National Library of Energy BETA

Sample records for traffic signal modules

  1. Seven Traffic Signals in Two Minutes

    Broader source: Energy.gov [DOE]

    Topeka, Kansas has activated the first of three key traffic corridors to receive a "green light tunnel," a real-time adaptive traffic signal system that synchronizes signals to create a series of...

  2. Evaluation of traffic signal controller transition methods 

    E-Print Network [OSTI]

    Hamilton, Curtis Lloyd

    2000-01-01

    A coordinated signal system achieves the best traffic progression when the signal plans are optimized at the correct offsets and intervals. When traffic conditions change and a transition to a new timing plan is warranted, it is important to reach...

  3. Seven Traffic Signals in Two Minutes

    SciTech Connect (OSTI)

    None

    2011-01-01

    Topeka, KS has activated the first of three key traffic corridors to receive a "green light tunnel," a real-time adaptive traffic signal system that synchronizes signals to create a series of green lights for motorists. The result is fewer stops, less travel time and -- most importantly -- a lot of saved gasoline.

  4. Adaptive Modulation and Scheduling of IP traffic over Fading Channels

    E-Print Network [OSTI]

    the traf- fic load. An obstacle in this context is the time-variability of the channel. To achieve a high to the traffic situation. 1 INTRODUCTION Fading channels confront us with the problem of lost packets. For a predicted value of the Signal to Noise and Interfer- ence Ratio (SNIR) of each channel, the modulation level

  5. Adaptive Modulation and Scheduling of IP traffic over Fading Channels

    E-Print Network [OSTI]

    the traf­ fic load. An obstacle in this context is the time­variability of the channel. To achieve a high to the traffic situation. 1 INTRODUCTION Fading channels confront us with the problem of lost packets. For a predicted value of the Signal to Noise and Interfer­ ence Ratio (SNIR) of each channel, the modulation level

  6. Hierarchical classification of modulation signals 

    E-Print Network [OSTI]

    Kim, Nam Jin

    2002-01-01

    This thesis addresses the problem of classifying both analog and digital modulation signals using different kinds of classifiers. The classification of modulation signals has both civilian and military applications. A total of 31 statistical signal...

  7. Performance Analysis of Isolated Intersection Traffic Signals 

    E-Print Network [OSTI]

    Yin, Kai

    2013-08-01

    This dissertation analyzes two unsolved problems to fulfill the gap in the literature: (1). What is the vehicle delay and intersection capacity considering left-turn traffic at a pre-timed signal? (2). What are the mean and variance of delay...

  8. Ohio Town Installing ‘Green’ Traffic Signals

    Broader source: Energy.gov [DOE]

    Elyria makes the move to efficient lighting. The town has decided to start replacing traffic lights with energy-efficient LEDs.

  9. Evaluation of detector placement strategies for first generation traffic responsive signal control 

    E-Print Network [OSTI]

    Brehmer, Christopher Lynn

    1996-01-01

    Traffic responsive signal systems rely on system detector data to evaluate current traffic conditions and select a corresponding timing plan from a library of plans. One of the major decisions surrounding the use of traffic responsive signal systems...

  10. Study on the relationship between left-turn traffic operations and safety at signalized intersections 

    E-Print Network [OSTI]

    Lee, Sunghoon

    2009-06-02

    Intersections are the most complex locations in a traffic system and are likely to have a higher crash count than any other location in the system. Intersection safety is related to traffic operations, such as traffic signal and approaching volume...

  11. Neurofibromin Regulation of ERK Signaling Modulates

    E-Print Network [OSTI]

    Silva, Alcino

    Neurofibromin Regulation of ERK Signaling Modulates GABA Release and Learning Yijun Cui,1 Rui M@mednet.ucla.edu DOI 10.1016/j.cell.2008.09.060 SUMMARY We uncovered a role for ERK signaling in GABA re- lease, long demonstrate that neurofibromin modulates ERK/synapsin I-dependent GABA re- lease, which in turn modulates

  12. Mitigating Wind-Induced Fatigue in Steel Traffic Signal Support Structures 

    E-Print Network [OSTI]

    Wieghaus, Kyle T

    2015-05-26

    Traffic signal structures undergo wind-induced vibrations that result in fatigue damage accumulation and reduced service life. Mast arms have failed and required removal while in service. A dual experimental and analytical modeling approach is taken...

  13. Multidimensional signal modulation and/or demodulation for data communications

    DOE Patents [OSTI]

    Smith, Stephen F. (London, TN); Dress, William B. (Camas, WA)

    2008-03-04

    Systems and methods are described for multidimensional signal modulation and/or demodulation for data communications. A method includes modulating a carrier signal in a first domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; modulating the carrier signal in a second domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; and modulating the carrier signal in a third domain selected from the group consisting of phase, frequency, amplitude, polarization and spread.

  14. Bicycle-Specific Traffic Signals: Results from a State-of-the-Practice Review Paper # 13-0536

    E-Print Network [OSTI]

    Bicycle-Specific Traffic Signals: Results from a State-of-the-Practice Review Paper # 13-0536 Sam R with known installations of bicycle-specific traffic signals and a review of available engineering guidance); the CROW design manual for bicycle traffic; and the Canadian, U.S. and Californian manuals on uniform

  15. Symmetry breaking in optimal timing of traffic signals on an idealized two-way street

    E-Print Network [OSTI]

    Panaggio, Mark J; Hu, Peiguang; Abrams, Daniel M

    2013-01-01

    Simple physical models based on fluid mechanics have long been used to understand the flow of vehicular traffic on freeways; analytically tractable models of flow on an urban grid, however, have not been as extensively explored. In an ideal world, traffic signals would be timed such that consecutive lights turned green just as vehicles arrived, eliminating the need to stop at each block. Unfortunately, this "green wave" scenario is generally unworkable due to frustration imposed by competing demands of traffic moving in different directions. Until now this has typically been resolved by numerical simulation and optimization. Here, we develop a theory for the flow in an idealized system consisting of a long two-way road with periodic intersections. We show that optimal signal timing can be understood analytically and that there are counter-intuitive asymmetric solutions to this signal coordination problem. We further explore how these theoretical solutions degrade as traffic conditions vary and automotive dens...

  16. http://tti.tamu.edu > Variable message signs > Traffic actuated controllers > Traffic signals > Flashing traffic signals > Lane use control signals > Road markings > Rumble strips > Warrants (Traffic control devices) > Gro

    E-Print Network [OSTI]

    and development > Airport maintenance > Bicycle and pedestrian > Ports and waterways >>> Transportation operations pipeline transportation > Airport planning and development > Airport maintenance > Bicycle and pedestrian > Measures of effectiveness > Traffic models > Traffic simula Saving Lives, Time and Resources AviAtion Rese

  17. (U) modulator to provide a continuous stepped frequency signal format

    DOE Patents [OSTI]

    Walters, Glenn A. (Escondido, CA)

    1991-01-01

    A modulator provides a continuous signal format composed of discrete freqcy steps and is designed to eliminate frequency overlap or smearing normally associated with filter ringing.

  18. Traffic Signal Systems The aim of this research was to develop operational strategies for inte-

    E-Print Network [OSTI]

    Tian, Zong Z.

    PART 2 Traffic Signal Systems #12;The aim of this research was to develop operational strategies. The key elements of the integration system and its operations include a proposed enhanced detection system metering could eliminate the deficiencies of the current independent system operations. The purpose

  19. Sigma delta modulation of a chaotic signal 

    E-Print Network [OSTI]

    Ushaw, Gary

    Sigma delta modulation SDM has become a widespread method of analogue to digital conversion, however its operation has not been completely defined. The majority of the analysis carried out on the circuit has been from a linear standpoint, with non...

  20. BBN Technical Memorandum No. 1321 Using Signal Processing to Analyze Wireless Data Traffic

    E-Print Network [OSTI]

    Strayer, William Timothy

    such as tunneling, traf- fic aggregation, false traffic generation, and data padding. Tunneling hides the original and uses security gateways as the endpoints as traffic traverses hostile networks. Traffic aggregation works with tunneling under the theory of protection in numbers--many traffic flows all sharing the same

  1. Approved Module Information for EE3SPR, 2014/5 Module Title/Name: Signal Processing Module Code: EE3SPR

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE3SPR, 2014/5 Module Title/Name: Signal Processing Module Code: EE the analytical basis of discrete time and digital signal processing. To introduce the design and implementation of real- time digital signal processing systems. To extend the concepts to other areas such as image

  2. Development and evaluation of an arterial adaptive traffic signal control system using reinforcement learning 

    E-Print Network [OSTI]

    Xie, Yuanchang

    2009-05-15

    extensively used in many applications including real-time control. In this dissertation, a systematic comparison between the reinforcement learning control methods and existing adaptive traffic control methods is first presented from the theoretical...

  3. Design and Modeling of a Continuous-Time Delta-Sigma Modulator for Biopotential Signal

    E-Print Network [OSTI]

    Mohanty, Saraju P.

    Design and Modeling of a Continuous-Time Delta-Sigma Modulator for Biopotential Signal Acquisition in biopotential signal acquisition. The rest of this paper is organized as follows: Section II presents the CT DSM

  4. The high risk HPV16 L2 minor capsid protein has multiple transport signals that mediate its nucleocytoplasmic traffic

    SciTech Connect (OSTI)

    Mamoor, Shahan; Onder, Zeynep [Biology Department, Boston College, Chestnut Hill, MA 02467 (United States)] [Biology Department, Boston College, Chestnut Hill, MA 02467 (United States); Karanam, Balasubramanyam; Kwak, Kihyuck [Department of Pathology, The Johns Hopkins University, Baltimore, MD 21231 (United States)] [Department of Pathology, The Johns Hopkins University, Baltimore, MD 21231 (United States); Bordeaux, Jennifer; Crosby, Lauren [Biology Department, Boston College, Chestnut Hill, MA 02467 (United States)] [Biology Department, Boston College, Chestnut Hill, MA 02467 (United States); Roden, Richard B.S. [Department of Pathology, The Johns Hopkins University, Baltimore, MD 21231 (United States)] [Department of Pathology, The Johns Hopkins University, Baltimore, MD 21231 (United States); Moroianu, Junona, E-mail: moroianu@bc.edu [Biology Department, Boston College, Chestnut Hill, MA 02467 (United States)] [Biology Department, Boston College, Chestnut Hill, MA 02467 (United States)

    2012-01-20

    In this study we examined the transport signals contributing to HPV16 L2 nucleocytoplasmic traffic using confocal microscopy analysis of enhanced green fluorescent protein-L2 (EGFP-L2) fusions expressed in HeLa cells. We confirmed that both nuclear localization signals (NLSs), the nNLS (1MRHKRSAKRTKR12) and cNLS (456RKRRKR461), previously characterized in vitro (Darshan et al., 2004), function independently in vivo. We discovered that a middle region rich in arginine residues (296SRRTGIRYSRIGNKQTLRTRS316) functions as a nuclear retention sequence (NRS), as mutagenesis of critical arginine residues within this NRS reduced the fraction of L2 in the nucleus despite the presence of both NLSs. Significantly, the infectivity of HPV16 pseudoviruses containing either RR297AA or RR297EE within the L2 NRS was strongly reduced both in HaCaT cells and in a murine challenge model. Experiments using Ratjadone A nuclear export inhibitor and mutation-localization analysis lead to the discovery of a leucine-rich nuclear export signal ({sub 462}LPYFFSDVSL) mediating 16L2 nuclear export. These data indicate that HPV16 L2 nucleocytoplasmic traffic is dependent on multiple functional transport signals.

  5. Amplitude Modulated Coherence Analysis of Biomedical Signals S. Pearson, M. Ray, J. McNames

    E-Print Network [OSTI]

    Names Biomedical Signal Processing Laboratory, Portland State University, Portland, Oregon, U.S.A. Abstract-- We information from biomedical signals. For example, if a quasi- periodic sinusoidal signal is processedAmplitude Modulated Coherence Analysis of Biomedical Signals S. Pearson, M. Ray, J. Mc

  6. Mindfulness training modulates value signals in ventromedial prefrontal cortex through input from insular cortex

    E-Print Network [OSTI]

    Buehrer, R. Michael

    Mindfulness training modulates value signals in ventromedial prefrontal cortex through input from Mindfulness training Longitudinal design Neuroimaging research has demonstrated that ventromedial prefrontal cortex (vmPFC) encodes value signals that can be modulated by top-down cognitive input such as semantic

  7. System and method of modulating electrical signals using photoconductive wide bandgap semiconductors as variable resistors

    DOE Patents [OSTI]

    Harris, John Richardson; Caporaso, George J; Sampayan, Stephen E

    2013-10-22

    A system and method for producing modulated electrical signals. The system uses a variable resistor having a photoconductive wide bandgap semiconductor material construction whose conduction response to changes in amplitude of incident radiation is substantially linear throughout a non-saturation region to enable operation in non-avalanche mode. The system also includes a modulated radiation source, such as a modulated laser, for producing amplitude-modulated radiation with which to direct upon the variable resistor and modulate its conduction response. A voltage source and an output port, are both operably connected to the variable resistor so that an electrical signal may be produced at the output port by way of the variable resistor, either generated by activation of the variable resistor or propagating through the variable resistor. In this manner, the electrical signal is modulated by the variable resistor so as to have a waveform substantially similar to the amplitude-modulated radiation.

  8. Code division multiple access signaling for modulated reflector technology

    DOE Patents [OSTI]

    Briles, Scott D. (Los Alamos, NM)

    2012-05-01

    A method and apparatus for utilizing code division multiple access in modulated reflectance transmissions comprises the steps of generating a phase-modulated reflectance data bit stream; modifying the modulated reflectance data bit stream; providing the modified modulated reflectance data bit stream to a switch that connects an antenna to an infinite impedance in the event a "+1" is to be sent, or connects the antenna to ground in the event a "0" or a "-1" is to be sent.

  9. The RTMS (Remote Traffic Microwave Sensor) unit is a traffic sensor which uses microwave signals to detect vehicles. Unlike sensors which use the Doppler effect, this sensor

    E-Print Network [OSTI]

    Prevedouros, Panos D.

    1 RTMS The RTMS (Remote Traffic Microwave Sensor) unit is a traffic sensor which uses microwave counter unit. Additional items for deployment include solar panel, batteries and modem with cellular dimly. The LED is bright only when data is being downloaded from it. Solar Panel The solar panel

  10. LED Traffic Light as a Communications Device Grantham Pang, Thomas Kwan, Chi-Ho Chan, Hugh Liu.

    E-Print Network [OSTI]

    Pang, Grantham

    :http://www.eee.hku.hk/~gpang Abstract The visible light from an LED (light emitting diode) traffic light can be modulated and encoded on the description of an audio information system made up of high brightness, visible light emitting diodes (LEDs messages 1. Introduction Recently, high intensity light emitting diodes for traffic signals are available

  11. Exercise training modulates apoptotic signaling in the aging rat heart 

    E-Print Network [OSTI]

    Kwak, Hyo Bum

    2005-11-01

    in the rate of apoptosis has been reported with aging in the rat left ventricle. In contrast, exercise training not only improves cardiac function, but also reduces the risk of heart disease. However, the ability of exercise training to modulate apoptotic...

  12. Diurnal modulation signal from dissipative hidden sector dark matter

    E-Print Network [OSTI]

    R. Foot; S. Vagnozzi

    2015-06-07

    We consider a simple generic dissipative dark matter model: a hidden sector featuring two dark matter particles charged under an unbroken $U(1)'$ interaction. Previous work has shown that such a model has the potential to explain dark matter phenomena on both large and small scales. In this framework, the dark matter halo in spiral galaxies features nontrivial dynamics, with the halo energy loss due to dissipative interactions balanced by a heat source. Ordinary supernovae can potentially supply this heat provided kinetic mixing interaction exists with strength $\\epsilon \\sim 10^{-9}$. This type of kinetically mixed dark matter can be probed in direct detection experiments. Importantly, this self-interacting dark matter can be captured within the Earth and shield a dark matter detector from the halo wind, giving rise to a diurnal modulation effect. We estimate the size of this effect for detectors located in the Southern hemisphere, and find that the modulation is large ($\\gtrsim 10\\%$) for a wide range of parameters.

  13. ITERATIVELY REWEIGHTED DESIGN OF OVERSAMPLING COMPLEX-MODULATED FILTER-BANKS FOR HIGH OUTPUT-SIGNAL QUALITY

    E-Print Network [OSTI]

    Göckler, Heinz G.

    of the frequency-dependent signal-to- disturbance ratio. Next, in section 3, we discuss the basic idea of the of the signal-to-disturbance ratio of the output-signal of an oversampling, complex-modulated subband-coder filter-bank pair with extensive subband-signal am- plification. The undesired non-linear disturbance

  14. PCI data acquisition and signal processing hardware modules for long pulse operation

    SciTech Connect (OSTI)

    Sousa, J.; Batista, A.J.N.; Combo, A.; Pereira, R.; Correia, Miguel; Cruz, N.; Carvalho, P.; Correia, Carlos; Varandas, C.A.F. [Associacao EURATOM/IST, Centro de Fusao Nuclear, Instituto Superior Tecnico, Avenue Rovisco Pais, 1049-001 Lisbon (Portugal)

    2004-10-01

    A set of PCI instrumentation modules was developed at the EURATOM/IST Association. The modules were engineered around a reconfigurable hardware core which permits one to reduce the development time of instrument for new applications, provide support for long time or even continuous operation, and is able to perform real-time digital signal processing. The core was engineered at low cost and the modules incorporate a high number of channels, which contribute to reduce the total cost per channel. Field results are as expected in terms of performance both in data throughput and input characteristics. Currently, a 2 MSPS, 14-bit, eight channel galvanic isolated transient recorder; a 200 MSPS, 8-bit, four channel pulse digitizer; an eight channel time-to-digital-converter with a resolution of 0.4 ns, and a reconfigurable hardware expandable board, are implemented.

  15. Performance of Multiple Pulse Multiple Delay Modulated UWB Signals in a Multiple Access Indoor Wireless Channel

    SciTech Connect (OSTI)

    Nekoogar, F

    2003-06-12

    In this paper, the performance of a two user UWB multiple access (UWB-MA) system based on multiple-pulse multiple-delay (MPMD) modulation scheme in an indoor wireless channel is evaluated by computer simulations. The indoor multipath propagation channel model used in this study is based on the modified statistical Saleh-Valenzuela model proposed by Foerester and Li from Intel. The simulation results indicate that the multipath performance of MPMD modulated signals in a multiple access system outperforms the nonmultipath case as the number of autocorrelation function (ACF) sampling points increases for each user. This is an unusual but important result, since MPMD receiver exploits multipath phenomenon in indoor wireless channels to increase the BER performance, hence the transmission rate in a UWB-MA system.

  16. Lilly, J. M. (2011). Modulated oscillations in three dimensions. IEEE Transac-tions on Signal Processing, 59 (12), 59305943.

    E-Print Network [OSTI]

    Lilly, Jonathan

    2011-01-01

    ://www.ieee.org/publications_standards/publications/rights/ rights_policies.html. #12;5930 IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 59, NO. 12, DECEMBER 2011Lilly, J. M. (2011). Modulated oscillations in three dimensions. IEEE Transac- tions on Signal Processing, 59 (12), 5930­5943. c 2011 IEEE. Personal use of this material is permitted. However, permission

  17. Bystander effects of ionizing radiation can be modulated by signaling amines

    SciTech Connect (OSTI)

    Poon, R.C.C.; Agnihotri, N.; Seymour, C.; Mothersill, C.

    2007-10-15

    Actual risk and risk management of exposure to ionizing radiation are among the most controversial areas in environmental health protection. Recent developments in radiobiology especially characterization of bystander effects have called into question established dogmas and are thought to cast doubt on the scientific basis of the risk assessment framework, leading to uncertainty for regulators and concern among affected populations. In this paper we test the hypothesis that small signaling molecules widely used throughout the animal kingdom for signaling stress or environmental change, such as 5-Hydroxytryptamine (5-HT, serotonin), L-DOPA, glycine or nicotine are involved in bystander signaling processes following ionizing radiation exposure. We report data which suggest that nano to micromolar concentrations of these agents can modulate bystander-induced cell death. Depletion of 5-HT present in tissue culture medium, occurred following irradiation of cells. This suggested that 5-HT might be bound by membrane receptors after irradiation. Expression of 5-HT type 3 receptors which are Ca{sup 2+} ion channels was confirmed in the cells using immunocytochemistry and receptor expression could be increased using radiation or 5-HT exposure. Zofran and Kitryl, inhibitors of 5-HT type 3 receptors, and reserpine a generic serotonin antagonist block the bystander effect induced by radiation or by serotonin. The results may be important for the mechanistic understanding of how low doses of radiation interact with cells to produce biological effects.

  18. Electrical system for pulse-width modulated control of a power inverter using phase-shifted carrier signals and related operating methods

    DOE Patents [OSTI]

    Welchko, Brian A. (Torrance, CA)

    2012-02-14

    Systems and methods are provided for pulse-width modulated control of power inverter using phase-shifted carrier signals. An electrical system comprises an energy source and a motor. The motor has a first set of windings and a second set of windings, which are electrically isolated from each other. An inverter module is coupled between the energy source and the motor and comprises a first set of phase legs coupled to the first set of windings and a second set of phase legs coupled to the second set of windings. A controller is coupled to the inverter module and is configured to achieve a desired power flow between the energy source and the motor by modulating the first set of phase legs using a first carrier signal and modulating the second set of phase legs using a second carrier signal. The second carrier signal is phase-shifted relative to the first carrier signal.

  19. Lilly, J. M., & Olhede, S. C. (2012). Analysis of modulated multivariate oscil-lations. IEEE Transactions on Signal Processing, 60 (2), 600612.

    E-Print Network [OSTI]

    Lilly, Jonathan

    2012-01-01

    Transactions on Signal Processing, 60 (2), 600­612. c 2012 IEEE. Personal use of this material is permitted_policies.html. #12;600 IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 60, NO. 2, FEBRUARY 2012 Analysis of Modulated for the recovery of such a signal from potentially noisy observations is proposed, and the time-varying bias

  20. Internet Traffic Modeling Using the Index of Variability

    E-Print Network [OSTI]

    Kansas, University of

    traffic models: the Two-State Markov Modulated Poisson Process (MMPP) and the renewal process1 Internet Traffic Modeling Using the Index of Variability Georgios Y. Lazarou, Xiangdong Xia and is analytically tractable for many popular traffic models. Using this proposed measure, we then analyzed two

  1. Diode-laser-pump module with integrated signal ports for pumping amplifying fibers and method

    DOE Patents [OSTI]

    Savage-Leuchs; Matthias P. (Woodinville, WA)

    2009-05-26

    Apparatus and method for collimating pump light of a first wavelength from laser diode(s) into a collimated beam within an enclosure having first and second optical ports, directing pump light from the collimated beam to the first port; and directing signal light inside the enclosure between the first and second port. The signal and pump wavelengths are different. The enclosure provides a pump block having a first port that emits pump light to a gain fiber outside the enclosure and that also passes signal light either into or out of the enclosure, and another port that passes signal light either out of or into the enclosure. Some embodiments use a dichroic mirror to direct pump light to the first port and direct signal light between the first and second ports. Some embodiments include a wavelength-conversion device to change the wavelength of at least some of the signal light.

  2. VEHICLE EMISSIONS AND TRAFFIC MEASURES: EXPLORATORY ANALYSIS OF FIELD

    E-Print Network [OSTI]

    Frey, H. Christopher

    VEHICLE EMISSIONS AND TRAFFIC MEASURES: EXPLORATORY ANALYSIS OF FIELD OBSERVATIONS AT SIGNALIZED between vehicle emissions and traffic control measures is an important step toward reducing the potential roadway design and traffic control, have the ability to reduce vehicle emissions. However, current vehicle

  3. Florida County Seeks to Reduce Emissions and Improve Traffic

    Office of Energy Efficiency and Renewable Energy (EERE)

    St. Johns County, Florida is tackling its traffic-timing problem with a little help from an Energy Department Energy Efficiency and Conservation Block grant. The county will use the grant to improve traffic flow by re-synchronizing signals at five major road segments. In total, 23 traffic signals will be retimed and synchronized, resulting in lower fuel consumption, shorter travel times, increased travel speed, less stopping and less engine idling.

  4. Prediction of traffic flow for real-time control 

    E-Print Network [OSTI]

    Chandrasekaran, Priya

    1998-01-01

    The prediction of traffic flow on a network and the relationship of these flows to the traffic control signal settings are major factors in the development of an adaptive real-time signal system. PASSER IV is an arterial system optimization package...

  5. An Analysis of the Impact of Reducing Pedestrian-Walking-Speed on Intersection Traffic MOEs 

    E-Print Network [OSTI]

    Li, Xiaohan

    2015-01-26

    Pedestrian traffic is an important element in signalized intersection analysis. As a low-speed traffic component, pedestrians crossing the street may take up time that could be utilized by vehicles on the other street to ...

  6. Automatic Model Classification of Measured Internet Traffic Yi Zeng and Thomas M. Chen

    E-Print Network [OSTI]

    Chen, Thomas M.

    issues for future work. II. MODEL-LIBRARY TRAFFIC CLASSIFICATION Many traffic models have been developed Model 2 module ... Model library Fig. 1. General model classification system In the general case with NAutomatic Model Classification of Measured Internet Traffic Yi Zeng and Thomas M. Chen Department

  7. Synchronisation and desynchronisation of self-modulation oscillations in a ring chip laser under the action of a periodic signal and noise

    SciTech Connect (OSTI)

    Dudetskiy, V Yu; Lariontsev, E G; Chekina, S N

    2014-09-30

    The effect of pump noise on the synchronisation of selfmodulation oscillations in a solid-state ring laser with periodic pump modulation is studied numerically and experimentally. It is found that, in contrast to desynchronisation that usually occurs under action of noise in the case of 1/1 synchronisation of self-oscillations by a periodic signal, the effect of noise on 1/2 synchronisation may be positive, namely, at a sufficiently low intensity, pump noise is favourable for synchronisation of self-oscillations, for narrowing of their spectrum, and for increasing the signal-to-noise ratio. (lasers)

  8. Modeling Traffic Flow Emissions

    E-Print Network [OSTI]

    Cappiello, Alessandra

    2002-09-17

    The main topic of this thesis is the development of light-duty vehicle dynamic emission models and their integration with dynamic traffic models. Combined, these models

  9. Traffic congestion forecasting model for the INFORM System. Final report

    SciTech Connect (OSTI)

    Azarm, A.; Mughabghab, S.; Stock, D.

