Powered by Deep Web Technologies
Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ITi Solar | Open Energy Information  

Open Energy Info (EERE)

ITi Solar ITi Solar Jump to: navigation, search Logo: iTi Solar Name iTi Solar Address 8401 Baseline Road Place Boulder, Colorado Zip 80303 Sector Solar Product Developing thin-film solar that can be printed on an inkjet printer Website http://www.itisolar.com/ Coordinates 40.001628°, -105.157147° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.001628,"lon":-105.157147,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


A Research on Strategies for Construction of MAS-Based Urban ITIS  

Science Conference Proceedings (OSTI)

In urban areas around the world, the number of trips made by vehicles has significantly increased in recent decades and resulted in frequent traffic congestions. ITIS offer optimal travel routes to road users with regard to the actual traffic state in ... Keywords: Multi-agent, ITIS, AHP, Urban traffic

Chaihou Zhao; Weiming Liu; Bei Wang



More Tales of Two (s)-ities. Kenneth Schilling, Mathematics Department, University of Michigan-Flint,  

E-Print Network (OSTI)

More Tales of Two (s)-ities. Kenneth Schilling, Mathematics Department, University of Michigan-Flint, Flint, MI 48502. email: ksch@umflint.edu AMS classification numbers: 28A05, 03G05 Abstract: In any

Schilling, Kenneth



NLE Websites -- All DOE Office Websites (Extended Search)

GenOpt A multi-parameter optimization program designed for minimization of an objective function, such as annual energy use, that is calculated by an external simulation program...


Preprint Lawrence Berkeley Laboratory U N I VERS ITY 0 F CALI FOR N I A  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 LBL-2378 1 Preprint Lawrence Berkeley Laboratory U N I VERS ITY 0 F CALI FOR N I A Physics Division Submitted to Astrophysical Journal SEP e 8 1987 An Analysis of Recent Measurements of the Temperature of the Cosmic Microwave Background Radiation G. Smoot, S.M Levin, C. Witebsky, G. De Amici, and Y. Rephaeli July 1987 TWO-WEEK LOAN COPY t This is a Library Circulating Copy which may be borrowed for two weeks, Prepared for the U.S. Department of Energy under Contract DE-AC03-76SF00098 An Analysis of Recent Measurements of the Temperature of the Cosmic Microwave Background Radiation George Smoot, Steven M. Levin, Chris Witebsky, Giovanni De Amici Space Sciences and Lawrence Berkeley Laboratories University of California, Berkeley Yoel Rephaeli


Aquaphile sarl Hydro Gen | Open Energy Information  

Open Energy Info (EERE)

Aquaphile sarl Hydro Gen Jump to: navigation, search Name Aquaphile sarl Hydro Gen Address 210 Le Vrennic Place Landda Zip 29870 Sector Marine and Hydrokinetic Phone number...


Brochure, Classification Bulletin GEN-16 - February 2012 | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bulletin GEN-16 - February 2012 Brochure, Classification Bulletin GEN-16 - February 2012 This brochure provides information on Classification Bulletin GEN-16, No Comment Policy on...


SABRE Gen | Open Energy Information  

Open Energy Info (EERE)

SABRE Gen SABRE Gen Jump to: navigation, search Name SABRE-Gen Place Johannesburg, South Africa Sector Renewable Energy Product Initiated by Eskom, this programme aims to ascertain whether utility scale, renewable electricity generation, is a viable supply-side option for Eskom and South Africa as a whole. Coordinates -26.460299°, 27.76053° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-26.460299,"lon":27.76053,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


First Gen Corporation | Open Energy Information  

Open Energy Info (EERE)

First Gen Corporation First Gen Corporation Jump to: navigation, search Name First Gen Corporation Place Philippines Sector Geothermal energy Product First Gen Corporation is an independent power generation company in the Philippine with an installed capacity of 1.9GW, most of it gas-fired. It is planning to enter the geothermal sector. References First Gen Corporation[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. First Gen Corporation is a company located in Philippines . References ↑ "First Gen Corporation" Retrieved from "http://en.openei.org/w/index.php?title=First_Gen_Corporation&oldid=345382" Categories: Clean Energy Organizations Companies Organizations


SolGen | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name SolGen Place Italy Sector Solar Product Italy-based Joint Venture to develop solar projects. References SolGen1 LinkedIn Connections...


GenXL | Open Energy Information  

Open Energy Info (EERE)

GenXL Place Melbourne, Florida Zip FL 32901 Product Joint venture that has a stake in battery technology developer EnGen. Coordinates -37.817532, 144.967148 Loading map......



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

H2GEN INNOVATIONS, INC. (H2GEN) FOR AN H2GEN INNOVATIONS, INC. (H2GEN) FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS TO INVENTIONS MADE UNDER COOPERATIVE AGREEMENT NUMBER DE-FC04-02AL67613, DOE WAIVER NO. W(A) 02-021. The Petitioner, H2Gen, a subcontractor to Air Products & Chemicals, Inc. (Air Products), has requested a waiver of all domestic and foreign patent rights to inventions that H2Gen may conceive or first reduce to practice in the course of H2Gen's work as a subcontractor under Cooperative Agreement Number DE-FC04-02AL67613 entitled "Development of a Turnkey Commercial Hydrogen Fueling Station" with the U.S. Department of Energy (DOE). H2Gen had originally requested rights in any trade secrets it may have conceived under the subcontract-this request for rights in trade secrets has


FutureGen Industrial Alliance Announces Carbon Storage Site Selection...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen Industrial Alliance Announces Carbon Storage Site Selection Process for FutureGen 2.0 FutureGen Industrial Alliance Announces Carbon Storage Site Selection Process for...


Vector CoGen Inc | Open Energy Information  

Open Energy Info (EERE)

CoGen, Inc. Place Carson City, Nevada Zip 89706 Product Vector CoGen produces micro-cogeneration systems for light commercial customers. References Vector CoGen, Inc.1 LinkedIn...


Classification Bulletin GEN-16 Revision | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Classification Bulletin GEN-16 Revision Classification Bulletin GEN-16 Revision Provides guidance to DOE Federal and contractor employees with access to classified information on...


Briefing, Classification Bulletin GEN-16 - April 2012 | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bulletin GEN-16 - April 2012 Briefing, Classification Bulletin GEN-16 - April 2012 April 2012 No Comment Policy on Classified Information in the Public Domain This briefing...


Brochure, Classification Bulletin GEN-16 - February 2012 | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Brochure, Classification Bulletin GEN-16 - February 2012 Brochure, Classification Bulletin GEN-16 - February 2012 This brochure provides information on Classification Bulletin...


DOE Announces Restructured FutureGen Approach to Demonstrate...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Restructured FutureGen Approach to Demonstrate CCS Technology at Multiple Clean Coal Plants DOE Announces Restructured FutureGen Approach to Demonstrate CCS Technology at Multiple...


FutureGen -- A Sequestration and Hydrogen Research Initiative...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen -- A Sequestration and Hydrogen Research Initiative FutureGen -- A Sequestration and Hydrogen Research Initiative A fact sheet on the Integrated Sequestration and...


NETL: Turbine Projects - Carbon Management (FutureGen)  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Management (FutureGen) Turbine Projects Carbon Management (FutureGen) Hydrogen Turbines new solicitation in FY05 DataFact Sheets...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ze-gen | Open Energy Information  

Open Energy Info (EERE)

Ze-gen Ze-gen Jump to: navigation, search Logo: Ze-gen Name Ze-gen Address 1380 Soldiers Field Road Place Boston, Massachusetts Zip 02135 Sector Biomass Product Gasification technology for producing energy from waste Website http://www.ze-gen.com/ Coordinates 42.3630196°, -71.1431496° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.3630196,"lon":-71.1431496,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Vision Vision for Tomorrow's Clean Energy FutureGen - A Sequestration and Hydrogen Research Initiative Responding to the President's Initiatives The Technology The Integrated Sequestration and Hydrogen Research Initiative is a $1 billion government/ industry partnership to design, build and operate a nearly emission-free, coal-fired electric and hydrogen production plant. The 275-megawatt prototype plant will serve as a large scale engineering laboratory for testing new clean power, carbon capture, and coal-to-hydrogen technologies. It will be the cleanest fossil fuel-fired power plant in the world. The project is a direct response to the President's Climate Change and Hydrogen Fuels Initiatives. President Bush emphasized the importance of technology in stabilizing greenhouse gas concentrations in the atmosphere with two major policy announcements: the National Climate


Alternative Fuels Data Center: NextGen Energy Board  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

NextGen Energy Board NextGen Energy Board to someone by E-mail Share Alternative Fuels Data Center: NextGen Energy Board on Facebook Tweet about Alternative Fuels Data Center: NextGen Energy Board on Twitter Bookmark Alternative Fuels Data Center: NextGen Energy Board on Google Bookmark Alternative Fuels Data Center: NextGen Energy Board on Delicious Rank Alternative Fuels Data Center: NextGen Energy Board on Digg Find More places to share Alternative Fuels Data Center: NextGen Energy Board on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type NextGen Energy Board The NextGen Energy Board (Board) was created to conduct research on how Minnesota can better invest its resources to achieve energy independence and agricultural and resource sustainability. The Board must:


Microsoft Word - NextGen20020829.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9, 2002 9, 2002 Department of Energy Awards $957,000 to Next Generation Economy Community Reuse Organization WASHINGTON, D.C. - The Department of Energy (DOE) has awarded $957,000 in the form of competitive grants to the Next Generation Community Reuse Organization (NextGen). NextGen is the community reuse organization (CRO) for the department's site in Albuquerque, New Mexico. "The Energy Department is a good neighbor to the communities surrounding our sites," Secretary of Energy Spencer Abraham said. "We will continue to work with the NextGen and other community reuse organizations around the country, to retain, expand or create jobs for workers affected by restructuring efforts." NextGen applied for funding from the department's Office of Worker and Community Transition


Southern Electric Gen Co | Open Energy Information  

Open Energy Info (EERE)

Gen Co Gen Co Jump to: navigation, search Name Southern Electric Gen Co Place Alabama Utility Id 17622 Utility Location Yes Ownership I NERC Location SERC NERC SERC Yes Operates Generating Plant Yes Activity Transmission Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Southern_Electric_Gen_Co&oldid=411565" Categories: EIA Utility Companies and Aliases Utility Companies


WebGen Systems | Open Energy Information  

Open Energy Info (EERE)

WebGen Systems WebGen Systems Jump to: navigation, search Logo: WebGen Systems Name WebGen Systems Address 41 Linksey Way Place Cambridge, Massachusetts Zip 02142 Sector Efficiency Product Software for energy conservation and control in commerical buildings Website http://www.webgensystems.com/ Coordinates 42.364771°, -71.0800567° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.364771,"lon":-71.0800567,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NETL: FutureGen Final EIS  

NLE Websites -- All DOE Office Websites (Extended Search)

Home > Technologies > Coal & Power Systems > FutureGen > EIS Home > Technologies > Coal & Power Systems > FutureGen > EIS FutureGen FutureGen Project Final Environmental Impact Statement (DOE/EIS-0394) Links presented below access the individual chapters and/or full volumes of the Final FutureGen Environmental Impact Statement (DOE/EIS-0394) and related documentation. If you would like to request a hardcopy of the stand-alone summary or the entire EIS, or a CD version, please send your name and mailing address to FutureGen.EIS@netl.doe.gov. Due to the high cost of shipping the four-volume EIS (approximately 2,500 pages) and possible duties or tariffs for copies sent to locations outside the U.S., DOE encourages requestors to download the document using the links below or to request only a CD. However, if requestors are willing and able to pay the applicable duties or tariffs, DOE will send hardcopies to locations outside the U.S. Please be aware that long delays may be possible and duties or tariffs may cost $100 (USD) or more.


ArborGen | Open Energy Information  

Open Energy Info (EERE)

ArborGen ArborGen Jump to: navigation, search Name ArborGen Place Summerville, South Carolina Product The company is invloved in research, development and commercialization of applications and solutions in tree genetics, including varietal forestry, that improve wood growth and quality for the forest products industry. Coordinates 33.01897°, -80.176014° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.01897,"lon":-80.176014,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


O Gen UK Ltd | Open Energy Information  

Open Energy Info (EERE)

O Gen UK Ltd O Gen UK Ltd Jump to: navigation, search Name O-Gen UK Ltd Place Stone, United Kingdom Zip ST15 8XU Sector Biomass Product Power generator from biomass. Coordinates 37.582998°, -82.270862° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.582998,"lon":-82.270862,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PublicGen | Open Energy Information  

Open Energy Info (EERE)

PublicGen PublicGen Jump to: navigation, search Name PublicGen Place Asheville, North Carolina Zip NC 28815 Sector Hydro, Hydrogen Product Provider of pre-sales, development stage project management and technical communications focusing on smart grid and hydrogen infrastructure systems. Coordinates 35.59846°, -82.553144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.59846,"lon":-82.553144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GenSelf Corp | Open Energy Information  

Open Energy Info (EERE)

GenSelf Corp GenSelf Corp Jump to: navigation, search Name GenSelf Corp Place Irvine, California Zip 92606 Product PV system installer in Southern California. Coordinates 41.837752°, -79.268594° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.837752,"lon":-79.268594,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Department of Energy and FutureGen Alliance Discuss Next Steps...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois Department of Energy and FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois August 19, 2010 -...


HydroGen Corporation formerly Chiste Corp | Open Energy Information  

Open Energy Info (EERE)

HydroGen Corporation formerly Chiste Corp HydroGen Corporation formerly Chiste Corp Jump to: navigation, search Name HydroGen Corporation (formerly Chiste Corp) Place Jefferson Hills, Pennsylvania Zip 15025 Sector Hydro, Hydrogen Product HydroGen Corporation is a manufacturer of multi-megawatt fuel cell systems utilizing its proprietary 400-kilowatt phosphoric acid fuel cell (PAFC) technology References HydroGen Corporation (formerly Chiste Corp)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. HydroGen Corporation (formerly Chiste Corp) is a company located in Jefferson Hills, Pennsylvania . References ↑ "HydroGen Corporation (formerly Chiste Corp)" Retrieved from "http://en.openei.org/w/index.php?title=HydroGen_Corporation_formerly_Chiste_Corp&oldid=346722"


FutureGen Industrial Alliance Announces Carbon Storage Site Selection  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen Industrial Alliance Announces Carbon Storage Site FutureGen Industrial Alliance Announces Carbon Storage Site Selection Process for FutureGen 2.0 FutureGen Industrial Alliance Announces Carbon Storage Site Selection Process for FutureGen 2.0 October 6, 2010 - 12:00am Addthis WASHINGTON -- The FutureGen Industrial Alliance today announced details of a process that will lead to the selection of an Illinois site for the storage of carbon dioxide (CO2) collected at FutureGen 2.0, a landmark project that will advance the deployment of carbon capture and storage technology at an Ameren Energy Resources power plant in Meredosia, Illinois. Last month the Department of Energy signed two agreements, one with the FutureGen Industrial Alliance and one with Ameren Energy Resources that committed $1 billion in Recovery Act funding to design, build and


HydroGen Aquaphile sarl | Open Energy Information  

Open Energy Info (EERE)

Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon HydroGen Aquaphile sarl Jump to: navigation, search Name HydroGen Aquaphile sarl Sector Marine...


US BioGen LLC | Open Energy Information  

Open Energy Info (EERE)

US BioGen LLC Place Dallas, Texas Zip 75231 Sector Hydro, Hydrogen Product Produces bioethanol, electricity and hydrogen from grain crops such as corn. References US BioGen LLC1...


Ze gen Inc | Open Energy Information  

Open Energy Info (EERE)

Ze gen Inc Ze gen Inc Jump to: navigation, search Name Ze-gen Inc Place Boston, Massachusetts Zip MA 02110 Product Ze-gen is a developer and integrator of waste gasification technology which converts construction and demolition waste (C&D) and municipal solid waste (MSW) into synthetic natural gas (syngas) and electrical energy. Coordinates 42.358635°, -71.056699° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.358635,"lon":-71.056699,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gen IV Materials Handbook Implementation Plan  

SciTech Connect

A Gen IV Materials Handbook is being developed to provide an authoritative single source of highly qualified structural materials information and materials properties data for use in design and analyses of all Generation IV Reactor Systems. The Handbook will be responsive to the needs expressed by all of the principal government, national laboratory, and private company stakeholders of Gen IV Reactor Systems. The Gen IV Materials Handbook Implementation Plan provided here addresses the purpose, rationale, attributes, and benefits of the Handbook and will detail its content, format, quality assurance, applicability, and access. Structural materials, both metallic and ceramic, for all Gen IV reactor types currently supported by the Department of Energy (DOE) will be included in the Gen IV Materials Handbook. However, initial emphasis will be on materials for the Very High Temperature Reactor (VHTR). Descriptive information (e.g., chemical composition and applicable technical specifications and codes) will be provided for each material along with an extensive presentation of mechanical and physical property data including consideration of temperature, irradiation, environment, etc. effects on properties. Access to the Gen IV Materials Handbook will be internet-based with appropriate levels of control. Information and data in the Handbook will be configured to allow search by material classes, specific materials, specific information or property class, specific property, data parameters, and individual data points identified with materials parameters, test conditions, and data source. Details on all of these as well as proposed applicability and consideration of data quality classes are provided in the Implementation Plan. Website development for the Handbook is divided into six phases including (1) detailed product analysis and specification, (2) simulation and design, (3) implementation and testing, (4) product release, (5) project/product evaluation, and (6) product maintenance and enhancement. Contracting of development of the Handbook website is discussed in terms of host server options, cost, technology, developer background and cooperative nature, and company stability. One of the first and most important activities in website development will be the generation of a detailed Handbook product requirements document including case diagrams and functional requirements tables. The Implementation Plan provides a detailed overview of the organizational structure of the Handbook and details of Handbook preparation, publication, and distribution. Finally, the Implementation Plan defines Quality Assurance requirements for the Handbook.

Rittenhouse, P.; Ren, W.




NLE Websites -- All DOE Office Websites (Extended Search)

GEN.2 GEN.2 Procedure Title Determine, Complete, and Document Required ES&H Training Procedure Manager HOLLEY, BELINDA M. Status Active Subject Matter Expert Linda P. Wilson Dorrance E. McLean-CA Contact Applicability, Exceptions, and Consequences This corporate procedure applies to all Members of the Workforce, except as noted below. This procedure addresses two types of ES&H Training: corporate-managed and line-managed training. Descriptions of these types of training are in the Ownership by Activity table on the Corporate Learning and Professional Development (CL&PD) website. This procedure does not address the performance-based training processes required at nuclear facilities and for safeguards and security. Those organizations may have to meet certain DOE requirements for


EcoGen LLC | Open Energy Information  

Open Energy Info (EERE)

EcoGen LLC EcoGen LLC Place Wichita, Kansas Zip 67202 Sector Wind energy Product Mid-West business focused on project development of ethanol and wind plants. Coordinates 37.68698°, -97.335579° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.68698,"lon":-97.335579,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GenDrive Limited | Open Energy Information  

Open Energy Info (EERE)

GenDrive Limited GenDrive Limited Jump to: navigation, search Name GenDrive Limited Place Cambridge, United Kingdom Zip CB23 3GY Sector Renewable Energy, Solar, Wind energy Product Developing a range of grid-connected inverters, 'Plug & Play', for renewable energy (mostly solar and wind) systems. These are intended to improve ease of installation. Coordinates 43.003745°, -89.017499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.003745,"lon":-89.017499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FlueGen Inc | Open Energy Information  

Open Energy Info (EERE)

FlueGen Inc FlueGen Inc Jump to: navigation, search Name FlueGen, Inc. Place Irvine, California Zip 92614 Product Irvine-based original equipment manufacturer (OEM) of air pollution control systems for the utility industry, including coal-fired power plants, in addition to financing client's projects, thereafter operating and maintaining the system for a fee. Coordinates 41.837752°, -79.268594° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.837752,"lon":-79.268594,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/SeaGen | Open Energy Information  

Open Energy Info (EERE)

SeaGen SeaGen < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage SeaGen.jpg Technology Profile Primary Organization Marine Current Turbines Ltd Project(s) where this technology is utilized *MHK Projects/Seaflow Tidal Energy System *MHK Projects/SeaGen 2 *MHK Projects/SeaGen KyleRhea *MHK Projects/Seagen Strangford *MHK Projects/The Skerries Technology Resource Click here Current/Tidal Technology Type Click here Axial Flow Turbine Technology Readiness Level Click here TRL 9: Commercial-Scale Production / Application Technology Description Two 16m diameter rotors mounted on a steel cross beam Mooring Configuration Jacketed quadrapod structure with 4 pinpiles each of 1m diameter penetrating 9m into bedrock. SeaGen can also be supplied on a 3.5m monopile and its predecessor the 300kW Seaflow was installed on a 2.1m diameter monopile.


MHK Technologies/HydroGen 10 | Open Energy Information  

Open Energy Info (EERE)

HydroGen 10 HydroGen 10 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage HydroGen 10.jpg Technology Profile Primary Organization HydroGen Aquaphile sarl Project(s) where this technology is utilized *MHK Projects/Hydro Gen Technology Resource Click here Current/Tidal Technology Type Click here Oscillating Wave Surge Converter Technology Readiness Level Click here TRL 7/8: Open Water System Testing & Demonstration & Operation Technology Description Hydro Gen is a big floating paddle wheels turbine included in a catamaran frame venturi shaped The frame is optimized to allow tapping a maximum of water in move in order to capture a maximum of kinetic energy which is transformed in mechanical energy by the wheel motion and then transformed into electrical energy through a generator mechanically driven by the wheel And then finally changed by a power control station to a steady electrical current normed at the customer request


Microsoft Word - ATD Gen 2 Performance Evaluation Final Report...  

NLE Websites -- All DOE Office Websites (Extended Search)

... 101 Figure B.5. ATD Gen 2 cycle-life cell with brass connectors and vellum insulator on the negative tab. ... 102 Figure B.6....


NETL: News Release - FutureGen Project Launched  

NLE Websites -- All DOE Office Websites (Extended Search)

2005 FutureGen Project Launched Government, Industry Agree to Build Zero-Emissions Power Plant of the Future WASHINGTON, DC - Secretary of Energy Samuel Bodman today announced...


Argonne, Evigia finalize licensing agreement for next-gen RFID...  

NLE Websites -- All DOE Office Websites (Extended Search)

See related New RFID technology tracks and monitors nuclear materials Argonne, Evigia finalize licensing agreement for next-gen RFID sensor technology By Angela Hardin * July 16,...


TidGen Power System Commercialization Project  

SciTech Connect

ORPC Maine, LLC, a wholly-owned subsidiary of Ocean Renewable Power Company, LLC (collectively ORPC), submits this Final Technical Report for the TidGen Power System Commercialization Project (Project), partially funded by the U.S. Department of Energy (DE-EE0003647). The Project was built and operated in compliance with the Federal Energy Regulatory Commission (FERC) pilot project license (P-12711) and other permits and approvals needed for the Project. This report documents the methodologies, activities and results of the various phases of the Project, including design, engineering, procurement, assembly, installation, operation, licensing, environmental monitoring, retrieval, maintenance and repair. The Project represents a significant achievement for the renewable energy portfolio of the U.S. in general, and for the U.S. marine hydrokinetic (MHK) industry in particular. The stated Project goal was to advance, demonstrate and accelerate deployment and commercialization of ORPCs tidal-current based hydrokinetic power generation system, including the energy extraction and conversion technology, associated power electronics, and interconnection equipment capable of reliably delivering electricity to the domestic power grid. ORPC achieved this goal by designing, building and operating the TidGen Power System in 2012 and becoming the first federally licensed hydrokinetic tidal energy project to deliver electricity to a power grid under a power purchase agreement in North America. Located in Cobscook Bay between Eastport and Lubec, Maine, the TidGen Power System was connected to the Bangor Hydro Electric utility grid at an on-shore station in North Lubec on September 13, 2012. ORPC obtained a FERC pilot project license for the Project on February 12, 2012 and the first Maine Department of Environmental Protection General Permit issued for a tidal energy project on January 31, 2012. In addition, ORPC entered into a 20-year agreement with Bangor Hydro Electric Company on January 1, 2013 for up to 5 megawatts at a price of $215/MWh, escalating at 2.0% per year.

Sauer, Christopher R. [President & CEO; McEntee, Jarlath [VP Engineering & CTO



Gen IV Materials Handbook Functionalities and Operation  

SciTech Connect

This document is prepared for navigation and operation of the Gen IV Materials Handbook, with architecture description and new user access initiation instructions. Development rationale and history of the Handbook is summarized. The major development aspects, architecture, and design principles of the Handbook are briefly introduced to provide an overview of its past evolution and future prospects. Detailed instructions are given with examples for navigating the constructed Handbook components and using the main functionalities. Procedures are provided in a step-by-step fashion for Data Upload Managers to upload reports and data files, as well as for new users to initiate Handbook access.

Ren, Weiju [ORNL



FutureGen Project Launched | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen Project Launched FutureGen Project Launched FutureGen Project Launched December 6, 2005 - 4:29pm Addthis Government, Industry Agree to Build Zero-Emissions Power Plant of the Future WASHINGTON, DC -- Secretary of Energy Samuel W. Bodman today announced that the Department of Energy has signed an agreement with the FutureGen Industrial Alliance to build FutureGen, a prototype of the fossil-fueled power plant of the future. The nearly $1 billion government-industry project will produce electricity and hydrogen with zero-emissions, including carbon dioxide, a greenhouse gas. The initiative is a response to President Bush's directive to develop a hydrogen economy by drawing upon the best scientific research to address the issue of global climate change. Today's announcement marks the official


Microsoft Word - NextGen20030620.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Friday, June 20, 2003 Department of Energy Awards $300,000 Grant to Next Generation Economy Inc. WASHINGTON, DC - The Department of Energy (DOE) today announced that it will award $300,000 to the Next Generation Economy Inc., (NextGen), a community reuse organization (CRO) located at the department's Sandia National Laboratory in Albuquerque, NM. The organization's goal is to diversify the regional economy, increase the number of quality jobs in the region and the state, and reduce the region's economic dependence on the federal government. A CRO is an organization recognized by the Energy Department that can apply for funding for programs that can modify the impacts of workforce restructuring at its facilities and reduce community dependence on the department's activities.


MHK Technologies/Deep Gen Tidal Turbines | Open Energy Information  

Open Energy Info (EERE)

Deep Gen Tidal Turbines Deep Gen Tidal Turbines < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Deep Gen Tidal Turbines.jpg Technology Profile Primary Organization Tidal Generation Ltd Project(s) where this technology is utilized *MHK Projects/Tidal Generation Ltd EMEC Technology Resource Click here Current/Tidal Technology Type Click here Axial Flow Turbine Technology Readiness Level Click here TRL 1-3: Discovery / Concept Definition / Early Stage Development & Design & Engineering Technology Description The DEEP Gen 1 MW fully submerged tidal turbine best exploits resources in depths 30m The horizontal axis turbine is inexpensive to construct and easy to install due to the lightweight 80 tons MW support structure allows rapid removal and replacement of powertrains enabling safe maintenance in a dry environment and is located out of the wave zone for improved survivability


Terra-Gen Power LLC | Open Energy Information  

Open Energy Info (EERE)

www.terra-genpower.com References Terra-Gen Power1 LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now Contents 1 General 2 Projects (2) 3 NEPA...


MHK Technologies/WET EnGen | Open Energy Information  

Open Energy Info (EERE)

EnGen EnGen < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage WET EnGen.jpg Technology Profile Primary Organization Wave Energy Technologies Inc Project(s) where this technology is utilized *MHK Projects/Sandy Cove Technology Resource Click here Wave Technology Type Click here Point Absorber Technology Readiness Level Click here TRL 5/6: System Integration and Technology Laboratory Demonstration Technology Description The EnGen point absorber, which features 'Smart Float' technology that allows the device to travel along a rigid spar at an incline of 45 degrees. The spar is moored at a single point of contact which allows the device to be fully compliant on all three axes (pitch, roll and yaw). Mooring Configuration Proprietary


Next Generation (NextGen) Geospatial Information System (GIS) | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Next Generation (NextGen) Geospatial Information System (GIS) Next Generation (NextGen) Geospatial Information System (GIS) Next Generation (NextGen) Geospatial Information System (GIS) July 12, 2013 - 12:17pm Addthis The U.S. Department of Energy Office of Legacy Management (LM) manages environmental records from Cold War legacy sites spanning nearly 40 years. These records are a key LM asset and must be managed and maintained efficiently and effectively. There are over 16 different applications that support the databases containing environmental and geospatial information. The current applications, respective systems, and processes require upgrades to effectively operate in the future. A multi-disciplined LM team collaborated to develop functional requirements and implement NextGen GIS; this system will replace the Geospatial


FutureGen 2.0 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clean Coal » Major Demonstrations » Clean Coal » Major Demonstrations » FutureGen 2.0 FutureGen 2.0 On August 5, 2010, U.S. Energy Secretary Steven Chu announced the awarding of $1 billion in Recovery Act funding to the FutureGen Alliance, Ameren Energy Resources, Babcock & Wilcox, and Air Liquide Process & Construction, Inc. to build FutureGen 2.0, a clean coal repowering program and carbon dioxide (CO2) storage network. The project partners will repower Ameren's 200 megawatt Unit 4 in Meredosia, Illinois with advanced oxy-combustion technology to capture approximately 1.3 million tonnes of CO2 each year - more than 90 percent of the plant's carbon emissions. Other emissions will be reduced to near zero levels. Oxy-combustion burns coal with a mixture of oxygen and CO2 instead of air


Terra-Gen Power LLC | Open Energy Information  

Open Energy Info (EERE)

a renewable energy company focused on geothermal, wind and solar generation. Terra-Gen Power owns 831 MW (net equity) in twenty-one operating renewable energy projects across the...


NETL: News Release - DOE Signs FutureGen Cooperative Agreement  

NLE Websites -- All DOE Office Websites (Extended Search)

0, 2007 DOE Signs FutureGen Cooperative Agreement WASHINGTON, DC - Today, the Department of Energy's Office of Fossil Energy announces the authorized start of the next phase of the...


