President's Trip to Holland, Michigan July 14, 2010 - 12:00am Addthis WASHINGTON- Today at 4:00 p.m. EDT, Michigan Governor Jennifer Granholm, White House Communications Director Dan Pfeiffer, and Matt Rogers, Senior Advisor to Energy Secretary Chu, will hold a press conference call ahead of the President's trip to Holland, MI, for the official groundbreaking of the new Compact Power plant. As part of the call, they will preview a new Department of Energy report to be released on Thursday that details how Recovery Act investments are creating jobs and helping to build the domestic advanced battery and electric vehicle industry from the ground


EnergyCS Prius Altairnano 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...


EnergyCS Prius Valence 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...



NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...


Live Theater Wetland Kayak Trip  

E-Print Network (OSTI)

Live Theater Wetland Kayak Trip Adapted from http://water.usgs.gov/outreach/poster2/grade footprints(squish squish) in the mud with every pass. The shore was lined with tall cattails, but we found doused in sun screen, with me in the front and Mrs. Findley doing all the work steering in the back

Texas at Austin, University of


Trip Table ?????? #ejdyrki-#ejebnjj  

U.S. Energy Information Administration (EIA)

http://trip-table.com - /5e8f0a852f9c1d454b6df13f1365e4ef/e684451614f1683226855e2b90e1249c.html ... Top page #ejdyrki:?XNHx/Baass #ejdzgey:?maO8DRy4pM #ejdzuzo ...


Trip Table ?????? #UFOYMAA-#UFPBHZB  

U.S. Energy Information Administration (EIA)

http://trip-table.com - /7faa9d44500591fbfecedcda9a9d9cf9/72b75372a04495579b32da4524a88ead.html ... Top page #UFOYMAA:?760XFpqqAg #UFOZAUQ:?GiyoPAoyp. #UFOZPPG ...


Trip Table ?????? #gopmusbo-#gopmxoap  

U.S. Energy Information Administration (EIA)

http://trip-table.com - /de823d5fcb90885762f4a837a7fa1e4c/8ef5e7522a1014862421869a133710f6.html ... Top page #gopmusbo:?MyJIL5jza2 #gopmvgwe:?AGL/5xDjfA #gopmvvqu ...


Trip Table ?????? #PNQTORG-#PNQWKQH  

U.S. Energy Information Administration (EIA)

http://trip-table.com - /57be3958616c440476cf50b429b2476e/a2758b2d3ccf7339fa919b48ba7c1570.html ... Top page #PNQTORG:?oGcbIPIQ/2 #PNQUDLW:?QPKgjR/j7k #PNQUSGM ...


Trip Table ?????? #ykccmpk-#ykcfiol  

U.S. Energy Information Administration (EIA)

http://trip-table.com - /ce18e28f19b8a620d092b2a6c9fc0e08/311af50ce0338abff3271747a78d2a6c.html ... Top page #ykccmpk:?Bc4XbewxcY #ykcdbka:?gHgq5mD6d2 #ykcdqeq ...


Gobble Up Fuel Savings on Your Next Road Trip with My Trip Calculator...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

is My Trip Calculator? It is an interactive tool that helps you plan a route, pick a car and estimate a fuel costs for your next road trip. Enter your own miles per gallon...



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 14% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 380 Number of trips 106 Distance traveled (mi) 237 Percent...



NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 414 Number of trips 152 Distance traveled (mi) 131 Percent...



NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 410 Number of trips 94 Distance traveled (mi) 307 Percent of...



NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Overall AC electrical energy consumption (AC Wh/mi)┬╣ 64 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 31 Total number of trips 831 Total distance traveled (mi) 7,559 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 35 DC electrical energy consumption (DC Wh/mi) 54 Number of trips 541 Percent of trips city | highway 79% | 21% Distance traveled (mi) 3,402 Percent of total distance traveled 45%



NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi)┬╣ 45 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 22 Total number of trips 1,585 Total distance traveled (mi) 14,910 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 34 DC electrical energy consumption (DC Wh/mi) 49 Number of trips 883 Percent of trips city | highway 81% | 19% Distance traveled (mi) 4,778 Percent of total distance traveled 32%



NLE Websites -- All DOE Office Websites (Extended Search)

53 53 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 34 Total number of trips 1,515 Total distance traveled (mi) 15,617 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 37 DC electrical energy consumption (DC Wh/mi) 65 Number of trips 739 Percent of trips city | highway 74% | 26% Distance traveled (mi) 4,915 Percent of total distance traveled 31% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 93 Percent of trips city | highway 38% | 62% Distance traveled (mi) 2,842 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 683 Percent of trips city | highway 72% | 28% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

45 45 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 29 Total number of trips 1,839 Total distance traveled (mi) 21,089 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 654 Percent of trips city | highway 66% | 34% Distance traveled (mi) 5,717 Percent of total distance traveled 27% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 57 Number of trips 117 Percent of trips city | highway 39% | 62% Distance traveled (mi) 3,683 Percent of total distance traveled 17% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 1,068 Percent of trips city | highway 71% | 30% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

36 36 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 18 Total number of trips 1,290 Total distance traveled (mi) 13,023 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 432 Percent of trips city | highway 75% | 25% Distance traveled (mi) 2,835 Percent of total distance traveled 22% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 48 Number of trips 52 Percent of trips city | highway 31% | 69% Distance traveled (mi) 1,613 Percent of total distance traveled 12% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 806 Percent of trips city | highway 73% | 27% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

49 49 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 27 Total number of trips 927 Total distance traveled (mi) 9,301 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 66 Number of trips 313 Percent of trips city | highway 68% | 32% Distance traveled (mi) 2,138 Percent of total distance traveled 23% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 63 Number of trips 46 Percent of trips city | highway 30% | 70% Distance traveled (mi) 1,462 Percent of total distance traveled 16% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 568 Percent of trips city | highway 75% | 25% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

50 50 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 22 Total number of trips 730 Total distance traveled (mi) 9,164 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 40 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 225 Percent of trips city | highway 68% | 32% Distance traveled (mi) 1,768 Percent of total distance traveled 19% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 36 DC electrical energy consumption (DC Wh/mi) 53 Number of trips 40 Percent of trips city | highway 23% | 78% Distance traveled (mi) 1,638 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 35 Number of trips 465 Percent of trips city | highway 70% | 30% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

with battery state of charge below 90% (for charging events with SOC reported) Vehicle Usage Number of trips 3,364 Total distance traveled (mi) 21,706 Avg trip distance (mi) 5.8...



NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 46 17088 152906 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 61 9239 47037 Percent of trips city highway Percent of total distance...



NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 50 8833 73569 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 70 4028 16574 Percent of trips city highway Percent of total distance...



NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 52 6728 59423 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 67 3472 16226 Percent of trips city highway Percent of total distance...



NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 47 5791 60007 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 55 2858 14977 Percent of trips city highway Percent of total distance...



NLE Websites -- All DOE Office Websites (Extended Search)

3 Total number of trips 51 15726 143695 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 66 8674 38188 Percent of trips city highway Percent of total distance...

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 52 6894 62248 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 68 3685 15315 Percent of trips city highway Percent of total distance...


Workshops and Field Trips for Teachers  

NLE Websites -- All DOE Office Websites (Extended Search)

Workshops and Field Trips for Teachers Workshops and Field Trips for Teachers Nature Bulletin No. 534-A Septmeber 7, 1974 Forest Preserve District of Cook County George W. Dunne, President Roland F. Eisenbeis, Supt. of Conservation WORKSHOPS AND FIELD TRIPS FOR TEACHERS The Forest Preserve District, as a part of the educational program conducted by its Department of Conservation, again is offering a series of three-day workshops and another of one-day field trips, during this school year, for teachers in the schools of Chicago and suburban Cook County. Only a few decades ago, most Illinois people resided on farms or in small towns. They lived close to the soil. From childhood they had been so familiar with the out-of-doors that special schooling in ecology, plant life, wildlife and land management seemed superfluous.


My Trip to Mongolia | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

My Trip to Mongolia My Trip to Mongolia My Trip to Mongolia September 29, 2010 - 10:37am Addthis Deputy Secretary Poneman meets with Mongolia’s Foreign Minister to discuss energy issues. Deputy Secretary Poneman meets with Mongolia's Foreign Minister to discuss energy issues. Daniel B. Poneman Daniel B. Poneman Deputy Secretary of Energy Last week, I traveled to Mongolia to discuss our shared energy challenges and our shared energy opportunities. The United States and Mongolia enjoy a warm friendship and deepening ties in a number of areas, including energy. The United States is committed to supporting the government and people of Mongolia as they continue to democratize. Although half a world apart, the United States and Mongolia share some common energy features: both our



NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Overall AC electrical energy consumption (AC Wh/mi)┬╣ 148 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 104 Total number of trips 1,212 Total distance traveled (mi) 11,846 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 58 DC electrical energy consumption (DC Wh/mi) 160 Number of trips 823 Percent of trips city | highway 81% | 19% Distance traveled (mi) 5,559 Percent of total distance traveled 47% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 46 DC electrical energy consumption (DC Wh/mi) 85 Number of trips 195 Percent of trips city | highway 40% | 61% Distance traveled (mi) 4,217 Percent of total distance traveled 36% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips


No "big trips" for the universe  

E-Print Network (OSTI)

It has been claimed in several papers that a phantom energy-dominated universe can undergo a ``big trip'', i.e., tunneling through a wormhole that grows faster than the cosmic substratum due to the accretion of phantom energy, and will reappear on the other mouth of the wormhole. We show that such claims are unfounded and contradict the Einstein equations.

Valerio Faraoni




E-Print Network (OSTI)

-- Exploration for Petroleum and Natural Gas (optional laboratory) 87 -- The Obelisk: Revisited 96 -- References recording past events. Rather than letters and words, rock characteristics such as shape, color, composition of answers to questions about the nature of geological data gathered through the field trips and laboratory

Engelder, Terry


Probabilistic methods in a study of trip setpoints  

SciTech Connect

Most early vintage Boiling Water Reactors have a high head and high capacity High Pressure Coolant Injection (HPCI) pump to keep the core covered following a loss of coolant accident (LOCA). However, the protection afforded by the HPCI pump for mitigating a LOCA introduces the potential that a spurious start of the HPCI pump could oversupply the reactor vessel and lead to an automatic trip of the main turbine due to high water level. A turbine trip and associated increase in moderator density could challenge the bases of fuel integrity operating limits. To prevent turbine trip during spurious operation of the HPCI pump, the reactor protection system includes instrumentation and logic to sense high water level and automatically trip the HPCI pump prior to reaching the turbine trip setpoint. This paper describes an analysis that was performed to determine if existing reactor vessel water level trip instrumentation, logic and setpoints result in a high probability that the HPCI pump will trip prior to actuation of the turbine trip. Using nominal values for the initial water level and for the HPCI pump and turbine trip setpoints, and using the probability distribution functions for measurement uncertainty in these setpoints, a Monte Carlo simulation was employed to determine probabilities of successfully tripping the HPCI pump prior to tripping of the turbine. The results of the analysis established that the existing setpoints, instrumentation and logic would be expected to reliably prevent a trip of the main turbine. (authors)

Kaulitz, D. E. [Tennessee Valley Authority, LP 4G-C, 1101 Market Street, Chattanooga, TN 37402-2801 (United States)




NLE Websites -- All DOE Office Websites (Extended Search)

Original Pack) 7 Total number of trips 38 2737 20475 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 40 2104 12131 Percent of trips city highway Percent of...



NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi)┬╣ 111 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 61 Total number of trips 1,135 Total distance traveled (mi) 4,408 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 296 Number of trips 264 Percent of trips city | highway 100% | 0% Distance traveled (mi) 781 Percent of total distance traveled 18% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 19 DC electrical energy consumption (DC Wh/mi) 141 Number of trips 44 Percent of trips city | highway 96% | 4% Distance traveled CD | CS (mi) 333 | 389 Percent of total distance traveled CD | CS



NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Overall AC electrical energy consumption (AC Wh/mi)┬╣ 93 Overall DC electrical energy consumption (DC Wh/mi)┬▓ 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 40 Total number of trips 11,047 Total distance traveled (mi) 119,879 Trips in Charge Depleting (CD) mode┬│ Gasoline fuel economy (mpg) 25 DC electrical energy consumption (DC Wh/mi) 208 Number of trips 4,491 Percent of trips city | highway 92% | 8% Distance traveled (mi) 30,376 Percent of total distance traveled 25% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 71 Number of trips 1,352 Percent of trips city | highway 69% | 31% Distance traveled CD | CS (mi) 12,772 | 20,001 Percent of total distance traveled CD | CS


Hunton Group core workshop and field trip  

SciTech Connect

The Late Ordovician-Silurian-Devonian Hunton Group is a moderately thick sequence of shallow-marine carbonates deposited on the south edge of the North American craton. This rock unit is a major target for petroleum exploration and reservoir development in the southern Midcontinent. The workshop described here was held to display cores, outcrop samples, and other reservoir-characterization studies of the Hunton Group and equivalent strata throughout the region. A field trip was organized to complement the workshop by allowing examination of excellent outcrops of the Hunton Group of the Arbuckle Mountains.

Johnson, K.S. [ed.



Policy Statement 2, Transmittal of Trip Reports and Other Safety...  

NLE Websites -- All DOE Office Websites (Extended Search)

2 Date: December 31, 1992 Subject Board policy on transmittal of trip reports and other safety information to the Secretary of Energy Summary This policy statement establishes...


Optimization Online - Solution Methods for the Multi-trip Elementary ...  

E-Print Network (OSTI)

Mar 11, 2011 ... gmail.com). Abstract: We investigate the multi-trip elementary shortest path problem ... Citation: Technical Report, Laboratory for Computationalá...


School Trips & Projects in Spring  

NLE Websites -- All DOE Office Websites (Extended Search)

& Projects in Spring & Projects in Spring Nature Bulletin No. 484 March 9, 1957 Forest Preserve District of Cook County Daniel Ryan, President Roberts Mann, Conservation Editor David H. Thompson, Senior Naturalist SCHOOL TRIPS & PROJECTS IN SPRINg Spring is the morning of the year when nature reawakens. The days become noticeably longer and warmer. We feel an urge to get out-of- doors and see green growing plants, early wildflowers, and swelling buds on trees and shrubs; see and hear birds returning from their winter homes; hear the mating songs of frogs and toads. The nearest forest preserve, park, meadow or hedgerow -- even a city street or weedy vacant lot -- will have a wealth of plant and animal life. March is a chancy month for field trips but spring can be perking in a classroom before many signs of it appear outdoors. One twig of a forsythia bush, placed in a bottle of water, will soon display its yellow flowers; willow and aspen twigs will develop fat fuzzy catkins; the end of branches from cottonwood, soft maple and elm trees will reveal how some of their winter buds produce flowers and others burst into leaves. The long reddish catkins on a male cottonwood are showy but the small flowers of a maple or an elm are no less beautiful, although seldom noticed on the trees.



NLE Websites -- All DOE Office Websites (Extended Search)

9 4876 47783 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 59 2317 11750 Percent of trips city highway Percent of total distance traveled 24.59% 81.00%...



NLE Websites -- All DOE Office Websites (Extended Search)

7 3902 45779 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 57 1758 8306 Percent of trips city highway Percent of total distance traveled 18.15% 85.00% 15.00%...



NLE Websites -- All DOE Office Websites (Extended Search)

500 79963 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 70 3596 17063 Percent of trips city highway Percent of total distance traveled 21.3% 86.4% 13.6% ...



NLE Websites -- All DOE Office Websites (Extended Search)

731 77160 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 69 3809 16711 Percent of trips city highway Percent of total distance traveled 21.7% 86.8% 13.2% ...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Multiscale Modeling of Fracture Resistance in TRIP-Assisted ...  

Science Conference Proceedings (OSTI)

Abstract Scope, The fracture resistance of TRIP-assisted multiphase steels is ... austenite in a matrix of ferrite, bainite and martensite in the multiphase steels. ... Statistical Failure Analysis of Crystallographically Isotropic Porous Materials.


Clean Cities: National Clean Fleets Partner: Kwik Trip  

NLE Websites -- All DOE Office Websites (Extended Search)

In addition to the CNG infrastructure, Kwik Trip is developing a liquefied natural gas (LNG) corridor that will run from the Twin Cities to the Wisconsin-Illinois border. Kwik...



NLE Websites -- All DOE Office Websites (Extended Search)

through December 2012 Vehicle Usage Overall fuel economy (mpg) 126 Overall electrical energy consumption (AC Whmi) 229 Number of trips 369,118 Total distance traveled (mi)...


Vehicle Technologies Office: Fact #615: March 22, 2010 Average Vehicle Trip  

NLE Websites -- All DOE Office Websites (Extended Search)

5: March 22, 5: March 22, 2010 Average Vehicle Trip Length to someone by E-mail Share Vehicle Technologies Office: Fact #615: March 22, 2010 Average Vehicle Trip Length on Facebook Tweet about Vehicle Technologies Office: Fact #615: March 22, 2010 Average Vehicle Trip Length on Twitter Bookmark Vehicle Technologies Office: Fact #615: March 22, 2010 Average Vehicle Trip Length on Google Bookmark Vehicle Technologies Office: Fact #615: March 22, 2010 Average Vehicle Trip Length on Delicious Rank Vehicle Technologies Office: Fact #615: March 22, 2010 Average Vehicle Trip Length on Digg Find More places to share Vehicle Technologies Office: Fact #615: March 22, 2010 Average Vehicle Trip Length on AddThis.com... Fact #615: March 22, 2010 Average Vehicle Trip Length According to the latest National Household Travel Survey, the average trip



NLE Websites -- All DOE Office Websites (Extended Search)

0 Overall DC electrical energy captured from regenerative braking (DC Whmi) 43 Total number of trips 12,106 Total distance traveled (mi) 110,949 Trips in Charge Depleting (CD)...



NLE Websites -- All DOE Office Websites (Extended Search)

2 Overall DC electrical energy captured from regenerative braking (DC Whmi) 44 Total number of trips 36,749 Total distance traveled (mi) 343,675 Trips in Charge Depleting (CD)...



NLE Websites -- All DOE Office Websites (Extended Search)

18 Overall DC electrical energy consumption (DC Whmi) 84 Total number of trips 1,919 Total distance traveled (mi) 20,128 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

5 Overall DC electrical energy consumption (DC Whmi) 72 Total number of trips 14,961 Total distance traveled (mi) 168,067 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

03 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 959 Total distance traveled (mi) 10,425 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

2 Overall DC electrical energy consumption (DC Whmi) 75 Total number of trips 1,394 Total distance traveled (mi) 18,639 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

136 Overall DC electrical energy consumption (DC Whmi) 93 Total number of trips 1,476 Total distance traveled (mi) 16,266 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

11 Overall DC electrical energy consumption (DC Whmi) 74 Total number of trips 1,027 Total distance traveled (mi) 10,669 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

8 Overall DC electrical energy consumption (DC Whmi) 63 Total number of trips 1,388 Total distance traveled (mi) 16,479 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

126 Overall DC electrical energy consumption (DC Whmi) 86 Total number of trips 470 Total distance traveled (mi) 4,017 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 14% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 402 Number of trips 694 Distance traveled (mi) 1,450 Percent...



NLE Websites -- All DOE Office Websites (Extended Search)

09 Overall DC electrical energy consumption (DC Whmi) 73 Total number of trips 1,476 Total distance traveled (mi) 17,810 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

6 Overall DC electrical energy consumption (DC Whmi) 73 Total number of trips 15,434 Total distance traveled (mi) 172,132 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

9 Overall DC electrical energy consumption (DC Whmi) 61 Total number of trips 1,509 Total distance traveled (mi) 19,521 Trips in Charge Depleting (CD) mode Gasoline fuel...

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

14 Overall DC electrical energy consumption (DC Whmi) 76 Total number of trips 800 Total distance traveled (mi) 9,275 Trips in Charge Depleting (CD) mode Gasoline fuel economy...



NLE Websites -- All DOE Office Websites (Extended Search)

93 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 1,811 Total distance traveled (mi) 24,662 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

78 Overall DC electrical energy consumption (DC Whmi) 37 Total number of trips 1,084 Total distance traveled (mi) 9,876 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

88 Overall DC electrical energy consumption (DC Whmi) 59 Total number of trips 1,097 Total distance traveled (mi) 15,333 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

24 Overall DC electrical energy consumption (DC Whmi) 87 Total number of trips 1,325 Total distance traveled (mi) 15,061 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

5 Overall DC electrical energy consumption (DC Whmi) 63 Total number of trips 1,314 Total distance traveled (mi) 19,332 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

03 Overall DC electrical energy consumption (DC Whmi) 68 Total number of trips 1,269 Total distance traveled (mi) 13,444 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

36 Overall DC electrical energy consumption (DC Whmi) 11 Total number of trips 1,083 Total distance traveled (mi) 12,432 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

10 Overall DC electrical energy consumption (DC Whmi) 75 Total number of trips 1,586 Total distance traveled (mi) 16,990 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

3 Overall DC electrical energy consumption (DC Whmi) 55 Total number of trips 1,120 Total distance traveled (mi) 13,603 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

23 Overall DC electrical energy consumption (DC Whmi) 83 Total number of trips 1,535 Total distance traveled (mi) 17,701 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

74 Overall DC electrical energy consumption (DC Whmi) 44 Total number of trips 722 Total distance traveled (mi) 8,574 Trips in Charge Depleting (CD) mode Gasoline fuel economy...



NLE Websites -- All DOE Office Websites (Extended Search)

10 Overall DC electrical energy consumption (DC Whmi) 77 Total number of trips 1,661 Total distance traveled (mi) 14,806 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

46 Overall DC electrical energy consumption (DC Whmi) 25 Total number of trips 1,425 Total distance traveled (mi) 15,478 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

0 Overall DC electrical energy consumption (DC Whmi) 56 Total number of trips 1,579 Total distance traveled (mi) 20,195 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

8 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 1,160 Total distance traveled (mi) 11,521 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

12 Overall DC electrical energy consumption (DC Whmi) 72 Total number of trips 973 Total distance traveled (mi) 12,099 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

03 Overall DC electrical energy consumption (DC Whmi) 73 Total number of trips 1,427 Total distance traveled (mi) 17,582 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

90 Overall DC electrical energy consumption (DC Whmi) 36 Total number of trips 700 Total distance traveled (mi) 6,684 Trips in Charge Depleting (CD) mode Gasoline fuel economy...



NLE Websites -- All DOE Office Websites (Extended Search)

9 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 1,440 Total distance traveled (mi) 17,617 Trips in Charge Depleting (CD) mode Gasoline fuel...

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

35 Overall DC electrical energy consumption (DC Whmi) 21 Total number of trips 1,492 Total distance traveled (mi) 14,935 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

85 Overall DC electrical energy consumption (DC Whmi) 54 Total number of trips 813 Total distance traveled (mi) 10,029 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

6 Overall DC electrical energy consumption (DC Whmi) 64 Total number of trips 1,266 Total distance traveled (mi) 16,125 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

111 Overall DC electrical energy consumption (DC Whmi) 70 Total number of trips 1,023 Total distance traveled (mi) 14,654 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

1 Overall DC electrical energy consumption (DC Whmi) 54 Total number of trips 1,830 Total distance traveled (mi) 22,888 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

17 Overall DC electrical energy consumption (DC Whmi) 74 Total number of trips 976 Total distance traveled (mi) 12,487 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

88 Overall DC electrical energy consumption (DC Whmi) 60 Total number of trips 1,528 Total distance traveled (mi) 18,774 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

7 Overall DC electrical energy consumption (DC Whmi) 74 Total number of trips 14,233 Total distance traveled (mi) 159,409 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

8 Overall DC electrical energy consumption (DC Whmi) 75 Total number of trips 10,798 Total distance traveled (mi) 118,394 Trips in Charge Depleting (CD) mode Gasoline fuel...



NLE Websites -- All DOE Office Websites (Extended Search)

9 Overall DC electrical energy consumption (DC Whmi) 76 Total number of trips 13,110 Total distance traveled (mi) 145,669 Trips in Charge Depleting (CD) mode Gasoline fuel...


Readout of Secretary Chu's Middle East trip: Thursday, February 25 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Readout of Secretary Chu's Middle East trip: Thursday, February 25 Readout of Secretary Chu's Middle East trip: Thursday, February 25 Readout of Secretary Chu's Middle East trip: Thursday, February 25 February 25, 2010 - 12:00am Addthis Today, Secretary Chu was in Doha, Qatar, where he began the day by signing a Memorandum of Understanding on Renewable and Alternative Energy with Deputy Prime Minister and Energy & Industry Minister Abdullah bin Hamad Al-Attiyah. The agreement provides a framework for bilateral cooperation with the Ministry and other Qatari institutions on clean energy innovation. He then met with Prime Minister Sheikh Hamad bin Jassim bin Jaber Al Thani. In the afternoon, the Secretary participated in a roundtable focused on renewable energy, hosted by the Qatar National Food Security Program. He then traveled to the Qatar Science and Technology Park (QSTP) where he


Assess Employee Awareness of Alternative Commuting and Trip-Reduction  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assess Employee Awareness of Alternative Commuting and Assess Employee Awareness of Alternative Commuting and Trip-Reduction Programs for Greenhouse Gas Profile Assess Employee Awareness of Alternative Commuting and Trip-Reduction Programs for Greenhouse Gas Profile October 7, 2013 - 2:19pm Addthis YOU ARE HERE: Step 2 For evaluating a greenhouse gas (GHG) profile, success can be measured by employee awareness and use of commuting alternatives and trip-reduction efforts. Efforts include guaranteed ride home programs, and showers for walkers and bicyclists. Low use or awareness of an option, combined with a high willingness to use an option, such as teleworking, may suggest the need to improve communications about available alternatives. Next Steps For evaluating a GHG emissions profile for employee commuting, also learn


Disruption Management with Rescheduling of Trips and Vehicle Circulations  

E-Print Network (OSTI)

This paper introduces a combined approach for the recovery of a timetable by rescheduling trips and vehicle circulations for a rail-based transportation system subject to disruptions. We propose a novel event-based integer programming (IP) model. Features include shifting and canceling of trips as well as modifying the vehicle schedules by changing or truncating the circulations. The objective maximizes the number of recovered trips, possibly with delay, while guaranteeing a conflict-free new timetable for the estimated time window of the disruption. We demonstrate the usefulness of our approach through experiments for real-life test instances of relevant size, arising from the subway system of Vienna. We focus on scenarios in which one direction of one track is blocked, and trains have to be scheduled through this bottleneck. Solving these instances is made possible by contracting parts of the underlying event-activity graph; this allows a significant size reduction of the IP. Usually, the solutions found wi...

Fekete, Sandor P; Lorek, Martin; Pfetsch, Marc




NLE Websites -- All DOE Office Websites (Extended Search)

Usage Usage Overall fuel economy (mpg) 139 Overall electrical energy consumption (AC Wh/mi) 293 Number of trips┬╣ 76,425 Total distance traveled (mi) 609,737 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 36.4 Avg number of trips between charging events 3.0 Avg distance traveled between charging events (mi) 24.1 Avg number of charging events per day when the vehicle was driven 1.5


Secretary Chu Postpones China Trip to Continue Work on BP Oil...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Postpones China Trip to Continue Work on BP Oil Spill Response Efforts Secretary Chu Postpones China Trip to Continue Work on BP Oil Spill Response Efforts May 21, 2010 - 12:00am...