    1995-05-01

    This report describes a computerized traffic forecasting model, developed by Brookhaven National Laboratory (BNL) for a portion of the Long Island INFORM Traffic Corridor. The model has gone through a testing phase, and currently is able to make accurate traffic predictions up to one hour forward in time. The model will eventually take on-line traffic data from the INFORM system roadway sensors and make projections as to future traffic patterns, thus allowing operators at the New York State Department of Transportation (D.O.T.) INFORM Traffic Management Center to more optimally manage traffic. It can also form the basis of a travel information system. The BNL computer model developed for this project is called ATOP for Advanced Traffic Occupancy Prediction. The various modules of the ATOP computer code are currently written in Fortran and run on PC computers (pentium machine) faster than real time for the section of the INFORM corridor under study. The following summarizes the various routines currently contained in the ATOP code: Statistical forecasting of traffic flow and occupancy using historical data for similar days and time (long term knowledge), and the recent information from the past hour (short term knowledge). Estimation of the empirical relationships between traffic flow and occupancy using long and short term information. Mechanistic interpolation using macroscopic traffic models and based on the traffic flow and occupancy forecasted (item-1), and the empirical relationships (item-2) for the specific highway configuration at the time of simulation (construction, lane closure, etc.). Statistical routine for detection and classification of anomalies and their impact on the highway capacity which are fed back to previous items.

  10. Design of Analog & Mixed Signal Circuits in Continuous-Time Sigma-Delta Modulators for System-on-Chip applications 

    E-Print Network [OSTI]

    Park, Chang Joon

    2013-08-22

    comparison stage.........................................................................56 III.3.5. PVT variations..........................................................................................59 III.4. Chip Measurement Results... under process-voltage-temperature (PVT) variations. Section V summarizes the contributions of this dissertation. 9 II. 5TH-ORDER ACTIVE-RC FILTER FOR BLOCKER TOLERANT CONTINUOUS-TIME SIGMA-DELTA MODULATORS II.1. Background and Motivation...

  11. Transforming Traffic Signals to Support Sustainability

    E-Print Network [OSTI]

    Bertini, Robert L.

    Do I Work For? Mayor Sam Adams, Leader of PDX Leader(s) of Koonce Household #12;Our intentions apply them? What are the safety benefits? #12;Passive Pedestrian Detection · Vehicles aren't forced

  12. "Using very high-fidelity microscopic traffic simulation tools to model and

    E-Print Network [OSTI]

    Zhigilei, Leonid V.

    with the goal of improving transportation system mobility, achieving sustainable transportation, and enhancing and mobility at urban networks. Existing state-of-the-practice traffic signal timing-optimization programs rely traffic signal timing plans for sustainability (i.e., minimizing fuel consumption and emissions). ITS

  13. air traffic the polytechnic school

    E-Print Network [OSTI]

    air traffic management the polytechnic school innovation.asu.edu #12;undergraduate degree program B.S., air traffic management Our undergraduate air traffic management program offers students exceptional training and state-of-the-art air traffic control simulators to enhance and reinforce classroom study. You

  14. Processing of transient signals from damage in CFRP composite materials monitored with embedded intensity-modulated fiber optic sensors

    E-Print Network [OSTI]

    of Metallurgy and Materials Engineering, Research Group Materials Performance and Non-Destructive Testing signals, a Non-Destructive Testing (NDT) system can be integrated into this complex material fibre communication technologies and the evolution in computer technology, new testing methods emerged

  15. IEEE JOURNAL OF QUANTUM ELECTRONICS, VOL. 36, NO. 11, NOVEMBER 2000 1299 Theory of Large-Signal Direct Modulation of

    E-Print Network [OSTI]

    Sipe,J. E.

    communications source. We find simple expressions for the instantaneous frequency and intensity in terms of a few of the dispersion of the extended cavity on the output electric field signal. We find simple expressions was supported by the Natural Sciences and Engineering Research Council of Canada, Photonics Research Ontario

  16. Traffic of Molecular Motors

    E-Print Network [OSTI]

    Stefan Klumpp; Melanie J. I. Müller; Reinhard Lipowsky

    2005-12-06

    Molecular motors perform active movements along cytoskeletal filaments and drive the traffic of organelles and other cargo particles in cells. In contrast to the macroscopic traffic of cars, however, the traffic of molecular motors is characterized by a finite walking distance (or run length) after which a motor unbinds from the filament along which it moves. Unbound motors perform Brownian motion in the surrounding aqueous solution until they rebind to a filament. We use variants of driven lattice gas models to describe the interplay of their active movements, the unbound diffusion, and the binding/unbinding dynamics. If the motor concentration is large, motor-motor interactions become important and lead to a variety of cooperative traffic phenomena such as traffic jams on the filaments, boundary-induced phase transitions, and spontaneous symmetry breaking in systems with two species of motors. If the filament is surrounded by a large reservoir of motors, the jam length, i.e., the extension of the traffic jams is of the order of the walking distance. Much longer jams can be found in confined geometries such as tube-like compartments.

  17. 1 SIDE CONSTRAINED TRAFFIC EQUILIBRIUM MODELS---TRAFFIC

    E-Print Network [OSTI]

    Patriksson, Michael

    i #12; #12; 1 SIDE CONSTRAINED TRAFFIC EQUILIBRIUM MODELS---TRAFFIC MANAGEMENT THROUGH LINK TOLLS in the inelastic demand case; this fact enables the traffic manager to choose a toll scheme which satisfies flow restrictions as side constraints. The set of toll prices obtained is not necessarily unique

  18. LUNAR SOIL SIMULATION TRAFFICABILITY PARAMETERS

    E-Print Network [OSTI]

    Rathbun, Julie A.

    LUNAR SOIL SIMULATION and TRAFFICABILITY PARAMETERS by W. David Carrier, III Lunar Geotechnical.0 RECOMMENDED LUNAR SOIL TRAFFICABILITY PARAMETERS Table 9.14 in the Lunar Sourcebook (Carrier et al. 1991, p. 529) lists the current recommended lunar soil trafficability parameters: bc = 0.017 N/cm2 bN = 35° K

  19. tti.tamu.edu > Variable message signs > Traffic actuated controllers > Traffic signals > Flashing traffic signals > Lane use control signals > Road markings > Rumble strips > Warrants (Traffic control devices) > Gro

    E-Print Network [OSTI]

    and development > Airport maintenance > Bicycle and pedestrian > Ports and waterways >>> Transportation operations > Statistics > Transportation engineering >>> Mathematics > Simulation > Statistical analysis > Backcalculation pipeline transportation > Airport planning and development > Airport maintenance > Bicycle and pedestrian

  20. Phase modulation in RF tag

    DOE Patents [OSTI]

    Carrender, Curtis Lee; Gilbert, Ronald W.

    2007-02-20

    A radio frequency (RF) communication system employs phase-modulated backscatter signals for RF communication from an RF tag to an interrogator. The interrogator transmits a continuous wave interrogation signal to the RF tag, which based on an information code stored in a memory, phase-modulates the interrogation signal to produce a backscatter response signal that is transmitted back to the interrogator. A phase modulator structure in the RF tag may include a switch coupled between an antenna and a quarter-wavelength stub; and a driver coupled between the memory and a control terminal of the switch. The driver is structured to produce a modulating signal corresponding to the information code, the modulating signal alternately opening and closing the switch to respectively decrease and increase the transmission path taken by the interrogation signal and thereby modulate the phase of the response signal. Alternatively, the phase modulator may include a diode coupled between the antenna and driver. The modulating signal from the driver modulates the capacitance of the diode, which modulates the phase of the response signal reflected by the diode and antenna.

  1. A Proposal for Data Collection: Saturation Flows at Signalized Intersections with high Pedestrian

    E-Print Network [OSTI]

    Bertini, Robert L.

    A Proposal for Data Collection: Saturation Flows at Signalized Intersections with high Pedestrian this estimation including pedestrian traffic, lane width, transit, and traffic composition. Our proposed project and pedestrian volumes at a minimum of three signalized intersections with high pedestrian traffic located

  2. Hybrid Traffic Data Collection Roadmap: Pilot Procurement of Third-Party Traffic Data

    E-Print Network [OSTI]

    Alexandre, Bayen

    2013-01-01

    TRAFFIC DATA COLLECTION ROADMAP: PILOT PROCUREMENT OF THIRD-TRAFFIC DATA COLLECTION ROADMAP: PILOT PROCUREMENT OF THIRD-Traffic Data Collection Roadmap project (Task Orders 1 and

  3. Scheduling and Queue Management for Multi-class Traffic in Access Router of Mobility Protocol

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    communicate with the Access Router (AR) through wireless channels for sending data packets and signalingScheduling and Queue Management for Multi-class Traffic in Access Router of Mobility Protocol Md communicating over Internet. Due to such high data traffic, the access routers are often overloaded with packets

  4. Module Handbook Module title

    E-Print Network [OSTI]

    . Students learn about selected topics from inorganic chemistry, biochemistry, materials chemistryModule Handbook Module title Module title in English Credits Degree of compulsion Level Learning Theory of Functional Materials 6 Compulsory Basic A systematic foundation for quantum physics

  5. Digital optical conversion module

    DOE Patents [OSTI]

    Kotter, D.K.; Rankin, R.A.

    1988-07-19

    A digital optical conversion module used to convert an analog signal to a computer compatible digital signal including a voltage-to-frequency converter, frequency offset response circuitry, and an electrical-to-optical converter. Also used in conjunction with the digital optical conversion module is an optical link and an interface at the computer for converting the optical signal back to an electrical signal. Suitable for use in hostile environments having high levels of electromagnetic interference, the conversion module retains high resolution of the analog signal while eliminating the potential for errors due to noise and interference. The module can be used to link analog output scientific equipment such as an electrometer used with a mass spectrometer to a computer. 2 figs.

  6. Water heater control module

    DOE Patents [OSTI]

    Hammerstrom, Donald J

    2013-11-26

    An advanced electric water heater control system that interfaces with a high temperature cut-off thermostat and an upper regulating thermostat. The system includes a control module that is electrically connected to the high-temperature cut-off thermostat and the upper regulating thermostat. The control module includes a switch to open or close the high-temperature cut-off thermostat and the upper regulating thermostat. The control module further includes circuitry configured to control said switch in response to a signal selected from the group of an autonomous signal, a communicated signal, and combinations thereof.

  7. A Mathematical Model and Descent Algorithm for Bilevel Traffic Management

    E-Print Network [OSTI]

    Patriksson, Michael

    as traffic signal setting, network design, and congestion pricing. The lower-level problem of the MPEC-relief measures for the quality of life, the environment, and the safety of the citizens not to deteriorate. Any, and how to travel. The criteria by which the user makes these choices are selfish, and are therefore

  8. Real-Time Traffic Maps

    E-Print Network [OSTI]

    Goldsberry, Kirk Patrick

    2007-01-01

    Philosophy in Geography by Kirk Patrick Goldsberry Committee2007 The dissertation of Kirk Patrick Goldsberry isTraffic Maps Copyright © 2007 by Kirk Patrick Goldsberry iii

  9. Wireless sensor networks for measuring traffic

    E-Print Network [OSTI]

    Varaiya, Pravin

    Wireless sensor networks for measuring traffic University of California, Berkeley Sing Yiu Cheung, Sinem Coleri, and Pravin Varaiya 2 Outline · Traffic measurement · Wireless Sensor Networks · Vehicle wireless sensor networks compete? 7 Outline · Traffic measurement · Wireless Sensor Networks · Vehicle

  10. Internet Traffic Measurement Carey Williamson

    E-Print Network [OSTI]

    Williamson, Carey

    Internet Traffic Measurement Carey Williamson Department of Computer Science University of Calgary in the design, testing, and evaluation of Internet protocols and applications. The article begins with some background information on Internet traffic measurement, and then proceeds to discuss the "tools of the trade

  11. Traffic information computing platform for big data

    SciTech Connect (OSTI)

    Duan, Zongtao Li, Ying Zheng, Xibin Liu, Yan Dai, Jiting Kang, Jun

    2014-10-06

    Big data environment create data conditions for improving the quality of traffic information service. The target of this article is to construct a traffic information computing platform for big data environment. Through in-depth analysis the connotation and technology characteristics of big data and traffic information service, a distributed traffic atomic information computing platform architecture is proposed. Under the big data environment, this type of traffic atomic information computing architecture helps to guarantee the traffic safety and efficient operation, more intelligent and personalized traffic information service can be used for the traffic information users.

  12. Temporary Pedestrian & Vehicular Traffic Flow Typical Conditions

    E-Print Network [OSTI]

    Kamat, Vineet R.

    Temporary Pedestrian & Vehicular Traffic Flow Typical Conditions Winter 2014 Ann Arbor - Ross 900150 Feet Pedestrian Route Existing Building Construction Area Traffic Detour Temporary Transit Stop

  13. Intelligent Traffic Light Control Marco Wiering

    E-Print Network [OSTI]

    Utrecht, Universiteit

    an adaptive optimization al- gorithm based on reinforcement learning. We have implemented a traffic light different traffic light controllers. Experimental results indicate that our adaptive traffic lightIntelligent Traffic Light Control Marco Wiering Jelle van Veenen Jilles Vreeken Arne Koopman

  14. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding/23/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T : GW - KM - DP & +VAR FV 3D Risk-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/23/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T : GW - KM - DP & High Tan + CFV 3D Risk Profile All FV-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/13/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  16. Quantum modulation against electromagnetic interference

    E-Print Network [OSTI]

    Juan Carlos Garcia-Escartin

    2014-11-26

    Periodic signals in electrical and electronic equipment can cause interference in nearby devices. Randomized modulation of those signals spreads their energy through the frequency spectrum and can help to mitigate electromagnetic interference problems. The inherently random nature of quantum phenomena makes them a good control signal. I present a quantum modulation method based on the random statistics of quantum light. The paper describes pulse width modulation schemes where a Poissonian light source acts as a random control that spreads the energy of the potential interfering signals. I give an example application for switching-mode power supplies and comment the further possibilities of the method.

  17. Microscale autonomous sensor and communications module

    DOE Patents [OSTI]

    Okandan, Murat; Nielson, Gregory N

    2014-03-25

    Various technologies pertaining to a microscale autonomous sensor and communications module are described herein. Such a module includes a sensor that generates a sensor signal that is indicative of an environmental parameter. An integrated circuit receives the sensor signal and generates an output signal based at least in part upon the sensor signal. An optical emitter receives the output signal and generates an optical signal as a function of the output signal. An energy storage device is configured to provide power to at least the integrated circuit and the optical emitter, and wherein the module has a relatively small diameter and thickness.

  18. Hybrid Traffic Data Collection Roadmap: Objectives and Methods

    E-Print Network [OSTI]

    Bayen, Alexandre

    2013-01-01

    information environment. Hybrid Traffic Data CollectionBibliography Bibliography Hybrid Traffic Data Collection19, no. 1, p. 15–25, 2003. Hybrid Traffic Data Collection

  19. Hybrid Traffic Data Collection Roadmap: Objectives and Methods

    E-Print Network [OSTI]

    Bayen, Alexandre

    2013-01-01

    Traffic Data Collection Roadmap: Objectives and MethodsTraffic Data Collection Roadmap: Objectives and MethodsTraffic Data Collection Roadmap: Objectives and Methods

  20. Identification coding schemes for modulated reflectance systems

    DOE Patents [OSTI]

    Coates, Don M. (Santa Fe, NM); Briles, Scott D. (Los Alamos, NM); Neagley, Daniel L. (Albuquerque, NM); Platts, David (Santa Fe, NM); Clark, David D. (Santa Fe, NM)

    2006-08-22

    An identifying coding apparatus employing modulated reflectance technology involving a base station emitting a RF signal, with a tag, located remotely from the base station, and containing at least one antenna and predetermined other passive circuit components, receiving the RF signal and reflecting back to the base station a modulated signal indicative of characteristics related to the tag.

  1. Development of ultra-broadband modulators

    E-Print Network [OSTI]

    Shamir, Orit A

    2008-01-01

    Optical signal modulation is a cornerstone of communication, allowing the transfer of information by electrically encoding data onto an optical carrier. Modulation with ultra-broadband capability enables the generation of ...

  2. Robust signal timing optimization with environmental Lihui Zhang a

    E-Print Network [OSTI]

    Chen, Shigang

    6 January 2013 Accepted 9 January 2013 Keywords: Traffic signal timing Traffic delay Air pollutant to capture the dispersion of air pollutants and compute the road- side pollutant concentrations. A measure and living conditions, air pollution has long emerged as one of the most acute problems in many metropolitan

  3. Division of IT Convergence Engineering Datacenter Traffic Monitoring

    E-Print Network [OSTI]

    Boutaba, Raouf

    Division of IT Convergence Engineering Datacenter Traffic Monitoring Using Traffic Mirroring, Korea 3 School of Computer Science, University of Waterloo, Canada In these days, datacenter traffic has been increased rapidly. Monitoring datacenter traffic is more difficult than conventional Internet

  4. Fermilab | Traffic Safety at Fermilab |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journal Article) | SciTechSubmitted MoreTraffic Safety Traffic Citation

  5. Temporary Pedestrian & Vehicular Traffic Flow Typical Conditions

    E-Print Network [OSTI]

    Kamat, Vineet R.

    Temporary Pedestrian & Vehicular Traffic Flow Typical Conditions Winter 2014 Ann Arbor - Medical://www.umaec.umich.edu/closures.html Roadway Closure Existing Traffic Pattern I0 400 800 1,200200 Feet Pedestrian Route Existing Building

  6. DATALITE: a Distributed Architecture for Traffic Analysis via Light-weight Traffic Digest

    E-Print Network [OSTI]

    Chao, Jonathan

    DATALITE: a Distributed Architecture for Traffic Analysis via Light-weight Traffic Digest for Traffic Analysis via LIght- weight Traffic digEst, which introduces a set of new distributed algorithms digests (TD's) amongst the network nodes. A TD for N packets only requires O(loglog N) bits of memory

  7. The Traffic Circle of Life Anna Nagurney

    E-Print Network [OSTI]

    Nagurney, Anna

    gallons of wasted fuel ­ enough to fill 4 New Orleans Superdomes. Anna Nagurney The Traffic Circle of Life

  8. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-5 3-4 2-3 1-2 0-1 12/12/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;P: BC/12/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/12/2013 4 GW-VCU VESSEL TRAFFIC

  9. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T: GW - KM GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK

  10. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;R: KM 348 3D-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  11. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;S: DP 415 3D-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  12. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;Q: GW 487 3D-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  13. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;Q: GW 487 & NB GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK

  14. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T: GW - KM/21/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/21/2013 5 GW-VCU VESSEL TRAFFIC

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-5 3-4 2-3 1-2 0-1 12/19/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;P: BC & LOW GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/19/2013 4 GW-VCU VESSEL TRAFFIC RISK

  16. RFID tag modification for full depth backscatter modulation

    DOE Patents [OSTI]

    Scott, Jeffrey Wayne [Pasco, WA; Pratt, Richard M [Richland, WA

    2010-07-20

    A modulated backscatter radio frequency identification device includes a diode detector configured to selectively modulate a reply signal onto an incoming continuous wave; communications circuitry configured to provide a modulation control signal to the diode detector, the diode detector being configured to modulate the reply signal in response to be modulation control signal; and circuitry configured to increase impedance change at the diode detector which would otherwise not occur because the diode detector rectifies the incoming continuous wave while modulating the reply signal, whereby reducing the rectified signal increases modulation depth by removing the reverse bias effects on impedance changes. Methods of improving depth of modulation in a modulated backscatter radio frequency identification device are also provided.

  17. Asynchronous SAN Switching under Multicast Traffic

    E-Print Network [OSTI]

    Asynchronous SAN Switching under Multicast Traffic Andrea Bianco *, Luca Giraudo *, Alessandra-Multicast traffic in Storage Area Networks (SANs) enables applications such as disaster recovery, remote data-less switching architecture devised for SANs is described, and its performance under multicast traffic is studied

  18. History-based Traffic Control Gabriel Balan

    E-Print Network [OSTI]

    López-Sánchez, Maite

    travel home, shouldn't traffic light controllers rec- ognize this fact and award you the green light@cs.gmu.edu Sean Luke George Mason University Fairfax, VA (USA) sean@cs.gmu.edu ABSTRACT What if traffic lights a vari- ety of multi-agent traffic light controllers which consider vehicles' past stopped

  19. May 21, 2014 Local Agency Traffic

    E-Print Network [OSTI]

    Minnesota, University of

    Field Evaluation Traffic Data Collection Processes Study Is there better EQUIPMENT for collecting low Improvements Field Evaluation Traffic Data Collection Processes Study Is there better EQUIPMENT for collecting;Project Overview 2013-2014Local Agency Data Collection 5 · Tested traffic sensors in a low

  20. Improving Air Traffic Management through Agent Suggestions

    E-Print Network [OSTI]

    Tumer, Kagan

    air traffic flow problem (de- scribed in [4]). 2. SUGGESTION AGENTS Though the system performanceImproving Air Traffic Management through Agent Suggestions (Extended Abstract) Adrian Agogino USCS.tumer@oregonstate.edu ABSTRACT Providing intelligent automation to manage the continu- ously increasing flow of air traffic

  1. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;12/19/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;12/19/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision

  2. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;Q: GW 487 3D RiskVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding

  3. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    -VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;Q: GW 487 3D RiskVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision

  4. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding

  5. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;12/19/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;12/19/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding

  6. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE #12;12/23/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE #12;T: GW - KM - DP 3D Risk Profile What-If FV - Oil

  7. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision

  8. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr;11/18/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE Draft #12;11/18/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE Draft #12;DEFINITION OF 15 WATERWAY

  9. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;12/23/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO #12;12/23/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO #12;T: GW) 2010 POTENTIAL GROUNDING OIL LOSS - PGO #12;12/23/2013 9 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA

  10. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    Draft #12;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/17/2013 9 GW

  11. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    #12;12/23/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO #12;12/23/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO #12;12/23/2013 9 GW-VCU VESSEL

  12. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;12/12/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;12/12/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;P-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;DEFINITION OF 15

  13. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    -VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;12/19/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;DEFINITION OF 15VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding

  14. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    -VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;12/19/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;DEFINITION OF 15VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;R: KM 348 3D RiskVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding

  16. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;11/21/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/21/2013 6 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;T ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/21/2013 10 GW-VCU VESSEL TRAFFIC RISK

  17. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    Draft #12;12/13/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;12/13/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL;12/13/2013 8 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12

  18. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE #12;12/23/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE #12;T: GW - KM - DP 3D Risk Profile What-If FV - Oil Time

  19. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;11/17/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;T-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;DEFINITION OF 15

  20. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    #12;12/23/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO #12;12/23/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO #12;12/23/2013 9 GW-VCU VESSEL

  1. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE #12;11/20/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE #12;T: GW - KM - DP 3D Risk Profile What-If FV - Oil Time

  2. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;11/21/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT GROUNDING OIL LOSS - PGO Draft #12;11/21/2013 9 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIALVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding

  3. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    -VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;R: KM 348 3D RiskVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision

  4. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ;12/12/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;12/12/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;P TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;DEFINITION OF 15 WATERWAY

  5. 2001 TRAFFIC ZONE BOUNDARIES Zone Numbers

    E-Print Network [OSTI]

    Toronto, University of

    2001 TRAFFIC ZONE BOUNDARIES Zone Numbers & Detailed Definitions #12;2001 TRAFFIC ZONE BOUNDARIES of Toronto Joint Program in Transportation January 2003 #12;PREFACE This report presents the 2001 traffic zone numbers by local municipalities in the 2001 TTS survey area. The second part presents detailed

  6. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision ASSESSMENT (VTRA) 2010 Draft #12;12/13/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION OIL LOSS - PCO Draft #12;12/13/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL

  7. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision ­ KM ­ DP & 6 RMM's Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 RMM 1: Max;11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT

  8. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision;11/22/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T: GW - KM - DP & ER 3D Risk Profile All

  9. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr & 6 RMM's Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 RMM 1: Max. Speed-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL

  10. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T : GW - KM - DP & +VAR FV 3D Risk RISK ASSESSMENT (VTRA) 2010 12/23/2013 3 GW-VCU Draft #12;12/23/2013 4 GW-VCU VESSEL TRAFFIC RISK

  11. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding ­ KM ­ DP & 6 RMM's Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 RMM 1: Max;11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT

  12. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T : GW - KM - DP & +VAR FV 3D Risk ASSESSMENT (VTRA) 2010 12/23/2013 3 GW-VCU Draft #12;12/23/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA

  13. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision T ­ GW ­ KM ­ DP & 6 RMM's Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 RMM 1) Draft #12;11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS

  14. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision ASSESSMENT (VTRA) 2010 Draft #12;12/13/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL COLLISION FREQUENCY - PCF Draft #12;12/13/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T: GW - KM - DP & ER 3D Risk Profile All FV - Oil Time

  16. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding T ­ GW ­ KM ­ DP & 6 RMM's Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 RMM 1) Draft #12;11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS

  17. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;U : GW - KM - DP & VAR 3D Risk Profile ASSESSMENT (VTRA) 2010 11/21/2013 3 GW-VCU Draft #12;11/21/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA

  18. Marine Traffic Engineering through Relational Data Mining

    E-Print Network [OSTI]

    Ceci, Michelangelo

    Marine Traffic Engineering through Relational Data Mining Antonio Bruno1 and Annalisa Appice1,2 1-relational method of frequent pattern discovery into the marine traffic investigation. Multi-relational data mining collected in the gulf of Taranto. 1 Introduction Marine traffic engineering is a research field originally

  19. The WSS scalar complex valued random process (X(t), t R) is amplitude modulated onto a carrier to produce the signal

    E-Print Network [OSTI]

    California at San Diego, University of

    and is independent of the process (Z(t), t R). (d) Derive an expression for the power spectral density SY Y a carrier to produce the signal Z(t) = 2X(t) cos(2fct + ), where is uniformly distributed on [0; 2) and is independent of the process (X(t), t R). (a) Demonstrate that (Z(t), t R) is WSS. (b) Derive an expression

  20. Crowding effects in vehicular traffic

    E-Print Network [OSTI]

    Combinido, Jay Samuel L

    2012-01-01

    While the impact of crowding on the diffusive transport of molecules within a cell is widely studied in biology, it has thus far been neglected in traffic systems where bulk behavior is the main concern. Here, we study the effects of crowding due to car density and driving fluctuations on the transport of vehicles. Using a microscopic model for traffic, we found that crowding can push car movement from a superballistic down to a subdiffusive state. The transition is also associated with a change in the shape of the probability distribution of positions from negatively-skewed normal to an exponential distribution. Moreover, crowding broadens the distribution of cars' trap times and cluster sizes. At steady state, the subdiffusive state persists only when there is a large variability in car speeds. We further relate our work to prior findings from random walk models of transport in cellular systems.