NETL: News Release - FutureGen Industrial Alliance Announces...  

NLE Websites -- All DOE Office Websites (Extended Search)

considered when siting power plants, such as access to water, fuel delivery systems, and transmission lines, as well as requirements that are unique to the FutureGen project, such...


Gen I 2003 Honda Civic Hybrid electric Fleet and Accelerated...  

NLE Websites -- All DOE Office Websites (Extended Search)

testing during May 2002 in two fleets in Arizona. Two of the Gen I Civic HEVs were driven 25,000 miles each (Fleet testing) and the remaining two were driven until they...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Building Energy Software Tools Directory: GenOpt  

NLE Websites -- All DOE Office Websites (Extended Search)

TRACE, TRNSYS, etc., or any user-written program). GenOpt is written entirely in Java so that it is platform independent. An interface for coupling external simulation...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Barriers To Keeping The Lights On Conducted by The NextGen Energy Council Management Information Services, Inc. September 2008 Northeast U.S. Blackout 2003 60 Million Citizens in...


Property:GenDelToGrid | Open Energy Information  

Open Energy Info (EERE)

property. B Blundell 1 Geothermal Facility + 198,846 + Blundell 2 Geothermal Facility + 75,513 + Retrieved from "http:en.openei.orgwindex.php?titleProperty:GenDelToGrid&oldid...


Hybrid Electric Vehicle End-of-life Testing on Honda Insights, Honda Gen I Civics, and Toyota Gen I Priuses  

NLE Websites -- All DOE Office Websites (Extended Search)

262 262 U.S. Department of Energy FreedomCAR & Vehicle Technologies Program Hybrid Electric Vehicle End-of-Life Testing On Honda Insights, Honda Gen I Civics and Toyota Gen I Priuses TECHNICAL REPORT James Francfort Donald Karner Ryan Harkins Joseph Tardiolo February 2006 Idaho National Laboratory Operated by Battelle Energy Alliance INL/EXT-06-01262 U.S. Department of Energy FreedomCAR & Vehicle Technologies Program Hybrid Electric Vehicle End-of-Life Testing On Honda Insights, Honda Gen I Civics and Toyota Gen I Priuses James Francfort i Donald Karner and Ryan Harkins ii Joseph Tardiolo iii February 2006 Idaho National Laboratory Transportation Technology Department Idaho Falls, Idaho 83415 Prepared for the U.S. Department of Energy


Property:Geothermal/AnnualGenGwhYr | Open Energy Information  

Open Energy Info (EERE)

AnnualGenGwhYr AnnualGenGwhYr Jump to: navigation, search This is a property of type Number. Pages using the property "Geothermal/AnnualGenGwhYr" Showing 25 pages using this property. (previous 25) (next 25) 4 4 UR Guest Ranch Pool & Spa Low Temperature Geothermal Facility + 1.6 + A Ace Development Aquaculture Low Temperature Geothermal Facility + 21.2 + Agua Calientes Trailer Park Space Heating Low Temperature Geothermal Facility + 1.5 + Alive Polarity's Murrietta Hot Spring Pool & Spa Low Temperature Geothermal Facility + 2.1 + Americulture Aquaculture Low Temperature Geothermal Facility + 5 + Aq Dryers Agricultural Drying Low Temperature Geothermal Facility + 1.9 + Aqua Caliente County Park Pool & Spa Low Temperature Geothermal Facility + 0.5 +


Property:Geothermal/AnnualGenBtuYr | Open Energy Information  

Open Energy Info (EERE)

AnnualGenBtuYr AnnualGenBtuYr Jump to: navigation, search This is a property of type Number. Pages using the property "Geothermal/AnnualGenBtuYr" Showing 25 pages using this property. (previous 25) (next 25) 4 4 UR Guest Ranch Pool & Spa Low Temperature Geothermal Facility + 5.3 + A Ace Development Aquaculture Low Temperature Geothermal Facility + 72.5 + Agua Calientes Trailer Park Space Heating Low Temperature Geothermal Facility + 5 + Alive Polarity's Murrietta Hot Spring Pool & Spa Low Temperature Geothermal Facility + 7 + Americulture Aquaculture Low Temperature Geothermal Facility + 17 + Aq Dryers Agricultural Drying Low Temperature Geothermal Facility + 6.5 + Aqua Caliente County Park Pool & Spa Low Temperature Geothermal Facility + 1.8 +


Generation IV (Gen IV) - Nuclear Engineering Division (Argonne)  

NLE Websites -- All DOE Office Websites (Extended Search)

Generation IV (Gen Generation IV (Gen IV) Generation IV Overview Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Major Programs Generation IV (Gen IV) Development of next generation nuclear systems featuring significant advances in sustainability, economics, safety, reliability, proliferation resistance and physical protection. Bookmark and Share Generation IV Fact Sheet (73 KB) Overview Generation IV nuclear energy systems target significant advances over current-generation and evolutionary systems in the areas of sustainability, safety and reliability, and economics. These systems are to be deployable by 2030 in both industrialized and developing countries. Development of Generation IV systems is an international initiative. A


Brig. Gen. Dawkins honored at Air Force promotion ceremony | National  

NLE Websites -- All DOE Office Websites (Extended Search)

Dawkins honored at Air Force promotion ceremony | National Dawkins honored at Air Force promotion ceremony | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Brig. Gen. Dawkins honored at Air Force ... Brig. Gen. Dawkins honored at Air Force promotion ceremony Posted By Office of Public Affairs Brig. Gen. Dawkins honored at Air Force promotion ceremony


NextGen Fuel Inc | Open Energy Information  

Open Energy Info (EERE)

NextGen Fuel Inc NextGen Fuel Inc Jump to: navigation, search Name NextGen Fuel Inc Place Fulton, New York Sector Biofuels Product Developer of new technology and chemistry for the production of biofuels and fuel additives. Coordinates 28.06259°, -97.041215° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":28.06259,"lon":-97.041215,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NETL: News Release - FutureGen Industrial Alliance Announces Carbon Storage  

NLE Websites -- All DOE Office Websites (Extended Search)

6, 2010 6, 2010 FutureGen Industrial Alliance Announces Carbon Storage Site Selection Process for FutureGen 2.0 Washington, D.C. - The FutureGen Industrial Alliance today announced details of a process that will lead to the selection of an Illinois site for the storage of carbon dioxide (CO2) collected at FutureGen 2.0, a landmark project that will advance the deployment of carbon capture and storage technology at an Ameren Energy Resources power plant in Meredosia, Illinois. Last month the Department of Energy signed two agreements, one with the FutureGen Industrial Alliance and one with Ameren Energy Resources that committed $1 billion in Recovery Act funding to design, build and operate FutureGen 2.0. MORE INFO FutureGen 2.0 Siting Guidance FutureGen 2.0 Fact Sheet


NETL: News Release - Department of Energy and FutureGen Alliance...  

NLE Websites -- All DOE Office Websites (Extended Search)

0 Department of Energy and FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois Washington, D. C. -Officials from the Department of Energy, the state of Illinois,...


NETL: News Release - Department of Energy and FutureGen Alliance...  

NLE Websites -- All DOE Office Websites (Extended Search)

Department of Energy and FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois Washington, D. C. -Officials from the Department of Energy, the state of Illinois,...


A Virtual Reality Framework to Optimize Design, Operation and Refueling of GEN-IV Reactors.  

SciTech Connect

many GEN-IV candidate designs are currently under investigation. Technical issues related to material, safety and economics are being addressed at research laboratories, industry and in academia. After safety, economic feasibility is likely to be the most important crterion in the success of GEN-IV design(s). Lessons learned from the designers and operators of GEN-II (and GEN-III) reactors must play a vital role in achieving both safety and economic feasibility goals.

Rizwan-uddin; Nick Karancevic; Stefano Markidis; Joel Dixon; Cheng Luo; Jared Reynolds



Draft Environmental Impact Statement for FutureGen Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MAY 2007 i MAY 2007 i SUMMARY TABLE OF CONTENTS TABLE OF CONTENTS............................................................................................................................... i LIST OF ACRONYMS ................................................................................................................................ v SUMMARY.............................................................................................................................................. S-1 S.1 OVERVIEW ............................................................................................................................. S-1 S.1.1 Basis for U.S. Department of Energy Action.................................................................... S-1 S.1.2 Relationship between the U.S. Department of Energy and the FutureGen Alliance


StrateGen Consulting LLC | Open Energy Information  

Open Energy Info (EERE)

StrateGen Consulting LLC StrateGen Consulting LLC Jump to: navigation, search Name StrateGen Consulting LLC Place Berkeley, California Zip 94705 Sector Renewable Energy Product California-based, consultancy firm. StratGen Consulting LLC focuses on developing and implementing successful market entry and market development strategies for renewable energy and clean technology firms. Coordinates 38.748315°, -90.334929° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.748315,"lon":-90.334929,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NewGen Fuel Technologies Ltd | Open Energy Information  

Open Energy Info (EERE)

NewGen Fuel Technologies Ltd NewGen Fuel Technologies Ltd Jump to: navigation, search Name NewGen Fuel Technologies, Ltd Place Charlotte, North Carolina Zip 28210 Product 50:50 JV between NewGen Technologies and AG Global Partners to drive global expansion. The JV is involved in all steps of the fuel supply chain internationally. Coordinates 35.2225°, -80.837539° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.2225,"lon":-80.837539,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE/NNSA perspective safeguard by design: GEN III/III+ light water reactors and beyond  

SciTech Connect

An overview of key issues relevant to safeguards by design (SBD) for GEN III/IV nuclear reactors is provided. Lessons learned from construction of typical GEN III+ water reactors with respect to SBD are highlighted. Details of SBD for safeguards guidance development for GEN III/III+ light water reactors are developed and reported. This paper also identifies technical challenges to extend SBD including proliferation resistance methodologies to other GEN III/III+ reactors (except HWRs) and GEN IV reactors because of their immaturity in designs.

Pan, Paul Y [Los Alamos National Laboratory



U.S. and India Sign Historic Agreement on FutureGen Project | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sign Historic Agreement on FutureGen Project Sign Historic Agreement on FutureGen Project U.S. and India Sign Historic Agreement on FutureGen Project April 3, 2006 - 10:02am Addthis India to Participate in World's First Integrated CO2 Sequestration and Hydrogen Production Research Power Plant, FutureGen Initiative NEW DELHI, INDIA - The U.S. Department of Energy (DOE) announced the signing of an agreement with India that makes it the first country to join the U.S. on the government steering committee for the FutureGen Initiative. FutureGen is an initiative to build and operate the world's first coal-based power plant that removes and sequesters carbon dioxide (CO2) while producing electricity and hydrogen. "Adding India to our list of partners is an exciting step for the FutureGen project," Secretary of Energy Samuel W. Bodman said. "The success of


Department of Energy and FutureGen Alliance Discuss Next Steps for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen Alliance Discuss Next Steps for FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois Department of Energy and FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois August 19, 2010 - 12:00am Addthis Washington, DC - At a meeting today in Chicago, officials from the Department of Energy, the state of Illinois, Ameren, Babcock & Wilcox, American Air Liquide and the FutureGen Alliance discussed the next steps for the FutureGen 2.0 carbon capture and storage project in Illinois. The project remains on track for obligation before the end of September. Preparations will then begin for the repowering of Unit 4 at the Ameren facility in Meredosia, with construction set to begin in 2012. At the same time, following DOE best practices, a site selection process will be


Terra-Gen Power and TAS Celebrate Innovative Binary Geothermal Technology |  

Open Energy Info (EERE)

and TAS Celebrate Innovative Binary Geothermal Technology and TAS Celebrate Innovative Binary Geothermal Technology Jump to: navigation, search OpenEI Reference LibraryAdd to library Web Site: Terra-Gen Power and TAS Celebrate Innovative Binary Geothermal Technology Abstract N/A Authors Terra-Gen Power and LLC Published Publisher Not Provided, Date Not Provided DOI Not Provided Check for DOI availability: http://crossref.org Online Internet link for Terra-Gen Power and TAS Celebrate Innovative Binary Geothermal Technology Citation Terra-Gen Power, LLC. Terra-Gen Power and TAS Celebrate Innovative Binary Geothermal Technology [Internet]. [updated 2011;cited 2011]. Available from: http://www.terra-genpower.com/News/TERRA-GEN-POWER-AND-TAS-CELEBRATE-INNOVATIVE-BINAR.aspx Retrieved from "http://en.openei.org/w/index.php?title=Terra-Gen_Power_and_TAS_Celebrate_Innovative_Binary_Geothermal_Technology&oldid=682514

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Department of Energy and FutureGen Alliance Discuss Next Steps for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and FutureGen Alliance Discuss Next Steps for and FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois Department of Energy and FutureGen Alliance Discuss Next Steps for FutureGen 2.0 in Illinois August 20, 2010 - 1:00pm Addthis Washington, DC - Officials from the Department of Energy, the state of Illinois, Ameren, Babcock & Wilcox, American Air Liquide and the FutureGen Alliance discussed the next steps for the FutureGen 2.0 carbon capture and storage project in Illinois. The project remains on track for obligation before the end of September. Preparations will then begin for the repowering of Unit 4 at the Ameren facility in Meredosia, with construction set to begin in 2012. At the same time, following DOE best practices, a site selection process will be conducted to locate a site for the carbon


MHK Projects/SeaGen 2 | Open Energy Information  

Open Energy Info (EERE)

SeaGen 2 SeaGen 2 < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.6517,"lon":-63.5683,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lights Out In 2009? Lights Out In 2009? A Critical Analysis of Ź The Threat of Major Blackouts Facing the U.S. Ź What Is Needed To Maintain Grid Reliability Through 2016 Ź The Major Barriers To Keeping The Lights On Conducted by The NextGen Energy Council Management Information Services, Inc. September 2008 Northeast U.S. Blackout 2003 60 Million Citizens in the dark, $6B-$10B in economic losses, multiple deaths. 2 Preface 3 Executive Summary 4 Introduction 6 The Grid is in Trouble 7 Generation Barriers 17 Transmission Barriers 21 Political Barriers 24 Cost of Blackouts 26 Findings 29 Conclusions 30 End Notes 32 Appendix 34 Study conducted by: Management Information Services, Inc. NextGen Energy Council Available On the Web: www.nextgenenergy.org


MHK Projects/Hydro Gen | Open Energy Information  

Open Energy Info (EERE)

Hydro Gen Hydro Gen < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.5823,"lon":-4.60517,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


Developing Next-Gen Batteries With Help From NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

NERSC Helps Develop NERSC Helps Develop Next-Gen Batteries NERSC Helps Develop Next-Gen Batteries A genomics approach to materials research could speed up advancements in battery performance December 18, 2012 | Tags: Materials Science, Science Gateways Contact: Linda Vu, lvu@lbl.gov, +1 510 495 2402 XBD201110-01310.jpg Kristin Persson To reduce the United States' reliance on foreign oil and lower consumer energy costs, the Department of Energy (DOE) is bringing together five national laboratories, five universities and four private firms to revolutionize next-generation battery performance. This collaboration-dubbed the Joint Center for Energy Storage Research (JCESR)-will receive $120 million over five years to establish a new Batteries and Energy Storage Hub led by Argonne National Laboratory (ANL)


H2Gen Innovations Inc | Open Energy Information  

Open Energy Info (EERE)

Gen Innovations Inc Gen Innovations Inc Jump to: navigation, search Name H2Gen Innovations Inc Place Alexandria, Virginia Zip 22304-4806 Sector Hydro, Hydrogen Product The company manufactures low-cost, small-scale hydrogen generators for industrial applications and for the emerging fuel cell vehicle and distributed fuel cell power generation markets. Coordinates 31.19224°, 29.88987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.19224,"lon":29.88987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


GreenGen Co Ltd | Open Energy Information  

Open Energy Info (EERE)

GreenGen Co Ltd GreenGen Co Ltd Jump to: navigation, search Name GreenGen Co Ltd Place Beijing, Beijing Municipality, China Zip 100098 Sector Hydro, Hydrogen Product Beijing based joint venture headed up by China Huaneng Group which focusses on coal gasification, hydrogen production, CO2 capture and power plant construction. Coordinates 39.90601°, 116.387909° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.90601,"lon":116.387909,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Kalahari Greentech Inc formerly NextGen Bioscience | Open Energy  

Open Energy Info (EERE)

Kalahari Greentech Inc formerly NextGen Bioscience Kalahari Greentech Inc formerly NextGen Bioscience Jump to: navigation, search Name Kalahari Greentech Inc (formerly NextGen Bioscience) Place London, England, United Kingdom Zip EC3N 1AL Sector Wind energy Product Plans to operate wind farms either on its own or in partnership with other firms. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/GyroWaveGen | Open Energy Information  

Open Energy Info (EERE)

GyroWaveGen GyroWaveGen < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage GyroWaveGen.jpg Technology Profile Primary Organization Paradyme Systems Technology Type Click here Oscillating Wave Surge Converter Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description A gyro wave energy transducer is mounted on the buoyant body for translating the pendulum like motions of the buoyant body into rotational motion The gyro wave energy transducer includes a gimbal comprised of first and second frames with the first frame being pivotally mounted to the second frame and the second frame being pivotally mounted to the buoyant body A gyroscope is mounted to the first frame for rotation about an axis perpendicular to the axes of rotation of the first and second frames A motor generator is coupled to the gyroscope for maintaining a controlled rotational velocity for the gyroscope Transferring members are associated with one of the first and second frames for transferring torque of one of the first and second frames to the gyroscope about an axis that is perpendicular to that of the gyroscope which results in rotation of the other of the first and second frames An electrical generator is responsive to the relative rotational movement of the first and se


RenGen Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

RenGen Energy Ltd RenGen Energy Ltd Jump to: navigation, search Name RenGen Energy Ltd Place London, Greater London, United Kingdom Zip SW1W 0NR Sector Biomass, Carbon, Renewable Energy Product London-based company operating in the new energy market. They source, develop and finance renewable energy, carbon credit, and biomass supply projects in Europe, North America and Latin America. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Secretary Chu Announces Agreement on FutureGen Project in Mattoon, Illinois  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agreement on FutureGen Project in Mattoon, Agreement on FutureGen Project in Mattoon, Illinois Secretary Chu Announces Agreement on FutureGen Project in Mattoon, Illinois June 12, 2009 - 1:00pm Addthis Washington, DC - U.S. Secretary of Energy Steven Chu today announced an agreement with the FutureGen Alliance that advances the construction of the first commercial scale, fully integrated, carbon capture and sequestration project in the country in Mattoon, Illinois. "This important step forward for FutureGen reflects this Administration's commitment to rapidly developing carbon capture and sequestration technology as part of a comprehensive plan to create jobs, develop clean energy and reduce climate change pollution." said Energy Secretary Steven Chu. "The FutureGen project holds great promise as a flagship facility to


Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agreement on FutureGen Project in Mattoon, Agreement on FutureGen Project in Mattoon, IL Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL June 12, 2009 - 12:00am Addthis Washington, D.C. - U.S. Secretary of Energy Steven Chu today announced an agreement with the FutureGen Alliance that advances the construction of the first commercial scale, fully integrated, carbon capture and sequestration project in the country in Mattoon, Illinois. "This important step forward for FutureGen reflects this Administration's commitment to rapidly developing carbon capture and sequestration technology as part of a comprehensive plan to create jobs, develop clean energy and reduce climate change pollution." said Energy Secretary Steven Chu. "The FutureGen project holds great promise as a flagship facility to


DOE Issues Final Environmental Impact Statement for the FutureGen 2.0  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Issues Final Environmental Impact Statement for the FutureGen Issues Final Environmental Impact Statement for the FutureGen 2.0 Project, Morgan County, Illinois DOE Issues Final Environmental Impact Statement for the FutureGen 2.0 Project, Morgan County, Illinois October 25, 2013 - 2:48pm Addthis The U.S. Department of Energy has issued the Final Environmental Impact Statement (EIS) for the FutureGen 2.0 Project. The EIS evaluates the potential impacts associated with DOE's proposed action to provide financial assistance to the FutureGen Industrial Alliance (the Alliance) for the FutureGen 2.0 Project, including the direct and indirect environmental impacts from construction and operation of the proposed project. DOE's proposed action would provide approximately $1 billion of funding (primarily under the American Recovery and Reinvestment Act) to


NETL: News Release - DOE Takes Next Steps with Restructured FutureGen...  

NLE Websites -- All DOE Office Websites (Extended Search)

evaluation criteria, terms and conditions, and cost sharing requirements for public-private cooperation under FutureGen. MORE INFO Read the Draft FOA DOE Press Release DOE...


NRG-GenOn acquisition plan would create the largest independent ...  

U.S. Energy Information Administration (EIA)

NRG was formed from the regulated utility Xcel Energy, and GenOn was formed from Mirant Energy, which was once the merchant arm of the Southern Company.


NETL: News Release - DOE Announces Restructured Approach to FutureGen  

NLE Websites -- All DOE Office Websites (Extended Search)

30, 2008 DOE Announces Restructured FutureGen Approach to Demonstrate Carbon Capture and Storage Technology at Multiple Clean Coal Plants Affirms Commitment to Clean Coal...


DOE Takes Next Steps with Restructured FutureGen Approach | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

with Restructured FutureGen Approach with Restructured FutureGen Approach DOE Takes Next Steps with Restructured FutureGen Approach May 7, 2008 - 11:30am Addthis Announces Draft Solicitation for Multiple Commercial-Scale Clean Coal Plants with Sequestration WASHINGTON, DC - The U.S. Department of Energy (DOE) today released a draft Funding Opportunity Announcement (FOA) to solicit public input on the demonstration of multiple commercial-scale Integrated Gasification Combined Cycle (IGCC) or other clean coal power plants with cutting-edge carbon capture and storage (CCS) technology under the Department's restructured FutureGen approach. The draft solicitation outlines the planned scope of the project, evaluation criteria, terms and conditions, and cost sharing requirements for public-private cooperation under FutureGen.


Secretary Chu Announces FutureGen 2.0 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen 2.0 FutureGen 2.0 Secretary Chu Announces FutureGen 2.0 August 5, 2010 - 1:00pm Addthis Washington, DC - Today, U.S. Energy Secretary Steven Chu and U.S. Senator Dick Durbin announced the awarding of $1 billion in Recovery Act funding to the FutureGen Alliance, Ameren Energy Resources, Babcock & Wilcox, and Air Liquide Process & Construction, Inc. to build FutureGen 2.0, a clean coal repowering program and carbon dioxide (CO2) storage network. The project partners estimate the program will bring 900 jobs to downstate Illinois and another 1,000 to suppliers across the state. Today's announcement will help ensure the US remains competitive in a carbon constrained economy, creating jobs while reducing greenhouse gas pollution," said Secretary Chu. "This investment in the world's first,


EIS-0460: FutureGen 2.0 Project, Morgan County, Illinois | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

60: FutureGen 2.0 Project, Morgan County, Illinois 60: FutureGen 2.0 Project, Morgan County, Illinois EIS-0460: FutureGen 2.0 Project, Morgan County, Illinois Summary This EIS evaluates the environmental impacts of a proposal to provide approximately $1 billion in Federal funding (most of it appropriated by the American Recovery and Reinvestment Act) for the FutureGen 2.0 project. Under the FutureGen 2.0 project, DOE would provide financial assistance for the repowering of an existing electricity generator with clean coal technologies integrated with a pipeline that would transport carbon dioxide to a sequestration site where it would be injected and stored in a deep geologic formation. Public Comment Opportunities None available at this time. Documents Available for Download January 15, 2014 EIS-0460: Record of Decision


VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion March 12, 2010 - 2:47pm Addthis Charlotte sees next-gen vehicle supply expansion: U.S. Energy Secretary Steve Chu speaks at Celgard LLC in Charlotte, N.C. as Mitch Pulwer, Celgard’s vice president and general manager, looks on. | Photo courtesy of Celgard | Charlotte sees next-gen vehicle supply expansion: U.S. Energy Secretary Steve Chu speaks at Celgard LLC in Charlotte, N.C. as Mitch Pulwer, Celgard's vice president and general manager, looks on. | Photo courtesy of Celgard | Joshua DeLung Right now, manufacturers of electric cars too often have to rely on foreign suppliers for the high-performance batteries needed in those vehicles. But

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion VP 100: Charlotte Sees Next-Gen Vehicle Supply Expansion March 12, 2010 - 2:47pm Addthis Charlotte sees next-gen vehicle supply expansion: U.S. Energy Secretary Steve Chu speaks at Celgard LLC in Charlotte, N.C. as Mitch Pulwer, Celgard’s vice president and general manager, looks on. | Photo courtesy of Celgard | Charlotte sees next-gen vehicle supply expansion: U.S. Energy Secretary Steve Chu speaks at Celgard LLC in Charlotte, N.C. as Mitch Pulwer, Celgard's vice president and general manager, looks on. | Photo courtesy of Celgard | Joshua DeLung Right now, manufacturers of electric cars too often have to rely on foreign suppliers for the high-performance batteries needed in those vehicles. But


February 27, 2003: Abraham and Dobriansky announce "FutureGen" | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7, 2003: Abraham and Dobriansky announce "FutureGen" 7, 2003: Abraham and Dobriansky announce "FutureGen" February 27, 2003: Abraham and Dobriansky announce "FutureGen" February 27, 2003: Abraham and Dobriansky announce "FutureGen" February 27, 2003 Secretary Abraham and Under Secretary of State for Global Affairs Paula Dobriansky announce the formation of an ambitious new international effort to advance carbon capture and storage technology as a way to reduce greenhouse gas emissions. The Secretary states that the U.S. will lead a $1 billion, 10-year public-private-international effort to construct the world's first fossil fuel, pollution-free power plant, known as "FutureGen." Designed by an industrial consortium, the plant will turn coal into a hydrogen-rich gas, rather than burning it directly. The hydrogen


Secretary Chu Announces FutureGen 2.0 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FutureGen 2.0 FutureGen 2.0 Secretary Chu Announces FutureGen 2.0 August 5, 2010 - 12:00am Addthis Washington, D.C. - Today, U.S. Energy Secretary Steven Chu and U.S. Senator Dick Durbin announced the awarding of $1 billion in Recovery Act funding to the FutureGen Alliance, Ameren Energy Resources, Babcock & Wilcox, and Air Liquide Process & Costruction, Inc. to build FutureGen 2.0, a clean coal repowering program and carbon dioxide (CO2) storage network. The project partners estimate the program will bring 900 jobs to downstate Illinois and another 1,000 to suppliers across the state. "Today's announcement will help ensure the US remains competitive in a carbon constrained economy, creating jobs while reducing greenhouse gas pollution," said Secretary Chu. "This investment in the world's first,


Carbon Capture and Storage FutureGen 2.0 Project Moves Forward Into Second  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Carbon Capture and Storage FutureGen 2.0 Project Moves Forward Into Carbon Capture and Storage FutureGen 2.0 Project Moves Forward Into Second Phase Carbon Capture and Storage FutureGen 2.0 Project Moves Forward Into Second Phase February 4, 2013 - 7:25pm Addthis NEWS MEDIA CONTACT (202) 586-4940 WASHINGTON - Following the successful completion of the first phase, the Energy Department today announced the beginning of Phase II of project development with a new cooperative agreement between the FutureGen Industrial Alliance and the Department of Energy for an innovative carbon capture and storage (CCS) project in Illinois. "The Department of Energy is committed to the demonstration of carbon capture and storage technologies. We believe FutureGen 2.0 is an important step in making economic, commercial scale CCS a reality," said U.S.


U.S. and China Announce Cooperation on FutureGen and Sign Energy Efficiency  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Announce Cooperation on FutureGen and Sign Energy Announce Cooperation on FutureGen and Sign Energy Efficiency Protocol at U.S.-China Strategic Economic Dialogue U.S. and China Announce Cooperation on FutureGen and Sign Energy Efficiency Protocol at U.S.-China Strategic Economic Dialogue December 15, 2006 - 9:46am Addthis BEIJING, CHINA - The United States and China today announced that China will join the Government Steering Committee of the FutureGen project making China the third country to join the United States in the FutureGen International Partnership. The U.S. and China also signed an Energy Efficiency and Renewable Energy Protocol renewing cooperation in advancing clean technology including solar, wind, and biomass. The agreements were made as an outcome of the U.S.-China Strategic Economic Dialogue (SED) in


U.S. and India Reach Historic Agreement on FutureGen Project | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reach Historic Agreement on FutureGen Project Reach Historic Agreement on FutureGen Project U.S. and India Reach Historic Agreement on FutureGen Project March 2, 2006 - 11:34am Addthis India becomes the first nation to accept U.S. invitation to participate in new clean coal project WASHINGTON, DC - President George W. Bush announced today that India will become the first country to participate on the government steering committee for the U.S. Department of Energy's FutureGen project - an initiative to build and operate the world's first coal-based power plant that removes and sequesters carbon dioxide (CO2) while it produces electricity and hydrogen. As a partner, the Indian government will contribute $10 million to the FutureGen Initiative and Indian companies will also be invited to participate in the private sector segment.


ITI-CERTH participation to TRECVID 2012  

Science Conference Proceedings (OSTI)

... Person, Athlete, At- tached Body Parts, Baby, Beach, Beards, Bicycles ... Forest, Free Standing Structures, Furniture, Girl, Glasses, Graphic, Greeting ...