New Developments in TRI?P and RIASH at KVI  

Science Conference Proceedings (OSTI)

The status of the TRI?P facility at KVI is reviewed. Recent results on ion catcher devices are described. A thermo?ionizer for use with alkali and earth?alkali elements is close to completion. Concerning the use of superfluid helium as stopping medium

P. Dendooven; TRI?P group; RIASH group



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Real-time trip information service for a large taxi fleet  

Science Conference Proceedings (OSTI)

In this paper, we describe the design, analysis, implementation, and operational deployment of a real-time trip information system that provides passengers with the expected fare and trip duration of the taxi ride they are planning to take. This system ... Keywords: history-based predictions, nearest neighbour queries, partition-based predictions, taxi fleets, trip information service

Rajesh Krishna Balan; Khoa Xuan Nguyen; Lingxiao Jiang




NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.4 Total distance traveled (mi) 2,041,556 Average Ambient Temperature (deg F) 64.4 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 345 Distance traveled (mi) 1,002,495 Percent of total distance traveled 49.1% Average driving style efficiency (distance weighted)┬╣ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 1,039,061 Percent of total distance traveled 50.9% Average driving style efficiency (distance weighted)┬╣ 78% City┬│ Highway┬│ Percent of miles in EV operation (%) 66.2% 31.0% Percent Number of trips 86.0% 14.0% Average trip distance (mi)

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

1.1 1.1 Overall AC electrical energy consumption (AC Wh/mi) 182 Average Trip Distance 11.8 Total distance traveled (mi) 355,058 Average Ambient Temperature (deg F) 46.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 416 Distance traveled (mi) 155,080 Percent of total distance traveled 43.7% Average driving style efficiency (distance weighted)┬╣ 69% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 34.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,978 Percent of total distance traveled 56.3% Average driving style efficiency (distance weighted)┬╣ 74% City┬│ Highway┬│ Percent of miles in EV operation (%) 60.5% 27.0% Percent Number of trips 86.3% 13.7% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

6.6 6.6 Overall AC electrical energy consumption (AC Wh/mi) 171 Average Trip Distance 11.9 Total distance traveled (mi) 370,316 Average Ambient Temperature (deg F) 53.8 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 371 Distance traveled (mi) 170,860 Percent of total distance traveled 46.1% Average driving style efficiency (distance weighted)┬╣ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,456 Percent of total distance traveled 53.9% Average driving style efficiency (distance weighted)┬╣ 77% City┬│ Highway┬│ Percent of miles in EV operation (%) 63.2% 28.1% Percent Number of trips 86.7% 13.3% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi) 157 Average Trip Distance 12.3 Total distance traveled (mi) 407,245 Average Ambient Temperature (deg F) 67.9 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 338 Distance traveled (mi) 189,426 Percent of total distance traveled 46.5% Average driving style efficiency (distance weighted)┬╣ 82% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.5 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 217,819 Percent of total distance traveled 53.5% Average driving style efficiency (distance weighted)┬╣ 79% City┬│ Highway┬│ Percent of miles in EV operation (%) 65.2% 28.3% Percent Number of trips 86.5% 13.5% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

6 6 Overall AC electrical energy consumption (AC Wh/mi) 175 Average Trip Distance 12.2 Total distance traveled (mi) 272,366 Average Ambient Temperature (deg F) 54.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 368 Distance traveled (mi) 129,389 Percent of total distance traveled 47.5% Average driving style efficiency (distance weighted)┬╣ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.0 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 142,977 Percent of total distance traveled 52.4% Average driving style efficiency (distance weighted)┬╣ 77% City┬│ Highway┬│ Percent of miles in EV operation (%) 65.1% 31.1% Percent Number of trips 85.5% 14.5% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

4.8 4.8 Overall AC electrical energy consumption (AC Wh/mi) 185 Average Trip Distance 13.1 Total distance traveled (mi) 208,165 Average Ambient Temperature (deg F) 77.6 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 369 Distance traveled (mi) 104,687 Percent of total distance traveled 50.3% Average driving style efficiency (distance weighted)┬╣ 87% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 37.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 103,478 Percent of total distance traveled 49.7% Average driving style efficiency (distance weighted)┬╣ 82% City┬│ Highway┬│ Percent of miles in EV operation (%) 69.8% 33.9% Percent Number of trips 85.0% 15.0% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

2.5 2.5 Overall AC electrical energy consumption (AC Wh/mi) 166 Average Trip Distance 12.1 Total distance traveled (mi) 385,849 Average Ambient Temperature (deg F) 78.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 332 Distance traveled (mi) 193,336 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)┬╣ 85% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 192,512 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)┬╣ 79% City┬│ Highway┬│ Percent of miles in EV operation (%) 67.2% 31.5% Percent Number of trips 86.7% 13.3% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

7.8 7.8 Overall AC electrical energy consumption (AC Wh/mi) 180 Average Trip Distance 12.8 Total distance traveled (mi) 346,409 Average Ambient Temperature (deg F) 51.5 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 384 Distance traveled (mi) 161,982 Percent of total distance traveled 46.8% Average driving style efficiency (distance weighted)┬╣ 74% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.1 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 184,427 Percent of total distance traveled 53.2% Average driving style efficiency (distance weighted)┬╣ 76% City┬│ Highway┬│ Percent of miles in EV operation (%) 63.8% 28.4% Percent Number of trips 85.7% 14.3% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Overall AC electrical energy consumption (AC Wh/mi) 174 Average Trip Distance 12.6 Total distance traveled (mi) 1,243,988 Average Ambient Temperature (deg F) 63.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 352 Distance traveled (mi) 615,161 Percent of total distance traveled 49.5% Average driving style efficiency (distance weighted)┬╣ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 628,828 Percent of total distance traveled 50.5% Average driving style efficiency (distance weighted)┬╣ 78% City┬│ Highway┬│ Percent of miles in EV operation (%) 66.8% 31.7% Percent Number of trips 85.5% 14.5% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

71.0 71.0 Overall AC electrical energy consumption (AC Wh/mi) 169 Average Trip Distance 12.5 Total distance traveled (mi) 1,661,080 Average Ambient Temperature (deg F) 67.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 340 Distance traveled (mi) 826,775 Percent of total distance traveled 49.8% Average driving style efficiency (distance weighted)┬╣ 81% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.7 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 834,306 Percent of total distance traveled 50.2% Average driving style efficiency (distance weighted)┬╣ 78% City┬│ Highway┬│ Percent of miles in EV operation (%) 66.9% 31.6% Percent Number of trips 85.8% 14.2% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

73.7 73.7 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.6 Total distance traveled (mi) 370,987 Average Ambient Temperature (deg F) 71.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 341 Distance traveled (mi) 185,282 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)┬╣ 83% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 185,705 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)┬╣ 79% City┬│ Highway┬│ Percent of miles in EV operation (%) 68.0% 32.4% Percent Number of trips 85.4% 14.6% Average trip distance (mi)


Distance in architecture  

E-Print Network (OSTI)

The document which follows represents an exploration of distance and its connection to architecture. This exploration is threefold. On one level it regards distance as an ontological question, researching for precedent ...

Criparacos, George C



Optimal distance separating halfspace  

E-Print Network (OSTI)

Plastria & Carrizosa / Optimal distance separating halfspace. 2. 1 Gauge Distance to a Hyperplane. Let ? be a gauge on Rd with unit ball B, i.e. B is a compactá...


Vehicle Technologies Office: Fact #728: May 21, 2012 Average Trip Length is  

NLE Websites -- All DOE Office Websites (Extended Search)

8: May 21, 2012 8: May 21, 2012 Average Trip Length is Less Than Ten Miles to someone by E-mail Share Vehicle Technologies Office: Fact #728: May 21, 2012 Average Trip Length is Less Than Ten Miles on Facebook Tweet about Vehicle Technologies Office: Fact #728: May 21, 2012 Average Trip Length is Less Than Ten Miles on Twitter Bookmark Vehicle Technologies Office: Fact #728: May 21, 2012 Average Trip Length is Less Than Ten Miles on Google Bookmark Vehicle Technologies Office: Fact #728: May 21, 2012 Average Trip Length is Less Than Ten Miles on Delicious Rank Vehicle Technologies Office: Fact #728: May 21, 2012 Average Trip Length is Less Than Ten Miles on Digg Find More places to share Vehicle Technologies Office: Fact #728: May 21, 2012 Average Trip Length is Less Than Ten Miles on AddThis.com...


Focus on International Cooperation Continues, Secretary Chu Ends Trip with  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Focus on International Cooperation Continues, Secretary Chu Ends Focus on International Cooperation Continues, Secretary Chu Ends Trip with Visit to Russian 'Los Alamos' Focus on International Cooperation Continues, Secretary Chu Ends Trip with Visit to Russian 'Los Alamos' June 10, 2011 - 2:05pm Addthis Lindsey Geisler Lindsey Geisler Public Affairs Specialist, Office of Public Affairs Secretary Chu wrapped up his week-long visit in Russia today with a special visit to the All Russian Scientific Research Institute of Experimental Physics (VNIIEF). Many consider it to be the Russian equivalent of our Los Alamos National Laboratory. VNIIEF, located in Sarov, has a long scientific tradition in Russia, beginning when it was established in 1946 to design nuclear weapons. It's also where the first Soviet nuclear bomb, the "RDS-1," was created.


Focus on International Cooperation Continues, Secretary Chu Ends Trip with  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Focus on International Cooperation Continues, Secretary Chu Ends Focus on International Cooperation Continues, Secretary Chu Ends Trip with Visit to Russian 'Los Alamos' Focus on International Cooperation Continues, Secretary Chu Ends Trip with Visit to Russian 'Los Alamos' June 10, 2011 - 2:05pm Addthis Lindsey Geisler Lindsey Geisler Public Affairs Specialist, Office of Public Affairs Secretary Chu wrapped up his week-long visit in Russia today with a special visit to the All Russian Scientific Research Institute of Experimental Physics (VNIIEF). Many consider it to be the Russian equivalent of our Los Alamos National Laboratory. VNIIEF, located in Sarov, has a long scientific tradition in Russia, beginning when it was established in 1946 to design nuclear weapons. It's also where the first Soviet nuclear bomb, the "RDS-1," was created.



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Analysis of a turbine trip test with a plant analyzer  

SciTech Connect

To improve nuclear power plant safety, the Taiwan Power Company is using a plant analyzer developed by Brookhaven National Laboratory (BNL). The BNL boiling water reactor (BWR) plant analyzer program was converted and modified for the Chinshan power station using the ADSIM simulation language. The plant analyzer uses a special-purpose peripheral processor, the AD-100 from the Applied Dynamic International Company, and detailed mathematical models. With the fast-computing features of the AD-100, the plant analyzer can carry out accurate and fast simulations of nuclear power plant transients. To qualify this program, simulation results were benchmarked against power test data. During a power test a Chinshan unit 1, a 1175-MW(thermal) boiling water reactor (BWR), a turbine trip test was performed from a steady-state condition of 83% of rated core power and 80% of rated core flow. It was initiated by a manual trip of the turbine. The purpose of this work is to simulate the turbine trip transient with the plant analyzer and compare the results with plant test data.

Wang, Shih-Jen; Chien, C.S.; Jang, J.Y.



Globular Cluster Distance Determinations  

E-Print Network (OSTI)

The present status of the distance scale to Galactic globular clusters is reviewed. Six distance determination techniques which are deemed to be most reliable are discussed in depth. These different techniques are used to calibrate the absolute magnitude of the RR Lyrae stars. The various calibrations fall into three groups. Main sequence fitting using Hipparcos parallaxes, theoretical HB models and the RR Lyrae in the LMC all favor a bright calibration, implying a `long' globular cluster distance scale. White dwarf fitting and the astrometric distances yield a somewhat fainter RR Lyrae calibration, while the statistical parallax solution yields faint RR Lyrae stars implying a `short' distance scale to globular clusters. Various secondary distance indicators discussed all favor the long distance scale. The `long' and `short' distance scales differ by (0.31+/-0.16) mag. Averaging together all of the different distance determinations yields Mv(RR) = (0.23+/-0.04)([Fe/H] + 1.6) + (0.56+/-0.12) mag.

Brian Chaboyer



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Nuclear Maintenance Applications Center: Post-Trip Voltage Prediction at Nuclear and Other Generating Stations  

Science Conference Proceedings (OSTI)

The objective of this Electric Power Research Institute (EPRI) project is to investigate the possibility of predicting the switchyard voltage in a nuclear power plant (NPP) following a trip of a nuclear unit. Two methods of post-trip voltage prediction are investigated. The first method, called the V-Q method, uses minimal local plant information (such as unit operating conditionsactive and reactive power output and pre-trip voltage) to predict post-trip voltage based on the sensitivity of voltage to the...



DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


The effect of multiple entrances on the elevator round trip time under up-peak traffic  

Science Conference Proceedings (OSTI)

The design of vertical transportation systems relies on the calculation of the interval as an indicator of the quality of service. This in turn involves the accurate calculation of the round trip time of a single elevator. The calculation of the round ... Keywords: Basement, Elevator, Interval, Lift, Round trip time, Up peak traffic

Lutfi Al-Sharif



DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Testing of the TriP Chip Running at 132 nsec Using a Modified AFE Board  

SciTech Connect

In this note we describe the first set of tests done with a sample of TriP chips that were mounted on a modified AFE board. The modifications consisted of different firmware and the replacement of one power supply switch. The board used was a standard AFEIc board (red type) on which new MCMs (MCMIIs) were mounted. The new MCMs were designed to support the TriP and emulate the SVX for readout when mounted on an AFEIc board. The TriP and the MCMs are described in Ref. [1]. Two versions of the MCMII were designed and built: one (MCMIIb) supports two TriP chips wirebonded directly to the MCM substrate. The other, (MCMIIc) supports one TriP which can be either wirebonded directly or packaged into a standard TQFP surface mount package. Due to space constraints, this MCM can support only 1 TriP. We tested 6 TriP chips on 3 different MCMIIb (MCMIIb-1, MCMIIb-2 and MCMIIb-3) and 2 other TriPs were tested on MCMIIc, one of them with an unpackaged TriP (MCMIIc-1) and the other with a packaged TriP (MCMIIc-2). A set of 10 programable internal registers control the TriP operation, the description of these registers can be found in [1]. Table 1 shows the values used for the tests described in this note. In Ref. [1] there is a description of the signals that are needed to operate the TriP chip. We implemented in a Field Programable Gate Array (FPGA), also part of the MCM, a set of shift registers that allow us to download via the 1553 interface to the AFE board, any desired timing for the signals that the FPGA has to send to the TriP chip. These registers are run with a 121.21 MHz clock (which is 16x the crossing clock and phase locked to it), which means that each bit corresponds to a time interval of 8.25 nsec. Finer control of timing is possible, but this changing the programing of the FPGA and recompiling. The bits downloaded to these shift registers inside the TriP are listed in Table 2.

Juan Estrada et al.



Readout of Secretary Chu's Middle East trip: Tuesday, February 23 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tuesday, February 23 Tuesday, February 23 Readout of Secretary Chu's Middle East trip: Tuesday, February 23 February 23, 2010 - 12:00am Addthis Today, Secretary Chu visited King Abdullah University of Science and Technology (KAUST) in Thuwal, Saudi Arabia, on the Red Sea coast near Jeddah. His host was Saudi Minister of Petroleum and Minerals Ali Al Naimi, who is Chair of the KAUST Board of Trustees. KAUST is an international, graduate-level research university dedicated to science and technology that opened in September of 2009. The Secretary received a briefing on scientific work underway at the university from Professor Choon Fong Shih, President of KAUST, faculty members and students. Secretary Chu emphasized the Administration's commitment to science and to the development of renewable sources of energy. He quizzed members of the


Readout of Secretary Chu's Middle East trip: Wednesday, February 24 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wednesday, February 24 Wednesday, February 24 Readout of Secretary Chu's Middle East trip: Wednesday, February 24 February 24, 2010 - 12:00am Addthis Today, Secretary Chu was in Abu Dhabi in the United Arab Emirates, where he affirmed the commitment of the United States to building a close relationship with the UAE on clean energy issues. He began the day with a meeting with the Minister of Energy for UAE, Mohammed bin Dha'en el Hamili. He then signed an Implementing Agreement on nuclear energy and nonproliferation with UAE Minister of State for Foreign Affairs Dr. Anwar Gargash. The Secretary traveled to the offices of the Masdar Initiative to discuss the work the initiative is doing to diversify the UAE economy and develop global leadership in alternative energy. He was hosted by Dr.


Readout of Secretary Chu's Middle East trip: Thursday, February 25 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thursday, February 25 Thursday, February 25 Readout of Secretary Chu's Middle East trip: Thursday, February 25 February 25, 2010 - 12:00am Addthis Today, Secretary Chu was in Doha, Qatar, where he began the day by signing a Memorandum of Understanding on Renewable and Alternative Energy with Deputy Prime Minister and Energy & Industry Minister Abdullah bin Hamad Al-Attiyah. The agreement provides a framework for bilateral cooperation with the Ministry and other Qatari institutions on clean energy innovation. He then met with Prime Minister Sheikh Hamad bin Jassim bin Jaber Al Thani. In the afternoon, the Secretary participated in a roundtable focused on renewable energy, hosted by the Qatar National Food Security Program. He then traveled to the Qatar Science and Technology Park (QSTP) where he


Approximating geodesic tree distance  

Science Conference Proceedings (OSTI)

Billera, Holmes, and Vogtmann introduced an intriguing new phylogenetic tree metric for weighted trees with useful properties related to statistical analysis. However, the best known algorithm for calculating this distance is exponential in the number ... Keywords: Analysis of algorithms, Phylogeny, Tree metric

Nina Amenta; Matthew Godwin; Nicolay Postarnakevich; Katherine St. John



Smarter outlier detection and deeper understanding of large-scale taxi trip records: a case study of NYC  

Science Conference Proceedings (OSTI)

Outlier detection in large-scale taxi trip records has imposed significant technical challenges due to huge data volumes and complex semantics. In this paper, we report our preliminary work on detecting outliers from 166 millions taxi trips in the New ... Keywords: high-performance, outlier detection, shortest path, taxi trip

Jianting Zhang



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Digital field trip to the Central Nevada Thrust Belt  

SciTech Connect

Hydrocarbon exploration in the Central Nevada Thrust Belt is still in its infancy. However, this thrust belt contains all the elements necessary for hydrocarbon accumulations: thick, organically-rich shales; reefs, regional unconformities, karst surfaces, porous sandstones, and extensive and pervasive fractures; anticlines tens of miles long by miles wide; thrust faults that juxtapose potential source and reservoir rocks; and oil seeps. Along a fairway from Las Vegas to Elko, for example, thick Mississippian shales contain 4-6% total organic carbon and are oil-prone and thermally mature. This presentation from a laptop computer and LCD projector is a multimedia version of our October 12-14, 1995 field trip to document the hydrocarbon potential of the thrust belt in Clark, Lincoln, and Nye Counties. Outcrop images were recorded by a digital camera that has a resolution equivalent to a 14 inch computer screen; these images were then downloaded to the computer. All of the images were processed digitally on location to enhance picture quality and color contrast. Many were annotated on location with our observations, measurements, and interpretations. These field annotations are supplemented in this presentation by laboratory analyses. The presentation includes full-color, annotated outcrop images, sounds, and animations. The results show the viability of the new, inexpensive digital cameras to geologic field work in which a multimedia report, ready for presentation to management, can be generated in the field.

Chamberlain, A.K. (Cedar Strat Corp., Hiko, NV (United States)); Hook, S.C. (Texaco E P Technology Department, Houston, TX (United States)); Frost, K.R. (Texaco Exploration and Production, Inc., Houston, TX (United States))



Trip report for field visit to Fayetteville Shale gas wells.  

Science Conference Proceedings (OSTI)

This report describes a visit to several gas well sites in the Fayetteville Shale on August 9, 2007. I met with George Sheffer, Desoto Field Manager for SEECO, Inc. (a large gas producer in Arkansas). We talked in his Conway, Arkansas, office for an hour and a half about the processes and technologies that SEECO uses. We then drove into the field to some of SEECO's properties to see first-hand what the well sites looked like. In 2006, the U.S. Department of Energy's (DOE's) National Energy Technology Laboratory (NETL) made several funding awards under a program called Low Impact Natural Gas and Oil (LINGO). One of the projects that received an award is 'Probabilistic Risk-Based Decision Support for Oil and Gas Exploration and Production Facilities in Sensitive Ecosystems'. The University of Arkansas at Fayetteville has the lead on the project, and Argonne National Laboratory is a partner. The goal of the project is to develop a Web-based decision support tool that will be used by mid- and small-sized oil and gas companies as well as environmental regulators and other stakeholders to proactively minimize adverse ecosystem impacts associated with the recovery of gas reserves in sensitive areas. The project focuses on a large new natural gas field called the Fayetteville Shale. Part of the project involves learning how the natural gas operators do business in the area and the technologies they employ. The field trip on August 9 provided an opportunity to do that.

Veil, J. A.; Environmental Science Division



Field trip guide to selected outcrops, Arbuckle Mountains, Oklahoma  

Science Conference Proceedings (OSTI)

The Arbuckle Mountains, named for Brigadier General Matthew Arbuckle, are located in south-central Oklahoma. The formations that comprise the Arbuckle Mountains have been extensively studied for hydrocarbon source rock and reservoir rock characteristics that can be applied to the subsurface in the adjacent Anadarko and Ardmore basins. Numerous reports and guidebooks have been written concerning the Arbuckle Mountains. A few important general publications are provided in the list of selected references. The purpose of this handout is to provide general information on the geology of the Arbuckle Mountains and specific information on the four field trip stops, adapted from the literature. The four stops were at: (1) Sooner Rock and Sand Quarry; (2) Woodford Shale; (3) Hunton Anticline and Hunton Quarry; and (4) Tar Sands of Sulfur Area. As part of this report, two papers are included for more detail: Paleomagnetic dating of basinal fluid migration, base-metal mineralization, and hydrocarbon maturation in the Arbuckle Mountains, Oklahoma and Laminated black shale-bedded chert cyclicity in the Woodford Formation, southern Oklahoma.



Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Energy Secretary Bodman Completes Middle East Trip | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Bodman Completes Middle East Trip Secretary Bodman Completes Middle East Trip U.S. Energy Secretary Bodman Completes Middle East Trip November 20, 2005 - 2:51pm Addthis WASHINGTON, DC - U.S. Secretary of Energy Samuel W. Bodman concluded his four-nation swing through the Middle East this weekend, by attending the inauguration of the New Permanent Headquarter Office Building of the International Energy Forum (IEF) Secretariat and participating in a number of bilateral meetings in Riyadh, Saudi Arabia. "This trip allowed me to meet face-to-face with leaders of energy-producing nations and discuss with them the energy goals and needs of the United States," Secretary Bodman said. "Especially in the aftermath of the hurricanes in the Gulf of Mexico this year, we recognize how important it


Secretary Chu Postpones China Trip to Continue Work on BP Oil Spill  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Postpones China Trip to Continue Work on BP Oil Spill Postpones China Trip to Continue Work on BP Oil Spill Response Efforts Secretary Chu Postpones China Trip to Continue Work on BP Oil Spill Response Efforts May 21, 2010 - 12:00am Addthis Washington DC -- Energy Secretary Steven Chu will postpone a trip to China, scheduled for next week, at the request of President Obama and stay in the country to continue his work on response efforts to the BP oil spill. "Finding a solution to this crisis is a matter of national importance," Secretary Chu said. "I want to continue to play a role in assisting in the efforts and stopping this leak as soon as possible." Secretary Chu was originally scheduled to visit Beijing and Shanghai and discuss further progress on bilateral clean energy cooperation.


Turbine-Generator Auxiliary Systems, Volume 5: Main and Feedpump Turbine Trip Systems  

Science Conference Proceedings (OSTI)

This report describes the trip systems for the mechanical hydraulic control (MHC) and electrohydraulic control (EHC) main turbine and feedpump turbines for the General Electric (GE) and Siemens Westinghouse (SW) units in the United States.



Effects of Forming Induced Phase Transformation on Crushing Behavior of TRIP Steel  

Science Conference Proceedings (OSTI)

In this paper, results of finite element crash simulation are presented for a TRIP steel side rail with and without considering the phase transformation during forming operations. A homogeneous phase transformation model is adapted to model the mechanical behavior of the austenite-to-martensite phase. The forming process of TRIP steels is simulated with the implementation of the material model. The distribution and volume fraction of the martensite in TRIP steels may be greatly influenced by various factors during forming process and subsequently contribute to the behavior of the formed TRIP steels during the crushing process. The results indicate that, with the forming induced phase transformation, higher energy absorption of the side rail can be achieved. The phase transformation enhances the strength of the side rail

Liu, Wenning N.; Choi, Kyoo Sil; Soulami, Ayoub; Sun, Xin; Khaleel, Mohammad A.



Field trip guide to the Valles Caldera and its geothermal systems  

DOE Green Energy (OSTI)

This field trip guide has been compiled from extensive field trips led at Los Alamos National Laboratory during the past six years. The original version of this guide was designed to augment a workshop on the Valles Caldera for the Continental Scientific Drilling Program (CSDP). This workshop was held at Los Alamos, New Mexico, 5-7 October 1982. More stops were added to this guide to display the volcanic and geothermal features at the Valles Caldera. The trip covers about 90 miles (one way) and takes two days to complete; however, those who wish to compress the trip into one day are advised to use the designated stops listed in the Introduction. Valles Caldera and vicinity comprise both one of the most exciting geothermal areas in the United States and one of the best preserved Quaternary caldera complexes in the world.

Goff, F.E.; Bolivar, S.L.



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


DOE Solar Decathlon: Tuskegee University: Going the Distance  

NLE Websites -- All DOE Office Websites (Extended Search)

Tuskegee University house on the National Mall in Washington, D.C., during Solar Decathlon 2002. Tuskegee University house on the National Mall in Washington, D.C., during Solar Decathlon 2002. Enlarge image The Tuskegee Solar Decathlon team got its inspiration from traditional Southern architecture, which relies on passive cooling strategies such as the dogtrot, a central shaded breezeway that runs through the house. (Credit: Paul Norton/U.S. Department of Energy Solar Decathlon) Who: Tuskegee University What: Solar house Where: Tuskegee University 1200 W. Montgomery Road Tuskegee, AL 36088 Map This House Public tours: Not available Solar Decathlon 2002 Tuskegee University: Going the Distance Tuskegee University students successfully overcame funding and time limitations to make the trip to Washington, D.C., for the U.S. Department of Energy Solar Decathlon 2002. Now, with time back on its side, the


Steam Turbine Supervisory Instrumentation Systems, Volume 1: Reducing Spurious Trips While Maintaining Machine Protection  

Science Conference Proceedings (OSTI)

Recently, personnel at a number of utilities operating steam turbine generators have expressed concern with regard to spurious or unnecessary unit trips caused by turbine supervisory instrumentation (TSI). Spurious trips can be costly, and they can cause unnecessary challenges to safety equipment, especially at nuclear units. A better understanding of the function and design basis surrounding TSI as well as how to appropriately use the instrumentation can help the industry to mitigate risks of false ...



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mńkinen; Jorma Tarhio



United States: Ukraine Technical Exchange II trip report  

Science Conference Proceedings (OSTI)

May 15--21, 1994, the first technical conference was held at Hanford between Ukraine-Chornobyl, Westinghouse Hanford, and SAIC, to exchange technical information and experience gained in cleanup and stabilization of radioactive contamination at Hanford and Chornobyl. Protocol was signed for a second exchange and technology demonstration program in Kiev and near Chornobyl power plants. Technical Exchange No. 2 was held from August 28--September 9, 1994, with 3 focus areas: field demonstration of DOE-Hanford technologies and application to cleanup of contaminated lands resulting from 1986 Chornobyl accident; application of other US DOE-technologies; and observation/evaluation of Ukraine-developed technologies for potential application in USA. Three radiological mapping systems were demonstrated near Chornobyl: man-carried Ultrasonic Ranging and Data System, a mobile radiological data system, and NOMAD field gamma spectroscopy system. The Ukraine-Chornobyl team hosted technical presentations, discussions and field trips for 4.5 days, providing insight on the Chornobyl problem and allowing the US team to present overviews on DOE technologies that may be applicable to the Chornobyl situation. It is concluded that Ukrainian scientists have tremendous talent and expended considerable energy in attempting to tackle such a problem, but economic and cultural conditions with Ukraine have prevented them from acquiring the resources to implement basic aspects of characterization and remediation activities. Most of their publications are in Russian only. Their translation, plus resources to carry out proposals for bench scale and field demonstration projects, could benefit the DOE complex and other nuclear programs. The considerable cultural and economic change occurring in Ukraine, is providing opportunities for private industries to assist in the changes and for DOE, others to apply cleanup technologies, and it is essential that close institutional relations be established.

Moak, D.J.; Wendling, M.A.



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


(Discussion of plastic media blasting): Foreign trip report, 1988  

SciTech Connect

The visit to MBB was to see and discuss the plastic media blasting equipment developed and manufactured as a cooperative effort by Schlick and MBB. The Germans emphasized a systematic approach and complete control over most parameters. The goal is to achieve conditions which do not cause damage to the aircraft. To arrive at the goal the air pressure that delivers the air to entrain the media, the flow rate of media, and the media itself are carefully and accurately controlled. Distance of nozzle and angle of blasting were systematically investigated. The wet (freon) cleanup system under development at Schlick was not discussed.

Gat, U.




NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 49 89,494 825,358 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 57 42...



NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 47 8,056 75,381 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 54 37...



NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 48 11,690 113,476 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 53 39...



NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 49 11,977 110,783 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 55 40...



NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 44 9,485 89,378 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 52 38...

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 47 10,148 96,085 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 56 41...



NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 48 11,151 103,642 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 56 40...



NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 46 9,988 93,994 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 54 40...



NLE Websites -- All DOE Office Websites (Extended Search)

4 Overall AC electrical energy consumption (AC Whmi) 94 Overall DC electrical energy consumption (DC Whmi) 60 Total number of trips 1,077 Total distance traveled (mi) 15,138...


U.S. Secretary of Energy Concludes Successful Trip to Trinidad and Tobago |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Successful Trip to Trinidad and Successful Trip to Trinidad and Tobago U.S. Secretary of Energy Concludes Successful Trip to Trinidad and Tobago May 13, 2008 - 12:00pm Addthis Visit continues bilateral efforts to advance energy security WASHINGTON, DC - U.S. Secretary of Energy Samuel W. Bodman today concluded a visit to the Republic of Trinidad and Tobago focused on strengthening and expanding the two nations' strategic energy and economic relationship. The United States is Trinidad and Tobago's largest market for liquefied natural gas (LNG), importing nearly 60 percent of the LNG exported from the country. As such, the country plays an integral role in advancing the Bush Administration's strategy to ensure safe, reliable, clean and diverse energy supplies in the United States. "The United States is proud of its relationship with a strong and open


Secretary Chu to Visit Google Headquarters During Trip to San Francisco |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Google Headquarters During Trip to San Google Headquarters During Trip to San Francisco Secretary Chu to Visit Google Headquarters During Trip to San Francisco October 21, 2010 - 12:00am Addthis Washington, DC - During a visit to San Francisco tomorrow, Friday, Oct. 22, U.S. Energy Secretary Steven Chu will visit Google, Inc. headquarters to participate in a fireside chat with company employees to discuss the Obama Administration's vision for a clean and renewable energy economy. While at Google, Secretary Chu will also participate in a series of briefings with company researchers and scientists to learn more about the company's innovative ventures in the energy sector. WHAT: U.S. Energy Secretary Steven Chu to participate in fireside chat at Google, Inc. WHEN: Friday, October 22, 2010


Rural Schools and Distance Education  

Science Conference Proceedings (OSTI)

In 2006, the author began research on current issues in rural education in which teachers recounted narratives of teaching. As deficits, they spoke of an inability to retain teachers, too little diversity in student programming, and lack of access to ... Keywords: Distance Education, Distance Education Technologies, Educational Technology, Rural Schools, Teacher Practices

Barbara G. Barter



Google+ virtual field trip: "Vehicle Electrification" (11/18/13) | Argonne  

NLE Websites -- All DOE Office Websites (Extended Search)

Google+ virtual field trip: "Vehicle Electrification" (11/18/13) Google+ virtual field trip: "Vehicle Electrification" (11/18/13) Share Topic Energy Energy efficiency Vehicles Electric drive technology Browse By - Any - Energy -Energy efficiency --Vehicles ---Alternative fuels ---Automotive engineering ---Diesel ---Electric drive technology ---Hybrid & electric vehicles ---Powertrain research --Building design ---Construction --Manufacturing -Energy sources --Renewable energy ---Bioenergy ---Solar energy --Fossil fuels ---Natural Gas --Nuclear energy ---Nuclear energy modeling & simulation ---Nuclear fuel cycle ---Reactors -Energy usage --Energy storage ---Batteries ----Lithium-ion batteries ----Lithium-air batteries --Electricity transmission --Smart Grid Environment -Biology --Computational biology --Environmental biology


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


System and method for individually testing valves in a steam turbine trip control system  

SciTech Connect

This patent describes a steam turbine power plant. It comprises: a steam generator; a steam turbine adapted to receive steam form the steam generator; a throttle valve for regulating the flow of the steam received by the steam turbine; and an electro-hydraulic trip control system for causing the throttle valve to close when a predetermined condition has been reached.