  1. Tunable Signal Processing in Synthetic MAP Kinase Cascades

    E-Print Network [OSTI]

    Collins, James J.

    Tunable Signal Processing in Synthetic MAP Kinase Cascades Ellen C. O'Shaughnessy,1 Santhosh Palani profiles. This work demonstrates that tunable signal processing is inherent to minimal MAPK modules are ubiquitous, versatile signaling modules found in all eukaryotic cells. They transmit and process signals

  2. Modular Composition of Synchronous Programs: Applications to Traffic Signal Control

    E-Print Network [OSTI]

    Zennaro, Marco; Sengupta, Raja

    2006-01-01

    Synchronous Programs Figure 9: The model used to estimate the overhead 512 Mb ram machines.machines. Hence, we argue that we can distribute a Simulink-like synchronous

  3. Modular Composition of Synchronous Programs: Applications to Traffic Signal Control

    E-Print Network [OSTI]

    Zennaro, Marco; Sengupta, Raja

    2006-01-01

    of Path-Planning for a UAV to Track a Ground Vehicle”, AINSR. , “An architecture for UAV team control”, IAV Conferenceemerging results in cooperative UAV control", IEEE 2004 44th

  4. Alpha-2 Heremans Schmid Glycoprotein (AHSG) Modulates Signaling Pathways in Head and Neck Squamous Cell Carcinoma Cell Line SQ20B

    SciTech Connect (OSTI)

    Thompson, Pamela D.; Sakwe, Amos [Department of Biochemistry and Cancer Biology, Meharry Medical College, Nashville, TN 37208 (United States); Koumangoye, Rainelli [Division of Surgical Oncology and Endocrine Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Yarbrough, Wendell G. [Division of Otolaryngology, Departments of Surgery and Pathology and Yale Cancer Center, Yale University, New Haven, CT 06520 (United States); Ochieng, Josiah [Department of Biochemistry and Cancer Biology, Meharry Medical College, Nashville, TN 37208 (United States); Marshall, Dana R., E-mail: dmarshall@mmc.edu [Department of Pathology, Anatomy and Cell Biology, Meharry Medical College, Nashville, TN 37208 (United States)

    2014-02-15

    This study was performed to identify the potential role of Alpha-2 Heremans Schmid Glycoprotein (AHSG) in Head and Neck Squamous Cell Carcinoma (HNSCC) tumorigenesis using an HNSCC cell line model. HNSCC cell lines are unique among cancer cell lines, in that they produce endogenous AHSG and do not rely, solely, on AHSG derived from serum. To produce our model, we performed a stable transfection to down-regulate AHSG in the HNSCC cell line SQ20B, resulting in three SQ20B sublines, AH50 with 50% AHSG production, AH20 with 20% AHSG production and EV which is the empty vector control expressing wild-type levels of AHSG. Utilizing these sublines, we examined the effect of AHSG depletion on cellular adhesion, proliferation, migration and invasion in a serum-free environment. We demonstrated that sublines EV and AH50 adhered to plastic and laminin significantly faster than the AH20 cell line, supporting the previously reported role of exogenous AHSG in cell adhesion. As for proliferative potential, EV had the greatest amount of proliferation with AH50 proliferation significantly diminished. AH20 cells did not proliferate at all. Depletion of AHSG also diminished cellular migration and invasion. TGF-? was examined to determine whether levels of the TGF-? binding AHSG influenced the effect of TGF-? on cell signaling and proliferation. Whereas higher levels of AHSG blunted TGF-? influenced SMAD and ERK signaling, it did not clearly affect proliferation, suggesting that AHSG influences on adhesion, proliferation, invasion and migration are primarily due to its role in adhesion and cell spreading. The previously reported role of AHSG in potentiating metastasis via protecting MMP-9 from autolysis was also supported in this cell line based model system of endogenous AHSG production in HNSCC. Together, these data show that endogenously produced AHSG in an HNSCC cell line, promotes in vitro cellular properties identified as having a role in tumorigenesis. Highlights: • Head and neck squamous cell carcinoma cell lines synthesize and secret AHSG. • AHSG depleted cell lines are significantly inhibited in their ability to proliferate, adhere, migrate, invade and protect MMP-9. • Human AHSG and bovine fetuin-A are functionally equivalent in regards to growth promotion of cancer cell lines.

  5. A nonlinear optoelectronic filter for electronic signal processing

    E-Print Network [OSTI]

    Loh, William

    The conversion of electrical signals into modulated optical waves and back into electrical signals provides the capacity for low-loss radio-frequency (RF) signal transfer over optical fiber. Here, we show that the unique ...

  6. Freeway Short-Term Traffic Flow Forecasting by Considering Traffic Volatility Dynamics and Missing Data Situations 

    E-Print Network [OSTI]

    Zhang, Yanru

    2012-10-19

    traffic managers in seeking solutions to congestion problems on urban freeways and surface streets. There is new research interest in short-term traffic flow forecasting due to recent developments in ITS technologies. Previous research involves...

  7. Got Traffic? An Evaluation of Click Traffic Providers Qing Zhang, Thomas Ristenpart

    E-Print Network [OSTI]

    Wang, Deli

    and Subject Descriptors H.3.5 [Information Systems]: On-line Information Service--Com- mercial services, Web- ondary traffic-selling ecosystem -- comprising traffic vendors who will contract to deliver clicks

  8. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    GROUNDING OIL LOSS - PGO Draft #12;11/22/2013 6 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;11/22/2013 7 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 T: GW - KM;11/22/2013 9 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12

  9. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/12/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/12/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING FREQUENCY

  10. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/23/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 #12;12/23/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING FREQUENCY

  11. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Q: GW 487 & NB & OH

  12. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision: GW ­ KM ­ DP & +1 Escort Cape Size Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  13. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12-2 0-1 VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 11/17/2013 3 GW-VCU Draft #12;11/17/2013 4 GW

  14. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T : GW - KM - DP & +VAR FV 3D Risk Profile All FV - Oil Time-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/23/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL FOR HARO-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA

  16. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 11/17/2013 2 GW-VCU Draft #12-2 0-1 11/17/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW

  17. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;U : GW - KM - DP & VAR 3D Risk Profile All FV - Vessel Time-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  18. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL FOR HARO-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  19. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-7 5-6 4-5 3-4 2-3 1-2 0-1 12/19/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;P-2 0-1 12/19/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/19/2013 4 GW

  20. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;U : GW - KM - DP & VAR 3D Risk Profile All FV - Oil Time-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  1. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision-2 0-1 12/23/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T : GW - KM - DP & +VAR-2 0-1 12/23/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/23/2013 4 GW

  2. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/13/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING

  3. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr & +1 Escort Cape Size Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

  4. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding ­ KM ­ DP & +1 Escort Cape Size Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

  5. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12-2 0-1 VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 11/17/2013 3 GW-VCU Draft #12;11/17/2013 4 GW

  6. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-7 5-6 4-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;P-2 0-1 11/17/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW

  7. Bicycle traffic planning and design criteria 

    E-Print Network [OSTI]

    Vathana, Jhirasak

    1975-01-01

    BICYCLE TRAFFIC PLANNING AND DESIGN CRITERIA A Thesis JHIRASAK VATHANA Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE May 1975 Major Subject...: Interdisciplinary Engineering BICYCLE TRAFFIC PLANNING AND DESIGN CRITER1A A Thesis DHIRASAK VATHANA Approved as to style and content by: Chairman of Committee (Head of epartment) j 'j (Memb ) (Member) (Member) May l975 ABSTRACT Bicycle Traffic Planning...

  8. Signal voter

    DOE Patents [OSTI]

    Goodwin, Roy L. (Chatsworth, CA)

    1981-01-01

    A voter for providing a single accurate output signal that is derived from the closest two signal levels of three input signals, each of which signals represents a measurement of the same phenomena. By means of the voting circuit, the signals are first sorted by level of amplitude and then ranked as highest, middle or lowest. The highest or lowest signal that is furthest from the middle signal is rejected, while the other highest or lowest signal is selected for processing. The selected high or low signal is then averaged with the middle signal to provide the output signal.

  9. Taxiway Aircraft Traffic Scheduling: A Model and Solution Algorithms 

    E-Print Network [OSTI]

    Tian, Chunyu

    2012-10-19

    With the drastic increase in the demand for air travel, taxiway aircraft traffic scheduling is becoming increasingly important in managing air traffic. In order to reduce traffic congestion on taxiways, this thesis proposes ...

  10. A Methodology for Estimating Interdomain Web Traffic Demand

    E-Print Network [OSTI]

    Maggs, Bruce M.

    A Methodology for Estimating Interdomain Web Traffic Demand Anja Feldmann , Nils Kammenhuber-varying) interdomain HTTP traffic demand matrix pairing several hundred thousand blocks of client IP addresses, Traffic demand, Interdomain, Es- timation 1. INTRODUCTION The reliable estimation and prediction

  11. Traffic condition tracking and visualization in virtual city testbed

    E-Print Network [OSTI]

    Zhu, Boyuan, M. Eng. Massachusetts Institute of Technology

    2011-01-01

    Computer traffic simulation is a tool widely used to understand how humans behave under varying traffic conditions. The Virtual City Testbed is a traffic simulation framework built to closely model human behavior by allowing ...

  12. Scaling Microblogging Services with Divergent Traffic Demands

    E-Print Network [OSTI]

    Almeroth, Kevin C.

    Scaling Microblogging Services with Divergent Traffic Demands Tianyin Xu1 , Yang Chen1 , Lei Jiao1 client-server architecture has not scaled with user demands, leading to server overload and significant #12;Scaling Microblogging Services with Divergent Traffic Demands 21 producing effective predictions

  13. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ASSESSMENT (VTRA) 2010 11/18/2013 2 GW-VCU Draft #12;P: BC & DH100 3D Risk Profile All FV - Pot. Ground. Oil OIL LOSS - PGO Draft #12;11/18/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIALVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding

  14. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    COLLISION OIL LOSS - PCO Draft #12;11/18/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIALVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision Oil Loss Dr. J. Rene van Dorp and Dr. Jason R.W Merrick 11/18/2013 1 GW-VCU November 2013 CASE P: BASE

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    ) 2010 Draft #12;11/18/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OILVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding Oil Loss Dr. J. Rene van Dorp and Dr. Jason R.W Merrick 11/18/2013 1 GW-VCU November 2013 CASE P: BASE

  16. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr RISK ASSESSMENT (VTRA) 2010 Draft #12;P: BC & DH100 3D Risk Profile All FV - Oil Time Exposure: 100 Draft #12;11/18/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE Draft

  17. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    COLLISION OIL LOSS - PCO Draft #12;11/19/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIALVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision Oil Loss Dr. J. Rene van Dorp and Dr. Jason R.W Merrick 11/19/2013 1 GW-VCU November 2013 CASE P: BASE

  18. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    -VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;11/17/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;T: GW - KM - DP 3 RISK ASSESSMENT (VTRA) 2010 POTENTIAL GROUNDING OIL LOSS - PGO Draft #12;DEFINITION OF 15 WATERWAY

  19. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    OIL LOSS - PGO Draft #12;11/19/2013 5 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 POTENTIALVESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding Oil Loss Dr. J. Rene van Dorp and Dr. Jason R.W Merrick 11/19/2013 1 GW-VCU November 2013 CASE P: BASE

  20. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr ASSESSMENT (VTRA) 2010 Draft #12;P: BC & OB HE100 3D Risk Profile All FV - Oil Time Exposure: 100% of Base;11/19/2013 4 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 OIL TIME EXPOSURE- OTE Draft #12;11/19/2013 5 GW

  1. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure Escort for all Focus Vessels on Haro Routes Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL FOR HARO-BOUNDARY ROUTES (GREEN

  2. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL All FV - Vessel Time Exposure: 125% of Base Case VTE 23-24 22-23 21-22 20-21 19-20 18-19 17-18 16

  3. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure GW-VCU Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 RMM 1: Max. Speed of Container Vessels at 17 knots. RMM 2: Reduce Human Error incident on Oil Barges by 50% RMM 3: No Bunkering

  4. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure Escort Cape Size Draft #12;11/21/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL FOR HARO-BOUNDARY ROUTES (GREEN) AND FOR ROSARIO ROUTES (ORANGE

  5. INTEGRATION: An Overview of Traffic Simulation Features

    E-Print Network [OSTI]

    Hellinga, Bruce

    emissions, and more recently the combined modeling of traffic and communications subsystems. However, all, such as the addition of car-following logic, lane-changing logic, and more dynamic traffic assignment routines. However plazas, vehicle emissions, weaving sections, and HOVs. In addition, some features, such as the real

  6. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision;11/22/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT RISK ASSESSMENT (VTRA) 2010 11/22/2013 3 GW-VCU Draft #12;T: GW - KM - DP & ER 3D Risk Profile All FV

  7. The National Traffic Safety Summit Traffic Incident Management, Traffic Homicide Investigation and Mitigation Strategies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S.Week Day Year(activeInforumMILC The NERSCIgnitionTraffic

  8. Fact #580: July 20, 2009 Traffic Congestion Grows | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Texas Transportation Institute's latest study on traffic congestion, two of every three cars experienced congestion in their morning or evening trip in 2007. As expected, traffic...

  9. Impact of Traffic States on Freeway Collision Frequency

    E-Print Network [OSTI]

    Yeo, Hwasoo; Jang, Kitae; Skabardonis, Alexander

    2010-01-01

    a section using upstream and downstream traffic states: freeBQ). In FF, both upstream and downstream traffic phases arephase means that both upstream and downstream locations are

  10. Module Configuration

    DOE Patents [OSTI]

    Oweis, Salah (Ellicott City, MD); D'Ussel, Louis (Bordeaux, FR); Chagnon, Guy (Cockeysville, MD); Zuhowski, Michael (Annapolis, MD); Sack, Tim (Cockeysville, MD); Laucournet, Gaullume (Paris, FR); Jackson, Edward J. (Taneytown, MD)

    2002-06-04

    A stand alone battery module including: (a) a mechanical configuration; (b) a thermal management configuration; (c) an electrical connection configuration; and (d) an electronics configuration. Such a module is fully interchangeable in a battery pack assembly, mechanically, from the thermal management point of view, and electrically. With the same hardware, the module can accommodate different cell sizes and, therefore, can easily have different capacities. The module structure is designed to accommodate the electronics monitoring, protection, and printed wiring assembly boards (PWAs), as well as to allow airflow through the module. A plurality of modules may easily be connected together to form a battery pack. The parts of the module are designed to facilitate their manufacture and assembly.

  11. Prosodic modules for speech recognition and understanding in VERBMOBIL. 

    E-Print Network [OSTI]

    Hess, Wolfgang; Batliner, A; Kießling, A; Kompe, R; Nöth, E; Petzold, A; Reyelt, M; Strom, Volker

    1995-01-01

    Within VERMOBIL, a large project on spoken language research in Germany, two modules for detecting and recognising prosodic events have been deveopled. One module operates on speech signal parameterss and the word hypothesis ...

  12. A First Look at Modern Enterprise Traffic

    SciTech Connect (OSTI)

    Pang, Ruoming; Mark Allman, Mark; Bennett, Mike; Lee, Jason; Paxson, Vern; Tierney, Brian

    2005-06-01

    While wide-area Internet traffic has been heavily studied for many years, the characteristics of traffic inside Internet enterprises remain almost wholly unexplored. Nearly all of the studies of enterprise traffic available in the literature are well over a decade old and focus on individual LANs rather than whole sites. In this paper we present a broad overview of internal enterprise traffic recorded at a medium-sized site. The packet traces span more than 100 hours, over which activity from a total of several thousand internal hosts appears. This wealth of data--which we are publicly releasing in anonymized form--spans a wide range of dimensions. While we cannot form general conclusions using data from a single site, and clearly this sort of data merits additional in-depth study in a number of ways, in this work we endeavor to characterize a number of the most salient aspects of the traffic. Our goal is to provide a first sense of ways in which modern enterprise traffic is similar to wide-area Internet traffic, and ways in which it is quite different.

  13. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010-4 2-3 1-2 0-1 11/17/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;11/17/2013 4 GW

  14. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 12/12/2013 2 GW-VCU Draft #12-4 2-3 1-2 0-1 12/12/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/12/2013 4 GW

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

  16. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/20/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA-7 5-6 4-5 3-4 2-3 1-2 0-1 VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 11/20/2013 3 GW-VCU #12

  17. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  18. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/12/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12-4 2-3 1-2 0-1 12/12/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;12/12/2013 4 GW

  19. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 11/17/2013 2 GW-5 3-4 2-3 1-2 0-1 11/17/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  20. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010-5 3-4 2-3 1-2 0-1 11/17/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  1. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  2. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Oil Time Exposure Dr-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12-5 3-4 2-3 1-2 0-1 12/13/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  3. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/20/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/20/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 #12

  4. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/19/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010-5 3-4 2-3 1-2 0-1 12/19/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  5. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Collision-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/23/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010-7 5-6 4-5 3-4 2-3 1-2 0-1 12/23/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 #12

  6. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/12/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010-5 3-4 2-3 1-2 0-1 12/12/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  7. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/20/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA-7 5-6 4-5 3-4 2-3 1-2 0-1 VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 11/20/2013 3 GW-VCU #12

  8. Fair Internet traffic integration: network flow models and analysis

    E-Print Network [OSTI]

    Kelly, Frank

    Fair Internet traffic integration: network flow models and analysis Peter Key, Laurent Massoulié the integration of two types of Internet traffic, elastic file transfers and streaming traffic. Previous studies have concentrated on just one type of traffic, such as the flow level models of Internet congestion

  9. http://tti.tamu.edu > Variable message signs > Traffic actuated controllers > Traffic signals > Flashing traffic signals > Lane use control signals > Road markings > Rumble strips > Warrants (Traffic control devices) > Gro

    E-Print Network [OSTI]

    and development > Airport maintenance > Bicycle and pedestrian > Ports and waterways >>> Transportation operations > Aesthetics > Statistics > Transportation engineering >>> Mathematics > Simulation > Statistical analysis pipeline transportation > Airport planning and development > Airport maintenance > Bicycle and pedestrian

  10. Scaling Microblogging Services with Divergent Traffic Demands

    E-Print Network [OSTI]

    Fu, Xiaoming

    Scaling Microblogging Services with Divergent Traffic Demands Tianyin Xu, Yang Chen, Lei Jiao, Ben-server architecture has not scaled with user demands, lead- ing to server overload and significant impairment

  11. Smart-card traffic system keeps Singapore

    E-Print Network [OSTI]

    Hunt, Julian

    Smart-card traffic system keeps Singapore in the fast lane Sir -- Recognizing the high economic tariffs from a smart card installed in a slot near the vehicle's windscreen. Infringement is registered

  12. Partitioning Complexity in Air Traffic Management Task

    E-Print Network [OSTI]

    Cummings, M. L.

    2006-01-01

    Cognitive complexity is a term that appears frequently in air traffic control (ATC) research literature, yet there is little principled investigation of the potential sources of cognitive complexity. Three distinctly ...

  13. Built Environmental Correlates of Traffic Collisions 

    E-Print Network [OSTI]

    Yu, Chia-Yuan

    2014-07-01

    relationships between built environmental attributes and crashes with different levels of injury severity in census block groups in Austin, TX. The results showed that traffic volume, highways/freeways, arterial roads, and commercial uses had consistently...

  14. Reverse Engineering User Behaviors From Network Traffic

    E-Print Network [OSTI]

    Xie, Guowu

    2013-01-01

    of user requests to web pages with beacon, ad, and either inof modern web traffic and web-pages, Ihm et al. proposed abeacons to track their web pages and objects. Intuitively,

  15. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure & No Bunkering Draft #12;Q: GW 487 3D Risk Profile All FV - Vessel Time Exposure: 113% of Base Case VTE 23-24 22-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;Q: GW 487 & NB

  16. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure + Bunkering Draft #12;P: Base Case 3D Risk Profile All FV - Vessel Time Exposure: 100% of Base Case VTE 23-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;S: DP 415 3

  17. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure & No Bunkering & Only Haro Draft #12;Q: GW 487 & NB 3D Risk Profile All FV - Vessel Time Exposure: 108% of Base-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  18. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure + Cargo FV set at High December 2013 Draft #12;T: GW - KM - DP 3D Risk Profile All FV - Vessel Time-12 10-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT

  19. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure + Bunkering Draft #12;P: Base Case 3D Risk Profile All FV - Vessel Time Exposure: 100% of Base Case VTE 23-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;R: KM 348 3

  20. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure ­ DP & Tankers set Low #12;T: GW - KM - DP 3D Risk Profile All FV - Vessel Time Exposure: 125% of Base-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/23/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 #12;T

  1. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure GW-VCU Draft #12;P: Base Case 3D Risk Profile All FV - Vessel Time Exposure: 100% of Base Case VTE 23-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;T: GW - KM

  2. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure + Bunkering Draft #12;P: Base Case 3D Risk Profile All FV - Vessel Time Exposure: 100% of Base Case VTE 23-5 3-4 2-3 1-2 0-1 11/17/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12;Q: GW 487 3

  3. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure + Cargo FV set Low December 2013 Draft #12;T: GW - KM - DP 3D Risk Profile All FV - Vessel Time Exposure-11 9-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/23/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA

  4. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure set at High December 2013 Draft #12;T: GW - KM - DP 3D Risk Profile All FV - Vessel Time Exposure: 125-10 8-9 7-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/13/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

  5. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure and Cargo FV set at High Draft #12;P: Base Case 3D Risk Profile All FV - Vessel Time Exposure: 100% of Base-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 12/12/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  6. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure Way ATB's Rosario #12;T: GW - KM - DP 3D Risk Profile All FV - Vessel Time Exposure: 125% of Base Case-7 5-6 4-5 3-4 2-3 1-2 0-1 11/20/2013 2 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 #12;T: GW

  7. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Potential Grounding RISK ASSESSMENT (VTRA) 2010 DEFINITION OF ASSUMED LOCATIONS FOR ADDED ESCORT VESSEL FOR HARO-8 6-7 5-6 4-5 3-4 2-3 1-2 0-1 11/21/2013 3 GW-VCU VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 Draft #12

  8. Smart Fan Modules And System

    DOE Patents [OSTI]

    Cipolla, Thomas M. (Katonah, NY); Kaufman, Richard I. (Somers, NY); Mok, Lawrence S. (Brewster, NY)

    2003-07-15

    A fan module including: two or more individual fans, each fan having an air movement means and a motor engaged with the air movement means for accelerating air entering each of the two or more individual fans; a temperature sensor for sensing a temperature associated with the two or more fans and for outputting a first signal corresponding to the temperature; rotational speed sensor for outputting a second signal corresponding to a rotational speed of each of the two or more fans; and a processor for receiving the first and second signals and controlling the two or more individual fans based on the first and second signals. A fan module including: two or more individual fans, each fan having an air movement means and a motor engaged with the air movement means for accelerating air entering each of the two or more individual fans; a temperature sensor for sensing a temperature associated with the two or more fans and for outputting a first signal corresponding to the temperature; rotational speed sensor for outputting a second signal corresponding to a rotational speed of each of the two or more fans; and a processor for receiving the first and second signals and controlling the two or more individual fans based on the first and second signals.

  9. Agilent E8267D PSG Vector Signal Generator

    E-Print Network [OSTI]

    Anlage, Steven

    Agilent E8267D PSG Vector Signal Generator Data Sheet The Agilent E8267D is a fully synthesized signal generator with high output power, low phase noise, and I/Q modulation capability. Specifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 Internal pulse generator

  10. TrafficView: Traffic Data Dissemination using Car-to-Car Communication

    E-Print Network [OSTI]

    Iftode, Liviu

    TrafficView: Traffic Data Dissemination using Car-to-Car Communication Tamer Nadeema, Sasan high- tech devices are integrated, and a common platform for inter-vehicle communication is necessary platform for inter-vehicle communication is necessary to realize an intelligent transportation system

  11. A nonlinear optoelectronic filter for electronic signal processing

    E-Print Network [OSTI]

    Ram, Rajeev J.

    A nonlinear optoelectronic filter for electronic signal processing William Loh1,2 , Siva signals into modulated optical waves and back into electrical signals provides the capacity for low-loss radio-frequency (RF) signal transfer over optical fiber. Here, we show that the unique properties

  12. Automated identification of terminal area air traffic flows and weather related deviations

    E-Print Network [OSTI]

    Ng, Tony M. Eng. Massachusetts Institute of Technology

    2008-01-01

    Air traffic in terminal air space is very complex, making it very difficult to identify air traffic flows. Finding air traffic flows and flow boundaries are very helpful in analyzing how air traffic would react to weather. ...