DOE Joint Genome Institute: Next Gen Sequencing Technology Pinpoint  

NLE Websites -- All DOE Office Websites (Extended Search)

February 12, 2009 February 12, 2009 Next Gen Sequencing Technology Pinpoint "On-Off Switches" in Genomes WALNUT CREEK, CA-Scientists from the U.S. Department of Energy (DOE) Joint Genome Institute (JGI), Lawrence Berkeley National Laboratory, and the University of California, San Diego have developed a set of molecular tools that provide important insight into the complex genomes of multicellular organisms. The strategy promises to clarify the longstanding mystery of the role played by vast stretches of DNA sequence that do not code for the functional units-genes-that nevertheless may have a powerful regulatory influence. The research is described in the 12 February edition of the journal Nature. DOE bioenergy researchers have an interest in identifying these regulatory


Final Environmental Impact Statement for the FutureGen Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I I Chapters 1-3, 8-12 Appendices NOVEMBER 2007 U.S. Department of Energy National Energy Technology Laboratory COVER SHEET Responsible Agency: U.S. Department of Energy Title: Final Environmental Impact Statement for FutureGen Project (DOE/EIS-0394) Location: Mattoon, Illinois; Tuscola, Illinois; Jewett, Texas; and Odessa, Texas Contact: For further information about this Environmental Impact Statement, contact: For general information on the U.S. Department of Energy's process for implementing the National Environmental Policy Act, contact: Mark McKoy, Document Manager U.S. Department of Energy National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 (304) 285-4426 or fax (304) 285-4403 Carol Borgstrom, Director


Final Environmental Impact Statement for the FutureGen Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Summary NOVEMBER 2007 U.S. Department of Energy National Energy Technology Laboratory COVER SHEET Responsible Agency: U.S. Department of Energy Title: Final Environmental Impact Statement for FutureGen Project (DOE/EIS-0394) Location: Mattoon, Illinois; Tuscola, Illinois; Jewett, Texas; and Odessa, Texas Contact: For further information about this Environmental Impact Statement, contact: For general information on the U.S. Department of Energy's process for implementing the National Environmental Policy Act, contact: Mark McKoy, Document Manager U.S. Department of Energy National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 (304) 285-4426 or fax (304) 285-4403 Carol Borgstrom, Director


NETL: News Release - PPL Corporation Joins FutureGen Industrial Alliance  

NLE Websites -- All DOE Office Websites (Extended Search)

23, 2006 23, 2006 PPL Corporation Joins FutureGen Industrial Alliance Washington, DC - The FutureGen Industrial Alliance today announced that power generator PPL Corporation has joined the non-profit consortium of global electric utilities and coal companies working with the U.S. Department of Energy to site and develop FutureGen, the world's cleanest coal-fueled power plant. MORE INFO FutureGen Industrial Alliance web site PPL becomes the tenth member of the Alliance, which is facilitating design, construction and operation of the first "zero-emissions" coal-fueled power plant and hydrogen production facility with integrated carbon capture and sequestration. "PPL's participation demonstrates continued interest among U.S. and international energy companies to work toward developing solutions to meet


Record of Decision Issued for the FutureGen 2.0 Project | Department...  

NLE Websites -- All DOE Office Websites (Extended Search)

with construction and operation of the FutureGen 2.0 Project, which is a public-private partnership formed for the purpose of developing the world's first...


U.S. and South Korea Sign Agreement on FutureGen Project | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

South Korea Sign Agreement on FutureGen Project South Korea Sign Agreement on FutureGen Project U.S. and South Korea Sign Agreement on FutureGen Project June 26, 2006 - 2:34pm Addthis Korea to Participate in World's First Integrated Carbon Sequestration and Hydrogen Production Research Power Plant WASHINGTON, DC - U.S. Energy Secretary Samuel W. Bodman and South Korean Minister of Commerce, Industry & Energy, Chung Sye Kyun, today signed an agreement making South Korea the second country, after India, to join the United States in the FutureGen International Partnership. Korea has pledged $10 million to help build and operate the world's first zero-emissions coal-fired power plant and will sit on a government steering committee to oversee this initiative. Once operational, this plant will remove and sequester carbon dioxide while producing electricity and


Terra-Gen Power closes US$286m lease financing for Dixie Valley...  

Open Energy Info (EERE)

Not Provided DOI Not Provided Check for DOI availability: http:crossref.org Online Internet link for Terra-Gen Power closes US286m lease financing for Dixie Valley Citation...


Consed with Next-Gen Data and BAM Files (7th Annual SFAF Meeting, 2012)  

Science Conference Proceedings (OSTI)

David Gordon on "Consed with Next-Gen Data and BAM Files" at the 2012 Sequencing, Finishing, Analysis in the Future Meeting held June 5-7, 2012 in Santa Fe, New Mexico.

Gordon, David [University of Washington



NETL: News Release - Secretary Chu Announces Agreement on FutureGen...  

NLE Websites -- All DOE Office Websites (Extended Search)

2, 2009 Secretary Chu Announces Agreement on FutureGen Project in Mattoon, Illinois Paves Way for First U.S. Commercial Scale Carbon Capture and Storage Project Washington, D.C. -...


Electricity Generation Cost Simulation Model (GenSim)  

Science Conference Proceedings (OSTI)

The Electricity Generation Cost Simulation Model (GenSim) is a user-friendly, high-level dynamic simulation model that calculates electricity production costs for variety of electricity generation technologies, including: pulverized coal, gas combustion turbine, gas combined cycle, nuclear, solar (PV and thermal), and wind. The model allows the user to quickly conduct sensitivity analysis on key variables, including: capital, O&M, and fuel costs; interest rates; construction time; heat rates; and capacity factors. The model also includes consideration of a wide range of externality costs and pollution control options for carbon dioxide, nitrogen oxides, sulfur dioxide, and mercury. Two different data sets are included in the model; one from the US. Department of Energy (DOE) and the other from Platt's Research Group. Likely users of this model include executives and staff in the Congress, the Administration and private industry (power plant builders, industrial electricity users and electric utilities). The model seeks to improve understanding of the economic viability of various generating technologies and their emissions trade-offs. The base case results, using the DOE data, indicate that in the absence of externality costs, or renewable tax credits, pulverized coal and gas combined cycle plants are the least cost alternatives at 3.7 and 3.5 cents/kwhr, respectively. A complete sensitivity analysis on fuel, capital, and construction time shows that these results coal and gas are much more sensitive to assumption about fuel prices than they are to capital costs or construction times. The results also show that making nuclear competitive with coal or gas requires significant reductions in capital costs, to the $1000/kW level, if no other changes are made. For renewables, the results indicate that wind is now competitive with the nuclear option and is only competitive with coal and gas for grid connected applications if one includes the federal production tax credit of 1.8cents/kwhr.




Electricity Generation Cost Simulation Model (GenSim).  

Science Conference Proceedings (OSTI)

The Electricity Generation Cost Simulation Model (GenSim) is a user-friendly, high-level dynamic simulation model that calculates electricity production costs for variety of electricity generation technologies, including: pulverized coal, gas combustion turbine, gas combined cycle, nuclear, solar (PV and thermal), and wind. The model allows the user to quickly conduct sensitivity analysis on key variables, including: capital, O&M, and fuel costs; interest rates; construction time; heat rates; and capacity factors. The model also includes consideration of a wide range of externality costs and pollution control options for carbon dioxide, nitrogen oxides, sulfur dioxide, and mercuty. Two different data sets are included in the model; one from the US. Department of Energy (DOE) and the other from Platt's Research Group. Likely users of this model include executives and staff in the Congress, the Administration and private industry (power plant builders, industrial electricity users and electric utilities). The model seeks to improve understanding of the economic viability of various generating technologies and their emissions trade-offs. The base case results, using the DOE data, indicate that in the absence of externality costs, or renewable tax credits, pulverized coal and gas combined cycle plants are the least cost alternatives at 3.7 and 3.5 cents/kwhr, respectively. A complete sensitivity analysis on fuel, capital, and construction time shows that these results coal and gas are much more sensitive to assumption about fuel prices than they are to capital costs or construction times. The results also show that making nuclear competitive with coal or gas requires significant reductions in capital costs, to the $1000/kW level, if no other changes are made. For renewables, the results indicate that wind is now competitive with the nuclear option and is only competitive with coal and gas for grid connected applications if one includes the federal production tax credit of 1.8cents/kwhr.

Kamery, William (Hobart and William Smith Colleges, Geneva, NY); Baker, Arnold Barry; Drennen, Thomas E.



Advancing Small Modular Reactors: How We're Supporting Next-Gen Nuclear  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Advancing Small Modular Reactors: How We're Supporting Next-Gen Advancing Small Modular Reactors: How We're Supporting Next-Gen Nuclear Energy Technology Advancing Small Modular Reactors: How We're Supporting Next-Gen Nuclear Energy Technology December 12, 2013 - 4:00pm Addthis The basics of small modular reactor technology explained. | Infographic by Sarah Gerrity, Energy Department. The basics of small modular reactor technology explained. | Infographic by Sarah Gerrity, Energy Department. Assistant Secretary Lyons Assistant Secretary Lyons Assistant Secretary for Nuclear Energy Nuclear energy continues to be an important part of America's diverse energy portfolio, and the Energy Department is committed to supporting a domestic nuclear industry.


Brig. Gen. Sandra Finan honored for commitment at NNSA | National Nuclear  

National Nuclear Security Administration (NNSA)

Sandra Finan honored for commitment at NNSA | National Nuclear Sandra Finan honored for commitment at NNSA | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Brig. Gen. Sandra Finan honored for commitment ... Brig. Gen. Sandra Finan honored for commitment at NNSA Posted By Office of Public Affairs A celebration was held yesterday to honor Brig. Gen. Sandra Finan, NNSA's

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


HigHligHts Fossil Energy Techline, "DOE Announces Restructured FutureGen  

NLE Websites -- All DOE Office Websites (Extended Search)

Announces Restructured FutureGen Announces Restructured FutureGen Approach to Demonstrate Carbon Capture and Storage Technology at Multiple Clean Coal Plants." On January 30, US Secretary of Energy Samuel W. Bodman announced a restructured approach to the FutureGen project, which involves the demonstration of carbon capture and storage (CCS) t e c h n o l o g y a t s e v e r a l commercial-scale Integrated Gasification Combined Cycle (IGCC) power plants. The US Department of Energy (DOE) said that the reorganized approach caps their financing at no more than the plant's CCS component, allowing for plants to be operational as early as 2015. Under this restructured approach, DOE believes that at least twice the amount of carbon dioxide


Department of Energy Takes Another Step Forward on FutureGen Project in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Takes Another Step Forward on FutureGen Takes Another Step Forward on FutureGen Project in Mattoon, Illinois Department of Energy Takes Another Step Forward on FutureGen Project in Mattoon, Illinois July 14, 2009 - 1:00pm Addthis Washington, D.C. - The Department of Energy today issued a National Environmental Policy Act (NEPA) Record of Decision to move forward toward the first commercial scale, fully integrated, carbon capture and sequestration project in the country. The Department's decision is based on careful consideration of the proposed project's potential environmental impacts, as well as the program goals and objectives. "The carbon capture and sequestration technologies planned for this flagship facility are vitally important to America and the world," said Energy Secretary Steven Chu. "This step forward demonstrates the


How Sweet It Is: Agrivida's Next-Gen Sugar Biofuel | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sweet It Is: Agrivida's Next-Gen Sugar Biofuel Sweet It Is: Agrivida's Next-Gen Sugar Biofuel How Sweet It Is: Agrivida's Next-Gen Sugar Biofuel December 8, 2011 - 3:03pm Addthis Agrivida's President and co-founder Mike Raab. His company is using ARPA-E funding to develop a new method for converting plant biomass into useful feedstock for the production of biofuels. | Photo courtesy of ARPA-E. Agrivida's President and co-founder Mike Raab. His company is using ARPA-E funding to develop a new method for converting plant biomass into useful feedstock for the production of biofuels. | Photo courtesy of ARPA-E. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs What does this project do? Innovative projects sponsored by ARPA-E are changing the way we produce and use energy.


Department of Energy Takes Another Step Forward on FutureGen Project in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Takes Another Step Forward on FutureGen Energy Takes Another Step Forward on FutureGen Project in Mattoon, IL Department of Energy Takes Another Step Forward on FutureGen Project in Mattoon, IL July 14, 2009 - 12:00am Addthis Washington, D.C. - The Department of Energy today issued a National Environmental Policy Act (NEPA) Record of Decision to move forward toward the first commercial scale, fully integrated, carbon capture and sequestration project in the country. The Department's decision is based on careful consideration of the proposed project's potential environmental impacts, as well as the program goals and objectives. "The carbon capture and sequestration technologies planned for this flagship facility are vitally important to America and the world," said Energy Secretary Steven Chu. "This step forward demonstrates the


FutureGen Technologies for Carbon Capture and Storage and Hydrogen and Electricity Production  

NLE Websites -- All DOE Office Websites (Extended Search)

FutureGen FutureGen Technologies for Carbon Capture and Storage and Hydrogen and Electricity Production Office of Fossil Energy U. S. Department of Energy Washington, DC June 2, 2003 Lowell Miller, Director, Office of Coal & Power Systems 24-Jun-03 Slide 2 Office of Fossil Energy Presentation Agenda * FE Hydrogen Program * FutureGen * Carbon Sequestration Leadership Forum (CSLF) 24-Jun-03 Slide 3 Office of Fossil Energy Key Drivers * Decreasing domestic supply will lead to increased imports from less stable regions * Conventional petroleum is finite; production will peak and irreversibly decline due to continually increasing demand * Improving environmental quality - Meeting air emission regulations - Greenhouse gas emissions 0 2 4 6 8 10 12 14 16 18 20 1970 1975 1980 1985 1990 1995 2000 2005


GenERRate: generating errors for use in grammatical error detection  

Science Conference Proceedings (OSTI)

This paper explores the issue of automatically generated ungrammatical data and its use in error detection, with a focus on the task of classifying a sentence as grammatical or ungrammatical. We present an error generation tool called GenERRate and show ...

Jennifer Foster; istein E. Andersen



"FutureGen 2.0 Project Draft Environmental Impact Statement Summary"  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SHEET SHEET Responsible Federal Agency: U.S. Department of Energy (DOE) Cooperating Agencies: None Title: Draft Environmental Impact Statement for the FutureGen 2.0 Project (DOE/EIS-0460D) Location: Morgan County, Illinois Contact: For further information about this Environmental Impact Statement, contact: For general information on the DOE process for implementing the National Environmental Policy Act,


"FutureGen 2.0 Project Final Environmental Impact Statement Summary"  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

COVER SHEET COVER SHEET Responsible Federal Agency: U.S. Department of Energy (DOE) Cooperating Agencies: None Title: Final Environmental Impact Statement for the FutureGen 2.0 Project (DOE/EIS-0460) Location: Morgan County, Illinois Contact: For further information about this Environmental Impact Statement, contact: For general information on the DOE process for implementing the National Environmental Policy Act,


FutureGen: Pathway to Near-Zero Emissions and Sustainable Energy  

DOE Green Energy (OSTI)

This presentation will highlight the U.S. Department of Energys (DOE) FutureGen project ? a $1 billion government-industry partnership to design, build, and operate a near-zero emissions coal-fueled power plant. The lead organization for the FutureGen initiative is the National Energy Technology Laboratory (NETL), a multi-purpose laboratory operated by the U.S. DOEs Office of Fossil Energy. NETL has a mission to conduct R&D from fundamental science to technology demonstration for resolving the environmental, supply, and reliability constraints of producing and using fossil energy resources. The commercial-scale FutureGen R&D facility is a pathway toward future fossil-energy power plants that will produce hydrogen and electricity while nearly eliminating emissions, including carbon dioxide. The 275-megawatt FutureGen plant will initiate operations around 2012 and employ advanced coal gasification technology integrated with combined cycle electricity generation, hydrogen production, and carbon capture and sequestration. Low carbon emissions would be achieved by integrating CO2 capture and sequestration operations with the power plant.

Zitney, S.E.; Sarkus, T.A



Solving the TTC 2011 Compiler Optimization Case with GrGen.NET  

E-Print Network (OSTI)

The challenge of the Compiler Optimization Case is to perform local optimizations and instruction selection on the graph-based intermediate representation of a compiler. The case is designed to compare participating tools regarding their performance. We tackle this task employing the general purpose graph rewrite system GrGen.NET (www.grgen.net).

Buchwald, Sebastian; 10.4204/EPTCS.74.7



Cryptometrion aestuescens gen. sp. nov. (Cryphonectriaceae) pathogenic to Eucalyptus in Indonesia  

E-Print Network (OSTI)

Cryptometrion aestuescens gen. sp. nov. (Cryphonectriaceae) pathogenic to Eucalyptus in Indonesia M, Indonesia. C Corresponding author. Email: Marieka.Gryzenhout@fabi.up.ac.za Abstract. The recently described on Eucalyptus. A recent investigation of dying Eucalyptus grandis clonal hedges in northern Sumatra, Indonesia


CBM-Gen+: An Algorithm for Reducing Case Base Inconsistencies in Hierarchical and Incomplete Domains  

E-Print Network (OSTI)

formulated case base maintenance (CBM) policies for reducing the size of the case base without losingCBM-Gen+: An Algorithm for Reducing Case Base Inconsistencies in Hierarchical and Incomplete Lehigh University Bethlehem, PA 18015,USA {kex2,hem4}@ lehigh.edu Abstract. We propose an algorithm, CBM

Muñoz-Avila, Héctor


Mercury: Next-gen Data Analysis and Annotation Pipeline (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

David Sexton (Baylor) gives a talk titled "Mercury: Next-gen Data Analysis and Annotation Pipeline" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Sexton, David (Baylor)



MHK Projects/SeaGen KyleRhea | Open Energy Information  

Open Energy Info (EERE)

SeaGen KyleRhea SeaGen KyleRhea < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":57.2359,"lon":-5.66055,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


MHK Projects/Homeowner Tidal Power Elec Gen | Open Energy Information  

Open Energy Info (EERE)

Homeowner Tidal Power Elec Gen Homeowner Tidal Power Elec Gen < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.4468,"lon":-69.6933,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


"FutureGen 2.0 Project Final Environmental Impact Statement Volume II"  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

APPENDIX F APPENDIX F Cultural Surveys F1 - Phase I - Site Characterization Locale Survey F2 - Phase I - Meredosia Energy Center Survey F3 - Phase I - Bluff Area Pipeline Right-of-Way Segment Survey F4 - Phase I - Soil Gas Monitoring Locations Survey for the Final Environmental Impact Statement FutureGen 2.0 Project Meredosia, Illinois (Morgan County) Note: This appendix was updated for the Final EIS.


Development of an Enhanced GenVARR (Generator Volt Ampere Reactive Reserve) System  

SciTech Connect

Transmission system operators require near real time knowledge of reactive power capability to reliably operate large electric power transmission systems. Reactive power produced by, or capable of being produced by, a power generator is often estimated based on a series of mega volt amperes (MVA) capability curves for the generator. These curves indicate the ability of the generator to produce real and reactive power under a variety of conditions. In transmission planning and operating studies, it is often assumed, based on estimates for these capability curves, that the generator can provide its rated MVA capability output when needed for system stability However, generators may not always operate at levels depicted by the maximum MVA capability curve due to present constraints. Transmission system operators utilizing the generators capability curves for operation decisions regarding transmission system stability or for planning horizons may overestimate the capability of the generators to supply reactive power when required. Southern Company has enhanced GenVARR(TM), the system of plant data query, retrieval, and analysis and calculates the actual not estimated -- remaining reactive power output capability. The remaining reactive output is considered spinning reserve and is displayed graphically to transmission control center and generating plant operators to identify real time VAR limits. GenVARR is capable of aggregating generators from a defined region, or other user selectable combinations, to represent the available reserves that the operators are specifically interested in. GenVARR(TM) has been put into live production operation and is expected to significantly improve the overall visibility of the reactive reserve capability of the system. This new version of GenVARR(TM) significantly enhances the products structure and performance, and enables links to other key transmission system operation tools.

Schatz, Joe E.



FibreGen plc formerly Libra Natural Resources plc | Open Energy Information  

Open Energy Info (EERE)

FibreGen plc formerly Libra Natural Resources plc FibreGen plc formerly Libra Natural Resources plc Jump to: navigation, search Name FibreGen plc (formerly Libra Natural Resources plc) Place London, Greater London, United Kingdom Zip EC2V 5DE Sector Biomass Product Set up to establish, invest in or acquire assets, businesses or companies involved in the natural resources sector, particularly in biomass and waste-to-energy, in Europe and North America. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FutureGen: Stepping-Stone to Sustainable Fossil-Fuel Power Generation  

SciTech Connect

This presentation will highlight the U.S. Department of Energy's FutureGen Initiative. The nearly $1 billion government-industry project is a stepping-stone toward future coal-fired power plants that will produce hydrogen and electricity with zero-emissions, including carbon dioxide. The 275-megawatt FutureGen plant will initiate operations around 2012 and employ advanced coal gasification technology integrated with combined cycle electricity generation, hydrogen production, and carbon capture and sequestration. The initiative is a response to a presidential directive to develop a hydrogen economy by drawing upon the best scientific research to address the issue of global climate change. The FutureGen plant will be based on cutting-edge power generation technology as well as advanced carbon capture and sequestration systems. The centerpiece of the project will be coal gasification technology that can eliminate common air pollutants such as sulfur dioxide and nitrogen oxides and convert them to useable by-products. Gasification will convert coal into a highly enriched hydrogen gas, which can be burned much more cleanly than directly burning the coal itself. Alternatively, the hydrogen can be used in a fuel cell to produce ultra-clean electricity, or fed to a refinery to help upgrade petroleum products. Carbon sequestration will also be a key feature that will set the Futuregen plant apart from other electric power plant projects. The initial goal will be to capture 90 percent of the plant's carbon dioxide, but capture of nearly 100 percent may be possible with advanced technologies. Once captured, the carbon dioxide will be injected as a compressed fluid deep underground, perhaps into saline reservoirs. It could even be injected into oil or gas reservoirs, or into unmineable coal seams, to enhance petroleum or coalbed methane recovery. The ultimate goal for the FutureGen plant is to show how new technology can eliminate environmental concerns over the future use of coal--the most abundant fossil fuel in the United States with supplies projected to last 250 years. FutureGen's co-production of power and hydrogen will also serve as a stepping-stone to an environmentally sustainable energy future.

Zitney, S.E.



Microsoft PowerPoint - Romanosky  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fossil Energy's HBCU Research Activities Fossil Energy's HBCU Research Activities Robert R. Romanosky, Advanced Research Technology Manager Washington DC July 09, 2009 2 * Innovations for Existing Plants * Gasification * Turbines * Fuel Cells * Sequestration * Fuels * Advanced Research Strategic Center for Coal Program 3 Fossil Energy Program Outline Basic Research Applied Research Process & Engineering Development Demonstration & Commercialization I n d u s t r y P a r t i c i p a t i o n & C o s t S h a r i n g I n c r e a s e s CCPI, PPII, CCT Demos FutureGen Fossil Energy Core Programs (e.g Gasification, Turbines) Office of Science Research Fossil Energy Advanced Research Public Benefits DOE Research Programs NETL's Energy RD&D Portfolio 4 Ultra-Clean Energy Plant CO2 S eq uestration O x y ge n M e m b ra n e Ele c tric ity Pr o c es s H e a t/ Ste a m P OWE R FU EL S

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tri-Generation Success Story: World's First Tri-Gen Energy Station - Fountain Valley  

NLE Websites -- All DOE Office Websites (Extended Search)

Tri-Generation Success Tri-Generation Success Story World's First Tri-Gen Energy Station- Fountain Valley The Fountain Valley energy station, supported in part by a $2.2 million grant from the Energy Department, is the world's first tri-generation hydrogen energy and electrical power station to provide transportation fuel to the public and electric power to an industrial facility. Located at the Orange County Sanitation District's wastewater treatment plant in Fountain Valley, California, the unit is a combined heat, hydrogen, and power (CHHP) system that co-produces hydrogen in addition to electricity and heat, making it a tri-generation system. The hydrogen produced by the system


Gen IV Materials Handbook Functionalities and Operation (4A) Handbook Version 4.0  

SciTech Connect

This document is prepared for navigation and operation of the Gen IV Materials Handbook, with architecture description and new user access initiation instructions. Development rationale and history of the Handbook is summarized. The major development aspects, architecture, and design principles of the Handbook are briefly introduced to provide an overview of its past evolution and future prospects. Detailed instructions are given with examples for navigating the constructed Handbook components and using the main functionalities. Procedures are provided in a step-by-step fashion for Data Upload Managers to upload reports and data files, as well as for new users to initiate Handbook access.

Ren, Weiju [ORNL] [ORNL



Gen IV Materials Handbook Functionalities and Operation (2B) Handbook Version 2.0  

Science Conference Proceedings (OSTI)

This document is prepared for navigation and operation of the Gen IV Materials Handbook, with architecture description and new user access initiation instructions. Development rationale and history of the Handbook is summarized. The major development aspects, architecture, and design principles of the Handbook are briefly introduced to provide an overview of its past evolution and future prospects. Detailed instructions are given with examples for navigating the constructed Handbook components and using the main functionalities. Procedures are provided in a step-by-step fashion for Data Upload Managers to upload reports and data files, as well as for new users to initiate Handbook access.

Ren, Weiju [ORNL



Advanced Technology Development Program for Lithium-Ion Batteries: Gen 2 Performance Evaluation Final Report  

Science Conference Proceedings (OSTI)

The Advanced Technology Development Program has completed performance testing of the second generation of lithium-ion cells (i.e., Gen 2 cells). The 18650-size Gen 2 cells, with a baseline and variant chemistry, were distributed over a matrix consisting of three states-of-charge (SOCs) (60, 80, and 100% SOC), four temperatures (25, 35, 45, and 55C), and three life tests (calendar-, cycle-, and accelerated-life). The calendar- and accelerated-life cells were clamped at an open-circuit voltage corresponding to the designated SOC and were subjected to a once-per-day pulse profile. The cycle-life cells were continuously pulsed using a profile that was centered around 60% SOC. Life testing was interrupted every four weeks for reference performance tests (RPTs), which were used to quantify changes in cell degradation as a function of aging. The RPTs generally consisted of C1/1 and C1/25 static capacity tests, a low-current hybrid pulse power characterization test, and electrochemical impedance spectroscopy. The rate of cell degradation generally increased with increasing test temperature, and SOC. It was also usually slowest for the calendar-life cells and fastest for the accelerated-life cells. Detailed capacity-, power-, and impedance-based performance results are reported.

Jon P. Christophersen; Ira Bloom; Edward V. Thomas; Kevin L. Gering; Gary L. Henriksen; Vincent S. Battaglia; David Howell



arXiv:submit/0451583[physics.gen-ph]8Apr2012 Including Nuclear Degrees of Freedom in a Lattice  

E-Print Network (OSTI)

arXiv:submit/0451583[physics.gen-ph]8Apr2012 Including Nuclear Degrees of Freedom in a Lattice and Engineering, University of Engineering and Technology. Lahore, Pakistan Abstract. Motivated by many condensed matter and nuclear systems are described initially on the same footing. Since it may be possible

Williams, Brian C.


Department of Energy Takes Another Step Forward on FutureGen Project in  

NLE Websites -- All DOE Office Websites (Extended Search)

July 14, 2009 July 14, 2009 Department of Energy Takes Another Step Forward on FutureGen Project in Mattoon, IL Record of Decision Issued for First US Commercial Scale Carbon Capture and Storage Project Washington, D.C. - The Department of Energy today issued a National Environmental Policy Act (NEPA) Record of Decision to move forward toward the first commercial scale, fully integrated, carbon capture and sequestration project in the country. The Department's decision is based on careful consideration of the proposed project's potential environmental impacts, as well as the program goals and objectives. MORE INFO Read the full Record of Decision. "The carbon capture and sequestration technologies planned for this flagship facility are vitally important to America and the world," said


NewGen Technologies Inc Formerly Bongiovi Entertainment Inc | Open Energy  

Open Energy Info (EERE)

Technologies Inc Formerly Bongiovi Entertainment Inc Technologies Inc Formerly Bongiovi Entertainment Inc Jump to: navigation, search Name NewGen Technologies Inc (Formerly Bongiovi Entertainment Inc) Place Charlotte, North Carolina Zip 28210 Product The company is allegedly focused on providing advanced fuels. Coordinates 35.2225°, -80.837539° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.2225,"lon":-80.837539,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE Joint Genome Institute: Advancing Next Gen Biofuels by Turning Up the  

NLE Websites -- All DOE Office Websites (Extended Search)

October 2, 2011 October 2, 2011 Advancing Next Gen Biofuels by Turning Up the Heat on Biomass Pretreatment Processes WALNUT CREEK, Calif.-The nation's Renewable Fuels Standard calls for annual production of 36 billion gallons of biofuel by 2022. One of the biggest hurdles to achieving this goal lies in optimizing the multistep process involved in breaking down plant biomass and then converting it into fermentable sugars that can be refined into fuel for our transportation needs. To overcome this challenge, the U.S. Department of Energy supports several projects focused on identifying enzymes from fungi and microbes such as cellulases-that breakdown plant cell walls-and heat-tolerant industrial-strength host cell systems to drive these reactions. Photo: The thermophilic fungus M. thermophila


Argonne, Evigia finalize licensing agreement for next-gen RFID sensor  

NLE Websites -- All DOE Office Websites (Extended Search)

See related See related New RFID technology tracks and monitors nuclear materials Argonne, Evigia finalize licensing agreement for next-gen RFID sensor technology By Angela Hardin * July 16, 2012 Tweet EmailPrint System enables monitoring, tracking and securing of nuclear material ANN ARBOR, Mich. and ARGONNE, Ill. (July 16, 2012)-Evigia Systems and the U.S. Department of Energy's (DOE) Argonne National Laboratory announced today that they have finalized a licensing agreement under which Argonne's patented, application-specific radio-frequency identification (RFID) sensor/seal technology and its custom-developed ARG-US software suite will be further developed and marketed by Evigia as a comprehensive nuclear and hazardous material handling solution. The system, jointly developed by Evigia and Argonne, adds sophisticated


Follow medical processes in the human body, study safe hydro-gen storage in complex metal structures for car design, follow  

E-Print Network (OSTI)

Follow medical processes in the human body, study safe hydro- gen storage in complex metal structures for car design, follow the phase transition of foodstuff to improve their taste, detect plastic


Emergency Decay Heat Removal in a GEN-IV Gas-Cooled Fast Reactor  

Science Conference Proceedings (OSTI)

A series of transient analyses using the system code RELAP5-3d has been performed to confirm the efficacy of a proposed hybrid active/passive combination approach to the decay heat removal for an advanced 2400 MWt GEN-IV gas-cooled fast reactor. The accident sequence of interest is a station blackout simultaneous with a small break (10 sq.inch/0.645 m{sup 2}) in the reactor vessel. The analyses cover the three phases of decay heat removal in a depressurization accident: (1) forced flow cooling by the power conversion unit (PCU) coast down, (2) active forced flow cooling by a battery powered blower, and (3) passive cooling by natural circulation. The blower is part of an emergency cooling system (ECS) that by design is to sustain passive decay heat removal via natural circulation cooling 24 hours after shutdown. The RELAP5 model includes the helium-cooled reactor, the ECS (primary and secondary side), the PCU with all the rotating machinery (turbine and compressors) and the heat transfer components (recuperator, pre-cooler and inter-cooler), and the guard containment that surrounds the reactor and the PCU. The transient analysis has demonstrated the effectiveness of passive decay heat removal by natural circulation cooling when the guard containment pressure is maintained at or above 800 kPa. (authors)

Cheng, Lap Y.; Ludewig, Hans; Jo, Jae [Brookhaven National Laboratory, P.O. Box 5000, Upton, NY 11973-5000 (United States)



Progress reports for Gen IV sodium fast reactor activities FY 2007.  