Hurley, J.D.



A Simulated Field Trip: "The Visual Aspects of Power Plant Sitings1"  

E-Print Network (OSTI)

Abstract: The growth of our economy is demanding construction of a variety of power plants to generateA Simulated Field Trip: "The Visual Aspects of Power Plant Sitings1" Bill Bottom 2 Alex Young 3 electricity which is having a significant impact on the visual environment. These power plants will consist

Standiford, Richard B.


Ice Climbing in Clear Creek Canyon A climbing trip report by Glenn Murray  

E-Print Network (OSTI)

Ice Climbing in Clear Creek Canyon A climbing trip report by Glenn Murray SUMMARY: I climb ice in to ask about local climbing. The guys there told me there was ice nearby, in Clear Creek Canyon. I. Four pitches? Five? It was time to find a partner. The only ice climber I knew in Denver was a friend


Acceptance test procedure for removal of CS1K circuit switcher block and trip schemes  

Science Conference Proceedings (OSTI)

This supporting document provides a detailed process to test the functions of the circuit switcher, protective relays, alarms, SCADA and 125VDC control logic of 115kV and 13.8kV systems at B3S4 substation following the removal of trip and blocking schemes to Transformer No.1 Circuit Switcher B594.




Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Random Distances Associated with Rhombuses  

E-Print Network (OSTI)

Parallelograms are one of the basic building blocks in two-dimensional tiling. They have important applications in a wide variety of science and engineering fields, such as wireless communication networks, urban transportation, operations research, etc. Different from rectangles and squares, the coordinates of a random point in parallelograms are no longer independent. As a case study of parallelograms, the explicit probability density functions of the random Euclidean distances associated with rhombuses are given in this report, when both endpoints are randomly distributed in 1) the same rhombus, 2) two parallel rhombuses sharing a side, and 3) two rhombuses having a common diagonal, respectively. The accuracy of the distance distribution functions is verified by simulation, and the correctness is validated by a recursion and a probabilistic sum. The first two statistical moments of the random distances, and the polynomial fit of the density functions are also given in this report for practical uses.

Yanyan Zhuang; Jianping Pan



Academic Strategies for Distance Education  

Science Conference Proceedings (OSTI)

Education all over the world is of paramount importance as it provides economies with opportunities for development and growth. Education is important for both-developed and developing economies-for the former to maintain their lead position and for ... Keywords: Academic, Distance Education, Education, Knowledge, Learning, Quality, Standards, Strategies

Neeta Baporikar



Distance indexing on road networks  

Science Conference Proceedings (OSTI)

The processing of kNN and continuous kNN queries on spatial network databases (SNDB) has been intensively studied recently. However, there is a lack of systematic study on the computation of network distances, which is the most fundamental difference ...

Haibo Hu; Dik Lun Lee; Victor C. S. Lee



Water-to-Cement Distance Analysis Software  

Science Conference Proceedings (OSTI)

Water-to-Cement Distance Analysis Software. Description/Summary: ... Type of software: Analysis Software of Water-to-Cement Distance Analysis. ...



Predicting Fracture Toughness of TRIP 800 using Phase Properties Characterized by In-Situ High Energy X-Ray Diffraction  

Science Conference Proceedings (OSTI)

TRansformation Induced Plasticity (TRIP) steel is a typical representative of 1st generation advanced high strength steel (AHSS) which exhibits a combination of high strength and excellent ductility due to its multiphase microstructure. In this paper, we study the crack propagation behavior and fracture resistance of a TRIP 800 steel using a microstructure-based finite element method with the various phase properties characterized by in-situ high energy Xray diffraction (HEXRD) technique. Uniaxial tensile tests on the notched TRIP 800 sheet specimens were also conducted, and the experimentally measured tensile properties and R-curves (Resistance curves) were used to calibrate the modeling parameters and to validate the overall modeling results. The comparison between the simulated and experimentally measured results suggests that the micromechanics based modeling procedure can well capture the overall complex crack propagation behaviors and the fracture resistance of TRIP steels. The methodology adopted here may be used to estimate the fracture resistance of various multiphase materials.

Soulami, Ayoub; Choi, Kyoo Sil; Liu, Wenning N.; Sun, Xin; Khaleel, Mohammad A.; Ren, Yang; Wang, Yan-Dong


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A dynamic model system of household car ownership, trip generation, and modal split: model development and simulation experiment  

E-Print Network (OSTI)

1987) Why do people buy cars? Paper presented at the 5thRegression Model of Private Car Use. Report AE 4/87, FacultyEffects of Income and Car Ownership on Trip Generation: A

Kitamura, Ryuichi



Effects of Sample Geometry and Loading Rate onTensile Ductility of TRIP800 Steel  

SciTech Connect

The effects of sample geometry and loading rate on the tensile ductility of a commercial grade Transformation Induced Plasticity (TRIP) steel are examined in this paper. Quasistatic tensile tests were performed for the 1.2mm gauge TRIP800 steel sheets with two geometries: sub-sized ASTM E-8 and a custom designed miniature tensile sample. Sample geometry effects on post-uniform elongation are discussed together with other experimental data reported in the open literature. Further discussions on the effects of sample geometry are cast in the context of mesh-size dependent ductility in finite element-based engineering simulations. The quasi-static tensile curve for the miniature sample is then compared with the split Hopkinson bar results at the loading rates of 1700-S-1 and 2650-S-1 with the same sample design. In contrary to the typical strain rate sensitivity results for mild steel where the dynamic strength increase at high strain rate usually occurs at the price of ductility reduction, our results show that the TRIP800 under examination has positive strain rate sensitivity on both strength and ductility. Images of the deformation process captured by high speed camera together with scanning electron microscopy (SEM) near the fracture zone are also used to elucidate the different deformation modes at different loading rates.

Sun, Xin; Soulami, Ayoub; Choi, Kyoo Sil; Guzman, O.; Chen, Weinong W.



Method and apparatus for optimizing a train trip using signal information  

DOE Patents (OSTI)

One embodiment of the invention includes a system for operating a railway network comprising a first railway vehicle (400) during a trip along track segments (401/412/420). The system comprises a first element (65) for determining travel parameters of the first railway vehicle (400), a second element (65) for determining travel parameters of a second railway vehicle (418) relative to the track segments to be traversed by the first vehicle during the trip, a processor (62) for receiving information from the first (65) and the second (65) elements and for determining a relationship between occupation of a track segment (401/412/420) by the second vehicle (418) and later occupation of the same track segment by the first vehicle (400) and an algorithm embodied within the processor (62) having access to the information to create a trip plan that determines a speed trajectory for the first vehicle (400), wherein the speed trajectory is responsive to the relationship and further in accordance with one or more operational criteria for the first vehicle (400).

Kumar, Ajith Kuttannair; Daum, Wolfgang; Otsubo, Tom; Hershey, John Erik; Hess, Gerald James



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Trip Report  

Office of Legacy Management (LM)

Site A/Plot M, Cook County, Illinois Site A/Plot M, Cook County, Illinois May 2013 Page 1 2013 Inspection and Annual Site Status Report for the Site A/Plot M, Cook County, Illinois Decontamination and Decommissioning Program Site Summary Site A/Plot M was inspected on April 10, 2013. The site, located within a county forest preserve with significant tree and grass cover, was in good condition. No cause for a follow-up inspection was identified. Erosion on top of the grass covered mound at Plot M continues to be a concern. Bike traffic produces ruts which if left unfixed grow and threaten the protectiveness of the soil cover on top of the mound. In 2010 ANL personnel repaired two areas at Plot M by filling in the ruts with clean top soil and re-seeding. In 2012, additional repairs were made by ANL personnel. Three-


Trip Report  

Office of Legacy Management (LM)

Department of Energy 2013 Annual Inspection - Piqua, OH, Decommissioned Reactor Site Department of Energy 2013 Annual Inspection - Piqua, OH, Decommissioned Reactor Site June 2013 Page 1 2013 Annual Inspection and Radiological Survey Results for the Piqua, Ohio, Decommissioned Reactor Site Summary The former Piqua Nuclear Power Facility (PNPF), a decommissioned nuclear power demonstration facility, was inspected on April 18, 2013. The site, located on the east bank of the Great Miami River in Piqua, Ohio, is in good physical condition. There is no requirement for a


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Adaptive multi-stage distance join processing  

Science Conference Proceedings (OSTI)

A spatial distance join is a relatively new type of operation introduced for spatial and multimedia database applications. Additional requirements for ranking and stopping cardinality are often combined with the spatial distance join in on-line query ...

Hyoseop Shin; Bongki Moon; Sukho Lee



Metrics and methods for social distance  

E-Print Network (OSTI)

Distance measures are important for scientists because they illustrate the dynamics of geospatial topologies for physical and social processes. Two major types of distance are generally used for this purpose: Euclidean ...

Andris, Clio



MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435┬░, -100.665669┬░ Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Normalized Compression Distance of Multiples  

E-Print Network (OSTI)

Normalized compression distance (NCD) is a parameter-free similarity measure based on compression. The NCD between pairs of objects is not sufficient for all applications. We propose an NCD of finite multisets (multiples) of objacts that is metric and is better for many applications. Previously, attempts to obtain such an NCD failed. We use the theoretical notion of Kolmogorov complexity that for practical purposes is approximated from above by the length of the compressed version of the file involved, using a real-world compression program. We applied the new NCD for multiples to retinal progenitor cell questions that were earlier treated with the pairwise NCD. Here we get significantly better results. We also applied the NCD for multiples to synthetic time sequence data. The preliminary results are as good as nearest neighbor Euclidean classifier.

Cohen, Andrew R



Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Local discriminative distance metrics ensemble learning  

Science Conference Proceedings (OSTI)

The ultimate goal of distance metric learning is to incorporate abundant discriminative information to keep all data samples in the same class close and those from different classes separated. Local distance metric methods can preserve discriminative ... Keywords: Distance metrics learning, Local learning

Yang Mu; Wei Ding; Dacheng Tao



Recent progress on system studies for long distance power transmission  

SciTech Connect

Two possible applications of helium-cooled underground cables for power transmission were studied to determine network characteristics and estimated costs. The first involved power transmission at 345 kV from a Long Island nuclear power plant to a substation 43 miles away. The second appication examined the feasibility of a 350 mi-long 550 kV transmission line from Western Pennsylvania to Allentown and Philadelphia. For both systems computer simulations were used to study operating characteristics. A detailed cost analysis was made. The Long Island study concluded that helium-cooled cables were well suited for high-power transmission in a suburban area, that such a system using two trenches and separate refrigerator stations would be more reliable than a single trench system, and that cost could be optimized by using a less expensive cryogenic envelope. The Pennsylvania study showed that the helium-cooled cable was technically capable of performing as well as overhead power lines, but the cost of the underground cryogenic system is so much greater that such a system could not be economically justified for long distance transmission across open country-side. (LCL)

Forsyth, E B


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Characterizing Walk Trips in communities by Using Data from 2009 National Household Travel Survey, American Community Survey, and Other Sources  

SciTech Connect

Non-motorized travel (i.e. walking and bicycling) are of increasing interest to the transportation profession, especially in context with energy consumption, reducing vehicular congestion, urban development patterns, and promotion of healthier life styles. This research project aimed to identify factors impacting the amount of travel for both walk and bike trips at the Census block group or tract level, using several public and private data sources. The key survey of travel behavior is the 2009 National Household Travel Survey (NHTS) which had over 87,000 walk trips for persons 16 and over, and over 6000 bike trips for persons 16 and over. The NHTS, in conjunction with the Census Bureau s American Community Survey, street density measures using Census Bureau TIGER, WalkScore , Nielsen Claritas employment estimates, and several other sources were used for this study. Stepwise Logistic Regression modeling techniques as well as Discriminant Analysis were applied using the integrated data set. While the models performed reasonably well for walk trips, travel by bike was abandoned due to sparseness of data. This paper discusses data sources utilized and modeling processes conducted under this study. It also presents a summary of findings and addresses data challenges and lesson-learned from this research effort.

Hwang, Ho-Ling [ORNL; Reuscher, Tim [Macrosys; Wilson, Daniel W [ORNL; Murakami, Elaine [FHWA USDOT



Validation of River Flows in HadGEM1 and HadCM3 with the TRIP River Flow Model  

Science Conference Proceedings (OSTI)

The Total Runoff Integrating Pathways (TRIP) global river-routing scheme in the third climate configuration of the Met Office Unified Model (HadCM3) and the newer Hadley Centre Global Environmental Model version 1 (HadGEM1) general circulation ...

Pete Falloon; Richard Betts; Andrew Wiltshire; Rutger Dankers; Camilla Mathison; Doug McNeall; Paul Bates; Mark Trigg




E-Print Network (OSTI)

Jun 6, 2010 ... part by NSF Grant CCF 0514213 and DOE Grant DESC0002218. REFERENCES . [1] A. Y. Alfakih, On the uniqueness of Euclidean distanceá...


Report Notes  

NLE Websites -- All DOE Office Websites (Extended Search)

Notes Notes 1 "Overall AC electrical energy consumption (AC Wh/mi)" is based on AC electricity consumed during charging events which began during the reporting period and distance driven during all trips in the reporting period. 2 "Overall DC electrical energy consumption (DC Wh/mi)" is based on net DC electricity discharged from or charged to the plug-in battery pack and distance driven during all trips in the reporting period. DC Wh/mi may not be comparable to AC Wh/mi if AC electricity charged prior to the reporting period was discharged during driving within the reporting period, or if AC electricity charged during the reporting period was not discharged during driving within the reporting period. 3 Trips when the plug-in battery pack charge was depleted to propel the vehicle throughout


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Treating high pressure zones in one trip in Canyon Reef area of Texas  

Science Conference Proceedings (OSTI)

In the Canyon Reef area near Snyder, Texas, Chevron U.S.A. Inc. is employing ratchet operated, packer type retrievable bridge plugs which have allowed operators to test, treat, or squeeze high pressure zones over a 35-day period on a single trip of the workstring. More zones could have been treated if necessary. The bridge plug was moved and set 31 times while treating the zones. Elapsed time is shown in days starting with T-date being the day tools were first run in for the treatment. The job was run with an average treating pressure of 1,000 psi, and a differential pressure of 2,500 psi that alternated from above the bridge plug to below and back each time the plug was moved to a new zone. The bridge plug used for the job seals by the action of a patented ratcheting mechanism which requires relatively light weight to set. Design of the ratchet enables the sealing elements to hold a seal against the casing wall while the hold-down slips are being set.

Cooley, G.; Mccowen, D.; Fore, M.



FY94 CAG trip reports, CAG memos and other products: Volume 2. Final report  

SciTech Connect

The Yucca Mountain Site Characterization Project (YMP) of the US DOE is tasked with designing, constructing, and operating an Exploratory Studies Facility (ESF) at Yucca Mountain, Nevada. The purpose of the YMP is to provide detailed characterization of the Yucca Mountain site for the potential mined geologic repository for permanent disposal of high-level radioactive waste. Detailed characterization of properties of the site are to be conducted through a wide variety of short-term and long-term in-situ tests. Testing methods require the installation of a large number of test instruments and sensors with a variety of functions. These instruments produce analog and digital data that must be collected, processed, stored, and evaluated in an attempt to predict performance of the repository. The Integrated Data and Control System (IDCS) is envisioned as a distributed data acquisition that electronically acquires and stores data from these test instruments. IDCS designers are responsible for designing and overseeing the procurement of the system, IDCS Operation and Maintenance operates and maintains the installed system, and the IDCS Data Manager is responsible for distribution of IDCS data to participants. This report is a compilation of trip reports, interoffice memos, and other memos relevant to Computer Applications Group, Inc., work on this project.




Optimal expected-distance separating halfspace  

E-Print Network (OSTI)

If a different norm is used for each data set in order to measure distances to ... In practical settings, one usually has a data set D = {(x1,y1),..., (xp,yp)} ?. Rd Î {?1


Global Evaluation of the ISBA-TRIP Continental Hydrological System. Part II: Uncertainties in River Routing Simulation Related to Flow Velocity and Groundwater Storage  

Science Conference Proceedings (OSTI)

In the companion paper to this one (Part I), the Interactions between Soil, Biosphere, and AtmosphereľTotal Runoff Integrating Pathways (ISBA-TRIP) continental hydrological system of the Centre National de Recherches MÚtÚorologiques is evaluated ...

B. Decharme; R. Alkama; H. Douville; M. Becker; A. Cazenave



Sensor fault detection using the Mahalanobis distance  

Science Conference Proceedings (OSTI)

A method is described by which a localized sensor abnormality can be detected using the Mahalanobis distance. The Mahalanobis distance is approximately the weighted distance from the hyperplane formed by the principal components to the particular observation. Qualitatively, the principal components correspond to the physical laws that govern the behavior of the systems and constraints placed on the system. If there are more sensors than principal components, there are redundant measurements. This redundancy can be used to detect abnormalities that are due either to sensor failure or a localized change in the system being measured. The method compares the distribution of the Mahalanobis distance during normal operation with the distribution during the current operation. A likelihood ratio test is then used to determine if a sensor has gone bad or if operations in the reactor are different from normal. The sensor whose value is not normal is identified by comparing Mahalanobis distances computed with one sensor masked. When the abnormal sensor is masked, the Mahalanobis distance for this subset of sensors will be within prespecified bounds. The method is demonstrated on 20 subassembly output thermocouples in the core of Experimental Breeder Reactor II.

White, A.M.; Gross, K.C. (Argonne National Lab., IL (United States)); Kubic, W.L (Los Alamos National Lab., NM (United States))




NLE Websites -- All DOE Office Websites (Extended Search)

26 26 Overall electrical energy consumption (AC Wh/mi) 253 Number of trips┬╣ 526,156 Total distance traveled (mi) 4,369,753 Avg trip distance (mi)┬▓ 8.2 Avg distance traveled per day when the vehicle was driven (mi) 39.4 Avg number of trips between charging events 3.4 Avg distance traveled between charging events (mi) 27.9 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 1766 Reporting period: January 2013 through March 2013 Charging Location Home charging location┬│ Away-from-home charging locations Unknown charging locations Total number of charging events 124,954 21,973 7,718 Percent of all charging events 81% 14% 5% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.



NLE Websites -- All DOE Office Websites (Extended Search)

26 26 Overall electrical energy consumption (AC Wh/mi) 229 Number of trips┬╣ 369,118 Total distance traveled (mi) 3,001,976 Avg trip distance (mi) 8.1 Avg distance traveled per day when the vehicle was driven (mi) 40.5 Avg number of trips between charging events 3.5 Avg distance traveled between charging events (mi) 28.2 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 1021 Reporting period: October 2012 through December 2012 Charging Location and Type Home charging location┬▓ Away-from- home charging locations┬│ Unknown charging locations Number of charging events 86,264 13,547 6,698 Percent of all charging events 81% 13% 6% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.



NLE Websites -- All DOE Office Websites (Extended Search)

55 55 Overall electrical energy consumption (AC Wh/mi) 242 Number of trips┬╣ 147,886 Total distance traveled (mi) 1,184,265 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 39.6 Avg number of trips between charging events 3.2 Avg distance traveled between charging events (mi) 26.0 Avg number of charging events per day when the vehicle was driven 1.5 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 408 Reporting period: April 2012 through June 2012 Charging Location and Type Home charging location┬▓ Away-from- home charging locations┬│ Unknown charging locations Number of charging events 36,015 6,374 3,179 Percent of all charging events 79% 14% 7% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Short-Distance Structure of Nuclei  

Science Conference Proceedings (OSTI)

One of Jefferson Lab's original missions was to further our understanding of the short-distance structure of nuclei. In particular, to understand what happens when two or more nucleons within a nucleus have strongly overlapping wave-functions; a phenomena commonly referred to as short-range correlations. Herein, we review the results of the (e,e'), (e,e'p) and (e,e'pN) reactions that have been used at Jefferson Lab to probe this short-distance structure as well as provide an outlook for future experiments.

Douglas Higinbotham, Eliazer Piasetzky, Stephen Wood



Bounds on distance distributions in codes of known size  

Science Conference Proceedings (OSTI)

We treat the problem of bounding components of the possible distance distributions of codes given the knowledge of their size and possibly minimum distance. Using the Beckner inequality from harmonic analysis, we derive upper bounds on distance distribution ...

A. E. Ashikhmin; G. D. Cohen; M. Krivelevich; S. N. Litsyn


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: ┬Ě Hot handling ┬Ě Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Semantic distances for technology landscape visualization  

Science Conference Proceedings (OSTI)

This paper presents a novel approach to the visualization of research domains in science and technology. The proposed methodology is based on the use of bibliometrics; i.e., analysis is conducted using information regarding trends and patterns ... Keywords: Clustering, Data mining, Semantic distance, Technology forecasting

Wei Lee Woon; Stuart Madnick



Solar Decathlon 2013: Going the Distance | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Going the Distance Solar Decathlon 2013: Going the Distance September 17, 2013 - 4:26pm Addthis Toggle Routes onoff Return to map Solar Decathlon Journeys Visualizing the...


The Protection of Pharmaceutical Patents and Data under TRIPS and US-Jordan FTA: Exploring the Limits of Obligations and Flexibilities: A Study of the Impacts on the Pharmaceutical Sector in Jordan.  

E-Print Network (OSTI)

??In 2000, Jordan signed the Agreement on Trade-related Aspects of Intellectual Property Rights (the TRIPS Agreement) and a free trade agreement with the US (USJFTA).ů (more)

Abughanm, Saad



Long working distance incoherent interference microscope  

DOE Patents (OSTI)

A full-field imaging, long working distance, incoherent interference microscope suitable for three-dimensional imaging and metrology of MEMS devices and test structures on a standard microelectronics probe station. A long working distance greater than 10 mm allows standard probes or probe cards to be used. This enables nanometer-scale 3-dimensional height profiles of MEMS test structures to be acquired across an entire wafer while being actively probed, and, optionally, through a transparent window. An optically identical pair of sample and reference arm objectives is not required, which reduces the overall system cost, and also the cost and time required to change sample magnifications. Using a LED source, high magnification (e.g., 50.times.) can be obtained having excellent image quality, straight fringes, and high fringe contrast.

Sinclair, Michael B. (Albuquerque, NM); De Boer, Maarten P. (Albuquerque, NM)




NLE Websites -- All DOE Office Websites (Extended Search)

NERSC Storage Systems Group NERSC Storage Systems Group Storage at a Distance --- 1 --- Open F abrics A lliance U ser D ay What is storage at a distance? * Data i s n ot l ocal t o t he u ser/resource * Processing a nd w orkflow n eeds a re n ear r eal---7me - Don't w ant t o w ait u n9l d ata t ransfer i s c omplete - Need t o s ee r esults, m ake a djustments, a nd t ry a gain * Network w ill b ecome p art o f t he i nstruments - Telescopes a nd t heir d ata - Sequencers a nd t heir g enome d ata - Light s ources a nd t heir d ata * Is t here a n a rchitecture/protocol t hat i s n ecessary today for successfully providing storage at a distance? - Ethernet v s. I B - ROCE v s. R DMA v s. I P --- 2 --- Open F abrics A lliance U ser D ay Use case 1: Instruments (beam lines) * ShiB w ork ( 24hr c overage) - Scien9sts fl y i n a nd u se t he i nstrument


Assessment of full power turbine trip start-up test for C. Trillo 1 with RELAP5/MOD2. International Agreement Report  

Science Conference Proceedings (OSTI)

C. Trillo I has developed a model of the plant with RELAP5/MOD2/36.04. This model will be validated against a selected set of start-up tests. One of the transients selected to that aim is the turbine trip, which presents very specific characteristics that make it significantly different from the same transient in other PWRs of different design, the main difference being that the reactor is not tripped: a reduction in primary power is carried out instead. Pre-test calculations were done of the Turbine Trip Test and compared against the actual test. Minor problems in the first model, specially in the Control and Limitation Systems, were identified and post-test calculations had been carried out. The results show a good agreement with data for all the compared variables.

Lozano, M.F.; Moreno, P.; de la Cal, C.; Larrea, E.; Lopez, A.; Santamaria, J.G.; Lopez, E.; Novo, M. [Consejo de Seguridad Nuclear, Madrid (Spain)



Ford Escape Advanced Research Vehicle Report Notes  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Research Vehicle Advanced Research Vehicle Report Notes 1 "Overall AC electrical energy consumption (AC Wh/mi)" is based on AC electricity consumed during charging events which began during the reporting period and distance driven during all trips in the reporting period. 2 "Overall DC electrical energy consumption (DC Wh/mi)" is based on net DC electricity discharged from or charged to the plug-in battery pack and distance driven during all trips in the reporting period. DC Wh/mi may not be comparable to AC Wh/mi if AC electricity charged prior to the reporting period was discharged during driving within the reporting period, or if AC electricity charged during the reporting period was not discharged during driving within the reporting period.


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


MEDICAL CONSENT AGREEMENT If I should require medical treatment because of injury or illness during the trip, I consent to such  

E-Print Network (OSTI)

MEDICAL CONSENT AGREEMENT If I should require medical treatment because of injury or illness during/or accident insurance for trip participants and I agree to be financially responsible for any medical bills incurred as a result of an emergency or other medical treatment I may require while participating

Dyer, Bill


Helsinki Journal, Entry 20, December 17, 2006 I am writing this entry on the day we returned to Helsinki from our trip to Norway  

E-Print Network (OSTI)

and Viking Ship Museums ┬ş Norwegians revere their famous explorers. I found each of these sights deeply. #12;One of the major highlights of the trip, however, was that we were able to meet with some distant coursin. It's difficult, at this point, to comment objectively on what it means to meet distant family

Bardsley, John


2D Euclidean distance transform algorithms: A comparative survey  

Science Conference Proceedings (OSTI)

The distance transform (DT) is a general operator forming the basis of many methods in computer vision and geometry, with great potential for practical applications. However, all the optimal algorithms for the computation of the exact Euclidean DT (EDT) ... Keywords: Dijkstra's algorithm, Distance transform, computational geometry, exact Euclidean distance map, performance evaluation, shape analysis

Ricardo Fabbri; Luciano Da F. Costa; Julio C. Torelli; Odemir M. Bruno



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Distance Is Not Dead: Social Interaction and Geographical Distance in the Internet Era  

E-Print Network (OSTI)

The Internet revolution has made long-distance communication dramatically faster, easier, and cheaper than ever before. This, it has been argued, has decreased the importance of geographic proximity in social interactions, transforming our world into a global village with a borderless society. We argue for the opposite: while technology has undoubtedly increased the overall level of communication, this increase has been most pronounced for local social ties. We show that the volume of electronic communications is inversely proportional to geographic distance, following a Power Law. We directly study the importance of physical proximity in social interactions by analyzing the spatial dissemination of new baby names. Counter-intuitively, and in line with the above argument, the importance of geographic proximity has dramatically increased with the internet revolution.

Goldenberg, Jacob



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



1993 International conference on nuclear waste management and environmental remediation, Prague, Czech Republic, September 5--11, 1993. Combined foreign trip report  

SciTech Connect

The purpose of the trip was to attend the 1993 International Conference on Nuclear Waste Management and Environmental Remediation. The principal objective of this conference was to facilitate a truly international exchange of information on the management of nuclear wastes as well as contaminated facilities and sites emanating from nuclear operations. The conference was sponsored by the American Society of Mechanical Engineers, the Czech and Slovak Mechanical Engineering Societies, and the Czech and Slovak Nuclear Societies in cooperation with the Commission of the European Communities, the International Atomic Energy Agency, and the OECD Nuclear Agency. The conference was cosponsored by the American Nuclear Society, the Atomic Energy Society of Japan, the Canadian Nuclear Society, the (former USSR) Nuclear Society, and the Japan Society of Mechanical Engineers. This was the fourth in a series of biennial conferences, which started in Hong Kong, in 1987. This report summarizes shared aspects of the trip; however, each traveler`s observations and recommendations are reported separately.

Slate, S.C. [comp.; Allen, R.E. [ed.


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Generic Requirements Specification for Upgrading the Safety-Related Reactor Trip and Engineered Safety Features Actuation Systems in Westinghouse PWR Nuclear Power Plants  

Science Conference Proceedings (OSTI)

To address obsolescence concerns, a generic requirements specification for digital upgrades to existing reactor trip systems and engineered safety features actuation systems in a Westinghouse pressurized water reactor (PWR) was developed. System requirements are based on a 4-loop PWR with a solid-state protection system since this typifies the most advanced capability level. However, the specification is applicable to relay-based 2- and 3-loop plants where some or all of the advances in the newest solid-...



On electric resistances for distance-regular graphs  

E-Print Network (OSTI)

We investigate the behavior of electric potentials on distance-regular graphs, and extend some results of a prior paper. Our main result, Theorem 4, shows(together with Corollary 3) that if distance is measured by the electric resistance between points then all points are close to being equidistant on a distance-regular graph with large valency. A number of auxiliary results are also presented.