  13. Development and implementation of algorithms used in ground and internet traffic monitoring 

    E-Print Network [OSTI]

    Ametha, Jayesh

    2001-01-01

    Two different problems have been analyzed, one involving Traffic Management Centers (TMCs), while the other involves Internet traffic monitoring at a network router. TMCs detect traffic incidents and manage traffic using Automatic Incident Detection...

  14. Signals & Systems Prof. Mark Fowler

    E-Print Network [OSTI]

    Fowler, Mark

    = 2f0 ) AM Radio: around 1 MHz FM Radio: around 100 MHz Cell Phones: around 900 MHz, around 1.8 GHz Transmitter (Tx) Modulator )(X FT of Message Signal Choose f0 > 10 kHz to enable efficient radiation (with 0

  15. Fact #581: July 27, 2009 Fuel Wasted in Traffic Congestion

    Broader source: Energy.gov [DOE]

    The researchers at the Texas Transportation Institute have recently published new estimates of the effects of traffic congestion. Nearly 3 billion gallons of fuel is wasted each year due to traffic...

  16. A mathematical model and descent algorithm for bilevel traffic management

    E-Print Network [OSTI]

    Patriksson, Michael

    demands, the possible presence of side constraints in the traff* *ic equilibrium system in cities with the immediate side effect of an incr* *ease in traffic demand. A functioning society depends traffic management Michael Patriksson* and R. Tyrrell Rockafellary

  17. Traffic prediction and navigation using historical and current information

    E-Print Network [OSTI]

    Lim, Sejoon

    2008-01-01

    We developed a traffic prediction and navigation system that deals with uncertainty of road traffic conditions by stochastic modeling of road networks. Our system consists of a data collecting system, a data management ...

  18. Off-line calibration of Dynamic Traffic Assignment models

    E-Print Network [OSTI]

    Balakrishna, Ramachandran, 1978-

    2006-01-01

    Advances in Intelligent Transportation Systems (ITS) have resulted in the deployment of surveillance systems that automatically collect and store extensive network-wide traffic data. Dynamic Traffic Assignment (DTA) models ...

  19. Laboratory to change vehicle traffic-screening regimen at vehicle...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Changes to vehicle traffic-screening Laboratory to change vehicle traffic-screening regimen at vehicle inspection station Lanes two through five will be open 24 hours a day and...

  20. Thermionic modules

    DOE Patents [OSTI]

    King, Donald B. (Albuquerque, NM); Sadwick, Laurence P. (Salt Lake City, UT); Wernsman, Bernard R. (Clairton, PA)

    2002-06-18

    Modules of assembled microminiature thermionic converters (MTCs) having high energy-conversion efficiencies and variable operating temperatures manufactured using MEMS manufacturing techniques including chemical vapor deposition. The MTCs incorporate cathode to anode spacing of about 1 micron or less and use cathode and anode materials having work functions ranging from about 1 eV to about 3 eV. The MTCs also exhibit maximum efficiencies of just under 30%, and thousands of the devices and modules can be fabricated at modest costs.

  1. Making the Traffic Operations Case for Congestion Pricing: Operational Impacts of Congestion Pricing

    SciTech Connect (OSTI)

    Chin, Shih-Miao [ORNL; Hu, Patricia S [ORNL; Davidson, Diane [ORNL

    2011-02-01

    Congestion begins when an excess of vehicles on a segment of roadway at a given time, resulting in speeds that are significantly slower than normal or 'free flow' speeds. Congestion often means stop-and-go traffic. The transition occurs when vehicle density (the number of vehicles per mile in a lane) exceeds a critical level. Once traffic enters a state of congestion, recovery or time to return to a free-flow state is lengthy; and during the recovery process, delay continues to accumulate. The breakdown in speed and flow greatly impedes the efficient operation of the freeway system, resulting in economic, mobility, environmental and safety problems. Freeways are designed to function as access-controlled highways characterized by uninterrupted traffic flow so references to freeway performance relate primarily to the quality of traffic flow or traffic conditions as experienced by users of the freeway. The maximum flow or capacity of a freeway segment is reached while traffic is moving freely. As a result, freeways are most productive when they carry capacity flows at 60 mph, whereas lower speeds impose freeway delay, resulting in bottlenecks. Bottlenecks may be caused by physical disruptions, such as a reduced number of lanes, a change in grade, or an on-ramp with a short merge lane. This type of bottleneck occurs on a predictable or 'recurrent' basis at the same time of day and same day of week. Recurrent congestion totals 45% of congestion and is primarily from bottlenecks (40%) as well as inadequate signal timing (5%). Nonrecurring bottlenecks result from crashes, work zone disruptions, adverse weather conditions, and special events that create surges in demand and that account for over 55% of experienced congestion. Figure 1.1 shows that nonrecurring congestion is composed of traffic incidents (25%), severe weather (15%), work zones, (10%), and special events (5%). Between 1995 and 2005, the average percentage change in increased peak traveler delay, based on hours spent in traffic in a year, grew by 22% as the national average of hours spent in delay grew from 36 hours to 44 hours. Peak delay per traveler grew one-third in medium-size urban areas over the 10 year period. The traffic engineering community has developed an arsenal of integrated tools to mitigate the impacts of congestion on freeway throughput and performance, including pricing of capacity to manage demand for travel. Congestion pricing is a strategy which dynamically matches demand with available capacity. A congestion price is a user fee equal to the added cost imposed on other travelers as a result of the last traveler's entry into the highway network. The concept is based on the idea that motorists should pay for the additional congestion they create when entering a congested road. The concept calls for fees to vary according to the level of congestion with the price mechanism applied to make travelers more fully aware of the congestion externality they impose on other travelers and the system itself. The operational rationales for the institution of pricing strategies are to improve the efficiency of operations in a corridor and/or to better manage congestion. To this end, the objectives of this project were to: (1) Better understand and quantify the impacts of congestion pricing strategies on traffic operations through the study of actual projects, and (2) Better understand and quantify the impacts of congestion pricing strategies on traffic operations through the use of modeling and other analytical methods. Specifically, the project was to identify credible analytical procedures that FHWA can use to quantify the impacts of various congestion pricing strategies on traffic flow (throughput) and congestion.

  2. Module No: 420244International Humanitarian Module Title

    E-Print Network [OSTI]

    Module No: 420244International Humanitarian law Module Title: Co-requisite:public international law 1Pre-requisite: Module Type: specialization requirementModule level: Second year Evening Study-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  3. Traffic Characterisation for Telecommunication Networks Attila Vidcs, Zsolt Kenesi, kos Rtfalvi, Pter Pozsgai, Sndor Molnr

    E-Print Network [OSTI]

    Molnár, Sándor

    the whole set of renewal processes for traffic characterisation. In data traffic modelling the so called ON depends on the nature of the traffic thereby there is an urgent need to find appropriate traffic models the nature of the traffic in future services. In spite of these difficulties of traffic modelling numerous

  4. module.h

    E-Print Network [OSTI]

    /* OS-9 module header definitions */ /* Executable memory module */ typedef struct { unsigned m_sync, /* sync bytes ($87cd) */ m_size, /* module size ...

  5. Air Traffic Control Using Virtual Stationary Automata Matthew D. Brown

    E-Print Network [OSTI]

    Lynch, Nancy

    Air Traffic Control Using Virtual Stationary Automata by Matthew D. Brown B.S., Massachusetts by . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Arthur C. Smith Chairman, Department Committee on Graduate Students #12;Air Traffic Control Using Virtual of Engineering Abstract As air travel has become an essential part of modern life, the air traffic control system

  6. A Twostep Statistical Approach for Inferring Network Traffic Demands #

    E-Print Network [OSTI]

    A Two­step Statistical Approach for Inferring Network Traffic Demands # A. Medina 1 , K. Salamatian knowledge of traffic demands in a communication net­ work enables or enhances a variety of traffic measuring a complete set of these demands is prohibitively expensive because of the huge amounts of data

  7. Adaptive Traffic Lights Using Car-to-Car Communication

    E-Print Network [OSTI]

    Iftode, Liviu

    Adaptive Traffic Lights Using Car-to-Car Communication Victor Gradinescu, Cristian Gorgorin, Raluca presents an adaptive traffic light system based on wireless communication between vehicles and fixed adaptive traffic light system. In section 4, we present the simulation framework we have developed

  8. Internet traffic growth: Sources and implications Andrew M. Odlyzko

    E-Print Network [OSTI]

    Odlyzko, Andrew M.

    Internet traffic growth: Sources and implications Andrew M. Odlyzko University of Minnesota, Minneapolis, MN, USA ABSTRACT The high tech bubble was inflated by myths of astronomical Internet traffic growth rates. Yet although these myths were false, Internet traffic was increasing very rapidly, close

  9. Internet Traffic Matrices: A Primer Paul Tune and Matthew Roughan

    E-Print Network [OSTI]

    Roughan, Matthew

    Internet Traffic Matrices: A Primer Paul Tune and Matthew Roughan School of Mathematical Sciences of various services from the Internet has led to an exponential growth of Internet traffic in the last decade for testing routing protocols. We conclude the chapter by summarising open questions in Internet traffic

  10. Stability for scalar balance laws; Application to pedestrian traffic.

    E-Print Network [OSTI]

    Mercier, Magali

    1 L1 Stability for scalar balance laws; Application to pedestrian traffic. Magali Mercier Universit-local flow, which appears for example in a new model of pedestrian traffic. 1 Introduction We consider condition. This is of interest in pedestrian traffic if for example we want to minimize the time of exit out

  11. High-resolution optical frequency dissemination on a telecommunication network with data traffic

    E-Print Network [OSTI]

    Fabien Kéfélian; Olivier Lopez; Haifeng Jiang; Christian Chardonnet; Anne Amy-Klein; Georgio Santarelli

    2009-02-12

    We transferred the frequency of an ultra-stable laser over a 108 km urban fiber link comprising 22 km of optical communications network fiber simultaneously carrying Internet data traffic. The metrological signal and the digital data signal are transferred on two different frequency channels in a dense wavelength division multiplexing scheme. The metrological signal is inserted into and extracted from the communications network by using bidirectional off-the-shelf optical add-drop multiplexers. The link-induced phase noise is measured and cancelled with round-trip technique using an all-fiber-based interferometer. The compensated link shows an Allan deviation of a few 10-16 at one second and below 10-19 at 10,000 seconds. This opens the way to a wide dissemination of ultra stable optical clock signals between distant laboratories via the Internet network.

  12. Asymmetric Multiclass Traffic Assignment: a coherent formulation

    E-Print Network [OSTI]

    Toint, Philippe

    of the asymmetric multiclass traffic assignment model are brought to light. A new formulation is presented, multiclass cost functions. A numerical calibration exercise for a car and truck class model concludes in the definition of coherent multiple value­of­time class and car­and­truck class models, and in the calibration

  13. Does Daylight Savings Time Affect Traffic Accidents? 

    E-Print Network [OSTI]

    Deen, Sophia 1988-

    2012-04-20

    This paper studies the effect of changes in accident pattern due to Daylight Savings Time (DST). The extension of the DST in 2007 provides a natural experiment to determine whether the number of traffic accidents is affected by shifts in hours...

  14. Understanding Data Center Traffic Characteristics Theophilus Benson

    E-Print Network [OSTI]

    Badrinath, B. R.

    Understanding Data Center Traffic Characteristics Theophilus Benson , Ashok Anand , Aditya Akella and Ming Zhang UW-Madison, Microsoft Research ABSTRACT As data centers become more and more central patterns in data center networks that can inform and help evaluate research and operational approaches. We

  15. TrafficView: A Driver Assistant Device for Traffic Monitoring based on Car-to-Car Communication

    E-Print Network [OSTI]

    Iftode, Liviu

    TrafficView: A Driver Assistant Device for Traffic Monitoring based on Car-to-Car Communication an intelligent transportation system, a common platform for inter-vehicle communication is needed. This platform, Directions, etc. Slide bar for areas infront or behind you Your car Other cars Fig. 1. Example of Traffic

  16. Variability in continuous traffic monitoring data

    SciTech Connect (OSTI)

    Wright, T.; Hu, P.S.; Young, J.

    1996-07-01

    Each state in the United States can be viewed as a universe of road segments. For each road segment in each state, it is desired to know various traffic characteristics based on count data, classification count data, and weigh-in-motion data. These data are absolutely essential for highway design, maintenance, safety, and planning. Given no cost constraints, each road segment would be continuously monitored every day of the year. However, in practice, a few road segments are monitored continuously every day of the year to produce annual characteristics of traffic flow. The remaining road segments are monitored for one or two days each year, and this resulting data are `adjusted` (using factors based on data collected from the continuously monitored road segments) to produce estimates of annual characteristics. With this general approach, each state strives to provide estimates of annual characteristics for each road segment within its jurisdiction. In 1985, the Federal Highway Administration (FHWA) published the Traffic Monitoring Guide to assist states in achieving this end. As with almost any data collection effort, the monitoring data suffers from errors from many sources. In this paper, we report some empirical findings in a research project sponsored by the FHWA. This research project studied the variability in the traffic data from the continuously monitored road segments from state(s) and, the extent to which this variability is transferred to and affects the precision of the data produced from the road segments which are monitored only one or two days each year. The ultimate hope is that states will eventually be able to not only publish an estimate of a characteristic such as Average Annual Daily Traffic (AADT) for each road segment, but also that each estimate will be accompanied by a statement expressing how good the estimate is in terms of its estimated variability or precision, which will likely be expressed as a coefficient of variation.

  17. Thermoelectric module

    DOE Patents [OSTI]

    Kortier, William E. (Columbus, OH); Mueller, John J. (Columbus, OH); Eggers, Philip E. (Columbus, OH)

    1980-07-08

    A thermoelectric module containing lead telluride as the thermoelectric mrial is encapsulated as tightly as possible in a stainless steel canister to provide minimum void volume in the canister. The lead telluride thermoelectric elements are pressure-contacted to a tungsten hot strap and metallurgically bonded at the cold junction to iron shoes with a barrier layer of tin telluride between the iron shoe and the p-type lead telluride element.

  18. Global synchronization of parallel processors using clock pulse width modulation

    DOE Patents [OSTI]

    Chen, Dong; Ellavsky, Matthew R.; Franke, Ross L.; Gara, Alan; Gooding, Thomas M.; Haring, Rudolf A.; Jeanson, Mark J.; Kopcsay, Gerard V.; Liebsch, Thomas A.; Littrell, Daniel; Ohmacht, Martin; Reed, Don D.; Schenck, Brandon E.; Swetz, Richard A.

    2013-04-02

    A circuit generates a global clock signal with a pulse width modification to synchronize processors in a parallel computing system. The circuit may include a hardware module and a clock splitter. The hardware module may generate a clock signal and performs a pulse width modification on the clock signal. The pulse width modification changes a pulse width within a clock period in the clock signal. The clock splitter may distribute the pulse width modified clock signal to a plurality of processors in the parallel computing system.

  19. Photovoltaic module and module arrays

    DOE Patents [OSTI]

    Botkin, Jonathan; Graves, Simon; Lenox, Carl J. S.; Culligan, Matthew; Danning, Matt

    2013-08-27

    A photovoltaic (PV) module including a PV device and a frame, The PV device has a PV laminate defining a perimeter and a major plane. The frame is assembled to and encases the laminate perimeter, and includes leading, trailing, and side frame members, and an arm that forms a support face opposite the laminate. The support face is adapted for placement against a horizontal installation surface, to support and orient the laminate in a non-parallel or tilted arrangement. Upon final assembly, the laminate and the frame combine to define a unitary structure. The frame can orient the laminate at an angle in the range of 3.degree.-7.degree. from horizontal, and can be entirely formed of a polymeric material. Optionally, the arm incorporates integral feature(s) that facilitate interconnection with corresponding features of a second, identically formed PV module.

  20. Photovoltaic module and module arrays

    DOE Patents [OSTI]

    Botkin, Jonathan (El Cerrito, CA); Graves, Simon (Berkeley, CA); Lenox, Carl J. S. (Oakland, CA); Culligan, Matthew (Berkeley, CA); Danning, Matt (Oakland, CA)

    2012-07-17

    A photovoltaic (PV) module including a PV device and a frame. The PV device has a PV laminate defining a perimeter and a major plane. The frame is assembled to and encases the laminate perimeter, and includes leading, trailing, and side frame members, and an arm that forms a support face opposite the laminate. The support face is adapted for placement against a horizontal installation surface, to support and orient the laminate in a non-parallel or tilted arrangement. Upon final assembly, the laminate and the frame combine to define a unitary structure. The frame can orient the laminate at an angle in the range of 3.degree.-7.degree. from horizontal, and can be entirely formed of a polymeric material. Optionally, the arm incorporates integral feature(s) that facilitate interconnection with corresponding features of a second, identically formed PV module.

  1. Active combustion flow modulation valve

    DOE Patents [OSTI]

    Hensel, John Peter; Black, Nathaniel; Thorton, Jimmy Dean; Vipperman, Jeffrey Stuart; Lambeth, David N; Clark, William W

    2013-09-24

    A flow modulation valve has a slidably translating hollow armature with at least one energizable coil wound around and fixably attached to the hollow armature. The energizable coil or coils are influenced by at least one permanent magnet surrounding the hollow armature and supported by an outer casing. Lorentz forces on the energizable coils which are translated to the hollow armature, increase or decrease the flow area to provide flow throttling action. The extent of hollow armature translation depends on the value of current supplied and the direction of translation depends on the direction of current flow. The compact nature of the flow modulation valve combined with the high forces afforded by the actuator design provide a flow modulation valve which is highly responsive to high-rate input control signals.

  2. The Physics of Traffic and Regional Development

    E-Print Network [OSTI]

    Helbing, Dirk

    2013-01-01

    This contribution summarizes and explains various principles from physics which are used for the simulation of traffic flows in large street networks, the modeling of destination, transport mode, and route choice, or the simulation of urban growth and regional development. The methods stem from many-particle physics, from kinetic gas theory, or fluiddynamics. They involve energy and entropy considerations, transfer the law of gravity, apply cellular automata and require methods from evolutionary game theory. In this way, one can determine interaction forces among driver-vehicle units, reproduce breakdowns of traffic including features of synchronized congested flow, or understand changing usage patterns of alternative roads. One can also describe daily activity patterns based on decision models, simulate migration streams, and model urban growth as a particular kind of aggregation process.

  3. Metropolitan Road Traffic Simulation on FPGAs.

    SciTech Connect (OSTI)

    Tripp J. L. (Justin L.); Mortveit, H. S. (Henning S.); Hansson, A. A. (Anders A.); Gokhale, M. (Maya)

    2005-01-01

    This work demonstrates that road traffic simulation of entire metropolitan areas is possible with reconfigurable supercomputing that combines 64-bit microprocessors and FPGAs in a high bandwidth, low latency interconnect. Previously, traffic simulation on FPGAs was limited to very short road segments or required a very large number of FPGAs. Our data streaming approach overcomes scaling issues associated with direct implementations and still allows for high-level parallelism by dividing the data sets between hardware and software across the reconfigurable supercomputer. Using one FPGA on the Cray XD1 supercomputer, we are able to achieve a 34.4 x speed up over the AMD microprocessor. System integration issues must be optimized to exploit this speedup in the overall simulation.

  4. VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010

    E-Print Network [OSTI]

    van Dorp, Johan René

    VESSEL TRAFFIC RISK ASSESSMENT (VTRA) 2010 3D Relative Risk Profile Comparison Vessel Time Exposure & Additional Variability of Case T What-If Focus Vessel Arrivals Draft #12;T: GW - KM - DP 3D Risk Profile All FV - Vessel Time Exposure: 125% of Base Case VTE 23-24 22-23 21-22 20-21 19-20 18-19 17-18 16-17 15

  5. FPGA Based Real-time Network Traffic Analysis using Traffic Dispersion Patterns

    SciTech Connect (OSTI)

    Khan, F; Gokhale, M; Chuah, C N

    2010-03-26

    The problem of Network Traffic Classification (NTC) has attracted significant amount of interest in the research community, offering a wide range of solutions at various levels. The core challenge is in addressing high amounts of traffic diversity found in today's networks. The problem becomes more challenging if a quick detection is required as in the case of identifying malicious network behavior or new applications like peer-to-peer traffic that have potential to quickly throttle the network bandwidth or cause significant damage. Recently, Traffic Dispersion Graphs (TDGs) have been introduced as a viable candidate for NTC. The TDGs work by forming a network wide communication graphs that embed characteristic patterns of underlying network applications. However, these patterns need to be quickly evaluated for mounting real-time response against them. This paper addresses these concerns and presents a novel solution for real-time analysis of Traffic Dispersion Metrics (TDMs) in the TDGs. We evaluate the dispersion metrics of interest and present a dedicated solution on an FPGA for their analysis. We also present analytical measures and empirically evaluate operating effectiveness of our design. The mapped design on Virtex-5 device can process 7.4 million packets/second for a TDG comprising of 10k flows at very high accuracies of over 96%.

  6. Traffic flow wide-area surveillance system definition

    SciTech Connect (OSTI)

    Allgood, G.O.; Ferrell, R.K.; Kercel, S.W.; Abston, R.A.; Carnal, C.L. [Oak Ridge National Lab., TN (United States); Moynihan, P.I. [Jet Propulsion Lab., Pasadena, CA (United States)

    1994-11-01

    Traffic Flow Wide-Area Surveillance (TFWAS) is a system for assessing the state of traffic flow over a wide area for enhanced traffic control and improved traffic management and planning. The primary purpose of a TFWAS system is to provide a detailed traffic flow description and context description to sophisticated traffic management and control systems being developed or envisioned for the future. A successful TFWAS system must possess the attributes of safety, reconfigurability, reliability, and expandability. The primary safety premise of TFWAS is to ensure that no action or failure of the TFWAS system or its components can result in risk of injury to humans. A wide variety of communication techniques is available for use with TFWAS systems. These communication techniques can be broken down into two categories, landlines and wireless. Currently used and possible future traffic sensing technologies have been examined. Important criteria for selecting TFWAS sensors include sensor capabilities, costs, operational constraints, sensor compatibility with the infrastructure, and extent. TFWAS is a concept that can take advantage of the strengths of different traffic sensing technologies, can readily adapt to newly developed technologies, and can grow with the development of new traffic control strategies. By developing innovative algorithms that will take information from a variety of sensor types and develop descriptions of traffic flows over a wide area, a more comprehensive understanding of the traffic state can be provided to the control system to perform the most reasonable control actions over the entire wide area. The capability of characterizing the state of traffic over an entire region should revolutionize developments in traffic control strategies.

  7. Tone signal generator for producing multioperator tone signals using an operator circuit including a waveform generator, a selector and an enveloper

    DOE Patents [OSTI]

    Dong, Q.; Jenkins, M.V.; Bernadas, S.R.

    1997-09-09

    A frequency modulation (FM) tone signal generator for generating a FM tone signal is disclosed. The tone signal generator includes a waveform generator having a plurality of wave tables, a selector and an enveloper. The waveform generator furnishes a waveform signal in response to a phase angle address signal. Each wave table stores a different waveform. The selector selects one of the wave tables in response to a plurality of selection signals such that the selected wave table largely provides the waveform signal upon being addressed largely by the phase angle address signal. Selection of the selected wave table varies with each selection signal. The enveloper impresses an envelope signal on the waveform signal. The envelope signal is used as a carrier or modulator for generating the FM tone signal. 17 figs.

  8. Properties and performance of the IEEE 802.11b complementary-code-key signal sets

    E-Print Network [OSTI]

    Royster, Thomas C., IV

    We describe similarities and differences between complementary-code-key (CCK) modulation and modulation that is derived from biorthogonal signals, and we present performance results and other information that may be useful ...

  9. Supported PV module assembly

    SciTech Connect (OSTI)

    Mascolo, Gianluigi; Taggart, David F.; Botkin, Jonathan D.; Edgett, Christopher S.

    2013-10-15

    A supported PV assembly may include a PV module comprising a PV panel and PV module supports including module supports having a support surface supporting the module, a module registration member engaging the PV module to properly position the PV module on the module support, and a mounting element. In some embodiments the PV module registration members engage only the external surfaces of the PV modules at the corners. In some embodiments the assembly includes a wind deflector with ballast secured to a least one of the PV module supports and the wind deflector. An array of the assemblies can be secured to one another at their corners to prevent horizontal separation of the adjacent corners while permitting the PV modules to flex relative to one another so to permit the array of PV modules to follow a contour of the support surface.

  10. System for transmitting low frequency analog signals over AC power lines

    DOE Patents [OSTI]

    Baker, Steven P. (Powell, TN); Durall, Robert L. (Lenoir City, TN); Haynes, Howard D. (Knoxville, TN)

    1989-01-01

    A system for transmitting low frequency analog signals over AC power lines using FM modulation. A low frequency analog signal to be transmitted is first applied to a voltage-to-frequency converter where it is converted to a signal whose frequency varies in proportion to the analog signal amplitude. This signal is then used to modulate the carrier frequency of an FM transmitter coupled to an AC power line. The modulation signal frequency range in selected to be within the response band of the FM transmitter. The FM modulated carrier signal is received by an FM receiver coupled to the AC power line, demodulated and the demodulated signal frequency is converted by a frequency-to-voltage converter back to the form of the original low frequency analog input signal.

  11. A system for tranmitting low frequency analog signals over ac power lines

    DOE Patents [OSTI]

    Baker, S.P.; Durall, R.L.; Haynes, H.D.

    1987-07-30

    A system for transmitting low frequency analog signals over ac power lines using FM modulation. A low frequency analog signal to be transmitted is first applied to a voltage-to-frequency converter where it is converted to a signal whose frequency varies in proportion to the analog signal amplitude. This signal is then used to modulate the carrier frequency of an FM transmitter coupled to an ac power line. The modulation signal frequency range is selected to be within the response band of the FM transmitter. The FM modulated carrier signal is received by an FM receiver coupled to the ac power line, demodulated and the demodulated signal frequency is converted by a frequency-to-voltage converter back to the form of the original low frequency analog input signal. 4 figs.