SciTech Connect

An important goal of the US DOE Sodium Fast Reactor (SFR) program is to develop the technology necessary to increase safety margins in future fast reactor systems. Although no decision has been made yet about who will build the next demonstration fast reactor, it seems likely that the construction team will include a combination of international companies, and the safety design philosophy for the reactor will reflect a consensus of the participating countries. A significant amount of experience in the design and safety analysis of Sodium Fast Reactors (SFR) using oxide fuel has been developed in both Japan and France during last few decades. In the US, the traditional approach to reactor safety is based on the principle of defense-in-depth, which is usually expressed in physical terms as multiple barriers to release of radioactive material (e.g. cladding, reactor vessel, containment building), but it is understood that the 'barriers' may consist of active systems or even procedures. As implemented in a reactor design, defense-in-depth is classed in levels of safety. Level 1 includes measures to specify and build a reliable design with significant safety margins that will perform according to the intentions of the designers. Level 2 consists of additional design measures, usually active systems, to protect against unlikely accidental events that may occur during the life of the plant. Level 3 design measures are intended to protect the public in the event of an extremely unlikely accident not foreseen to occur during the plant's life. All of the design measures that make up the first three levels of safety are within the design basis of the plant. Beyond Level 3, and beyond the normal design basis, there are accidents that are not expected to occur in a whole generation of plants, and it is in this class that severe accidents, i.e. accidents involving core melting, are included. Beyond design basis measures to address severe accidents are usually identified as being for prevention of progression into severe accident conditions (prevention of core melting) or for mitigation of severe accident consequences (mitigation of the impact of core melting to protect public health and safety). Because design measures for severe accident prevention and mitigation are beyond the normal design basis, established regulatory guidelines and codes do not provide explicit identification of the design performance requirements for severe accident accommodation. The treatment of severe accidents is one of the key issues of R&D plans for the Gen IV systems in general, and for the Sodium Fast Reactor (SFR) in particular. Despite the lack of an unambiguous definition of safety approach applicable for severe accidents, there is an emerging consensus on the need for their consideration for the design. The US SFR program and Argonne National Laboratory (ANL) in particular have actively studied the potential scenarios and consequences of Hypothetical Core Disruptive Accidents (HCDA) for SFRs with oxide fuel during the Fast Flux Test Facility (FFTF) and Clinch River Breeder Reactor Plant (CRBRP) programs in the 70s and 80s. Later, the focus of the US SFR safety R&D activities shifted to the prevention of all HCDAs through passive safety features of the SFRs with metal fuel in the Integral Fast Reactor (IFR) program, and the study of severe accident consequences was de-emphasized. The goal of this paper is to provide an overview of the current SFR safety approach and the role of severe accidents in Japan and France, in preparation for an expected and more active collaboration in this area between the US, Japan, and France.

Cahalan, J. E.; Tentner, A. M.; Nuclear Engineering Division



Third-Party Evaluation of Petro Tex Hydrocarbons, LLC, ReGen Lubricating Oil Re-refining Process  

DOE Green Energy (OSTI)

This report presents an assessment of market, energy impact, and utility of the PetroTex Hydrocarbons, LLC., ReGen process for re-refining used lubricating oil to produce Group I, II, and III base oils, diesel fuel, and asphalt. PetroTex Hydrocarbons, LLC., has performed extensive pilot scale evaluations, computer simulations, and market studies of this process and is presently evaluating construction of a 23 million gallon per year industrial-scale plant. PetroTex has obtained a 30 acre site in the Texas Industries RailPark in Midlothian Texas. The environmental and civil engineering assessments of the site are completed, and the company has been granted a special use permit from the City of Midlothian and air emissions permits for the Texas Commission on Environmental Quality.

Compere, A L [ORNL; Griffith, William {Bill} L [ORNL



Evaluating the Suitability for CO2 Storage at the FutureGen 2.0 Site, Morgan County, Illinois, USA  

SciTech Connect

FutureGen 2.0 site will be the first near-zero emission power plant with fully integrated long-term storage in a deep, non-potable saline aquifer in the United States. The proposed FutureGen 2.0 CO2 storage site is located in northeast Morgan County, Illinois, U.S.A., forty-eight kilometres from the Meredosia Energy Center where a large-scale oxy-combustion demonstration will be conducted. The demonstration will involve > 90% carbon capture, which will produce more than one million metric tons (MMT) of CO2 per year. The CO2 will be compressed at the power plant and transported via pipeline to the storage site. To examine CO2 storage potential of the site, a 1,467m characterization well (FGA#1) was completed in December 2011. The target reservoir for CO2 storage is the Mt. Simon Sandstone and Elmhurst Sandstone Member of the lower Eau Claire Formation for a combined thickness of 176 m. Confining beds of the overlying Lombard and Proviso Members (upper Eau Claire Formation) reach a thickness of 126 m. Characterization of the target injection zone and the overlying confining zone was based on wellbore data, cores, and geophysical logs, along with surface geophysical (2-D seismic profiles, magnetic and gravity), and structural data collected during the initial stage of the project . Based on this geological model, 3D simulations of CO2 injection and redistribution were conducted using STOMP-CO2, a multiphase flow and transport simulator. After this characterization stage, it appears that the injection site is a suitable geologic system for CO2 sequestration and that the injection zone is sufficient to receive up to 33 MMT of CO2 at a rate of 1.1 MMT/yr. GHGT-11 conference

Bonneville, Alain HR; Gilmore, Tyler J.; Sullivan, E. C.; Vermeul, Vincent R.; Kelley, Mark E.; White, Signe K.; Appriou, Delphine; Bjornstad, Bruce N.; Gerst, Jacqueline L.; Gupta, Neeraj; Horner, Jacob A.; McNeil, Caitlin; Moody, Mark A.; Rike, William M.; Spane, Frank A.; Thorne, Paul D.; Zeller, Evan R.; Zhang, Z. F.; Hoffman, Jeffrey; Humphreys, Kenneth K.




NLE Websites -- All DOE Office Websites (Extended Search)

XXXXE XXXXE A validation of a ray-tracing tool used to generate bi-directional scattering distribution functions for complex fenestration systems A. McNeil Lawrence Berkeley National Laboratory J.C. Jonsson Lawrence Berkeley National Laboratory D. Appelfeld Technical University of Denmark G. Ward Anyhere Software E.S. Lee Lawrence Berkeley National Laboratory Windows and Envelope Materials Group Building Technology and Urban Systems Department Environmental Energy Technologies Division November 2013 Published in Solar Energy 98 (2013): 404-414 DOI: 10.1016/j.solener.2013.09.032 DISCLAIMER This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the


Hua-Gen Yu  

NLE Websites -- All DOE Office Websites (Extended Search)

as the one-dimensional (1D) potential-optimized discrete variable representation (PO-DVR) approach. The ZDVR method provides exponential convergence and accurate energies. It...


FutureGen Update  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Technology Laboratory * Only DOE national lab dedicated to fossil energy - Fossil fuels provide 85% of U.S. energy supply * One lab, five locations, one management...


FutureGen Technologies  

NLE Websites -- All DOE Office Websites (Extended Search)

a transportation fuel. The main challenge is to use coal - the nation's most abundant fossil fuel - cost-effectively in ways that produce essentially zero emissions, which...


The ICT SCRM CoMMunITy FRaMewoRk DevelopMenT ...  

Science Conference Proceedings (OSTI)

... work, Toward a Cyber-Supply Chain Code of Practice (March 2011), we ... a proliferation and fragmentation of industry best practices and standards ...



Underground Injection Control Permit Applications for FutureGen 2.0 Morgan County Class VI UIC Wells 1, 2, 3, and 4  

NLE Websites -- All DOE Office Websites (Extended Search)

FG-RPT-017 FG-RPT-017 Revision 1 Underground Injection Control Permit Applications for FutureGen 2.0 Morgan County Class VI UIC Wells 1, 2, 3, and 4 SUPPORTING DOCUMENTATION March 2013 (Revised May 2013 in accordance with the U.S. Environmental Protection Agency's Completeness Review) Acknowledgment: This material is based upon work supported by the Department of Energy under Award Number DE-FE0001882. Disclaimer: This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The history of NATO TNF policy: The role of studies, analysis and exercises conference proceedings. Volume 3: Papers by Gen. Robert C. Richardson III (Ret.)  

Science Conference Proceedings (OSTI)

This conference was organized to study and analyze the role of simulation, analysis, modeling, and exercises in the history of NATO policy. The premise was not that the results of past studies will apply to future policy, but rather that understanding what influenced the decision process-and how-would be of value. The structure of the conference was built around discussion panels. The panels were augmented by a series of papers and presentations focusing on particular TNF events, issues, studies, or exercises. The conference proceedings consist of three volumes. Volume 1 contains the conference introduction, agenda, biographical sketches of principal participants, and analytical summary of the presentations and discussion panels. Volume 2 contains a short introduction and the papers and presentations from the conference. This volume contains selected papers by Brig. Gen. Robert C. Richardson III (Ret.).

Rinne, R.L. [ed.



Air-Cooled Stack Freeze Tolerance Freeze Failure Modes and Freeze Tolerance Strategies for GenDriveTM Material Handling Application Systems and Stacks Final Scientific Report  

Science Conference Proceedings (OSTI)

Air-cooled stack technology offers the potential for a simpler system architecture (versus liquid-cooled) for applications below 4 kilowatts. The combined cooling and cathode air allows for a reduction in part count and hence a lower cost solution. However, efficient heat rejection challenges escalate as power and ambient temperature increase. For applications in ambient temperatures below freezing, the air-cooled approach has additional challenges associated with not overcooling the fuel cell stack. The focus of this project was freeze tolerance while maintaining all other stack and system requirements. Through this project, Plug Power advanced the state of the art in technology for air-cooled PEM fuel cell stacks and related GenDrive material handling application fuel cell systems. This was accomplished through a collaborative work plan to improve freeze tolerance and mitigate freeze-thaw effect failure modes within innovative material handling equipment fuel cell systems designed for use in freezer forklift applications. Freeze tolerance remains an area where additional research and understanding can help fuel cells to become commercially viable. This project evaluated both stack level and system level solutions to improve fuel cell stack freeze tolerance. At this time, the most cost effective solutions are at the system level. The freeze mitigation strategies developed over the course of this project could be used to drive fuel cell commercialization. The fuel cell system studied in this project was Plug Power's commercially available GenDrive platform providing battery replacement for equipment in the material handling industry. The fuel cell stacks were Ballard's commercially available FCvelocity 9SSL (9SSL) liquid-cooled PEM fuel cell stack and FCvelocity 1020ACS (Mk1020) air-cooled PEM fuel cell stack.

Hancock, David, W.



Thermosyntropha lipolytica gen. nov., sp. nov., a lipolytic, anaerobic, alkalitolerant, thermophilic bacterium utilizing short- and long-chain fatty acids in syntrophic coculture with a methanogenic archaeum  

Science Conference Proceedings (OSTI)

Three strains of an anaerobic thermophilic organoheterotrophic lipolytic alkalitolerant bacterium, Thermosyntropha lipolytica gen. nov., sp. nov. (type strain JW/VS-264{sup T}; DSM 11003) were isolated from alkaline hot springs of Lake Bogoria (Kenya). The cells were nonmotile, non-spore forming, straight or slightly curved rods. At 60{degrees}C, the pH range for growth determined at 25{degrees}C [pH{sup 25{degrees}C}] was 7.15 to 9.5, with an optimum between 8.1 and 8.9 (pH{sup 60{degrees}C} of 7.6 and 8.1). At a pH{sup 25{degrees}C} of 8.5 temperature range for growth was from 52 to 70{degrees}C, with an optimum between 60 and 66{degrees}C. The shortest doubling time was around 1 h. In pure culture the bacterium grew in a mineral base medium supplemented with yeast extract, tryptone, Casamino Acids, betaine, and crotonate as carbon sources, producing acetate as a major product and constitutively a lipase. During growth in the presence of olive oil, free long-chain fatty acids were accumulated in the medium but the pure culture syntrophic coculture (Methanobacterium strain JW/VS-M29) the lipolytic bacteria grew on triacylglycerols and linear saturated and unsaturated fatty acids with 4 to 18 carbon atoms, but glycerol was not utilized. Fatty acids with even numbers of carbon atoms were degraded to acetate and methane, while from odd-numbered fatty acids 1 mol of propionate per mol of fatty acid was additionally formed. 16S rDNA sequence analysis identified Syntrophospora and Syntrophomonas spp. as closest phylogenetic neighbors.

Svetlitshnyi, V.; Wiegel, J. [Univ. of Georgia, Athens, GA (United States); Rainey, F. [German Collection of Microorganisms and Cell Cultures, Braunschweig (Germany)



GenII Gap Analysis  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GENII-Gap Analysis GENII-Gap Analysis Defense Nuclear Facilities Safety Board Recommendation 2002-1 Software Quality Assurance Improvement Plan Commitment Software Quality Assurance Improvement Plan: GENII Gap Analysis Final Report U.S. Department of Energy Office of Environment, Safety, and Health 1000 Independence Ave., S.W. Washington, DC 20585-2040 May 2004 GENII Gap Analysis May 2004 Final Report INTENTIONALLY BLANK ii GENII Gap Analysis May 2004 Final Report FOREWORD This document provides an evaluation of the Software Quality Assurance (SQA) attributes of GENII, a radiological dispersion computer code, relative to established requirements. This evaluation, a "gap analysis", is performed to meet commitment of the Department of



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

gasification plant and the receiving geologic formation. Sequester at least 90 percent of CO2 emissions from the plant with the future potential to capture and sequester nearly 100...


The Combinatory Morphemic Lexicon Cem Bozsahin  

E-Print Network (OSTI)

with the morphological bracketings in (1b­2b). HHH (1) a. HH hydro electric -ity b. HHH hydro HH electric -ity HHH (2) a¸s-ti c. Adam-in araba ve ev]-i man-GEN car and house-POSS 'the man's house and car' d. Araba-yi adam ve ¸cocuk]-lar-a g¨oster-di-m Car-ACC man and child-PLU-DAT show-TENSE-PERS1 '(I) showed the car to the men

Bozsahin, Cem


c 2002 Association for Computational Linguistics The Combinatory Morphemic Lexicon  

E-Print Network (OSTI)

with the morphological bracketings in (1b­2b). (1) a. hydro electric -ity b. hydro electric -ity (2) a. G¨odel number-in [araba ve ev]-i man-GEN car and house-POSS 'the man's house and car' d. Araba-yi [adam ve ¸cocuk]-lar-a g¨oster-di-m Car-ACC man and child-PLU-DAT show-TENSE-PERS1 '(I) showed the car to the men and the children.' e


William M. Hoge Abrams, Gen. Creighton: 155,  

E-Print Network (OSTI)

, 236, 240-241 Atchafalaya floodway: 58, 59 Atomic bombs: 160 Attu Island: 162 Australian troops: 174 B: 162 E Education of officers: 31-32, 43-47 Efficiency reports: 231-232 Eisenhower, General of the Army

US Army Corps of Engineers


New Materials for NGNP/Gen IV  

SciTech Connect

The bounding conditions were briefly summarized for the Next Generation Nuclear Plant (NGNP) that is the leading candidate in the Department of Energy Generation IV reactor program. Metallic materials essential to the successful development and proof of concept for the NGNP were identified. The literature bearing on the materials technology for high-temperature gas-cooled reactors was reviewed with emphasis on the needs identified for the NGNP. Several materials were identified for a more thorough study of their databases and behavioral features relative to the requirements ASME Boiler and Pressure Vessel Code, Section III, Division 1, Subsection NH.

Robert W. Swindeman; Douglas L. Marriott



Introduction of Micro-gen in Japan  

Science Conference Proceedings (OSTI)

... Residential CHPs in Japan PEFC: Polymer Electrolyte Fuel Cell, SOFC: Solid Oxide Fuel Cell Page 8. 8 ... Energy Companies ?Market Research ...




NLE Websites -- All DOE Office Websites (Extended Search)

Develop and Use Technical Work Documents Procedure Manager BENDURE, ALBERT O. Status Active Subject Matter Expert Heidi M. Herrera Aden C. Jackson-CA Contact Applicability,...


SUSTaINabIlITy PERfORmaNcE ScOREcaRd 1. Reported per 200,000 employee hours worked.  

E-Print Network (OSTI)

30% from 2003-2015 (Target: 143 kBtu/ft2 ) · At least 7.5% of electricity use from renewable sources by 2013 and thereafter · Reduce petroleum-based fuel use in fleet vehicles 20% from 2005-2015 (Target: 31


Using the WWW as the delivery mechanism for interactive, visulaization-based instructional modules: report of the ITiCSE '97 working group on visualization  

Science Conference Proceedings (OSTI)

Visualization has long been an important pedagogical tool in CS education. The widespread use of the Web and the introduction of Java, with its ability to present interactive animated applets and other types of animation, all provide opportunities to ...

Thomas Naps; Joseph Bergin; Ricardo Jimnez-Peris; Myles F. McNally; Marta Patio-Martnez; Viera K. Proulx; Jorma Tarhio



Failure Analysis of a 345 kV High-Pressure, Fluid-Filled Cable Insulated with Laminated Paper Polypropylene at New York Power Author ity  

Science Conference Proceedings (OSTI)

Three cable pieces of a 345-kV high-pressure, fluid-filled, laminated paper151polypropylene (LPP) cable, each nearly 3 ft in length, were received from New York Power Authority in January 2010. The Detroit Edison Company performed the dissection and analysis to address the cause(s) of the failure that occurred in late December 2009 and that was experienced by this 10.1 circuit-mile cable that had been energized in service in May 1991. One of the pieces contained the failure, and the other two were adjace...



An nual En ergy Re view 2001  

Gasoline and Diesel Fuel Update (EIA)

An nual En ergy Re view 2001 An nual En ergy Re view 2001 The An nual En ergy Re view (AER) pres ents the En ergy In for ma tion Ad min - is tra tion's his tor i cal en ergy sta tis tics. For many se ries, sta tis tics are given for ev ery year from 1949 through 2001. The sta tis tics, ex pressed in ei ther phys i cal units or Brit ish ther mal units, cover all ma jor en ergy ac tiv i ties, in - clud ing con sump tion, pro duc tion, trade, stocks, and prices, for all ma jor en - ergy com mod i ties, in clud ing fos sil fu els, elec tric ity, and re new able en ergy sources. Pub li ca tion of this re port is re quired un der Pub lic Law 95-91 (De part ment of En ergy Or ga ni za tion Act), Sec tion 205(c), and is in keep ing with re spon - si bil i ties given to the En ergy In for ma tion Ad min is tra tion un der Sec tion



NLE Websites -- All DOE Office Websites (Extended Search)

DOE News Release, "President Requests $863 Million for Fossil Energy Programs: FY2008 Fossil DOE News Release, "President Requests $863 Million for Fossil Energy Programs: FY2008 Fossil Budget Request One of Largest Since Taking Office." President Bush's Fiscal Year (FY) 2008 budget for the Office of Fossil Energy totals $863 million, a 33 percent increase over last year's budget. The proposal focuses on early initiation of an expansion of the Strategic Petroleum Reserve to 1.5 billion barrels by 2027; accelerating the development of carbon sequestration technologies to manage and virtually eliminate emis- sions of the greenhouse gas carbon dioxide from fossil fuel use in power generation and other industrial activ- ity; and moving forward with the design and early work on the FutureGen Initiative. Funding for the FutureGen Initiative will increase two-


Gen IV public comments-G Vine.PDF  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Generation IV Goals and Roadmap Generation IV Goals and Roadmap Public meeting, Thursday, Nov. 16, 2000 JW Marriott, Washington DC Gary Vine, EPRI I'd like to cite two regulatory landmarks established during the U.S. DOE/Industry ALWR Program, 1983-98, the intent of which should be incorporated into the goal setting for all future reactors. These are followed by four specific comments on the Generation IV goals. A. ALWR goals are Industry goals, and must be kept distinct from regulatory requirements. The ALWR Program was very careful to maintain and preserve clear separation between regulatory requirements and industry goals, as expressed in the EPRI ALWR Utility Requirements Document. The industry needed to decide how to comply with regulations in the most cost-effective way, and needed to strategically design-in the extra margins needed for investment protection, operational


EcoGen Projects Ltd | Open Energy Information  

Open Energy Info (EERE)

Projects Ltd Projects Ltd Place Machynlleth, United Kingdom Zip SY20 8WE Sector Renewable Energy, Solar, Wind energy Product Renewable energy project developer involved in wind and solar. Coordinates 52.59096°, -3.846723° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.59096,"lon":-3.846723,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


February 2013 Edition GenCen News and Events  

E-Print Network (OSTI)

www.arts.canterbury.ac.nz/internships Project Title: Fracking in Canterbury? Bachelor of Arts: Joanna Goven Project Reference Number: S212/Fracking/22/NP Application Deadline: 2 July NOON Project Description: Fracking is the term given to the hydraulic fracturing of rock to extract natural gas


Draft Environmental Impact Statement for FutureGen Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE/EIS-0394D FUTUREGEN PROJECT EIS DOE/EIS-0394D FUTUREGEN PROJECT EIS DRAFT TABLE OF CONTENTS MAY 2007 i TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................................................................ i LIST OF ACRONYMS ................................................................................... LIST OF ACRONYMS - 1 VOLUME I 1. PURPOSE AND NEED FOR AGENCY ACTION ......................................................................1-1 1.1 INTRODUCTION......................................................................................................................1-1 1.2 PROPOSED ACTION ...............................................................................................................1-1 1.3 PURPOSE AND NEED FOR AGENCY ACTION...................................................................1-2

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Gen_Atomics  

Office of Legacy Management (LM)

General Atomics Hot Cell Facility, California, Site General Atomics Hot Cell Facility, California, Site This Site All Sites All LM Quick Search Key Documents and Links All documents are Adobe Acrobat files. pdf_icon Key Documents General Atomics Hot Cell Facility, California, Site Fact Sheet Please be green. Do not print these documents unless absolutely necessary. Request a paper copy of any document by submitting a Document Request. All Site Documents All documents are Adobe Acrobat files. pdf_icon Fact Sheet Environmental Assessment Other Documents Fact Sheet General Atomics Hot Cell Facility, California, Site Fact Sheet December 12, 2011 Environmental Assessment Final Environmental Assessment for Decontaminating and Decommissioning the General Atomics Hot Cell Facility DOE/EA-1053 August 1995 Other Documents


Final Environmental Impact Statement for the FutureGen Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RISK ASSESSMENT REPORT RISK ASSESSMENT REPORT REVISED OCTOBER 2007 5-2 Figure 5-1. Role of the Analog Site Database and Ancillary Databases in the Approach for Conducting the Risk Assessment FINAL RISK ASSESSMENT REPORT REVISED OCTOBER 2007 5-100 Figure 5-6. Area Within Which H 2 S Released from CO 2 Injection Wells Exceeds Chronic Toxicity Criteria (i.e., 0.0014 ppmv H 2 S) at the Tuscola (IL) Site DOE/EIS-0394 FUTUREGEN PROJECT EIS FINAL SUMMARY NOVEMBER 2007 S-10 Figure S-4. Proposed Mattoon Power Plant and Sequestration Site Figure S-5. Proposed Utility Corridors for the Mattoon Power Plant and Sequestration Site Mattoon Power Plant and Sequestration Site Coles County Shelby County Shelby County Moultrie County C a n a d i a n N a t i o n a l R a i l r o a d Lake Shelbyville Lake Paradise C a n a d i a n N a t


Final Environmental Impact Statement for the FutureGen Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Revision 1 April 2007) Revision 1 April 2007) (Revision 2 October 2007) FINAL RISK ASSESSMENT REPORT Revised October 2007 i TABLE OF CONTENTS 1.0 INTRODUCTION .........................................................................................................................1-1 2.0 CONCEPTUAL SITE MODELS ..................................................................................................2-1 2.1 Generic Conceptual Model Applicable to All Sites...................................................................2-1 2.2 Power Plant and Capture of Carbon Dioxide and Other Gases..................................................2-3 2.3 Generic Sequestration Site Description .....................................................................................2-5


HyMotion GEN 2 Fact Sheet - backup.pdf  

NLE Websites -- All DOE Office Websites (Extended Search)

1.6 seconds 1.6 seconds Acceleration 1/4 Mile Time: 19.3 seconds Maximum Speed: 78.9 MPH Acceleration 1 Mile Maximum Speed: 106.5 MPH Charge Sustaining: Acceleration 0-60 MPH Time: 12.4 seconds Acceleration 1/4 Mile Time: 19.8 seconds Maximum Speed: 76.7 MPH Acceleration 1 Mile Maximum Speed: 107.0 MPH Brake Test @ 60 MPH Distance Required: 153.0 ft UDDS Fuel Economy 6 HWFET Fuel Economy 6 Distance (miles) Fuel Economy (mpg) AC Energy Consumed gy gy (kWh) 7 Distance (miles) Fuel Economy (mpg) AC Energy Consumed gy gy (kWh) 7 10 157.8 2.03 10 92.0 1.57 20 164.4 4.03 20 102.3 3.10 40 119.0 4.95 40 91.3 4.66 60 97.6 4.98 60 79.0 4.66 80 87.0 4.98 80 73.0 4.66 100 80.7 4.98 100 69.5 4.66 200 68.0 4.98 200 62.4 4.66 Fuel Economy with A/C Off 1 Cold Start Charge Depleting 2 : Fuel Economy: 155.2 MPG A AC kWh Consumed 7 : 0.204 kWh/mi Charge Depleting


Dist Gen 6-2-03.p65  

NLE Websites -- All DOE Office Websites (Extended Search)



Brig. Gen. Sandra Finan honored for commitment at NNSA | National...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandra Finan honored for commitment at NNSA | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy...


Developing Next-Gen Batteries With Help From NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

2402 XBD201110-01310.jpg Kristin Persson To reduce the United States' reliance on foreign oil and lower consumer energy costs, the Department of Energy (DOE) is bringing together...


Secure RFID authentication scheme for EPC class Gen2  

Science Conference Proceedings (OSTI)

Recently, much research has been actively conducted for a new kind of network environment ubiquitous computing. This paper will define the essential technology called "ad hoc network" and the "RFID technology" required by a ubiquitous environment. Therefore, ... Keywords: RFID, authentication, security

Dae-Hee Seo; Jang-Mi Baek; Dong-sub Cho



DOE - Office of Legacy Management -- Gen_Atomics  

NLE Websites -- All DOE Office Websites (Extended Search)

General Atomics Hot Cell Facility, California, Site A Oakland Operations Office site genatomicsmap The General Atomics Hot Cell Facility site was a research laboratory formerly...


Tri-Generation Success World's First Tri-Gen  

E-Print Network (OSTI)

station uses anaerobically digested biogas from the municipal wastewater treatment plant as the fuel SAE protocols for rapid 3-minute complete tank refueling. Gas or Biogas H2 is produced at anode Gas the versatility of fuel cells to utilize multiple feedstocks, such as biogas and natural gas, to produce power


Microsoft Word - ATD Gen 2 GDR Performance Evaluation Final Report...  

NLE Websites -- All DOE Office Websites (Extended Search)

and profiles that have been defined for technology life verification testing. Cell aging consisted of characterization, followed by life testing with periodic breaks for...


Building Energy Software Tools Directory: D-Gen PRO  

NLE Websites -- All DOE Office Websites (Extended Search)

sales and marketing reports and graphs on the economic feasibility of on-site and cogeneration, including waste heat analysis. Graphs can be viewed by the monthly energy...


NNSA Welcomes Brig. Gen. Sandra Finan as New Principal Assistant...  

National Nuclear Security Administration (NNSA)

Jan 18, 2011 General begins her second assignment at the U.S. Department of Energy WASHINGTON, D.C. - The National Nuclear Security Administration (NNSA) today welcomed...


DOE - Office of Legacy Management -- Gen_Atomics  

Office of Legacy Management (LM)

Office, California. After remediation, the site transferred to the Office of Legacy Management in 2005. The site requires records management and stakeholder support. For...



NLE Websites -- All DOE Office Websites (Extended Search)

SLCAIP Historical & Forecast Generation at Plant Total Range of Hydrology 0 2,000,000,000 4,000,000,000 6,000,000,000 8,000,000,000 10,000,000,000 12,000,000,000 1 9 7 0 1 9 7 2 1...