Koolen, Jack; Park, Jongyook



Hazardous Waste Minimum Distance Requirements (Connecticut) | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minimum Distance Requirements (Connecticut) Minimum Distance Requirements (Connecticut) Hazardous Waste Minimum Distance Requirements (Connecticut) < Back Eligibility Agricultural Commercial Construction Fed. Government Fuel Distributor General Public/Consumer Industrial Installer/Contractor Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential Municipal/Public Utility Nonprofit Residential Retail Supplier Rural Electric Cooperative Schools State/Provincial Govt Systems Integrator Transportation Tribal Government Utility Program Info State Connecticut Program Type Siting and Permitting Provider Department of Energy and Environmental Protection These regulations set minimum distance requirements between certain types of facilities that generate, process, store, and dispose of hazardous waste


Spatial chemical distance based on atomic property fields  

E-Print Network (OSTI)

009-9316-x Spatial chemical distance based on atomicSimilarity of compound chemical structures often leads tonot always true, as distinct chemical scaffolds can exhibit

Grigoryan, A. V.; Kufareva, I.; Totrov, M.; Abagyan, R. A.



Consumer Adoption of Online Banking: Does Distance Matter?  

E-Print Network (OSTI)

Adoption of Online Banking: Does Distance Matter? Beethikaand Goolsbee, Austan (2002). "Does the Internet Make Marketsto the closest bank branch does not affect the likelihood of

Khan, Beethika S.



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


A Collaborative Case Study System for Distance Learning  

Science Conference Proceedings (OSTI)

Distance Learning from Case Studies involves enabling collaboration between two or more learners at a distance on a case study activity. In this paper we present an empirical qualitative study that simulates a learning scenario in which a pair of subjects ...

Marta C. Rosatelli; John A. Self



Measuring Dialect Distance Phonetically John Nerbonne and Wilbert Heeringa  

E-Print Network (OSTI)

- tance, both simple (based on atomic char- acters) and complex (based on feature vec- tors). The measurements using feature vec- tors varied according to whether city-block distance, Euclidean distance or (a sensitive, that city-block dis- tance is a good measure of phonetic over- lap of feature vectors


Computing the FrÚchet distance between piecewise smooth curves  

Science Conference Proceedings (OSTI)

We consider the Frechet distance between two curves which are given as a sequence of m+n curved pieces. If these pieces are sufficiently well-behaved, we can compute the Frechet distance in O(mnlog(mn)) time. The decision version of the problem can be ... Keywords: Shape matching

GŘnter Rote



A Novel Distributed Simulation Approach in Adaptive Distance Relaying  

Science Conference Proceedings (OSTI)

In this paper, an adaptive distance relaying strategy based on the global network simulation (GNS) concept is presented. The GNS concept is actually a distributed simulation approach (DSA) for piecewise analysis of large-scale power grids using diakoptics ... Keywords: adaptive distance relaying, coordination rules, diakoptics, distributed simulation approach (DSA), global network simulation (GNS), large change sensitivity (LCS), mutually coupled lines

V. Gohari Sadr; S.M. Kouhsari



Optimal selection of robots by using distance based approach method  

Science Conference Proceedings (OSTI)

A deterministic quantitative model based on Distance Based Approach (DBA) method has been developed for evaluation, selection and ranking of robots, which is a concept hitherto not employed in selection problem of this kind. As a significant development ... Keywords: Distance based approach, Optimized selection, Ranking, Robots

Rishi Kumar; R. K. Garg



An extreme-distance approach to multiple criteria ranking  

Science Conference Proceedings (OSTI)

A distance approach based on extreme points, or predefined ideal and anti-ideal points, is proposed to improve on the TOPSIS (Technique for Order Performance [or Ordered Preference] by Similarity to Ideal Solution) method of multiple criteria ranking. ... Keywords: Comparative study, Distance-based ranking, Multiple criteria decision analysis, Multiple criteria ranking, TOPSIS

Ye Chen; D. Marc Kilgour; Keith W. Hipel



Solar Decathlon 2013: Going the Distance | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Going the Distance Going the Distance Solar Decathlon 2013: Going the Distance September 17, 2013 - 4:26pm Addthis Toggle Routes on/off Return to map Ôćĺ Solar Decathlon Journeys Visualizing the distances that each Solar Decathlon house travelled Click competitors to toggle their journeys on and off. All routes and distances are approximate. Rebecca Matulka Rebecca Matulka Digital Communications Specialist, Office of Public Affairs Solar Decathlon 2013: In our new blog series, we're going behind the scenes to show you what it takes to compete in the Solar Decathlon. First up: Meet the teams competing this year and learn how they were selected. Part two looks at how the teams must master the art of fundraising. What does it take to design an energy-efficient, solar-powered house? Part three looks at creating a winning design.


Winter Field Trips  

NLE Websites -- All DOE Office Websites (Extended Search)

terrarium is merely to put a quart of rich damp soil in a clean wide-mouthed gallon jar, screw the lid on tight and set it near a window. That's all. Soon, dormant seeds...


Transportation / Field Trips  

Science Conference Proceedings (OSTI)

... In the event that a child misses the transportation, parents may choose the ... their child's class on an outing and possibly transport themselves or their ...



Slips, Trips and Falls  

NLE Websites -- All DOE Office Websites (Extended Search)

Climb down a ladder one rung at a time Do not climb with tools in hand - use a tool belt Keep your body between the ladder side rails when climbing Do not lean...


Trip to China  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to China By row boat or by plane... 16 hours later Linda Field Patent Counsel Department of Energy Destination: Wuhan, China Purpose: Innovation Promotion in CERC - IP Clarity &...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 18% 42% 58% DC electrical energy consumption (DC Whmi) 50 6 Trips in Charge Sustaining (CS) mode Distance traveled...

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 20% 47% 53% DC electrical energy consumption (DC Whmi) 49 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 12% 52% 48% DC electrical energy consumption (DC Whmi) 47 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 16% 46% 54% DC electrical energy consumption (DC Whmi) 52 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 15% 49% 51% DC electrical energy consumption (DC Whmi) 49 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 20% 48% 52% DC electrical energy consumption (DC Whmi) 48 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 15% 47% 53% DC electrical energy consumption (DC Whmi) 50 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 14% 51% 49% DC electrical energy consumption (DC Whmi) 50 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 13% 51% 49% DC electrical energy consumption (DC Whmi) 54 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 13% 50% 50% DC electrical energy consumption (DC Whmi) 46 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 19% 46% 54% DC electrical energy consumption (DC Whmi) 49 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 16% 46% 55% DC electrical energy consumption (DC Whmi) 50 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 19% 49% 51% DC electrical energy consumption (DC Whmi) 52 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 18% 53% 47% DC electrical energy consumption (DC Whmi) 51 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 15% 48% 52% DC electrical energy consumption (DC Whmi) 49 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 17% 50% 50% DC electrical energy consumption (DC Whmi) 50 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 17% 47% 53% DC electrical energy consumption (DC Whmi) 46 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 17% 50% 50% DC electrical energy consumption (DC Whmi) 48 6 Trips in Charge Sustaining (CS) mode Distance traveled...



NLE Websites -- All DOE Office Websites (Extended Search)

of trips city highway Percent of total distance traveled 17% 52% 48% DC electrical energy consumption (DC Whmi) 49 6 Trips in Charge Sustaining (CS) mode Distance traveled...


1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



Distance visualization of ultrascale data with explorable images  

Science Conference Proceedings (OSTI)

This talk presents a new approach to distance visualization of very large data sets output from scientific supercomputing. The processing power of massively parallel supercomputers increases at a rather fast rate, about an order of magnitude faster every ...

Kwan-Liu Ma; Anna Tikhonova; Carlos D. Correa


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Redshift-Independent Distances to Type Ia Supernovae  

E-Print Network (OSTI)

We describe a procedure for accurately determining luminosity distances to Type Ia supernovae (SNe Ia) without knowledge of redshift. This procedure, which may be used as an extension of any of the various distance determination methods currently in use, is based on marginalizing over redshift, removing the requirement of knowing $z$ a priori. We demonstrate that the Hubble diagram scatter of distances measured with this technique is approximately equal to that of distances derived from conventional redshift-specific methods for a set of 60 nearby SNe Ia. This indicates that accurate distances for cosmological SNe Ia may be determined without the requirement of spectroscopic redshifts, which are typically the limiting factor for the number of SNe that modern surveys can collect. Removing this limitation would greatly increase the number of SNe for which current and future SN surveys will be able to accurately measure distance. The method may also be able to be used for high-$z$ SNe Ia to determine cosmological density parameters without redshift information.

Brian J. Barris; John L. Tonry



SBF Distances to Leo and Virgo using the HST  

E-Print Network (OSTI)

We have used archive HST WFPC2 data for three elliptical galaxies (NGC 3379 in the Leo I group, and NGC 4472 and NGC 4406 in the Virgo cluster) to determine their distances using the Surface Brightness Fluctuation (SBF) method as described by Tonry and Schneider (1988). A comparison of the HST results with the SBF distance moduli of Ciardullo et al (1993) shows significant disagreement and suggests that the r.m.s. error on these ground-based distance moduli is actually as large as +-0.25 mag. The agreement is only slightly improved when we compare our results with the HST and ground-based SBF distances from Ajhar et al (1997) and Tonry et al (1997); the comparison suggests that a lower limit on the error of the HST SBF distance moduli is +-0.17 mag. Overall, these results suggest that previously quoted measurement errors may underestimate the true error in SBF distance moduli by at least a factor of 2-3.

P. W. Morris; T. Shanks




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 ├Ś 599 pixels. Other resolution: 464 ├Ś 600 pixels. Full resolution ÔÇÄ(1,275 ├Ś 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 ├Ś 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Combination of evidence in recommendation systems characterized by distance functions  

SciTech Connect

Recommendation systems for different Document Networks (DN) such as the World Wide Web (WWW), Digitnl Libarries, or Scientific Databases, often make use of distance functions extracted from relationships among documents and between documents and semantic tags. For instance, documents In the WWW are related via a hyperlink network, while documents in bibliographic databases are related by citation and collaboration networks.Furthermore, documents can be related to semantic tags such as keywords used to describe their content, The distance functions computed from these relations establish associative networks among items of the DN, and allow recommendation systems to identify relevant associations for iudividoal users. The process of recommendation can be improved by integrating associative data from different sources. Thus we are presented with a problem of combining evidence (about assochaons between items) from different sonrces characterized by distance functions. In this paper we summarize our work on (1) inferring associations from semi-metric distance functions and (2) combining evidence from different (distance) associative DN.

Rocha, L. M. (Luis Mateus)



FastMeasure Distance Measuring Tools | Open Energy Information  

Open Energy Info (EERE)

FastMeasure Distance Measuring Tools FastMeasure Distance Measuring Tools Jump to: navigation, search Logo: FastMeasure Distance Measuring Tools Name FastMeasure Distance Measuring Tools Address 2890 Cherokee Lane Place Riverwoods, Illinois Zip 60015 Sector Vehicles Product Distance Measuring Instrument Year founded 2008 Number of employees 11-50 Phone number (888) 876-6050 Website http://www.fast-measure.com Coordinates 42.181686┬░, -87.898862┬░ Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.181686,"lon":-87.898862,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


CAKE Goes 'The Distance' with Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CAKE Goes 'The Distance' with Solar CAKE Goes 'The Distance' with Solar CAKE Goes 'The Distance' with Solar February 2, 2011 - 10:00am Addthis April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs CAKE. Whether it takes the form of cupcakes, birthday cake, the ever-popular cheesecake or even gluten-free - it unfailingly brightens up almost anyone's day. CAKE the band, however, has taken the sweetness to another level with their newest album Showroom of Compassion, which was produced using 100 percent solar energy. The group formed in 1991 and took the Northern California music scene by storm in the mid-nineties. Since then, they've become internationally renowned headliners. Earlier this month, CAKE released their sixth album, recorded in a studio in Sacramento powered entirely by solar power.


Short-distance contribution to the spectrum of Hawking radiation  

E-Print Network (OSTI)

The Hawking effect can be rederived in terms of two-point functions and in such a way that it makes it possible to estimate, within the conventional semiclassical theory, the contribution of ultrashort distances to the Planckian spectrum. For Schwarzschild black holes of three solar masses the analysis shows that Hawking radiation is very robust up to frequencies of 96 T_H or 270 T_H for bosons and fermions, respectively. For primordial black holes (with masses around 10^{15} g) these frequencies turn out to be of order 52T_H and 142 T_H. Only at these frequencies and above do we find that the contribution of Planck distances is of order of the total spectrum itself. Below this scale, the contribution of ultrashort distances to the spectrum is negligible. This suggests that only above these frequencies could an underlying quantum theory of gravity potentially predict significant deviations from Hawking's semiclassical result.

I. Agullo; J. Navarro-Salas; Gonzalo J. Olmo; Leonard Parker



Creating a Virtual HVAC Laboratory for Continuing/Distance Education  

E-Print Network (OSTI)

Facilities engineering is one technical field where lab-based continuing education programs can be delivered in a distance learning format. The widespread use of computer controls for optimizing the efficiency of a building's mechanical and electrical systems has made the "distance" element possible. Rather than traveling to individual buildings to make pressure, temperature, and flow measurements in person, facility engineers routinely access performance data over the Internet. This networking capability has been used in an educational setting to deliver interactive technical training to large numbers of undergraduate students and professional facilities engineers. Many students can access real time data from a single piece of HVAC equipment over the Internet.

William J. Hutzel



Levenshtein Distance Technique in Dictionary Lookup Methods: An Improved Approach  

E-Print Network (OSTI)

Dictionary lookup methods are popular in dealing with ambiguous letters which were not recognized by Optical Character Readers. However, a robust dictionary lookup method can be complex as apriori probability calculation or a large dictionary size increases the overhead and the cost of searching. In this context, Levenshtein distance is a simple metric which can be an effective string approximation tool. After observing the effectiveness of this method, an improvement has been made to this method by grouping some similar looking alphabets and reducing the weighted difference among members of the same group. The results showed marked improvement over the traditional Levenshtein distance technique.

Haldar, Rishin



Evidence against correlations between nuclear decay rates and Earth-Sun distance  

E-Print Network (OSTI)

distance of the source to the Sun. This work was supportedNuclear Decay Rates and Earth-Sun Distance Eric B. Normanand 241 Am and the Earth-Sun distance. We find no evidence

Norman, Eric B.



Auctions by price and distance via cellular phones  

Science Conference Proceedings (OSTI)

We consider e-commerce auctions via cellular phones in which the winner is selected based on two factors: the requested price and the promise to provide a service on time. The auctioneer can verify that the bidder intends to provide the service by tracking ... Keywords: Auctions, Cellular, Distance, Electronic commerce, Multi-attribute, Simulation, Strategies

Yosi Ben Asher; Mohsen Abu Saleh



A proposal for detecting hidden explosives to high distance  

Science Conference Proceedings (OSTI)

In this paper author describes a proposal for an apparatus utilising o nuclear physics techniques to identify hidden explosives to a distance of several tenth of meters. The apparatus uses a modified PFNA (Pulsed Fast neutron Analysis) with the gamma ... Keywords: application of nuclear physics, electronic instrumentation, explosives detection, security apparatus

Carlo Artemi



Weighted Distance Transforms for Images Using Elongated Voxel Grids  

Science Conference Proceedings (OSTI)

In this paper we investigate weighted distance transforms in 3D images using elongated voxel grids. We use a local neighbourhood of size 3 Î 3 Î 3 and assume a voxel grid with equal resolution along two axes and lower along the third. The weights (local ...

Ida-Maria Sintorn; Gunilla Borgefors



Computing the Edit-Distance between Unrooted Ordered Trees  

Science Conference Proceedings (OSTI)

An ordered tree is a tree in which each node's incident edges are cyclically ordered; think of the tree as being embedded in the plane. Let A and B be two ordered trees. The edit distance between A and B is the minimum cost ...

Philip N. Klein



UHF measurement of breathing and heartbeat at a distance  

Science Conference Proceedings (OSTI)

The detection of breathing and heartbeat from a distance is important for medical triage and mass casualty events as well as routine monitoring of higher-risk patients. Typical approaches include wiring up patients to devices and wearable devices, but ... Keywords: UHF, breathing, heartbeat, radar

Jerry Silvious; David Tahmoush



Move-to-Front, Distance Coding, and Inversion Frequencies revisited  

Science Conference Proceedings (OSTI)

Move-to-Front, Distance Coding and Inversion Frequencies are three simple and effective techniques used to process the output of the Burrows-Wheeler Transform. In this paper we provide the first complete comparative analyses of these techniques, establishing ... Keywords: Burrows-Wheeler Transform, Data Compression, Empirical entropy

Travis Gagie; Giovanni Manzini



Free Energy Surfaces from Single-Distance Information Philipp Schuetz,  

E-Print Network (OSTI)

Free Energy Surfaces from Single-Distance Information Philipp Schuetz, Rene┬┤ Wuttke, Benjamin We propose a network-based method for determining basins and barriers of complex free energy surfaces for the iterative determination of individual basins by the minimum-cut-based free energy profile, a barrier

Caflisch, Amedeo

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Distance between quantum states in the presence of initial qubit-environment correlations: A comparative study  

Science Conference Proceedings (OSTI)

The time evolution of the trace distance between two states of an open quantum system may increase due to initial system-environment correlations, thus exhibiting a breakdown of distance contractivity of the reduced dynamics. We analyze how the time evolution of the distance depends on the chosen distance measure. Here we elucidate the behavior of the trace distance, the Hilbert-Schmidt distance, the Bures distance, the Hellinger distance, and the quantum Jensen-Shannon divergence for two system-environment setups, namely a qubit bilinearly coupled to an infinite and a finite-size environment with the latter composed of harmonic oscillators.

Dajka, Jerzy; Luczka, Jerzy; Haenggi, Peter [Institute of Physics, University of Silesia, 40-007 Katowice (Poland); Institute of Physics, University of Augsburg, D-86135 Augsburg (Germany)



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Hym Prius Personal-use Ch and Dr 9-2008 to 3-2010.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Personal-use Personal-use Charging rate: Level 1 Number of households: Charge control: Uncontrolled Date range: Sep 2008 - Mar 2010 Battery Capacity: 5 kWh Weekday Weekend Number of trips Total distance driven (mi) Number of charging events Charging energy consumed (AC kWh) Charge depleting (CD) distance driven (mi) Percent of total distance Charge sustaining (CS) distance driven (mi) Percent of total distance Driving segments between charging events 1 67 1,285 373 7,596 1,828 1,735 510 14,142 5,026 401 130 Overall 2,245 531 1,659 19,168 9,425 49% 9,743 51% 54% 36% 6,545 3,198 46% 64% Vehicle Technologies Program 0 2000 4000 6000 8000 10000 12000 14000 16000 Weekday Weekend Distance traveled (mi) Distance Traveled by Operating Mode CS CD 0% 20% 40% 60% f total distance driven driving segment bin Miles-weighted Distribution of Distance


Luminosity distance and redshift in the Szekeres inhomogeneous cosmological models  

E-Print Network (OSTI)

The Szekeres inhomogeneous models can be used to model the true lumpy universe that we observe. This family of exact solutions to Einstein's equations was originally derived with a general metric that has no symmetries. In this work, we develop and use a framework to integrate the angular diameter and luminosity distances in the general Szekeres models. We use the affine null geodesic equations in order to derive a set of first-order ordinary differential equations that can be integrated numerically to calculate the partial derivatives of the null vector components. These equations allow the integration in all generality of the distances in the Szekeres models and some examples are given. The redshift is determined from simultaneous integration of the null geodesic equations. This work does not assume spherical or axial symmetry, and the results will be useful for comparisons of the general Szekeres inhomogeneous models to current and future cosmological data.

Anthony Nwankwo; Mustapha Ishak; John Thompson



Weighted distance transforms generalized to modules and their computation on point lattices  

Science Conference Proceedings (OSTI)

This paper presents the generalization of weighted distances to modules and their computation through the chamfer algorithm on general point lattices. The first part is dedicated to formalization of definitions and properties (distance, metric, norm) ... Keywords: Chamfer algorithm, Distance transform, Non-standard grids, Weighted distance

CÚline Fouard; Robin Strand; Gunilla Borgefors



Shortcut estimation of safety distances of pipelines from explosives  

SciTech Connect

Purposely or accidentally detonating explosives near pressurized gas pipelines may have severe consequences on them, ranging from permanent deformation to gas loss or even violent rupture. Owing to lack of analytical prediction models, a shortcut is proposed in this article by which conservative estimations can be obtained of the safety distance of a pipeline from an explosion source, when explosive quantity is known. Alternatively, the maximum allowable explosive quantity can be calculated, provided distance is given. If both explosive quantity and distance are given, stresses on the pipeline may be estimated. Experimentally determined ratios of circumferential to longitudinal strains found in the literature are used. This ratio depends on soil peak particle velocity in contact with the pipeline. For total stress estimations on the pipeline, either biaxial or Huber-Hencky-Mises stresses are used, the latter being more conservative. Validation of proposed method is obtained against experimental observations and results. In this prediction model the characteristics of the explosion source, of the soil, and of the pipeline are taken into account.

Rigas, F.; Sebos, I. [National Technical Univ. of Athens (Greece)



Hym Prius Commercial-use Ch and Dr All 2009.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial-use Commercial-use Charging rate: Level 1 Number of vehicles: Charge control: Uncontrolled Date range: Jan - Dec 2009 Battery Capacity: 5 kWh Weekday Weekend Number of trips Total distance driven (mi) Number of charging events Charging energy consumed (AC kWh) Charge depleting (CD) distance driven (mi) Percent of total distance Charge sustaining (CS) distance driven (mi) Percent of total distance Driving segments between charging events 1 153 32,253 3,478 179,351 15,767 61,134 5,309 575,891 58,893 12,902 1,461 Overall 66,443 634,784 14,363 35,731 195,118 31% 439,667 69% 31% 27% 396,540 43,127 69% 73% Vehicle Technologies Program 0 100000 200000 300000 400000 500000 600000 700000 Weekday Weekend Distance traveled (mi) Distance Traveled by Operating Mode CS CD 0% 20% 40% 60% 80% f total distance driven driving segment


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



High speed, long distance, data transmission multiplexing circuit  

DOE Patents (OSTI)

A high speed serial data transmission multiplexing circuit, which is operable to accurately transmit data over long distances (up to 3 Km), and to multiplex, select and continuously display real time analog signals in a bandwidth from DC to 100 Khz. The circuit is made fault tolerant by use of a programmable flywheel algorithm, which enables the circuit to tolerate one transmission error before losing synchronization of the transmitted frames of data. A method of encoding and framing captured and transmitted data is used which has a low overhead and prevents some particular transmitted data patterns from locking an included detector/decoder circuit.

Mariotti, Razvan (Boulder, CO)



A high speed, long distance, data transmission multiplexing circuit  

DOE Patents (OSTI)

A high speed serial data transmission multiplexing circuit, which is operable to accurately transmit data over long distances (up to 3 Km), and to multiplex, select and continuously display real time analog signals in a bandwidth from DC to 100Khz. The circuit is made fault tolerant by use of a programmable flywheel algorithm, which enables the circuit to tolerate one transmission error before losing synchronization of the transmitted frames of data. A method of encoding and framing captured and transmitted data is used which has a low overhead and prevents some particular transmitted data patterns from locking an included detector/decoder circuit. 9 figs.

Mariotti, R.



Gamma ray burst distances and the timescape cosmology  

E-Print Network (OSTI)

Gamma ray bursts can potentially be used as distance indicators, providing the possibility of extending the Hubble diagram to redshifts ~7. Here we follow the analysis of Schaefer (2007), with the aim of distinguishing the timescape cosmological model from the \\LambdaCDM model by means of the additional leverage provided by GRBs in the range 2 < z < 7. We find that the timescape model fits the GRB sample slightly better than the \\LambdaCDM model, but that the systematic uncertainties are still too little understood to distinguish the models.

Peter R. Smale



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



A comparison of standard evasion scenarios at near regional distances  

SciTech Connect

We performed numerical simulations of three nuclear testing evasion scenarios. These calculations were done in two parts. The first part was done near source (within 10 km) with a non-linear weapons effects code. Particle velocity histories from the non-linear code were linked to an elastic linear finite-difference code for the second part. Seismic waveforms from the evasion scenario calculations were compared with the waveforms for a non-evasive explosion calculation at near regional distances. The results of this comparison suggest that it may be important to include realistic stratigraphy in such simulations: the overall wave amplitude in the present simulations is reduced by only a factor of 3-5 in contradiction to factors of 20-100 in {open_quotes}classical{close_quotes} decoupling analyses for ideal (i.e., unlayered) media. Two of the evasion scenarios simulated retain explosive waveform characteristics at near regional distances, while the third scenario indicates that certain source geometries might lead to more non-explosive (i.e., earthquake-like) seismic signals.

Bos, R.; App, F.; Jones, E.; Dey, T.; Kamm, J.



Obtaining oblique technique source-to-skin distances for irregular field (Clarkson) calculations: The Mayo Off-axis Distance Indicator  

Science Conference Proceedings (OSTI)

Significant dose inhomogeneities may exist between the supraclavicular fossa (SCF) and the internal mammary chain (IMC) regions in the irregular L-shaped (hockey stick) field associated with breast cancer treatments. This dose inhomogeneity exists, in part, because of a positive air gap in the SCF and a negative air gap in the IMC locations. Independent of treatment technique, (i.e., whether anterior-posterior (AP) or oblique fields are used), accurate source-to-skin distance (SSD) values for the SCF, IMC, and axilla are necessary when doing an irregular field (Clarkson) dose calculation. However, when an oblique technique is used to treat the hockey stick field, obtaining non-central-axis SSDs is not as straightforward as when an AP technique is employed. The Mayo Off-axis Distance Indicator was constructed to slide into the blocking tray slot of the simulator or treatment machine. This mechanical measuring device provides quick and accurate SSD measurements for non-central-axis points under either AP or, more importantly, oblique treatment conditions.

Lajoie, W.N. (Mayo Medical Center, Rochester, MN (USA))



Imaging the Solar Tachocline by Time-Distance Helioseismology  

E-Print Network (OSTI)

The solar tachocline at the bottom of the convection zone is an important region for the dynamics of the Sun and the solar dynamo. In this region, the sound speed inferred by global helioseismology exhibits a bump of approximately 0.4% relative to the standard solar model. Global helioseismology does not provide any information on possible latitudinal variations or asymmetries between the Northern and Southern hemisphere. Here, we develop a time-distance helioseismology technique, including surface- and deep-focusing measurement schemes and a combination of both, for two-dimensional tomographic imaging of the solar tachocline that infers radial and latitudinal variations in the sound speed. We test the technique using artificial solar oscillation data obtained from numerical simulations. The technique successfully recovers major features of the simplified tachocline models. The technique is then applied to SOHO/MDI medium-l data and provides for the first time a full two-dimensional sound-speed perturbation i...

Zhao, Junwei; Kosovichev, A G; Mansour, N N



Answer extraction as sequence tagging with tree edit distance  

E-Print Network (OSTI)

Our goal is to extract answers from preretrieved sentences for Question Answering (QA). We construct a linear-chain Conditional Random Field based on pairs of questions and their possible answer sentences, learning the association between questions and answer types. This casts answer extraction as an answer sequence tagging problem for the first time, where knowledge of shared structure between question and source sentence is incorporated through features based on Tree Edit Distance (TED). Our model is free of manually created question and answer templates, fast to run (processing 200 QA pairs per second excluding parsing time), and yields an F1 of 63.3 % on a new public dataset based on prior TREC QA evaluations. The developed system is open-source, and includes an implementation of the TED model that is state of the art in the task of ranking QA pairs. 1

Xuchen Yao; Benjamin Van Durme; Chris Callison-burch; Peter Clark



Drones, information technology, and distance: mapping the moral epistemology of remote fighting  

Science Conference Proceedings (OSTI)

Ethical reflection on drone fighting suggests that this practice does not only create physical distance, but also moral distance: far removed from one's opponent, it becomes easier to kill. This paper discusses this thesis, frames it as a moral-epistemological ... Keywords: Distance, Drones, Ethics, Information technology, Military robotics, Phenomenology

Mark Coeckelbergh



Improvement of the disc harmonic moments descriptor by an exponentially decaying distance transform  

Science Conference Proceedings (OSTI)

The authors propose an improvement of a recent region-based shape descriptor inspired by the 3D spherical harmonics: the Disk Harmonic Moments Descriptor (DHMD). The binary image is weighted by an exponentially decaying distance transform (EDDT) before ... Keywords: content-based image, distance transform, legendre polynomials, region-based shape descriptor, retrieval, salience distance transform, spherical harmonics

Noureddine Ennahnahi; Mohammed Oumsis; Mohammed Meknassi



Adaptive feedback generation to support teachers in web-based distance education  

Science Conference Proceedings (OSTI)

This work examines the application of user-adapted technologies to address problems experienced in web-based distance education. We have proposed an approach to support distance learning instructors by offering advice that points at problems faced by ... Keywords: (Semi-)automatic advice generation, Distance learning, Empirical evaluation, Intelligent course management systems, Personalised feedback, Teacher support/help

Essam Kosba; Vania Dimitrova; Roger Boyle


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Stochastic/Perturbation Global Optimization Algorithm for Distance Geometry Problems  

Science Conference Proceedings (OSTI)

We present a new global optimization approach for solving exactly or inexactly constrained distance geometry problems. Distance geometry problems are concerned with determining spatial structures from measurements of internal distances. They arise ... Keywords: Lennard-Jones cluster, Molecular conformation, global optimization

Zhihong Zou; Richard H. Bird; Robert B. Schnabel



A wavelet-tree-based watermarking method using distance vector of binary cluster  

Science Conference Proceedings (OSTI)

This paper proposes a wavelet-tree-based watermarking method using distance vector of binary cluster for copyright protection. In the proposed method, wavelet trees are classified into two clusters using the distance vector to denote binary watermark ... Keywords: Blind watermarking method, Copyright protection, Distance vector, Significant coefficient, Watermark, Wavelet tree

Wei-Hung Lin; Yuh-Rau Wang; Shi-Jinn Horng



The influence of animal mobility on the assumption of uniform distances in aerial line transect surveys  

E-Print Network (OSTI)

for estimating animal density from aerial surveys. Analysis of line transect distance data usually relies test evidence for non- uniformity using double-observer distance data from two aerial surveys of five in Queensland. Key words: aerial surveys, double platform distance sampling, independent observers, responsive

Buckland, Steve


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Analysis of the Argonne distance tabletop exercise method.  