  12. Module Embedding Atanas Radenski

    E-Print Network [OSTI]

    Radenski, Atanas

    Module Embedding 1 Atanas Radenski Computer Science Department UNC-WSSU, P. O. Box 19479 Winston module embedding that enables the building of new modules from existing ones through inheritance for this mechanism. Module embedding is beneficial when modules and classes are used in combination and need

  13. Measurements of Diesel Truck Traffic Associated with Goods Movement

    E-Print Network [OSTI]

    Houston, Douglas; Krudysz, Margaret; Winer, Arthur

    2007-01-01

    Concentrations of PM2.5 and Diesel Exhaust Particles onPatterns of Measured Port Diesel Traffic. (a) Intersectionof particulate emissions from diesel engines: a review’, J.

  14. Resisting Traffic Analysis on Encrypted Data Streams | The Ames...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Resisting Traffic Analysis on Encrypted Data Streams New innovations in energy delivery systems and control systems continue to advance the reliability and resilience of the...

  15. Addendum to 2010 NREL Environmental Performance Report ? Traffic...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    was developed to address potential environmental impacts from changes in traffic at NREL and to support a Finding of No Significant Impact for several projects at the...

  16. NREL Leads Effort to Get Traffic Moving in Right Direction -...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NREL Leads Effort to Get Traffic Moving in Right Direction Connected Traveler project will guide travelers in energy-efficient manner August 17, 2015 The Energy Department's...

  17. Working with Modules within Python

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Using Modules within Python The EnvironmentModules python package gives access to the module system from within python. The EnvironmentModules python package has a single...

  18. Approved Module Information for EE2ESE, 2014/5 Module Title/Name: Electrical Systems Engineering Module Code: EE2ESE

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    fundamentals and mathematical description of power electronics and transmission of electric signals. * Ability of electromagnetism * electricity generation, power electronics, simple motors and machines * Ability to describeApproved Module Information for EE2ESE, 2014/5 Module Title/Name: Electrical Systems Engineering

  19. IEEE PHOTONICS TECHNOLOGY LETTERS, VOL. 20, NO. 4, FEBRUARY 15, 2008 315 Power Distribution of Phase-Modulated Microwave

    E-Print Network [OSTI]

    Yao, Jianping

    of Phase-Modulated Microwave Signals in a Dispersive Fiber-Optic Link Hao Chi and Jianping Yao, Senior the transmission of a phase-modulated microwave signal in a dispersive radio-over-fiber (RoF) link is presented. The presented model helps simplify the design and analysis of a phase-modulation-based microwave photonic link

  20. Watching Traffic for an Anomaly: Data Visualization

    E-Print Network [OSTI]

    Patwari, Neal

    -generated map -20 -15 -10 -5 0 5 10 15 -2 -1.5 -1 -0.5 0 0.5 1 1.5 2 2.5 ATLA CHIN DNVR HSTN IPLS KSCY LOSA NYCM SNVA STTL WASH -20 -15 -10 -5 0 5 10 15 20 -8 -6 -4 -2 0 2 4 6 8 10 ATLA CHIN DNVR HSTN IPLS KSCY LOSA [1] Plonka, D. "FlowScan: A Network Traffic Flow Reporting and Visualization Tool". In Proc. LISA

  1. Traffic lights for crop-based biofuels

    E-Print Network [OSTI]

    Phalan, Ben

    stream_source_info Phalan_311010.pdf.txt stream_content_type text/plain stream_size 11462 Content-Encoding UTF-8 stream_name Phalan_311010.pdf.txt Content-Type text/plain; charset=UTF-8 Traffic lights for crop-based biofuels Ben... if it reduces the number of pedestrians killed and injured. How is this relevant to biofuels? There are many different kinds of biofuels, including some with considerable potential to generate cleaner energy and boost rural economies, but also others which...

  2. Wireless Communication Systems Based on Spatial Modulation MIMO 

    E-Print Network [OSTI]

    Wu, Xiping

    2015-01-01

    Spatial modulation (SM) is a unique single-stream, multiple-input multiple-output (MIMO) transmission technique. Unlike traditional MIMO schemes, SM sends out signals through a single active antenna, and achieves ...

  3. On Efficient Bandwidth Allocation for Traffic Variability in Datacenters

    E-Print Network [OSTI]

    Lui, John C.S.

    On Efficient Bandwidth Allocation for Traffic Variability in Datacenters Jian Guo1 Fangming Liu1 of Hong Kong. Abstract--Datacenter networks suffer unpredictable perfor- mance due to a lack dynamic traffic in datacenter networks. In this paper, we consider the effects of large numbers of short

  4. Jetway: Minimizing Costs on Inter-Datacenter Video Traffic

    E-Print Network [OSTI]

    Li, Baochun

    Jetway: Minimizing Costs on Inter-Datacenter Video Traffic Yuan Feng, Baochun Li Department deploy a number of datacenters inter-connected by high-capacity links, spanning different geographical-to-customer video serving, constitutes a large portion of a cloud provider's inter- datacenter traffic. Charged

  5. ON DATA ACQUISITION, MODELING AND SIMULATION OF HIGHWAY TRAFFIC

    E-Print Network [OSTI]

    pollution, health problems, stress, and discomfort. Therefore, the prediction of traffic jams, 1990): number of vehicles per time unit (traffic intensity), speed of the vehicles, occupancy level of vehicles passing at a certain point in a certain #12; data acquisition interfacing conditioning data

  6. Top-percentile traffic routing problem by Dynamic Programming

    E-Print Network [OSTI]

    Grothey, Andreas

    Top-percentile traffic routing problem by Dynamic Programming Andreas Grothey, Xinan Yang School according to top-percentile pricing. We call this problem the Top-percentile Traffic Routing Problem (Tp problem, which is hard to solve due to the integer variables introduced by top-percentile pricing. Several

  7. Traffic Light Mapping and Detection Nathaniel Fairfield Chris Urmson

    E-Print Network [OSTI]

    Cortes, Corinna

    Traffic Light Mapping and Detection Nathaniel Fairfield Chris Urmson {nfairfield, curmson, and lidar to perceive their surroundings, the state of standard traffic lights can only be perceived lights and improve detection of the light state. The prior map also encodes the control semantics

  8. A mathematical model and descent algorithm for bilevel traffic management

    E-Print Network [OSTI]

    Patriksson, Michael

    variables enter as parameters in the travel costs. We consider a (small) variety of model settings, and interpret their workings in terms of the traffic network. Key words: Traffic equilibrium; Stackelberg game derivative; Armijo line search; stationary point. 1 Introduction The need for measures to reduce congestion

  9. Internet Packet Transport: Traffic Control and Network Engineering \\Lambda

    E-Print Network [OSTI]

    Kumar, Anurag

    Internet Packet Transport: Traffic Control and Network Engineering \\Lambda ANURAG KUMAR Dept. of Electrical Communication Engineering Indian Institute of Science Bangalore, 560 012 Abstract The Internet can of store­and­forward (also called elastic) traffic in the Internet. We first motivate the need for feedback

  10. TMN conference Page 1 Traffic Management for IBC networks

    E-Print Network [OSTI]

    Griffin, David

    manager. This is particularly useful for congestion control and load balancing as well as reTMN conference Page 1 Traffic Management for IBC networks by David Griffin (GPT Ltd) and Pravin Patel (Dowty Communications Ltd) 1 Introduction This paper concentrates on the traffic management

  11. Meddle: Middleboxes for Increased Transparency and Control of Mobile Traffic

    E-Print Network [OSTI]

    Legout, Arnaud

    a framework that allows us to intercept and potentially modify traffic generated by mobile devices this function- ality is difficult on mobile devices because it requires warranty- voiding techniques- proach, carriers may manipulate traffic once it leaves the mobile device [13], thus rendering some

  12. Nericell: Rich Monitoring of Roads and Traffic Using Mobile Smartphones

    E-Print Network [OSTI]

    Rajamani, Sriram K.

    Nericell: Rich Monitoring of Roads and Traffic Using Mobile Smartphones Joint work with Prashanth India 1 Ram Ramjee #12;Road and Traffic Monitoring 2 Bangalore Courtesy intersections · Potholes · Road bumps · ... Need to go beyond GPS-based vehicle tracking! #12;Widespread

  13. Pricing Schemes for Metropolitan Traffic Data Markets Negin Golrezaei1

    E-Print Network [OSTI]

    Shahabi, Cyrus

    Marshall School of Business, University of Southern California, Los Angeles, CA 90089 {golrezae, nazerzad of the pricing schemes applicable to data marketplaces in the context of transportation traffic data. Traffic congestion is a growing problem in many metropolitan areas. It not only wastes our time and energy

  14. Photonic generation of UWB pulses with pulse position modulation

    E-Print Network [OSTI]

    Yao, Jianping

    Photonic generation of UWB pulses with pulse position modulation H. Mu and J. Yao A novel photonic approach to generating ultra-wideband (UWB) signals with pulse position modulation (PPM) is proposed delay-line filter for UWB monocycle pulse generation, the second subsystem being a pulse

  15. Ballasted photovoltaic module and module arrays

    DOE Patents [OSTI]

    Botkin, Jonathan (El Cerrito, CA); Graves, Simon (Berkeley, CA); Danning, Matt (Oakland, CA)

    2011-11-29

    A photovoltaic (PV) module assembly including a PV module and a ballast tray. The PV module includes a PV device and a frame. A PV laminate is assembled to the frame, and the frame includes an arm. The ballast tray is adapted for containing ballast and is removably associated with the PV module in a ballasting state where the tray is vertically under the PV laminate and vertically over the arm to impede overt displacement of the PV module. The PV module assembly can be installed to a flat commercial rooftop, with the PV module and the ballast tray both resting upon the rooftop. In some embodiments, the ballasting state includes corresponding surfaces of the arm and the tray being spaced from one another under normal (low or no wind) conditions, such that the frame is not continuously subjected to a weight of the tray.

  16. Note: On-line weak signal detection via adaptive stochastic resonance

    SciTech Connect (OSTI)

    Lu, Siliang; He, Qingbo Kong, Fanrang

    2014-06-15

    We design an instrument with a novel embedded adaptive stochastic resonance (SR) algorithm that consists of a SR module and a digital zero crossing detection module for on-line weak signal detection in digital signal processing applications. The two modules are responsible for noise filtering and adaptive parameter configuration, respectively. The on-line weak signal detection can be stably achieved in seconds. The prototype instrument exhibits an advance of 20 dB averaged signal-to-noise ratio and 5 times averaged adjust R-square as compared to the input noisy signal, in considering different driving frequencies and noise levels.

  17. Comparative Traffic Performance Analysis of Urban Transportation Network Structures

    E-Print Network [OSTI]

    Amini, Behnam; Mojarradi, Morteza; Derrible, Sybil

    2015-01-01

    The network structure of an urban transportation system has a significant impact on its traffic performance. This study uses network indicators along with several traffic performance measures including speed, trip length, travel time, and traffic volume, to compare a selection of seven transportation networks with a variety of structures and under different travel demand conditions. The selected network structures are: modified linear, branch, grid, 3-directional grid, 1-ring web, 2-ring web, and radial. For the analysis, a base origin-destination matrix is chosen, to which different growth factors are applied in order to simulate various travel demand conditions. Results show that overall the 2-ring web network offers the most efficient traffic performance, followed by the grid and the 1-ring networks. A policy application of this study is that the branch, 3-directional grid, and radial networks are mostly suited for small cities with uncongested traffic conditions. In contrast, the 2-ring web, grid, and 1-r...

  18. Integrated Signal Processing and Signal Understanding1

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Integrated Signal Processing and Signal Understanding1 Victor Lesser, Hamid Nawaby, Malini Bhandaru processing and heuristic problem-solving in signal interpretation. The need for such a paradigm arises in signal understanding domains that require the processing of complicated interacting signals under

  19. Integrated Signal Processing and Signal Understanding 1

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Integrated Signal Processing and Signal Understanding 1 Victor Lesser, Hamid Nawab y , Malini processing and heuristic problem­solving in signal interpretation. The need for such a paradigm arises in signal understanding domains that require the processing of complicated interacting signals under

  20. Chopper Modulation Improves OTA Information Transmission

    E-Print Network [OSTI]

    Maryland at College Park, University of

    Chopper Modulation Improves OTA Information Transmission Nicole M Nelson and Pamela A Abshire 20742 Email: {nmnelson,pabshire}@umd.edu Abstract-- We have investigated information transmission- ing the channel capacity for transmission of analog signals through an OTA using an information

  1. DUAL USE OF LEDS: SIGNALING AND COMMUNICATIONS IN ITS Grantham Pang, Chi-ho Chan, Hugh Liu, Thomas Kwan

    E-Print Network [OSTI]

    Pang, Grantham

    lights with LEDs is a reduction in power consumption [7]. In addition, incandescent traffic signals burn1 DUAL USE OF LEDS: SIGNALING AND COMMUNICATIONS IN ITS Grantham Pang, Chi-ho Chan, Hugh Liu of light-emitting diodes (LEDs) over incandescent lights is well-supported. This is due to their high

  2. Shield Module Design Considerations

    E-Print Network [OSTI]

    McDonald, Kirk

    Shield Module Design Considerations Adam Carroll Van Graves July 3, 2014 #12;2 Managed by UT-Battelle for the U.S. Department of Energy Shield Module Design Considerations 3 July 2014 Overview · Capability to remotely remove and reinstall the shield modules is required · Shield module concept is He-cooled tungsten

  3. Adaptive Modulation for Fading Channels Nilo Casimiro Ericsson

    E-Print Network [OSTI]

    communication systems, transmission in the downlink will often dominate the traf­ fic load. High bit. INTRODUCTION Fading channels confront us with the problem of lost packets and the need for frequent the signalling overhead. For a predicted value of the signal to noise ratio (SNR) of the channel, the modulation

  4. Adaptive Modulation for Fading Channels Nilo Casimiro Ericsson

    E-Print Network [OSTI]

    communication systems, transmission in the downlink will often dominate the traf- fic load. High bit. INTRODUCTION Fading channels confront us with the problem of lost packets and the need for frequent the signalling overhead. For a predicted value of the signal to noise ratio (SNR) of the channel, the modulation

  5. Emergency evacuation/transportation plan update: Traffic model development and evaluation of early closure procedures. Final report

    SciTech Connect (OSTI)

    1993-10-28

    Prolonged delays in traffic experienced by Laboratory personnel during a recent early dismissal in inclement weather, coupled with reconstruction efforts along NM 502 east of the White Rock Wye for the next 1 to 2 years, has prompted Los Alamos National Laboratory (LANL) to re-evaluate and improve the present transportation plan and its integration with contingency plans maintained in other organizations. Facilities planners and emergency operations staff need to evaluate the transportation system`s capability to inefficiently and safely evacuate LANL under different low-level emergency conditions. A variety of potential procedures governing the release of employees from the different technical areas (TAs) requires evaluation, perhaps with regard to multiple emergency-condition scenarios, with one or more optimal procedures ultimately presented for adoption by Lab Management. The work undertaken in this project will hopefully lay a foundation for an on-going, progressive transportation system analysis capability. It utilizes microscale simulation techniques to affirm, reassess and validate the Laboratory`s Early Dismissal/Closure/Delayed Opening Plan. The Laboratory is required by Federal guidelines, and compelled by prudent practice and conscientious regard for the welfare of employees and nearby residents, to maintain plans and operating procedures for evacuation if the need arises. The tools developed during this process can be used outside of contingency planning. It is anticipated that the traffic models developed will allow site planners to evaluate changes to the traffic network which could better serve the normal traffic levels. Changes in roadway configuration, control strategies (signalization and signing), response strategies to traffic accidents, and patterns of demand can be modelled using the analysis tools developed during this project. Such scenarios typically are important considerations in master planning and facilities programming.

  6. Visualization of Traffic Flow and Atmospheric Pollutant Flow in Urban Areas

    E-Print Network [OSTI]

    Tokyo, University of

    and air pollutants using polygons and translucent particles. The system is applied for public roads around.transport.iis.u-tokyo.ac.jp CCity modelity model Air pollutionAir pollution simsim.. TrafficTraffic simsim.. CCity modelity model Air pollutionAir pollution simsim.. TrafficTraffic simsim.. #12;

  7. The impact of gasoline price changes on traffic safety: a time geography explanation Guangqing Chi a,

    E-Print Network [OSTI]

    Levinson, David M.

    The impact of gasoline price changes on traffic safety: a time geography explanation Guangqing Chi, United States a r t i c l e i n f o Keywords: Time geography Gasoline prices Traffic safety Traffic crashes Fatal crashes Space­time path a b s t r a c t The impact of gasoline price changes on traffic

  8. Selective chemical detection by energy modulation of sensors

    DOE Patents [OSTI]

    Stetter, J.R.; Otagawa, T.

    1985-05-20

    A portable instrument for use in the field in detecting, identifying, and quantifying a component of a sampled fluid includes a sensor which chemically reacts with the component of interest or a derivative thereof, an electrical heating filament for heating the sample before it is applied to the sensor, and modulating means for continuously varying the temperature of the filament (and hence the reaction rate) between two values sufficient to produce the chemical reaction. In response to this thermal modulation, the sensor produces a modulated output signal, the modulation of which is a function of the activation energy of the chemical reaction, which activation energy is specific to the particular component of interest and its concentration. Microprocessor means compares the modulated output signal with standard responses for a plurality of components to identify and quantify the particular component of interest. 4 figs.

  9. Planar photovoltaic solar concentrator module

    DOE Patents [OSTI]

    Chiang, C.J.

    1992-12-01

    A planar photovoltaic concentrator module for producing an electrical signal from incident solar radiation includes an electrically insulating housing having a front wall, an opposing back wall and a hollow interior. A solar cell having electrical terminals is positioned within the interior of the housing. A planar conductor is connected with a terminal of the solar cell of the same polarity. A lens forming the front wall of the housing is operable to direct solar radiation incident to the lens into the interior of the housing. A refractive optical element in contact with the solar cell and facing the lens receives the solar radiation directed into the interior of the housing by the lens and directs the solar radiation to the solar cell to cause the solar cell to generate an electrical signal. An electrically conductive planar member is positioned in the housing to rest on the housing back wall in supporting relation with the solar cell terminal of opposite polarity. The planar member is operable to dissipate heat radiated by the solar cell as the solar cell generates an electrical signal and further forms a solar cell conductor connected with the solar cell terminal to permit the electrical signal generated by the solar cell to be measured between the planar member and the conductor. 5 figs.

  10. Planar photovoltaic solar concentrator module

    DOE Patents [OSTI]

    Chiang, Clement J. (New Brunswick, NJ)

    1992-01-01

    A planar photovoltaic concentrator module for producing an electrical signal from incident solar radiation includes an electrically insulating housing having a front wall, an opposing back wall and a hollow interior. A solar cell having electrical terminals is positioned within the interior of the housing. A planar conductor is connected with a terminal of the solar cell of the same polarity. A lens forming the front wall of the housing is operable to direct solar radiation incident to the lens into the interior of the housing. A refractive optical element in contact with the solar cell and facing the lens receives the solar radiation directed into the interior of the housing by the lens and directs the solar radiation to the solar cell to cause the solar cell to generate an electrical signal. An electrically conductive planar member is positioned in the housing to rest on the housing back wall in supporting relation with the solar cell terminal of opposite polarity. The planar member is operable to dissipate heat radiated by the solar cell as the solar cell generates an electrical signal and further forms a solar cell conductor connected with the solar cell terminal to permit the electrical signal generated by the solar cell to be measured between the planar member and the conductor.

  11. Scram signal generator

    DOE Patents [OSTI]

    Johanson, Edward W. (New Lenox, IL); Simms, Richard (Westmont, IL)

    1981-01-01

    A scram signal generating circuit for nuclear reactor installations monitors a flow signal representing the flow rate of the liquid sodium coolant which is circulated through the reactor, and initiates reactor shutdown for a rapid variation in the flow signal, indicative of fuel motion. The scram signal generating circuit includes a long-term drift compensation circuit which processes the flow signal and generates an output signal representing the flow rate of the coolant. The output signal remains substantially unchanged for small variations in the flow signal, attributable to long term drift in the flow rate, but a rapid change in the flow signal, indicative of a fast flow variation, causes a corresponding change in the output signal. A comparator circuit compares the output signal with a reference signal, representing a given percentage of the steady state flow rate of the coolant, and generates a scram signal to initiate reactor shutdown when the output signal equals the reference signal.

  12. Predicting traffic speed in urban transportation subnetworks for multiple horizons

    E-Print Network [OSTI]

    Jaillet, Patrick

    such as route guidance, urban traffic control and management, and sustainable mobility [1]­[3]. Consequently Laboratory for Information and Decision Systems, MIT, Cambridge, MA. 4 Center for Future Urban Mobility

  13. Fact #667: March 21, 2011 Fuel Wasted in Traffic Congestion

    Broader source: Energy.gov [DOE]

    The researchers at the Texas Transportation Institute have recently published new estimates of the effects of traffic congestion. The trend toward increased congestion eased in 2007 and 2008 with...

  14. Decision support systems for automated terminal area air traffic control

    E-Print Network [OSTI]

    Pararas, John Demetrios

    1982-01-01

    This work studies the automation of the terminal area Air Traffic Management and Control (ATM/C) system. The ATM/C decision-making process is analyzed and broken down into a number of "automation functions". Each of these ...

  15. Observability of Origin-Destination matrices for Dynamic Traffic Assignment

    E-Print Network [OSTI]

    Gupta, Ashish, S.M. Massachusetts Institute of Technology

    2005-01-01

    The estimation of dynamic Origin-Destination (O-D) matrices from aggregated sensor counts is one of the most important and well-researched problems in Dynamic Traffic Assignment (DTA) systems. In practice, more often than ...

  16. Generalized Cost Function Based Forecasting for Periodically Measured Nonstationary Traffic

    E-Print Network [OSTI]

    Zeng, Yong - Department of Mathematics and Statistics, University of Missouri

    1 Generalized Cost Function Based Forecasting for Periodically Measured Nonstationary Traffic true value. However, such a forecast- ing function is not directly applicable for applications potentially result in insufficient allocation of bandwidth leading to short term data loss. To facilitate

  17. Intelligent Cruise Control design based on a traffic flow specification 

    E-Print Network [OSTI]

    Huandra, Rusli

    1998-01-01

    The principal objectives of the Automated Highway graphics. System (AHS), an Intelligent Transportation System (ITS) technology, are to increase the safety and through-put of the existing highway by traffic automation. Advanced Vehicle Control...

  18. Robust decision-support tools for airport surface traffic

    E-Print Network [OSTI]

    Carr, Francis R. (Francis Russell), 1976-

    2004-01-01

    Forecasts of departure demand are one of the driving inputs to tactical decision-support tools (DSTs) for airport surface traffic. While there are well-known results on average- or worst-case forecast uncertainty, it is ...

  19. Robust Decision-Support Tools for Airport Surface Traffic

    E-Print Network [OSTI]

    Carr, Francis R.

    Forecasts of departure demand are one of the driving inputs to tactical decision-support tools (DSTs) for airport surface traffic. While there are well-known results on average- or worst-case forecast uncertainty, it is ...

  20. On Dominant Characteristics of Residential Broadband Internet Traffic

    E-Print Network [OSTI]

    Paxson, Vern

    of rich access allows users to tightly integrate network use into their lives--from checking the weather-to-peer--traffic dominates by a significant margin; that more often than not the home user's imme- diate ISP connectivity

  1. Microsoft Word - Results_of_the_Independent_Hanford_Traffic_Safety...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2010 To: ALL HANFORD EMPLOYEES Subject: RESULTS OF INDEPENDENT HANFORD TRAFFIC SAFETY STUDY AND NEXT STEPS One of the most hazardous situations that most of us face each day is...

  2. An Ising Model for Road Traffic Cyril Furtlehner

    E-Print Network [OSTI]

    Furtlehner, Cyril

    Chapter 1 An Ising Model for Road Traffic Inference Cyril Furtlehner Abstract We review some, as a minimizer of a Bethe free energy [32], a solver of the cavity equations [21] and its relation to the TAP

  3. Advanced silicon photonic modulators

    E-Print Network [OSTI]

    Sorace, Cheryl M

    2010-01-01

    Various electrical and optical schemes used in Mach-Zehnder (MZ) silicon plasma dispersion effect modulators are explored. A rib waveguide reverse biased silicon diode modulator is designed, tested and found to operate at ...

  4. Structural and safety characteristics and warrants for highway traffic barriers 

    E-Print Network [OSTI]

    Kohutek, Terry Lee

    1975-01-01

    Ross Highway traffic barriers are highway appurtenances that provide vehicle occupants with a relative degree of protection from roadside hazards and from errant vehicles encroaching across a median. The six basic types of traffic barr1ers are roads... are decision criteria that 1dentify sites along highways that need traff1c barrier installations. Structural and safety character- istics of the barr1ers refer to the impact performance, the structural integrity, and the safety of the vehicle occupants upon...

  5. Pulse-modulated second harmonic imaging microscope quantitatively demonstrates marked increase of collagen in tumor after chemotherapy

    E-Print Network [OSTI]

    Raja, Anju M.

    Pulse-modulated second harmonic imaging microscopes (PM-SHIMs) exhibit improved signal-to-noise ratio (SNR) over conventional SHIMs on sensitive imaging and quantification of weak collagen signals inside tissues. We quantify ...

  6. Modulating lignin in plants

    DOE Patents [OSTI]

    Apuya, Nestor; Bobzin, Steven Craig; Okamuro, Jack; Zhang, Ke

    2013-01-29

    Materials and methods for modulating (e.g., increasing or decreasing) lignin content in plants are disclosed. For example, nucleic acids encoding lignin-modulating polypeptides are disclosed as well as methods for using such nucleic acids to generate transgenic plants having a modulated lignin content.

  7. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  8. Selective chemical detection by energy modulation of sensors

    DOE Patents [OSTI]

    Stetter, J.R.; Otagawa, T.