ESnet and Internet2 to launch next gen research network  

E-Print Network (OSTI)

"The Department of Energy's (DOE) Energy Sciences Network (ESnet) and Internet2 will deploy a high capacity nationwide network that will greatly enhance the capabilities of researchers across the country who participate in the DOE's scientific research efforts." (1 page)



Lessons Learned From Gen I Carbon Dioxide Cooled Reactors  

Science Conference Proceedings (OSTI)

This paper provides a review of early gas cooled reactors including the Magnox reactors originating in the United Kingdom and the subsequent development of the Advanced Gas-cooled Reactors (AGR). These early gas cooled reactors shared a common coolant medium, namely carbon dioxide (CO2). A framework of information is provided about these early reactors and identifies unique problems/opportunities associated with use of CO2 as a coolant. Reactor designers successfully rose to these challenges. After years of successful use of the CO2 gas cooled reactors in Europe, the succeeding generation of reactors, called the High Temperature Gas Reactors (HTGR), were designed with Helium gas as the coolant. Again, in the 21st century, with the latest reactor designs under investigation in Generation IV, there is a revived interest in developing Gas Cooled Fast Reactors that use CO2 as the reactor coolant. This paper provides a historical perspective on the 52 CO2 reactors and the reactor programs that developed them. The Magnox and AGR design features and safety characteristics were reviewed, as well as the technologies associated with fuel storage, reprocessing, and disposal. Lessons-learned from these programs are noted to benefit the designs of future generations of gas cooled nuclear reactors.

David E. Shropshire



Building Energy Software Tools Directory: GenOpt  

NLE Websites -- All DOE Office Websites (Extended Search)

Tools by Country Australia Austria Belarus Belgium Brazil Canada Chile China Czech Republic Denmark Finland France Germany India Ireland Israel Italy Japan Netherlands New Zealand...


Gen IV Materials (ASME-DOE Project) - Programmaster.org  

Science Conference Proceedings (OSTI)

... reactors, ASME Standards Technology, LLC (ASME ST-LLC) has been working with major stakeholders from industry, government, and academia to develop...


Brig. Gen. Dawkins honored at Air Force promotion ceremony |...  

National Nuclear Security Administration (NNSA)

Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GenCLOn: An ontology for city logistics  

Science Conference Proceedings (OSTI)

City logistics is a discipline specialized to cope with the sustainability problems encountered in urban freight transport. A key characteristic of it is the heterogeneity of the stakeholders involved. Besides the traditional logistics actors such as ... Keywords: Agent-based modeling, City logistics, Ontology

Nilesh Anand; Mengchang Yang; J. H. R. Van Duin; Lori Tavasszy



Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tric-frontier-foundation-implementing Page Parking and Garage Parking in the Forrestal Garage http:energy.govmanagementoffice-managementemployee-servicesparking-and-garage...


The African wave-type electric fish,

Science Conference Proceedings (OSTI)

tric fish, performs its jamming avoidance response by relying solely upon ... cy lowers its frequency, suggesting that the fish can deter- mine the sign of the...



NLE Websites -- All DOE Office Websites (Extended Search)

of Pressure and Dissolved Gas Supersaturation on Turbine-Passed Fish Migratory and resident fish in the Columbia River Basin are exposed to stresses associated with hydroelec- tric...



E-Print Network (OSTI)

Pines, "Program GEOTHM, a Thermodynamic Process Program forand R. L. Fulton, "The Thermodynamic and Cost Benefits of aof Elec- tric Power, Thermodynamic and Economic Design

Pope, William L.




E-Print Network (OSTI)

a greater number of wood central heating than in 1963, whichthe use of wood and elec- tric supplementary heating. Suchor wood, storage heaters dependant upon the central heating

Schipper, L.



Section 5.2.4 Absorption Cooling: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

Though an elec- tric pump is usually used (the principal exceptions being the small hotel and recreational vehicle RV re- frigerators), pump energy requirements are...


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tric-generation-and-transmission-siting-kentucky Rebate Black Hills Energy- On-Site Solar PV Rebate Program '''''Note: This program is temporarily closed while the Colorado Public...


Traveling Wave Thermoacoustic-Piezoelectric Energy Harvester: Theory and Experiment.  

E-Print Network (OSTI)

??This thesis presents a theoretical and experimental investigation of a piezoelec- tric energy harvester coupled to a traveling wave thermoacoustic engine (TWTAE). By simplifying the (more)

Roshwalb, Andrew Zvi



Clean Coal Briefs The Ohio Power Company recently  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydroelec- tric power potential is estimated to be 220 GW, but cannot meet all future energy needs. Hydro also has the disadvantage of severe environ- mental disruption and...


Hybrid Electric Vehicle End-Of-Life Testing On Honda Insights, Gen I Civics And Toyota Gen I Priuses  

SciTech Connect

This technical report details the end-of-life fuel efficiency and battery testing on two model year 2001 Honda Insight hybrid electric vehicles (HEVs), two model year 2003 Honda Civic HEVs, and two model year 2002 Toyota Prius HEVs. The end-of-life testing was conducted after each vehicle has been operated for approximately 160,000 miles. This testing was conducted by the U.S. Department of Energys (DOE) Advanced Vehicle Testing Activity (AVTA). The AVTA is part of DOEs FreedomCAR and Vehicle Technologies Program. SAE J1634 fuel efficiency testing was performed on the six HEVs with the air conditioning (AC) on and off. The AC on and off test results are compared to new vehicle AC on and off fuel efficiencies for each HEV model. The six HEVs were all end-of-life tested using new-vehicle coast down coefficients. In addition, one of each HEV model was also subjected to fuel efficiency testing using coast down coefficients obtained when the vehicles completed 160,000 miles of fleet testing. Traction battery pack capacity and power tests were also performed on all six HEVs during the end-of-life testing in accordance with the FreedomCAR Battery Test Manual For Power-Assist Hybrid Electric Vehicles procedures. When using the new-vehicle coast down coefficients (Phase I testing), 11 of 12 HEV tests (each HEV was tested once with the AC on and once with the AC off) had increases in fuel efficiencies compared to the new vehicle test results. The end-of-life fuel efficiency tests using the end-of-life coast down coefficients (Phase II testing) show decreases in fuel economies in five of six tests (three with the AC on and three with it off). All six HEVs experienced decreases in battery capacities, with the two Insights having the highest remaining capacities and the two Priuses having the lowest remaining capacities. The AVTAs end-of-life testing activities discussed in this report were conducted by the Idaho National Laboratory; the AVTA testing partner Electric Transportation Applications, and by Exponent Failure Analysis Associates.

James Francfort; Donald Karner; Ryan Harkins; Joseph Tardiolo




Office of Legacy Management (LM)

,, The ,foll.owing recommeodations were previ0nsl.y slrbmtted the May' 8, 1959 tric ' report on the initial piercing opcrations on April 14 to April 23. 1959, and April 2G to :...


GenDocSum+MCLR: Generic document summarization based on maximum coverage and less redundancy  

Science Conference Proceedings (OSTI)

With the rapid growth of information on the Internet and electronic government recently, automatic multi-document summarization has become an important task. Multi-document summarization is an optimization problem requiring simultaneous optimization ... Keywords: Differential evolution algorithm, Generic document summarization, Less redundancy, Maximum coverage, Optimization model

Rasim M. Alguliev; Ramiz M. Aliguliyev; Makrufa S. Hajirahimova



ESS 2012 Peer Review - International Energy Storage Database - Janice Lin, StrateGen  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Storage Database Energy Storage Database Janice Lin Site Admin: storage.exchange@strategen.com; 510-665-7811 Special thanks to the DOE Energy Storage Program and Dr. Imre Gyuk US Department of Energy, Office of Electricity, Energy Storage Program Sandia National Laboratories Purpose: Establish the go-to source of open-access, reference-grade information on energy storage projects and policies. Status: The database beta is fully functional and is currently in the population stage, with over 70 entries vetted and published, and additional user-submitted entries being added regularly. The beta can be seen at http://sandia.gov/ess/database. Future Plans: We will continue to vet and maintain the entry data, as well as implement a variety of capabilities that will enhance functionality, and allow for a broader


Department of Energy Takes Another Step Forward on FutureGen Project in  

NLE Websites -- All DOE Office Websites (Extended Search)

August 5, 2009 August 5, 2009 President Obama Announces $2.4 Billion in Grants to Accelerate the Manufacturing and Deployment of the Next Generation of U.S. Batteries and Electric Vehicles Recovery Act will fund 48 new advanced battery and electric drive components manufacturing and electric drive vehicle deployment projects in over 20 states Elkhart, Indiana - Further accelerating the manufacturing and deployment of electric vehicles, batteries, and components here in America, and creating tens of thousands of new jobs, President Obama today announced 48 new advanced battery and electric drive projects that will receive $2.4 billion in funding under the American Recovery and Reinvestment Act. These projects, selected through a highly competitive process by the Department of Energy, will accelerate the development of U.S. manufacturing capacity for batteries and electric drive components as well as the deployment of electric drive vehicles, helping to establish American leadership in creating the next generation of advanced vehicles.


Microsoft Word - PowerGen 1207 NETL CCS Program.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

- Feeley - Feeley DOE'S CARBON CAPTURE AND SEQUESTRATION R&D PROGRAM Thomas J. Feeley, III National Energy Technology Laboratory, 626 Cochrans Mill Road, Pittsburgh, PA 15236 Timothy E. Fout National Energy Technology Laboratory, 3610 Collins Ferry Road, Morgantown, WV 26507 Andrew P. Jones Science Applications International Corporation, 626 Cochrans Mill Road, Pittsburgh, PA 15236 ABSTRACT Since its inception 10 years ago, the Department of Energy's Carbon Sequestration Program - managed within the Office of Fossil Energy and implemented by the National Energy Technology Laboratory - has been developing both core and supporting technologies through which carbon capture and storage (CCS) will become an effective and economically viable option for reducing carbon dioxide (CO



E-Print Network (OSTI)

information for ORPS contact telephone call list (see Attachment #2). Remove references to paging system indicated) Section A, Step 5 - Remove reference to pager, add info on ORPS FM duty schedule Section I, Step

Princeton Plasma Physics Laboratory


PLENARY ADDRESSES 3USDA Forest Service Gen. Tech. Rep. PSW-GTR-160. 1997.  

E-Print Network (OSTI)

David H. Byrne David J. Leatham David J. Caldwell Rosana G. Moreira Craig J. Coates Tim H. Murphy Mickey

Stephens, Scott L.


OEP Terminal and CONUS Weather Radar Coverage Gap Identification Analysis for NextGen  

E-Print Network (OSTI)

instances in the future. Likewise, we also did not include wind turbine interference, another dynamic) will not meet the 4D weather cube single authoritative source (4D Wx SAS) vertical resolution requirements, but do not have the requisite spatial resolution and coverage. Phased array radars would be capable

Cho, John Y. N.


FutureGen Case 2-1-1, 2.1.2 Topical Report  

NLE Websites -- All DOE Office Websites (Extended Search)

other liquid products or chemical feedstocks that can be shipped to a conventional oil refinery or chemical plant. * The system does not include carbon capturesequestration...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cycle-Life Studies of Advanced Technology Development Program Gen 1 Lithium Ion Batteries  

E-Print Network (OSTI)

Batteries This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, make any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product or process disclosed, or represents that its use would not infringe on privately owned rights. References herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States Government or any agency thereof. DOE/ID-10845

Randy B. Wright; Chester G. Motloch



USDA Forest Service Gen. Tech. Rep. PSW-GTR-193. 2004. 111 Sierra Nevada Grasslands: Interactions  

E-Print Network (OSTI)

land cover, they are particularly important areas and affect ecosystem processes at rates within a context of historical grazing. If we are to learn the best way to protect these rare and are enclosed with a 2-strand electric fence. Each plot contains a spring and ephemeral creek in addition

Standiford, Richard B.


GenAlyzer: interactive visualization of sequence similarities between entire genomes  

Science Conference Proceedings (OSTI)

Summary: Genalyzer is a software tool designed for the interactive visualization of sequence matches between DNA or protein sequences. It provides visualizations on different levels of granularity, from complete overviews via zoomed regions to ... Keywords: Drosophila, accessory gland protein, gene duplication, gene expression, molecular evolution, selection

Jomuna V. Choudhuri; Chris Schleiermacher; Stefan Kurtz; Robert Giegerich



Transmission Line Workstation - Generation 2 (TLW-Gen2) v1.2: Lightning & Grounding Module  

Science Conference Proceedings (OSTI)

This is a complete rewrite of the platform supporting the Transmission Line Workstation. The result is to provide a common platform to share data and support tools between existing and future T&S software. This release adds Vibration and OpenDSS Fault calculations to the initial TFlash and ACDC line ...



Carbon Capture and Storage FutureGen 2.0 Project Moves Forward...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

partners, the Department of Energy is investing in the upgrade of a coal-fired power plant in Meredosia, Ill. with oxy-combustion technology to capture more than 1 million...


Model year 2010 (Gen 3) Toyota Prius level 1 testing report.  

DOE Green Energy (OSTI)

As a part of the US Department of Energy's Advanced Vehicle Testing Activity (AVTA), a model year 2010 Toyota Prius (Generation 3) was procured by eTec (Phoenix, AZ) and sent to ANL's Advanced Powertrain Research Facility for the purposes of 'Level 1' testing in support of the Advanced Vehicle Testing Activity (AVTA). Data was acquired during testing using non-intrusive sensors, vehicle network connection, and facilities equipment (emissions and dynamometer data). Standard drive cycles, performance cycles, steady-state cycles and A/C usage cycles were conducted. Much of this data is openly available for download in ANL's Downloadable Dynamometer Database (D{sup 3}). The major results are shown here in this report. Given the preliminary nature of this assessment, the majority of the testing was done over standard regulatory cycles and seeks to obtain a general overview of how the vehicle performs. These cycles include the US FTP cycle (Urban) and Highway Fuel Economy Test cycle as well as the US06, a more aggressive supplemental regulatory cycle. Data collection for this testing was kept at a fairly high level and includes emissions and fuel measurements from the exhaust emissions bench, high-voltage and accessory current and voltage from a DC power analyzer, and minimal CAN bus data such as engine speed and pedal position. The following sections will seek to explain some of the basic operating characteristics of the MY2010 Prius over standard regulatory cycles.

Rask, E.; Duoba, M.; Lohse-Busch, H.; Bocci, D.; Energy Systems



Design and simulation of a PCI Express Gen 3.0 communication channel  

E-Print Network (OSTI)

PCI Express (PCIe) is a serial interconnect technology, developed by the PCI-Sig organization, which provides high bandwidth data transmission with the added benefits of reduced board space requirements, smaller connectors ...

Warnakulasuriyarachchi, Dilini (Dilini M.)



Microsoft Word - PowerGen 1207 NETL CCS Program.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

of Fossil Energy and implemented by the National Energy Technology Laboratory - has been developing both core and supporting technologies through which carbon capture and storage...


Passive EPC Class 1 Gen 2 UHF RFID sensor tag For health monitoring applications  

E-Print Network (OSTI)

Parkinson's disease (PD) is a chronic and degenerative condition that affects millions of Americans. Current approach of PD evaluation, diagnosis, and treatment is mainly qualitative using the Unified Parkinson's Disease ...

Dong, Haobo (Haobo Jack)



Final Risk Assessment Report for the FutureGen Project Environmental...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

human, injury Saripalli et al. 2003 Severe Chronic-Human Human CO 2 182,956 100,000 human, lethal Saripalli et al. 2003 Normal Air Normal CO 2 280 air NIOSH IDLH Acute 30 min...


Design and Testing of Helium Cooled Components for DEMO and Synergies with Gen4 Reactor  

Science Conference Proceedings (OSTI)

Power Plants, Demo, and Next Steps / Eighteenth Topical Meeting on the Technology of Fusion Energy (Part 2)

Thomas Ihli


Investigation Of The Ion Current Signal In Gen-Set Turbocharged Diesel Engine.  

E-Print Network (OSTI)

??Diesel powered generator sets have traditionally been and remain the number-one choice for standby and emergency power systems. As an established engine technology, diesel engines (more)

Badawy, Tamer Hassan



Consistent Multigroup Theory Enabling Accurate Course-Group Simulation of Gen IV Reactors  

Science Conference Proceedings (OSTI)

The objective of this proposal is the development of a consistent multi-group theory that accurately accounts for the energy-angle coupling associated with collapsed-group cross sections. This will allow for coarse-group transport and diffusion theory calculations that exhibit continuous energy accuracy and implicitly treat cross- section resonances. This is of particular importance when considering the highly heterogeneous and optically thin reactor designs within the Next Generation Nuclear Plant (NGNP) framework. In such reactors, ignoring the influence of anisotropy in the angular flux on the collapsed cross section, especially at the interface between core and reflector near which control rods are located, results in inaccurate estimates of the rod worth, a serious safety concern. The scope of this project will include the development and verification of a new multi-group theory enabling high-fidelity transport and diffusion calculations in coarse groups, as well as a methodology for the implementation of this method in existing codes. This will allow for a higher accuracy solution of reactor problems while using fewer groups and will reduce the computational expense. The proposed research represents a fundamental advancement in the understanding and improvement of multi- group theory for reactor analysis.

Rahnema, Farzad; Haghighat, Alireza; Ougouag, Abderrafi



''NowGen'': getting real about coal carbon capture and sequestration  

Science Conference Proceedings (OSTI)

It's clear that managing climate change will require addressing one of its key drivers: coal-fired electricity generation. This likely can't be done by just avoiding coal use altogether. We need cost-effective CCS and enabling technologies, we need them at commercial scale, and we need them soon. (author)

Cohen, Armond; Fowler, Mike; Waltzer, Kurt



Cycle Life Studies of Advanced Technology Development Program Gen 1 Lithium Ion Batteries  

SciTech Connect

This report presents the test results of a special calendar-life test conducted on 18650-size, prototype, lithium-ion battery cells developed to establish a baseline chemistry and performance for the Advanced Technology Development Program. As part of electrical performance testing, a new calendar-life test protocol was used. The test consisted of a once-per-day discharge and charge pulse designed to have minimal impact on the cell yet establish the performance of the cell over a period of time such that the calendar life of the cell could be determined. The calendar life test matrix included two states of charge (i.e., 60 and 80%) and four temperatures (40, 50, 60, and 70C). Discharge and regen resistances were calculated from the test data. Results indicate that both discharge and regen resistance increased nonlinearly as a function of the test time. The magnitude of the discharge and regen resistance depended on the temperature and state of charge at which the test was conducted. The calculated discharge and regen resistances were then used to develop empirical models that may be useful to predict the calendar life or the cells.

Wright, Randy Ben; Motloch, Chester George



Calendar Life Studies of Advanced Technology Development Program Gen 1 Lithium Ion Batteries  

SciTech Connect

This report presents the test results of a special calendar-life test conducted on 18650-size, prototype, lithium-ion battery cells developed to establish a baseline chemistry and performance for the Advanced Technology Development Program. As part of electrical performance testing, a new calendar-life test protocol was used. The test consisted of a once-per-day discharge and charge pulse designed to have minimal impact on the cell yet establish the performance of the cell over a period of time such that the calendar life of the cell could be determined. The calendar life test matrix included two states of charge (i.e., 60 and 80%) and four temperatures (40, 50, 60, and 70C). Discharge and regen resistances were calculated from the test data. Results indicate that both discharge and regen resistance increased nonlinearly as a function of the test time. The magnitude of the discharge and regen resistance depended on the temperature and state of charge at which the test was conducted. The calculated discharge and regen resistances were then used to develop empirical models that may be useful to predict the calendar life or the cells.

Wright, Randy Ben; Motloch, Chester George



Pages that link to "Terra-Gen Power LLC" | Open Energy Information  

Open Energy Info (EERE)

- Permitting and Initial Development ( links) Phase IV - Resource Production and Power Plant Construction ( links) Alta I ( links) Alta II (Vestas) (...


Statement of Lt Gen Frank Klotz, USAF (Ret) Before the United...  

National Nuclear Security Administration (NNSA)

and the public. The military services often say that people are their most important asset. It's true; and, it applies to NNSA as well. Highly trained, experienced and motivated...


Optimized, Competitive Supercritical-CO2 Cycle GFR for Gen IV Service  

DOE Green Energy (OSTI)

An overall plant design was developed for a gas-cooled fast reactor employing a direct supercritical Brayton power conversion system. The most important findings were that (1) the concept could be capital-cost competitive, but startup fuel cycle costs are penalized by the low core power density, specified in large part to satisfy the goal of significatn post-accident passive natural convection cooling; (2) active decay heat removal is preferable as the first line of defense, with passive performance in a backup role; (3) an innovative tube-in-duct fuel assembly, vented to the primpary coolant, appears to be practicable; and (4) use of the S-Co2 GFR to support hydrogen production is a synergistic application, since sufficient energy can be recuperated from the product H2 and 02 to allow the electrolysis cell to run 250 C hotter than the reactor coolant, and the water boilers can be used for reactor decay heat removal. Increasing core poer density is identified as the top priority for future work on GFRs of this type.

M.J. Driscoll; P. Hejzlar; G. Apostolakis



U.S. and China Announce Cooperation on FutureGen and Sign Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of energy related issues. Secretary Bodman traveled to China after visiting Japan and Korea earlier this week. Tomorrow Secretary Bodman will participate in the Five-Party Energy...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Announces Restructured FutureGen Approach to Demonstrate CCS Technology at Multiple Clean Coal Plants  

Energy.gov (U.S. Department of Energy (DOE))

Affirms Commitment to Clean Coal Technology Investments; Requests $648 Million for Coal Research, Development and Deployment for FY09 Budget - Largest Coal Budget Request in more than 25 years...


NETL: News Release - Secretary Chu Announces FutureGen 2.0  

NLE Websites -- All DOE Office Websites (Extended Search)

Awards 1 Billion in Recovery Act Funding for Carbon Capture and Storage Network in Illinois Washington, D.C. - Today, U.S. Energy Secretary Steven Chu and U.S. Senator Dick...


Bryant fall 2010 FCP H I L A N T H R O P Y I N A C T I O N FA L L/WI NTER2011ABRyA NTUN IvE RsITyREsoURcEFo RP Ro FEssIoNALsUccEss  

E-Print Network (OSTI)

to a series of convenience store robberies in Baltimore County. This work was supported by National Institute to the Baltimore County Police Department and especially to Phil Canter. #12;MULTIMODEL INFERENCE AND GEOGRAPHIC of papers by Akaike (1973, 1974, 1977), and an excellent description of the relevant theory and applications

Blais, Brian


Indoor air movement acceptability and thermal comfort in hot-humid climates  

E-Print Network (OSTI)

climate zone showed almost 90% thermal acceptabil- ity within the operative temperature ranges prescribed in the ASHRAE

Candido, Christhina Maria



2012 MBE Presentations  

Science Conference Proceedings (OSTI)

... Announcements & Admin. Simon Frechette, NIST Paul Huang, ARL. Open Manufacturing. Mick Maher, DARPA-DSO. CSI Update. John Gray, ITI. ...



Voltage- and time-dependent action of histrionicotoxin on the endplate current of the frog muscle.J. Gen  

E-Print Network (OSTI)

arrow poison frog, Dendrobates histrionicus, decreased the amplitude and timecourse of the endplate current, and altered the voltage dependence of the halfdecay time. In addition, the toxin produced a characteristic nonlinearity in the current-voltage relationship of the endplate current when 3-s voltage conditioning steps were used. Reduction in time of the conditioning steps to 10 ms made the current-voltage relationship linear. The decrease in peak amplitude of the endplate current (epc) produced by histrionicotoxin measured during long hyperpolarizing conditioning steps was fitted by a single exponential function. The calculated rate constants ranged from 0.03 to 0.14 s-1 and varied with membrane potential at hyperpolarizing levels. The voltage- and time-dependent action of histrionicotoxin does not require an initial activation of receptors by acetylcholine (ACh). The characteristic of the current-voltage relationship can be accounted for by the observed voltage and time dependency of the attenuation of the endplate current amplitude in the presence of histrionicotoxin during long conditioning steps. These effects of histrionicotoxin on the peak amplitude, and on the voltage and time dependence of the epc were concentration-dependent and slowly reversible upon washing out the toxin. Thus, the voltage- and time-dependent action of histrionicotoxin at the endplate is related to an increase in the affinity between the toxin and the ACh receptor-ionic channel complex. This increase in affinity is postulated to be due to a conformational change of the macromolecule in the presence of histrionicotoxin which is demonstrated to be relatively slow, i.e., on the order of tens of seconds.

Leona M. Masukawa; Edson X. Albuquerque



A Qualitative Assessment of Diversion Scenarios for an Example Sodium Fast Reactor Using the GEN IV PR&PP Methodology  

Science Conference Proceedings (OSTI)

FAST REACTORS;NUCLEAR ENERGY;NUCLEAR MATERIALS MANAGEMENT;PROLIFERATION;SAFEGUARDS;THEFT; A working group was created in 2002 by the Generation IV International Forum (GIF) for the purpose of developing an internationally accepted methodology for assessing the Proliferation Resistance of a nuclear energy system (NES) and its individual elements. A two year case study is being performed by the experts group using this methodology to assess the proliferation resistance of a hypothetical NES called the Example Sodium Fast Reactor (ESFR). This work demonstrates how the PR and PP methodology can be used to provide important information at various levels of details to NES designers, safeguard administrators and decision makers. The study analyzes the response of the complete ESFR nuclear energy system to different proliferation and theft strategies. The challenges considered include concealed diversion, concealed misuse and 'break out' strategies. This paper describes the work done in performing a qualitative assessment of concealed diversion scenarios from the ESFR.

Zentner, Michael D.; Coles, Garill A.; Therios, Ike



USDA Forest Service Gen. Tech. Rep. PSW-GTR-181. 2002. 111 A Preliminary Study of Ant Diversity and of  

E-Print Network (OSTI)

387­394, Vancouver, British Columbia, Canada, October. Association for Computational Linguistics. T. c 2006 Association for Computational Linguistics A Pipeline Framework for Dependency Parsing Ming, IL 61801 {mchang21, quangdo2, danr}@uiuc.edu Abstract Pipeline computation, in which a task

Lindgren, Staffan


Transmission Line Workstation - Generation 2 (TLW-Gen2) v1.2: HVDC Electrical Effects - Version 1.0  

Science Conference Proceedings (OSTI)

This is a complete rewrite of the platform supporting the Transmission Line Workstation. The result is to provide a common platform to share data and support tools between existing and future T&S software. This release adds Vibration and OpenDSS Fault calculations to the initial TFlash and ACDC line ...



A novel action of quinine and quinidine on the membrane conductance of neurons from the vertebrate retina..]. Gen. Physiol  

E-Print Network (OSTI)

ABSTRACT The cinchona alkaloids quinine and quinidine have been shown to block a broad range of voltage-gated membrane conductances in a variety of excitable tissues. Using the whole-cell version of the patch clamp technique, we examined the effects of these compounds on voltage-dependent currents from horizontal cells dissociated enzymatically from the all-rod retina of the skate. We report here a novel and unexpected action of quinine and quinidine on isolated horizontal cells. In addition to blocking several of the voltage-activated currents of these cells, the introduction of the alkaloids evoked a large outward current when the cells were held at depolarized potentials. Using tail current analysis, the reversal potential of the outward current was close to O mV, and the current was markedly suppressed by extracellularly applied cobalt, acetate, and halothane. Depolarization in the presence of quinine also permitted entry into the cells of extracellularly applied Lucifer yellow (MW-- 443 D), whereas a 3-kD fluorescein-dextran complex was excluded. These findings suggest that the large, apparently nonselective conductance induced by quinine and quinidine results from the opening of hemi-gap junctional channels.

Robert Paul Malchow; W Haohua Qian; Harris Ripps W



An assessment of environmental impacts of a nextGen implementation scenario and its implications on policy-making  

E-Print Network (OSTI)

With demand for aviation projected to grow by 5% per year over the next 20 to 25 years, policy makers must not only consider ways to ensure that the air transportation system can accomodate significant growth, but also how ...

Fan, Alice



Parastrombidinopsis shimi n. gen., n. sp. (Ciliophora: Choreotrichia) from the Coastal Waters of Korea: Morphology and Small Subunit Ribosomal DNA  

E-Print Network (OSTI)

are alive; when stained, it is cylindrical for the upper two-fifths, half-bowl shaped for the middle two. STRU¨ EDER-KYPKE,b DENIS H. LYNN,b SANGHEE KIM,c JONG HYEOK KIMd and SEUNG HYEON LEEa a School of Earth and Environmental Science, College of Natural Sciences, Seoul National University, Seoul, 151-747, Republic of Korea

Jeong, Hae Jin


Microsoft PowerPoint - Future Generation Reactors_2012.pptx ...  

NLE Websites -- All DOE Office Websites (Extended Search)

Gen II Gen III Gen III+ Gen IV 1950 1960 1970 1980 1990 2000 2010 2020 2030 Existing commercial reactors: producing 20% of U.S. electricity, 70% of emission-free electric...



NLE Websites -- All DOE Office Websites (Extended Search)

PowerProjections2003(avgusing5-03water,BrokerPrices)(amended).xls SLIP Energy WY Gross Gen from Hydro LP Dolores Gen. Total SLIP Gross Gen Avg. Plant Use SLIP Net Gen @ Plant...