Science Conference Proceedings (OSTI)

The purpose of this report is to summarize and evaluate the Argonne Distance Tabletop Exercise (DISTEX) method. DISTEX is intended to facilitate multi-organization, multi-objective tabletop emergency response exercises that permit players to participate from their own facility's incident command center. This report is based on experience during its first use during the FluNami 2007 exercise, which took place from September 19-October 17, 2007. FluNami 2007 exercised the response of local public health officials and hospitals to a hypothetical pandemic flu outbreak. The underlying purpose of the DISTEX method is to make tabletop exercising more effective and more convenient for playing organizations. It combines elements of traditional tabletop exercising, such as scenario discussions and scenario injects, with distance learning technologies. This distance-learning approach also allows playing organizations to include a broader range of staff in the exercise. An average of 81.25 persons participated in each weekly webcast session from all playing organizations combined. The DISTEX method required development of several components. The exercise objectives were based on the U.S. Department of Homeland Security's Target Capabilities List. The ten playing organizations included four public health departments and six hospitals in the Chicago area. An extent-of-play agreement identified the objectives applicable to each organization. A scenario was developed to drive the exercise over its five-week life. Weekly problem-solving task sets were designed to address objectives that could not be addressed fully during webcast sessions, as well as to involve additional playing organization staff. Injects were developed to drive play between webcast sessions, and, in some cases, featured mock media stories based in part on player actions as identified from the problem-solving tasks. The weekly 90-minute webcast sessions were discussions among the playing organizations that were moderated by a highly-qualified public health physician, who reviewed key scenario developments and player actions, as well as solicited input from each playing organization. The exercise control structure included trusted agents who oversaw exercise planning, playing organization points of contact to ensure exercise coordination, and exercise controller/evaluators to initiate and oversee exercise play. A password-protected exercise website was designed for FluNami 2007 to serve as a compartmentalized central information source, and for transmitting exercise documents. During the course of FluNami 2007, feedback on its quality was collected from players and controller/evaluators. Player feedback was requested at the conclusion of each webcast, upon completion of each problem-solving task, and on October 17, 2007, after the final webcast session had ended. The overall average score given to FluNami 2008 by the responding players was 3.9 on a five-point scale. In addition, suggestions for improving the process were provided by Argonne controller/evaluators after the exercise concluded. A series of recommendations was developed based on feedback from the players and controller/evaluators. These included improvements to the exercise scope and objectives, the problem-solving tasks, the scenarios, exercise control, the webcast sessions, the exercise website, and the player feedback process.

Tanzman, E. A.; Nieves, L. A.; Decision and Information Sciences



Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

42 hours and 39 minutes of luminosity to the experiments. - A NuMI power supply trip glitches a feeder that trips off Recycler, which loses its stash. - Booster suffers...


Distance-Scaled Water Concentrations versus Mass-Median Drop Size, Temperature, and Altitude in Supercooled Clouds  

Science Conference Proceedings (OSTI)

About 28 000 nautical miles (n mi) of select in-flight measurements of liquid water content (LWC), droplet sizes, temperature, and other variables in supercooled clouds from a variety of research projects over portions of North America, Europe, ...

Richard K. Jeck



A New Years Trip A New Years Trip  

E-Print Network (OSTI)

19-24 19:44 M 71 10 Hitson, Will 18-U 19:58 M 59 11 Sableman, Brian 19-24 20:02 M 74 12 Raines, Adam Gender Race # 1 Rose, Brian 25-34 17:22 M 72 2 Capehart, Dustin 19-24 17:45 M 8 3 Sinclair, Taylor 19

Wilson, W. Stephen


Theoretical Antineutrino Detection, Direction and Ranging at Long Distances  

E-Print Network (OSTI)

In this paper we introduce the concept of what we call "NUDAR" (NeUtrino Direction and Ranging), making the point that measurements of the observed energy and direction vectors can be employed to passively deduce the exact three-dimensional location and thermal power of geophysical and anthropogenic neutrino sources from even a single detector. We present the most precise background estimates to date, all handled in full three dimensions, as functions of depth and geographical location. For the present calculations, we consider a hypothetical 138 kiloton detector which can be transported to an ocean site and deployed to an operational depth. We present a Bayesian estimation framework to incorporate any a priori knowledge of the reactor that we are trying to detect, as well as the estimated uncertainty in the background and the oscillation parameters. Most importantly, we fully employ the knowledge of the reactor spectrum and the distance-dependent effects of neutrino oscillations on such spectra. The latter, in particular, makes possible determination of range from one location, given adequate signal statistics. Further, we explore the rich potential of improving detection with even modest improvements in individual neutrino direction determination. We conclude that a 300 MWth reactor can indeed be geolocated, and its operating power estimated with one or two detectors in the hundred kiloton class at ranges out to a few hundred kilometers. We note that such detectors would have natural and non-interfering utility for scientific studies of geo-neutrinos, neutrino oscillations, and astrophysical neutrinos. This motivates the development of cost effective methods of constructing and deploying such next generation detectors.

Glenn R. Jocher; Daniel A. Bondy; Brian M. Dobbs; Stephen T. Dye; James A. Georges III; John G. Learned; Christopher L. Mulliss; Shawn Usman



EIA Energy Kids - Field Trips  

U.S. Energy Information Administration (EIA)

Agricultural Research Center ╗ Alcoa Aluminum ╗ Anadarko Drilling Rig ╗ Baltimore RESCO Waste-to-Energy Plant ╗ Cape Cod Wind Turbine ╗ Carson Refinery╗


Iterative method to compute the Fermat points and Fermat distances of multiquarks  

E-Print Network (OSTI)

The multiquark confining potential is proportional to the total distance of the fundamental strings linking the quarks and antiquarks. We address the computation of the total string distance an of the Fermat points where the different strings meet. For a meson (quark-antiquark system) the distance is trivially the quark-antiquark distance. For a baryon (three quark system) the problem was solved geometrically from the onset, by Fermat and by Torricelli. The geometrical solution can be determined just with a rule and a compass, but translation of the geometrical solution to an analytical expression is not as trivial. For tetraquarks, pentaquarks, hexaquarks, etc, the geometrical solution is much more complicated. Here we provide an iterative method, converging fast to the correct Fermat points and the total distances, relevant for the multiquark potentials. We also review briefly the geometrical methods leading to the Fermat points and to the total distances.

P. Bicudo; M. Cardoso



Bounded-distance multi-clusterhead formation in wireless ad hoc networks  

Science Conference Proceedings (OSTI)

We present a clustering technique addressing redundancy for bounded-distance clusters, which means being able to determine the minimum number of cluster-heads per node, and the maximum distance from nodes to their cluster-heads. This problem is similar ... Keywords: (k,r)-dominating sets, Ad hoc networks, Clustering, Distance domination, Domination in graphs, Multi-core multicast protocols, Multicast protocols, Multiple domination

Marco AurÚlio Spohn; J. J. Garcia-Luna-Aceves




E-Print Network (OSTI)

Abstract. We use a simple geometric-combinatorial argument to establish a quantitative relation between the generalized Hausdorff measure of a set and its distance set, extending a result originally due to Falconer. Let A be a subset of the plane. The distance set D(A) is defined as the set of all distances between points of A. Namely D(A) ={|x ? y | : x, y ? A}. It follows from the work of Falconer [2] (see also Mattila [3]) that 1

Communicated David Preiss



Chrysler RAM PHEV Fleet Results Report  

NLE Websites -- All DOE Office Websites (Extended Search)

istance (mi) 4 45 Trips in Charge Depleting (CD) mode City Highway Gasoline fuel economy (mpg) DC electrical energy consumption (DC Whmi) Percent of miles with internal combustion...


Single-photon frequency upconversion for long-distance quantum teleportation and communication  

E-Print Network (OSTI)

Entanglement generation, single-photon detection, and frequency translation that preserves the polarization quantum state of the photons are essential technologies for long distance quantum communication protocols. This ...

Albot?, Marius A., 1974-



Calibration of the distance scale from galactic Cepheids: I Calibration based on the GFG sample  

E-Print Network (OSTI)

New estimates of the distances of 36 nearby galaxies are presented based on accurate distances of galactic Cepheids obtained by Gieren, Fouque and Gomez (1998) from the geometrical Barnes-Evans method. The concept of 'sosie' is applied to extend the distance determination to extragalactic Cepheids without assuming the linearity of the PL relation. Doing so, the distance moduli are obtained in a straightforward way. The correction for extinction is made using two photometric bands (V and I) according to the principles introduced by Freedman and Madore (1990). Finally, the statistical bias due to the incompleteness of the sample is corrected according to the precepts introduced by Teerikorpi (1987) without introducing any free parameters (except the distance modulus itself in an iterative scheme). The final distance moduli depend on the adopted extinction ratio {R_V}/{R_I} and on the limiting apparent magnitude of the sample. A comparison with the distance moduli recently published by the Hubble Space Telescope Key Project (HSTKP) team reveals a fair agreement when the same ratio {R_V}/{R_I} is used but shows a small discrepancy at large distance. In order to bypass the uncertainty due to the metallicity effect it is suggested to consider only galaxies having nearly the same metallicity as the calibrating Cepheids (i.e. Solar metallicity). The internal uncertainty of the distances is about 0.1 magnitude but the total uncertainty may reach 0.3 magnitude.

G. Paturel; G. Theureau; P. Fouque; J. N. Terry; I. Musella; T. Ekholm



Semi-supervised Learning with Density Based Distances Avleen S. Bijral  

E-Print Network (OSTI)

Semi-supervised Learning with Density Based Distances Avleen S. Bijral Toyota Technological Institute Chicago, IL 60637 Nathan Ratliff Google Inc. Pittsburg, PA 15206 Nati Srebro Toyota Technological

Srebro, Nathan


Long distance symmetries for nuclear forces and the similarity renormalization group  

Science Conference Proceedings (OSTI)

In this work we study the emergence of long distance symmetries for nuclear forces within the framework of the similarity renormalization group approach.

Szpigel, S. [Faculdade de Computacao e Informatica, Universidade Presbiteriana Mackenzie, 01302-907, Sao Paulo - SP (Brazil); Timoteo, V. S. [Faculdade de Tecnologia, Universidade Estadual de Campinas, 13484-332, Limeira - SP (Brazil); Arriola, E. R. [Departamento de Fisica Atomica, Molecular y Nuclear and Instituto Carlos I de Fisica Teorica y Computacional, Universidad de Granada, E-18071, Granada (Spain)



The iBP algorithm for the discretizable molecular distance geometry ...  

E-Print Network (OSTI)

Jan 6, 2011 ... wireless sensors given some of the distances (estimated by monitoring the ..... this operation for all the amino acids forming a protein, then theá...


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ultra-stable long distance optical frequency distribution using the Internet fiber network  

E-Print Network (OSTI)

We report an optical link of 540 km for ultrastable frequency distribution over the Internet fiber network. The stable frequency optical signal is processed enabling uninterrupted propagation on both directions. The robustness and the performance of the link are enhanced by a cost effective fully automated optoelectronic station. This device is able to coherently regenerate the return optical signal with a heterodyne optical phase locking of a low noise laser diode. Moreover the incoming signal polarization variation are tracked and processed in order to maintain beat note amplitudes within the operation range. Stable fibered optical interferometer enables optical detection of the link round trip phase signal. The phase-noise compensated link shows a fractional frequency instability in 10 Hz bandwidth of 5\\times10-15 at one second measurement time and 2\\times10-19 at 30 000 s. This work is a significant step towards a sustainable wide area ultrastable optical frequency distribution and comparison network.

Lopez, Olivier; Chanteau, Bruno; Chardonnet, Christian; Amy-Klein, Anne; Santarelli, Georgio



Ultra-stable long distance optical frequency distribution using the Internet fiber network  

E-Print Network (OSTI)

We report an optical link of 540 km for ultrastable frequency distribution over the Internet fiber network. The stable frequency optical signal is processed enabling uninterrupted propagation on both directions. The robustness and the performance of the link are enhanced by a cost effective fully automated optoelectronic station. This device is able to coherently regenerate the return optical signal with a heterodyne optical phase locking of a low noise laser diode. Moreover the incoming signal polarization variation are tracked and processed in order to maintain beat note amplitudes within the operation range. Stable fibered optical interferometer enables optical detection of the link round trip phase signal. The phase-noise compensated link shows a fractional frequency instability in 10 Hz bandwidth of 5x10-15 at one second measurement time and 2x10-19 at 30 000 s. This work is a significant step towards a sustainable wide area ultrastable optical frequency distribution and comparison network.

Olivier Lopez; Adil Haboucha; Bruno Chanteau; Christian Chardonnet; Anne Amy-Klein; Giorgio Santarelli



Including cognitive biases and distance-based rewards in a connectionist model of complex problem solving  

Science Conference Proceedings (OSTI)

We present a cognitive, connectionist-based model of complex problem solving that integrates cognitive biases and distance-based and environmental rewards under a temporal-difference learning mechanism. The model is tested against experimental data obtained ... Keywords: Cognitive biases, Computational modeling, Distance-reduction heuristic, Problem solving, Reinforcement learning, Temporal-difference learning

FrÚdÚric Dandurand; Thomas R. Shultz; Arnaud Rey



On accurate orientation extraction and appropriate distance measure for low-resolution palmprint recognition  

Science Conference Proceedings (OSTI)

Orientation feature has been demonstrated to be one of the most effective features for low resolution palmprint recognition. In this paper, using steerable filter, we investigate the accurate orientation extraction and appropriate distance measure problems ... Keywords: Distance measure, Feature extraction, Palmprint verification, Steerable filter

Wangmeng Zuo; Feng Yue; David Zhang



Tactile distance feedback for firefighters: design and preliminary evaluation of a sensory augmentation glove  

Science Conference Proceedings (OSTI)

In this paper, we describe the design and preliminary evaluation of a vibrotactile glove for distance display in low vision search contexts. Specifically, this glove was developed for firefighting applications in which users experience compromised vision ... Keywords: distance sensing, glove, sensory augmentation, smart clothing, vibrotactile display, wearable technology

Anthony Carton; Lucy E. Dunne



Visualising student tracking data to support instructors in web-based distance education  

Science Conference Proceedings (OSTI)

This paper presents a novel approach of using web log data generated by course management systems (CMS) to help instructors become aware of what is happening in distance learning classes. Specifically, techniques from Information Visualization are used ... Keywords: Web-based distance education, information visualization, student tracking

Riccardo Mazza; Vania Dimitrova



Impacts of deregulation and competitive entry on telecommunication networks: long distance telephone service  

Science Conference Proceedings (OSTI)

Over the past thirty years, the long distance telephone sector has been revolutionised by a series of technical and regulatory developments. In 1996, Congress passed the Telecommunications Act 1996, which substantially deregulated the telecommunications ... Keywords: economic regulation, long distance service, regression models, telecommunications

K. H. Tiedemann



Community detection algorithm based on centrality and node distance in scale-free networks  

Science Conference Proceedings (OSTI)

In this paper, we present a method for detecting community structures based on centrality value and node distance. Many real world networks possess a scale-free property and this property makes community detection difficult especially on algorithms that ... Keywords: centrality value, community detection, node distance, scale-free network

Sorn Jarukasemratana; Tsuyoshi Murata; Xin Liu



EIMD: a new congestion control for fast long-distance networks  

Science Conference Proceedings (OSTI)

In fast long-distance networks, TCP fails to fully utilize the bandwidth due to its congestion control mechanism A plethora of congestion control schemes that may enhance the performance of the transport protocol in fast long-distance networks have been ...

Eunho Yang; Seong-il Ham; Seongho Cho; Chong-kwon Kim; Pillwoo Lee



Estimating Thematic Similarity of Scholarly Papers with Their Resistance Distance in an Electric Network Model  

E-Print Network (OSTI)

We calculate resistance distances between papers in a nearly bipartite citation network of 492 papers and the sources cited by them. We validate that this is a realistic measure of thematic distance if each citation link has an electric resistance equal to the geometric mean of the number of the paper's references and the citation number of the cited source.

Havemann, Frank; Glńser, Jochen; Struck, Alexander



A conceptual model of the cognitive processing of environmental distance information  

Science Conference Proceedings (OSTI)

I review theories and research on the cognitive processing of environmental distance information by humans, particularly that acquired via direct experience in the environment. The cognitive processes I consider for acquiring and thinking about environmental ... Keywords: cognitive processing, distance information, spatial cognition

Daniel R. Montello



A Power Transmission Line Fault Distance Estimation VLSI Chip: Design and Defect Tolerance  

Science Conference Proceedings (OSTI)

This paper presents a system-on-a-chip for fault detection and fault-distance-estimation for power transmission lines in the smart grid. Toward this goal we have designed and fabricated three chips: PGS4, PGS5 and PGS6, each successively more advanced ... Keywords: Smart grid, fault distance, arcing fault, system on a chip, defect tolerance, Radojevic algorithm.

E. MacLean; V. K. Jain



Formation of metal nanoparticles by short-distance sputter deposition in a reactive ion etching chamber  

Science Conference Proceedings (OSTI)

A new method is reported to form metal nanoparticles by sputter deposition inside a reactive ion etching chamber with a very short target-substrate distance. The distribution and morphology of nanoparticles are found to be affected by the distance, the ion concentration, and the sputtering time. Densely distributed nanoparticles of various compositions were fabricated on the substrates that were kept at a distance of 130 mum or smaller from the target. When the distance was increased to 510 mum, island structures were formed, indicating the tendency to form continuous thin film with longer distance. The observed trend for nanoparticle formation is opposite to the previously reported mechanism for the formation of nanoparticles by sputtering. A new mechanism based on the seeding effect of the substrate is proposed to interpret the experimental results.

Nie Min; Meng, Dennis Desheng [Department of Mechanical Engineering and Engineering Mechanics, Michigan Technological University, Houghton, Michigan 49931 (United States); Sun Kai [Department of Materials Science and Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States)




SciTech Connect

Using the H I emission/absorption method, we resolve the kinematic distance ambiguity and derive distances for 149 of 182 (82%) H II regions discovered by the Green Bank Telescope H II Region Discovery Survey (GBT HRDS). The HRDS is an X-band (9 GHz, 3 cm) GBT survey of 448 previously unknown H II regions in radio recombination line and radio continuum emission. Here, we focus on HRDS sources from 67 Degree-Sign {>=} l {>=} 18 Degree-Sign , where kinematic distances are more reliable. The 25 HRDS sources in this zone that have negative recombination line velocities are unambiguously beyond the orbit of the Sun, up to 20 kpc distant. They are the most distant H II regions yet discovered. We find that 61% of HRDS sources are located at the far distance, 31% at the tangent-point distance, and only 7% at the near distance. 'Bubble' H II regions are not preferentially located at the near distance (as was assumed previously) but average 10 kpc from the Sun. The HRDS nebulae, when combined with a large sample of H II regions with previously known distances, show evidence of spiral structure in two circular arc segments of mean Galactocentric radii of 4.25 and 6.0 kpc. We perform a thorough uncertainty analysis to analyze the effect of using different rotation curves, streaming motions, and a change to the solar circular rotation speed. The median distance uncertainty for our sample of H II regions is only 0.5 kpc, or 5%. This is significantly less than the median difference between the near and far kinematic distances, 6 kpc. The basic Galactic structure results are unchanged after considering these sources of uncertainty.

Anderson, L. D. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States); Bania, T. M. [Institute for Astrophysical Research, Department of Astronomy, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Balser, Dana S. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903-2475 (United States); Rood, Robert T., E-mail: Loren.Anderson@mail.wvu.edu [Astronomy Department, University of Virginia, P.O. Box 3818, Charlottesville, VA 22903-0818 (United States)



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 ľ 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: ę 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Standoff Spectroscopy Using a Conditioned Target Identifies Hazardous Materials at a Distance  

A safer method for the standoff (long distance) detection and identification ofmolecules on a surface has been invented by researchers at ORNL and the Universityof Tennessee. This invention avoids the necessity of close and potentially ...

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Generation of Optimal Unit Distance Codes for Rotary Encoders through Simulated Evolution  

Science Conference Proceedings (OSTI)

An evolutionary algorithm is used to generate unit distance codes for absolute rotary encoders. The target is to obtain a code suitable for disk size reduction, or for resolution increase, thus overcoming the limitations of conventional Gray codes. Obtained ...

Stefano Gregori; Roberto Rossi; Guido Torelli; Valentino Liberali



Visualisation of influenza A protein segments in distance invariant self-organising map  

Science Conference Proceedings (OSTI)

Due to the lateral gene transfer, the phylogenetic tree could be inadequate for representing the evolution of virus. This paper employs the distance invariant manifold (Cheng and Liou, 2009) to display the collection of influenza A in a cubic space. ...

Wei-Chen Cheng; Cheng-Yuan Liou



Decisionmaking in hospital earthquake evacuation: Does distance from the epicenter matter?  

E-Print Network (OSTI)

status of hospitals that does not depend on intactis one option. This study does not have the ability toUsing larger distances does not make sense, as no hospital

Schultz, Carl H. MD; Koenig, Kristi L. MD; Lewis, Roger J. MD, PhD



A preliminary comparison of synchronous venues for distance learning: traditional videoconferencing vs. web-based conferencing  

Science Conference Proceedings (OSTI)

Synchronous venues are often preferred in distance learning settings as they most closely approximate the face-to-face experience. This paper examines two synchronous venues: videoconferencing and web-based conferencing. Both are compared, ...

Norman A. Garrett



Web services model for mobile, distance and distributed learning using service-oriented architecture  

Science Conference Proceedings (OSTI)

This paper describes web services and service-oriented architecture and how these new technologies could be exploited to develop integrated software for mobile, distance and distributed learning. The paper also provides details of a prototype translator ... Keywords: VLE, distance learning, distributed learning, interoperability, m-learning, mobile communications, mobile learning, online education, online learning, service-oriented architecture, virtual learning environments, web services, web-based education

Sushil K. Sharma; Fred L. Kitchens; Queen Esther Booker; Huinan Xu



Photon flux and distance from the source: consequences for quantum foundations and technologies  

E-Print Network (OSTI)

The paper explores the fundamental physical principles of quantum mechanics (in fact, quantum field theory) which limit the bit rate for long distances. Propagation of photons in optical fibers is modeled using methods of quantum electrodynamics. We define photon "duration" as the standard deviation of the photon arrival time; we find its asymptotics for long distances and then obtain the main result of the paper: the linear dependence of photon duration on the distance. This effect puts the limit to joint increasing of the photon flux and the distance from the source and it has important consequences both for quantum information technologies and quantum foundations. Once quantum communication develops into a real technology, it would be appealing to the engineers to increase both the photon flux and the distance. And here our "photon flux/distance effect" has to be taken into account (at least if successively emitted photons are considered as independent). This effect also has to be taken into account in a loophole free test of Bell's type -- to close jointly the detection and locality loopholes.

Andrei Khrennikov; B÷rje Nilsson; Sven Nordebo; Igor Volovich



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Long-Distance Debris Transport by Tornadic Thunderstorms.Part I: The 7 May 1995 Supercell Thunderstorm  

Science Conference Proceedings (OSTI)

On 7 May 1995, during VORTEX 95, the Tornado Debris Project at the University of Oklahoma collected debris transported up to 190 km (120 mi) in association with an isolated tornadic thunderstorm which moved over north Texas and southern/central ...

Michael A. Magsig; John T. Snow



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


The extragalactic distance scale Key Project. III. The discovery of Cepheids and a new distance to M101 using the {ital Hubble} {ital Space} {ital Telescope}  

Science Conference Proceedings (OSTI)

We report on the discovery of 29 Cepheid variables in the galaxy M101 using the original Wide Field Camera (WFC) and the new Wide Field and Planetary Camera 2 (WFPC2) on the {ital Hubble} {ital Space} {ital Telescope}. We observed a field in M101 at 17 independent epochs in {ital V} (F555W), five epochs in {ital I} (F785LP/F814W), and one epoch in {ital B} (F439W), with a time interval baseline of 381 days. We have found Cepheids with periods ranging from 10 to 60 days. The data have been calibrated using WFPC2 observations with zero points derived from {omega} Cen, Pal 4, and NGC 2419 observations. This calibration has been verified by using the Medium Deep Survey (MDS) WFC photometric zero points, and ground-based secondary standards in {ital V} and {ital I}. The {ital V} calibrations agree to {plus_minus}0.06 mag, and the {ital I} calibrations agree to {plus_minus}0.04 mag. We have constructed {ital V} and {ital I} period-luminosity (PL) relations and have derived apparent distance moduli based on a distance modulus for the Large Magellanic Cloud (LMC) of 18.50 mag and a reddening of {ital E}({ital B}{minus}{ital V})=0.10 mag to the LMC Cepheids. Period-residual minimization was used to minimize the effects of Malmquist bias on the period-luminosity relation fitting process. Using a Galactic extinction law and the apparent {ital V} and {ital I} distance moduli, we have found a mean reddening for the M101 sample of {ital E}({ital B}{minus}{ital V})=0.03 mag and a true distance modulus to M101 of 29.34{plus_minus}0.17 mag, corresponding to a distance of 7.4{plus_minus}0.6 Mpc. The sources of error have been rigorously tracked through an error budget; systematic and random errors contribute roughly equally to the quoted error. The mean gas-phase metal abundances in the LMC and in the M101 outer field are similar so we expect metallicity effects to be minimal. (Abstract Truncated)

Kelson, D.D.; Illingworth, G.D. [UCO/Lick Observatory, University of California, Santa Cruz, California 95064 (United States); Freedman, W.F. [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, California 91101 (United States); Graham, J.A. [Department of Terrestrial Magnetism, Carnegie Institution of Washington, 5241 Broad Branch Road NW, Washington, District of Columbia 20015 (United States); Hill, R. [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, California 91101 (United States); Madore, B.F. [NASA/IPAC Extragalactic Database, Infrared Processing and Analysis Center, Jet Propulsion Laboratory, California Institute of Technology, Pasadena, California 91125 (United States); Saha, A. [Space Telescope Institute, Homewood Campus, Baltimore, Maryland 21218 (United States); Stetson, P.B. [Dominion Astrophysical Observatory, National Research Council, 5071 West Saanich Road, Victoria, BC, V8X 4M6 (CANADA); Kennicutt, R.C. Jr. [Steward Observatory, University of Arizona, Tucson, Arizona 85721 (United States); Mould, J.R. [Mt. Stromlo and Siding Springs Observatories, Private Bag, Weston Creek Post Office ACT 2611 (Australia); Hughes, S.M. [Royal Greenwich Observatory, Madingley Road, Cambridge, (United Kingdom) CB3 0EZ; Ferrarese, L. [Space Telescope Institute, Homewood Campus, Baltimore, Maryland 21218 (United States)]|[Department of Physics and Astronomy, Bloomberg 501, Johns Hopkins University, 3400 North Charles Street, Baltimore, Maryland 21218 (United States); Phelps, R. [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, California 91101 (United States); Turner, A. [Steward Observatory, University of Arizona, Tucson, Arizona 85721 (United States); Cook, K.H. [Lawrence Livermore National Laboratory, Mississippi L-401, P.O. Box 808, Livermore, California 94550 (United States); Ford, H. [Space Telescope Institute, Homewood Campus, Baltimore, Maryland 21218 (United States)



Holocene lahars and their byproducts along the historical path of the White River between Mount Rainier and Seattle: Geological Society of America Field Trip  

SciTech Connect

Clay-poor lahars of late Holocene age from Mount Rainier change down the White River drainage into lahar-derived fluvial and deltaic deposits that filled an arm of Puget Sound between the sites of Auburn and Seattle, 110-150 km downvalley from the volcano's summit. Lahars in the debris-flow phase left cobbly and bouldery deposits on the walls of valleys within 70 km of the summit. At distances of 80-110 km, transitional (hyperconcentrated) flows deposited pebbles and sand that coat terraces in a gorge incised into glacial drift and the mid-Holocene Osceola Mudflow. On the broad, level floor of the Kent valley at 110-130 km, lahars in the runout or streamflow phase deposited mostly sand-size particles that locally include the trunks of trees probably entrained by the flows. Beyond 130 km, in the Duwamish valley of Tukwila and Seattle, laminated andesitic sand derived from Mount Rainier built a delta northward across the Seattle fault. This distal facies, warped during an earthquake in A.D. 900-930, rests on estuarine mud at depths as great as 20 m. The deltaic filling occurred in episodes that appear to overlap in time with the lahars. As judged from radiocarbon ages of twigs and logs, at least three episodes of distal deposition postdate the Osceola Mudflow. One of these episodes occurred about 2200-2800 cal yr B.P., and two others occurred 1700-1000 cal yr B.P. The most recent episode ended by about the time of the earthquake of A.D. 900-930. The delta's northward march to Seattle averaged between 6 and 14 m/yr in the late Holocene.

Brown, T A; Zehfuss, P H; Atwater, B F; Vallance, J W; Brenniman, H



Estimation and validation of mode distances for the 1993 Commodity Flow Survey  

SciTech Connect

The 1993 Commodity Flow Survey (CFS) collected shipment data from a sample of approximately 200,000 domestic business establishments. Each selected establishment provided information on origin, destination, commodity, shipment weight and value, and modes of transport for a sample of its outbound shipments. One data item not reported by CFS participants was shipment distance. This important piece of information was estimated by simulating probable routes using computer models of the highway, rail, air, waterway, and pipeline networks and their interconnections. This paper describes the nature of the shipment distance estimation problem, the procedures used to estimate mode-specific distances between origin and destination ZIP codes, and the techniques used to validate the results.