    1991-09-10

    A portable instrument for use in the field in detecting, identifying, and quantifying a component of a sampled fluid includes a sensor which chemically reacts with the component of interest or a derivative thereof, an electrical heating filament for heating the sample before it is applied to the sensor, and modulator for continuously varying the temperature of the filament (and hence the reaction rate) between two values sufficient to produce the chemical reaction. In response to this thermal modulation, the sensor produces a modulated output signal, the modulation of which is a function of the activation energy of the chemical reaction, which activation energy is specific to the particular component of interest and its concentration. Microprocessor which compares the modulated output signal with standard responses for a plurality of components to identify and quantify the particular component of interest. In particular, the concentration of the component of interest is proportional to the amplitude of the modulated output signal, while the identifying activation output energy of the chemical interaction indicative of that component is proportional to a normalized parameter equal to the peak-to-peak amplitude divided by the height of the upper peaks above a base line signal level. 5 figures.

  9. Selective chemical detection by energy modulation of sensors

    DOE Patents [OSTI]

    Stetter, Joseph R. (Naperville, IL); Otagawa, Takaaki (Solon, OH)

    1991-01-01

    A portable instrument for use in the field in detecting, identifying, and quantifying a component of a sampled fluid includes a sensor which chemically reacts with the component of interest or a derivative thereof, an electrical heating filament for heating the sample before it is applied to the sensor, and modulator for continuously varying the temperature of the filament (and hence the reaction rate) between two values sufficient to produce the chemical reaction. In response to this thermal modulation, the sensor produces a modulated output signal, the modulation of which is a function of the activation energy of the chemical reaction, which activation energy is specific to the particular component of interest and its concentration. Microprocessor which compares the modulated output signal with standard responses for a plurality of components to identify and quantify the particular component of interest. In particular, the concentration of the component of interest is proportional to the amplitude of the modulated output signal, while the identifying activation output energy of the chemical interaction indicative of that component is proportional to a normalized parameter equal to the peak-to-peak amplitude divided by the height of the upper peaks above a base line signal level.

  10. A rigorous treatment of a follow-the-leader traffic model with traffic lights present

    SciTech Connect (OSTI)

    Argall, Brenna; Cheleshkin, Eugene; Greenberg, J.M.; Hinde, Colin; Lin, Pei-Jen

    2003-07-16

    Traffic flow on a unidirectional roadway in the presence of traffic lights is modeled. Individual car responses to green, yellow, and red lights are postulated and these result in rules governing the acceleration and deceleration of individual cars. The essence of the model is that only specific cars are directly affected by the lights. The other cars behave according to simple follow-the-leader rules which limit their speed by the spacing between it and the car directly ahead. The model has a number of desirable properties; namely cars do not run red lights, cars do not smash into one another, and cars exhibit no velocity reversals. In a situation with multiple lights operating in-phase we get, after an initial startup period, a constant number of cars through each light during any green-yellow period. Moreover, this flux is less by one or two cars per period than the flux obtained in discretized versions of the idealized Lighthill, Whitham, Richards model which allows for infinite accelerations.

  11. Communications, and Signal Processing

    E-Print Network [OSTI]

    Prodiæ, Aleksandar

    : Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical: Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical: Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical

  12. Stochastic Traffic and Connectivity Dynamics for Vehicular Ad-Hoc Networks in Signalized Road Systems

    E-Print Network [OSTI]

    Leung, Kin K.

    Engineering, Imperial College London Centre for Transport Studies, Imperial College London {wh.ho, kin

  13. An investigation into the use of highway traffic signals at highway-railroad grade crossings 

    E-Print Network [OSTI]

    Frieslaar, Andre Henry

    1997-01-01

    Rail-highway grade crossings are amongst the most dangerous of intersections a driver will encounter. One out of every nine accidents at rail-highway crossings produces a fatality. In half of these cases, the crossing is an active crossing, meaning...

  14. Soliton communication lines based on spectrally efficient modulation formats

    SciTech Connect (OSTI)

    Yushko, O V; Redyuk, A A

    2014-06-30

    We report the results of mathematical modelling of optical-signal propagation in soliton fibre-optic communication lines (FOCLs) based on spectrally efficient signal modulation formats. We have studied the influence of spontaneous emission noise, nonlinear distortions and FOCL length on the data transmission quality. We have compared the characteristics of a received optical signal for soliton and conventional dispersion compensating FOCLs. It is shown that in the presence of strong nonlinearity long-haul soliton FOCLs provide a higher data transmission performance, as well as allow higher order modulation formats to be used as compared to conventional communication lines. In the context of a coherent data transmission, soliton FOCLs allow the use of phase modulation with many levels, thereby increasing the spectral efficiency of the communication line. (optical communication lines)

  15. Dielectric waveguide gas-filled stark shift modulator

    DOE Patents [OSTI]

    Hutchinson, Donald P.; Richards, Roger K.

    2003-07-22

    An optical modulator includes a dielectric waveguide for receiving an optical beam and coupling energy of the optical beam into the waveguide. At least one Stark material is provided in the waveguide. A bias circuit generates a bias signal to produce an electrical field across the Stark material to shift at least one of the Stark absorption frequencies towards the frequency of the optical beam. A circuit for producing a time varying electric field across the Stark material modulates the optical beam. At least a portion of the bias field can be generated by an alternating bias signal, such as a square wave. A method of modulating optical signals includes the steps of providing a dielectric waveguide for receiving an optical beam and coupling energy of the optical beam into the waveguide, the waveguide having at least one Stark material disposed therein, and varying an electric field imposed across the Stark material.

  16. Mechanism, function and modulation of oncogenic cripto signaling

    E-Print Network [OSTI]

    Kelber, Jonathan A.

    2009-01-01

    J.S. (2003) Morphogenesis and oncogenesis of MCF-10A mammaryduring embryogenesis and oncogenesis. Oncogene, 24, 5731-

  17. Bracket for photovoltaic modules

    DOE Patents [OSTI]

    Ciasulli, John; Jones, Jason

    2014-06-24

    Brackets for photovoltaic ("PV") modules are described. In one embodiment, a saddle bracket has a mounting surface to support one or more PV modules over a tube, a gusset coupled to the mounting surface, and a mounting feature coupled to the gusset to couple to the tube. The gusset can have a first leg and a second leg extending at an angle relative to the mounting surface. Saddle brackets can be coupled to a torque tube at predetermined locations. PV modules can be coupled to the saddle brackets. The mounting feature can be coupled to the first gusset and configured to stand the one or more PV modules off the tube.

  18. Traffic Optimization to Control Epidemic Outbreaks in Metapopulation Models

    E-Print Network [OSTI]

    Preciado, Victor M

    2013-01-01

    We propose a novel framework to study viral spreading processes in metapopulation models. Large subpopulations (i.e., cities) are connected via metalinks (i.e., roads) according to a metagraph structure (i.e., the traffic infrastructure). The problem of containing the propagation of an epidemic outbreak in a metapopulation model by controlling the traffic between subpopulations is considered. Controlling the spread of an epidemic outbreak can be written as a spectral condition involving the eigenvalues of a matrix that depends on the network structure and the parameters of the model. Based on this spectral condition, we propose a convex optimization framework to find cost-optimal approaches to traffic control in epidemic outbreaks.

  19. Module No: 410336Personal Statutes for Non-Module Title

    E-Print Network [OSTI]

    Module No: 410336Personal Statutes for Non- Muslims Module Title: Co-requisite:Introduction of Islamic Jurisprudence Pre-requisite: Module Type: specialization requirementModule level: Third Year Academic rank Module coordinator 307384Assistant Professor Dr. Fuad Sartawi ResearchTutorial Guidance

  20. Module No: 410319Copyrights and Neighboring Module Title

    E-Print Network [OSTI]

    Module No: 410319Copyrights and Neighboring Rights Module Title: Co-requisite:Effects of ObligationsPre-requisite: Module Type: specialization elective requirementModule level: Third Year Evening Academic rank Module coordinator e-bataineh@philadelphia.edu.joAssistant Professor Dr. Iyad Bataineh

  1. GE Lighting Solutions: Proposed Penalty (2013-SE-4901)

    Broader source: Energy.gov [DOE]

    DOE alleged in a Notice of Proposed Civil Penalty that General Electric Lighting Solutions manufactured and distributed noncompliant traffic signal modules in the U.S.

  2. GE Lighting Solutions: Noncompliance Determination (2013-SE-4901)

    Broader source: Energy.gov [DOE]

    DOE issued a Notice of Noncompliance Determination to General Electric Lighting Solutions finding that various models of traffic signal modules do not comport with the energy conservation standards.

  3. Department of Energy Requests Fast Track Rulemaking for Implementing...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and freezers and ice cream freezers. Other products include traffic signals and pedestrian control modules. For more information on the Department of Energy's appliance and...

  4. Methods and systems for detecting abnormal digital traffic

    DOE Patents [OSTI]

    Goranson, Craig A [Kennewick, WA; Burnette, John R [Kennewick, WA

    2011-03-22

    Aspects of the present invention encompass methods and systems for detecting abnormal digital traffic by assigning characterizations of network behaviors according to knowledge nodes and calculating a confidence value based on the characterizations from at least one knowledge node and on weighting factors associated with the knowledge nodes. The knowledge nodes include a characterization model based on prior network information. At least one of the knowledge nodes should not be based on fixed thresholds or signatures. The confidence value includes a quantification of the degree of confidence that the network behaviors constitute abnormal network traffic.

  5. The design of a traffic control system with distributed intelligence 

    E-Print Network [OSTI]

    Tietjen, Donald Louis

    1973-01-01

    the transition from one synchro- n1zat1on scheme to another on the basis of measurements of traffic This thesis fo11 s th ty1 d f t f th ~oot di ~ s of th Istitt ofEIeti I dEI t I ~Ei ~ Ts. at some key points in an arterial network (2). Instead of a traffic.... Mew Time Address RON( ARO~' I ARO"I 2 To Off- line memory From "11nl- comnuter From 0n-line "emory Instruction Register 'Jext Time Address To Lights &i gure S. Two-'1emory System 18 The main limitation of this system design is the cost...

  6. Approved Module Information for PD2003, 2014/5 Module Title/Name: Engineering Principles 2 Module Code: PD2003

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD2003, 2014/5 Module Title/Name: Engineering Principles 2 Module Code: PD2003 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module? No Module Dependancies Pre-requisites: Engineering Principles (PD1803). Co-requisites: None Specified Module

  7. Approved Module Information for BF2210, 2014/5 Module Title/Name: Making Managerial Decisions Module Code: BF2210

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2210, 2014/5 Module Title/Name: Making Managerial Decisions Module Code: BF2210 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Florian Gebreiter Email Address gebreif1

  8. Approved Module Information for LPM040, 2014/5 Module Title/Name: Rethinking European Integration Module Code: LPM040

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LPM040, 2014/5 Module Title/Name: Rethinking European Integration Module Code: LPM040 School: Languages and Social Sciences Module Type: Standard Module New Module? Yes Module Credits: 20 Module Management Information Module Leader Name Nathaniel Copsey Email Address n

  9. Approved Module Information for LEM039, 2014/5 Module Title/Name: Grammar Module Code: LEM039

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LEM039, 2014/5 Module Title/Name: Grammar Module Code: LEM039 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Urszula Clark Email Address u

  10. Approved Module Information for LS3006, 2014/5 Module Title/Name: Hispanic Film Module Code: LS3006

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LS3006, 2014/5 Module Title/Name: Hispanic Film Module Code: LS3006 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Raquel Medina Email Address r

  11. Approved Module Information for LT2102, 2014/5 Module Title/Name: Inventory Control Module Code: LT2102

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT2102, 2014/5 Module Title/Name: Inventory Control Module Code: LT2102 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name James Stone Email Address j

  12. Approved Module Information for PY2217, 2014/5 Module Title/Name: Personality Practical (JH) Module Code: PY2217

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY2217, 2014/5 Module Title/Name: Personality Practical (JH) Module Code: PY2217 School: Life and Health Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Ed Walford Email Address e

  13. Approved Module Information for BS3347, 2014/5 Module Title/Name: Economics of Entrepreneurship Module Code: BS3347

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BS3347, 2014/5 Module Title/Name: Economics of Entrepreneurship Module Code: BS3347 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Anna Rebmann Email Address rebmanna

  14. Approved Module Information for PY3351, 2014/5 Module Title/Name: Child Development Module Code: PY3351

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY3351, 2014/5 Module Title/Name: Child Development Module Code: PY3351 School: Life and Health Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Claire Farrow Email Address farrowc

  15. Approved Module Information for CE2110, 2014/5 Module Title/Name: Process Laboratory Module Code: CE2110

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE2110, 2014/5 Module Title/Name: Process Laboratory Module Code: CE2110 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name John Brammer Email Address brammejg

  16. Approved Module Information for LK2004, 2014/5 Module Title/Name: Global Society Module Code: LK2004

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LK2004, 2014/5 Module Title/Name: Global Society Module Code: LK2004 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Demelza Jones Email Address jonesd4@aston

  17. Approved Module Information for CH3117, 2014/5 Module Title/Name: Literature Research Project Module Code: CH3117

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CH3117, 2014/5 Module Title/Name: Literature Research Project Module Code: CH3117 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Andrew James Sutherland Email Address

  18. Approved Module Information for LE1008, 2014/5 Module Title/Name: Grammar & Meaning Module Code: LE1008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE1008, 2014/5 Module Title/Name: Grammar & Meaning Module Code: LE1008 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Jack Grieve Email Address grievej1

  19. Approved Module Information for BN3385, 2014/5 Module Title/Name: Effective Project Delivery Module Code: BN3385

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN3385, 2014/5 Module Title/Name: Effective Project Delivery Module Code: BN3385 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Panagiotis Petridis Email Address petridip

  20. Approved Module Information for BS1163, 2014/5 Module Title/Name: Introduction to Microeconomics Module Code: BS1163

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BS1163, 2014/5 Module Title/Name: Introduction to Microeconomics Module Code: BS1163 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Morris Email Address morrisd5@aston

  1. Approved Module Information for LEM016, 2014/5 Module Title/Name: Methodology Module Code: LEM016

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LEM016, 2014/5 Module Title/Name: Methodology Module Code: LEM016 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Muna Morris-Adams Email Address adamsmm

  2. Approved Module Information for BF2251, 2014/5 Module Title/Name: Financial Management Module Code: BF2251

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2251, 2014/5 Module Title/Name: Financial Management Module Code: BF2251 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Colin Chapman Email Address chapmac1@aston

  3. Approved Module Information for LT2315, 2014/5 Module Title/Name: Rail Transport Module Code: LT2315

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT2315, 2014/5 Module Title/Name: Rail Transport Module Code: LT2315 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name P Connor Email Address connorp

  4. Approved Module Information for ME2018, 2014/5 Module Title/Name: Quality Engineering Module Code: ME2018

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME2018, 2014/5 Module Title/Name: Quality Engineering Module Code: ME2018 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Upton Email Address uptondp

  5. Approved Module Information for LI2008, 2014/5 Module Title/Name: Communication across Cultures Module Code: LI2008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LI2008, 2014/5 Module Title/Name: Communication across Cultures Module Code: LI2008 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Olga Castro Email Address o

  6. Approved Module Information for CE4018, 2014/5 Module Title/Name: Advanced Particle Processing Module Code: CE4018

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE4018, 2014/5 Module Title/Name: Advanced Particle Processing Module Code: CE4018 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Mark Leaper Email Address m

  7. Approved Module Information for SE4031, 2014/5 Module Title/Name: Extended Integrative Option Module Code: SE4031

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for SE4031, 2014/5 Module Title/Name: Extended Integrative Option Module Code: SE4031 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 30 Module Management Information Module Leader Name Trevor Oliver Email Address t

  8. Approved Module Information for LT1312, 2014/5 Module Title/Name: Literature Review Project Module Code: LT1312

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT1312, 2014/5 Module Title/Name: Literature Review Project Module Code: LT1312 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Carpenter Email Address d

  9. Approved Module Information for LS2017, 2014/5 Module Title/Name: Contemporary Latin America Module Code: LS2017

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LS2017, 2014/5 Module Title/Name: Contemporary Latin America Module Code: LS2017 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Stephanie Panichelli-Batalla Email Address

  10. Approved Module Information for CE3013, 2014/5 Module Title/Name: Particle Processing Module Code: CE3013

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE3013, 2014/5 Module Title/Name: Particle Processing Module Code: CE3013 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Mark Leaper Email Address m

  11. Approved Module Information for LE2057, 2014/5 Module Title/Name: Computer Mediated Communication Module Code: LE2057

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2057, 2014/5 Module Title/Name: Computer Mediated Communication Module Code: LE2057 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Nur Hooton Email Address n

  12. Approved Module Information for BS3325, 2014/5 Module Title/Name: Competition Policy -Theory Module Code: BS3325

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BS3325, 2014/5 Module Title/Name: Competition Policy - Theory Module Code: BS3325 School: Aston Business School Module Type: Standard Module New Module? Yes Module Credits: 10 Module Management Information Module Leader Name Matt Olczak Email Address olczakm

  13. Approved Module Information for BL1179, 2014/5 Module Title/Name: Accounting for Law Module Code: BL1179

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BL1179, 2014/5 Module Title/Name: Accounting for Law Module Code: BL1179 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Angela Stanhope Email Address a

  14. Approved Module Information for BFM120, 2014/5 Module Title/Name: Investment Management Module Code: BFM120

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM120, 2014/5 Module Title/Name: Investment Management Module Code: BFM120 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Colin Chapman Email Address chapmac1@aston

  15. Approved Module Information for PY2216, 2014/5 Module Title/Name: Neuroscience Practicals Module Code: PY2216

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY2216, 2014/5 Module Title/Name: Neuroscience Practicals Module Code: PY2216 School: Life and Health Sciences Module Type: Standard Module New Module? Yes Module Credits: 10 Module Management Information Module Leader Name Ed Walford Email Address e

  16. Approved Module Information for BHM348, 2014/5 Module Title/Name: Employee Relations & Counselling Module Code: BHM348

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM348, 2014/5 Module Title/Name: Employee Relations & Counselling Module Code: BHM348 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name M Carter Email Address cartermr

  17. Approved Module Information for LT1307, 2014/5 Module Title/Name: Principles of Economics Module Code: LT1307

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT1307, 2014/5 Module Title/Name: Principles of Economics Module Code: LT1307 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Carpenter Email Address d

  18. Approved Module Information for ME2050, 2014/5 Module Title/Name: Dynamics and Control Module Code: ME2050

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME2050, 2014/5 Module Title/Name: Dynamics and Control Module Code: ME2050 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Xianghong Ma Email Address max

  19. Approved Module Information for BHM328, 2014/5 Module Title/Name: Strategic Business Sustainability Module Code: BHM328

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM328, 2014/5 Module Title/Name: Strategic Business Sustainability Module Code: BHM328 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name H Borland Email Address borlanhm

  20. Approved Module Information for BF2244, 2014/5 Module Title/Name: Strategic Finance Module Code: BF2244

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2244, 2014/5 Module Title/Name: Strategic Finance Module Code: BF2244 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Colin Chapman Email Address chapmac1@aston

  1. Approved Module Information for CE3102, 2014/5 Module Title/Name: Reaction Engineering Module Code: CE3102

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE3102, 2014/5 Module Title/Name: Reaction Engineering Module Code: CE3102 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Feroz Kabir Email Address kabirf

  2. Approved Module Information for LE2053, 2014/5 Module Title/Name: Variations of English Module Code: LE2053

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2053, 2014/5 Module Title/Name: Variations of English Module Code: LE2053 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Jack Grieve Email Address grievej1

  3. Approved Module Information for BF3314, 2014/5 Module Title/Name: Derivatives Module Code: BF3314

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF3314, 2014/5 Module Title/Name: Derivatives Module Code: BF3314 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Winifred Huang-Meier Email Address w

  4. Approved Module Information for PY3472, 2014/5 Module Title/Name: Autistic Spectrum Module Code: PY3472

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY3472, 2014/5 Module Title/Name: Autistic Spectrum Module Code: PY3472 School: Life and Health Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Gina Rippon Email Address rippong@aston.ac.uk Telephone

  5. Approved Module Information for CE3112, 2014/5 Module Title/Name: Nanomaterials Module Code: CE3112

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE3112, 2014/5 Module Title/Name: Nanomaterials Module Code: CE3112 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Qingchun Yuan Email Address q.yuan@aston.ac.uk Telephone

  6. Approved Module Information for CE1002, 2014/5 Module Title/Name: Design and Build Module Code: CE1002

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE1002, 2014/5 Module Title/Name: Design and Build Module Code: CE1002 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Paul Andrew Tack Email Address tackpa

  7. Approved Module Information for LG2018, 2014/5 Module Title/Name: Metropolis Berlin Module Code: LG2018

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LG2018, 2014/5 Module Title/Name: Metropolis Berlin Module Code: LG2018 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Uwe Schütte Email Address u

  8. Approved Module Information for PD2002, 2014/5 Module Title/Name: Commercial Practice Module Code: PD2002

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD2002, 2014/5 Module Title/Name: Commercial Practice Module Code: PD2002 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Jon Hewitt Email Address Not Specified

  9. Approved Module Information for BN2290, 2014/5 Module Title/Name: Operational Research Techniques Module Code: BN2290

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN2290, 2014/5 Module Title/Name: Operational Research Techniques Module Code: BN2290 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Ozren Despic Email Address o

  10. Approved Module Information for LT1319, 2014/5 Module Title/Name: Air Transport Module Code: LT1319

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT1319, 2014/5 Module Title/Name: Air Transport Module Code: LT1319 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name James Stone Email Address j.stone@aston.ac.uk Telephone

  11. Engineering and policy analysis of strategic and tactical options for future aerospace traffic management

    E-Print Network [OSTI]

    Falker, John M

    2002-01-01

    Current space launch/landing events are conducted only within Special Use Airspace (SUA), separate from air traffic. This is a strategic traffic management policy because SUA size and duration are set well in advance. It ...

  12. Congestion-aware traffic routing for large-scale mobile agent systems

    E-Print Network [OSTI]

    Lim, Sejoon

    2012-01-01

    Traffic congestion is a serious world-wide problem. Drivers have little knowledge of historical and real-time traffic congestion for the paths they take and often tend to drive suboptimal routes. Congestion phenomena are ...

  13. Link-State Routing with Hop-by-Hop Forwarding Can Achieve Optimal Traffic Engineering

    E-Print Network [OSTI]

    Chiang, Mung

    -state routing. Keywords: Interior gateway protocol, traffic engineering, rout- ing, OSPF, optimization, network-to-end tunneling. Such simplicity was thought to come at the expense of optimality. In a procedure known as Traffic

  14. Facilitation of visual pattern recognition by extraction of relevant features from microscopic traffic data 

    E-Print Network [OSTI]

    Fields, Matthew James

    2009-05-15

    1985 study by JHK and Associates (traffic research) for the Federal Highway Administration, covers an hour long time period over a quarter mile section and includes nine different identifying features for traffic at any given time. The initial step...

  15. The integration of Automatic Speech Recognition into the Air Traffic Control system

    E-Print Network [OSTI]

    Karlsson Joakim

    1990-01-01

    Today, the Air Traffic Control (ATC) system relies primarily on verbal communication between the air traffic controllers and the pilots of the aircraft in the controlled airspace. Although a computer system exists that ...

  16. MICRO SIMULATION OF CITY TRAFFIC FLOWS IN SUPPORT OF PREDICTIVE OPERATIONAL CONTROL

    E-Print Network [OSTI]

    Bargiela, Andrzej

    of the modelling process and the prediction model. Several types of traffic models have been used with demand- responsive traffic control systems. In parallel with the development of new control systems, there have been

  17. PARALEL SIMULATION OF CITY TRAFFIC FLOWS USING "PADSIM" (Probabilistic ADaptive SImulation Model)

    E-Print Network [OSTI]

    Bargiela, Andrzej

    of the modelling process and the prediction model. Several types of traffic models have been used with demand- responsive traffic control systems. In parallel with the development of new control systems, there have been

  18. Utilizing Correlations to Compress Time-Series in Traffic Monitoring Sensor Networks

    E-Print Network [OSTI]

    Martin, Ralph R.

    at £20bn. In urban areas, transport is the major source of carbon dioxide emissions, and traffic Cambridge testbed (Figure 1) and the spatio- temporal properties of a real traffic dataset. Section III

  19. Creating a Systems Engineering Approach for the Manual on Uniform Traffic Control Devices 

    E-Print Network [OSTI]

    McNeal, Heather

    2010-07-14

    The Manual on Uniform Traffic Control Devices (MUTCD) establishes the basic principles for the design, selection, installation, operation, maintenance, and removal of traffic control devices (TCDs). The MUTCD indicates ...

  20. Road traffic noise modifies behaviour of a keystone species Graeme Shannon a, *

    E-Print Network [OSTI]

    Angeloni, Lisa

    Road traffic noise modifies behaviour of a keystone species Graeme Shannon a, * , Lisa M. Angeloni the influence of traffic noise on foraging and vigilance in a keystone species in North American prairie systems

  1. Encapsulation of High Temperature Thermoelectric Modules | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Encapsulation of High Temperature Thermoelectric Modules Encapsulation of High Temperature Thermoelectric Modules Presents concept for hermetic encapsulation of TE modules...

  2. Boise Air Traffic Control Tower: High Performance and sustainable Building Guiding Principles Technical Assistance

    SciTech Connect (OSTI)

    Fowler, Kimberly M.; Goel, Supriya; Henderson, Jordan W.

    2013-09-01

    Overview of energy efficiency opportunities for new FAA tower construction using the Boise Air Traffic Control Tower as an example.

  3. Membrane module assembly

    DOE Patents [OSTI]

    Kaschemekat, J.

    1994-03-15

    A membrane module assembly is described which is adapted to provide a flow path for the incoming feed stream that forces it into prolonged heat-exchanging contact with a heating or cooling mechanism. Membrane separation processes employing the module assembly are also disclosed. The assembly is particularly useful for gas separation or pervaporation. 2 figures.