Journal of Chromatography A, 910 (2001) 137145 www.elsevier.com/locate/chroma  

E-Print Network (OSTI)

:1 disadvantages of the method are that the stoichiome- molecular ratio (SDS1GEN) were separately added try that both SDS and GEN phase systems containing SDS, GEN and SDS1 decrease the retention of Gly indicating interaction3 GEN. The similarities or dissimilarities between the interactive capacity of SDS, GEN and SDS1GEN

Miksik, Ivan


Modeling and Control Interactive Networks  

E-Print Network (OSTI)

and disturbance-free electricity; bank- ing and finance systems depend on the robustness of elec- tric power aircraft and land and sea vessels, depend on communica- tion and energy networks. Links between the power to be a lynchpin of energy 22 IEEE Control Systems Magazine February 2002 0272-1708/02/$17.00©2002IEEE Theauthor

Amin, S. Massoud


he Northwest Power Planning Council and  

E-Print Network (OSTI)

Thomas Edison invented the phonograph and 12 years before Portland would have elec- tric street lights Scien- tific Group in 1996, the National Research Council, also in 1996, and the National Fish Hatchery harvest is being recon- sidered in light of issues such as genetic impacts on wild stocks and the capacity


Number 159 August 1, 2002 Development of technically and economically viable processes for the conversion and utilization of fossil fuels is a major objective of both the DOE Fossil  

E-Print Network (OSTI)

at sizes typical of larger commercial power plants. --For more information, contact: David Anna, DOE for Tokyo Elec- tric Power Company's (TEPCO) Futtsu Thermal Power Station Group No. 4 Project. Each system will be supplied by Toshiba Corporation and Hitachi Limited. The Futtsu Power Plant is scheduled to generate 1


0018-9162/00/$10.00 2000 IEEE44 Computer Toward Self-Healing  

E-Print Network (OSTI)

0018-9162/00/$10.00 © 2000 IEEE44 Computer Toward Self-Healing Infrastructure Systems V irtually on the robustness of elec- tric power, cable, and wireless telecommunications. Transportation systems, including factors and policies and human performance also affect these networks. The Complex Interactive Networks/Systems

Amin, S. Massoud


Science&TechnologyHighlights As the world's lightest metal, lithium is well positioned to meet  

E-Print Network (OSTI)

of one million plug-in hybrid elec- tric vehicles onAmerican highways by 2015. Battery manufacturers commitments from the EERE's Vehicle Technologies (VTP) and Industrial Technologies (ITP) Programs manufactur- ers to make dark-colored roofs more solar-reflective. "We found that the addition of certain

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Published by Oak Ridge National Laboratory No. 1 2010 The industrial sector accounts for nearly one-third of the  

E-Print Network (OSTI)

in the production of batteries for elec- tric vehicles?" To help make American battery manufacturers more com-third of the U.S. economy and nearly one-quarter of the products of global manufacturing. Industry drives the U of technologies with interested manufacturers to ensure world-class technology and products. The technologies


continued on p. 2 Published by Oak Ridge National Laboratory No. 2 2010  

E-Print Network (OSTI)

of each vehicle, helping meet DOE goals. In a hybrid, plug-in hybrid, and all-elec- tric car, multiple and Integration Center, drove a plug-in hybrid electric vehicle (PHEV) between ORNL and the most energy in NewYork City, ECOSaver IV hybrid vehicles manufac- tured by DesignLine (Charlotte, N.C.) and equipped


FUELING THE FUTURE: Meeting Pakistan's Energy Needs in the 21st Century  

E-Print Network (OSTI)

controversy and provincial disagreements associated with storage-based hydroelec- tric power generation of the industries and ther- mal power generating units in the country, and includes 9,060 km of high pressure percent is oil. Nuclear energy accounts for only 3 percent of power generation. Current installed capacity

Vermont, University of



E-Print Network (OSTI)

In this course we will study and visit several local elec- tric power generation plants. We will have a two, from writ- ing and literature to history and science. We encourage you to explore new subjects, delve.O.C. House 32 12:00-2:00 The History Of Hanover And Dartmouth (8 wks) Senior Center 32 4:30-6:00 Dance

Lotko, William



E-Print Network (OSTI)

. Analysis over consumers historical kWh load profile data from Uruguayan Elec- tric Company (UTE) showsIMPROVING ELECTRIC FRAUD DETECTION USING CLASS IMBALANCE STRATEGIES Mat´ias Di Martino, Federico, jmolinelli}@gmail.com Keywords: Electricity theft, Support vector machine, Optimum path forest, Unbalance


Plug-In Electric Vehicle Handbook for Electrical  

E-Print Network (OSTI)

-based fuel while driving and produce no tailpipe emissions . EVSE (electric vehicle supply equipment) deliv a PEV requires plugging in to elec- tric vehicle supply equipment (EVSE, Figure 1). There are various communicates with the vehicle to ensure that an appropriate and safe flow of electricity is supplied. EVSE


A Study on Energy Harvesting Aware Routing for Vibration-Motivated Wireless Sensor Networks  

E-Print Network (OSTI)

Mechanics, Shijiazhuang Railway Institute, Shijiazhuang 050043, P.R. China R. K. L. Su (B) Department the participating phases are piezoelectric and piezomag- netic (Avellaneda and Harshe 1994; Benvensite 1995; Harshe 1976) used for piezoelec- tric ceramics to magnetoelectroelastic materials. However, for piezoelectric

Lim, Sunho


Sustainability Research & Development Consortium for DoD Installations  

E-Print Network (OSTI)

the architectures for the future elec- tric grid, and brought clean energy solutions to the developing world's Capabilities: Engines and engine controls Energy systems Smart grid Energy for development Advanced and Energy Conversion Laboratory Center for Contaminant Hydrology InteGrid Test & Development Laboratory


Financial Statistics of Major U.S. Publicly Owned Electric ...  

U.S. Energy Information Administration (EIA)

Rural Electric Borrowers published by the Rural Util-ities Service of the U.S. Department of Agriculture. Summary tables for the cooperative borrowers are


Bed Surface Patchiness in Gravel-Bed Rivers  

E-Print Network (OSTI)

this case was a completely armored, immobile bed. Table 2.4that gravel beds are armored because equal mobil- ity

Nelson, Peter August




Science Conference Proceedings (OSTI)

... RE OVE PREPARED BY: ~L-~. ~7";..,r. ~E ';:'. __ lIdards Application and Analys. Diy.ion ItI8TITUTE FOR APPLIED TECHNO;LOGY . ...



Approximating the Stability Region for Binary Mixed-Integer Programs  

E-Print Network (OSTI)

Nov 13, 2007 ... ity analysis and re-optimization when there is objective coefficient ...... and 2 GB RAM, and using CPLEX 9.0 as the optimization engine.


Technical Program  

Science Conference Proceedings (OSTI)

ity of replacing conventional incandescent bulbs and fluorescent lights with LED ... and exciting light sources as a commercial product with a high output.


Economic and agronomic strategies to achieve sustainable irrigation  

Science Conference Proceedings (OSTI)

Aug 12, 2003 ... waters, which are among the problems that continue to threaten productivity and degrade environmental qual- ity. We consider sustainability to...



NLE Websites -- All DOE Office Websites (Extended Search)

Util- ity Office Building (RLUOB) is part of the capital project to replace the aging Cold War-era Chemistry and Metallurgy Research building. Capabilities RLUOB provides:...


protide informatidn.for your decision regtiding l&a future dcr...  

Office of Legacy Management (LM)

mat program after July 1,:1953. Thisproject Is being conducted 7.. :' ,,:,:by the Sylvuia Electric Pro++, Itie.;under Contract AT(30-1)-13 . . . i:, ..,. ::"(Hicksville...


Low Carbon Fuel Standards  

E-Print Network (OSTI)

emissions for fuels such as biofuels, electric- ity, andcould, for instance, sell biofuels or buy credits fromthat 36 billion gallons of biofuels be sold annu- ally by

Sperling, Dan; Yeh, Sonia



Cybersecurity, Innovation and the Internet Economy  

Science Conference Proceedings (OSTI)

... sectors such as energy, critical manufacturing ... to the Information Technology Industry Council (ITI ... real life situation where homeowners who invest in ...




NLE Websites -- All DOE Office Websites (Extended Search)

ity that supports the calculation, modeling, simulation, and visualization of complex nuclear weapons data in support of the Stockpile Stewardship Program. National Security...


Agents for the Masses?  

Science Conference Proceedings (OSTI)

... CDT are satisfied that the models they have ... MR Genesereth, An Agent-Based Framework for Interoperabil- ity ... one another, such a model is insuf ...


Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

ity Constraints, PhD thesis, Dept. of Computer Science, University of Colorado, 1991. [16] M. J. D. Powell, Convergence properties of a class of minimization...


Sustainable use of California biomass resources can help meet state and national bioenergy targets  

E-Print Network (OSTI)

California biomass power sector. Above this price, the modelprices below $1.50 per gge, electric- ity markets provide demand for the lowest-cost biomass

Jenkins, Bryan M; Williams, Robert B; Gildart, Martha C; Kaffka, Stephen R.; Hartsough, Bruce; Dempster, Peter G



Addressing the Need for Alternative Transportation Fuels: The Joint BioEnergy Institute  

E-Print Network (OSTI)

Biomass as Feedstock for a Bioen- ergy and Bioproducts Industry: The Technical Feasibil-ity of a Billion-Ton Annual Supply,

Blanch, Harvey



Microbial Diversity-Based Novel Crop Protection Products  

E-Print Network (OSTI)

ial divers ity- based new crop protection products andicultural production of major crop plan ts and industrialand insect pests major crop plants. If the of cell- free

Yalpani, Ronald Flannagan, Rafael Herrmann, James Presnail, Tamas Torok, and Nasser



This publication and other Energy Information Administration (EIA ...  

U.S. Energy Information Administration (EIA)

distillation units, is one measure of the refining industrys ability to satisfy demand. While refinery distillation capac-ity has generally paralleled product ...


Northern Power Systems Unlocking a New US Wind Turbine Technology...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

* Meet the ITI (CBEMA) curve during power quality events * Resynchronize with backup power or grid as necessary 3 Palmdale Water District Clearwell Site Clearwell Protected...


EA-1882: U.S. Department of Energy Loan Guarantee to Littlerock...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

82: U.S. Department of Energy Loan Guarantee to Littlerock Solar Power Gen 1, LLC for the Littlerock Solar Power Gen 1, LLC Project and to Swan Solar Power Gen Station 1, LLC for...


Microsoft PowerPoint - CellTechSECA2010V1.ppt [Read-Only] [Compatibili...  

NLE Websites -- All DOE Office Websites (Extended Search)

presenter, CellTech Power Thomas Tao, presenter, CellTech Power 3 Generations of LTA-SOFC Development 2002 2006 2004 1998 2000 Gen 1: Gen 2: Gen 3 0: 2008 G 3 1 2009 - 2010 G 3...


Essays on energy and environmental policy  

E-Print Network (OSTI)

North South Houston West Oklahoma ? Wind Gen. N R Chi-sq(1)North South Houston West Oklahoma ? Wind Gen. N R Chi-sq(1)North South Houston West Oklahoma ? Wind Gen. N R Chi-sq(1)

Novan, Kevin Michael



Notice of Intent To Prepare an Environmental Impact Statement for Implementation of the FutureGen Project (DOE/EIS-0394) (07/29/06)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

40 Federal Register 40 Federal Register / Vol. 71, No. 145 / Friday, July 28, 2006 / Notices U.S. Department of Education, 830 First Street, NE., Union Center Plaza, room #41B4, Washington, DC 20202-5320. Telephone: 202-377-3212; and as a secondary contact, Shirley Wheeler, Director, Collections Management, Federal Student Aid, U.S. Department of Education, 830 First Street, NE., Union Center Plaza, room #41F1, Washington, DC 20202-5320. Telephone: (202) 377- 3294. If you use a telecommunications device for the deaf (TTD), you may call the Federal Relay Service (FRS) at 1- 800-877-8339. Individuals with disabilities may obtain this document in an alternative format (e.g., Braille, large print, audiotape, or computer diskette) on request to either contact person listed in



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

933-238 933-238 (or obligation limit imposed) for fiscal year 2013 for any discre- tionary account in divisions A through E of this Act; and (b) For purposes of subsection (a), the applicable percentage shall be- (1) for budget authority in the nonsecurity category (as defined in section 250(c)(4)(A) of the Balanced Budget and Emergency Deficit Control Act of 1985, in- (A) divisions A and E, 2.513. percent; and (B) division B, 1.877 percent; and (2) for budget authority in the security category (as defined in section 250(c)(4)(B) of the Balanced Budget and Emergency Deficit Control Act of 1985), 0.1 percent. (c) Any rescission made by subsection (a) shall be applied proportionately- (1) to each discretionary account and each item of budget authority described in such subsection; and


Advance Notice of Intent to Prepare an Environmental Impact Statement for the the Implementation of the FutureGen Project (DOE/EIS-0394) (02/16/06)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

83 Federal Register 83 Federal Register / Vol. 71, No. 32 / Thursday, February 16, 2006 / Notices The Executive Committee will meet in closed session on March 2, 2006, from 5:15 p.m. to 6:15 p.m. From 5:15 p.m. to 5:45 p.m., the Committee will receive independent government cost estimates from the Associate Commissioner, National Center for Education Statistics, for options affecting current and planned operations under current contracts due to the one percent reduction in the NAEP budget in FY 2006. From 5:45 p.m. to 6:15 p.m. the Associate Commissioner will present additional independent cost estimates for newly proposed activities under current contracts including item development for the science assessment, bridge studies, and validity research. The discussion of independent


Environmental Impact Statements; Notice of Availability; FutureGen Final EIS; Draft PEIS for Designation of Energy Corridors in Eleven Western States (11/16/07)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

618 Federal Register 618 Federal Register / Vol. 72, No. 221 / Friday, November 16, 2007 / Notices Corridor Improvement Project, Proposed Roadway Improvements on Route 101 between the Eureka Slough Bridge and 11th St. Overcrossing in Arcata, Humbolt County, CA. Summary: EPA expressed environmental concerns about impacts to air quality and noise. EPA encourages continued interagency coordination to mitigate impacts to wetlands and cumulative impacts. Rating EC2. EIS No. 20070323, ERP No. D-FHW- J40177-CO, US-36 Corridor, Multi- Modal Transportation Improvements between I-25 in Adams County and Foothills Parkway/Table Mesa Drive in Boulder, Adams, Denver, Broomfield, Boulder and Jefferson Counties, CO. Summary: EPA expressed environmental concerns about the wetlands impacts and impacts to the


Withdrawal of Notice of Intent to Prepare an Environmental Impact Statement GenPower, New York, L.L.C. (DOE/EIS-0339) (03/04/05)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 1 Federal Register / Vol. 70, No. 42 / Friday, March 4, 2005 / Notices DEPARTMENT OF ENERGY [Dockets No. EA-166-B] Application to Export Electric Energy; Duke Energy Trading and Marketing, L.L.C. AGENCY: Office of Fossil Energy, DOE. ACTION: Notice of application. SUMMARY: Duke Energy Trading and Marketing, L.L.C. (DETM) has applied to renew its authority to transmit electric energy from the United States to Mexico pursuant to section 202(e) of the Federal Power Act. DATES: Comments, protests or requests to intervene must be submitted on or before April 4, 2005. ADDRESSES: Comments, protests or requests to intervene should be addressed as follows: Office of Coal & Power Import/Export (FE-27), Office of Fossil Energy, U.S. Department of Energy, 1000 Independence Avenue,



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5297 5297 One Hundred Eleventh Congress of the United States of America AT T H E S E C O N D S E S S I O N Begun and held at the City of Washington on Tuesday, the fifth day of January, two thousand and ten An Act To create the Small Business Lending Fund Program to direct the Secretary of the Treasury to make capital investments in eligible institutions in order to increase the availability of credit for small businesses, to amend the Internal Revenue Code of 1986 to provide tax incentives for small business job creation, and for other purposes. Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, SECTION 1. SHORT TITLE. This Act may be cited as the ''Small Business Jobs Act of 2010''. SEC. 2. TABLE OF CONTENTS.


J. Phys. A Math. Gen. 26 (1993) 765-768. Printed in the UK Addendum to `Non-analytic behaviour of the free energy of  

E-Print Network (OSTI)

-analytic behaviour of the free energy of fermions coupled to small solitons' M Nakahara, D Waxmant and G Williams in units ofthe coherence length, was small compared with unity, the free energy was shown to behave the exact free energy, with reasonable accuracy, over a wide range of A. Thus at zero temperature

Waxman, David


J. Phyr. A Math. Gen. 24 (1991)3611.3623. Printed in the UK Non-analytic behaviour of the free energy of fermions coupled  

E-Print Network (OSTI)

to yield non-analytic terms in the free energy ofthe form A" In A where A is a parameter proponional to the size of the soliton. A representation of the free energy that is suitable for a small &expansion is derived for general soliton profiles. The non-analytic expansion of the free energy about A = 0 is found

Waxman, David


Forecast-Based Decision Support for San Francisco International Airport: A NextGen Prototype System That Improves Operations during Summer Stratus Season  

E-Print Network (OSTI)

During summer, marine stratus encroaches into the approach to San Francisco International Airport (SFO) bringing low ceilings. Low ceilings restrict landings and result in a high number of arrival delays, thus impacting ...

Reynolds, David W.


Transmission Line Workstation - Generation 2 (TLW-Gen2) v1.2: Single-Conductor Aeolian Vibration Design and Control Module  

Science Conference Proceedings (OSTI)

This is a complete rewrite of the platform supporting the Transmission Line Workstation. Theresult is to provide a common platform to share data and support tools between existing and future T&S software. This release adds Vibration and OpenDSS Fault calculations to the initial TFlash and ACDC line calculations.Benefits & Value: Simplified data input by sharing between ...



Forecast-Based Decision Support for San Francisco International Airport: A NextGen Prototype System That Improves Operations during Summer Stratus Season  

Science Conference Proceedings (OSTI)

During summer, marine stratus encroaches into the approach to San Francisco International Airport (SFO) bringing low ceilings. Low ceilings restrict landings and result in a high number of arrival delays, thus impacting the National Air Space (NAS). These ...

David W. Reynolds; David A. Clark; F. Wesley Wilson; Lara Cook


Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Kettlectric and myGen : portable, thermoelectric-based power generation systems for off-grid home use and the village entrepreneur  

E-Print Network (OSTI)

There are 1.6 billion people across the globe who still live without access to electricity. For this group, the modern electrical framework providing fundamental services for health, food and water processing and storage, ...

Kozlowski, Michael C. (Michael Charles)



Regulatory Safety Issues in the Structural Design Criteria of ASME Section III Subsection NH and for Very High Temperatures for VHTR & GEN IV  

Science Conference Proceedings (OSTI)

The objective of this task is to identify issues relevant to ASME Section III, Subsection NH [1], and related Code Cases that must be resolved for licensing purposes for VHTGRs (Very High Temperature Gas Reactor concepts such as those of PBMR, Areva, and GA); and to identify the material models, design criteria, and analysis methods that need to be added to the ASME Code to cover the unresolved safety issues. Subsection NH was originally developed to provide structural design criteria and limits for elevated-temperature design of Liquid Metal Fast Breeder Reactor (LMFBR) systems and some gas-cooled systems. The U.S. Nuclear Regulatory Commission (NRC) and its Advisory Committee for Reactor Safeguards (ACRS) reviewed the design limits and procedures in the process of reviewing the Clinch River Breeder Reactor (CRBR) for a construction permit in the late 1970s and early 1980s, and identified issues that needed resolution. In the years since then, the NRC and various contractors have evaluated the applicability of the ASME Code and Code Cases to high-temperature reactor designs such as the VHTGRs, and identified issues that need to be resolved to provide a regulatory basis for licensing. This Report describes: (1) NRC and ACRS safety concerns raised during the licensing process of CRBR , (2) how some of these issues are addressed by the current Subsection NH of the ASME Code; and (3) the material models, design criteria, and analysis methods that need to be added to the ASME Code and Code Cases to cover unresolved regulatory issues for very high temperature service.

William J. ODonnell; Donald S. Griffin



57USDA Forest Service Gen. Tech. Rep. PSW-GTR-158. 1995. Abstract: Despite a quarter of a century of prescribed burning by  

E-Print Network (OSTI)

of prescribed burning by the National Park Service (NPS) in California, there is reason to believe that the fuels situation is getting worse rather than better. The area burned in the past 10 years has declined by 42 percent compared to the previous 10 years. The total area burned per year from wildfire

Standiford, Richard B.


EURECOM and ECNU at TrecVid 2010: The Semantic ...  

Science Conference Proceedings (OSTI)

... ITI-CERTH_3 ITI-CERTH_4 MUG-AUTH_2 CPRBUPT1_1 FKI-MADM_4 _Fusebase_4 ecom_Gist_2 T+GT_run4_4 MMM-TJU4_4 MUG-AUTH_1 ...



Generating Natural Language Aggregations Using a Propositional Representation of Sets  

E-Print Network (OSTI)

always produces this ab- normality when it fails. 4 Oil Pump always produces this abnormality when (normal is combusting). 2 Oil Nozzle always produces this abnormal- ity when it fails. 3 Oil Supply valve it fails. 5 Oil Filter always produces this abnormal- ity when it fails. 6 System Control Module sometimes

Di Eugenio, Barbara


Proceedings of the 10th annual SIGCSE conference on Innovation and technology in computer science education  

Science Conference Proceedings (OSTI)

We are pleased to present the proceedings of the 10th Annual Conference on Innovation and Technology in Computer Science Education - ITiCSE 2005. We are honored to host this event, in particular as 2005 marks the tenth anniversary ITiCSE conference, ...

Jos Cunha; William Fleischman; Viera K. Proulx; Joo Loureno




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

through Sandia National Laboratories Future Renewable Electric Energy Delivery and Management Systems Center 2 Backgrounds and Objectives * Gen-I to Gen-III ETOs (Emitter...


Net Zero Energy High Performance Green Buildings Net Zero ...  

Science Conference Proceedings (OSTI)

... Tropical Forest Conservation R&D Partnerships: IPHE, CSLR, GNEP, GenIV, ITER, FutureGen International Partnerships & Initiatives Page 7. 7 ...



National Electric Transmission Congestion Study 2009 Executive Summary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Executive Executive Summary In the Energy Policy Act of 2005 (EPAct), Con- gress directed the U.S. Department of Energy (DOE) to conduct a study every three years on elec- tric transmission congestion and constraints within the Eastern and Western Interconnections. The American Reinvestment and Recovery Act of 2009 (Recovery Act) further directed the Secretary to in- clude in the 2009 Congestion Study an analysis of significant potential sources of renewable energy that are constrained by lack of adequate transmis- sion capacity. Based on this study, and comments concerning it from states and other stakeholders, the Secretary of Energy may designate any geographic area experiencing electric transmission capacity constraints or congestion as a national interest elec- tric transmission corridor (National Corridor). In August 2006, the Department published its first National Electric


17?-Estradiol Prevents Early-Stage Atherosclerosis in Estrogen Receptor-Alpha Deficient Female Mice  

E-Print Network (OSTI)

E 2 have been demonstrated for catechol estrogens (estrogensconverted to catechol estro- gens via oxidation) where

Villablanca, Amparo C.; Tenwolde, Amy; Lee, Michael; Huck, Melissa; Mumenthaler, Shannon; Rutledge, John C.



Bachelor of Science in Health Science with a Concentration in Health Services Administration 2012-2013 Old Dominion University Catalog  

E-Print Network (OSTI)

Guide GEN. ED. Oral Comm Skills 3 Can be satisfied in the major with CHP 400, 450, AND 415W or 430W. GEN and Ethics 3 Can be satisfied in the major with CHP 400 GEN. ED. Human Behavior 3 See Transfer Guide GEN. ED. Impact of Technology 3 Can be satisfied in the major with CHP 485 MAJOR REQUIREMENTS Old Dominion


centre for telematics and information progress report  

E-Print Network (OSTI)

on the vulnerabil- ity of SCADA protocols. Security venues such as DEFCON, Blackhat, and RSA have recently included implementation vulnerabilities that allow attack- ers to execute arbitrary code in specific SCADA protocols

Al Hanbali, Ahmad


CyberPhysical System Security for the Electric Power Grid  

E-Print Network (OSTI)

on the vulnerabil- ity of SCADA protocols. Security venues such as DEFCON, Blackhat, and RSA have recently included implementation vulnerabilities that allow attack- ers to execute arbitrary code in specific SCADA protocols

Manimaran, Govindarasu


2002 TMS Annual Meeting & Exhibition  

Science Conference Proceedings (OSTI)

elastic energy) open applications in sporting goods materials (golf clubs, skis, other ...... the process beginning, the velocity of components mixing, the veloc- ity of formation ...... Program Organizers: Nikhilesh Chawla, Arizona State University, .


Kheshbn No. 106- Fall 1985 - Journal  

E-Print Network (OSTI)

pnasipp :K. PI iti oipoa ,ton 01 ,8 r T n Oitt SOPO Tsa^ov sopo Tsa^o pnn uan jpnayrpt pK rtsroya on PK u ;prsa



Introduction to thematic issue: language policies and health  

E-Print Network (OSTI)

impaired/ailing or disabled body, one must return tocreate the problem of the disabled person (2006, p. 3).able, able-ism, disabled, disabil- ityemerged in the

Ramanathan, Vaidehi



By Karen Urschel, EVP  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

We've made key changes to the Earned Value Management Systems (EVMS) require- ments in DOE Order 413.3B to give responsibil- ity and authority to the contractors and Programs...


References - Energy Information Administration  

U.S. Energy Information Administration (EIA)

References 1.En ergy In for ma tion Ad min istra tion. Natu ral Gas Pro - duc tive Ca pac ity for the Lower 48 States 1980 through 1991 . DOE/EIA- 0542 (Wash ing ton ...


CO2-Water-Rock Interactions and the Integrity of Hydrodynamic...  

NLE Websites -- All DOE Office Websites (Extended Search)

InteraCtIOns and the IntegrIty Of hydrOdynamIC seals Background Developing confidence in methods of sequestering carbon dioxide (CO 2 ) in geological formations requires an...



Gasoline and Diesel Fuel Update (EIA)


Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Furnace Blower Electricity: National and Regional Savings Potential  

E-Print Network (OSTI)

Ducts Total Electricity Consumption (kWh/year) ity ni x FrDucts Total Electricity Consumption (kWh/year) nt a ni x Fryear. Furnace blowers account for about 80% of the total furnace electricity consumption

Franco, Victor; Florida Solar Energy Center



UC Davis Natural Reserve System-Four-Year Report (1999-2003)  

E-Print Network (OSTI)

7. Jepson Prairie Reserve 8. McLaughlin Natural Reserve 9.U.C. Davis U.C. Davis McLaughlin Publications Boulton, A.Grav- ity Survey of the McLaughlin Reserve: Study of Local

Harrison, Susan; Waddell, Shane M.; Boucher, Virginia L.



APD 2013.pptx  

Science Conference Proceedings (OSTI)

... s ity (c ou nts) 2? (degrees) Intensity (counts) 2? (degrees) ... G aithersbu rg 22-25 A p ril 2013 Testing for accuracy 40 60 80 100 120 140 160 0.9985 ...



Dk$2>ooo31-Environmental Radioactivity  

E-Print Network (OSTI)

. Hallstadius*, E. Holm*, and J. Lippert ·University of Lund, Sweden Abstract. Measurements of fallout, FOOD, FOOD CHAINS, GLOBAL FALLOUT, MILK, PLANTS, RADIOACTIV- ITY, SEA WATER, SHEEP, TABLES [1


Spanish and English of United States Hispanos (1975)  

E-Print Network (OSTI)

Ernesto Jesus de. Puerto Rico . . . Galvan, Roberto A UnAmerican Univers ity of Puerto RIco; Prof. Frank JosephSUAREZ, Jesus de. Puerto Rico eu-Nueva York: sociologa de

Teschner, Richard V.; Bills, Garland D.; Craddock, Jerry R



SDP vs. LP relaxations for the moment approach in some ...  

E-Print Network (OSTI)

ity moment conditions, yields a sequence of semidefinite programs (or SDP ... of such processes is that their infinitesimal generator maps the polynomials into polynomials. ...... The monitoring statistic Yt based on the likelihood ratio, see [1],


Carbon Nanostructured for Energy Storage Bingqing (BQ) Wei  

Science Conference Proceedings (OSTI)

... E n e rg y d e n s ity (W h /k g ) Power density (kW/kg) Flywheels Department of Energy (DOE) Target Ragone Chart NIST Workshop 2011BQWei ...



Friedmann_China 15Aug12.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

c lean c ities c onference 5. Hosting v isits t o t he US: * Huaneng * Shenhua * China Univ. M ining Tech. Lawrence Livermore National Laboratory LLNL---PRES---xxxxxx This w...


Community Greening: How to Develop a Strategic Energy Plan.  

NLE Websites -- All DOE Office Websites (Extended Search)

electric- ity planning for communities, using a step-by-step approach to develop the plan. This method has a high chance of success, because it is based on stakeholder buy-in...



E-Print Network (OSTI)

Assurance Symposium, Denver, Colorado, March 26-28, 1979.D .. Univ('r! '>ity of Colorado E" U. S. Geological Survey,hi= L~h('lrColorado, I Table 4. ELEMENTAL

Fox, J.P.



Development of a cold gas propulsion system for the TALARIS hopper  

E-Print Network (OSTI)

The TALARIS (Terrestrial Artificial Lunar And Reduced gravIty Simulator) hopper is a small prototype flying vehicle developed as an Earth-based testbed for guidance, navigation, and control algorithms that will be used for ...

Nothnagel, Sarah L. (Sarah Lynn)



Effects of Temporal Wind Patterns on the Value of Wind-Generated Electricity in California and the Northwest  

E-Print Network (OSTI)

Modeling Utility-Scale Wind Power Plants Part 2: Capac- ityNakafuji, "Grid Im- pacts of Wind Power Variability: RecentParsons, and M. Milligan, "Wind Power Impacts on Electric-

Wiser, Ryan H



Renewable source controls for grid stability.  

SciTech Connect

The goal of this study was to evaluate the small signal and transient stability of the Western Electric- ity Coordinating Council (WECC) under high penetrations of renewable energy, and to identify control technologies that would improve the system performance. The WECC is the regional entity responsible for coordinating and promoting bulk electric system reliability in the Western Interconnection. Transient stability is the ability of the power system to maintain synchronism after a large disturbance while small signal stability is the ability of the power system to maintain synchronism after a small disturbance. Tran- sient stability analysis usually focuses on the relative rotor angle between synchronous machines compared to some stability margin. For this study we employed generator speed relative to system speed as a metric for assessing transient stability. In addition, we evaluated the system transient response using the system frequency nadir, which provides an assessment of the adequacy of the primary frequency control reserves. Small signal stability analysis typically identi es the eigenvalues or modes of the system in response to a disturbance. For this study we developed mode shape maps for the di erent scenarios. Prony analysis was applied to generator speed after a 1.4 GW, 0.5 second, brake insertion at various locations. Six di erent WECC base cases were analyzed, including the 2022 light spring case which meets the renewable portfolio standards. Because of the di culty in identifying the cause and e ect relationship in large power system models with di erent scenarios, several simulations were run on a 7-bus, 5-generator system to isolate the e ects of di erent con gurations. Based on the results of the study, for a large power system like the WECC, incorporating frequency droop into wind/solar systems provides a larger bene t to system transient response than replacing the lost inertia with synthetic inertia. From a small signal stability perspective, the increase in renewable penetration results in subtle changes to the system modes. In gen- eral, mode frequencies increase slightly, and mode shapes remain similar. The system frequency nadir for the 2022 light spring case was slightly lower than the other cases, largely because of the reduced system inertia. However, the nadir is still well above the minimum load shedding frequency of 59.5 Hz. Finally, several discrepancies were identi ed between actual and reported wind penetration, and additional work on wind/solar modeling is required to increase the delity of the WECC models.