Middendorf, D.P.; Bronzini, M. S.; Peterson, B.; Liu, Cheng; Chin, Shih-Miao



(Whose) value-sensitive design: a study of long- distance relationships in an Arabic cultural context  

Science Conference Proceedings (OSTI)

This paper describes a qualitative study of how 11 Arab individuals use technology in the context of their long-distance romantic relationships. Our participants' communication practices bear similarities to previous findings on the mediation of intimacy ... Keywords: communication, culture, feminism, intimacy, values

Tamara Alsheikh; Jennifer A. Rode; SiÔn E. Lindley



The proximity factor: impact of distance on co-located collaboration  

Science Conference Proceedings (OSTI)

Groups collaborating around a large wall display can do so in a variety of arrangements, positioning themselves at different distances from the display and from each other. We examined the impact of proximity on the effectiveness and enjoyment of co-located ... Keywords: co-located collaboration, direct input, indirect input, large displays, proximity, single-display groupware (SDG), wall display

Kirstie Hawkey; Melanie Kellar; Derek Reilly; Tara Whalen; Kori M. Inkpen



3-D chamfer distances and norms in anisotropic grids Celine Fouarda,b,c,*, Gregoire Malandaina  

E-Print Network (OSTI)

U N C O R R EC TED PR O O F 3-D chamfer distances and norms in anisotropic grids Ce┬┤line Fouarda the center lines of the vessels and to compute their radii [5]. Clearly this volume of data cannot will approximately double the volume of input data (here from 450 to 900 Mb). While modern computer disk capacity

Ayache, Nicholas


Trace distance and linear entropy of qubit states: Role of initial qubit-environment correlations  

E-Print Network (OSTI)

The role of initial qubit-environment correlations on trace distance between two qubit states is studied in the framework of non--Markovian pure dephasing. The growth of mixedness of reduced state quantified by linear entropy is shown to be related to the degree of initial qubit--environment correlations.

Jerzy Dajka; Jerzy Luczka



Distance Dependence of Electron Transfer in DNA: The Role of the Reorganization Energy and Free Energy  

E-Print Network (OSTI)

Distance Dependence of Electron Transfer in DNA: The Role of the Reorganization Energy and Free of the solvent reorganization energy and free energy in the heterogeneous DNA environment. DNA is modeled represents water. Model calculations show the importance of including the reorganization energy and the free

Fayer, Michael D.


Reducing the Plagiarism Detection Search Space on the Basis of the Kullback-Leibler Distance  

E-Print Network (OSTI)

Reducing the Plagiarism Detection Search Space on the Basis of the Kullback-Leibler Distance, jbenedi}@dsic.upv.es http://www.dsic.upv.es/grupos/nle/ Abstract. Automatic plagiarism detection the plagiarised fragments to their potential source. Publications on this task often assume that the search space

Rosso, Paolo

Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A sequential minimal optimization algorithm for the all-distances support vector machine  

Science Conference Proceedings (OSTI)

The All-Distances SVM is a single-objective light extension of the binary Á-SVM for multi-category classification that is competitive against multi-objective SVMs, such as One-against-the-Rest SVMs and One-against-One SVMs. Although the model takes ... Keywords: kernel machines, multi-category classification, sequential minimal optimization, support vector machines

Diego Candel; Ricardo Đanculef; Carlos Concha; HÚctor Allende



Magnetic hose: Routing and Long-distance Transportation of Magnetic Fields  

E-Print Network (OSTI)

Magnetism is a fundamental interaction shaping our physical world, at the basis of technologies such as magnetic recording or energy generation. Unlike electromagnetic waves, which can be routed and transmitted with waveguides to long distances, magnetic fields rapidly decay with distance. Here we show the concept, design, and properties of a magnetic hose which enables to transfer the static magnetic field generated by a source to an arbitrary distance, and along any given trajectory. Using transformation optics, adapted to static magnetic fields, we first introduce an ideal scheme displaying the basic mechanism behind our proposal and allowing for a perfect transfer. Then we present a simplified approach, which allows to construct a magnetic hose using two available materials: a superconducting shell with a ferromagnetic core. Such a magnetic hose can guide and transport magnetic fields to large distances, unlike ferromagnets- the conventional existing method-, for which transmitted fields decay quickly with the ferromagnetic length. As a proof of pinciple experiment, we demonstrate the field transmission through superconducting-ferromagnetic hoses with lengths up to 140mm, which improve the transmission of an analogous ferromagnet by a 400% factor. Magnetic hoses may provide new solutions in enhancing spin couplings in all-magnetic logic schemes and in harnessing quantum systems by addressable magnetic fields, in the context of quantum information processing.

Carles Navau; Jordi Prat-Camps; Oriol Romero-Isart; J. Ignacio Cirac; Alvaro Sanchez



Geomagnetic Precursor Z Component Diurnal Variation Phase Anomaly Recognition based on the Pattern Distance  

Science Conference Proceedings (OSTI)

Geomagnetic precursor is one of many earthquake precursors, which have better effects on earthquake prediction, while the diurnal variation anomaly of geomagnetic precursor Z component is an important one in short-impending anomalies. Basing on the pattern ... Keywords: Geomagnetic Precursor, Diurnal Variation, Pattern Distance, Anomaly Recognition

Shaochun Wu; Tongyu Yuan; Yan Tang; Bofeng Zhang; Daming Wei



Improved multicriteria spanners for Ad-Hoc networks under energy and distance metrics  

Science Conference Proceedings (OSTI)

We study the problem of spanner construction in wireless ad-hoc networks through power assignments under two spanner modelsŚdistance and energy. In particular, we are interested in asymmetric power assignments so that the induced communication ... Keywords: Geometric and energy spanners, approximation algorithms

Hanan Shpungin, Michael Segal



Final Technical Report: Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae  

Science Conference Proceedings (OSTI)

The final technical report from the project "Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae" led at Rutgers the State University of New Jersey by Prof. Saurabh W. Jha is presented, including all publications resulting from this award.

Saurabh W. Jha



Effectiveness of a Virtual Laboratory as a preparatory resource for Distance Education chemistry students  

Science Conference Proceedings (OSTI)

Many have argued that interactive 3D virtual environments have great educational potential due to their ability to engage learners in the exploration, construction and manipulation of virtual objects, structures and metaphorical representations of ideas. ... Keywords: Chemistry education, Distance Education, Interactive learning environments, Post-secondary education, Simulations, Virtual reality

Barney Dalgarno; Andrea G. Bishop; William Adlong; Danny R. Bedgood, Jr.



Combining lexical resources with tree edit distance for recognizing textual entailment  

Science Conference Proceedings (OSTI)

This paper addresses Textual Entailment (i.e. recognizing that the meaning of a text entails the meaning of another text) using a Tree Edit Distance algorithm between the syntactic trees of the two texts. A key aspect of the approach is the estimation ...

Milen Kouylekov; Bernardo Magnini



Geomagnetic imprinting: A unifying hypothesis of long-distance natal homing in salmon and sea turtles  

E-Print Network (OSTI)

Geomagnetic imprinting: A unifying hypothesis of long-distance natal homing in salmon and sea geomagnetic polarity reversals, may affect ecological processes by disrupting natal homing, resulting the globe before reentering the planet in the northern hemisphere. Several geomagnetic elements vary pre

Lohmann, Kenneth J.


Constructive episodic simulation: temporal distance and detail of past and future events modulate hippocampal engagement  

E-Print Network (OSTI)

ABSTRACT: Behavioral, lesion and neuroimaging evidence show striking commonalities between remembering past events and imagining future events. In a recent event-related fMRI study, we instructed participants to construct a past or future event in response to a cue. Once an event was in mind, participants made a button press, then generated details (elaboration) and rated them. The elaboration of past and future events recruited a common neural network. However, regions within this network may respond differentially to event characteristics, such as the amount of detail generated and temporal distance, depending on whether the event is in the past or future. To investigate this further, we conducted parametric modulation analyses, with temporal distance and detail as covariates, and focused on the medial temporal lobes and frontopolar cortex. The analysis of detail (independent of temporal distance) showed that the left posterior hippocampus was responsive to the amount of detail comprising both past and future events. In contrast, the left anterior hippocampus responded differentially to the amount of detail comprising future events, possibly reflecting the recombination of details into a novel future event. The analysis of temporal distance revealed that the increasing recency of past events correlated with activity in the right parahippocampus gyrus (Brodmann area (BA) 35/36), while activity in the bilateral hippocampus was significantly correlated with the increasing remoteness of future events. We propose that the hippocampal response to the distance of future events reflects the increasing disparateness of details likely included in remote future events, and the intensive relational processing required for integrating such details into a coherent episodic simulation of the future. These findings provide further support for the constructive episodic simulation hypothesis (Schacter and Addis (2007) Philos Trans R Soc Lond B Biol Sci 362:773ľ786) and highlight the involvement of the hippocampus in relational processing during elaboration of future events. VC 2007 Wiley-Liss, Inc. KEY WORDS: episodic; autobiographical memory; future; fMRI; parametric modulation

Donna Rose Addis; Daniel L. Schacter



Evaluation of sight distance as a criterion for prioritizing rail-highway intersections in Texas  

E-Print Network (OSTI)

Priority or hazard indices are used by the states to rank their rail-highway intersections according to relative hazard to aid in locating crossings for treatment of conditions and/or improvements in warning devices. The Texas Priority Index has been effective over the years in identifying particularly hazardous rail-highway intersections based on high vehicle volumes, train volumes, and accident histories, and these crossings have been treated or improved. Many of the remaining crossings, however, are not well discriminated in terms of their need for improvement; many crossings have the same index number. The objective of this research was to evaluate sight distance as a criterion for prioritizing rail-highway intersections in Texas to help distinguish between the crossings with similar or identical priority index numbers. Accident and sight distance data were compiled and analyzed. A sight distance variable was incorporated into the current Texas Priority Index and evaluated for its effects on the overall ranking of the rail-highway intersections. A state hazard index was chosen from a state-of-the-practice review with which to compare the current and revised Texas Priority Indices. Finally, the effectiveness of each of the indices was predicted in terms of the distribution of priority index numbers and their ability to move the most potentially hazardous crossings up in the rankings. It was concluded from the accident analysis that sight distance contributed to more vehicle-train accidents than any other factor. Further, improvements to warning devices at passive crossings would effectively reduce the overall sight obstruction, reduce the number of train involved accidents, and thus, reduce the number of injuries and fatalities resulting from accidents at rail-highway intersections. It was concluded from the field data analysis that the Method 1 revised Texas Priority Index was the most effective index of the four priority indices evaluated in this thesis for ranking crossings in terms of exposure, accident history, sight distance, and protection type. The Method 1 revised index was effective at redistributing the individual index numbers in the rank and identifying crossings with restricted sight distance while conserving the significance of the exposure values.

Pecheux, Kelley Klaver



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Time-Distance Imaging of Solar Far-Side Active Regions  

E-Print Network (OSTI)

It is of great importance to monitor large solar active regions in the far-side of the Sun for space weather forecast, in particular, to predict their appearance before they rotate into our view from the solar east limb. Local helioseismology techniques, including helioseismic holography and time-distance, have successfully imaged solar far-side active regions. In this Letter, we further explore the possibility of imaging and improving the image quality of solar far-side active regions by use of time-distance helioseismology. In addition to the previously used scheme with four acoustic signal skips, a five-skip scheme is also included in this newly developed technique. The combination of both four- and five-skip far-side images significantly enhances the signal-to-noise ratio in the far-side images, and reduces spurious signals. The accuracy of the far-side active region imaging is also assessed using one whole year solar observation.

Junwei Zhao



Time-Distance Imaging of Solar Far-Side Active Regions  

E-Print Network (OSTI)

It is of great importance to monitor large solar active regions in the far-side of the Sun for space weather forecast, in particular, to predict their appearance before they rotate into our view from the solar east limb. Local helioseismology techniques, including helioseismic holography and time-distance, have successfully imaged solar far-side active regions. In this Letter, we further explore the possibility of imaging and improving the image quality of solar far-side active regions by use of time-distance helioseismology. In addition to the previously used scheme with four acoustic signal skips, a five-skip scheme is also included in this newly developed technique. The combination of both four- and five-skip far-side images significantly enhances the signal-to-noise ratio in the far-side images, and reduces spurious signals. The accuracy of the far-side active region imaging is also assessed using one whole year solar observation.

Zhao, Junwei



Fast Tree: Computing Large Minimum-Evolution Trees with Profiles instead of a Distance Matrix  

Science Conference Proceedings (OSTI)

Gene families are growing rapidly, but standard methods for inferring phylogenies do not scale to alignments with over 10,000 sequences. We present FastTree, a method for constructing large phylogenies and for estimating their reliability. Instead of storing a distance matrix, FastTree stores sequence profiles of internal nodes in the tree. FastTree uses these profiles to implement neighbor-joining and uses heuristics to quickly identify candidate joins. FastTree then uses nearest-neighbor interchanges to reduce the length of the tree. For an alignment with N sequences, L sites, and a different characters, a distance matrix requires O(N^2) space and O(N^2 L) time, but FastTree requires just O( NLa + N sqrt(N) ) memory and O( N sqrt(N) log(N) L a ) time. To estimate the tree's reliability, FastTree uses local bootstrapping, which gives another 100-fold speedup over a distance matrix. For example, FastTree computed a tree and support values for 158,022 distinct 16S ribosomal RNAs in 17 hours and 2.4 gigabytes of memory. Just computing pairwise Jukes-Cantor distances and storing them, without inferring a tree or bootstrapping, would require 17 hours and 50 gigabytes of memory. In simulations, FastTree was slightly more accurate than neighbor joining, BIONJ, or FastME; on genuine alignments, FastTree's topologies had higher likelihoods. FastTree is available at http://microbesonline.org/fasttree.

N. Price, Morgan; S. Dehal, Paramvir; P. Arkin, Adam



The distance and neutral environment of the massive stellar cluster Westerlund 1  

E-Print Network (OSTI)

The goal of this study is to determine a distance to Westerlund 1 independent of the characteristics of the stellar population and to study its neutral environment, using observations of atomic hydrogen. The HI observations are taken from the Southern Galactic Plane Survey to study HI absorption in the direction of the HII region created by the members of Westerlund 1 and to investigate its environment as observed in the HI line emission. A Galactic rotation curve was derived using the recently revised values for the Galactic centre distance of $R_\\odot = 7.6$ kpc, and the velocity of the Sun around the Galactic centre of $\\Theta_\\odot = 214$ km s$^{-1}$. The newly determined rotation model leads us to derive a distance of $3.9\\pm 0.7$ kpc to Westerlund 1, consistent with a location in the Scutum-Crux Arm. Included in this estimate is a very careful investigation of possible sources of error for the Galactic rotation curve. We also report on small expanding HI features around the cluster with a maximum dynamic age of 600,000 years and a larger bubble which has a minimum dynamic age of 2.5 million years. Additionally we re-calculated the kinematic distances to nearby HII regions and supernova remnants based on our new Galaxic rotation curve. We propose that in the early stages of the development of Wd 1 a large interstellar bubble of diameter about 50 pc was created by the cluster members. This bubble has a dynamic age similar to the age of the cluster. Small expanding bubbles, with dynamical ages $\\sim 0.6$ Myr are found around Wd 1, which we suggest consist of recombined material lost by cluster members through their winds.

R. Kothes; S. M. Dougherty



Long-distance entanglement in many-body atomic and optical systems  

E-Print Network (OSTI)

We discuss the phenomenon of long-distance entanglement in the ground state of quantum spin models, its use in high-fidelity and robust quantum communication, and its realization in many-body systems of ultracold atoms in optical lattices and in arrays of coupled optical cavities. We investigate different patterns of site-dependent interaction couplings, singling out two general settings: Patterns that allow for perfect long-distance entanglement (LDE) in the ground state of the system, namely such that the end-to-end entanglement remains finite in the thermodynamic limit, and patterns of quasi long-distance entanglement (QLDE) in the ground state of the system, namely, such such that the end-to-end entanglement vanishes with a very slow power-law decay as the length of the spin chain is increased. We discuss physical realizations of these models in ensembles of ultracold bosonic atoms loaded in optical lattices. We show how, using either suitably engineered super-lattice structures or exploiting the presence of edge impurities in lattices with single periodicity, it is possible to realize models endowed with nonvanishing LDE or QLDE. We then study how to realize models that optimize the robustness of QLDE at finite temperature and in the presence of imperfections using suitably engineered arrays of coupled optical cavities. We finally introduce LDE-based schemes of long-distance quantum teleportation in linear arrays of coupled cavities and show that they allow for high-fidelity and high success rates even at moderately high temperatures.

Salvatore M. Giampaolo; Fabrizio Illuminati



Distribution of the distance between opposite nodes of random polygons with a fixed knot  

E-Print Network (OSTI)

We examine numerically the distribution function $f_K(r)$ of distance $r$ between opposite polygonal nodes for random polygons of $N$ nodes with a fixed knot type $K$. Here we consider three knots such as $\\emptyset$, $3_1$ and $3_1 \\sharp 3_1$. In a wide range of $r$, the shape of $f_K(r)$ is well fitted by the scaling form of self-avoiding walks. The fit yields the Gaussian exponents $\

Akihisa Yao; Hiroshi Tsukahara; Tetsuo Deguchi; Takeo Inami




SciTech Connect

We present the direct measurement of the Hubble constant, yielding the direct measurement of the angular-diameter distance to NGC 6264 using the H{sub 2}O megamaser technique. Our measurement is based on sensitive observations of the circumnuclear megamaser disk from four observations with the Very Long Baseline Array, the Green Bank Telescope (GBT), and the Effelsberg telescope. We also monitored the maser spectral profile for 2.3 years using the GBT to measure accelerations of maser lines by tracking their line-of-sight velocities as they change with time. The measured accelerations suggest that the systemic maser spots have a significantly wider radial distribution than in the archetypal megamaser in NGC 4258. We model the maser emission as arising from a circumnuclear disk with orbits dominated by the central black hole. The best fit of the data gives a Hubble constant of H{sub 0} = 68 {+-} 9 km s{sup -1} Mpc{sup -1}, which corresponds to an angular-diameter distance of 144 {+-} 19 Mpc. In addition, the fit also gives a mass of the central black hole of (3.09 {+-} 0.42) Multiplication-Sign 10{sup 7} M{sub Sun }. The result demonstrates the feasibility of measuring distances to galaxies located well into the Hubble flow by using circumnuclear megamaser disks.

Kuo, C. Y. [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 10617, Taiwan (China); Braatz, J. A.; Lo, K. Y.; Condon, J. J.; Impellizzeri, C. M. V. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903 (United States); Reid, M. J. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Henkel, C. [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, D-53121 Bonn (Germany)



Shedding Some Light on RFID Distance Bounding Protocols and Terrorist Attacks  

E-Print Network (OSTI)

During the last years, researchers have focused on designing secure and efficient RFID authentication protocols. The vast majority of these protocols assume proximity between readers and tags due to the limited range of the radio channel. However, in real scenarios, an intruder can be located between the prover (tag) and the verifier (reader) and trick the latter into thinking that the prover is in close proximity. This attack is globally known as a relay attack, a kind that includes others such as distance fraud, mafia fraud and terrorist attacks. Distance bounding protocols represent a promising countermeasure to hinder relay attacks. Several protocols have been proposed in the last years, but vulnerabilities of major or minor relevance have been identified in all of them. In 2008, Kim et al. [10] proposed a new distance bounding protocol with the objective of being the best one in terms of security, privacy, tag computational overhead and fault tolerance - as claimed by their authors. The study of this rec...

Peris-Lopez, Pedro; Tapiador, J M E; van der Lubbe, Jan C A



Shedding Light on RFID Distance Bounding Protocols and Terrorist Fraud Attacks  

E-Print Network (OSTI)

The vast majority of RFID authentication protocols assume the proximity between readers and tags due to the limited range of the radio channel. However, in real scenarios an intruder can be located between the prover (tag) and the verifier (reader) and trick this last one into thinking that the prover is in close proximity. This attack is generally known as a relay attack in which scope distance fraud, mafia fraud and terrorist attacks are included. Distance bounding protocols represent a promising countermeasure to hinder relay attacks. Several protocols have been proposed during the last years but vulnerabilities of major or minor relevance have been identified in most of them. In 2008, Kim et al. [18] proposed a new distance bounding protocol with the objective of being the best in terms of security, privacy, tag computational overhead and fault tolerance. In this paper, we analyze this protocol and we present a passive full disclosure attack, which allows an adversary to discover the long-term secret key of the tag. The presented attack is very relevant, since no security objectives are met in Kim et al.ĺs protocol. Then, design guidelines are introduced with the aim of facilitating protocol designers the stimulating task of designing secure and efficient schemes against relay attacks. Finally a new protocol, named Hitomi and inspired by [18], is designed conforming the guidelines proposed previously.

Pedro Peris-lopez; Julio C. Hern; Aikaterini Mitrokotsa; Juan M. E. Tapiador


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Long-distance entanglement and quantum teleportation in XX spin chains  

E-Print Network (OSTI)

Isotropic XX models of one-dimensional spin-1/2 chains are investigated with the aim to elucidate the formal structure and the physical properties that allow these systems to act as channels for long-distance, high-fidelity quantum teleportation. We introduce two types of models: I) open, dimerized XX chains, and II) open XX chains with small end bonds. For both models we obtain the exact expressions for the end-to-end correlations and the scaling of the energy gap with the length of the chain. We determine the end-to-end concurrence and show that model I) supports true long-distance entanglement at zero temperature, while model II) supports {\\it ``quasi long-distance''} entanglement that slowly falls off with the size of the chain. Due to the different scalings of the gaps, respectively exponential for model I) and algebraic in model II), we demonstrate that the latter allows for efficient qubit teleportation with high fidelity in sufficiently long chains even at moderately low temperatures.

Venuti, L Campos; Illuminati, F; Zanardi, P



Line-Based Object Recognition using Hausdorff Distance: From Range Images to Molecular Secondary Structure  

SciTech Connect

Object recognition algorithms are fundamental tools in automatic matching of geometric shapes within a background scene. Many approaches have been proposed in the past to solve the object recognition problem. Two of the key aspects that distinguish them in terms of their practical usability are: (i) the type of input model description and (ii) the comparison criteria used. In this paper we introduce a novel scheme for 3D object recognition based on line segment representation of the input shapes and comparison using the Hausdor distance. This choice of model representation provides the flexibility to apply the scheme in different application areas. We define several variants of the Hausdor distance to compare the models within the framework of well defined metric spaces. We present a matching algorithm that efficiently finds a pattern in a 3D scene. The algorithm approximates a minimization procedure of the Hausdor distance. The output error due to the approximation is guaranteed to be within a known constant bound. Practical results are presented for two classes of objects: (i) polyhedral shapes extracted from segmented range images and (ii) secondary structures of large molecules. In both cases the use of our approximate algorithm allows to match correctly the pattern in the background while achieving the efficiency necessary for practical use of the scheme. In particular the performance is improved substantially with minor degradation of the quality of the matching.

Guerra, C; Pascucci, V




Science Conference Proceedings (OSTI)

After 1970 Transuranic (TRU) and suspect TRU waste was buried in the ground with the intention that at some later date the waste would be retrieved and processed into a configuration for long term storage. To retrieve this waste the soil must be removed (excavated). Sloping the bank of the excavation is the method used to keep the excavation from collapsing and to provide protection for workers retrieving the waste. The purpose of this paper is to document the minimum distance (setback) that equipment must stay from the edge of the excavation to maintain a stable slope. This evaluation examines the equipment setback distance by dividing the equipment into two categories, (1) equipment used for excavation and (2) equipment used for retrieval. The section on excavation equipment will also discuss techniques used for excavation including the process of benching. Calculations 122633-C-004, 'Slope Stability Analysis' (Attachment A), and 300013-C-001, 'Crane Stability Analysis' (Attachment B), have been prepared to support this evaluation. As shown in the calculations the soil has the following properties: Unit weight 110 pounds per cubic foot; and Friction Angle (natural angle of repose) 38{sup o} or 1.28 horizontal to 1 vertical. Setback distances are measured from the top edge of the slope to the wheels/tracks of the vehicles and heavy equipment being utilized. The computer program utilized in the calculation uses the center of the wheel or track load for the analysis and this difference is accounted for in this evaluation.




Long-distance entanglement and quantum teleportation in XX spin chains  

E-Print Network (OSTI)

Isotropic XX models of one-dimensional spin-1/2 chains are investigated with the aim to elucidate the formal structure and the physical properties that allow these systems to act as channels for long-distance, high-fidelity quantum teleportation. We introduce two types of models: I) open, dimerized XX chains, and II) open XX chains with small end bonds. For both models we obtain the exact expressions for the end-to-end correlations and the scaling of the energy gap with the length of the chain. We determine the end-to-end concurrence and show that model I) supports true long-distance entanglement at zero temperature, while model II) supports {\\it ``quasi long-distance''} entanglement that slowly falls off with the size of the chain. Due to the different scalings of the gaps, respectively exponential for model I) and algebraic in model II), we demonstrate that the latter allows for efficient qubit teleportation with high fidelity in sufficiently long chains even at moderately low temperatures.

L. Campos Venuti; S. M. Giampaolo; F. Illuminati; P. Zanardi



Long-distance entanglement and quantum teleportation in XX spin chains  

SciTech Connect

Isotropic XX models of one-dimensional spin-1/2 chains are investigated with the aim to elucidate the formal structure and the physical properties that allow these systems to act as channels for long-distance, high-fidelity quantum teleportation. We introduce two types of models: (i) open, dimerized XX chains, and (ii) open XX chains with small end bonds. For both models we obtain the exact expressions for the end-to-end correlations and the scaling of the energy gap with the length of the chain. We determine the end-to-end concurrence and show that model (i) supports true long-distance entanglement at zero temperature, while model (ii) supports 'quasi-long-distance' entanglement that slowly falls off with the size of the chain. Due to the different scalings of the gaps, respectively exponential for model (i) and algebraic in model (ii), we demonstrate that the latter allows for efficient qubit teleportation with high fidelity in sufficiently long chains even at moderately low temperatures.

Campos Venuti, L. [ISI Foundation for Scientific Interchange, Villa Gualino, Viale Settimio Severo 65, I-10133 Turin (Italy); Giampaolo, S. M. [Dipartimento di Matematica e Informatica, Universita degli Studi di Salerno, Via Ponte don Melillo, I-84084 Fisciano (Italy); CNR-INFM Coherentia, Napoli (Italy); CNISM Unita di Salerno and INFN Sezione di Napoli, Gruppo collegato di Salerno, Baronissi (Italy); Illuminati, F. [Dipartimento di Matematica e Informatica, Universita degli Studi di Salerno, Via Ponte don Melillo, I-84084 Fisciano (Italy); CNR-INFM Coherentia, Napoli (Italy); CNISM Unita di Salerno and INFN Sezione di Napoli, Gruppo collegato di Salerno, Baronissi (Italy); ISI Foundation for Scientific Interchange, Villa Gualino, Viale Settimio Severo 65, I-10133 Turin (Italy); Zanardi, P. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0484 (United States); ISI Foundation for Scientific Interchange, Villa Gualino, Viale Settimio Severo 65, I-10133 Turin (Italy)



CourseVis: A graphical student monitoring tool for supporting instructors in web-based distance courses  

Science Conference Proceedings (OSTI)

This paper presents CourseVis, a system that takes a novel approach of using Web log data generated by course management systems (CMSs) to help instructors become aware of what is happening in distance learning classes. Specifically, techniques from ... Keywords: Information visualization, Student tracking, Web-based distance education

Riccardo Mazza; Vania Dimitrova



Some comments on goodness-of-fit tests for the parametric form of the copula based on L2-distances  

Science Conference Proceedings (OSTI)

In a recent paper Fermanian (2005) [9] studied a goodness-of-fit test for the parametric form of a copula, which is based on an L^2-distance between a parametric and a nonparametric estimate of the copula density. In the present paper we investigate ... Keywords: 62G, 62P, Copula, Goodness-of-fit tests, L2-distance, Parametric bootstrap

Axel BŘcher; Holger Dette



Correction of distance-dependent blurring in projection data for fully three-dimensional electron microscopic reconstruction  

Science Conference Proceedings (OSTI)

We propose a method of correction for distance-dependent blurring, which is one of the limiting factors to achieving higher resolution in 3D reconstructions of biological specimens from 2D projections obtained by an electron microscope. Our proposed ... Keywords: contrast transfer function, distance-dependent blurring, electron microscopy, stationary phase

Joanna Klukowska; Gabor T. Herman; Ivan G. Kazantsev



Marker ReDistancing/Level Set Method for High-Fidelity Implicit Interface Tracking  

SciTech Connect

A hybrid of the Front-Tracking (FT) and the Level-Set (LS) methods is introduced, combining advantages and removing drawbacks of both methods. The kinematics of the interface is treated in a Lagrangian (FT) manner, by tracking markers placed at the interface. The markers are not connected ľ instead, the interface topology is resolved in an Eulerian (LS) framework, by wrapping a signed distance function around Lagrangian markers each time the markers move. For accuracy and efficiency, we have developed a high-order ôanchoringö algorithm and an implicit PDE-based re-distancing. We have demonstrated that the method is 3rd-order accurate in space, near the markers, and therefore 1st-order convergent in curvature; in contrast to traditional PDE-based re-initialization algorithms, which tend to slightly relocate the zero Level Set and can be shown to be non-convergent in curvature. The implicit pseudo-time discretization of the re-distancing equation is implemented within the Jacobian-Free Newton Krylov (JFNK) framework combined with ILU(k) preconditioning. We have demonstrated that the steady-state solutions in pseudo-time can be achieved very efficiently, with iterations (CFL ), in contrast to the explicit re-distancing which requires 100s of iterations with CFL . The most cost-effective algorithm is found to be a hybrid of explicit and implicit discretizations, in which we apply first 10-15 iterations with explicit discretization (to bring the initial guess to the ball of convergence for the Newtonĺs method) and then finishing with 2-3 implicit steps, bringing the re-distancing equation to a complete steady-state. The eigenscopy of the JFNK-ILU(k) demonstrates the efficiency of the ILU(k) preconditioner, which effectively cluster eigenvalues of the otherwise extremely ill-conditioned Jacobian matrices, thereby enabling the Krylov (GMRES) method to converge with iterations, with only a few levels of ILU fill-ins. Importantly, due to the Level Set localization, the bandwidth of the Jacobian matrix is nearly constant, and the ILU preconditioning scales as , which implies efficiency and good scalability of the overall algorithm. The numerical examples include the well-established tests for interface kinematics under translational, rotational and tearing/stretching motion. We have shown that the mass conservation is not an issue anymore, as demonstrated using the Rider&Kotheĺs time-reversed tests with extreme deformation. We are able to stretch interface structures to the under-resolved/subgrid (on the chosen Eulerian mesh) scales, and recover them back without any change in shape/loss of mass.