  4. Membrane module assembly

    DOE Patents [OSTI]

    Kaschemekat, Jurgen (Palo Alto, CA)

    1994-01-01

    A membrane module assembly adapted to provide a flow path for the incoming feed stream that forces it into prolonged heat-exchanging contact with a heating or cooling mechanism. Membrane separation processes employing the module assembly are also disclosed. The assembly is particularly useful for gas separation or pervaporation.

  5. Module Safety Issues (Presentation)

    SciTech Connect (OSTI)

    Wohlgemuth, J.

    2012-02-01

    Description of how to make PV modules so that they are less likely to turn into safety hazards. Making modules inherently safer with minimum additional cost is the preferred approach for PV. Safety starts with module design to ensure redundancy within the electrical circuitry to minimize open circuits and proper mounting instructions to prevent installation related ground faults. Module manufacturers must control the raw materials and processes to ensure that that every module is built like those qualified through the safety tests. This is the reason behind the QA task force effort to develop a 'Guideline for PV Module Manufacturing QA'. Periodic accelerated stress testing of production products is critical to validate the safety of the product. Combining safer PV modules with better systems designs is the ultimate goal. This should be especially true for PV arrays on buildings. Use of lower voltage dc circuits - AC modules, DC-DC converters. Use of arc detectors and interrupters to detect arcs and open the circuits to extinguish the arcs.

  6. Module Handbook Fernstudium

    E-Print Network [OSTI]

    Berns, Karsten

    Module Handbook Fernstudium postgradual Nanotechnology (Master of Science) Infineon Technology, Munich Distance studies postgraduate #12;Module name Fundamentals of Quantum Mechanics Lecturer apl. Prof is to present the fundamental concepts of quantum physics in a way that a clear understanding of the theoretical

  7. Ultracompact Field Effect Electro-Absorption Plasmonic Modulator

    E-Print Network [OSTI]

    Shi, Kaifeng

    2015-01-01

    One of the technical barriers impeding the wide applications of integrated photonic circuits is the lack of ultracompact, high speed, broadband electro-optical (EO) modulators, which up-convert electronic signals into high bit-rate photonic data. In addition to direct modulation of lasers, EO modulators can be classified into (i) phase modulation based on EO effect or free-carrier injection, or (ii) absorption modulation based on Franz-Keldysh effect or quantum-confined Stark effect. Due to the poor EO properties of regular materials, a conventional EO modulator has a very large footprint. Based on high-Q resonators, recent efforts have advanced EO modulators into microscale footprints, which have nearly reached their physical limits restricted by the materials. On-chip optical interconnects require ultrafast EO modulators at the nanoscale. The technical barrier may not be well overcome based on conventional approaches and well-known materials. Herein, we report an EO modulator, more specifically electro-abso...

  8. Cross-phase modulation in multispan WDM optical fiber systems

    E-Print Network [OSTI]

    Hui, Rongqing; Demarest, Kenneth; Allen, Christopher Thomas

    1999-06-01

    wave propagation equation [5]. Consider probe and pump optical signals, Aj(t, z) and Ak(t, z), copropagating in the same optical fiber. The evolution of the probe wave is described by (a similar equation can be written for the pump wave) dAj(t, 2... optical powers were I 1.5 dBm, and the pump channel modulation frequency was swept from 50 MHz to 10 GHz. In order to avoid significant higher order har- monics generated from the LiNb03 Mach-Zehnder intensity modulator, the modulation index is chosen...

  9. Air traffic complexity and the interacting particle system method: An integrated approach for collision risk estimation

    E-Print Network [OSTI]

    Del Moral , Pierre

    Air traffic complexity and the interacting particle system method: An integrated approach explore the possibility of using air traffic complexity metrics to accelerate the Interacting Particle to assess the performance and impact of, e.g., possible modifications of the current air traffic management

  10. On the Convergence of Statistical Techniques for Inferring Network Traffic Demands

    E-Print Network [OSTI]

    On the Convergence of Statistical Techniques for Inferring Network Traffic Demands Alberto Medina 1 knowledge of traffic demands in a communication net­ work enables or enhances a variety of traffic measuring a complete set of these demands is prohibitively expensive because of the huge amounts of data

  11. Integration of an Aggregate Flow Model with a Traffic Flow Simulator

    E-Print Network [OSTI]

    Integration of an Aggregate Flow Model with a Traffic Flow Simulator Robert Hoffman , Dengfeng Sun restrictions to aircraft movement are applied by air traffic controllers and traffic managers in response to demand overages or capacity shortfalls in sectors of airspace. To estimate and assess the efficiency

  12. Coupling traffic models on networks and urban dispersion models for simulating sustainable

    E-Print Network [OSTI]

    Ceragioli, Francesca

    models for modeling and testing different traffic scenarios, in order to define the impact on air quality it with the urban dispersion model Sirane. Keywords: urban air quality, macroscopic traffic models, road networks, pollutant dispersion models, traffic emissions control. AMS subject classification: 35L65, 35L67, 60K30, 90B

  13. Review of Urban Bicyclists' Intake and Uptake of Traffic-Related Air Pollution

    E-Print Network [OSTI]

    Bertini, Robert L.

    Review of Urban Bicyclists' Intake and Uptake of Traffic-Related Air Pollution ALEXANDER Y. BIGAZZI- clists may experience increased inhalation of traffic-related air pollutants. Bicyclists have two to five regarding urban bicyclists' intake and uptake of traffic-related air pollution and to identify key knowledge

  14. Review of Urban Bicyclists' Intake and Uptake of Traffic-Related Air Pollution

    E-Print Network [OSTI]

    Bertini, Robert L.

    1 Review of Urban Bicyclists' Intake and Uptake of Traffic-Related Air Pollution Alexander Y of Traffic-Related Air Pollution Abstract Bicycling as a mode of transportation is enjoying a boost in many while bicycling, bicyclists may experience increased inhalation of traffic-related air pollutants

  15. Topographically-Based Real-Time Traffic Anomaly Detection in a Metropolitan Highway System

    E-Print Network [OSTI]

    Grossman, Robert

    Topographically-Based Real-Time Traffic Anomaly Detection in a Metropolitan Highway System Rajmonda metropolitan area. Our Chicago Alert System (CAS) considers both the spatial and temporal aspects of the data of attack, the need for real-time traffic management is crucial. Real-time traffic management encompasses

  16. Gasoline price effects on traffic safety in urban and rural areas: Evidence from Minnesota, 19982007

    E-Print Network [OSTI]

    Levinson, David M.

    Gasoline price effects on traffic safety in urban and rural areas: Evidence from Minnesota, 1998 February 2012 Received in revised form 3 May 2013 Accepted 24 May 2013 Keywords: Gasoline prices Traffic examines the role of gasoline prices in the occurrence of traffic crashes. However, no studies have

  17. The Case for Fine-Grained Traffic Engineering in Data Centers Theophilus Benson

    E-Print Network [OSTI]

    Liblit, Ben

    Computer Sciences Department The Case for Fine-Grained Traffic Engineering in Data Centers-Grained Traffic Engineering in Data Centers Theophilus Benson , Aditya Akella and Ming Zhang University of Wisconsin-Madison; Microsoft Research Abstract Data center traffic characteristics are not well under

  18. MicroTE: Fine Grained Traffic Engineering for Data Centers Theophilus Benson

    E-Print Network [OSTI]

    Akella, Aditya

    MicroTE: Fine Grained Traffic Engineering for Data Centers Theophilus Benson , Ashok Anand , Aditya center traffic characteristics on data cen- ter traffic engineering is not well understood. In particu on the network making it appro- priate for current and future data centers. Categories and Subject Descriptors C

  19. Towards Robust Multi-layer Traffic Engineering: Optimization of Congestion Control and Routing

    E-Print Network [OSTI]

    Singh, Jaswinder Pal

    Towards Robust Multi-layer Traffic Engineering: Optimization of Congestion Control and Routing. Keywords: Congestion control, Traffic Engineering, Network util- ity maximization, Optimization, Robustness, in a process known as traffic engineering. TCP congestion control assumes that the network paths do not change

  20. Improvement of the Road Traffic Management by an Ant-Hierarchical Fuzzy System

    E-Print Network [OSTI]

    Casillas Barranquero, Jorge

    of the road network capacity [3], the improvement of the traffic safety, the minimization of the energyImprovement of the Road Traffic Management by an Ant-Hierarchical Fuzzy System Habib M. Kammoun@decsai.ugr.es Abstract--In view of dynamicity on road networks and the sharp increase of traffic jam states, the road

  1. Forecasting Spatiotemporal Impact of Traffic Incidents on Road Networks Bei Pan, Ugur Demiryurek, Cyrus Shahabi

    E-Print Network [OSTI]

    Shahabi, Cyrus

    Forecasting Spatiotemporal Impact of Traffic Incidents on Road Networks Bei Pan, Ugur Demiryurek and quantifying the impact of traffic incidents. Traffic incidents include any non-recurring events on road networks, including accidents, weather hazard, road construction or work zone closures. By analyzing

  2. Nericell: Rich Monitoring of Road and Traffic Conditions using Mobile Smartphones

    E-Print Network [OSTI]

    Rajamani, Sriram K.

    Nericell: Rich Monitoring of Road and Traffic Conditions using Mobile Smartphones Prashanth Mohan@microsoft.com Microsoft Research India, Bangalore ABSTRACT We consider the problem of monitoring road and traffic con to be much more com- plex owing to varied road conditions (e.g., potholed roads), chaotic traffic (e

  3. Photovoltaic module and interlocked stack of photovoltaic modules

    DOE Patents [OSTI]

    Wares, Brian S.

    2014-09-02

    One embodiment relates to an arrangement of photovoltaic modules configured for transportation. The arrangement includes a plurality of photovoltaic modules, each photovoltaic module including a frame. A plurality of individual male alignment features and a plurality of individual female alignment features are included on each frame. Adjacent photovoltaic modules are interlocked by multiple individual male alignment features on a first module of the adjacent photovoltaic modules fitting into and being surrounded by corresponding individual female alignment features on a second module of the adjacent photovoltaic modules. Other embodiments, features and aspects are also disclosed.

  4. Traffic-Aware Video Streaming in Broadband Wireless Networks

    E-Print Network [OSTI]

    Ansari, Nirwan

    Traffic-Aware Video Streaming in Broadband Wireless Networks Ehsan Haghani and Nirwan Ansari Shyam in the Internet. Streaming real-time video in wireless networks is a challenging problem due to the stringent video quality at the end user in wireless networks. Our solution incorporates the characteristics

  5. BlindBox: Deep Packet Inspection over Encrypted Traffic

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    BlindBox: Deep Packet Inspection over Encrypted Traffic Justine Sherry UC Berkeley Chang Lan UC middleboxes perform deep packet inspection (DPI), a set of useful tasks which examine packet payloads that simultaneously provides both of these properties. The approach of Blind- Box is to perform the deep

  6. Data Streaming Algorithms for Estimating Entropy of Network Traffic

    E-Print Network [OSTI]

    Sekar, Vyas

    distributions has been shown to aid a wide variety of network monitoring applications such as anomaly detection, clustering to reveal interesting patterns, and traffic classification. However, realizing this potential Research Office contract number DAAD19-02-1-0389. Permission to make digital or hard copies of all or part

  7. A Mathematical Analysis of Air Traffic Priority Rules Anthony Narkawicz

    E-Print Network [OSTI]

    Muñoz, César A.

    A Mathematical Analysis of Air Traffic Priority Rules Anthony Narkawicz C´esar A. Mu~noz Jeffrey of important properties. Specific properties considered in this paper include safety, exclusiveness presents an analytical framework to examine key safety properties of implicit coordination for non

  8. Evaluation of Non-intrusive Traffic Detection Technologies Phase III

    E-Print Network [OSTI]

    Minnesota, University of

    TPF-5(171) Evaluation of Non-intrusive Traffic Detection Technologies Ð Phase III #12 not intrude into pavement for installation. ·! Sensors above, below or to the side of the roadway qualify;Miovision #12;Miovision #12;Laser-based sensors #12;PEEK AxleLight #12;TIRTL #12;TIRTL #12;#12;#12;#12;

  9. Intelligent Control in Automation Based on Wireless Traffic Analysis

    SciTech Connect (OSTI)

    Kurt Derr; Milos Manic

    2007-09-01

    Wireless technology is a central component of many factory automation infrastructures in both the commercial and government sectors, providing connectivity among various components in industrial realms (distributed sensors, machines, mobile process controllers). However wireless technologies provide more threats to computer security than wired environments. The advantageous features of Bluetooth technology resulted in Bluetooth units shipments climbing to five million per week at the end of 2005 [1, 2]. This is why the real-time interpretation and understanding of Bluetooth traffic behavior is critical in both maintaining the integrity of computer systems and increasing the efficient use of this technology in control type applications. Although neuro-fuzzy approaches have been applied to wireless 802.11 behavior analysis in the past, a significantly different Bluetooth protocol framework has not been extensively explored using this technology. This paper presents a new neurofuzzy traffic analysis algorithm of this still new territory of Bluetooth traffic. Further enhancements of this algorithm are presented along with the comparison against the traditional, numerical approach. Through test examples, interesting Bluetooth traffic behavior characteristics were captured, and the comparative elegance of this computationally inexpensive approach was demonstrated. This analysis can be used to provide directions for future development and use of this prevailing technology in various control type applications, as well as making the use of it more secure.

  10. Intelligent Control in Automation Based on Wireless Traffic Analysis

    SciTech Connect (OSTI)

    Kurt Derr; Milos Manic

    2007-08-01

    Wireless technology is a central component of many factory automation infrastructures in both the commercial and government sectors, providing connectivity among various components in industrial realms (distributed sensors, machines, mobile process controllers). However wireless technologies provide more threats to computer security than wired environments. The advantageous features of Bluetooth technology resulted in Bluetooth units shipments climbing to five million per week at the end of 2005 [1, 2]. This is why the real-time interpretation and understanding of Bluetooth traffic behavior is critical in both maintaining the integrity of computer systems and increasing the efficient use of this technology in control type applications. Although neuro-fuzzy approaches have been applied to wireless 802.11 behavior analysis in the past, a significantly different Bluetooth protocol framework has not been extensively explored using this technology. This paper presents a new neurofuzzy traffic analysis algorithm of this still new territory of Bluetooth traffic. Further enhancements of this algorithm are presented along with the comparison against the traditional, numerical approach. Through test examples, interesting Bluetooth traffic behavior characteristics were captured, and the comparative elegance of this computationally inexpensive approach was demonstrated. This analysis can be used to provide directions for future development and use of this prevailing technology in various control type applications, as well as making the use of it more secure.

  11. The Path Less Travelled: Overcoming Tor's Bottlenecks with Traffic Splitting

    E-Print Network [OSTI]

    Goldberg, Ian

    The Path Less Travelled: Overcoming Tor's Bottlenecks with Traffic Splitting Mashael AlSabah, Kevin of Computer Science University of Waterloo Abstract. Tor is the most popular low-latency anonymity network, Tor has a variety of performance problems that result in poor quality of service, a strong

  12. Traffic Analysis Attacks and Defenses in Low Latency Anonymous Communication

    E-Print Network [OSTI]

    Keromytis, Angelos D.

    the true network identity of com- municating parties against eavesdropping adversaries. Tor, acronym for The Onion Router, is an example of such a system. Such systems relay the traffic of their users through an overlay of nodes that are called Onion Routers and are operated by volunteers distributed across the globe

  13. Computation Availability of Crossbar Systems in a Nonuniform Traffic Environment

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    Computation Availability of Crossbar Systems in a Non­uniform Traffic Environment M. Atiquzzaman M in the presence of a hot spot in the system. Computation availability is taken as the criteria for measuring as the amount of computation available at time t. The computation availability is based on the system

  14. Frugal Traffic Monitoring with Autonomous Participatory Sensing Vladimir Coric

    E-Print Network [OSTI]

    Vucetic, Slobodan

    hundreds of billions of dollars each year, increases pollution, and has a negative impact on the overall vehicles was introduced [19]. This involved installation of spe- cialized GPS-enabled devices in vehicles such as buses and taxis to monitor position of the vehicles and their speed. The collected traffic data from

  15. Energy-Traffic Tradeoff Cooperative Offloading for Mobile Cloud Computing

    E-Print Network [OSTI]

    Buyya, Rajkumar

    Energy-Traffic Tradeoff Cooperative Offloading for Mobile Cloud Computing Jian Song, Yong Cui Network (WLAN). We propose a novel Energy-Efficient Cooperative Offloading Model (E2COM) for energy operators [8]. In this paper, we propose an Energy-Efficient Cooperative Offloading Model (E2COM) in one

  16. A categorical model for traffic incident likelihood estimation 

    E-Print Network [OSTI]

    Kuchangi, Shamanth

    2007-04-25

    In this thesis an incident prediction model is formulated and calibrated. The primary idea of the model developed is to correlate the expected number of crashes on any section of a freeway to a set of traffic stream characteristics, so that a...

  17. Comparison of Stochastic Methods for Control in Air Traffic Management

    E-Print Network [OSTI]

    Cambridge, University of

    of dangerous encounters through maintenance of safe separation between aircraft. Loss of the minimum safe safely accommodate (European Commission (2000)). The level of anticipated growth in aviation travel Aviation Authority (2009)). It is untenable to accommodate this anticipated traffic growth without a shift

  18. Understanding Data Center Traffic Characteristics Theophilus Benson, Ashok Anand,

    E-Print Network [OSTI]

    Liblit, Ben

    Understanding Data Center Traffic Characteristics Theophilus Benson, Ashok Anand, Aditya Akella Research Redmond, WA, USA mzh@microsoft.com ABSTRACT As data centers become more and more central patterns in data center networks that can inform and help evaluate research and operational approaches. We

  19. Heavy Traffic Analysis for EDF Queues with December 17, 2007

    E-Print Network [OSTI]

    Ramanan, Kavita

    by the fraction of reneged work (the residual work lost due to elapsed deadlines), which is shown to be minimized by a measure-valued process. The heavy traffic limit of this (properly scaled) process is shown. The fraction of reneged work in a heavily loaded system and the fraction of late work in the corresponding sys

  20. Integration of traffic congestion and predictive modeling offers

    E-Print Network [OSTI]

    Bustamante, Fabián E.

    are far fewer issues when products are flown or driven across the country, but getting them to your home interacting more intimately with traffic congestion, the weather, and other day-to-day variants." To combat, and that is a major motivation," says Mahmassani. "Companies may also want to do the right thing, but we live

  1. Treatment-Based Traffic Classification for Residential Wireless Networks

    E-Print Network [OSTI]

    Kinicki, Robert E.

    provide no QoS support (e.g., the 5th generation Apple Airport Extreme IEEE 802.11n wireless router [101 Treatment-Based Traffic Classification for Residential Wireless Networks Feng Li, Mark Claypool concurrently over bottlenecked wireless access points (APs). This paper presents Classification and Treatment

  2. Author's personal copy Gasoline prices and traffic safety in Mississippi

    E-Print Network [OSTI]

    Levinson, David M.

    more than 16% from 1973 to 1974 when the oil crisis occurred. International oil prices historically-grade unleaded gasoline price data from the Energy Information Administration of the U.S. Department of EnergyAuthor's personal copy Gasoline prices and traffic safety in Mississippi Guangqing Chi a, , Arthur

  3. Measuring Bicyclists' Uptake of Traffic-Related Air Pollution

    E-Print Network [OSTI]

    Bertini, Robert L.

    Measuring Bicyclists' Uptake of Traffic-Related Air Pollution Alex Bigazzi PSU Transportation doses 4.Health effects 4Urban Bicyclists' Pollution Uptake #12;Bicyclists' Exposure to Air Pollution 5 reduce exposure risks for bikers? Urban transportation system Bicyclists' uptake of air pollution #12

  4. Estimating Emissions in Latin America: An Alternative to Traffic Models

    E-Print Network [OSTI]

    Richner, Heinz

    Estimating Emissions in Latin America: An Alternative to Traffic Models Margarita Ossés de Eicker; Hans Hurni, Centre for Development and Environment (CDE), University of Bern, Switzerland Emissions allow precise estimations of these emissions but are too expensive for a broad application. A simplifed

  5. Transport Layer Identification of P2P Traffic Thomas Karagiannis

    E-Print Network [OSTI]

    California at San Diego, University of

    examination of packet payload, a method- ological landmine from legal, privacy, technical, logistic methodology, we also develop a payload technique for P2P traffic identification, by reverse engineering methodological land- mines: legal, privacy, technical, logistic, and financial ob- stacles abound, and overcoming

  6. Using Real-Time Road Traffic Data to Evaluate Congestion

    E-Print Network [OSTI]

    Cambridge, University of

    Using Real-Time Road Traffic Data to Evaluate Congestion Jean Bacon, Andrei Iu. Bejan, Alastair R regression, spline interpolation. 1 Introduction Congestion on roads, especially in urban areas, has a large kilometres in 2008 [2]. #12;Congestion can be tackled either by increasing road network capacity

  7. Hybrid Control Models of Next Generation Air Traffic Management ?

    E-Print Network [OSTI]

    Pappas, George J.

    Hybrid Control Models of Next Generation Air Traffic Management ? C. Tomlin, G. Pappas, J. Lygeros the overcrowding of large urban airports and the need to more efficiently handle larger numbers of aircraft malfunctions, ATC malfunctions (e.g. power failure), shifting winds (that cause changes in approach patterns

  8. Module bay with directed flow

    SciTech Connect (OSTI)

    Torczynski, John R. (Albuquerque, NM)

    2001-02-27

    A module bay requires less cleanroom airflow. A shaped gas inlet passage can allow cleanroom air into the module bay with flow velocity preferentially directed toward contaminant rich portions of a processing module in the module bay. Preferential gas flow direction can more efficiently purge contaminants from appropriate portions of the module bay, allowing a reduced cleanroom air flow rate for contaminant removal. A shelf extending from an air inlet slit in one wall of a module bay can direct air flowing therethrough toward contaminant-rich portions of the module bay, such as a junction between a lid and base of a processing module.

  9. Modulation cancellation method for laser spectroscopy V. Spagnolo*a,b

    E-Print Network [OSTI]

    of modulated signals generated by two different excitation sources. The primary intended applications: 10.1117/12.877706 Proc. of SPIE Vol. 7945 79450I-1 Downloaded from SPIE Digital Library on 31 Jan

  10. A high frequency polarization intensity electrooptic modulator in BSTN ferroelectric crystal 

    E-Print Network [OSTI]

    Wilson, Erik James

    1996-01-01

    Optical waveguide devices allow the "capture" of an optical signal and its manipulation to make it modulate, change its path, switch on and off and perform many other functions. One of the desirable parameters for a good electrooptic waveguide...

  11. High-Speed Link Modeling: Analog/Digital Equalization and Modulation Techniques 

    E-Print Network [OSTI]

    Lee, Keytaek

    2012-07-16

    High-speed serial input-output (I/O) link has required advanced equalization and modulation techniques to mitigate inter-symbol interference (ISI) caused by multi-Gb/s signaling over band-limited channels. Increasing demands ...

  12. Sonication standard laboratory module

    DOE Patents [OSTI]

    Beugelsdijk, Tony (Los Alamos, NM); Hollen, Robert M. (Los Alamos, NM); Erkkila, Tracy H. (Los Alamos, NM); Bronisz, Lawrence E. (Los Alamos, NM); Roybal, Jeffrey E. (Santa Fe, NM); Clark, Michael Leon (Menan, ID)

    1999-01-01

    A standard laboratory module for automatically producing a solution of cominants from a soil sample. A sonication tip agitates a solution containing the soil sample in a beaker while a stepper motor rotates the sample. An aspirator tube, connected to a vacuum, draws the upper layer of solution from the beaker through a filter and into another beaker. This beaker can thereafter be removed for analysis of the solution. The standard laboratory module encloses an embedded controller providing process control, status feedback information and maintenance procedures for the equipment and operations within the standard laboratory module.

  13. Modulated curvaton decay

    SciTech Connect (OSTI)

    Assadullahi, Hooshyar; Wands, David [Institute of Cosmology and Gravitation, University of Portsmouth, Dennis Sciama Building, Burnaby Road, Portsmouth PO1 3FX (United Kingdom); Firouzjahi, Hassan [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P. O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Namjoo, Mohammad Hossein, E-mail: hooshyar.assadullahi@port.ac.uk, E-mail: firouz@mail.ipm.ir, E-mail: mh.namjoo@mail.ipm.ir, E-mail: david.wands@port.ac.uk [Yukawa Institute for theoretical Physics, Kyoto University, Kyoto 606-8502 (Japan)

    2013-03-01

    We study primordial density perturbations generated by the late decay of a curvaton field whose decay rate may be modulated by the local value of another isocurvature field, analogous to models of modulated reheating at the end of inflation. We calculate the primordial density perturbation and its local-type non-Gaussianity using the sudden-decay approximation for the curvaton field, recovering standard curvaton and modulated reheating results as limiting cases. We verify the Suyama-Yamaguchi inequality between bispectrum and trispectrum parameters for the primordial density field generated by multiple field fluctuations, and find conditions for the bound to be saturated.

  14. Effects of the chemomechanical stepping cycle on the traffic of molecular motors

    E-Print Network [OSTI]

    Stefan Klumpp; Yan Chai; Reinhard Lipowsky

    2008-10-09

    We discuss effects of the stepping kinetics of molecular motors on their traffic behavior on crowded filaments using a simple two-state chemomechanical cycle. While the general traffic behavior is quite robust with respect to the detailed kinetics of the step, a few observable parameters exhibit a strong dependence on these parameters. Most strikingly, the effective unbinding rate of the motors may both increase and decrease with increasing traffic density, depending on the details of the motor step. Likewise the run length either exhibits a strong decrease or almost no dependence on the traffic density. We compare our theoretical results with recent experimental observations on motor traffic.