Byrne, Raymond Harry; Elliott, Ryan Thomas; Neely, Jason C.; Silva Monroy, Cesar Augusto; Schoenwald, David Alan; Grant, Lisa



Gene structure and expression of serotonin receptor HTR2C in hypothalamic samples from infanticidal and control sows  

E-Print Network (OSTI)

) [24] and psychia- tric disorders such as puerperal psychosis [25] there is a modest association with HTR2C specific haplotypes, but many genetic association studies in humans are incon- clusive or contradictory. More detailed recent analyses looking... TTGAAGGATGGGGATTCTTG cDNA 653 HTR2CX2-5 GTAGGCCAAGAATCCCCATC ACCAATAGGCCAATCAGGTG cDNA 263 HTR2CX4-5 CATGGTGAACCTGAGGAAAG GCAGAGACAGTGGCATGA cDNA 335 HTR2CX5-7 CATGCCACTGTCTCTGCTTG TGTTGTTGACGAACACCTTG cDNA 299/204 HTR2CNR TTGCCCAAACAATAGCAATC cDNA HTR2CL...

Quilter, Claire R; Bagga, Meenashki; Moinie, Ahmad; Junaid, Fatima; Sargent, Carole A



EA-1882: U.S. Department of Energy Loan Guarantee to Littlerock Solar Power  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

82: U.S. Department of Energy Loan Guarantee to Littlerock 82: U.S. Department of Energy Loan Guarantee to Littlerock Solar Power Gen 1, LLC for the Littlerock Solar Power Gen 1, LLC Project and to Swan Solar Power Gen Station 1, LLC for the Swan Solar Power Gen Station 1, LLC Project EA-1882: U.S. Department of Energy Loan Guarantee to Littlerock Solar Power Gen 1, LLC for the Littlerock Solar Power Gen 1, LLC Project and to Swan Solar Power Gen Station 1, LLC for the Swan Solar Power Gen Station 1, LLC Project Overview DOE prepared an Environmental Assessment for the Idaho National Laboratory (INL) Stand-Off Experiment (SOX) Range. The objective of the EA was to evaluate the potential environmental impacts of creating and operating the SOX Range. The EA evaluated two alternatives: (1) the proposed action, and (2) a 'No Action' alternative. The SOX Range will be used to


MINEX Compliant List  

Science Conference Proceedings (OSTI)

... SecuGen Corporation, 1G, 000A0035, SecuGen ANSI INCITS 378 Template Generator v3.5. BIO-key International, Inc. ... BIO-key International, Inc. ...



[14] a) H. Jia, G. Zhu, B. Vugrinovich, W. Kataphinan, D. H. Reneker, P. Wang, Biotechnol. Prog. 2002, 18, 1027. b) M. M. Demir, M. A.  

E-Print Network (OSTI)

and efficient energy sources/carriers to replace fossil fuels. Seeking renewable energy sources/car- riers of hydro- gen becomes a key issue that must be addressed if the hydro- gen economy is to be developed

Li, Jing


Institution Investigator  

E-Print Network (OSTI)

Manufacturing Inc, HydroGen Corp, Keithley Instruments, McKinsey & Company, MetaMateria Partners LLC, NexEnergy Inc, Honda of America Manufacturing Inc, HydroGen Corporation, Keithley Instruments, McKinsey



U.S. Energy Information Administration (EIA)

peter cave mining co. mine #1 martin 159 1504331 prep plant ... lincoln bank #88 3608106 t j mining inc t j #1 3608128 mt carmel co-gen, inc. mt. carmel co-gen culm ...


October 21, 2003, Board Public Meeting Testimony - Attachment...  

NLE Websites -- All DOE Office Websites (Extended Search)

to achieve a H2 vehicle commercialization decision in 20 15 NE - A new Gen IV Reactor in Idaho (and possibly a new Gen III+ start) appear within reach Game Changing Performance...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The unique evolution of the programmed cell death 4 protein in plants  

E-Print Network (OSTI)

vulgare GenBank: BAK08048; Sb, Sorghum bicolor GenBank:have three members such as Sorghum bicolor, BrachypodiumEVOD-8494 b PAWA5255 b PAWA2930 Sorghum bicolor Brachypodium

Cheng, Shijun; Liu, Renyi; Gallie, Daniel R



Hydrogen Energy Stations: Poly-Production of Electricity, Hydrogen, and Thermal Energy  

E-Print Network (OSTI)

the potential of hydro- gen energy stations as a source ofVegas energy station that has a lower electricity to hydro-hydro- gen roadmap in an effort led by the New York State Energy

Lipman, Timothy; Brooks, Cameron



Reflections on Day One  

Science Conference Proceedings (OSTI)

... Surface-based Networks Gas Conc. Standards Wind Velocity Standards ... Bottom Up Electricity Gen. General Industrial Energy Generation ...



Renewable Hydrogen: Technology Review and Policy Recommendations for State-Level Sustainable Energy Futures  

E-Print Network (OSTI)

PV), wind power, hydro- power, nuclear power, etc. Gridof hydro- gen as part of a solution to stationary power,

Lipman, Timothy; Edwards, Jennifer Lynn; Brooks, Cameron



GAO ET AL. VOL. 6 ' NO. 1 ' 234240 ' 2012 www.acsnano.org  

E-Print Network (OSTI)

the evolution of oxygen and hydro- gen.2,5 Increasing the number of charge car- riers that can reach

Yang, Peidong


to 150 GPa, consistent with the modulus values of large SWNT bundles (22). Al-  

E-Print Network (OSTI)

. Thiophene and ferrocene were dissolved in the car- bon source (liquid n-hexane), sprayed into the hydro- gen

Devoret, Michel H.


TROPIC: Transactional Resource Orchestration Platform In the Cloud Changbin Liu Yun Mao Xu Chen Mary F. Fernndez  

E-Print Network (OSTI)

of in gen- erating flow summaries. Compound and stateful signatures in Ju- niper's Netscreen-IDP suite [16

Pennsylvania, University of


Engineering Development & Applications - Nuclear Engineering...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies (FCT) Generation IV (Gen IV) Nuclear Energy Program Decontamination and Decommissioning Nuclear Regulatory Research Facilities Environmentally Assisted Cracking...


MANENT: An Infrastructure for Integrating, Structuring and Searching Digital Libraries  

E-Print Network (OSTI)

Department of Modern and Contemporary History, University of Genova, Via Balbi 6, 16126 Gen- ova, Italy, e

Mascardi, Viviana


Before the House Science and Technology Subcommittee on Energy and Environment  

Energy.gov (U.S. Department of Energy (DOE))

Subject: FutureGen Near-Zero Emission Power Plant By: Victor Der, Acting Assistant Secretary, Office of Fossil Energy



Luigi&Gen5le&Polese,&Commercial&Buildings&Research& ... Potential to integrate with building security systems for even ...



E-Print Network (OSTI)

(Revised 3/21/2012) APPLICANT Robert W. Lawhn Project Director GenOn Energy, Inc. 2655 Solera Moon Drive


"Price Hub","Trade Date","Delivery Start Date","Delivery End...  

U.S. Energy Information Administration (EIA) Indexed Site

NP 15 EZ Gen DA LMP Peak",41246,41247,41247,37.25,37.25,37.25,1.56,400,1,2 "NP 15 EZ Gen DA LMP Peak",41249,41250,41251,34,34,34,-3.25,3200,4,4 "NP 15 EZ Gen DA LMP...


Climate Change, Nuclear Power and Nuclear  

E-Print Network (OSTI)

Climate Change, Nuclear Power and Nuclear Proliferation: Magnitude Matters Rob Goldston MIT IAP biomass wind hydro coal CCS coal nat gas CCS nat gas nuclear Gen IV nuclear Gen III nuclear Gen II 5-1 Electricity Generation: CCS and Nuclear Power Technology Options Available Global Electricity Generation WRE


B.S.H.S. with a Concentration in Health Services Administration (with Licensure, A.A.S. Degree and/or Certification) 2013-2014 Old Dominion University Catalog  

E-Print Network (OSTI)

/or Certification) 2013-2014 Old Dominion University Catalog Name: UIN: Phone: Site: Old Dominion University Transfer Guide GEN. ED. Oral Comm Skills 3 Can be satisfied in the major with CHP 400, 450, AND 415W or 430 Guide GEN. ED. Philosophy and Ethics 3 Can be satisfied in the major with CHP 400 GEN. ED. Human


Bachelor of Science in Health Science with a Concentration in Health Services Administration 2011-2012 Old Dominion University Catalog  

E-Print Network (OSTI)

Comm Skills 3 See Transfer Guide/can be satisfied in the major with CHP 400, 450, AND 415W or 430W. GEN and Ethics 3 See Transfer Guide/can be satisfied in the major with CHP 400. GEN. ED. Human Behavior 3 See Transfer Guide GEN. ED. Impact of Technology 3 Can be satisfied in the major with CHP 485 MAJOR


B.S.H.S. with a Concentration in Health Services Administration (without Licensure, A.A.S. Degree and/or Certification) 2013-2014 Old Dominion University Catalog  

E-Print Network (OSTI)

and/or Certification) 2013-2014 Old Dominion University Catalog Name: UIN: Phone: Site: Old Dominion. Literature 3 See Transfer Guide GEN. ED. Oral Comm Skills 3 Can be satisfied in the major with CHP 400, 450 See Transfer Guide GEN. ED. Philosophy and Ethics 3 Can be satisfied in the major with CHP 400 GEN. ED


Energetics of hydrogen in amorphous silicon: An ab initio study Blair Tuttle*  

E-Print Network (OSTI)

poten- tial energy would determine the occupancy of various hydro- gen binding states. However, recent, after 70% of the hydro- gen evolved, the activation energy was 2.1 eV. In general, there may theoreti- cal studies. We provide estimates for the energies of hydro- gen trap levels ET , ES , and ED

Adams, James B


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

SP-15 Gen DA LMP Peak",39904,39905,39905,30.85,30,30.44,"na",69200,129,16 SP-15 Gen DA LMP Peak",39904,39905,39905,30.85,30,30.44,"na",69200,129,16 "SP-15 Gen DA LMP Peak",39905,39906,39907,28.7,27.5,28.03,-2.41,119200,103,17 "SP-15 Gen DA LMP Peak",39906,39909,39909,31.5,30.25,30.5,2.47,43200,89,17 "SP-15 Gen DA LMP Peak",39909,39910,39910,33.3,32.45,32.83,2.33,40800,80,20 "SP-15 Gen DA LMP Peak",39910,39911,39912,29,28,28.69,-4.14,116000,117,22 "SP-15 Gen DA LMP Peak",39911,39913,39914,27.25,26.55,26.88,-1.81,96800,110,21 "SP-15 Gen DA LMP Peak",39912,39916,39916,28.5,27.5,28.01,1.13,58000,119,19 "SP-15 Gen DA LMP Peak",39916,39917,39917,26.65,25,26.27,-1.74,26400,51,17 "SP-15 Gen DA LMP Peak",39917,39918,39918,28.25,27.7,27.97,1.7,55600,101,20


Department of Energy Formally Commits $1 Billion in Recovery Act Funding to  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Formally Commits $1 Billion in Recovery Act Formally Commits $1 Billion in Recovery Act Funding to FutureGen 2.0 Department of Energy Formally Commits $1 Billion in Recovery Act Funding to FutureGen 2.0 September 28, 2010 - 1:00pm Addthis Washington, DC - U.S. Energy Secretary Steven Chu today announced that the Department of Energy has signed final cooperative agreements with the FutureGen Industrial Alliance and Ameren Energy Resources that formally commit $1 billion in Recovery Act funding to build FutureGen 2.0. The FutureGen 2.0 project will help to position the United States as a leader in innovative technologies for reducing carbon emissions from existing coal-fired power plants. As part of this new initiative, the Department of Energy will partner with the FutureGen Industrial Alliance to select an

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Department of Energy Formally Commits $1 Billion in Recovery Act Funding to  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Formally Commits $1 Billion in Recovery Act Formally Commits $1 Billion in Recovery Act Funding to FutureGen 2.0 Department of Energy Formally Commits $1 Billion in Recovery Act Funding to FutureGen 2.0 September 28, 2010 - 12:00am Addthis Washington, D.C. - U.S. Energy Secretary Steven Chu today announced that the Department of Energy has signed final cooperative agreements with the FutureGen Industrial Alliance and Ameren Energy Resources that formally commit $1 billion in Recovery Act funding to build FutureGen 2.0. The FutureGen 2.0 project will help to position the United States as a leader in innovative technologies for reducing carbon emissions from existing coal-fired power plants. As part of this new initiative, the Department of Energy will partner with the FutureGen Industrial Alliance to select an


EIS-0460: DOE Notice of Availability of the Draft Environmental Impact  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE Notice of Availability of the Draft Environmental DOE Notice of Availability of the Draft Environmental Impact Statement EIS-0460: DOE Notice of Availability of the Draft Environmental Impact Statement FutureGen 2.0 Project, Morgan County, Illinois DOE announces the availability of the Draft Environmental Impact Statement for the FutureGen 2.0 Project (DOE/EIS-0460D) for public review and comment, as well as the date, location, and time for a public hearing. The draft environmental impact statement (EIS) analyzes the potential impacts associated with the FutureGen 2.0 Project (FutureGen 2.0), which would be designed, constructed, operated, and partially funded by the FutureGen Industrial Alliance, Inc. (Alliance). In addition to Alliance funding, FutureGen 2.0 may receive approximately $1 billion in federal


Determination of the cross sections of (n,2n), (n,gamma) nuclear reactions on germanium isotopes at the energy of neutrons 13.96 MeV  

E-Print Network (OSTI)

The cross sections of 70Ge(n,2n)69Ge, 72Ge(n,2n)71Ge, 76Ge(n,gamma)77(g+0.21m)Ge, 76Ge(n,2n)75Ge nuclear reactions were measured at the energy of neutrons 13.96(6) MeV by activation method with gamma-ray and X-ray spectra studies.

S. V. Begun; O. G. Druzheruchenko; O. O. Pupirina; V. K. Tarakanov



The virtual power system testbed and inter-testbed integration  

Science Conference Proceedings (OSTI)

The Virtual Power System Testbed (VPST) at University of Illinois at Urbana-Champaign is part of the Trustworthy Cyber Infrastructure for the Power Grid (TCIP) and is maintained by members of the Information Trust Institute (ITI). VPST is designed to ...

David C. Bergman; Dong Jin; David M. Nicol; Tim Yardley



96 IEEE power & energy magazine march/april 2005 THE MASSIVE POWER OUTAGE OF  

E-Print Network (OSTI)

collaboration among economists, scientists, and engineers to slowly but surely transform the power grid96 IEEE power & energy magazine march/april 2005 T THE MASSIVE POWER OUTAGE OF August 2003 underscored the vulnerabil- ity of our nation's power grid and the fact that this vital yet complex infrastruc

Amin, S. Massoud


A message from Dean Joyce Berry March 2010 WCNR Spotlight  

E-Print Network (OSTI)

by reforming petroleum, a nonrenewable energy re- source. By operating at ambient temperature and without com: water and energy. Today, water providers are forced to tap sources of lower quality: polluted ground and river water, eutrophic lake and reservoir water, and wastewater. These poor-qual- ity sources need


UMass Lowell recently worked with Boston-area consulting group Maguire  

E-Print Network (OSTI)

. Their modular, 945-square- foot entry, "4D," was transported and assembled at the competition site in Washington that these themes fit per- fectly given the University's high qual- ity academics, affordability and emphasis the world vying to deliver the most energy- efficient, cost-effective and aesthetically pleasing home

Massachusetts at Lowell, University of


KUNLP system using Classification Information Model at SENSEVAL-2  

E-Print Network (OSTI)

model or CIM classi- fies instances by considering the discrimination abil- ity of their features, which was proven to be useful for word sense disambiguation at SENSEVAL-1. But the CIM has a problem of information loss. KUNLP system at SENSEVAL-2 uses a modified version of the CIM for word sense disambiguation. We


Metadata for Digital Libraries: Architecture and Design Rationale \\Lambda Michelle Baldonado ChenChuan K. Chang Luis Gravano  

E-Print Network (OSTI)

, the full text of #12; a textual document would be included as the value of its Full Text attribute, interoperabil­ ity, attribute model, attribute model translation, meta­ data repository, InfoBus, proxy this information metadata. In an earlier paper [1], we analyzed the needs of our digital library InfoBus archi

Gravano, Luis


Documents de Travail du Centre d'Economie de la Sorbonne  

E-Print Network (OSTI)

" , second that "the stabil- ity of a market system depends on the fact that prices are private information). The analysis is performed using the notion of stochastic stability (see the exposition of stochastic stability echoes the principle of minimum energy in thermodynamics, it would be compatible with the presence

Paris-Sud XI, Université de


Lithium Inhibits a Late Step in Agrin-Induced AChR Aggregation  

E-Print Network (OSTI)

Lithium Inhibits a Late Step in Agrin-Induced AChR Aggregation S. K. Sharma,* B. G. Wallace 1. Here we report that treating chick myotubes with lithium prevented any detectable agrin-induced change phosphorylation and detergent extractabil- ity. Lithium treatment also increased the rate at which AChR aggregates

Sharma, Shiv K.



E-Print Network (OSTI)

STYRIAN AcADEmY FoR SUSTAINABlE ENERGIES INTERNATIoNAl WINTER School 2011 "SUSTAINABlE SmART cITIES climate, hazardous nuclear technologies, high investment costs for modernizing the energy system ­ are facing a pressure to change which will alter the image of the city. As a consequence, the compatibility


The Tycho Slate: Complex Drawing and Editing in Tcl Tk H. John Reekie and Edward A. Lee  

E-Print Network (OSTI)

The Tycho Slate: Complex Drawing and Editing in Tcl Tk H. John Reekie and Edward A. Lee School at UC Berkeley. The Slate is layered over the Tcl Tk can- vas, and contains features that we believe is the abil- ity to de ne new item types in Tcl. The second is an implementation of the concept of interactor

California at Berkeley, University of


The Tycho Slate: Complex Drawing and Editing in Tcl/Tk H. John Reekie and Edward A. Lee  

E-Print Network (OSTI)

The Tycho Slate: Complex Drawing and Editing in Tcl/Tk H. John Reekie and Edward A. Lee School at UC Berkeley. The Slate is layered over the Tcl/Tk can­ vas, and contains features that we believe is the abil­ ity to define new item types in Tcl. The second is an implementation of the concept of interactor

California at Berkeley, University of


Marketing research for EE G Mound Applied Technologies' heat treatment process of high strength materials  

Science Conference Proceedings (OSTI)

This report summarizes research conducted by ITI to evaluate the commercialization potential of EG G Mound Applied Technologies' heat treatment process of high strength materials. The remainder of the report describes the nature of demand for maraging steel, extent of demand, competitors, environmental trends, technology life cycle, industry structure, and conclusion. (JL)

Shackson, R.H.



KNOWLEDGEENHANCED COMONITORING IN COALMINES Wolfram Burgard 1 , Armin B. Cremers 1 , Dieter Fox 1 ,  

E-Print Network (OSTI)

KNOWLEDGE­ENHANCED CO­MONITORING IN COAL­MINES Wolfram Burgard 1 , Armin B. Cremers 1 , Dieter Fox of underground fires is an important secur­ ity task in hard­coal mining. Automated fire detection systems system is still in a prototypic stage, the three major German hard­coal mining companies decided to use

Burgard, Wolfram


Abstract--This paper addresses the problem of interaction between short run and long run locational signals and the coordination between generation investments and lumpy transmission  

E-Print Network (OSTI)

electricity from distributed producers, and also sell electric- ity to consumers, via a Tariff Market­a new and selling electricity. The Tariff Market design, explained fur- ther in Section 2, incentivizes Broker a Wholesale Market where electricity can be traded in larger quantities. Let T be a Tariff Market consisting

Paris-Sud XI, Université de


This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network (OSTI)

a viscos- ity decrease when unentanglements occur [38]. We recall that in Brownian dynamics simulation- molecules 36 (2003) 3890. [31] A. Tiwari, A.K. Nema, C.K. Das, S.K. Nema, Thermochim. Acta 417 (2004) 133.N. Medvedev, Macromol. Theory Simul. 4 (1995) 745. [40] W. Brostow, M. Drewniak, J. Chem. Phys. 105 (1996

North Texas, University of


2510 IEEE TRANSACTIONS ON INDUSTRIAL ELECTRONICS, VOL. 60, NO. 6, JUNE 2013 Control Strategies for Augmenting LVRT Capability  

E-Print Network (OSTI)

for Augmenting LVRT Capability of DFIGs in Interconnected Power Systems M. Jahangir Hossain, Member, IEEE, Tapan (DFIGs), lin- earization, low-voltage ride-through (LVRT) capability, nonlinear- ity, robust control of common coupling. DFIG Doubly fed induction generator. GSC Grid-side converter. VSC Voltage

Pota, Himanshu Roy


Brain dynamics promotes function Carlos Lourenco  

E-Print Network (OSTI)

dynamics? At this point in brain research, we are happy if we can at least provide a partial answer. Key. Natural scientists look for correlations between measured electrical signals and behavior or mental states by considering the so-called dynamical complex- ity as revealed e.g. by the measurement of the brain's electrical

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Hierarchical Spatio-Temporal Context Modeling for Action Recognition , Shuicheng Yan3  

E-Print Network (OSTI)

-temporal context model with the Space-Time Inter- est Point (STIP) proposed in [6] for recognizing human ac- tions performance comparison of our hierarchical spatial-temporal context model with the STIP features in [6+TPD, SIFT+TTD+TPD, STIP. jectory transition descriptor (TTD), and trajectory proxim- ity descriptor (TPD

Fah, Cheong Loong


Bulletin of Latin American Research, 2011 DOI:10.1111/j.1470-9856.2011.00529.x The Global Gold Mining Industry,  

E-Print Network (OSTI)

became deputy and acting director of the Office of Energy Research and Development Policy of the National, awarded jointly by the American Association of Engineering Societies and the National Audubon Society. He, and Asia and on energy facil ity siting, including nuclear waste shipping and storage. In addition to his

Wisconsin at Madison, University of


V = x G %N+, y G Z+, z G {0, 1}N : ? ieNR ixi S RU W y, xSz}, R i >0 ...  

E-Print Network (OSTI)

T h i s set app e ar s a s a common su b st r u c tu r e of man y n et work des ign ... For a m u lt icommo d ity n et work des ign probl e m with e ithe r fix ed c h arg...


? ? ? "! ?# "?$? ?!&% ' ?0 214365785 9?@BAC@E D"FHG$IQPS R  

E-Print Network (OSTI)

9?@BAC@E D"FHG$IQPS R. TFHUWVYXa`abcFHd7`f eYg2 hieYbqp IrdWVY`) eYXaIts P$ u vwUE`aIrbxIty IteYd. FHXa te7e. FHXa te7e vwd7` VYXaIte. de.


Consciousness in Robots: The Hard Problem and Some Less Hard Problems  

E-Print Network (OSTI)

Consciousness in Robots: The Hard Problem and Some Less Hard Problems B. J. MacLennan Department it is also important. Finally we explore the Hard Problem for robots (i.e., whether they can experience sub, intentional- ity, evolutionary psychology, artificial life, autonomous robots, the hard problem I

Tennessee, University of


Diurnal and seasonal variations of wind farm impacts on land surface temperature over western Texas  

E-Print Network (OSTI)

industry has installed a total of 46,919 megawatts (MW) of capac- ity, making it second in the world behind, University at Albany, State University of New York, 1400 Washington Avenue, Albany, NY 12222, USA e energy is among the world's fastest growing sources of energy. Through the end of 2011, the US wind

Zhou, Liming


The open archives initiative: building a low-barrier interoperability framework  

Science Conference Proceedings (OSTI)

The Open Archives Initiative (OAI) develops and promotes interoperabil ity solutions that aim to facilitate the efficient dissemination of content. The roots of the OAI lie in the E-Print community. Over the last year its focus has been extended to include ... Keywords: digital libraries, interoperability, metadata, protocols

Carl Lagoze; Herbert Van de Sompel



GPUfs: Integrating a File System with GPUs Mark Silberstein  

E-Print Network (OSTI)

access to files on the host OS file system. Although the power, functionality, and util- ity of today and the GPU's local memory. Man- aging data transfers between CPU and GPU increases the design Permission enjoyed by CPU programmers for decades. We propose GPUfs , an infrastructure that exposes the file sys

Keidar, Idit


Focus on Research Three New DOE Energy Centers Awarded  

E-Print Network (OSTI)

on the three projects. "We also face short- age of power system engineers, energy engineers and skilled workers Center supports a comprehensive training infrastructure for sales, design, installation, commissioning, util- ity officers, manufacturing executives, and workforce development agencies, the GridSTAR Center

Yener, Aylin



E-Print Network (OSTI)

and underground util- ity lines were installed and the team has started to build the infrastructure simulta- neously. Through the utilization of this de- livery method, UCSF is able to receive the building including the Memory and Aging Center and Multiple Sclerosis Center, the Institute for Neurodegenerative

Yamamoto, Keith


Project Kittyhawk: Building a Global-Scale Computer Blue Gene/P as a Generic Computing Platform  

E-Print Network (OSTI)

power plants [8], colocating physical machines in large data centers, over-committing physical hardware to building a power plant from a collection of portable generators. That is, commod- ity computers were never. The explosive growth of the Internet is creating a demand for inexpensive online computing capacity. This demand

Appavoo, Jonathan



E-Print Network (OSTI)

gradient (b) Horizontal commissioning in the accelerator. Figure 1. Results from CEBAF on 5­cell 1.5 GHz machines, it is most informative to investigate the experience to date of the SRF cavities of CEBAF. [10] Figure 1 shows the achieved gradients in the CEBAF cav­ ities, both in vertical testing and in horizontal


Proceedings of the 14th annual ACM SIGCSE conference on Innovation and technology in computer science education  

Science Conference Proceedings (OSTI)

Welcome to Paris and the 14th Annual ACM SIGCSE conference on Innovation and Technology in Computer Science Education (ITiCSE 2009) at Universit Pierre et Marie Curie -- Paris 6 (UPMC). We are pleased to present the proceedings of the conference. ...

Patrick Brzillon; Ingrid Russell; Jean-Marc Labat



A Re nery Immobot for Abnormal Situation Management Kurt D. Krebsbach and David J. Musliner  

E-Print Network (OSTI)

be extremely costly,resulting in poor product qual- ity, schedule delays, equipment damage, reduced occu represents an extreme case within the spec- trum of major industrial process disruptions, collec- tively, estimating (abnormal) states, and diagnosing, isolating, and recovering from mal- functions. At the Honeywell

Krebsbach, Kurt D.


Revenue Management: A Real Options Approach  

E-Print Network (OSTI)

case a subtle but noticeable upward trend in the average rental price is observed. In any event. The active management typically occurs through managerial levers such as price, promotion or availabil- ity acceptable prices and inventory release quantities (number of cars available for rent at a given price

Marcotte, Patrice



E-Print Network (OSTI)

investigations by federal energy regulators of possible manipulation of electricity prices in California by EnronA FIRST LOOK AT THE EMPIRICAL RELATION BETWEEN SPOT AND FUTURES ELECTRICITY PRICES IN THE UNITED the statistical properties of wholesale electric- ity spot and futures prices traded on the New York Mercantile

Marathe, Achla


Effect of Blast Design on Crack Response C.H. Dowding  

E-Print Network (OSTI)

to determine those with the best correlation. Variations in the ground motion and air pressure wave (air blast Conference Siebert and Dowding (2000) described development of the autonomous crack measurement (ACM) system). These theses are available online at www.iti.northwestern.edu/research/current/acm. This article describes


California's Energy Recovery and Reinvestment Act  

E-Print Network (OSTI)

California's Energy Recovery and Reinvestment Act P I iti tiProgram Initiatives November 18, 2009 Director Economic Stimulus Program California Energy CommissionCalifornia Energy Commission #12 Act (ARRA) Energy Programs · Programs the Energy Commission is Administering · Workforce Opportunities


Sustainable Energy Science and Engineering Center Hydrogen Storage  

E-Print Network (OSTI)

Sustainable Energy Science and Engineering Center Hydrogen Storage #12;Sustainable Energy Science 1990 2000 2010 2020 Hydrogen pellets Mg(NH3)6Cl2 Hydrogen Storage Source: Ian Edwards, ITI Energy, May. Portable applications including: computing, cell-phones and cameras (the 3 `C's'). Main Energy Storage

Krothapalli, Anjaneyulu


This document was downloaded on May 22, 2013 at 14:28:55 Author(s) Naval Postgraduate School (U.S.)  

E-Print Network (OSTI)

, procedures and objectives. In 1973, the Naval Postgraduate School, together with the Naval War College. ADMISSIONS PROCEDURES U.S. NAVAL OFFICERS U.S. Navy officers interested in ad- mission to one- ity of quotas assigned to each country. The procedures for application are con- tained in OPNAV

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


This document was downloaded on May 22, 2013 at 14:29:10 Author(s) Naval Postgraduate School (U.S.)  