Robert Nourgaliev; Samet Kadioglu; Vincent Mousseau; Dana Knoll




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Bremsstrahlung versus Monoenergetic Photon Dose and Photonuclear Stimulation Comparisons At Long Standoff Distances  

SciTech Connect

Energetic photon sources with energies greater than 6 MeV continue to be recognized as viable source for various types of inspection applications, especially those related to nuclear and/or explosive material detection. These energetic photons can be produced as a continuum of energies (i.e., bremsstrahlung distribution) or as a set of one or more discrete photon energies (i.e., monoenergetic distribution). This paper will provide a follow-on extension of the photon dose comparison presented at the 9th International Conference on Applications of Nuclear Techniques (June 2008). The latter paper showed the comparative advantages and disadvantages of the photon doses provided by these two energetic interrogation sources and highlighted the higher energy advantage of the bremsstrahlung source, especially at long standoff distances (i.e., distance from source to the inspected object). Specifically, this paper will pursue this higher energy photon inspection advantage (up to 100 MeV) by providing dose and stimulated photonuclear interaction predictions for air and an infinitely dilute interrogated material (used for comparative interaction rate assessments since it excludes material self-shielding) as the interrogation object positioned forward on the inspection beam axis at increasing standoff distances. In addition to the direct energetic photon-induced stimulation, the predictions will identify the importance of any secondary downscattered/attenuated source-term effects arising from the photon transport in the intervening atmosphere. *Supported in part by the Defense Threat Reduction Agency and Department of Energy (DOE) Idaho Operations Office under Contract Number DE-AC07-05ID14517.

J. L. Jones; J.W. Sterbentz; W.Y. Yoon



Shedding Some Light on RFID Distance Bounding Protocols and Terrorist Attacks  

E-Print Network (OSTI)

During the last years, researchers have focused on designing secure and efficient RFID authentication protocols. The vast majority of these protocols assume proximity between readers and tags due to the limited range of the radio channel. However, in real scenarios, an intruder can be located between the prover (tag) and the verifier (reader) and trick the latter into thinking that the prover is in close proximity. This attack is globally known as a relay attack, a kind that includes others such as distance fraud, mafia fraud and terrorist attacks. Distance bounding protocols represent a promising countermeasure to hinder relay attacks. Several protocols have been proposed in the last years, but vulnerabilities of major or minor relevance have been identified in all of them. In 2008, Kim et al. [10] proposed a new distance bounding protocol with the objective of being the best one in terms of security, privacy, tag computational overhead and fault tolerance- as claimed by their authors. The study of this recent protocol is the main subject of this paper. We present a passive full disclosure attack which allows an adversary-listening the public messages exchanged on the channel- to discover the long-term secret key of the tag. The presented attack is very relevant as it implies that none of the protocol security objectives are guaranteed. Additionally, we also show that the probability of a successful mafia fraud attack against the Reid et al. protocol [16] is bounded by (3/4) n and not by (7/8) n as Piramuthu states in [15].

unknown authors



Low-Energy Nuclear Reactions of Protons in Host Metals at Picometre Distance  

Science Conference Proceedings (OSTI)

A review is given for the explanation of the measurements of Miley et al. of a fully reproducible generation of nuclei of the whole periodic table by protons in host metals during a several-weeks reaction. Similar low-energy nuclear reactions (LENR) were observed by other groups. The fact that the heavy nuclides are not due to pollution can be seen from the fact that such very rare elements as thulium and terbium were detected by unique K-shell X-ray spectra. The nuclear reaction energy goes into the heavy nuclei as measured from much bigger traces in CR39 than from alphas. The fact that any reaction of the protons results in stable daughter nuclei is confirmed by the fact that the highest energy gain is resulting with stable reaction products. This has been explained in Ref. 2, and the energy gain for the heavy element generation by a compound reaction was discussed. The explanation is based on the model of the authors from 1989 to assume free motion of the protons contrary to localized crystalline states. A relation of the reaction time U on distance d of the reacting nuclei by a power law with an exponent 34.8 was derived. Based on few reproducible D-D reactions, a reaction time near the range of megaseconds and a reaction distance of nanometers was concluded. A splendid confirmation of the picometre-megasecond reactions was achieved by Li et al. from his direct quantum mechanical calculations of the hot fusion D-T reactions based on a one-step selective resonance tunneling model. Li et al. were able for the first time to derive the cross sections of the hot fusion. Li's application to picometre distance showed megasecond reaction times with no neutron or gamma emission. Because of the imaginary part in the Schroedinger potential, the problem of the level width is reduced by damping.

Heinrich Hora; George H. Miley; Jak C. Kelly



A Comparison of Four Indices for Combining Distance and Dose Differences  

Science Conference Proceedings (OSTI)

Purpose: When one is comparing two dose distributions, a number of methods have been published to combine dose difference and distance to agreement into a single measure. Some have been defined as pass/fail indices and some as numeric indices. We show that the pass/fail indices can all be used to derive numeric indices, and we compare the results of using these indices to evaluate one-dimensional (1D) and three-dimensional (3D) dose distributions, with the aim of selecting the most appropriate index for use in different circumstances. Methods and Materials: The indices compared are the gamma index, the kappa index, the index in International Commission on Radiation Units and Measurements Report 83, and a box index. Comparisons are made for 1D and 3D distributions. The 1D distribution is chosen to have a variety of dose gradients. The 3D distribution is taken from a clinical treatment plan. The effect of offsetting distributions by known distances and doses is studied. Results: The International Commission on Radiation Units and Measurements Report 83 index causes large discontinuities unless the dose gradient cutoff is set to equal the ratio of the dose tolerance to the distance tolerance. If it is so set, it returns identical results to the kappa index. Where the gradient is very high or very low, all the indices studied in this article give similar results for the same tolerance values. For moderate gradients, they differ, with the box index being the least strict, followed by the gamma index, and with the kappa index being the most strict. Conclusions: If the clinical tolerances are much greater than the uncertainties of the measuring system, the kappa index should be used, with tolerance values determined by the clinical tolerances. In cases where the uncertainties of the measuring system dominate, the box index will be best able to determine errors in the delivery system.

Thomas, Simon J., E-mail: simon.thomas@addenbrookes.nhs.uk [Department of Medical Physics, Addenbrooke's Hospital, Cambridge (United Kingdom); Cowley, Ian R. [Department of Medical Physics, Harley Street Clinic, London (United Kingdom)



The design, construction, and operation of long-distance high-voltage electricity transmission technologies.  

SciTech Connect

This report focuses on transmission lines, which operate at voltages of 115 kV and higher. Currently, the highest voltage lines comprising the North American power grid are at 765 kV. The grid is the network of transmission lines that interconnect most large power plants on the North American continent. One transmission line at this high voltage was built near Chicago as part of the interconnection for three large nuclear power plants southwest of the city. Lines at this voltage also serve markets in New York and New England, also very high demand regions. The large power transfers along the West Coast are generally at 230 or 500 kV. Just as there are practical limits to centralization of power production, there are practical limits to increasing line voltage. As voltage increases, the height of the supporting towers, the size of the insulators, the distance between conductors on a tower, and even the width of the right-of-way (ROW) required increase. These design features safely isolate the electric power, which has an increasing tendency to arc to ground as the voltage (or electrical potential) increases. In addition, very high voltages (345 kV and above) are subject to corona losses. These losses are a result of ionization of the atmosphere, and can amount to several megawatts of wasted power. Furthermore, they are a local nuisance to radio transmission and can produce a noticeable hum. Centralized power production has advantages of economies of scale and special resource availability (for instance, hydro resources), but centralized power requires long-distance transfers of power both to reach customers and to provide interconnections for reliability. Long distances are most economically served at high voltages, which require large-scale equipment and impose a substantial footprint on the corridors through which power passes. The most visible components of the transmission system are the conductors that provide paths for the power and the towers that keep these conductors at a safe distance from each other and from the ground and the natural and built environment. Common elements that are generally less visible (or at least more easily overlooked) include the maintained ROW along the path of the towers, access roads needed for maintenance, and staging areas used for initial construction that may be restored after construction is complete. Also visible but less common elements along the corridor may include switching stations or substations, where lines of similar or different voltages meet to transfer power.

Molburg, J. C.; Kavicky, J. A.; Picel, K. C.



Ultra-large distance modification of gravity from Lorentz symmetry breaking at the Planck scale  

E-Print Network (OSTI)

We present an extension of the Randall--Sundrum model in which, due to spontaneous Lorentz symmetry breaking, graviton mixes with bulk vector fields and becomes quasilocalized. The masses of KK modes comprising the four-dimensional graviton are naturally exponentially small. This allows to push the Lorentz breaking scale to as high as a few tenth of the Planck mass. The model does not contain ghosts or tachyons and does not exhibit the van Dam--Veltman--Zakharov discontinuity. The gravitational attraction between static point masses becomes gradually weaker with increasing of separation and gets replaced by repulsion (antigravity) at exponentially large distances.

D. S. Gorbunov; S. M. Sibiryakov



Transmitting signals over interstellar distances: Three approaches compared in the context of the Drake equation  

E-Print Network (OSTI)

I compare three methods for transmitting signals over interstellar distances: radio transmitters, lasers and artificial transits. The quantitative comparison is based on physical quantities depending on energy cost and transmitting time L, the last parameter in the Drake equation. With our assumptions, radio transmitters are the most energy-effective, while macro-engineered planetary-sized objects producing artificial transits seem effective on the long term to transmit an attention-getting signal for a time that might be much longer than the lifetime of the civilization that produced the artifact.

Arnold, Luc



Microsoft PowerPoint - Francfort AVTA-INL EDVs - The Networked...  

NLE Websites -- All DOE Office Websites (Extended Search)

mile average trip distance * 5.3 mph average speed g * 32.2 average stops per mile * 15% regenerative braking energy recovery - All trips 1 43 AC DC Whmi ratio 668 AC Whmi...


The Geneva-Copenhagen Survey of the Solar neighbourhood III. Improved distances, ages, and kinematics  

E-Print Network (OSTI)

Ages, chemical compositions, velocity vectors, and Galactic orbits for stars in the solar neighbourhood are fundamental test data for models of Galactic evolution. We aim to improve the accuracy of the Geneva-Copenhagen Survey data by implementing the recent revision of the Hipparcos parallaxes. The new parallaxes yield improved astrometric distances for 12,506 stars in the GCS. We also check the GCS II scales of T_eff and [Fe/H] and find no need for change. Introducing the new distances, we recompute M_V for 16,086 stars, and U, V, W, and Galactic orbital parameters for the 13,520 stars that also have radial-velocity measurements. We also recompute stellar ages from the Padova stellar evolution models used in GCS I-II, using the new values of M_V, and compare them with ages from the Yale-Yonsei and Victoria-Regina models. Finally, we compare the observed age-velocity relation in W with three simulated disk heating scenarios to show the potential of the data. With these revisions, the basic data for the GCS stars should now be as reliable as is possible with existing techniques. Further improvement must await consolidation of the T_eff scale from angular diameters and fluxes, and the Gaia trigonometric parallaxes. We discuss the conditions for improving computed stellar ages from new input data, and for distinguishing different disk heating scenarios from data sets of the size and precision of the GCS.

J. Holmberg; B. Nordstr÷m; J. Andersen



Dynamic Rotor Deformation and Vibration Monitoring Using a Non-Incremental Laser Doppler Distance Sensor  

Science Conference Proceedings (OSTI)

Monitoring rotor deformations and vibrations dynamically is an important task for improving the safety and the lifetime as well as the energy efficiency of motors and turbo machines. However, due to the high rotor speed encountered in particular at turbo machines, this requires concurrently a high measurement rate and high accuracy, which can not be fulfilled by most commercially available sensors. To solve this problem, we developed a non-incremental laser Doppler distance sensor (LDDS), which is able to measure simultaneously the in-plane velocity and the out-of-plane position of moving rough solid objects with micrometer precision. In addition, this sensor concurrently offers a high temporal resolution in the microsecond range, because its position uncertainty is in principle independent of the object velocity in contrast to conventional distance sensors, which is a unique feature of the LDDS. Consequently, this novel sensor enables precise and dynamic in-process deformation and vibration measurements on rotating objects, such as turbo machine rotors, even at very high speed. In order to evidence the capability of the LDDS, measurements of rotor deformations (radial expansion), vibrations and wobbling motions are presented at up to 50,000 rpm rotor speed.

Pfister, Thorsten; Guenther, Philipp; Dreier, Florian; Czarske, Juergen [Technische Universitaet Dresden, Faculty of Electrical Engineering and Information Technology, Laboratory for Measurement and Testing Techniques, Helmholtzstrasse 18, D-01062 Dresden (Germany)


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Extending the redshift-distance relation in Cosmological General Relativity to higher redshifts  

E-Print Network (OSTI)

The redshift-distance modulus relation, the Hubble Diagram, derived from Cosmological General Relativity has been extended to arbitrarily large redshifts. Numerical methods were employed and a density function was found that results in a valid solution of the field equations at all redshifts. The extension has been compared to 302 type Ia supernova data as well as to 69 Gamma-ray burst data. The latter however do not not truly represent a `standard candle' as the derived distance modulii are not independent of the cosmology used. Nevertheless the analysis shows a good fit can be achieved without the need to assume the existence of dark matter. The Carmelian theory is also shown to describe a universe that is always spatially flat. This results from the underlying assumption of the energy density of a cosmological constant $\\Omega_{\\Lambda} = 1$, the result of vacuum energy. The curvature of the universe is described by a \\textit{spacevelocity} metric where the energy content of the curvature at any epoch is $\\Omega_K = \\Omega_{\\Lambda} - \\Omega = 1-\\Omega$, where $\\Omega$ is the matter density of the universe. Hence the total density is always $\\Omega_K + \\Omega = 1$

John G. Hartnett




Science Conference Proceedings (OSTI)

The recently discovered transitional millisecond pulsar system J1023+0038 exposes a crucial evolutionary phase of recycled neutron stars for multiwavelength study. The system, comprising the neutron star itself, its stellar companion, and the surrounding medium, is visible across the electromagnetic spectrum from the radio to X-ray/gamma-ray regimes and offers insight into the recycling phase of millisecond pulsar evolution. Here, we report on multiple-epoch astrometric observations with the Very Long Baseline Array (VLBA) which give a system parallax of 0.731 {+-} 0.022 milliarcseconds (mas) and a proper motion of 17.98 {+-} 0.05 mas yr{sup -1}. By combining our results with previous optical observations, we are able to use the parallax distance of 1368{sup +42}{sub -{sub 39}} pc to estimate the mass of the pulsar to be 1.71 {+-} 0.16 M{sub Sun }, and we are also able to measure the three-dimensional space velocity of the system to be 126 {+-} 5 km s{sup -1}. Despite the precise nature of the VLBA measurements, the remaining {approx}3% distance uncertainty dominates the 0.16 M{sub Sun} error on our mass estimate.

Deller, A. T. [Netherlands Institute for Radio Astronomy (ASTRON), 7990-AA Dwingeloo (Netherlands); Archibald, A. M.; Kaspi, V. M. [Department of Physics, McGill University, 3600 University Street, Montreal, QC H3A 2T8 (Canada); Brisken, W. F. [National Radio Astronomy Observatory, Socorro, NM 87801 (United States); Chatterjee, S. [Astronomy Department, Cornell University, Ithaca, NY 14853 (United States); Janssen, G. H.; Lyne, A. G.; Stappers, B. [Jodrell Bank Centre for Astrophysics, School of Physics and Astronomy, University of Manchester, Manchester M13 9PL (United Kingdom); Lorimer, D.; McLaughlin, M. A. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States); Ransom, S. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Stairs, I. H. [Department of Physics and Astronomy, University of British Columbia, 6224 Agricultural Road, Vancouver, BC V6T 1Z1 (Canada)



Clinical Study Anterior Lumbar Interbody Implants: Importance of the Interdevice Distance  

E-Print Network (OSTI)

Copyright ę 2011 Brian R. Subach et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Object. The implantation of interbody fusion cages allows for the restoration of disc height and the enlargement of the neuroforaminal space. The purpose of this study was to compare the extent of subsidence occurring after conventional cage placement compared to a novel wider cage placement technique. Methods. This study is a retrospective evaluation of radiographs of patients who underwent stand-alone single level anterior lumbar interbody fusion with lordotic titanium cages and rhBMP-2. Fifty-three patients were evaluated: 39 patients had wide cage placement (6 mm interdevice distance) and 14 had narrow cage placement (2 mm interdevice distance). Anterior and posterior intervertebral disc space heights were measured post-operatively and at follow-up imaging. Results. The decrease in anterior intervertebral disc space height was 2.05 mm versus 3.92 mm (P subsidence greater than 2 mm was 41.0 % in the wide cage patients and 85.7 % for the narrow cage patients (P subsidence while allowing for a greater exposed surface area for interbody fusion. 1.

Brian R. Subach; Anne G. Copay; Marcus M. Martin; Thomas C. Schuler




SciTech Connect

The internal proper motion dispersion of NGC 6266 was measured using Hubble Space Telescope Wide Field Planetary Camera 2 images with an epoch difference of eight years. The dispersion was found to be 0.041 {+-} 0.001 arcsec century{sup -1}. This value was then equated to the cluster's radial velocity dispersion of 13.7 {+-} 1.1 km s{sup -1} to yield a distance to NGC 6266 of 7054 {+-} 583 pc. Based on this distance we find that the NGC 6266 RR Lyrae stars have M{sub V} = 0.51 {+-} 0.18 mag. This magnitude is in good agreement with that predicted by the M{sub V} versus [Fe/H] relation found by Benedict et al. Using an average [Fe/H] of -1.25 for NGC 6266, their relation predicts M{sub V} = 0.49 {+-} 0.06. Based on the RR Lyrae M{sub V} versus age relation determined by Chaboyer et al., we estimate that NGC 6266 has an age of 11.4 {+-} 2.2 Gyr.

McNamara, Bernard J.; McKeever, Jean, E-mail: bmcnamar@nmsu.edu, E-mail: jeanm12@nmsu.edu [Department of Astronomy, New Mexico State University, P.O. Box 30001, MSC 4500, Las Cruces, NM 88003-8001 (United States)



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Cell Merger Potential in Multicell Thunderstorms of Weakly Sheared Environments: Cell Separation Distance versus Planetary Boundary Layer Depth  

Science Conference Proceedings (OSTI)

Using high-resolution three-dimensional numerical experiments, this paper shows that the cell separation distance scales as 0.75 times the planetary boundary layer (PBL) depth for successful cell mergers between constructively interacting cells ...

James R. Stalker; Kevin R. Knupp



The Use of Euclidean Geometric Distance on RGB Color Space for the Classification of Sky and Cloud Patterns  

Science Conference Proceedings (OSTI)

The current work describes the use of multidimensional Euclidean geometric distance (EGD) and Bayesian methods to characterize and classify the sky and cloud patterns present in image pixels. From specific images and using visualization tools, it ...

Sylvio Luiz Mantelli Neto; Aldo von Wangenheim; Enio Bueno Pereira; Eros Comunello



ORNL trip (3/25~4/1)  

NLE Websites -- All DOE Office Websites (Extended Search)

Methane Recovery from Hydrate-bearing Sediments Methane Recovery from Hydrate-bearing Sediments Final Scientific/Technical Report (Fall 2006 - Spring 2011) Submitted By: J. Carlos Santamarina and Costas Tsouris November 3, 2011 Funding Number: DE-FC26-06NT42963 Georgia Institute of Technology Atlanta, GA 30332-0355 Disclaimer: This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product,


Trip Report, Solar aircraft, May 26, 1960  

SciTech Connect

Discussions held with A. S. Stetson, General George Gordes and W. Compton going over technical aspects of Contract NO-S-935 for the research and development studies on coating materials for SNAP reactors.

Henry, D.L.



Trip Report Bean/Cowpea CRSP  

E-Print Network (OSTI)

. Wheat lines having a flour yield of one percentage point or greater below that of USG 3209 would ............................................................................................. 3 Barley and Wheat Entries, Blacksburg, VA, 2008 harvest. #12;2 Section 2: Wheat Varieties Discussion of wheat varieties and summary

Ginzel, Matthew


ORNL trip (3/25~4/1)  

NLE Websites -- All DOE Office Websites (Extended Search)

A diagenetic mechanism for the formation of shear fractures in shales hosting deep tight gas plays, AAAG meeting, June - Denver. Santamarina, J.C. and Jang, J. (2009), Gas...


My Trip to Mongolia | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

power generation. I also toured some of Mongolia's energy facilities, including a thermal power plant, to see first-hand how Mongolia has met its energy needs over the...


Gas Mileage Tips - Planning and Combining Trips  

NLE Websites -- All DOE Office Websites (Extended Search)

Tips for Hybrids, Plug-in Hybrids, and Electric Vehicles Many of the gas-saving driving and maintenance tips for conventional vehicles also apply to hybrids, plug-in hybrids, and...


2012 Newsletter Students on field trip  

E-Print Network (OSTI)

- trona. Uz to je, pomou STM mogue micati dodatne pojedinacne atome, stvarati zeljene nanostrukture i

Suzuki, Masatsugu


Gas Mileage Tips - Planning and Combining Trips  

NLE Websites -- All DOE Office Websites (Extended Search)

ride-share programs. You can cut your weekly fuel costs in half and save wear on your car if you take turns driving with other commuters. Many urban areas allow vehicles with...


Trip Report-Produced-Water Field Testing  

Science Conference Proceedings (OSTI)

Los Alamos National Laboratory (LANL) conducted field testing of a produced-water pretreatment apparatus with assistance from faculty at the Texas A&M University (TAMU) protein separation sciences laboratory located on the TAMU main campus. The following report details all of the logistics surrounding the testing. The purpose of the test was to use a new, commercially-available filter media housing containing modified zeolite (surfactant-modified zeolite or SMZ) porous medium for use in pretreatment of oil and gas produced water (PW) and frac-flowback waters. The SMZ was tested previously in October, 2010 in a lab-constructed configuration ('old multicolumn system'), and performed well for removal of benzene, toluene, ethylbenzene, and xylenes (BTEX) from PW. However, a less-expensive, modular configuration is needed for field use. A modular system will allow the field operator to add or subtract SMZ filters as needed to accommodate site specific conditions, and to swap out used filters easily in a multi-unit system. This test demonstrated the use of a commercial filter housing with a simple flow modification and packed with SMZ for removing BTEX from a PW source in College Station, Texas. The system will be tested in June 2012 at a field site in Pennsylvania for treating frac-flowback waters. The goals of this test are: (1) to determine sorption efficiency of BTEX in the new configuration; and (2) to observe the range of flow rates, backpressures, and total volume treated at a given flow rate.

Sullivan, Enid J. [Los Alamos National Laboratory



Light celebrating place, West Texas Road Trip  

E-Print Network (OSTI)

The dissertation explores the ability of light to embody and enhance the spirit of place in the Big Bend section of West Texas. A series of surveys and research investigated and then paired elements of light and place that were designed, and installed or simulated, in four experiential case studies. The case studies were evaluated by published authors of light and place and the dissertation committee and deemed mostly successful. Light installations can be embodied and enhance the spirit of place, the installations which were experienced ôliveö did this most effectively.

Mulholland, Jill Cecilia



TAKING A TRIP? Travel Management Contracts  

E-Print Network (OSTI)

to airline/rail reservations, hotel lodging, airport transportation, and car rentals. #12;TRAVEL MGMT, car rentals, incidentals. Improper usage examples include movies, utility bills, alcohol. Non travel

Zobin, Nahum


Time-Distance analysis of the Emerging Active Region NOAA 10790  

E-Print Network (OSTI)

We investigate the emergence of Active Region NOAA 10790 by means of time--distance helioseismology. Shallow regions of increased sound speed at the location of increased magnetic activity are observed, with regions becoming deeper at the locations of sunspot pores. We also see a long-lasting region of decreased sound speed located underneath the region of the flux emergence, possibly relating to a temperature perturbation due to magnetic quenching of eddy diffusivity, or to a dense flux tube. We detect and track an object in the subsurface layers of the Sun characterised by increased sound speed which could be related to emerging magnetic flux and thus obtain a provisional estimate of the speed of emergence of around $1 {\\rm km s^{-1}}$.

S. Zharkov; M. J. Thompson



Extension of the Focusable Mass Range in Distance-of-Flight Mass Spectrometry with Multiple Detectors  

SciTech Connect

Since the underlying theory of Distance-of-Flight Mass Spectrometry (DOFMS) was reported in 2007,[1] laboratory results[2, 3] have proven its practical viability. However, these previous implementations of DOFMS considered ion detection only over narrow DOF-detection windows, with 25-mm being the greatest detection length explored. These small mass windows cannot be used to evaluate how DOFMS focusing performs over greater DOF detection lengths and mass ranges. In the present study, we expand on previous studies by placing two spatially selective ion detectors along the detection plane of the DOFMS instrument. Ion signals are simultaneously collected from both DOF detectors in order to simulate DOFMS performance with a longer spatially selective ion detector.

Gundlach-Graham, Alexander W.; Dennis, Elise; Ray, Steven J.; Enke, Christie G.; Carado, Anthony J.; Barinaga, Charles J.; Koppenaal, David W.; Hieftje, Gary M.


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Binomial moments of the distance distribution and the probability of undetected error  

Science Conference Proceedings (OSTI)

In [1] K.A.S. Abdel-Ghaffar derives a lower bound on the probability of undetected error for unrestricted codes. The proof relies implicitly on the binomial moments of the distance distribution of the code. The authors use the fact that these moments count the size of subcodes of the code to give a very simple proof of the bound in [1] by showing that it is essentially equivalent to the Singleton bound. They discuss some combinatorial connections revealed by this proof. They also discuss some improvements of this bound. Finally, they analyze asymptotics. They show that an upper bound on the undetected error exponent that corresponds to the bound of [1] improves known bounds on this function.

Barg, A. [Lucent Technologies, Murray Hill, NJ (United States). Bell Labs.; Ashikhmin, A. [Los Alamos National Lab., NM (United States)



Physical parameters of the Small Magellanic Cloud RR Lyrae stars and the distance scale  

E-Print Network (OSTI)

We present a careful and detailed light curve analysis of RR Lyrae stars in the Small Magellanic Cloud (SMC) discovered by the Optical Gravitational Lensing Experiment (OGLE) project. Out of 536 single mode RR Lyrae stars selected from the database, we have investigated the physical properties of 335 `normal looking' RRab stars and 17 RRc stars that have good quality photometric light curves. We have also been able to estimate the distance modulus of the cloud which is in good agreement with those determined from other independent methods. The Fourier decomposition method has been used to study the basic properties of these variables. Accurate Fourier decomposition parameters of 536 RR Lyrae stars in the OGLE-II database are computed. Empirical relations between the Fourier parameters and some physical parameters of these variables have been used to estimate the physical parameters for the stars from the Fourier analysis. Further, the Fourier decomposition of the light curves of the SMC RR Lyrae stars yields ...

Deb, Sukanta



Distance priority based multicast routing in WDM networks considering sparse light splitting  

E-Print Network (OSTI)

As we know, the member-only algorithm in provides the best links stress and wavelength usage for the construction of multicast light-trees in WDM networks with sparse splitting. However, the diameter of tree is too big and the average delay is also too large, which are intolerant for QoS required multimedia applications. In this paper, a distance priority based algorithm is proposed to build light-trees for multicast routing, where the Candidate Destinations and the Candidate Connectors are introduced. Simulations show the proposed algorithm is able to greatly reduce the diameter and average delay of the multicast tree (up to 51% and 50% respectively), while keep the same or get a slightly better link stress as well as the wavelength usage than the famous Member-Only algorithm.

Zhou, Fen; Cousin, Bernard; 10.1109/ICCS.2008.4737278



B-Spline Surface Approximation to Cross-Sections Using Distance Maps  

E-Print Network (OSTI)

this paper, we present a method of surface approximation to cross-sections with multiple branching problems. In this method, we first decompose each multiple branching problem into a set of single branching problems by providing a set of intermediate contours using distance maps. For each single branching region, a procedure then performs the skinning of contour curves represented by cubic B-spline curves on a common knot vector, each of which is fitted to its contour points within a given accuracy. In order to acquire a more compact representation for the surface, the method includes an algorithm for reducing the number of knots in the common knot vector. The approximation surface to the crosssections is represented by a set of bicubic B-spline surfaces. This method provides a smooth surface model, yet realises efficient data reduction.

J. Jeong; K. Kim; H. Park; H. Cho; M. Jung



Reverse estimation theory, Complementality between RLD and SLD, and monotone distances  

E-Print Network (OSTI)

Many problems in quantum information theory can be vied as interconversion between resources. In this talk, we apply this view point to state estimation theory, motivated by the following observations. First, a monotone metric takes value between SLD and RLD Fisher metric. This is quite analogous to the fact that entanglement measures are sandwiched by distillable entanglement and entanglement cost. Second, SLD add RLD are mutually complement via purification of density matrices, but its operational meaning was not clear. To find a link between these observations, we define reverse estimation problem, or simulation of quantum state family by probability distribution family, proving that RLD Fisher metric is a solution to local reverse estimation problem of quantum state family with 1-dim parameter. This result gives new proofs of some known facts and proves one new fact about monotone distances. We also investigate information geometry of RLD, and reverse estimation theory of a multi-dimensional parameter fam...