  15. Approved Module Information for CS2020, 2014/5 Module Title/Name: Software Engineering Module Code: CS2020

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CS2020, 2014/5 Module Title/Name: Software Engineering Module Code: CS2020 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Electronic Engineering and Computer Science. Available to Exchange Students? Yes Module Dependancies Pre

  16. Approved Module Information for BMM645, 2014/5 Module Title/Name: International Marketing Management Module Code: BMM645

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Management Module Code: BMM645 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Aarti Sood Email Address a.sood3 are expected to attend lectures and seminars as well as to take part in classroom discussions. The module

  17. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Verleysen, Michel

    Mechanical Systems and Signal Processing Mechanical Systems and Signal Processing 22 (2008) 155 Department of Mechanical Engineering, University of Sheffield, Mappin Street S1 3JD Sheffield, UK Received 27

  18. RESEARCH Open Access RFTraffic: a study of passive traffic awareness

    E-Print Network [OSTI]

    Beigl, Michael

    of a car receives the signal generated during electrical activity of the vehicles' sub-systems. This signal or electrical motors (to derive the pumps or fans), each car emits radio frequency (RF) signals. These signals situation detection are reported with higher than 95%. Although the electrical noises of the various

  19. Module Title: Project Module Code: OPTO6005

    E-Print Network [OSTI]

    Molinari, Marc

    Ibsen, Dr Ping Hua, Prof James Wilkinson Contact (email ID) sm@orc.soton.ac.uk, mi@orc.soton.ac.uk, ph2@orc.soton.ac.uk, jsw@orc.soton.ac.uk Is the module subject to external accreditation? No If yes and optical labs of the ORC 3. Train in technical and hands-on research skills to gain technical insight

  20. City traffic operations planners and managers use traffic simulators known as stochastic microscopic simulators to in-

    E-Print Network [OSTI]

    Entekhabi, Dara

    city center, the new meth- od identified signal plans that lead to a 34 percent reduction in average costly than micromodels, are typically used to evaluate transportation strategies, but these lack, and it outperforms traditional simulation-based optimization methods. The framework is robust to initial points

  1. Module No: 410121Introduction to Commercial Module Title

    E-Print Network [OSTI]

    Module No: 410121Introduction to Commercial Law Module Title: Co-requisite: Commercial Papers/ Companies and Bankruptcy/International Trade Law- Maritime Law Introduction to LawPre-requisite: Module Type: department prerequisiteModule level: First year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours

  2. Approved Module Information for BF3358, 2014/5 Module Title/Name: Investments Module Code: BF3358

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module learned how to measure the performance of an investment strategy. ? Transferable Skill ? have conducted performance measurement Portfolio return measurement. Risk adjusted performance measures. Attribution analysis

  3. GREET Pretreatment Module

    SciTech Connect (OSTI)

    Adom, Felix K.; Dunn, Jennifer B.; Han, Jeongwoo

    2014-09-01

    A wide range of biofuels and biochemicals can be produced from biomass via different pretreatment technologies that yield sugars. This report documents the material and energy flows that occur when fermentable sugars from four lignocellulosic feedstocks (corn stover, miscanthus, switchgrass, and poplar) are produced via dilute acid pretreatment and ammonia fiber expansion. These flows are documented for inclusion in the pretreatment module of the Greenhouses Gases, Regulated Emissions, and Energy Use in Transportation (GREET) model. Process simulations of each pretreatment technology were developed in Aspen Plus. Material and energy consumption data from Aspen Plus were then compiled in the GREET pretreatment module. The module estimates the cradle-to-gate fossil energy consumption (FEC) and greenhouse gas (GHG) emissions associated with producing fermentable sugars. This report documents the data and methodology used to develop this module and the cradle-to-gate FEC and GHG emissions that result from producing fermentable sugars.

  4. Manipulation of Host Signaling by Vector-Borne and Non-Vector-Borne Pathogens

    E-Print Network [OSTI]

    Sakhon, Olivia S.

    2013-01-01

    Aedes spp. , Mansonia spp. Nod-like receptor NLRP3 Nod1 Nod22009) Short Report?: Disruption of Nod-like Receptors Altersal. (2008) Caspase-12 modulates NOD signaling and regulates

  5. From Signal Information Processing

    E-Print Network [OSTI]

    From Signal to Information Processing Don H. Johnson Computer and Information Technology Institute of signals o Here, all signals are assumed to be stochastic information source information encoder Information extraction systems--determining a from X(a)--fall into two categories h Classification: Which

  6. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Ray, Asok

    Mechanical Systems and Signal Processing Mechanical Systems and Signal Processing 21 (2007) 866 and analytical models. This paper attempts to address this inadequacy by taking advantage of advanced signal processing and pattern recognition tools. Since a vast majority of structural components that are prone

  7. Recent Upgrade of the Klystron Modulator at SLAC

    SciTech Connect (OSTI)

    Nguyen, M.N.; Burkhart, C.P.; Lam, B.K.; Morris, B.; /SLAC

    2011-11-04

    The SLAC National Accelerator Laboratory employs 244 klystron modulators on its two-mile-long linear accelerator that has been operational since the early days of the SLAC establishment in the sixties. Each of these original modulators was designed to provide 250 kV, 262 A and 3.5 {mu}S at up to 360 pps using an inductance-capacitance resonant charging system, a modified type-E pulse-forming network (PFN), and a pulse transformer. The modulator internal control comprised of large step-start resistor-contactors, vacuum-tube amplifiers, and 120 Vac relays for logical signals. A major, power-component-only upgrade, which began in 1983 to accommodate the required beam energy of the SLAC Linear Collider (SLC) project, raised the modulator peak output capacity to 360 kV, 420 A and 5.0 {mu}S at a reduced pulse repetition rate of 120 pps. In an effort to improve safety, performance, reliability and maintainability of the modulator, this recent upgrade focuses on the remaining three-phase AC power input and modulator controls. The upgrade includes the utilization of primary SCR phase control rectifiers, integrated fault protection and voltage regulation circuitries, and programmable logic controllers (PLC) -- with an emphasis on component physical layouts for safety and maintainability concerns. In this paper, we will describe the design and implementation of each upgraded component in the modulator control system. We will also report the testing and present status of the modified modulators.

  8. Adapt-Traf: An adaptive multiagent road traffic management system based on hybrid ant-hierarchical fuzzy model

    E-Print Network [OSTI]

    Casillas Barranquero, Jorge

    of the energy consumption, and others. Road traffic management consists on improving the traffic fluency on roadAdapt-Traf: An adaptive multiagent road traffic management system based on hybrid ant systems Ant colony Hierarchical fuzzy system Traffic simulation a b s t r a c t Usually, road networks

  9. Photovoltaic module reliability workshop

    SciTech Connect (OSTI)

    Mrig, L. (ed.)

    1990-01-01

    The paper and presentations compiled in this volume form the Proceedings of the fourth in a series of Workshops sponsored by Solar Energy Research Institute (SERI/DOE) under the general theme of photovoltaic module reliability during the period 1986--1990. The reliability Photo Voltaic (PV) modules/systems is exceedingly important along with the initial cost and efficiency of modules if the PV technology has to make a major impact in the power generation market, and for it to compete with the conventional electricity producing technologies. The reliability of photovoltaic modules has progressed significantly in the last few years as evidenced by warranties available on commercial modules of as long as 12 years. However, there is still need for substantial research and testing required to improve module field reliability to levels of 30 years or more. Several small groups of researchers are involved in this research, development, and monitoring activity around the world. In the US, PV manufacturers, DOE laboratories, electric utilities and others are engaged in the photovoltaic reliability research and testing. This group of researchers and others interested in this field were brought together under SERI/DOE sponsorship to exchange the technical knowledge and field experience as related to current information in this important field. The papers presented here reflect this effort.

  10. Molecular Cell Frequency-Modulated Pulses of ERK Activity

    E-Print Network [OSTI]

    Albeck, John

    Molecular Cell Article Frequency-Modulated Pulses of ERK Activity Transmit Quantitative://dx.doi.org/10.1016/j.molcel.2012.11.002 SUMMARY The EGF-stimulated ERK/MAPK pathway is a key conduit and the response curve relating signal output to prolifer- ation. Under steady-state conditions, we find that ERK

  11. Beam test of the SDC barrel EM calorimeter test module

    SciTech Connect (OSTI)

    Balka, L.; Guarino, V.; Hill, N.

    1994-05-01

    The SDC barrel electromagnetic calorimeter test module was exposed to beams of high energy pions and electrons in the MP9 test beam at Fermilab in the fall of 1991. Data were collected on resolution, light yield, signal timing and hermiticity. These data demonstrated that the design met the specifications for the barrel electromagnetic calorimeter of the Solenoidal Detector collaboration (SDC).

  12. Dark-matter harmonics beyond annual modulation

    SciTech Connect (OSTI)

    Lee, Samuel K.; Lisanti, Mariangela; Safdi, Benjamin R. E-mail: mlisanti@princeton.edu

    2013-11-01

    The count rate at dark-matter direct-detection experiments should modulate annually due to the motion of the Earth around the Sun. We show that higher-frequency modulations, including daily modulation, are also present and in some cases are nearly as strong as the annual modulation. These higher-order modes are particularly relevant if (i) the dark matter is light, O(10) GeV, (ii) the scattering is inelastic, or (iii) velocity substructure is present; for these cases, the higher-frequency modes are potentially observable at current and ton-scale detectors. We derive simple expressions for the harmonic modes as functions of the astrophysical and geophysical parameters describing the Earth's orbit, using an updated expression for the Earth's velocity that corrects a common error in the literature. For an isotropic halo velocity distribution, certain ratios of the modes are approximately constant as a function of nuclear recoil energy. Anisotropic distributions can also leave observable features in the harmonic spectrum. Consequently, the higher-order harmonic modes are a powerful tool for identifying a potential signal from interactions with the Galactic dark-matter halo.

  13. Thermoelectrics Partnership: Automotive Thermoelectric Modules...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    More Documents & Publications Novel Nanostructured Interface Solution for Automotive Thermoelectric Modules Application Thermoelectrics Partnership: Automotive...

  14. INJECTIVE MODULES FOR UNIFORM ALGEBRAS

    E-Print Network [OSTI]

    White, Michael C.

    of right Banach A-modules as mod-A and the class of Banach A-bimodules as A-mod-A. We shall refer to the module maps in each case as morphisms. Modules will be denoted by upper-case Roman letters, morphisms ), bounded linear maps are denoted by lower-case Roman letters. The assumption that all modules

  15. Approved Module Information for PH2502, 2014/5 Module Title/Name: Pharmaceutical

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PH2502, 2014/5 Module Title/Name: Pharmaceutical Microbio Credits: 20 Module Management Information Module Leader Name Deborah Lowry Email Address lowryd to Exchange Students? Not Specified Module Learning Information Module Aims: Pharmaceutical Microbiology

  16. Nitric Oxide in Astrocyte-Neuron Signaling

    SciTech Connect (OSTI)

    Nianzhen Li

    2002-06-27

    Astrocytes, a subtype of glial cell, have recently been shown to exhibit Ca{sup 2+} elevations in response to neurotransmitters. A Ca{sup 2+} elevation can propagate to adjacent astrocytes as a Ca{sup 2+} wave, which allows an astrocyte to communicate with its neighbors. Additionally, glutamate can be released from astrocytes via a Ca{sup 2+}-dependent mechanism, thus modulating neuronal activity and synaptic transmission. In this dissertation, the author investigated the roles of another endogenous signal, nitric oxide (NO), in astrocyte-neuron signaling. First the author tested if NO is generated during astrocytic Ca{sup 2+} signaling by imaging NO in purified murine cortical astrocyte cultures. Physiological concentrations of a natural messenger, ATP, caused a Ca{sup 2+}-dependent NO production. To test the roles of NO in astrocytic Ca{sup 2+} signaling, the author applied NO to astrocyte cultures via addition of a NO donor, S-nitrosol-N-acetylpenicillamine (SNAP). NO induced an influx of external Ca{sup 2+}, possibly through store-operated Ca{sup 2+} channels. The NO-induced Ca{sup 2+} signaling is cGMP-independent since 8-Br-cGMP, an agonistic analog of cGMP, did not induce a detectable Ca{sup 2+} change. The consequence of this NO-induced Ca{sup 2+} influx was assessed by simultaneously monitoring of cytosolic and internal store Ca{sup 2+} using fluorescent Ca{sup 2+} indicators x-rhod-1 and mag-fluo-4. Blockage of NO signaling with the NO scavenger PTIO significantly reduced the refilling percentage of internal stores following ATP-induced Ca{sup 2+} release, suggesting that NO modulates internal store refilling. Furthermore, locally photo-release of NO to a single astrocyte led to a Ca{sup 2+} elevation in the stimulated astrocyte and a subsequent Ca{sup 2+} wave to neighbors. Finally, the author tested the role of NO inglutamate-mediated astrocyte-neuron signaling by recording the astrocyte-evoked glutamate-dependent neuronal slow inward current (SIC). Although NO is not required for the SIC,PTIO reduced SIC amplitude, suggesting that NO modulates glutamate release from astrocytes or glutamate receptor sensitivity of neurons.

  17. Resonant Visible Light Modulation with Graphene

    E-Print Network [OSTI]

    Yu, Renwen; de Abajo, F Javier Garcia

    2015-01-01

    Fast modulation and switching of light at visible and near-infrared (vis-NIR) frequencies is of utmost importance for optical signal processing and sensing technologies. No fundamental limit appears to prevent us from designing wavelength-sized devices capable of controlling the light phase and intensity at gigaherts (and even terahertz) speeds in those spectral ranges. However, this problem remains largely unsolved, despite recent advances in the use of quantum wells and phase-change materials for that purpose. Here, we explore an alternative solution based upon the remarkable electro-optical properties of graphene. In particular, we predict unity-order changes in the transmission and absorption of vis-NIR light produced upon electrical doping of graphene sheets coupled to realistically engineered optical cavities. The light intensity is enhanced at the graphene plane, and so is its absorption, which can be switched and modulated via Pauli blocking through varying the level of doping. Specifically, we explor...

  18. A comparison of thick film and thin film traffic stripes 

    E-Print Network [OSTI]

    Keese, Charles J

    1952-01-01

    of this thesis. CONTESTS Introduction ~ ~ ~ ~ ~ 1 Scope and Obfectives Method of Conducting Road Service Tests ~ ~ ~ ~ ~ ~ ~ ~ 7 ~ ~ ~ ~ ~ ~ ~ ~ ~ 8 PART I A Comparison of Paint Films of Various Thicknesses . . . . . . . . ~ ~, ~, ~ 72 App1ioation... of Test Stripes . Results of Thiokness Tests . 13 19 Conclusions 2$ PART II A Comparison of Various Thick Film and Thin Film Traffic Stripes. 26 Paint Stripes Over Adhesive Films Rosin Striping Compounds. . . + ~ . , ~ 29 ~ ~ ~ Preforsmd Plastic...

  19. Development of Omnidirectional 3D LIDAR Using Unlimited Rotating Device -Power Supplying and Signal Transmitting through Rotaing Shaft-

    E-Print Network [OSTI]

    Ohya, Akihisa

    Transmitting through Rotaing Shaft- ( ), ( ), ( ) Morihiko YOSHIDA, University of Tsukuba Atsushi WATANABE shaft and transmitting modulated carrier signal on power supply line. Also, the detailed designof Vcc 0 0 Vcc 0 Signal Fig. 1 Power supply and signal transmission through rotaing shaft 3.1 2 URG-04

  20. Approved Module Information for BHM346, 2014/5 Module Title/Name: Organisational Behaviour: Theory &

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM346, 2014/5 Module Title/Name: Organisational Behaviour: Theory & Practice Module Code: BHM346 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Yves Guillaume Email Address guilyrf2

  1. Approved Module Information for CE2106, 2014/5 Module Title/Name: Reaction Kinetics & Equilibrium

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE2106, 2014/5 Module Title/Name: Reaction Kinetics & Equilibrium Thermodynamics Module Code: CE2106 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Mark Leaper Email Address

  2. Approved Module Information for BNM803, 2014/5 Module Title/Name: Developing Business Systems

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BNM803, 2014/5 Module Title/Name: Developing Business Systems Workshop Module Code: BNM803 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Email Address Not Specified Telephone

  3. Food sensitizes C. elegans avoidance behaviours through acute dopamine signalling

    E-Print Network [OSTI]

    Schafer, William R.

    Food sensitizes C. elegans avoidance behaviours through acute dopamine signalling Marina Ezcurra1 at NOVUM, Karolinska Institute, Huddinge, Sweden Many behavioural states are modulated by food avail of an external food source enhances avoidance responses to soluble repellents sensed by the polymodal ASH neurons

  4. Modulation Effects in Dark Matter-Electron Scattering Experiments

    E-Print Network [OSTI]

    Lee, Samuel K; Mishra-Sharma, Siddharth; Safdi, Benjamin R

    2015-01-01

    One of the next frontiers in dark-matter direct-detection experiments is to explore the MeV to GeV mass regime. Such light dark matter does not carry enough kinetic energy to produce an observable nuclear recoil, but it can scatter off electrons, leading to a measurable signal. We introduce a semi-analytic approach to characterize the resulting electron-scattering events in atomic and semiconductor targets, improving on previous analytic proposals that underestimate the signal at high recoil energies. We then use this procedure to study the time-dependent properties of the electron-scattering signal, including the modulation fraction, higher-harmonic modes and modulation phase. The time dependence can be distinct in a non-trivial way from the nuclear scattering case. Additionally, we show that dark-matter interactions inside the Earth can significantly distort the lab-frame phase-space distribution of sub-GeV dark matter.

  5. Radar transponder apparatus and signal processing technique

    DOE Patents [OSTI]

    Axline, Jr., Robert M. (Albuquerque, NM); Sloan, George R. (Albuquerque, NM); Spalding, Richard E. (Albuquerque, NM)

    1996-01-01

    An active, phase-coded, time-grating transponder and a synthetic-aperture radar (SAR) and signal processor means, in combination, allow the recognition and location of the transponder (tag) in the SAR image and allow communication of information messages from the transponder to the SAR. The SAR is an illuminating radar having special processing modifications in an image-formation processor to receive an echo from a remote transponder, after the transponder receives and retransmits the SAR illuminations, and to enhance the transponder's echo relative to surrounding ground clutter by recognizing special transponder modulations from phase-shifted from the transponder retransmissions. The remote radio-frequency tag also transmits information to the SAR through a single antenna that also serves to receive the SAR illuminations. Unique tag-modulation and SAR signal processing techniques, in combination, allow the detection and precise geographical location of the tag through the reduction of interfering signals from ground clutter, and allow communication of environmental and status information from said tag to be communicated to said SAR.

  6. Radar transponder apparatus and signal processing technique

    DOE Patents [OSTI]

    Axline, R.M. Jr.; Sloan, G.R.; Spalding, R.E.

    1996-01-23

    An active, phase-coded, time-grating transponder and a synthetic-aperture radar (SAR) and signal processor means, in combination, allow the recognition and location of the transponder (tag) in the SAR image and allow communication of information messages from the transponder to the SAR. The SAR is an illuminating radar having special processing modifications in an image-formation processor to receive an echo from a remote transponder, after the transponder receives and retransmits the SAR illuminations, and to enhance the transponder`s echo relative to surrounding ground clutter by recognizing special transponder modulations from phase-shifted from the transponder retransmissions. The remote radio-frequency tag also transmits information to the SAR through a single antenna that also serves to receive the SAR illuminations. Unique tag-modulation and SAR signal processing techniques, in combination, allow the detection and precise geographical location of the tag through the reduction of interfering signals from ground clutter, and allow communication of environmental and status information from said tag to be communicated to said SAR. 4 figs.

  7. Experimental study of a modulated beam AlGaAs/GaAs diode amplifier operating in the highly saturated gain regime

    SciTech Connect (OSTI)

    D'yachkov, N V; Bogatov, A P; Gushchik, T I; Drakin, A E [P N Lebedev Physics Institute, Russian Academy of Sciences, Moscow (Russian Federation)

    2014-11-30

    The variation in the modulation parameters of an optical signal in a diode power amplifier has been studied experimentally. The experimental data obtained agree well with theory that takes into account nonlinear interaction between fields in the gain medium of a laser through inversion beating. It is shown that the dominant type of output signal modulation is phase modulation, whose depth depends on the amplitude – phase coupling coefficient of the gain medium of the amplifier and the nature of the modulation (the phase relationships between the spectral components) of the output signal. (lasers)

  8. Approved Module Information for ME3023, 2014/5 Module Title/Name: Energy Efficiency Module Code: ME3023

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    for assessing thermal processes in industry. Key issues associated with energy usage and reduction includingApproved Module Information for ME3023, 2014/5 Module Title/Name: Energy Efficiency Module Code: ME3023 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits

  9. Approved Module Information for ME2045, 2014/5 Module Title/Name: Solid Mechanics Module Code: ME2045

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    and comprehensive theory as well as practical application of the fundamental principles of mechanics and materialsApproved Module Information for ME2045, 2014/5 Module Title/Name: Solid Mechanics Module Code: ME2045 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits

  10. Approved Module Information for BHM347, 2014/5 Module Title/Name: Assessment Performance & Reward Module Code: BHM347

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM347, 2014/5 Module Title/Name: Assessment Performance & Reward Module Code: BHM347 School: Aston Business School Module Type: Standard Module New Module? No Module Practitioners: Recruitment and Selection (including Selection Assessment) Performance Measurement Management

  11. Approved Module Information for ME2502, 2014/5 Module Title/Name: Engineering for Industry Module Code: ME2502

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME2502, 2014/5 Module Title/Name: Engineering for Industry Module Code: ME2502 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module) Programmes in which available: BEng Design Engineering. BSc Industrial Product Design. BSc Product Design

  12. Approved Module Information for PD1803, 2014/5 Module Title/Name: Engineering Principles Module Code: PD1803

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD1803, 2014/5 Module Title/Name: Engineering Principles Module Code: PD1803 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module; * have a knowledge and understanding of and be able to apply the basic engineering principles

  13. Approved Module Information for ME1601, 2014/5 Module Title/Name: Engineering Science Module Code: ME1601

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME1601, 2014/5 Module Title/Name: Engineering Science Module Code: ME1601 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module/MEng Mechanical Engineering. BEng/MEng Electromechanical Engineering. BEng Design Engineering. BEng

  14. Photovoltaic module and interlocked stack of photovoltaic modules

    DOE Patents [OSTI]

    Wares, Brian S.

    2012-09-04

    One embodiment relates to an arrangement of photovoltaic modules configured for transportation. The arrangement includes a plurality of photovoltaic modules, each photovoltaic module including a frame having at least a top member and a bottom member. A plurality of alignment features are included on the top member of each frame, and a plurality of alignment features are included on the bottom member of each frame. Adjacent photovoltaic modules are interlocked by the alignment features on the top member of a lower module fitting together with the alignment features on the bottom member of an upper module. Other embodiments, features and aspects are also disclosed.

  15. Radar transponder operation with compensation for distortion due to amplitude modulation

    DOE Patents [OSTI]

    Ormesher, Richard C. (Albuquerque, NM); Tise, Bertice L. (Albuquerque, NM); Axline, Jr., Robert M. (Albuquerque, NM)

    2011-01-04

    In radar transponder operation, a variably delayed gating signal is used to gate a received radar pulse and thereby produce a corresponding gated radar pulse for transmission back to the source of the received radar pulse. This compensates for signal distortion due to amplitude modulation on the retransmitted pulse.

  16. Power module assembly

    DOE Patents [OSTI]

    Campbell, Jeremy B. (Torrance, CA); Newson, Steve (Redondo Beach, CA)

    2011-11-15

    A power module assembly of the type suitable for deployment in a vehicular power inverter, wherein the power inverter has a grounded chassis, is provided. The power module assembly comprises a conductive base layer electrically coupled to the chassis, an insulating layer disposed on the conductive base layer, a first conductive node disposed on the insulating layer, a second conductive node disposed on the insulating layer, wherein the first and second conductive nodes are electrically isolated from each other. The power module assembly also comprises a first capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the first conductive node, and further comprises a second capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the second conductive node.

  17. Approved Module Information for EE3WSN, 2014/5 Module Title/Name: Wireless Sensor Networks Module Code: EE3WSN

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE3WSN, 2014/5 Module Title/Name: Wireless Sensor Networks Module Code: EE3WSN School: Engineering and Applied Science Module Type: Standard Module New Module? No Module

  18. Long Pulse Modulators

    E-Print Network [OSTI]

    Eckoldt, J

    2015-01-01

    Long pulse modulators are used to produce high-voltage, high-power pulses with durations of several hundred microseconds up to some milliseconds. The loads are one or more klystrons for producing RF power to accelerate the particle beam in superconducting cavities. After years of development and improvements in different institutes a variety of topologies exist, and are presented. The basics of modulators, pulse requirements and klystrons are explained. Additionally, the charging of internal energy storage will be addressed. The outlook for future developments is given.

  19. Method of monolithic module assembly

    DOE Patents [OSTI]

    Gee, James M. (Albuquerque, NM); Garrett, Stephen E. (Albuquerque, NM); Morgan, William P. (Albuquerque, NM); Worobey, Walter (Albuquerque, NM)

    1999-01-01

    Methods for "monolithic module assembly" which translate many of the advantages of monolithic module construction of thin-film PV modules to wafered c-Si PV modules. Methods employ using back-contact solar cells positioned atop electrically conductive circuit elements affixed to a planar support so that a circuit capable of generating electric power is created. The modules are encapsulated using encapsulant materials such as EVA which are commonly used in photovoltaic module manufacture. The methods of the invention allow multiple cells to be electrically connected in a single encapsulation step rather than by sequential soldering which characterizes the currently used commercial practices.

  20. Module Title: Metamaterials, Nanophotonics and Plasmonics Module Code: OPTO6004

    E-Print Network [OSTI]

    Molinari, Marc

    1 Module Title: Metamaterials, Nanophotonics and Plasmonics Module Code: OPTO6004 Core introduction to the three cornerstones of future photonic technologies, namely metamaterials, plasmonics. Comprehend the concept of metamaterials and underlying principles of their operation A3. Learn about