E-Print Network (OSTI)

, procedures and objectives. In 1973, the Naval Postgraduate School, together with the Naval War College or local bookstores, or from other students. ADMISSIONS PROCEDURES U.S. NAVAL OFFICERS U.S. Navy officers. Their admission is subject to availabil- ity of quotas assigned to each country. The procedures for application


This document was downloaded on May 22, 2013 at 14:29:21 Author(s) Naval Postgraduate School (U.S.)  

E-Print Network (OSTI)

, procedures and objectives. In 1973, the Naval Postgraduate School, together with the Naval War College MILITARY OFFICERS ADMISSIONS PROCEDURES U.S. NAVAL OFFICERS U.S. Navy officers interested in ad- Military- ity of quotas assigned to each country. The procedures for application are con- 8 #12;GENERAL


677.ps.gz - Optimization Online  

E-Print Network (OSTI)

Cwitjh{b |S one for each commod ity pairs BAS EDS ! an6 we are as e to satisfy the mahy imX m fraction~} of allj eman6 si i.e. mahyf} s bGt ect...


MSU Extension Publication Archive Archive copy of publication, do not use for current recommendations. Up-to-date  

E-Print Network (OSTI)

,A.L facilities need notbe elaborate or unduly expensive. Itis essential, however, that they be strong andsolid of an efficient recordkeeping system; 2) well-designed, strong cattle- handling facilities; 3) a sound nutrition-trained A.I. technician. Records Accurate and complete records are essential to any intensive management


Sustainable use of California biomass resources can help meet state and national bioenergy targets  

E-Print Network (OSTI)

the energy supply. The sustainable use of biomass can reduceBiomass as Feedstock for a Bioenergy and Bioprod- ucts Industry: The Technical Feasibility of a Billion-Ton Annual Supply.supply, renewabil- ity of this resource, sustainability of production and utilization practices, feasibility of advanced technologies for converting biomass

Jenkins, Bryan M; Williams, Robert B; Gildart, Martha C; Kaffka, Stephen R.; Hartsough, Bruce; Dempster, Peter G



Learning to Manage Combined Energy Supply Systems Azalia Mirhoseini, Farinaz Koushanfar  

E-Print Network (OSTI)

. of of Electrical and Computer Engineering, Rice University, Houston, Texas azalia@rice.edu, farinaz- alone supply because of their comparatively higher leakage and lower energy density. Due functional capabil- ities. The wide-spread usage of batteries is because of their cost, rechargeability


Molly Lutcavage Scott Kraus  

E-Print Network (OSTI)

to influence spotter pilot par- ticipation. Aerial photographic surveys may provide a means ofobtaining area; Suzuki and Ishizuka, 1991; Safina, 1993). Aerial surveys have been used to obtain relative indices signals such as bioluminescence or turbid- ity fields. Visual biomass estimates from aerial survey data


Net Force on a Dam Consider a dam holding back an incompressible fluid such as water. Let us suppose that  

E-Print Network (OSTI)

and dams Research dealing with the interaction between a gravity cur- rent and obstacles is scare. A first catching dam heights. For the reference avalanche, the veloc- ity just behind the nose in the head% for the 2-D simulation. The reduction in front velocity due to the presence of dams was an increasing

Keesling, James


Space geodesy to understand the recent fall in the Lake Victoria M. Van Camp 1 , O. de Viron 2 , J.  

E-Print Network (OSTI)

and dams Research dealing with the interaction between a gravity cur- rent and obstacles is scare. A first catching dam heights. For the reference avalanche, the veloc- ity just behind the nose in the head% for the 2-D simulation. The reduction in front velocity due to the presence of dams was an increasing

Dessert, Céline


The Open Biochemistry Journal, 2008, 2, 121-128 121 1874-091X/08 2008 Bentham Open  

E-Print Network (OSTI)

-assays, together with enzymatic activity and cell proliferation assays, reveal that the levels of paclitaxel in which differential activity of caspase-3 in lung versus breast tumor cell lines controls tumor sensitivity and resistance to paclitaxel. We found that lung tumor cells, with repressed caspase-3 activ- ity

Larson-Prior, Linda


Detection of CO2 Seepage From Geological Sequestration Sites Using an Array of Downhole Pressure Gauges Jalal Jalali, Shahab D. Mohaghegh, Dept. of Petroleum & Natural Gas Engineering, West Virginia University  

E-Print Network (OSTI)

especially in smart fields because of their improved reliability and valuable information they provide?50?1 grid system. Some of the reservoir properties are shown on Table 1. )()(2 iTi i XXXXD --= Figure 4 prediction 4 days after seepage occurred in the reservoir. Figure 2 shows the architecture of the ANN (Back

Mohaghegh, Shahab


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Counterparties"  

U.S. Energy Information Administration (EIA) Indexed Site

1246,41247,41247,44.25,43.5,43.87,2.68,16400,29,14 1246,41247,41247,44.25,43.5,43.87,2.68,16400,29,14 "SP-15 Gen DA LMP Peak",41247,41248,41248,43,42,42.36,-1.51,36800,59,23 "SP-15 Gen DA LMP Peak",41248,41249,41249,40.25,39.75,40,-2.36,17200,24,11 "SP-15 Gen DA LMP Peak",41249,41250,41251,37,36.5,36.56,-3.44,31200,28,13 "SP-15 Gen DA LMP Peak",41250,41253,41253,41.25,40,40.84,4.28,12000,26,16 "SP-15 Gen DA LMP Peak",41253,41254,41254,39.5,38.5,39.08,-1.76,12400,26,15 "SP-15 Gen DA LMP Peak",41254,41255,41255,39.45,39,39.11,0.03,15600,26,13 "SP-15 Gen DA LMP Peak",41255,41256,41256,43.75,42,43.02,3.91,16000,32,20 "SP-15 Gen DA LMP Peak",41256,41257,41258,43,40.5,42.17,-0.85,38400,32,18 "SP-15 Gen DA LMP Peak",41257,41260,41260,42,41.5,41.62,-0.55,6400,10,11



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WA (DOEEIS-0467) FOSSIL ENERGY 12. Hydrogen Energy California's Integrated Gasification Combined Cycle Project, CA (DOEEIS-0431) 13. FutureGen 2.0 (DOEEIS-0460) 14. Lake...


Porous Core-Shell Nanostructures for Catalytic Applications  

E-Print Network (OSTI)

kinetic and sum frequency gen- eration vibrational spectroscopy study. Journal of the American Chemicalkinetic studies of their activity and stability against leach- ing. Journal of the American Chemical

Ewers, Trevor David



Secretary Bodman in India Highlights Clean Energy Investment...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

including India's new membership in the International Thermonuclear Experiment Reactor (ITER), their participation in the FutureGen Initiative, and joint efforts between the two...


Bridging the Gap Between Transportation and Stationary Power: Hydrogen Energy Stations and their Implications for the Transportation Sector  

E-Print Network (OSTI)

of renewable energy). 14. Energy Service Companies Anothersell electricity and provide energy services. TheseCompanies (GenCos), Retail Energy Service Providers (RESPs),

Weinert, Jonathan X.; Lipman, Timothy; Unnasch, Stephen



No Slide Title  

Science Conference Proceedings (OSTI)

... Sunlight Wind Air Water CO 2 Solar cells Wind mills Wave gen. Farms Heat Electricity Gasoline Diesel Jet A Page 8. Energy Markets US (2005): ...



Annual Electric Generator data - EIA-860 data file  

U.S. Energy Information Administration (EIA)

The "Boiler_Gen" identifies which boilers are associated with each generator; the "Boiler_Cool" tab shows which cooling systems are associated with each boiler; ...


Folie 1  

Science Conference Proceedings (OSTI)

... CoGen unit Heat puffer storage Peak boiler Space heating circuit Hot water supply system ... Storages CHP Unit Peak Load Boiler Thermal Building ...




NLE Websites -- All DOE Office Websites (Extended Search)

January 2006 January 2006 *Sequestration in the News *Geology *Terrestrial *Legislative Activity *Science *Technology *Trading *Events and Announcements *Policy *Ocean *Recent Publications *Contact Information Sequestration in the News THE CARBON SEQUESTRATION NEWSLETTER http://www.netl.doe.gov/technologies/carbon_seq/index.html Page 1 Department of Energy Press Release, "FutureGen Project Launched." In a press release issued on December 6, Sec- retary of Energy Samuel W. Bodman announced the official "kick off" of the FutureGen project by the Department of En- ergy with the signing of the FutureGen Industrial Alliance agreement. The FutureGen Industrial Alliance consists of: American Electric Power (Columbus, OH); BHP Billiton

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Program & Project Management For The Acquisition Of Capital Assets  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 3, 2011 February 3, 2011 Operational Organization Chart (FY 11) Office of Engineering & Construction Management POLICY - GUIDANCE -OVERSIGHT Pete Check Deputy Director Les Novitsky - Management Analyst (on detail) Rosalyn Matthews - Program Support Specialist EIR Program Analyst (IBM) - Monica Morris Robert Raines Director for Project Management Systems & Assessments Peter O'Konski Director for Facilities Management & Professional Development Paul Bosco Director Real Estate Tom Geronikos - Realty Spec Mark Price - Realty Spec David Steinau - Realty Spec Project Management James Fountain - Prog Analyst John Makepeace - Prog Analyst Cynthia Seiter - Prog Analyst Project Mgt Assessment Mike Peek - Gen Engr Tom Bruder- Gen Engr Brian Huizenga - Gen Engr Rick Elliott -- Gen Engr


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

40182,40183,40183,52.5,51.5,51.85,0.9,67600,116,25 40182,40183,40183,52.5,51.5,51.85,0.9,67600,116,25 "SP-15 Gen DA LMP Peak",40183,40184,40184,51.75,50.5,51.01,-0.84,61600,115,25 "SP-15 Gen DA LMP Peak",40184,40185,40185,53,50.5,51.39,0.38,59600,115,24 "SP-15 Gen DA LMP Peak",40185,40186,40187,58.5,55,56.79,5.4,394400,381,29 "SP-15 Gen DA LMP Peak",40186,40189,40189,51.25,50.75,51,-5.79,59200,116,26 "SP-15 Gen DA LMP Peak",40189,40190,40190,50.25,49,49.8,-1.2,53600,102,25 "SP-15 Gen DA LMP Peak",40190,40191,40192,51.5,50.75,51.12,1.32,59200,61,19 "SP-15 Gen DA LMP Peak",40191,40193,40194,49,48.25,48.35,-2.77,77600,71,20 "SP-15 Gen DA LMP Peak",40192,40196,40196,50.5,50,50.3,1.95,38800,71,18 "SP-15 Gen DA LMP Peak",40193,40197,40197,51.35,50,50.93,0.63,66800,84,19


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

contractor LATA Environmental Services of Kentucky. http:energy.govemarticlescost-efficient-work-rids-paducah-site-old-facilities Article FutureGen Industrial Alliance...


zentrum hygiene und humangenetik ABTEIlUNG HUMANGENETIK centre for hygiene and human Genetics DEPARTMENT OF HUMAN GENETICS  

E-Print Network (OSTI)

progenitors. J. Gen. Virol. 77:3099­3102. 40. Miltenberger, R. J., K. A. Sukow, and P. J. Farnham. 1995. An E

Gollisch, Tim



NLE Websites -- All DOE Office Websites (Extended Search)

... 46 Figure A1.4. ATD Gen 2 cell with brass connectors and vellum insulator on the negative tab. ... 47 Figure A1.5....


INEEL/EXT-03-00095 Advanced Technology Development Program For...  

NLE Websites -- All DOE Office Websites (Extended Search)

...97 A2.5. ATD Gen 2 cycle-life cell with brass connectors and vellum insulator on the negative tab. ...98 A2.6....


Reformulation of a model for hierarchical divisive graph modularity ...  

E-Print Network (OSTI)

generation algorithm originally proposed by Grtschel and Wakabayashi (1989) for gen- ... column generation algorithm proposed by Cafieri et al. (2010), and a...


Honda Insight Fleet and Accelerated Reliability Testing  

NLE Websites -- All DOE Office Websites (Extended Search)

Gen II Insight HEV Accelerated Testing - August 2012 Two model year 2010 Honda Generation II Insight hybrid electric vehicles (HEVs) entered Accelerated testing during July 2009 in...



Science Conference Proceedings (OSTI)

... gen; radiation correction; thermal con- with measurements on liquid toluene as ductivity; thermal diffusivity; toluene; well as argon and nitrogen gas. ...



Buchbesprechungen - Springer  

Science Conference Proceedings (OSTI)

sache, dab der Autor in einem Bereich, in dem Deutsch nicht die Staatssprache ist ... gen- und Elektroneninterferenzen in der Chemie. 2. erwei- terte AufI...


NIST Tech Beat for June 7, 2011  

Science Conference Proceedings (OSTI)

... These tiny objects can deliver drugs efficiently and enhance the properties of ... NIST Contests in China Put Next-Gen Robot Technologies to the Test. ...



Sex steroid metabolism polymorphisms and mammographic density in pre- and early peri-menopausal women  

E-Print Network (OSTI)

potentially carcinogenic catechol estro- gens, especially 4-tion of 4-hydroxy catechol estrogens in carcinogenesisof cytochrome P450 1B1 and catechol-O-methyltrans- ferase in



Premixed Carbon MonoxideNitrous OxideHydrogen Flames ...  

Science Conference Proceedings (OSTI)

... the combustion emission charac- teristics of stationary and mobile power plants. ... present data are in good agreement with the low-hydro- gen data ...



CODATA recommended values of the fundamental physical ...  

Science Conference Proceedings (OSTI)

... for Mass and Related Quantities CCM W90 conventional unit of power: W90=V90 ... theoretical ex- pression for an energy level of either hydro- gen H ...




Science Conference Proceedings (OSTI)

... array maps the effect of laser power and pulse ... was discovered at lower laser powers, suggesting a ... with studies of some model hydro- gen bonding ...



User's Guide for the  

Science Conference Proceedings (OSTI)

... the computer system should be fully powered up inc ... It shows electrical power is available. ... Next, turn on the hydro gen/helium combustion gas ...



EIA - Electricity Data - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Energy Information Administration - EIA - Official Energy Statistics from the U.S. Government ... Piedmont Green Power: GA: 57909: GEN1: 53.50: WDS: ST: 2013: 4: 15394:


RTO and Balancing AuthoritProposals for EIA Surveys  

U.S. Energy Information Administration (EIA)

... dynamics important to integration of renewable energy sources and development of smart grid technologies and demand response. ... Net Gen Demand Forecast ...


Updated Uranium Fuel Cycle Environmental Impacts for Advanced Reactor Designs  

Science Conference Proceedings (OSTI)

The purpose of this project was to update the environmental impacts from the uranium fuel cycle for select advanced (GEN III+) reactor designs.

Nitschke, R.



Many Pathways to Renewable Hydrogen (Presentation)  

DOE Green Energy (OSTI)

Presentation on the paths to renewable hydrogen presented by Robert Remick at the 2008 PowerGen: Renewable Energy and Fuels 2008 conference.

Remick, R.


Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Metal Matrix Composites II  

Science Conference Proceedings (OSTI)

Aug 6, 2013... by Spark Sintering Process: Gen Sasaki1; Kota Ishikawa1; Kenjiro Sugio1; Yongbum Choi1; Kazuhiro Matsugi1; 1Hiroshima University


Theory of Interacting Quantum Gases  

Science Conference Proceedings (OSTI)

... superfluid helium film, ii) the surface recombination rate is much larger, and iii) the sample is contaminated with atomic hydro- gen [5 ... 14] CAR S de ...




Science Conference Proceedings (OSTI)

... To boost fuel efficiency, the US auto industry is striv- ing to manufacture cars from lightweight ... for evaluating how parts of a hydro- gen pipeline ...



B452 Journal of The Electrochemical Society, 0013-4651/2007 ...  

an electrolyzer, although fuel cell and electrolyzer functions are car- ... tive electrode measurements were performed in a mixture of hydro-gen, ...


november 2003  

NLE Websites -- All DOE Office Websites (Extended Search)

releases200310prweb84970.htm Rapidly changing tone. If CO2 generated by making hydro- gen from fossil fuels were sequestered underground, cars and power plants of the...


Advanced Energy Storage Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Energy Storage Publications Reports: Advanced Technology Development Program For Lithium-Ion Batteries: Gen 2 Performance Evaluation Final Report Advanced Technology...


Manufacturing Pre-Solicitation Transcript  

NLE Websites -- All DOE Office Websites (Extended Search)

the component. Is the solicitation limited to PEM technology, solid oxide fuel cells? SOFC is a highly viable alternative technology to today's diesel gen sets. We agree. They...


EIS-0394: EPA Notice of Availability of the Environmental Impact...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EPA Notice of Availability of the Environmental Impact Statement EIS-0394: EPA Notice of Availability of the Environmental Impact Statement FutureGen Environmental Impact...


EIS-0394: EPA Notice of Availability of the Draft Environmental...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4: EPA Notice of Availability of the Draft Environmental Impact Statement EIS-0394: EPA Notice of Availability of the Draft Environmental Impact Statement FutureGen Project...


EIS-0394: EPA Notice of Availability of the Draft Environmental...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EPA Notice of Availability of the Draft Environmental Impact Statement EIS-0394: EPA Notice of Availability of the Draft Environmental Impact Statement FutureGen Project Planning,...


Understanding and managing corporate agency problems  

E-Print Network (OSTI)

Composition and Financial Statement Fraud, The Accountinga firm comes through financial statements mandated by theCommission (SEC). Financial statements must use Gen- erally

Vojtech, Cindy M.



C S I R O P U B L I S H I N G Invertebrate Taxonomy  

E-Print Network (OSTI)

. (Cosmopolitan), Eurycardiochiles, gen. nov. (type species: C. occidentalis Dangerfield & Austin) (Australasian Mao) (Nearctic and Palaearctic), Schoenlandella Cameron (Cosmopolitan) and Toxoneuron Say

Whitfield, James B.


Scenario Analysis Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

for their utilization Natural Gas Distributed Reforming R&D * H2Gen Innovations Low Cost Production System: High reformer throughput, low installation costs, reduced footprint *...


Optimal selection of on-site generation with combined heat and power applications  

E-Print Network (OSTI)

the burning of natural gas for on-site power generation andnatural gas absorption chiller GenL i , m , t , h , u Generated power by distributed generation

Siddiqui, Afzal S.; Marnay, Chris; Bailey, Owen; Hamachi LaCommare, Kristina



Project 368  

NLE Websites -- All DOE Office Websites (Extended Search)

QUANTITATIVE CHAR KINETICS FOR PRESSURIZED GASIFICATION OF COAL Description To succeed in achieving the goals of Vision 21, particularly the FutureGen power plant concept...


First Commercial, Grid-Connected, Hydrokinetic Tidal Energy Project...  

Office of Science (SC) Website

Image courtesy of Ocean Renewable Power Company ORPC's TidGen(tm) turbine generator unit. R&D Opportunity Advanced water power technologies include devices capable of extracting...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DETERlIINATION RECIPI": NT:Ocean Renewable Power Company PROJECT TITLE: TidGen Power System Commercialization Project Pagelof3 STATE: ME Fundin Opportunity Announcement...


Glossary - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

N#net_gen. There are no record(s) that match your search criteria. Please try again! Thank You. We welcome your comments or suggestions (optional).


Integrated Hydrogen and Intelligent Transportation Systems Evaluation for the California Department of Transportation  

E-Print Network (OSTI)

electric drive systems for vehicles, demonstrated its V2G system with the companys Gen-2 AC150 drivetrain at the Electric Transportation Industry

Lipman, Timothy; Shaheen, Susan



Classified Information Training | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Classified Information Training Classified Information Training Training Introduction to Classified Information, December 2013 GEN-16, "No Comment" Policy for Classified Subject...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NETL: Gasifipedia  

NLE Websites -- All DOE Office Websites (Extended Search)

& Power Systems Major Demonstrations Innovations for Existing Plants Gasification Turbines Fuel Cells FutureGen Advanced Research Contacts Industrial Capture & Storage Carbon...


New York's 23rd congressional district: Energy Resources | Open...  

Open Energy Info (EERE)

State Wind Energy LLC Fenner Renewable Energy Education Center NextGen Fuel Inc Robbins Corn & Bulk Services Energy Generation Facilities in New York's 23rd congressional district...



NLE Websites -- All DOE Office Websites (Extended Search)

Honda Civic Hybrid Electric Vehicle Accelerated Testing - January 2009 Two model year 2006 (Gen II) Honda Civic hybrid electric vehicles (HEVs) entered Accelerated testing during...


Delaware - State Energy Profile Data - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Kansas: Kentucky Louisiana Maine Maryland ... (Conectiv Delmarva Gen Inc) ; Delaware City Plant (The Premcor Refining Group Inc) ; McKee Run ... Ethanol Plant Capacity


Molten Salt Breeder Reactors Academia Sinica, ITRI, NTHU  

E-Print Network (OSTI)

Power 4/8/12 Frank H. Shu Gen IV MSBR/LFTR Liquid fuel (molten salt) Molten salt coolant (unpopulated

Wang, Ming-Jye


Efficiency enhancement of luminescent solar concentrations for photovoltaic technologies  

E-Print Network (OSTI)

1.1 Solar Energy . . . . . . . . .on ?uorescent glass-?lms. Solar Energy Materials and SolarHo?mann. Photovoltaic Solar Energy Gen- eration. Optical

Wang, Chunhua



Honda Insight Fleet and Accelerated Reliability Testing  

NLE Websites -- All DOE Office Websites (Extended Search)

Gen III Prius HEV Accelerated Testing - May 2012 Two model year 2010 Toyota Generation III Prius hybrid electric vehicles (HEVs) entered Accelerated testing during July 2009 in a...


Cryo-Compressed Hydrogen Storage: Performance and Cost Review  

NLE Websites -- All DOE Office Websites (Extended Search)

from Gen2 Reduced insulation Better packaging Vacuum valve box eliminated In-tank heat exchanger 4000-psi pressure vessel rating 4 System Analysis of Physical Storage...


Why Not?  

Science Conference Proceedings (OSTI)

... Keep in Mind Fundamentals of Electricity Transmission ... Combustion turbine gen--relatively high inertia (? 4 or 5) Page 13. 13 ... Turbines Page 22. ...




E-Print Network (OSTI)

without steam gen. ) Steam generator Control Rods Refuelingcooling system, steam generator, and auxiliary coolingcooling system and steam generator. A brief look at tables

Nero, A.V.



Learning and cost reductions for generating technologies in the national energy modeling system (NEMS)  

E-Print Network (OSTI)

Waste Hydroelectric Pumped Storage Wind Dist. Gen. BaseSolid Waste Hydroelectric Pumped Storage Wind Solar ThermalSolid Waste Hydroelectric Pumped Storage Wind Solar Thermal

Gumerman, Etan; Marnay, Chris



Geospatial | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Geospatial Science Program Next Generation (NextGen) Geospatial Information System (GIS) This map from a newly published DOE Office of Indian Energy white paper shows...


Hydrogen and Fuel Cell Technologies Program: Fuel Cells Fact...  

NLE Websites -- All DOE Office Websites (Extended Search)

for backup power, power for remote loca- tions, distributed power generation, and cogeneration (in which excess heat released during electricity gen- eration is used for other...


Plant and microbial controls on nitrogen retention and loss in a Humid Tropical Forest  

E-Print Network (OSTI)

Experimental Forest, Puerto Rico. Hydrological Processes 18:and productivity in Puerto-Rico's luquillo mountains.experimental forest Puerto Rico. US Forest Serv Gen Tech Rep

Templer, P.



2011 January 27 Draft NNSA NEWS 2010.pmd  

NLE Websites -- All DOE Office Websites (Extended Search)

1 National Nuclear Security Administration Monthly News NNSA Honored for Project Management Excellence Brig. Gen. Sandra Finan Named Principal Assistant Deputy Administrator for...



U.S. Energy Information Administration (EIA)

GL Dairy Biogas LLC GL Dairy Biogas WI 1426 Other Waste Biomass 633 Genesis Solar LLC Genesis Solar Energy Project GEN02 Solar Thermal without Energy ...


February 3, 2004, Board Public Meetings on Oversight - Board...  

NLE Websites -- All DOE Office Websites (Extended Search)

PRESENT RICHARD A. AZZARO General Counsel BRIG. GEN. RONALD J. HAECKLE USAF National Nuclear Security Administration J. KENT FORTENBERRY Technical Director KENNETH M. PUSATERI...



NLE Websites -- All DOE Office Websites (Extended Search)

2007 Toyota Prius 8820 with Gen I Hymotion Prius Conversion Plug-In Hybrid Battery Test Results Tyler Gray Jeffrey Wishart James Francfort June 2010 The Idaho National...



NLE Websites -- All DOE Office Websites (Extended Search)

2007 Toyota Prius 8820 with Gen II Hymotion Prius Conversion Plug-In Hybrid Battery Test Results Tyler Gray Jeffrey Wishart James Francfort June 2010 The Idaho National...


Tax Credit for Solar and Wind Energy Systems on Residential Property...  

Open Energy Info (EERE)

of Revenue Website http:www.revenue.louisiana.govsectionsfaqdefault.aspx?typeGEN&catWIND Date added to DSIRE 2007-07-18 Last DSIRE Review 02052013 Last Substantive...

Note: This page contains sample records for the topic "tric ity gen" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pennsylvania's 18th congressional district: Energy Resources...  

Open Energy Info (EERE)

Energy Companies in Pennsylvania's 18th congressional district Allegheny Power HydroGen Corporation formerly Chiste Corp KeyTex Energy LLC Westinghouse Plasma Corporation...


PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory Network National Laboratory Gene Library Project GenBank TB Structural Genomics Consortium Bioforensics Analysis Research and Development Center Immunological...


Department of Energy - Minnesota  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3043 en Xcel Energy Wind and Biomass Generation Mandate http:energy.govsavingsxcel-energy-wind-and-biomass-generation-mandate gen...


Browse wiki | Open Energy Information  

Open Energy Info (EERE)

PageKeyword US BioGen LLC + , Energy Company + , Hydro + , Hydrogen + , Produces bioethanol + , electricity and hydrogen from grain crops such as corn. + , Dallas + , Texas +...



U.S. Energy Information Administration (EIA)

Texas State University - San Marcos Commercial Southwest Texas State University TX GEN1 NG IC Chevron Products Co-Pascagoula ... Kentucky Utilities Co ...


EIA - Electricity Data - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Texas State University - San Marcos: Commercial: Southwest Texas State University: TX: 50263: GEN1: 6.00: NG: IC: ... Kentucky Utilities Co: Electric ...


Fundamental Constants and Tests of Theory in Rydberg ...  

Science Conference Proceedings (OSTI)

... The reason is that in using the Sturmian decomposition of the hydro- gen Coulomb Green function, as done for lower-n states, the radial ...



Katerina E Aifantis  

Science Conference Proceedings (OSTI)

Katerina E Aifantis. Aristotle University Thessaloniki Thessaloniki, 55124. Greece Telephone: Fax: E-Mail: k.aifantis@mom.gen.auth.gr.


Renewable Hydrogen From Wind in California  

E-Print Network (OSTI)

2004,ACOREPower?GenRenewable Energy,LasVegas,NVthe International Renewable Hydrogen TransmissionNovember 1998, National Renewable Energy Laboratory, NREL/

Bartholomy, Obadiah




E-Print Network (OSTI)

.nickerson@genon.com Robert W. Lawhn Project Director GenOn Energy, Inc. 2655 Solera Moon Drive Henderson, NV 89044 e


[hal-00809847, v1] AI-Ckpt: Leveraging Memory Access Patterns...  

NLE Websites -- All DOE Office Websites (Extended Search)

asynchronous checkpointing gen- erate the same kind of interference as they did in past iter- ations. Based on this assumption, we propose novel asyn- chronous checkpointing...


NETL: Gasifipedia  

NLE Websites -- All DOE Office Websites (Extended Search)

Coal & Power Systems Major Demonstrations Innovations for Existing Plants Gasification Turbines Fuel Cells FutureGen Advanced Research Contacts Industrial Capture & Storage...


NETL: Ambient Monitoring - Carnegie-Mellon University (CMU)  

NLE Websites -- All DOE Office Websites (Extended Search)

Coal & Power Systems Major Demonstrations Innovations for Existing Plants Gasification Turbines Fuel Cells FutureGen Advanced Research Contacts Industrial Capture & Storage...


The Materials Genome Initiative at NIST  

Science Conference Proceedings (OSTI)

... to direct alloy development for Gen 4 nuclear reactors. ... chips to next-generation nuclear power plants ... that enhance economic security and improve ...



NIST FY 2012 Budget Overview Working with Industry to ...  

Science Conference Proceedings (OSTI)

... (+$4.0M) This initiative will increase the Nation's cyberspace security, reduce ... alloy development for Gen 4 nuclear reactors. GE ...



Mixed metal ?lms with switchable optical properties  

The electrochemical hydro-gen loading behavior of these mixed metal ?lms was similar ... Energy Ef?ciency and Renewable Energy, Of?ce of Building


Meeting Action Items and Highlights from the Bio-Derived Liquids...  

NLE Websites -- All DOE Office Websites (Extended Search)

facilitated sessions (see "figures of merit" presentation) (DOE and HPTT) Highlights: * Sandy Thomas, H2Gen: "Low-Cost Hydrogen from Ethanol: A Distributed Production System." *...


Quarterly Coal Report, January-March 1997  

Gasoline and Diesel Fuel Update (EIA)

1Q) 1Q) Distribution Category UC-950 Quarterly Coal Report January-March 1997 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Acting Chief, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Questions addressing the


Quarterly Coal Report, July-September 1997  

Gasoline and Diesel Fuel Update (EIA)

3Q) 3Q) Distribution Category UC-950 Quarterly Coal Report July-September 1997 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Project Leader, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Questions addressing the


Quarterly Coal Report, October-December 1997  

Gasoline and Diesel Fuel Update (EIA)

4Q) 4Q) Distribution Category UC-950 Quarterly Coal Report October-December 1997 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Project Leader, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Questions addressing the