Matsumoto, K



Reverse estimation theory, Complementality between RLD and SLD, and monotone distances  

E-Print Network (OSTI)

Many problems in quantum information theory can be vied as interconversion between resources. In this talk, we apply this view point to state estimation theory, motivated by the following observations. First, a monotone metric takes value between SLD and RLD Fisher metric. This is quite analogous to the fact that entanglement measures are sandwiched by distillable entanglement and entanglement cost. Second, SLD add RLD are mutually complement via purification of density matrices, but its operational meaning was not clear. To find a link between these observations, we define reverse estimation problem, or simulation of quantum state family by probability distribution family, proving that RLD Fisher metric is a solution to local reverse estimation problem of quantum state family with 1-dim parameter. This result gives new proofs of some known facts and proves one new fact about monotone distances. We also investigate information geometry of RLD, and reverse estimation theory of a multi-dimensional parameter family.

Keiji Matsumoto



Deficit of reactor antineutrinos at distances smaller than 100 m and inverse beta-decay  

E-Print Network (OSTI)

We analyse a change of a deficit of reactor antineutrinos at distances smaller than 100 m by changing the lifetime of the neutron from tau_n = 885.7 s to tau_n = 879.6 s, calculated for the axial coupling constants lambda = - 1.2694 and lambda = - 1.2750, respectively, in order to get a result corresponding the new world average value tau_n = 880.1(1.1) s. We calculate the angular distribution and cross section for the inverse beta-decay, taking into account the contributions of the "weak magnetism" and the neutron recoil to next-to-leading order in the large baryon mass expansion and the radiative corrections of order alpha/\\pi ~ 10^(-3), calculated to leading order in the large baryon mass expansion. We obtain an increase of a deficit of reactor antineutrinos in of about 0.734%.

A. N. Ivanov; R. Hollwieser; N. I. Troitskaya; M. Wellenzohn; O. M. Zherebtsov; A. P. Serebrov



The Age, Extinction and Distance of the Old, Metal-Rich Open Cluster NGC 6791  

E-Print Network (OSTI)

An extensive grid of metal-rich isochrones utilizing the latest available input physics has been calculated for comparison with the old, metal-rich open cluster NGC 6791. The isochrones have been simultaneously fit to BV and VI color magnitude diagrams, with the same composition, reddening and distance modulus required for both colors. Our best fitting isochrone assumes [Fe/H] = +0.4, scaled solar abundance ratios, and dY/dZ = 2 (Y = 0.31), yielding an excellent fit to the data at all points along the major sequences. The resulting age is 8 Gyr, with E(B-V) = 0.10 and (m-M)_v = 13.42. The derived cluster parameters are fairly robust to variations in the isochrone [Fe/H] and helium abundances. All of the acceptable fits indicate that 0.07 < E(B-V) < 0.14$, 13.29 < (m-M)_v < 13.46, and that NGC 6791 has an age of 8.0+/- 0.5 Gyr. The fits also suggest that dY/dZ lies between 1 and 3. A metallicity as low as solar is clearly ruled out, as is dY/dZ = 0. Comparison with previous isochrone studies indicates that the derived reddening is primarily due to our use of the most recent color transformations, whereas the age depends upon both the colors and the input physics. Our isochrones provide an excellent fit to the Hyades zero-age main sequence as determined by Hipparcos, providing evidence that our derived reddening and distance modulus are reliable.

Brian Chaboyer; Elizabeth M. Green; James Liebert



Thick-to-Thin Filament Surface Distance Modulates Cross-Bridge Kinetics in Drosophila Flight Muscle  

Science Conference Proceedings (OSTI)

The demembranated (skinned) muscle fiber preparation is widely used to investigate muscle contraction because the intracellular ionic conditions can be precisely controlled. However, plasma membrane removal results in a loss of osmotic regulation, causing abnormal hydration of the myofilament lattice and its proteins. We investigated the structural and functional consequences of varied myofilament lattice spacing and protein hydration on cross-bridge rates of force development and detachment in Drosophila melanogaster indirect flight muscle, using x-ray diffraction to compare the lattice spacing of dissected, osmotically compressed skinned fibers to native muscle fibers in living flies. Osmolytes of different sizes and exclusion properties (Dextran T-500 and T-10) were used to differentially alter lattice spacing and protein hydration. At in vivo lattice spacing, cross-bridge attachment time (t{sub on}) increased with higher osmotic pressures, consistent with a reduced cross-bridge detachment rate as myofilament protein hydration decreased. In contrast, in the swollen lattice, t{sub on} decreased with higher osmotic pressures. These divergent responses were reconciled using a structural model that predicts t{sub on} varies inversely with thick-to-thin filament surface distance, suggesting that cross-bridge rates of force development and detachment are modulated more by myofilament lattice geometry than protein hydration. Generalizing these findings, our results suggest that cross-bridge cycling rates slow as thick-to-thin filament surface distance decreases with sarcomere lengthening, and likewise, cross-bridge cycling rates increase during sarcomere shortening. Together, these structural changes may provide a mechanism for altering cross-bridge performance throughout a contraction-relaxation cycle.

Tanner, Bertrand C.W.; Farman, Gerrie P.; Irving, Thomas C.; Maughan, David W.; Palmer, Bradley M.; Miller, Mark S. (IIT); (Vermont); (BU)



2768 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 55, NO. 12, DECEMBER 2008 Taser Blunt Probe Dart-To-Heart Distance Causing  

E-Print Network (OSTI)

Dart-To-Heart Distance Causing Ventricular Fibrillation in Pigs Jiun-Yan Wu, Student Member, IEEE. Webster*, Life Fellow, IEEE Abstract--The maximum distance between the heart and a model Taser stimulation dart, called the dart-to-heart distance, at which the Taser can directly cause ventricular fibrillation

Sheridan, Jennifer


Effect of distance to radiation treatment facility on use of radiation therapy after mastectomy in elderly women  

Science Conference Proceedings (OSTI)

Purpose: We sought to study the effect of distance to the nearest radiation treatment facility on the use of postmastectomy radiation therapy (PMRT) in elderly women. Methods and Materials: Using data from the linked Surveillance, Epidemiology, and End Results-Medicare (SEER-Medicare) database, we analyzed 19,787 women with Stage I or II breast cancer who received mastectomy as definitive surgery during 1991 to 1999. Multivariable logistic regression was used to investigate the association of distance with receipt of PMRT after adjusting for clinical and sociodemographic factors. Results: Overall 2,075 patients (10.5%) treated with mastectomy received PMRT. In addition to cancer and patient characteristics, in our primary analysis, increasing distance to the nearest radiation treatment facility was independently associated with a decreased likelihood of receiving PMRT (OR 0.996 per additional mile, p = 0.01). Secondary analyses revealed that the decline in PMRT use appeared at distances of more than 25 miles and was statistically significant for those patients living more than 75 miles from the nearest radiation facility (odds of receiving PMRT of 0.58 [95% CI 0.34-0.99] vs. living within 25 miles of such a facility). The effect of distance on PMRT appeared to be more pronounced with increasing patient age (>75 years). Variation in the effect of distance on radiation use between regions of the country and nodal status was also identified. Conclusions: Oncologists must be cognizant of the potential barrier to quality care that is posed by travel distance, especially for elderly patients; and policy makers should consider this fact in resource allocation decisions about radiation treatment centers.

Punglia, Rinaa S. [Department of Radiation Oncology, Dana-Farber Cancer Institute, Boston, MA (United States)]. E-mail: rpunglia@lroc.harvard.edu; Weeks, Jane C. [Division of Medical Oncology, Center for Outcomes and Policy Research, Dana-Farber Cancer Institute, Boston, MA (United States); Neville, Bridget A. [Division of Medical Oncology, Center for Outcomes and Policy Research, Dana-Farber Cancer Institute, Boston, MA (United States); Earle, Craig C. [Division of Medical Oncology, Center for Outcomes and Policy Research, Dana-Farber Cancer Institute, Boston, MA (United States)



DIRECT Distances to Nearby Galaxies Using Detached Eclipsing Binaries and Cepheids; 4, Variables in the Field M31D  

E-Print Network (OSTI)

We undertook a long term project, DIRECT, to obtain the direct distances to two important galaxies in the cosmological distance ladder -- M31 and M33 -- using detached eclipsing binaries (DEBs) and Cepheids. While rare and difficult to detect, DEBs provide us with the potential to determine these distances with an accuracy better than 5%. The extensive photometry obtained in order to detect DEBs provides us with good light curves for the Cepheid variables. These are essential to the parallel project to derive direct Baade-Wesselink distances to Cepheids in M31 and M33. For both Cepheids and eclipsing binaries, the distance estimates will be free of any intermediate steps. As a first step in the DIRECT project, between September 1996 and October 1997 we obtained 95 full/partial nights on the F. L. Whipple Observatory 1.2 m telescope and 36 full nights on the Michigan-Dartmouth-MIT 1.3 m telescope to search for DEBs and new Cepheids in the M31 and M33 galaxies. In this paper, fourth in the series, we present th...

Kaluzny, J; Stanek, K Z; Krockenberger, M; Sasselov, D D; Tonry, J L; Mateo, M



DIRECT Distances to Nearby Galaxies Using Detached Eclipsing Binaries and Cepheids; 5, Variables in the Field M31F  

E-Print Network (OSTI)

We undertook a long term project, DIRECT, to obtain the direct distances to two important galaxies in the cosmological distance ladder -- M31 and M33 -- using detached eclipsing binaries (DEBs) and Cepheids. While rare and difficult to detect, DEBs provide us with the potential to determine these distances with an accuracy better than 5%. The extensive photometry obtained in order to detect DEBs provides us with good light curves for the Cepheid variables. These are essential to the parallel project to derive direct Baade-Wesselink distances to Cepheids in M31 and M33. For both Cepheids and eclipsing binaries, the distance estimates will be free of any intermediate steps. As a first step in the DIRECT project, between September 1996 and October 1997 we obtained 95 full/partial nights on the F. L. Whipple Observatory 1.2 m telescope and 36 full nights on the Michigan-Dartmouth-MIT 1.3 m telescope to search for DEBs and new Cepheids in the M31 and M33 galaxies. In this paper, fifth in the series, we present the...

Mochejska, B J; Stanek, K Z; Krockenberger, M; Sasselov, D D



DIRECT Distances to Nearby Galaxies Using Detached Eclipsing Binaries and Cepheids; 2, Variables in the Field M31A  

E-Print Network (OSTI)

We undertook a long term project, DIRECT, to obtain the direct distances to two important galaxies in the cosmological distance ladder -- M31 and M33, using detached eclipsing binaries (DEBs) and Cepheids. While rare and difficult to detect, detached eclipsing binaries provide us with the potential to determine these distances with an accuracy better than 5%. The massive photometry obtained in order to detect DEBs provides us with the light curves for the Cepheid variables. These are essential to the parallel project to derive direct Baade-Wesselink distances to Cepheids in M31 and M33. For both Cepheids and eclipsing binaries the distance estimates will be free of any intermediate steps. As a first step of the DIRECT project, between September 1996 and January 1997 we have obtained 36 full nights on the Michigan-Dartmouth-MIT (MDM) 1.3-meter telescope and 45 full/partial nights on the F. L. Whipple Observatory (FLWO) 1.2-meter telescope to search for detached eclipsing binaries and new Cepheids in the M31 an...

Stanek, K Z; Krockenberger, M; Sasselov, D D; Tonry, J L; Mateo, M



DIRECT Distances to Nearby Galaxies Using Detached Eclipsing Binaries and Cepheids; 1, Variables in the Field M31B  

E-Print Network (OSTI)

We undertook a long term project, DIRECT, to obtain the direct distances to two important galaxies in the cosmological distance ladder - M31 and M33, using detached eclipsing binaries (DEBs) and Cepheids. While rare and difficult to detect, detached eclipsing binaries provide us with the potential to determine these distances with an accuracy better than 5%. The massive photometry obtained in order to detect DEBs provides us with good light curves for the Cepheid variables. These are essential to the parallel project to derive direct Baade-Wesselink distances to Cepheids in M31 and M33. For both Cepheids and eclipsing binaries the distance estimates will be free of any intermediate steps. As a first step of the DIRECT project, between September 1996 and January 1997 we have obtained 36 full nights on the Michigan-Dartmouth-MIT (MDM) 1.3-meter telescope and 45 full/partial nights on the F. L. Whipple Observatory (FLWO) 1.2-meter telescope to search for detached eclipsing binaries and new Cepheids in the M31 an...

Kaluzny, J; Krockenberger, M; Sasselov, D D; Tonry, J L; Mateo, M



DIRECT Distances to Nearby Galaxies Using Detached Eclipsing Binaries and Cepheids; 3, Variables in the Field M31C  

E-Print Network (OSTI)

We undertook a long term project, DIRECT, to obtain the direct distances to two important galaxies in the cosmological distance ladder -- M31 and M33 -- using detached eclipsing binaries (DEBs) and Cepheids. While rare and difficult to detect, DEBs provide us with the potential to determine these distances with an accuracy better than 5%. The extensive photometry obtained in order to detect DEBs provides us with good light curves for the Cepheid variables. These are essential to the parallel project to derive direct Baade-Wesselink distances to Cepheids in M31 and M33. For both Cepheids and eclipsing binaries, the distance estimates will be free of any intermediate steps. As a first step in the DIRECT project, between September 1996 and October 1997 we obtained 95 full/partial nights on the F. L. Whipple Observatory 1.2 m telescope and 36 full nights on the Michigan-Dartmouth-MIT 1.3 m telescope to search for DEBs and new Cepheids in the M31 and M33 galaxies. In this paper, third in the series, we present the...

Stanek, K Z; Krockenberger, M; Sasselov, D D; Tonry, J L; Mateo, M



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Comparison of Single-Fired and Delay-Fired Explosions at Regional and Local Distances,  

SciTech Connect

A wide range of blasting practices are utilized by the U.S. mining industry resulting in dramatically different local and regional seismic signatures. This variability in blasting and resulting seismograms suggests that no single discriminant may be appropriate for identifying this class of sources. A range of blasting styles are identified in this paper and the distinguishing characteristics at regional distances are determined. The blasting styles are quantified with the help of mining company records and close-in acoustic,seismic and video graphic data. The regional data consists of portable deployments of high frequency and broadband sensors as well as data from the International Monitoring System Primary Array at Pinedale, Wyoming. Critical to the success of this study is the comparison of regional data from the mining explosions to data from contained, single-fired explosions. Two types of single-fired explosions are utilized, the first a calibration explosion (8 vertical boreholes with 5,000 lbs of explosives each) fired simultaneous. The second, single-fired explosion consists of a number of boreholes detonated simultaneously in the mine for the purpose of pre-splitting the material (driving fractures between boreholes) prior to a large cast shot. Data from these explosions provide the basis for identifying the source signatures of the more typical delay-fired explosions. At high frequencies the single-fired and delay-fired explosions exhibit very similar waveforms at regional distances.Both event types show a high P/L{sub g} ratio at the highest frequencies with L{sub g} dominating at lower frequencies. Mining explosions that cast material show an enrichment in surface wave energy at relatively long periods of 4-12 seconds. Timing anomalies are identified in a high percentage of mining explosions designed to cast material. The accidental, simultaneous detonation of a number of boreholes has been observed in 2 of 9 carefully instrumented cast blasts. These produce regional waveforms that can have characteristics of a single-fired explosion. Spectral scalloping is observed from some delay-fired explosions while not from others. The existence of these characteristics is dependent on the exact delay pattern utilized. Data from a single- fired explosion allows the assessment of local receiver effects that might appear as a characteristic of delay-firing. 9 figs.

Stump, B.W., Pearson, D.C.



Distance to the scaling law: a useful approach for unveiling relationships between crime and urban metrics  

E-Print Network (OSTI)

We report on a quantitative analysis of relationships between the number of homicides, population size and other ten urban metrics. By using data from Brazilian cities, we show that well defined average scaling laws with the population size emerge when investigating the relations between population and number of homicides as well as population and urban metrics. We also show that the fluctuations around the scaling laws are log-normally distributed, which enabled us to model these scaling laws by a stochastic-like equation driven by a multiplicative and log-normally distributed noise. Because of the scaling laws, we argue that it is better to employ logarithms in order to describe the number of homicides in function of the urban metrics via regression analysis. In addition to the regression analysis, we propose an approach to correlate crime and urban metrics via the evaluation of the distance between the actual value of the number of homicides (as well as the value of the urban metrics) and the value that is...

Alves, Luiz G A; Lenzi, Ervin K; Mendes, Renio S



Long-distance contributions to D{sup 0}-D{sup 0} mixing parameters  

SciTech Connect

Long-distance contributions to the D{sup 0}-D{sup 0} mixing parameters x and y are evaluated using latest data on hadronic D{sup 0} decays. In particular, we take on two-body D{yields}PP and VP decays to evaluate the contributions of two-body intermediate states because they account for {approx}50% of hadronic D{sup 0} decays. Use of the diagrammatic approach has been made to estimate yet-observed decay modes. We find that y is of order a few x10{sup -3} and x of order 10{sup -3} from hadronic PP and VP modes. These are in good agreement with the latest direct measurement of D{sup 0}-D{sup 0} mixing parameters using the D{sup 0{yields}}K{sub S{pi}}{sup +{pi}-} and K{sub S}K{sup +}K{sup -} decays by BABAR. We estimate the contribution to y from the VV modes using the factorization model and comment on the single-particle resonance effects and contributions from other two-body modes involving even-parity states.

Cheng Haiyang [Institute of Physics, Academia Sinica, Taipei, Taiwan 115 (China); Physics Department, Brookhaven National Laboratory, Upton, New York 11973 (United States); Chiang, C.-W. [Department of Physics and Center for Mathematics and Theoretical Physics, National Central University, Chungli, Taiwan 320 (China); Institute of Physics, Academia Sinica, Taipei, Taiwan 115 (China)


Note: This page contains sample records for the topic "trip distance mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

mi) 79 Overall DC electrical energy consumption (DC Whmi) 63 Overall DC electrical energy captured from regenerative braking (DC Whmi) 31 Total number of trips 2,245 Total...


Monthly Summary Results for the Chrysler RAM PHEV Fleet  

NLE Websites -- All DOE Office Websites (Extended Search)

istance (mi) 6 40 Trips in Charge Depleting (CD) mode City Highway Gasoline fuel economy (mpg) 21 25 DC electrical energy consumption (DC Whmi) 227 168 Percent of miles with...


Toward a better understanding of the gamma index: Investigation of parameters with a surface-based distance method  

SciTech Connect

Purpose: The purpose of this work was to clarify the interactions between the parameters used in the {gamma} index with the surface-based distance method, which itself can be viewed as a generalized version of the {gamma} index. The examined parameters included the distance to agreement (DTA)/dose difference (DD) criteria, the percentage used as a passing criterion, and the passing percentage for given DTA/DD criteria. The specific aims of our work were (1) to understand the relationships between the parameters used in the {gamma} index, (2) to determine the detection limit, or the minimum detectable error, of the {gamma} index with a given set of parameters, and (3) to establish a procedure to determine parameters that are consistent with the capacity of an IMRT QA system. Methods: The surface-based distance technique with dose gradient factor was derived, and then the relationship between surface-based distance and {gamma} index was established. The dose gradient factor for plans and measurements of 10 IMRT patients, 10 spine stereotactic radiosurgery (SRS) patients, and 3 Radiological Physics Center (RPC) head and neck phantom were calculated and evaluated. The detection limits of the surface-based distance and {gamma} index methods were examined by introducing known shifts to the 10 IMRT plans. Results: The means of the dose gradient factors were 0.434 mm/% and 0.956 mm/% for the SRS and IMRT plans, respectively. Key quantities (including the mean and 90th and 99th percentiles of the distance distribution) of the surface-based distance distribution between two dose distributions were linearly proportional to the actual shifts. However, the passing percentage of the {gamma} index for a given set of DTA/DD criteria was not associated with the actual shift. For IMRT, using the standard quality assurance criteria of 3 mm/3% DTA/DD and a 90% passing rate, we found that the detection limit of the {gamma} index in terms of global shift was 4.07 mm/4.07 % without noise. Conclusions: Surface-based distance is a direct measure of the difference between two dose distributions and can be used to evaluate or determine parameters for use in calculating the {gamma} index. The dose gradient factor represents the weighting between spatial and dose shift and should be determined before DTA/DD criteria are set. The authors also present a procedure to determine {gamma} index parameters from measurements.

Li Heng; Dong Lei; Zhang Lifei; Yang, James N.; Gillin, Michael T.; Zhu, X. Ronald [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas 77030 (United States)



On using the WMAP distance priors in constraining the time evolving equation of state of dark energy  

E-Print Network (OSTI)

Recently, the WMAP group has published their five-year data and considered the constraints on the time evolving equation of state of dark energy for the first time from the WMAP distance information. In this paper, we study the effectiveness of the usage of these distance information and find that these compressed CMB information can give similar constraints on dark energy parameters compared with the full CMB power spectrum if dark energy perturbations are included, however, once incorrectly neglecting the dark energy perturbations, the difference of the results are sizable.

Hong Li; Jun-Qing Xia; Gong-Bo Zhao; Zu-Hui Fan; Xinmin Zhang



On using the WMAP distance priors in constraining the time evolving equation of state of dark energy  

E-Print Network (OSTI)

Recently, the WMAP group has published their five-year data and considered the constraints on the time evolving equation of state of dark energy for the first time from the "WMAP distance priors". In this paper, we study the effectiveness of the usage of these distance priors and find that these compressed CMB information can give similar constraints on dark energy parameters compared with the full CMB power spectrum if dark energy perturbation is included, however, once incorrectly neglecting the dark energy perturbation, the difference of the results is sizable.

Li, Hong; Zhao, Gong-Bo; Fan, Zu-Hui; Zhang, Xinmin



Distance learning in toxicology: Resident and remote; Scotland, IPCS, IUPAC, and the world  

SciTech Connect

Globally, very few college or university chemistry courses incorporate toxicology although public perception of chemicals and the chemical industry as threats to health and the environment has had an adverse effect on chemistry and on the use of its products. The International Union for Pure and Applied Chemistry (IUPAC) through its Commission on Toxicology recognized this and, with the support of the Committee on the Teaching of Chemistry has used the IUPAC web site to promote distance learning in toxicology for chemists. After preparation of a thoroughly refereed consensus Glossary of Terms for Chemists of Terms Used in Toxicology, a textbook Fundamental Toxicology for Chemists and a set of educational modules entitled Essential Toxicology were compiled and put through the normal thorough review procedure of IUPAC before being approved by the organization. There is now an additional Glossary of Terms Used in Toxicokinetics. The modules are freely downloadable in Adobe PDF format and are designed to be used both by educators and by students. Educators are asked to select whatever is appropriate to their students and to use the material as they wish, adding content specifically relevant to their circumstances. For self-study, the web modules have self-assessment questions and model answers. Currently the original Glossary for Chemists of Terms Used in Toxicology is being revised and it is expected that this will lead to further developments. The currently available components of the IUPAC programme may be accessed through the IUPAC website at the Subcommittee on Toxicology and Risk Assessment page: http://www.iupac.org/divisions/VII/VII.C.2/index.html.

Duffus, John H. [Edinburgh Centre for Toxicology, 43 Mansionhouse Road, Edinburgh EH9 2JD, Scotland (United Kingdom)]. E-mail: J.H.Duffus@btinternet.com



Going the Distance? NRC's Response to the National Academy of Science's Transportation Study  

Science Conference Proceedings (OSTI)

In February 2006, the National Academy of Sciences (NAS) published the results of a 3 1/2-year study, titled Going the Distance, that examined the safety of transporting spent nuclear fuel (SNF) and high level waste (HLW) in the United States. NAS initiated this study to address what it perceived to be a national need for an independent, objective, and authoritative analysis of SNF and HLW transport in the United States. The study was co-sponsored by the U.S. Nuclear Regulatory Commission (NRC), the U.S. Department of Energy (DOE), the U.S. Department of Transportation (DOT), the Electric Power Research Institute and the National Cooperative Highway Research Program. This paper addresses some of the recommendations made in the NAS study related to the performance of SNF transportation casks in long duration fires, the use of full-scale package testing, and the need for an independent review of transportation security prior to the commencement of large scale shipping campaigns to an interim storage site or geologic repository. In conclusion: The NRC believes that the current regulations in 10 CFR Part 71 for the design of SNF and HLW transportation packages provide a very high level of protection to the public for very severe accidents and credible threat scenarios. As recommended by the NAS study, additional studies of accidents involving severe fires have been completed. These studies have confirmed that spent fuel casks would be expected to withstand very severe fires without the release of any fission products from the spent fuel. Additionally, changes in rail operating procedures such as the use of dedicated trains and prohibition on the co-location of SNF and flammable liquids in rail tunnels can further reduce the already low probability of severe rail accident fires involving SNF and HLW. (authors)

Easton, E.P.; Bajwa, C.S. [United States Nuclear Regulatory Commission, Washington, DC (United States)



3Solar Energy and the Distance to Juno from the Sun As the Juno spacecraft travels to Jupiter,  

E-Print Network (OSTI)

at its maximum distance from the sun? Space Math http://spacemath.gsfc.nasa.gov #12;Answer Key 3 Problem, it gets farther from the sun every day. Because the spacecraft generates its electrical power using solar(r)? Problem 3 ┬ş For what angle, , will the spacecraft be able to generate only ┬╝ of the electrical power


An exploration on long-distance communications between left-behind children and their parents in China  

Science Conference Proceedings (OSTI)

In China, hundreds of millions of migrant workers have moved to cities or coastal regions for more or better-paid jobs and have left their children behind at their rural homes. Separated by thousands of kilometers, these "left-behind" children and their ... Keywords: left-behind children, long-distance communication, mobile mediated contact

Lu Pan; Feng Tian; Fei Lu; Xiaolong (Luke) Zhang; Ying Liu; Wenxin Feng; Guozhong Dai; Hongan Wang



Investigation of Examples of E-education Environment for Scientific Collaboration and Distance Graduate Studies. Part 2  

Science Conference Proceedings (OSTI)

The aim is to investigate two emerging information technologies in graduate studies and scientific cooperation. Internet is the first technology. The open source is the second. They help each other in many ways. The joint influence of both is regarded ... Keywords: Bayesian approach, distance studies, global optimization, tuning heuristics

Jonas Mockus



Fast affine invariant shape matching from 3d images based on the distance association map and the genetic algorithm  

Science Conference Proceedings (OSTI)

The decision on whether a pair of closed contours is derived from different views of the same object, a task commonly known as affine invariant matching, can be encapsulated as the search for the existence of an affine transform between them. Past research ... Keywords: affine invariant matching, chamfer distance transform

Peter Wai-Ming Tsang; W. C. Situ; Chi Sing Leung; Kai-Tat Ng



Abstract--The distance protection scheme without communication is often applied to the backup protection of EHV  

E-Print Network (OSTI)

setting. Effects of parameters, such as substation grounding, cable layouts and transposition, are also protection of EHV cable lines. For a reliable operation of a ground distance relay, the ground loop impedance to the fault location. The discontinuity of the ground loop impedance at cross-bonding points may have an ill

Bak, Claus Leth


Measuring the relative efficiency of IC design firms using the directional distance function and a meta-frontier approach  

Science Conference Proceedings (OSTI)

This paper presents an alternative approach for evaluating the efficiency of integrated circuit (IC) design firms. In doing so, it accounts for differences between technology groups containing one or more design firms, and input and output factors to ... Keywords: Directional distance function, Group-frontier, IC design firm, Meta-frontier, Performance evaluations

Bo Hsiao; Ching-Chin Chern; Ming-Miin Yu




NLE Websites -- All DOE Office Websites (Extended Search)

0 Overall DC electrical energy consumption (DC Whmi) 66 Overall DC electrical energy captured from regenerative braking (DC Whmi) 30 Total number of trips 725 Total distance...


Measuring the differences in spatial ability between a face-to-face and a syncronous distance education undergraduate engineering graphics course.  

E-Print Network (OSTI)

?? Distance education is growing at colleges and universities throughout the United States. Engineering graphics laboratory courses are unique in their focus on skills andů (more)

Greenhalgh, Scott D.



DIRECT Distances to Nearby Galaxies Using Detached Eclipsing Binaries and Cepheids. VI. Variables in the Central Part of M33  

E-Print Network (OSTI)

The DIRECT project aims to determine direct distances to two important galaxies in the cosmological distance ladder - M31 and M33 - using detached eclipsing binaries (DEBs) and Cepheids. We present the results of the first large-scale CCD-based search for variables in M33. We have observed two fields located in the central region of M33 for a total of 95 nights on the F. L. Whipple Observatory 1.2-m telescope and 36 nights on the Michigan-Dartmouth-MIT 1.3-m telescope. We have found a total of 544 variables, including 251 Cepheids and 47 eclipsing binaries. The catalog of variables is available online, along with finding charts and BVI light curve data (consisting of 8.2x10^4 individual measurements). The complete set of CCD frames is available upon request.

Macri, L M; Sasselov, D D; Krockenberger, M; Kaluzny, J



Assessing Energy Impact of Plug-In Hybrid Electric Vehicles: Significance of Daily Distance Variation over Time and Among Drivers  

Science Conference Proceedings (OSTI)

Accurate assessment of the impact of plug-in hybrid electric vehicles (PHEVs) on petroleum and electricity consumption is a necessary step toward effective policies. Variations in daily vehicle miles traveled (VMT) over time and among drivers affect PHEV energy impact, but the significance is not well understood. This paper uses a graphical illustration, a mathematical derivation, and an empirical study to examine the cause and significance of such an effect. The first two methods reveal that ignoring daily variation in VMT always causes underestimation of petroleum consumption and overestimation of electricity consumption by PHEVs; both biases increase as the assumed PHEV charge-depleting (CD) range moves closer to the average daily VMT. The empirical analysis based on national travel survey data shows that the assumption of uniform daily VMT over time and among drivers causes nearly 68% underestimation of expected petroleum use and nearly 48% overestimation of expected electricity use by PHEVs with a 40-mi CD range (PHEV40s). Also for PHEV40s, consideration of daily variation in VMT over time but not among drivers similar to the way the utility factor curve is derived in SAE Standard SAE J2841 causes underestimation of expected petroleum use by more than 24% and overestimation of expected electricity use by about 17%. Underestimation of petroleum use and overestimation of electricity use increase with larger-battery PHEVs.

Lin, Zhenhong [ORNL; Greene, David L [ORNL
